sort by

3 publications mentioning mtr-MIR167a

Open access articles that are associated with the species Medicago truncatula and mention the gene name MIR167a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 29
Prediction of the microRNA putative target sites of MtARF genesIn Arabidopsis, the expression levels of ARF6 and ARF8 are regulated by microRNA167 (Yang et al., 2006) and ARF10, 16, and 17 were targeted by microRNA160 (Liu et al., 2007). [score:7]
In Arabidopsis, the expression levels of ARF6 and ARF8 are regulated by microRNA167 (Yang et al., 2006) and ARF10, 16, and 17 were targeted by microRNA160 (Liu et al., 2007). [score:5]
Sequence analysis of ARFs in M. truncatula implied that the 1344–1364 bp region on MtARF1 and the 1314–1330 bp region on MtARF10 may be the target sites of miRNA160 and the 2457–2477 bp region on MtARF6 and the 2301–2321 bp region on MtARF9 may be the target sites of miRNA167 (Figure 4). [score:5]
The miR167 also was found to function in ARF -mediated auxin regulation by reinforcing or maintaining transcriptionally established gene expression patterns (Wu et al., 2006). [score:4]
Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. [score:3]
Figure 4Predictions of target sites of Mrt-miR167 and Mrt-miR160 in MtARF genes. [score:3]
Our results suggest that five precursors (mtr-miR160, 160b, 160c, 160d, and 160e) in the M. truncatula genome were needed to produce the mature mtr-miRNA160 sequence (UGCCUGGCUCCCUGUAUGCCA), but only one precursor (mtr-miRNA167) was needed to produce the mature mtr-miRNA167 sequence (UGAAGCUGCCAGCAUGAUCUA). [score:1]
cn/PMRD/) was used to search the sequences of Mrt-miR160 and Mrt-miR167. [score:1]
[1 to 20 of 8 sentences]
2
[+] score: 16
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR156b, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR393b, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR156h, mtr-MIR166f, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, osa-MIR169r, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR397, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR172a, sly-MIR172b, sly-MIR399, osa-MIR827, osa-MIR396f, mtr-MIR2118, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, mtr-MIR169k, mtr-MIR169j, mtr-MIR399q, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, mtr-MIR4414a, mtr-MIR4414b, mtr-MIR482, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, sly-MIR482e, sly-MIR482a, mtr-MIR167b, mtr-MIR168c, mtr-MIR408, mtr-MIR396c, mtr-MIR171g, stu-MIR6024, sly-MIR6024, stu-MIR482c, stu-MIR482b, stu-MIR482a, stu-MIR482d, stu-MIR482e, sly-MIR482b, sly-MIR482c, stu-MIR6025, stu-MIR6026, sly-MIR6026, sly-MIR168a, sly-MIR168b, mtr-MIR169i, mtr-MIR172d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, stu-MIR7980a, stu-MIR7983, stu-MIR8007a, stu-MIR8007b, stu-MIR7980b, stu-MIR399a, stu-MIR399b, stu-MIR399c, stu-MIR399d, stu-MIR399e, stu-MIR399f, stu-MIR399g, stu-MIR399h, stu-MIR3627, stu-MIR171b, stu-MIR166a, stu-MIR166b, stu-MIR166c, stu-MIR166d, stu-MIR171a, stu-MIR171c, stu-MIR399i, stu-MIR827, stu-MIR172b, stu-MIR172c, stu-MIR172a, stu-MIR172d, stu-MIR172e, stu-MIR156a, stu-MIR156b, stu-MIR156c, stu-MIR156d, stu-MIR171d, stu-MIR167c, stu-MIR167b, stu-MIR167a, stu-MIR167d, stu-MIR399j, stu-MIR399k, stu-MIR399l, stu-MIR399m, stu-MIR399n, stu-MIR399o, stu-MIR393, stu-MIR398a, stu-MIR398b, stu-MIR396, stu-MIR408a, stu-MIR408b, stu-MIR397, stu-MIR171e, stu-MIR156e, stu-MIR156f, stu-MIR156g, stu-MIR156h, stu-MIR156i, stu-MIR156j, stu-MIR156k, stu-MIR169a, stu-MIR169b, stu-MIR169c, stu-MIR169d, stu-MIR169e, stu-MIR169f, stu-MIR169g, stu-MIR169h, sly-MIR403, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR827, sly-MIR393, sly-MIR398a, sly-MIR399b, sly-MIR6025, sly-MIR169f, sly-MIR171f
Although no target gene was predicted for miR167 under the strict criterion used in this study, miR167 has been evidenced to regulate the expression of auxin response factors expression in tomato by direct cleavage (Liu et al., 2014). [score:9]
In soybean, the miR167 modulates nodulation and lateral root development by targeting auxin response factors (Wang et al., 2015). [score:4]
MicroRNA167-directed regulation of the auxin response factors GmARF8a and GmARF8b is required for soybean nodulation and lateral root development. [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 6
Other miRNAs from this paper: mtr-MIR160a, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR395a, mtr-MIR395b, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR395c, mtr-MIR395d, mtr-MIR395e, mtr-MIR395f, mtr-MIR395g, mtr-MIR395h, mtr-MIR395i, mtr-MIR395j, mtr-MIR395l, mtr-MIR395m, mtr-MIR395n, mtr-MIR395o, mtr-MIR395k, mtr-MIR156b, mtr-MIR164a, mtr-MIR160b, mtr-MIR166b, mtr-MIR160c, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR390, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR393b, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR164b, mtr-MIR156h, mtr-MIR166f, mtr-MIR160d, mtr-MIR164c, mtr-MIR164d, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR160e, mtr-MIR399p, mtr-MIR1507, mtr-MIR1509a, mtr-MIR2118, mtr-MIR169k, mtr-MIR2590a, mtr-MIR2590b, mtr-MIR2590c, mtr-MIR2590d, mtr-MIR2590e, mtr-MIR2590f, mtr-MIR2592b, mtr-MIR2592c, mtr-MIR2592d, mtr-MIR2592e, mtr-MIR2592f, mtr-MIR2592i, mtr-MIR2592j, mtr-MIR2592o, mtr-MIR2592p, mtr-MIR2592q, mtr-MIR2592r, mtr-MIR2592s, mtr-MIR2597, mtr-MIR2111c, mtr-MIR2111d, mtr-MIR2111e, mtr-MIR2111g, mtr-MIR2111h, mtr-MIR2111i, mtr-MIR2111m, mtr-MIR2111n, mtr-MIR2111o, mtr-MIR2610a, mtr-MIR2610b, mtr-MIR169j, mtr-MIR1509b, mtr-MIR2619a, mtr-MIR2592a, mtr-MIR2592g, mtr-MIR2592h, mtr-MIR2592k, mtr-MIR2592l, mtr-MIR2592m, mtr-MIR2592n, mtr-MIR2111b, mtr-MIR2111j, mtr-MIR2111k, mtr-MIR2630a, mtr-MIR2630b, mtr-MIR2630c, mtr-MIR2630w, mtr-MIR2630x, mtr-MIR2630y, mtr-MIR2630d, mtr-MIR2630e, mtr-MIR2630f, mtr-MIR2630g, mtr-MIR2630h, mtr-MIR2630i, mtr-MIR2630j, mtr-MIR2630k, mtr-MIR2630l, mtr-MIR2630m, mtr-MIR2630n, mtr-MIR2630o, mtr-MIR2630p, mtr-MIR2630q, mtr-MIR2630r, mtr-MIR2630s, mtr-MIR2630t, mtr-MIR2630u, mtr-MIR2630v, mtr-MIR2645, mtr-MIR399q, mtr-MIR5205a, mtr-MIR5205b, mtr-MIR5205c, mtr-MIR5205d, mtr-MIR2592t, mtr-MIR2592u, mtr-MIR2592v, mtr-MIR2592w, mtr-MIR2592x, mtr-MIR2592y, mtr-MIR2592z, mtr-MIR2592ab, mtr-MIR2592ac, mtr-MIR2592ad, mtr-MIR2592ae, mtr-MIR2592af, mtr-MIR2592ah, mtr-MIR2592ai, mtr-MIR2592aj, mtr-MIR2592al, mtr-MIR2592am, mtr-MIR2592an, mtr-MIR2592ao, mtr-MIR2592ap, mtr-MIR2592aq, mtr-MIR2592ar, mtr-MIR2592as, mtr-MIR2592at, mtr-MIR2592au, mtr-MIR2592av, mtr-MIR2592aw, mtr-MIR2592ax, mtr-MIR2592ay, mtr-MIR2592az, mtr-MIR2592ba, mtr-MIR2592bb, mtr-MIR2592bc, mtr-MIR2592bd, mtr-MIR2592be, mtr-MIR2592bf, mtr-MIR2592bg, mtr-MIR2592bi, mtr-MIR2592bj, mtr-MIR2592bk, mtr-MIR482, mtr-MIR5241a, mtr-MIR5241b, mtr-MIR5241c, mtr-MIR2111l, mtr-MIR2111f, mtr-MIR160f, mtr-MIR171h, mtr-MIR399r, mtr-MIR156j, mtr-MIR2590g, mtr-MIR5283, mtr-MIR2590h, mtr-MIR2590i, mtr-MIR2590j, mtr-MIR5287a, mtr-MIR5287b, mtr-MIR2619b, mtr-MIR2592bl, mtr-MIR2592bm, mtr-MIR2592bn, mtr-MIR167b, mtr-MIR2111a, mtr-MIR396c, mtr-MIR171g, mtr-MIR530, mtr-MIR169i, mtr-MIR397, mtr-MIR7696a, mtr-MIR7696b, mtr-MIR7696c, mtr-MIR7696d, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, mtr-MIR2592bo, mtr-MIR2592bp, mtr-MIR2592bq, mtr-MIR2592br
Many of them, like miR160, miR164, miR167, miR390 and miR393, directly or indirectly regulate genes related to auxin signaling [10]. [score:4]
Interestingly, three additional miR167 precursors and a novel variant were found, suggesting a more complex regulatory module than previously reported for this auxin-related miRNA [28]. [score:2]
[1 to 20 of 2 sentences]