sort by

23 publications mentioning hsa-mir-874

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-874. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 427
In this study, we found that miR-874 strongly repressed GC angiogenesis by targeting the 3′ untranslated region (3′-UTR) of the STAT3 mRNA, leading to inhibition of the STAT3 pathway and down-regulation of the angiogenic factor VEGF-A. Our results suggest that down-regulation of miR-874 may be important for the development and progression of GC, highlighting the potential for miR-874 as a therapeutic target. [score:16]
Overexpression of miR-874 in human GC cell lines inhibited STAT3 and p-STAT3 production at the translational level, and ectopic expression of STAT3 effectively reversed the suppression of HUVEC proliferation, migration, invasion and VEGF-A expression caused by miR-874 overexpression. [score:15]
To further demonstrate that miR-874 in GC cells affects the angiogenesis of HUVECs through the regulation of STAT3, we up-regulated and down-regulated STAT3 expression. [score:10]
We demonstrated that ectopic expression of miR-874 in GC cells suppressed the tube formation, proliferation, migration and invasion of HUVECs and inhibited VEGF-A and STAT3 protein expression. [score:9]
Forced expression of miR-874 markedly suppressed luciferase activity from the wild-type reporter (50%) but not from the mutant reporter, suggesting that the 3′-UTR of STAT3 is targeted by miR-874 and that the point mutations in this sequence abolished this effect (Fig. 2E). [score:8]
The reverse experiments for miR-874 inhibitor/pre-miR-874 were performed through the down-regulation/overexpression of STAT3. [score:8]
As expected, knockdown of miR-874 increased secreted VEGF-A protein expression, and overexpression of miR-874 decreased secreted VEGF-A protein expression (Fig. 2C). [score:8]
Further experiments revealed that miR-874 could attenuate tumor angiogenesis by down -regulating expression of VEGF-A. These results strongly suggest that down-regulation of miR-874 enhances the development and progression of GC. [score:8]
In SGC-7901 cells, we observed a similar phenomenon, which could be counteracted by down-regulation of STAT3 (Figs. 4A–D; c, miR-874 -inhibitor+STAT3-shRNA vs d, miR-874 -inhibitor+STAT3-shcontrol). [score:8]
miR-874 suppresses STAT3 protein expression through translational repression. [score:7]
SGC-7901 (a: miR-874-NC; b: miR-874 -inhibitor; c: miR-874 -inhibitor+STAT3-shRNA; d: miR-874 -inhibitor+STAT3-shcontrol; e: LV-NC; f: LV-STAT3). [score:7]
Figure 5SGC-7901 (a: miR-874-NC; b: miR-874 -inhibitor; c: miR-874 -inhibitor+STAT3-shRNA; d: miR-874 -inhibitor+STAT3-shcontrol; e: LV-NC; f: LV-STAT3). [score:7]
Figure 4SGC-7901(a: miR-874-NC; b: miR-874 -inhibitor; c: miR-874 -inhibitor+STAT3-shRNA; d: miR-874 -inhibitor+STAT3-shcontrol; e: LV-NC; f: LV-STAT3). [score:7]
As shown in Fig. 5M, linear correlation analysis showed a significant inverse correlation between miR-874 and STAT3 expression in GC tissues (P < 0.01), confirming that decreased expression of miR-874 was significantly associated with increased STAT3 protein expression in this set of GC tissues. [score:7]
The data clearly confirmed that ectopic expression of STAT3 effectively reversed the suppression of HUVEC proliferation, migration and invasion caused by miR-874 overexpression (Figs. 4E–H; c, pre-miR-874+LV-STAT3 vs d, pre-miR-874+LV-NC). [score:7]
SGC-7901(a: miR-874-NC; b: miR-874 -inhibitor; c: miR-874 -inhibitor+STAT3-shRNA; d: miR-874 -inhibitor+STAT3-shcontrol; e: LV-NC; f: LV-STAT3). [score:7]
Our data revealed that HUVECs migration was enhanced by miR-874 knockdown in SGC-7901 cells, whereas migration was suppressed by miR-874 overexpression in AGS cells (Fig. 1E). [score:6]
miR-874 has been identified as a tumor-suppressor and is reportedly down-regulated in some types of cancer, including GC [17– 21]. [score:6]
Taken together, these results confirmed our hypothesis that miR-874 in GC cells affects HUVEC proliferation, migration, invasion and VEGF-A expression by regulating STAT3 expression. [score:6]
Furthermore, western blotting analysis of the implanted mouse tumors verified that STAT3 and VEGF-A protein expression were significantly enhanced in the SGC-7901-miR-874 inhibitor -transfected group compared with the controls, whereas their expression were decreased in the AGS-pre-miR-874 -transfected group (Fig. 3G). [score:6]
These findings indicate that our study has clinical relevance and that miR-874 overexpression and/or strategies for inhibiting STAT3/VEGF-A signaling may have therapeutic applications for gastric cancer. [score:5]
miR-874 inhibits tumor angiogenesis by targeting STAT3. [score:5]
miR-874 silencing in SGC7901 cells, which lack endogenous STAT3 expression, resulted in the up-regulation of STAT3 protein by approximately 3 folds compared with the negative control. [score:5]
We modified the commercial LV3-has-miR-874-pre-microRNA vector (pre-miR-874) and LV3-has-miR-874-sponge inhibitor vector (miR-874 inhibitor) lentiviral constructs (Genepharma, CHINA). [score:5]
To determine whether reduced miR-874 expression correlates with increased levels of STAT3 in GC tissues, eighty pairs of primary GC tissues and adjacent normal tissues were used to determine the STAT3 expression using Western blotting analysis. [score:5]
These results indicate that the down-regulation of miR-874 plays an important role in the initiation and development of GC. [score:5]
miR-874 inhibits tumor growth, angiogenesis in vivo and negative correlated with STAT3, VEGF-A expression. [score:5]
The vector LV-STAT3, which contains only the STAT3 coding sequence, was constructed for STAT3 expression without miR-874 targeting. [score:5]
Figure 6 miR-874 suppresses STAT3 (p-STAT3) protein expression by binding to the 3′region of STAT3 mRNA. [score:5]
VEGF-A expression is inhibited by miR-874. [score:5]
By contrast, enhanced expression of miR-874 suppressed these effects. [score:5]
Intriguingly, the inhibitory effect of STAT3 silencing on these cellular phenotypes was consistent with the effect of miR-874 overexpression. [score:5]
miR-874 inhibits VEGF expression. [score:5]
Taken together, we found that miR-874 could inhibit tumor growth and angiogenesis in vivo, and that the negative correlation between miR-874 expression and STAT3 or VEGF-A levels. [score:5]
Wild-type (WT) and mutant (MUT) versions of the STAT3 3′-UTR – the latter containing site-directed mutations in the putative miR-874 target sites – were cloned into reporter plasmids. [score:5]
miR-874 suppresses STAT3 (p-STAT3) protein expression by binding to the 3′region of STAT3 mRNA. [score:5]
Figure 2 (A) qRT-PCR was used to analyze the expression levels of VEGF-A in SGC-7901 and AGS cells transfected with miR-NC, the miR-874 inhibitor or pre-miR-874. [score:5]
miR-874 inhibits tumor growth, angiogenesis in vivo and negative correlated with STAT3, VEGF-A expressionTo determine the effects of miR-874 on tumorigenicity in vivo. [score:5]
Additionally, compared with control cells, the silencing of miR-874 in SGC-7901 cells dramatically boosted HUVECs invasiveness, whereas miR-874 up-regulation inhibited HUVECs invasiveness, as assessed using a Matrigel invasion assay (Fig. 1F). [score:4]
By contrast, miR-874 knockdown promoted these behaviors and enhanced VEGF-A and STAT3 protein expression (Figs. 1, 2, 3). [score:4]
In addition, the activated form of STAT3 (p-STAT3, Tyr705) was significantly increased in miR-874 knockdown cells (SGC-7901) and decreased in miR-874 -overexpressing cells (AGS) (Figs. 2G and 2I). [score:4]
The roles of miR-874 and STAT3 in the regulation of VEGF-A expression in gastric cancer cellsSTAT3 protein levels were negatively correlated with miR-874 levels in GC tissues. [score:4]
Our study shows that miR-874 negatively regulates STAT3 at the post-transcriptional level by binding to a specific target site within the 3′-UTR. [score:4]
These results indicate that miR-874 is down-regulated in both GC tissues and cancer cell lines. [score:4]
However, the regulation of angiogenesis-related cytokines in cancer cells is quite complex, and we do not rule out the possibility that other signaling pathways that modulate VEGF-A expression may also be affected by miR-874. [score:4]
To determine whether miR-874 is mis-regulated in GC tissues, miR-874 expression in GC tissues and adjacent normal tissues was analyzed using miRNA RT-PCR. [score:4]
Using bioinformatics, we identified STAT3 – a key transcription factor [12] that plays a vital role in human gastric cancer angiogenesis [13] – as a potential direct target of miR-874. [score:4]
miR-874 is down-regulated in human gastric cancer tissues and cells. [score:4]
In summary, we present evidence that miR-874 suppresses GC progression by modulating angiogenesis through the STAT3/VEGF-A pathway. [score:3]
As shown in Fig. 1A, the expression levels of miR-874 in human GC tissues were much lower than in the adjacent normal tissues. [score:3]
A total of twenty-four nude mice (BALB/c nude mice, Vitalriver, China; four weeks old) were randomly divided into four groups, and SGC7901-NC, SGC-7901-miR-874 inhibitor, AGS-NC or AGS-pre-miR-874 stable cells were inoculated subcutaneously into the flanks of nude mice. [score:3]
In our previous study, we demonstrated that miR-874 plays a suppressive role in the growth, migration and invasiveness of GC cells [11]. [score:3]
After 21 days, we observed a slower tumor growth in the miR-874-NC group than in the miR-874 -inhibitor group (SGC-7901 cells). [score:3]
In a previous study, we demonstrated that miR-874 suppressed the growth, migration and invasion of gastric cancer cells [11]. [score:3]
Here, we describe a role for miR-874 in inhibiting angiogenesis, which is supported by a number of in vitro and in vivo experiments. [score:3]
miRNA RT-PCR was used to analyze the expression levels of miR-874. [score:3]
org) were used to predict genes which miR-874 might target. [score:3]
Conversely, the protein levels of STAT3 were significantly reduced about 67% in AGS cells, which exhibit basally high expression of STAT3, after transfection with pre-miR-874 (Figs. 2G and 2H). [score:3]
We also demonstrate that the levels of miR-874 expression in resected patient gastric tumor tissues are significantly lower than in adjacent normal tissues and that they are inversely correlated with STAT3 protein levels in these tumors. [score:3]
We also observed that xenografted tumors from pre-miR-874 -transfected cells were smaller and had a lower microvessel density (MVD) than tumors from miR-874 -inhibitor -transfected cells. [score:3]
Our results showed that miR-874 can inhibit angiogenesis through the STAT3/VEGF-A pathway (Fig. 6). [score:3]
The expression of miR-874 in GC tissues and cell lines. [score:3]
In the present study, we confirmed that miR-874 expression is significantly lower in GC tissues and cell lines. [score:3]
The miR-874-NC, pre-miR-874 and miR-874 inhibitor lentiviral vectors were used to infect cells at an appropriate multiplicity of infection (MOI) when AGS and SGC7901 cells had grown to 40–50% confluence. [score:3]
miR-874 expression is negatively correlated with the STAT3 levels in human GC tissues. [score:3]
Therefore, we searched for potential targets of miR-874 in gastric cancer cells using several computational algorithms. [score:3]
The 3′-UTR of STAT3 is a target of miR-874. [score:3]
Interestingly, mir-874 is also involved in Mild Cognitive Impairment (MCI), such as Alzheimer's diseases [22]. [score:3]
miR-874 inhibits tumorigenicity in vivo. [score:3]
SGC-7901-NC, SGC-7901-miR-874 -inhibitor, AGS-NC and AGS-pre-miR-874 cells were used to test the levels of VEGF-A, which is the most important angiogenic factor influencing vasculature and angiogenesis. [score:3]
These results suggest that the inhibitory effects of miR-874 on angiogenesis are dependent on STAT3. [score:3]
SGC-7901-NC, SGC-7901-miR-874 inhibitor, AGS-NC and AGS-pre-miR-874 stable cell lines were selected for using 3 μg/ml bulk puromycin-resistant culturing (puromycin, Sigma, USA) for five days. [score:3]
We identified a putative miR-874 binding site within the 3′-UTR of STAT3 (Fig. 2D), and a luciferase reporter assay was used to validate whether STAT3 is a direct target of miR-874. [score:3]
Identification of STAT3 as a potential target of miR-874. [score:3]
After that, cells were analyzed for miR-874 expression using the Hairpin-it™ miRNA qPCR Quantitation Kit. [score:3]
Figure 1The expression of miR-874 in GC tissues and cell lines. [score:3]
Subsequently, we investigated whether STAT3 could counteract the suppression of these cellular phenotypes induced by miR-874 overexpression in HUVECs. [score:3]
miR-874 regulates the processes of tumor angiogenesis in vitroTo confirm that miR-874 is a potential angiogenesis suppressor in GC, we investigated the influence of miR-874 on the tube formation, proliferation, migration and invasion of HUVEC cells in vitro. [score:2]
However, the exact mechanisms underlying the regulation of angiogenesis in GC by miR-874 remain unknown. [score:2]
The proliferation of HUVECs in the miR-874 inhibitor -treated group was significantly increased compared with the control group in SGC-7901 cells. [score:2]
Tube-formation assays with HUVECs were performed with the different group of conditioned medium (miR-874 inhibitor, pre-miR-874 or empty vector). [score:2]
miR-874 regulates the processes of tumor angiogenesis in vitro. [score:2]
As shown in Fig. 2A, when compared with SGC7901-NC cells, VEGF-A mRNA levels in the SGC-7901-miR-874 -inhibitor cells were increased by approximately 33%. [score:2]
miR-874 negatively regulates HUVEC proliferation, migration, invasion and tube formation in vitro. [score:2]
Moreover, the immunohistochemical assays showed that the number of CD31 -positive microvessels was dramatically increased about 3 folds by the SGC-7901-miR-874 inhibitor, whereas AGS-pre-miR-874 decreased the number of CD31 -positive microvessels to 65% (Figs. 3D). [score:2]
Compared with control cells, the silencing of miR-874 group increased the tube-forming capacity of HUVECs, whereas ectopic expression of miR-874 group dramatically reduced the tube-forming capacity of HUVECs (Fig. 1D). [score:2]
miR-874 negatively regulates HUVEC proliferation, migration, invasion and tube formation in vitro (A) from eighty paired adjacent normal tissues and GC tissues were used to extract total RNA. [score:2]
Asterisks indicate significant differences compared with negative controls versus SGC-7901-miR-874 inhibitor and AGS-pre-miR-874, respectively; P < 0.05. [score:2]
The roles of miR-874 and STAT3 in the regulation of HUVEC proliferation, migration and invasion. [score:2]
To investigate the impact of miR-874 on tumor angiogenesis, we constructed both miR-874 overexpression and knockdown GC cell lines (Fig. 1C). [score:2]
In addition, a STAT3 shRNA impaired the enhanced angiogenesis caused by miR-874 knockdown. [score:2]
As shown, miR-874 was knockdown about 80% in SGC7901 cells, increased about 140 folds in AGS cells. [score:2]
AGS (a: miR-874-NC; b: pre-miR-874; c: pre-miR-874+LV-STAT3; d: pre-miR-874+LV-NC; e: STAT3-shcontrol; f: STAT3-shRNA). [score:1]
To determine the effects of miR-874 on tumorigenicity in vivo. [score:1]
The average weight of tumors from the miR-874-inbibitor group was significantly more than that from the control group in SGC-7901 cells. [score:1]
Similarly, the protein levels of VEGF-A were increased in SGC-7901-miR-874 -inhibitor cells compared with SGC7901-NC cells, and they were also decreased in AGS-pre-miR-874 cells compared with AGS-NC cells (Fig. 2B). [score:1]
Similar phenomenon was observed in AGS cells, that tumor in pre-miR-874 group grow slower than in miR-874-NC group (Figs. 3A, 3B and Supplementary Fig. 1). [score:1]
Therefore, we hypothesized that miR-874 may contribute to tumor angiogenesis in GC. [score:1]
The 3′UTR of the STAT3 mRNA containing either the putative or mutated miR-874 binding site was synthesized by Shenggong (Shanghai, China). [score:1]
However, the mechanisms underlying how miR-874 affects tumor angiogenesis were not clear. [score:1]
miR-874 depletion in GC cells promotes HUVEC proliferation, migration, invasion and tube formation in vitro and increases micro-vessel density in vivo. [score:1]
Further experiments showed that several GC cell lines, including AGS, BGC823, MKN28 and SGC7901, had undetectable or low levels of miR-874. [score:1]
Schematic representation of the roles of miR-874 on the angiogenic properties of GC cells. [score:1]
The snRNA U6 was selected as an endogenous reference to calculate the relative expression levels of miR-874 in each sample using the 2 [−ΔΔCt] method. [score:1]
The levels of miR-874 were analyzed by miRNA RT-PCR. [score:1]
In AGS cells, we could find that the tumors from pre-miR-874 group were heavier than that from the control group, which was consistent with the results in SGC-7901 cells (Fig. 3C). [score:1]
To confirm that miR-874 is a potential angiogenesis suppressor in GC, we investigated the influence of miR-874 on the tube formation, proliferation, migration and invasion of HUVEC cells in vitro. [score:1]
By contrast, normal gastric mucosa epithelial cells (GES-1) had high levels of miR-874 (Fig. 1B). [score:1]
AGS cells were co -transfected with miR-874 precursor and either LV-STAT3 or LV-NC. [score:1]
[1 to 20 of 109 sentences]
2
[+] score: 204
Other miRNAs from this paper: hsa-mir-145
As reported, miR-874 overexpression in breast cancer cells can suppress cell growth and increase cell apoptosis, while miR-874 overexpression could dramatically suppress tumorigenicity in nude mice in vivo [10]. [score:9]
Moreover, miR-874 is significantly downregulated in breast cancer cells and its overexpression could suppress growth, colony formation and cycle of breast cancer cells and increase cell apoptosis [10]. [score:8]
As reported, miR-874 expression is remarkably down-regulated and miR-874 may function as an oncogenic or tumor suppressor in various malignancies. [score:8]
The miR-874 expressions are also downregulated in breast cancer tissues compared with paranormal tissues from an external breast cancer cohort in TCGA (Figure 1B), indicating that miR-874 is significantly down-regulated in breast cancer (P < 0.01). [score:8]
Recently, several reports show that miRNA-874 (miR-874) expression is downregulated and functions as a tumor suppressor in several cancers, including non-small cell lung cancer (NSCLC) [9], breast cancer [10], osteosarcoma [11, 12], gastric cancer [13, 14], colorectal cancer [15], testis cancer [16], and maxillary sinus squamous cell carcinoma [17]. [score:8]
miR-874 is also involved in tumor progression by suppressing the protein expressions of matrix metalloproteinase-2 (MMP-2) and uPA and targeting CDK9, E2F3, HDAC1, aquaporin-3, HCA587/MAGE-C2 and signal transducer-activator of transcription 3 (STAT3), a key transcription factor that plays a significant role in human cancer angiogenesis [9– 16, 18, 19]. [score:7]
As depicted in Figure 3A, 3B, the 3- or 5-day inhibition of DNA methylation with different 5-aza-CdR concentrations significantly increased miR-874 expression in two breast cancer cell lines (MCF-7 and MDA-MB-231), suggesting a significant negative correlation between miR-874 expression and methylation levels. [score:7]
Accordingly, we used the median miR-874 expression as a cutoff point and divided the 47 breast cancer patients into a high -expression group (n = 24) and a low -expression group (n = 23). [score:7]
Quantitative real-time polymerase chain reaction (qRT-PCR) shows that miR-874 expressions are downregulated in 47 pairs of breast cancer samples and matched paranormal tissues (Figure 1A). [score:6]
To explore the epigenetic mechanism mediating miR-874 in breast cancer, we detected miR-874 expression after de-methylation treatment or pretreatment with 5-aza-CdR in two breast cancer cell lines and found it was remarkably upregulated. [score:6]
To further explore the upstream molecular mechanism of down-regulated miR-874 expression in breast cancer, we assessed the DNA methylation status of the miR-874 promoter region in both breast cancer cells and tissues. [score:6]
Comprehensively, these data suggest that DNA hyper-methylation in the upstream region of miR-874 might play a significant role in miR-874 expression downregulation in breast cancer. [score:6]
Results show miR-874 expression is downregulated in breast cancer tissues in association with elevated DNA methylation, which is further confirmed in a large cohort from TCGA. [score:6]
As depicted in Figure 1C–1E, miR-874 expression is downregulated in breast cancer tissues with poor differentiation, TNM staging III and IVand positive lymph node examined by t-test (all P < 0.05). [score:6]
In addition, miR-874 is involved in tumor progression by suppressing the protein levels of MMP-2 and uPA and targeting E2F3, HDAC1, AQP3 STAT3 and HCA587/MAGE-C2 in a variety of cancers [10– 16, 18, 33]. [score:5]
Therefore, we determined the miR-874 expressions in breast cancer tissues and matched normal tissues using RT-PCR, which revealed a drastic decrease of miR-874 expression in the breast cancer tissues. [score:5]
This result suggests hyper- methylation plays a significant role in regulation of miR-874 expression in breast cancer. [score:4]
Importantly, the novel finding in our study is that miR-874 level downregulation is correlated with lymph node metastasis and TNM staging in breast cancer. [score:4]
As reported, miR-874 is downregulated in NSCLC, breast cancer, osteosarcoma, gastric cancer, colorectal cancer, and maxillary sinus squamous cell carcinoma. [score:4]
miR-874 downregulation is due to aberrant CpG methylation of miR-874 gene promoter region in breast cancer. [score:4]
miR-874 downregulation is correlated with poor prognosis of breast cancer patients. [score:4]
Here we aim to investigate the upstream molecular mechanism of down-regulated miR-874 expression in breast cancer. [score:4]
DNA methylation is responsible for miR-874 downregulation from TCGA. [score:4]
Furthermore, miR-874 may function as a competing endogenous RNA to regulate the AQP3 expression through competition with lncRNA H19, which has received much attention for years [19]. [score:4]
To our knowledge, this is the first study to investigate the upstream molecular mechanism of down-regulated miR-874 expression in breast cancer. [score:4]
Moreover, patients with high miR-874 expression exhibit better OS (HR = 0.425, P = 0.001; Figure 1F). [score:3]
A linear regression was performed to infer the correlation between the methylation level and expression of miR-874. [score:3]
The univariate and multivariate analysis further indicates the miR-874 expression may be a significant prognostic biomarker in breast cancer patients (P < 0.01) (Table 2 and Figure 1G). [score:3]
tw) show a significant negative correlation between miR-874 expression and methylation levels in its 300-upstream region (Figure 2C). [score:3]
To explore whether miR-874 was associated with several clinic-pathologic parameters, we detected the miR-874 expressions in 47 patients without receiving neoadjuvant therapy. [score:3]
Then we plotted the correlation between miR-874 expression (x-axis) and mean methylation level (y-axis) in breast cancer (Figure 3E) and found a significant reverse correlation (Spearman r = −0.684, p < 0.01). [score:3]
The connection between miR-874 expressions and clinical parameters were analyzed by the chi [2] test. [score:3]
Further analysis of 873 breast cancer with DNA methylation levels intensely suggests that DNA methylation may be a common mechanism of miR-874 expression silencing in breast cancer. [score:3]
The discriminating methylation levels of the three CpG sites (cg19032799, cg04184179, cg03894789), the miR-874 expression and clinic-pathologic data in breast cancer and non-tumor tissues were analyzed on basis of the gene chip data (TCGA_BRCA_ hMethyl450) and (TCGA_BRCA_miRNA) from Cancer Browser (https://genome-cancer. [score:3]
Collectively, these results suggest that miR-874 expression might serve as a novel prognostic biomarker in breast cancer. [score:3]
It is demonstrated that miR-874 expression is correlated with tumor size, tumor/node/metastasis (TNM) staging and lymph node metastasis [13]. [score:3]
Furthermore, we find miR-874 expression is associated with pathological differentiation, TNM staging and lymph node metastasis in breast cancer tissues. [score:3]
Correlation between miR-874 expression and different clinicopathological features in breast cancer. [score:3]
However, the upstream mechanism underlying how miR-874 is down- regulated in breast cancer still has not been well elucidated. [score:2]
Figure 3(A, B) Real time-PCR demonstrated miR-874 expression in two breast cancer cell lines after treatment with different proportions of 5-aza-2-deoxycytidine for 3 or 5 days compared with control cells. [score:2]
Given its critical role in tumor development and progression, we also explored the utility of miR-874 as a prognostic marker by integrating miR-874 and DNA methylation next-generation sequencing data from The Cancer Genome Atlas (TCGA), which was proved convictive and appropriate by previous molecular studies. [score:2]
Figure 1(A) Real time-PCR demonstrated miR-874 expression in 47 patients with breast cancer compared with matched para-normal tissues. [score:2]
The findings suggest that miR-874, which is mediated by DNA methylation, might serve as a prognostic biomarker in breast cancer patients. [score:1]
Methylation of the miR-874 promoter was quantitatively analyzed on Sequenom MassARRAY (CapitalBio), which employs matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry and RNA base-specific cleavage. [score:1]
After comprehensive considerations, we think miR-874, which might serve as a prognostic biomarker or potential therapeutic strategy, is mediated by DNA methylation in breast cancer patients. [score:1]
Figure 2(A) Schematic representation of the location of miR-874 in chr5:136983261-136983338. [score:1]
Therefore, only downstream mechanisms of miR-874 altering cellular processes are confirmed. [score:1]
miR-874 is located on chromosome 5q31.2, a well-known frequent fragile site where the human genome is specifically correlated with chromosomal rearrangements in cancers [32]. [score:1]
To our knowledge, this is the first investigation about the aberrant miR-874 expression due to DNA methylation in breast cancer. [score:1]
Considering the small sample size and some samples without long-time follow-up records, we also applied the clinical parameters with long-time follow-up records to investigate the association between miR-874 expression and OS from an external breast cancer cohort in TCGA (n = 1089). [score:1]
Moreover, Kaplan-Meier survival analysis and multivariate analysis further indicate that miR-874 might be regarded as a novel potential prognostic maker from an external breast cancer cohort in TCGA. [score:1]
Several studies partially substantiated the downstream mechanisms of miR-874 altering cell processes. [score:1]
We applied for 1089 primary invasive ductal carcinomas (IDCs) in the TCGA cohort, the most frequent type of breast cancer, and used long-time follow-up records to evaluate the correlations of miR-874 expression with clinic-pathological parameters and overall survival (OS) in breast cancer patients. [score:1]
As shown in Figure 2A, miR-874 is located on chromosome chr5: 136983261-136983338. [score:1]
Three CpG sites(cg19032799, cg04184179, cg03894789 ), located on chromosome chr5:136983354, chr5: 136983367 and chr5: 136983373, represented as yellow spot located in the promoter region of miR-874. [score:1]
[1 to 20 of 55 sentences]
3
[+] score: 39
It has been demonstrated that miR-29a, miR-29b and miR-874 were downregulated in most of the osteosarcoma tissues and higher expression of miR-29a increased the expression of E2F1 and E2F3 [65, 66]. [score:8]
Overexpression of miR-874 was reported to remarkably inhibit proliferation and metastasis of osteosarcoma by targeting E2F3 [66]. [score:7]
Also, re -expression of miR-874 could remarkably suppress migration and invasion of osteosarcoma cells by targeting E2F3. [score:7]
E2F3 was also identified as a target of miR-874 in osteosarcoma cells and E2F3 overexpression could partially reverse its tumor-suppressive effects [66]. [score:7]
And, miR-874 inhibited osteosarcoma cell growth by inducing cell apoptosis through downregulation of E2F3 [66]. [score:6]
One study showed that miR-29 played a critical role in osteosarcoma pathogenesis, while other studies provided evidence that miR-874 expression was correlated with TNM stage, tumor size, and lymph node metastasis. [score:3]
Thus, these data indicated that miR-29 and miR-874 mediated network involving in E2F3 may be employed as a prognosis marker a novel candidate for osteosarcoma therapeutics [65, 66]. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 38
Based on the miRNA signature that we have identified in glioblastoma stem cells, we may be able to develop targeted glioblastoma therapies by inhibiting the up-regulated miR-10a or miR-10b function using miR-10 antogonists or overexpressing the down-regulated miR-124 or miR-874. [score:13]
For miRNAs that were down-regulated in glioblastoma stem cells, both miR-124 and miR-874 displayed a significant decrease of expression in most of the glioblastoma tissues tested, compared to their average expression in normal brain tissues (Fig. 3C, D). [score:7]
Specifically, the relatively new miRNA miR-874 that has not been studied extensively exhibited a significant reduction of expression in all three glioblastoma stem cell lines, with more than 20-fold reduction in two of the glioblastoma stem cell lines GSC1 and GSC3 (Fig. 2E). [score:3]
The expression levels of miR-10a (A), miR-10b (B), miR-124 (C), and miR-874 (D) in 9 glioblastoma tissues and 4 normal brain tissues were determine by real-time RT-PCR analysis, shown in scatted graph and bar graph. [score:3]
0036248.g003 Figure 3The expression levels of miR-10a (A), miR-10b (B), miR-124 (C), and miR-874 (D) in 9 glioblastoma tissues and 4 normal brain tissues were determine by real-time RT-PCR analysis, shown in scatted graph and bar graph. [score:3]
The expression levels of miR-10a (A), miR-10b (B), miR-140-5p (C), miR-124 (D), and miR-874 (E) in three glioblastoma stem cell (GSC) lines were measured by real-time RT-PCR, and compared to their expression in three neural stem cell (NSC) lines. [score:2]
Both miR-124 and miR-874 exhibited reproducible decrease of expression in all three glioblastoma stem cell lines tested, compared to normal neural stem cells (Fig. 2D, E). [score:2]
0036248.g002 Figure 2The expression levels of miR-10a (A), miR-10b (B), miR-140-5p (C), miR-124 (D), and miR-874 (E) in three glioblastoma stem cell (GSC) lines were measured by real-time RT-PCR, and compared to their expression in three neural stem cell (NSC) lines. [score:2]
For example, we demonstrate for the first time in this study that the expression of miR-874 is dramatically reduced in glioblastoma tissues, compared to normal brain tissues. [score:2]
2 −13.24 1.43E-09 hsa-miR-492 12q22 −7.77 5.38E-08 hsa-miR-874 5q31.2 −6.76 1.53E-08hsa-miR-30b * 8q24.22 −6.54 2.73E-09 hsa-miR-602 9q34.3 −5.75 2.63E-08 * hsa-miR-124 is transcribed from three chromosomal locations, but the mature sequences are the same. [score:1]
[1 to 20 of 10 sentences]
5
[+] score: 14
Other miRNAs from this paper: hsa-mir-296
A comparison between the miRNAs expression profile of OID daughters and their fathers revealed that three miRNAs were similarly altered in both generations (Fig. 5c): mmu-miR-1896, mmu-miR-874 and mmu-miR-296-5p were down-regulated in paternal sperm and their female offspring’s mammary tissue. [score:6]
Validation of signaling pathways alterations associated with miR-874, 296-5p, and 1896 down-regulation in normal mammary tissue and mammary tumors of OID dautgters. [score:4]
In addition, a list of canonical pathways generated using predicted targets for each individual miRNA is provided in Table S6 (mmu-miR-1896), Table S7 (mmu-miR-874), and S8 (mmu-miR-296-5p). [score:3]
We focused our down-stream analyses on mmu-miR-1896, mmu-miR-874 and mmu-miR-296-5p. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 14
The blue and orange lines indicate the two main clusters of samples To validate the data obtained from the miRNA microarray, RT-qPCR was performed to re-examine the expression level of nine miRNAs, namely miR-328-5p, miR-4750-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p. [score:3]
As for atrial myocardial samples from infants with CHDs, we found significantly different expression of six miRNAs (miR-210-5p with a P-value of 0.014, miR-423-3p with a P-value of 0.034, miR-143-3p with a P-value of 0.018, miR-564 with a P-value of 0.024, miR-770-5p with a P-value of 0.025, and miR-874-5p with a P-value of 0.040) between prior and after CPB (Fig.   4). [score:3]
In addition, we selected six miRNAs (miR-328-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-874-5p and miR-93-5p) with low or moderate expression levels based on the array analysis and with known association with cardiac pathologies and its related process [26– 33]. [score:3]
As for the atrial myocardial samples from neonates with CHDs, we found a significantly different expression for miR-874-5p with a P-value of 0.040 between prior CPB and after CPB. [score:3]
The significance of the differences in the expression was confirmed for seven miRNAs namely miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p) (P < 0.05) in the atrial myocardial samples from patients with CHDs after CPB compared to before CPB by RT-qPCR (Fig.   3). [score:2]
[1 to 20 of 5 sentences]
7
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
8
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Selected miRNAs were also analyzed in nasal biopsies from asthmatic patients and healthy donors, revealing differential expression of 10 miRNAs (miR-18a, miR-126, let-7e, miR-155, miR-224 were down-regulated, while miR-498, miR-197, miR-874, miR-143, miR-886-3p were up-regulated) [25]. [score:9]
Analysis of patients with asthma and allergic rhinitis showed further alterations in expression for six miRNAs: miR-224, miR-498, miR-187, miR-874, miR-143, miR-886-3p as compared to the control subjects. [score:2]
[1 to 20 of 2 sentences]
9
[+] score: 8
While we did not seek an explanation for this novel csp-8 related finding, a plausible link between procsp–8 downregulation, necroptosis and miR-874 has been recently described in cardiomyocytes [29]. [score:4]
Wang K Liu F Zhou LY Ding SL Long B Liu CY Sun T Fan YY Sun L miR-874 regulates myocardial necrosis by targeting caspase-8Cell Death Dis. [score:4]
[1 to 20 of 2 sentences]
10
[+] score: 7
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Some miRNAs (miR-129-1-3p; miR-129-2-3p, miR-129-5p, miR181c-5p, miR181d-5p, miR-409a-5p, miR-655 and miR-874-3p) were up-regulated (Fig. 2, Supplementary Fig. S3A), whereas others (miR-296-5p, miR-500-3p and miR-652-3p) were down-regulated only in the chronic phase, while not being significantly altered during latency (Fig. 2, Supplementary Fig. S3B). [score:7]
[1 to 20 of 1 sentences]
11
[+] score: 6
Functional analysis indicated that ectopic miR-874 expression suppressed the growth, migration, invasion, and tumorigenicity of GC cells, whereas miR-874 knockdown promoted these phenotypes [29]. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 6
32−1.25miR-574-3p-hsa-miR-585,hsa-mir-585−2.51-miR-585-hsa-miR-874,hsa-mir-874−1.68−1.56miR-874-hsa-miR-887,hsa-mir-887−1.90−1.99miR-887-hsa-miR-891a,hsa-mir-891a−7.14−6.86miR-891a- Up-regulated miRNA MiRDeep (logFC) MiRExpress (logFC) Family NPC ref. [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 5
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3
Moreover, miR-874 suppresses AQP3 expression by binding to the 3 [’]UTR of AQP3 mRNA in GC cells [84]. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 5
Other miRNAs from this paper: mmu-mir-874
Interestingly, it has been shown that AQP3 may impair the intestinal barrier integrity [107], which is probably mediated by miR-874 through targeting AQP3 following intestinal ischemic injury [108]. [score:3]
Zhi X. Tao J. Li Z. Jiang B. Feng J. Yang L. Xu H. Xu Z. MiR-874 promotes intestinal barrier dysfunction through targeting AQP3 following intestinal ischemic injury FEBS Lett. [score:2]
[1 to 20 of 2 sentences]
15
[+] score: 5
Furthermore, Western blot and immunohistochemical analyses of the implanted tumors in mice revealed significant downregulation of WWP1 protein expression in the miR-874 -mimic -transfected group compared with that in the control group. [score:5]
[1 to 20 of 1 sentences]
16
[+] score: 5
MicroRNAs miR-187 (previously identified to be induced by influenza A virus [26]), miR-147b, miR-190b, miR-874, and the miR-449 family (miR-449a, miR-449b, and miR-449c) were all validated as highly regulated by influenza A virus infection (Figure 2). [score:2]
0076560.g003 Figure 3 (A) A549 cells were mock infected, infected with A/WSN/33 (5 pfu/cell), or infected after transfection with an equimolar mixture of miRNAs (50nM final concentration) that included either hsa-miR-141, hsa-miR-374b, hsa-miR-449b, hsa-miR-518b, and hsa-miR-1263 (G1), or hsa-miR-147b, hsa-miR-190b, hsa-miR-199a-5p, hsa-miR-512-5p, and hsa-miR-874 (G2). [score:1]
Transfections were performed using the following miRNA specific mimics at a final concentration of 50nM: miR-141, miR-147b, miR-190b, miR-199a-5p, miR-374b, miR-449b, miR-512-5p, miR-518b, miR-874, and miR-1263 (Thermo Scientific/Dharmacon). [score:1]
Ten highly inducible miRNAs (miR-141, miR-147b, miR-190b, miR-199a-5p, miR-374b, miR-449b, miR-512-5p, miR-518b, miR-874, and miR-1263) were used in this experiment and divided randomly into two groups of 5 for analysis: one group (G1) consisted of miR-141, miR-374b, miR-449b, miR-518b, and miR-1263, and the other group (G2) consisted of miR-147b, miR-190b, miR-199a-5p, miR-512-5p, and miR-874 (Figure 3A). [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 5
CDF increased the expression of miR-874 which targets MMP-2 [167]. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 3
In this DAG, the gene LSM12 is targeted by intronic miRNAs miR-19a, miR-19b,miR-26a,miR-26b, miR-27b, miR-214, miR-340, and miR-874 which are located in the introns of CTDSP2, CTDSPL, MIRHG1, CTDSP1, C9orf3, RNF130, DNM3, and KLHL3. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
MiR-874 suppresses gastric cancer progression by modulating angiogenesis through STAT3/VEGF-A pathway [11]. [score:2]
[1 to 20 of 1 sentences]
20
[+] score: 1
Other miRNAs from this paper: hsa-mir-107, hsa-mir-34a, hsa-mir-140, hsa-mir-143, hsa-mir-544a
Another study has revealed that the level of miR-874 in NSCLC TSCs reduced, leading to the loss of TSC self-renewal and CD133 on the TSC surface (16). [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
73(12) hsa-miR-377* 14q32.2 −2.72 hsa-miR-7 15q25.3/19p13.3/9q21.32 −2.72(12, 14) hsa-miR-124 20p23.1/8q12.3/8p23.1 −2.71(12, 14, 29, 48, 49) hsa-miR-323-5p 14q32.31 −2.69(12) hsa-miR-873 9p21.1 −2.65 hsa-miR-129* 11p11.2/7q32.1 −2.63 hsa-miR-338-5p 17q25.3 −2.61(14) hsa-miR-409-5p 14q32.2 −2.61 hsa-miR-874 5q31.2 −2.46 hsa-miR-495 14q32.2 −2.46(52) hsa-miR-885-5p 3p25.3 −2.45 hsa-miR-376c 14q32.2 −2.43(52) hsa-miR-299-5p 14q32.2 −2.41 hsa-miR-539 14q32. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Preliminary results showed that the level of miR874-3p, miR-422a, miR-490-3p, miR-374b, miR-133a, let-7 g, miR-378, miR-9*, and miR-378i were all deregulated in the CRC tissues compared with the neighboring noncancerous colorectal tissues (all P < 0.05) (Figure  2). [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
found a putative connection between pal-can-300 (miR-874) and FANCI, which is involved in DNA repair. [score:1]
[1 to 20 of 1 sentences]