38 publications mentioning mmu-mir-574

Open access articles that are associated with the species Mus musculus and mention the gene name mir-574. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

NC = negative control miR-574-5p overexpression suppresses BACE1 elevation and restores synaptic and cognitive impairment following PM [2.5] exposureIf miR-574-5p directly binds to the 3’UTR of BACE1 and miR-574-5p deregulation stimulates BACE1 expression and impairs synaptic and cognitive function in response to PM [2.5] aspiration, then overexpression of miR-574-5p should suppress BACE1 elevation and restore synaptic and cognitive impairment.

Additionally, PM [2.5] -induced downregulation of miR-574-5p expression and upregulation of BACE1 were reversed by NF-κB inhibition.

*/ [#] P < 0.05; **/ [##] P < 0.01 PM [2.5] exposure downregulates the expression of miR-574-5p which has a binding site in the 3′UTR of BACE1To determine the molecular mechanism by which PM [2.5] augmented BACE1 expression and produced deficits in synaptic transmission and spatial learning and memory, microarray was used as initial screening using unadjusted p < 0.05, with expression of relevant candidates verified by real-time qPCR.

NC = negative control If miR-574-5p directly binds to the 3’UTR of BACE1 and miR-574-5p deregulation stimulates BACE1 expression and impairs synaptic and cognitive function in response to PM [2.5] aspiration, then overexpression of miR-574-5p should suppress BACE1 elevation and restore synaptic and cognitive impairment.

Considering its relationship with central nervous system development and that mediation of post-transcriptional regulation [50] and dysregulation of miR-574-5p have been reported in neurodegenerative diseases [51, 52], we focused on miR-574-5p and examined its predicted binding sites in the 3′ untranslated region (UTR) of BACE1.

Figure 7 shows that miR-574-5p efficiently inhibited luciferase expression by binding to the BACE1 3′-UTR and significantly reduced the relative luciferase reporter activity of the wild-type BACE1 3′-UTR, whereas the luciferase reporter activity of the mutant BACE1 3′-UTR was not altered, suggesting that miR-574-5p could directly bind to the 3′-UTR of BACE1 but did not inhibit the reporter activity with the mutated luciferase construct.

To address this question, we performed a miRNA microarray analysis and found that miR-574-5p, which is homologous in humans and targets BACE1, was downregulated in a dose -dependent manner following PM [2.5] exposure, suggesting that BACE1 elevation following PM [2.5] exposure is likely the result of reduced miR-574-5p expression.

If NF-κB activation regulates miR-574-5p expression and then induces BACE1 elevation in response to PM [2.5] exposure, then NF-κB inhibition should rescue the reduced miR-574-5p expression and elevated BACE1 activation.

To verify this notion, we pharmacologically and genetically inhibited NF-κB and detected miR-574-5p expression and BACE1 activation by applying an NF-κB inhibitor, SC-514, and using an NF-κB p65 shRNA silencing technique in primary cultured hippocampal neurons.

These results indicate that miR-574-5p overexpression successfully suppressed BACE1 expression after PM [2.5] aspiration.

The action was mediated by NF-κB p65-regulated downregulation of miR-574-5p, which targets BACE1.

Fig. 7Direct inhibition of BACE1 expression by miR-574-5p was detected with a dual-luciferase-luciferase reporter system.

PM [2.5] exposure downregulates the expression of miR-574-5p which has a binding site in the 3′UTR of BACE1.

Among these altered miRNAs, miR-574-5p was homologous to the corresponding human miRNA, and the significantly downregulated expression was validated by miRNA real-time qPCR (Fig. 6b).

LV-Con + Veh = LV-scramble control + vehicle; LV-574 + Veh = LV-miR-574-5p + vehicle; LV-Con + PM [2.5] = LV-scramble control + PM [2.5]; LV-574 + PM [2.5] = LV-miR-574-5p + PM [2.5] NF-κB activation regulates miR-574-5p expression in response to PM [2.5] exposuremiR-574-5p is a previously unrecognized miRNA that targets BACE1 following PM [2.5] aspiration.

Furthermore, we provide evidence that this action was mediated by NF-κB p65 -induced downregulation of miR-574-5p, which targets BACE1.

Fig. 6PM [2.5] exposure downregulates miR-574-5p expression.

Additionally, through the dual-luciferase reporter system in HEK293T cells, we found that PM [2.5] directly stimulated NF-κB activity (Additional file 1: Figure S4), suggesting that downregulation of miR-574-5p by PM [2.5] likely occurs through activating NF-κB and increasing the reverse modulation of NF-κB on miR-574-5p.

Overexpression of miR-574-5p in the hippocampal region decreased BACE1 expression, restored synaptic function, and improved spatial memory and learning following PM [2.5] exposure.

Importantly, miR-574-5p overexpression significantly restored the attenuation of glutamate receptor expression and the deterioration of LTP and spatial learning and memory in response to PM [2.5] aspiration.

To test this prediction, we overexpressed miR-574-5p by stereotaxically injecting LV into the hippocampal area (Fig. 8a), and detected BACE1 expression in the absence or presence of PM [2.5] aspiration.

Together, our results suggest that PM [2.5] aspiration suppresses miR-574-5p expression by augmenting NF-κB activity, which then facilitates BACE1 activation and results in synaptic and cognitive impairment.

miR-574-5p overexpression suppresses BACE1 elevation and restores synaptic and cognitive impairment following PM [2.5] exposure.

Importantly, BACE1 inhibition rescued synaptic and cognitive impairment in animals following PM [2.5] aspiration, which was further supported by the fact that overexpression of miR-574-5p robustly reduced BACE1 elevation and rescued synaptic and cognitive impairment.

Importantly, PM [2.5]-exposed mice showed improved behavioral performance after receiving LV-miR-574-5p in contrast to those receiving the LV-scramble control, including an effectively reversed prolonged latency of reaching the platform, a significantly increased number of times crossing the target zone, and an increased amount of time spent in the target quadrant (Fig. 9).

Importantly, overexpression of miR-574-5p in the hippocampal region decreased BACE1 expression, restored synaptic function, and improved spatial memory and learning following PM [2.5] aspiration.

NF-κB activation regulates miR-574-5p expression in response to PM [2.5] exposure.

*/ [#] P < 0.05; **/ [##] P < 0.01; ***/ [###] P < 0.001 The results of our present study provide evidence that PM [2.5] aspiration impairs synaptic and cognitive function and that this effect is associated with a previously unrecognized role for BACE1 induction through NF-κB signaling -mediated miR-574-5p downregulation.

Fig. 10NF-κB activation regulates miR-574-5p expression in response to PM [2.5] exposure.

This information provides further evidence that the adverse effects of BACE1 -mediated synaptic and cognitive deterioration resulting from PM [2.5] aspiration are associated with downregulation of miR-574-5p through its binding to the 3’UTR of BACE1.

The present study confirms that PM [2.5] exposure leads to impaired synaptic and cognitive function, and this action is associated with a previously unrecognized role for BACE1 induction through NF-κB signaling -mediated miR-574-5p downregulation.

With PM [2.5] treatment, miR-574-5p overexpression statistically significantly attenuated BACE1 elevation, in contrast to that observed in LV-scramble control mice (Fig. 8b).

Taken together, our findings reveal a novel molecular mechanism underlying impaired synaptic and cognitive function following exposure to PM [2.5], suggesting that miR-574-5p is a potential intervention target for the prevention and treatment of PM [2.5] -induced neurological disorders.

LV-Con + Veh = LV-scramble control + vehicle; LV-574 + Veh = LV-miR-574-5p + vehicle; LV-Con + PM [2.5] = LV-scramble control + PM [2.5]; LV-574 + PM [2.5] = LV-miR-574-5p + PM [2.5] Following the above results, we further determined whether overexpression of miR-574-5p could reverse synaptic and cognitive deterioration.

Furthermore, we found that the abnormal synaptic ultrastructures (Additional file 1: Figure S3) and reduced LTP (Fig. 8e) recovered following miR-574-5p overexpression.

Indeed, our results showed that overexpression of miR-574-5p significantly reduced BACE1 elevation, which supported this speculation.

Additionally, PM [2.5] increased NF-κB reporter activity, indicating that NF-κB activation following PM [2.5] exposure amplifies NF-κB -mediated inhibition of miR-574-5p transcription.

Using Lipofectamine 2000 (Invitrogen), cells were transfected with 100 ng/mL of either the wild-type or mutant 3′-UTR vector and 50 nM miR-574-5p mimic or 100 nM miR-574-5p inhibitor.

Our results showed that miR-574-5p expression was decreased to 0.89- and 0.76-fold of the control after PM [2.5] exposure at 1 and 5 mg/kg bw, respectively, with a statistical significant difference being observed at the higher dose.

LV-Con + Veh = LV-scramble control + vehicle; LV-574 + Veh = LV-miR-574-5p + vehicle; LV-Con + PM [2.5] = LV-scramble control + PM [2.5]; LV-574 + PM [2.5] = LV-miR-574-5p + PM [2.5] miR-574-5p is a previously unrecognized miRNA that targets BACE1 following PM [2.5] aspiration.

LV-Con + Veh = LV-scramble control + vehicle; LV-574 + Veh = LV-miR-574-5p + vehicle; LV-Con + PM [2.5] = LV-scramble control + PM [2.5]; LV-574 + PM [2.5] = LV-miR-574-5p + PM [2.5] Following the above results, we further determined whether overexpression of miR-574-5p could reverse synaptic and cognitive deterioration.

miR-574-5p overexpression recovers morphological alterations of synapse.

This finding suggests that reduced expression of miR-574-5p, via altered binding to the 3’UTR of BACE1, may be conducive to BACE1 elevation and synaptic and cognitive impairment following PM [2.5] exposure.

Our findings revealed that inhibition of NF-κB diminished PM [2.5] -induced repression of miR-574-5p and induction of BACE1, which further supports our earlier results (Fig. 10b and c).

In response to PM [2.5] aspiration, the reduced expression of the glutamate NMDA and AMPA receptor subunits and PSD-95 was statistically significantly restored in animals treated with LV-miR-574-5p compared with that in those treated with the LV-scramble control (Fig. 8c and d).

Thus, it was essential to clarify whether and how NF-κB is linked to miR-574-5p deregulation in response to PM [2.5] aspiration.

The mutant BACE1 3′-UTR contains mutations in the miR-574-5p binding site that disrupt base pairing (indicated in red).

Therefore, it was necessary to clarify how miR-574-5p is regulated following exposure.

These data provide further evidence that miR-574-5p mediates PM [2.5] -induced BACE1 elevation following synaptic and cognitive deterioration.

BACE1 contains a conserved 3′-UTR sequence (positions 1458–1464) that perfectly complements the miR-574-5p seed sequence (both are shown in blue).

Here, to provide a more complete picture of the different aspects of miRNA modulation after PM [2.5] exposure, we used ChIP analyses to show that NF-κB p65 was able to bind to the promoter region of the miR-574-5p gene.

The pLVX-IRES-TDtomato LV (Clontech) was used to insert mature miR-574-5p driven by the CMV promoter.

*/ [#] P < 0.05 According to the statistical analysis, miR-574-5p has at least one binding site in the 3’UTR of BACE1.

The data regarding the different effects of miR-574-5p on the BACE1 3′-UTR and its mutant are presented as the means ± SE (n = 6).

As presented in Fig. 10a, binding activity of NF-κB p65 was detected in the promoter positions of miR-574-5p, and this interaction was enhanced by PM [2.5] treatment.

The mice were also stereotaxically injected with β-site amyloid precursor protein cleaving enzyme 1 (β-secretase, BACE1) shRNA or LV-miR-574-5p lentiviral constructs in the absence or presence of PM [2.5] aspiration at 5 mg/kg bw every other day for 4 weeks.

ChIP analysis was performed according to the manufacturer’s instructions (Millipore, CA, USA) to test the binding of NF-κB p65 to the miR-574-5p promoter.

Here, we measured glutamate NMDA and AMPA receptor expression, LTP, and spatial learning and memory in mice that received either LV-miR-574-5p or LV-scramble in the absence or presence of PM [2.5] treatment.

A construct possessing mutations disrupting the putative mir-574-5p binding site in the 3′-UTR of BACE1 was prepared using KOD Plus neo DNA Polymerase (ToYoBo) with the following primers: 5′-TGGTTCTTGGGCTAGGTTGTGGGGGGGTGTGAGACCTCTTCCCTGCCAGTTCTAACAC -3′ (forward) and 5′-GTGTTAGAACTGGCAGGGAAGAGGTCTCACACCCCCCCACAACCTAGCCCAAGAACCA-3′ (reverse).

PM [2.5] β-site amyloid precursor protein cleaving enzyme 1 (β-secretase, BACE1) MicroRNA-574-5p (miR-574-5p) NF-κB Synaptic dysfunction Spatial memory and learning Air pollution contributes to a broad array of acute and chronic health effects, with an estimated impact of 5.5 million deaths per year worldwide [1].

cgi?dirDB=TF_8.3) to predict potential binding sites between NF-κB p65 and miR-574-5p, and the results showed that there was at least one NF-κB binding site.

Dual-luciferase reporter gene and chromatin immunoprecipitation (ChIP) analyses were used to detect the binding of miR-574-5p in the 3’UTR of BACE1 and NF-κB p65 in the promoter of miR-574-5p, respectively.

After 6 weeks, four groups (control shRNA, BACE1 shRNA, LV-scramble control and LV-miR-574-5p) received an oropharyngeal aspiration of 5 mg/kg PM [2.5] or saline, which was processed by ultrasonic oscillation of the control membrane filter, every other day for 4 weeks.

*/ [#] P < 0.05 According to the statistical analysis, miR-574-5p has at least one binding site in the 3’UTR of BACE1.

Importantly, pharmacological and genetic silencing of NF-κB p65 prevented the miR-574-5p reduction and BACE1 elevation following PM [2.5] exposure, supporting our hypothesis.

2

Compared to corresponding control group, the protein expression of MACC-1 was down-regulated in mimic groups in both SW1116 and HCT116 cell lines (P < 0.05), as shown in Figure 3A, B. Compared to corresponding control group, the protein expression of MACC-1 was up-regulated in inhibitor group in both SW1116 and HCT116 cell lines (P < 0.05), also shown in Figure 3A, B. The protein expression of has-miR-574-5p was reduced in antisense transfected HCT116 cells, while it was increased in miRNA mimics transfected SW1116 cells (Figure 3C).

Effect of hsa-miR-574-5p on MACC-1 expression in HCT116 and SW1116 cells; compared with control group, mimic group reduced MACC-1 expression, while inhibitor group increased MACC-1 expression (*P < 0.05, inhibitor vs.

Therefore, we speculated that hsa-miR-574-5p played a suppressive role in colorectal cancer liver metastasis by negatively involved in the down-regulation of MACC-1 expression.

Taken together, our findings partly elucidated that hsa-miR-574-5p played a suppressive role in colorectal cancer liver metastasis by negatively directing the expression of MACC-1. The results in this study might offer a novel therapy option of hsa-miR-574-5p in colorectal cancer liver metastasis.

It was partly elucidated that hsa-miR-574-5p played a suppressive role in colorectal cancer liver metastasis by negatively directing MACC-1 expression, offering a novel therapeutic approach for colorectal cancer liver metastasis.

Has-miR-574-5p directly targets MACC-1. The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on MACC-1 protein expression in SW1116 and HCT116 cell lines.

Furthermore, the effect of hsa-miR-574-5p antisense and miRNA mimics transfection on MACC-1 expression in SW1116 and HCT116 cell lines showed that hsa-miR-574-5p negatively regulated MACC-1 expression at protein level.

control group); C. hsa-miR-574-5p expression was reduced in antisense (inhibitor group) transfected HCT116 cells, while it was increased in miRNA mimics (mimic group) transfected SW1116 cells ([#]P < 0.01 vs.

It has been reported that hsa-miR-574-5p decreased CBR1 (carbonyl resuctase 1) gene expression and activity [21] and negatively regulated Qki6/7 to impact β-catenin/Wnt signalling and the development of colorectal cancer [22].

Inhibition of hsa-miR-574-5p suppressed the growth of colorectal tumors in the nude mice [22].

It was hypothesized that hsa-miR-574-5p affected colony formation, cell invasion and cell spheroid formation by mediating the expression of MACC-1. Increased MACC-1 expression in colorectal cancer cells can induce proliferation, migration and invasion of cancer cells in vitro, while promoting liver metastasis in a xenograft mo del [30].

The top 15 were shown in Table 1. Among those miRNAs, hsa-miR-574-5p expression level may be correlated to MACC-1 expression for the E value (0.10) was relatively lower.

The results showed that has-miR-574-5p might inhibit MACC1 expression.

Our work firstly demonstrated that hsa-miR-574-5p negatively regulated MACC-1 expression in colorectal cancer cells.

Thus, it was indicated that hsa-miR-574-5p negatively regulated MACC-1 expression at protein level.

Figure 3 The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on MACC-1 expression in SW1116 and HCT116 cell lines.

Western-blot to detect MACC-1 protein expression in hsa-miR-574-5p antisense or miRNA mimic transfected SW1116 and HCT116 cell lines.

Hairpin-it miRNAs qPCR kit (GenePharma, China) was used to detect the hsa-miR-574-5p expression in SW1116 and HCT116 cell lines with stem-loop reverse transcription.

It showed that the decreased expression of has-miR-574-5p in HCT116 cells stimulated cell proliferation and invasive activity, inducing increased colony formation, cell invasion and cell spheroid formation of HCT116 cells, compared to control group (P < 0.05), as shown in Figure 4. Conversely, the increased expression of has-miR-574-5p in SW1116 cells decreased colony formation, cell invasion and cell spheroid formation, compared to control group (P < 0.05), as shown in Figure 4. Figure 4 The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell colony formation, cell invasion and cell spheroid formation in SW1116 and HCT116 cell lines.

Figure 2 The mRNA expression levels of MACC-1 and hsa-miR-574-5p in SW1116 and HCT116 cell lines.

It showed that the decreased expression of has-miR-574-5p in HCT116 cells stimulated cell proliferation and invasive activity, inducing increased colony formation, cell invasion and cell spheroid formation of HCT116 cells, compared to control group (P < 0.05), as shown in Figure 4. Conversely, the increased expression of has-miR-574-5p in SW1116 cells decreased colony formation, cell invasion and cell spheroid formation, compared to control group (P < 0.05), as shown in Figure 4. Figure 4 The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell colony formation, cell invasion and cell spheroid formation in SW1116 and HCT116 cell lines.

Bioinformatics analysis showed hsa-miR-574-5p negatively regulated MACC-1 and then their interaction was demonstrated at mRNA and protein level.

It was verified that hsa-miR-574-5p was negatively involved in the regulation of MACC-1 at mRNA and protein levels.

Subsequently, results demonstrated that hsa-miR-574-5p was involved in the regulation of MACC-1, playing a functional role in colorectal cancer liver metastasis.

Therefore, it was verified that hsa-miR-574-5p was negatively involved in the regulation of MACC-1 at mRNA and protein levels.

Our results indicated that an inverse correlation between hsa-miR-574-5p and MACC-1 at mRNA level was observed in the SW1116 and HCT116 cell lines.

The E value of hsa-miR-574-5p is relatively lower.

MACC-1 and hsa-miR-574-5p mRNA levels in SW1116 and HCT116 cell lines.

HCT116); C. hsa-miR-574-5p mRNA level in HCT116 is significant higher than that in SW1116 cell ([✩]P < 0.01 vs.

We co -transfected MACC-1 (3′UTR sequence) vector and hsa-miR-574-5p or negative control into cells.

So the hsa-miR-574-5p is chosen for investigating if this miRNA is correlated with the expression of MACC-1. In this study, qRT-PCR analysis indicated that an inverse correlation between hsa-miR-574-5p and MACC-1 at mRNA level was observed in the SW1116 and HCT116 cell lines.

And the knockdown of has-miR-574-5p demonstrated increased colony formation, cell invasion and cell spheroid formation in HCT116 cells, compared to control group (P < 0.05).

We performed qRT-PCR analysis to detect the mRNA level of MACC-1 and hsa-miR-574-5p in SW1116 and HCT116 cell lines.

The effect of hsa-miR-574-5p on colony formation, cell invasion and cell spheroid formation in SW1116 and HCT116 cell lines.

Though HCT116 cells represented a low metastasis potential, siRNA mediated knockdown of has-miR-574-5p increased colony formation, cell invasion and cell spheroid formation in HCT116 cells, compared to control group.

Transfection of hsa-miR-574-5p antisense or miRNA mimic into SW1116 and HCT116 cell lines.

The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell colony formation in SW1116 and HCT116 cell lines (*P < 0.01 vs.

The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell spheroid formation in SW1116 and HCT116 cell lines (*P < 0.01 vs.

The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell invasion in SW1116 and HCT116 cell lines (#P < 0.01 vs.

The amplified PCR products of 3′UTR sequence of wild type MACC-1 or mutant MACC-1 containing the putative has-miR-574-5p binding site were transformed into 293 T cells by pGL3 vector.

The mRNA level of hsa-miR-574-5p in HCT116 cells was higher than that in SW1116 cells (P < 0.01, Figure 2C).

Moreover, hsa-miR-574-5p affected the colony formation, cell invasion and cell spheroid formation.

The hsa-miR-574-5p was chosen for further analysis.

Second, although the hsa-miR-574-5p may be the potential therapy for colorectal cancer liver metastasis therapy, the function of it in patients with colorectal cancer liver metastasis need further experiments to explore.

We identified miRNAs that might regulate MACC-1 expression by bioinformatics analysis and further investigated the relationship of MACC-1 and hsa-miR-574-5p by luciferase reporter assay, quantitative RT-PCR and western blot.

3

Moreover, HOTTIP overexpression led to an increase of miR-574-5p expression (Fig. 4e), while HOTTIP knockdown led to EZH1 decreasing significantly (Fig. 4f), and co -expression relationship analysis of EZH1 and HOTTIP in clinical tissues showed a positive correlation (Fig. 4g).

By flow cytometry, cell-cycle profiles following miR-574-5p knockdown showed that suppression of miR-574-5p led to an increase in the number of cells in the S-phase and the G2-phase (Fig.   7a), which indicated that miR-574-5p suppression led to an opposite effect on SCLC cell cycle with HOTTIP knockdown.

Altogether, the positive correlation between HOTTIP and EZH1 expression, and their relevance to miR-574-5p expression confirm our hypothesis that ceRNA may sequester miRNA, thereby protecting their target mRNAs from repression.

Meanwhile, HOTTIP was involved in SCLC pathogenesis by up -regulating the expression of miRNA-574-5p’s target gene, EZH1, through competitively “sponging” this miRNA.

Plate colony formation experiments showed that miR-574-5p knockdown may promote SCLC cell growth while miR-574-5p overexpression may inhibit that (Fig. 7b).

Our results verified that miR-574-5p negatively regulated the expression of HOTTIP and EZH1 by RT-qPCR and Western blot (Additional file 2: Fig. S2B-C, Fig. 4b-c), and co -expression relationship analysis of miR-574-5p and HOTTIP in clinical tissues showed a negative correlation (Fig. 4d).

e & f HOTTIP may positively regulated EZH1 expression but negatively regulated miR-574-5p.

d & g Correlation analysis in SCLC tissues showed that HOTTIP expression is negatively associated with miR-574-5p but positively associated with EZH1 expression.

Considering the exclusive localization of HOTTIP in the nuclei and Ago2 generally interacts with RNAs exported to cytoplasm, we examined if expression of ‘nuclear’ HOTTIP and EZH1 could be inhibited by miRNA-574-5p via RT-qPCR using nuclear and cytoplasmic RNAs isolated from cells treated with miR-574-5p.

Using CCK8 assay, we found that miR-574-5p knockdown may promote SCLC cell growth while miR-574-5p overexpression may inhibit that (Fig. 7c).

c miR-574-5p may negatively regulated expression of EZH1 at protein level in H146 cell.

b miR-574-5p may negatively regulated expression of HOTTIP and EZH1 at mRNA level in H146 cell.

*, P < 0.05 In order to clarify the role of HOTTIP in the novel regulatory complex, we carried out the co-transfection dual luciferase reporter assay and found that, luciferase activity for HOTTIP and EZH1 were reduced respectively compared with the control when miR-574-5p expressed (Fig.   5a-b), and the inhibited reporter plasmid luciferase activity for EZH1 was reversed in the presence of HOTTIP (Fig. 5c), which indicates that HOTTIP acts as an endogenous “sponge” by binding miR-574-5p, thus abolishing the miRNA-574-5p induced repressing activity on the EZH1 3′-UTR.

As shown in Additional file 3: Fig. S3B-E, we found that miRNA-574-5p could directly silence the expression of HOTTIP and EZH1 in either the nucleus or cytoplasm.

*, P < 0.05 In order to clarify the role of HOTTIP in the novel regulatory complex, we carried out the co-transfection dual luciferase reporter assay and found that, luciferase activity for HOTTIP and EZH1 were reduced respectively compared with the control when miR-574-5p expressed (Fig.   5a-b), and the inhibited reporter plasmid luciferase activity for EZH1 was reversed in the presence of HOTTIP (Fig. 5c), which indicates that HOTTIP acts as an endogenous “sponge” by binding miR-574-5p, thus abolishing the miRNA-574-5p induced repressing activity on the EZH1 3′-UTR.

Fig. 4HOTTIP may enhance EZH1 expression by sponging miR-574-5p.

a Putative binding site of miR-574-5p in HOTTIP and EZH1 3′-UTR and the site of target mutagenesis we indicated.

Moreover, RIP experiments showed that Ago2 had a function in the formation of HOTTIP and miR574-5p complex and in their regulation of EZH1 (Fig. 5f), Which suggests HOTTIP, miR-574-5p and Ago2 combination formed the RNA silencing complex, and further clarify the direct interaction of miR-574-5p, HOTTIP and EZH1.

a Flow-cytometric analysis was used for cell cycle detection after miR-574-5p suppression in H446 and H69 cells.

edu/), 5 miRNAs including miR-574-5p were predicted that have targeted binding relationship with HOTTIP and have been testified by RT-qPCR (Additional file 1: Fig. S1G).

These results above suggest HOTTIP may be involved in a novel regulatory network of miRNA-574-5p-HOTTIP-EZH1.

b Plate clone formation assay showed miR-574-5p may inhibit SCLC cell proliferation.

Furthermore, we used RNA pull-down, mass spectrometry and RIP assays to support the ceRNA mechanism of miR-574-5p and its target genes through modulating RISC.

c CCK8 assay showed miR-574-5p may inhibit SCLC cell proliferation.

f RIP experiments showed that Ago2 had a function in the formation of HOTTIP and miR574-5p complex and in their regulation of EZH1.

As a vital role, HOTTIP may be involved in SCLC through the regulatory network “HOTTIP/miR-574-5p/EZH1”.

SCLC cells (2 × 10 [5] cells/well) were spread in a 12-well plate and co -transfected with 40 nM of either hsa-miR-574-5p or miRNA negative control of either recombinant plasmids or corresponding mutants, and 1 ng of PSICHECK2.0 (Promega) by using Lipofectamine™ 2000.

We also demonstrated that HOTTIP was involved in SCLC pathogenesis through ceRNA network “HOTTIP/miR-574-5p/EZH1”, then led to the occurrence and progression of SCLC.

Thirdly, further mechanistic investigations showed that HOTTIP might function as a role of ceRNA by binding miR-574-5p and abrogating their tumor suppressive function in this setting.

*, P < 0.05 In the above section, we have proved the negative relevance between miR-574-5p and HOTTIP, but whether miR-574-5p is involved in SCLC biology is still unclear.

miR-574-5p may mediate the effect of HOTTIP on SCLC biology.

*, P < 0.05 Therefore, HOTTIP, miR-574-5p, EZH1 were all involved in the pathogenesis of SCLC according to the results above.

*, P < 0.05 Therefore, HOTTIP, miR-574-5p, EZH1 were all involved in the pathogenesis of SCLC according to the results above.

Consequently, using a series of in vitro and in vivo experiments, our study suggested that HOTTIP is involved in SCLC tumorigenesis through the ceRNA network “HOTTIP/miR-574-5p/EZH1”.

Overall, we identified that HOTTIP was involved in SCLC tumorigenesis through the ceRNA network “HOTTIP/miR-574-5p/EZH1”.

We also found that EZH1 contains putative regions that matches to the seed sequence of miR-574-5p but not match other miRNAs by further searching in RNA22-seq database (Fig.   4a).

Hence, miR-574-5p was selected for further experiments in our study (Additional file 2: Fig. S2A).

Additional file 1: HOTTIP and miR-574-5p were screened out by microarray and RT-qPCR methods.

Mechanistic investigations showed that HOTTIP functions as an oncogene in SCLC progression by sponging miR-574-5p and affecting the expression of polycomb group protein EZH1.

4

Some miRNAs were overexpressed in tumors (miR-155, miR-193b, miR-27a, miR-31, miR-99b, miR-484, miR-574-3p, miR-125a-5p, miR-182), whereas others displayed down-regulation (miR-20a, miR-200c, miR-93, miR-340-5p, miR-720) or a comparable level of expression (miR-200a) with respect to non tumor tissues.

MiR-340-5p, miR-484, miR-574-3p, and miR-720 showed fluctuant levels of slight down-regulation or over -expression during the treatment.

Among them, miR-340-5p, miR-484, miR-574-3p, miR-720, whose expression was never described in NAFLD, NASH and HCC tissues, and miR-125a-5p and miR-182, which showed early and significant dysregulation in the sequential hepatic damage process.

The above-mentioned miRs appear to be up- (miR-484 and miR-574-3p) or down-regulated (miR-340-5p, miR-720) in tumor tissues.

No data are reported about the expression and role of miR-340-5p, miR-484, miR-574-3p, and miR-720 in NAFLD, NASH and HCC tissues.

Four dysregulated microRNAs (miR-340-5p, miR-484, miR-574-3p, miR-720), never described in liver damage and tumorigenesis, were here detected.

MiR-574-3p was identified over-expressed in plasma from head and neck [77] and in prostate cancer patients [78].

Just one study showed miR-574-3p increase in sera from HCC and liver cirrhosis patients [70].

5

At 14 weeks from injection and in the presence of tumor, miR-205-5p was significantly downregulated and miR-214 and miR-574-3p were upregulated.

The miRNA pattern of expression remained similar to previous experiments with increased levels of mir-214, miR-335-5p, and miR-574-3p in the diseased state.

Both miR-335-5p and miR-574-3p have been reported to be important in bone and cartilage development and differentiation through the regulation of the Wnt pathway and SOX9 expression, respectively 21, 22.

Three of the four miRNAs (miR-205-5p-5p, miR-214, and miR-335-5p) were validated in an independent set of diseased and wild-type mice to be statistically significant (P < 0.05) using a two-sample, two-tailed Student’s t-test comparing the 2 [−ΔCq] values of the two groups MicroRNA-574-3p was not statistically significant in final statistical analysis, but was included in simultaneous studies based on preliminary results (P =  0.15) (Fig. 1).

The levels of miR-205-5p, miR-574-3p, and miR-214 were significant from baseline at the time of tumor development (14 week time point).

Areas under the curve (AUCs) were 0.70 (95% CI 0.576–0.827), 0.80 (95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively.

As shown in Figure 5A, the areas under the curves (AUCs) were 0.70 (95% CI 0.576–0.827), 0.8 0(95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively.

The ΔCq cut-points were 8.34 for miR-205-5p, 10.31 for miR-214, 9.78 for miR-335-5p and 6.08 for miR-574-3p.

Therefore, we monitored the levels of miR-205-5p, miR-214, miR-335-5p, and miR-574-3p prior to and serially after transplantation of OS cells.

Finally, miR-574-3p has recently been reported to play an important role in maintaining mesenchymal stem cell multipotency, which is of interest for OS, as it is thought that the mesenchymal stem cell is the cell of origin in OS 22.

Four miRNAs (miR-205-5p-5p, miR-214, miR-335-5p, and miR-574-3p) were chosen as candidate miRNAs based on reports in published literature, the presence of a conserved known human homologue, and the fold change in the global qPCR analysis.

While our study is the first report of plasma miR-205-5p, miR-214, miR-335-5p, and miR-574-3p to be used as biomarkers, the literature supports that each of these miRNAs may have an important biologic function in OS.

6

Specifically, two miRNAs (miR-18a-5p and miR-574-3p) were upregulated in the Mn [2+] -induced NPA mo del, while let-7e-5p was downregulated and miR-205-5p was upregulated in the chlorpromazine -induced NPA mo del.

In the lupus-like disease produced by Mn [2+] -induced NPA, miR-18a-5p and miR-574-3p exhibited increased expression.

The remaining six deregulated miRNAs: let-7e-5p, miR-18a-5p, miR-23b-3p, miR-205-5p, miR-207, and miR-574-3p, which are specific to each of our murine lupus-like mo dels, highlight some differences between them, but also show roles on inflammation and immune disease.

7

The expression of CCNB1 (cyclin B1) that activates CDK1 driving G2/M-phase progression [67], of CDCA8 (borealin) that is required for the proper segregation of chromosomes during mitosis [68] and of NUSAP1 that is selectively expressed in proliferative cells and is a positive regulator of mitosis by acting on microtubules organization [69] were significantly inversely correlated to mmu-miR-574-5p expression.

Primers were designed for several miRNAs undergoing regulation at, at least, two time-points (such as mmu-miR-146b, -29c…) and for miRNAs selected on the basis of their abundancy (such as mmu-let-7b, mmu-miR-21, -145…), the magnitude of the observed regulations (such as mmu-miR-574-5p, -672…) and the potential significance of their mRNA targets (see below).

Transient transfection analysis for luciferase reporter expression with Arid4b, Il-6 or Lpin2 3′UTR in the presence of miR-223; with Gmnn, Nola2 or Ube2c 3′UTR in the presence of miR-483; with Dera or Nusap1 3′UTR in the presence of miR-574-5p; with Cd3g or Phb2 3′UTR in the presence of miR-672; and with Fst, Ctse or Cdca8 3′UTR in the presence of miR-690.

These correlations reinforce the hypothesis that cell proliferation predominates at the early stages of asthma development rather than in the late stage and might probably partly be under miRNA control, especially through mmu-miR-574-5p regulation.

8

Three of those four (not miR-574-3p) validated miRs had mRNA targets that were also differentially expressed and Table 7 presents the morphine-responsive miRs along with their corresponding mRNA targets.

Fig 4 illustrates the dose -dependent effects of morphine on array expression (panel A) and RT-PCR expression (panel B) of miR-204-5p, miR-448-5p, miR-455-3p, and miR-574-3p.

The following TaqMan RT-PCR assays from Life Technologies were used to assess expression of mmu-miR-455, mmu-miR-574-3p, mmu-miR-448-5p, mmu-miR-45c-5p, mmu-miR-34c-3p, mmu-miR-204, mmu-miR-1839-3p, mmu-miR-153, mmu-miR-1983, mmu-miR-214 in mouse: 002455 (mmu-miR-455), 002349 (mmu-miR-574-3p), 464921_mat (mmu-miR-448-5p), 000428 (mmu-miR-45c-5p), 001197 (mmu-miR-204), 002584 (mmu-miR-34c*), 121203_mat (mmu-miR-1839-3p), 001191 (mmu-miR-153), 121204_mat (mmu-miR-1983), 002306 (mmu-miR-214) and 001973 (U6 snRNA).

RT-PCR analysis was performed for miR-448, miR-34c, miR-34c*, miR-204, miR-1839-3p, miR-153, miR-1983, miR-214, miR-455, miR-574-3p.

miR array profiling identified ten specific miRs that were altered (>1.5 fold, p < 0.05) by morphine (miR-204, miR-448, miR-455, miR-574, miR-34c, miR-34c*, miR-1839, miR-153, miR-1983 and miR-214) and RT-PCR analysis was performed for those ten miRs.

9

To validate the data of the miRNA array, we conducted real-time quantitative reverse transcriptional polymerase chain reaction (qRT-PCR) for the expression of six upregulated miRNAs (mmu-miR-574-5p, mmu-miR-466i, mmu-miR-342-3p, mmu-let-7i, mmu-miR-34a and mmu-miR-188-5p) and five downregulated miRNAs (mmu-miR-378a-3p, mmu-miR-202, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p) in liver tissues from the CCl [4] group (n = 5) and the control group (n = 4).

Among these 12 miRNAs, seven miRNAs, including mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p and mmu-miR-5119, were upregulated, whereas five miRNAs, including mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p, were downregulated in CCl [4] compared to the control group (Table 1).

10

Modulation of pulmonary miRNAs targeting p53 (miR-138 and miR-376c) and apoptosis (miR-98 and miR-350) is consistent with the notion that AMPK is involved in the p53 -mediated cell cycle arrest and apoptosis 2. Several miRNAs upregulated in the lung of metformin -treated mice, including miR-30b, miR-138, miR-239a, miR-342, and miR-574, are involved in stress response and inflammation and target NF κB or Tlr9 (Toll-like receptor).

In addition, metformin modulated the expression of a number of miRNAs (let-7f, miR-30b, miR-362, miR-376c, miR-466h, miR-490, and miR-574) involved in the regulation of the cell cycle, which is a crucial mechanism in the AMPK -mediated activity of this drug 42.

01 Stress response, cell proliferation miR-542 ↓2.60 NA miR-574 ↑2.09 Inflammation (Tlr9 activation), cell proliferation, apoptosis miR-669j ↑3.12 NA miR-672 ↑2.40 NA miR-674 ↑2.19 NA miR-744 ↑4.35Oncogene (Tgf) suppression miR-873 ↑2.53 ↑3.22 NA miR-1930 ↑3.31 NA miR-1934 ↑2.17 ↑3.27 NA miR-1942 ↑2.49 NA miR-3064 ↑2.50 NA miR-3065 ↑3.20 NA miR-3069 ↑2.98 NA miR-3071 ↑3.51 NA miR-3073 ↓2.78 NA miR-3092 ↑3.48 NA miR-3093 ↑3.28 NA miR-3109 ↓2.07 NAAll reported variations were statistically significant (P < 0.05).

11

Significant levels of miR-574-5p are expressed in lung, heart, and liver tissue [31], and radiation/LPS could also be stimulating the releases of extracellular vesicles from those organs, contributing to the observed increase in plasma levels on day 1. miR-146a is another molecule that exhibited significant plasma response after radiation as well as LPS treatment.

It is interesting to note that miR-574-5p expression levels were significantly changed in both LPS and WBI samples.

Based on this analysis, hsa-miR-574-5p and hsa-miR-150-5p show significant dose response to WBI.

Moreover, multiple GU repeats present in the miR-574-5p sequence makes it a stronger agonist for TLR7/8 signaling [44].

For example, the relative abundance of miR-574-5p significantly increases with dose on day 1 (p-value < 0.005), but does not show significant changes in abundance at day 3 or 7. On the other hand, miR-150-5p shows a dose -dependent decrease in abundance in all days, with strong decreases occurring in day 3 and 7 (Fig 3A).

Circulating miR-574-5p could also be of viral origin, and the kinetics and response indicate possible nucleic acid -mediated activation of toll-like receptor signaling [43].

Another major outcome from the current study is the discovery of miR-574-5p as a novel early response biomarker, with clear dose response detectable at 24 h. A similar increase in circulating miR-574-5p abundance was observed in NHPs exposed to bacterial endotoxin LPS as well, suggesting that the plasma response here was associated with acute inflammatory response as a cause or effect.

These sequences, miR-1-5p, miR-146a-5p, miR-150-5p, miR-206, miR-342-3p, miR-574-5p, and miR-1283, had time- and dose-specific changes in abundance (Fig 6A).

One-way ANOVA of the dose response of each sequence on each day suggests that miR-150-5p and miR-574-5p are sensitive to radiation (Fig 6A).

LPS treatment caused significant increase in abundance of miR-146a-5p, miR-574-5p and decreased abundance of miR-1-3p, miR-133a-3p, miR-206, and miR-365a-3p/365b-3p.

12

miR-302 has also been reported to suppress p63 expression in germ cells [48], while iASPP protein inhibits the expression of miR-574-3p and miR-720, which in turn inhibits p63 expression [49, 50].

13

In the context of these diseases, miR-574-3p could be detected in the serum but also in cerebrospinal fluid, with a down-regulation in cerebrospinal fluid of affected patients [43].

Interestingly, of these miRNAs, miR-574-3p is highly expressed in myeloid cells and can be isolated from blood plasma [30] but is not present in previously published miRNA libraries specifically prepared from Purkinje neurons [31].

With regard to specific functions of individual miRNAs, interestingly miRNA-574-3p that we detect only in recombined Purkinje neurons as well as in exosomes from peripheral blood regulates and in turn is regulated by TAR DNA -binding protein 43 (TDP-43) [42], [43].

14

miR-19 has been reported to be downregulated by CsA in vitro[18] while miR-574 has been reported to be downregulated with acute rejection in human [19].

Two microRNAs—miR-19 and miR-574 have been reported to be related to CsA immunosuppression effect.

15

In contrast, the expressions of some miRNAs were significantly inhibited by RDX exposure; the miRNAs with at least 4-fold inhibition were miR-574-5p, miR-466f-3p, and let-7e.

The fold change miRNA expression ranged from 14-fold down (miR-10b) to 26.5-fold up (miR-206) in the brain, compared with only 10-fold down (miR-574-5p) to 6.5-fold up (miR-689) in the liver (Tables 1 and 2).

16

Of the 186 miRNAs the expression of which was altered, nine were up-regulated at both time points (miR-125a-3p, miR-297c, miR-421, miR-452, miR-483, miR-574-3p, miR-574-5p, miR-669a, miR-720) and 11 were down-regulated at both time points (let-7g, miR-107, miR-10a, miR-15a, miR-15b, miR-199b*, miR-26a, miR-29c, miR-324-5p, miR-331-3p, miR-342-3p).

17

For example, during SARS coronavirus infection process, miR-17 [∗], mir-574-5p, and miR-214, were up-regulated, and miR-98 and miR-223 were down regulated.

Among these miRNAs, miR-17 [∗], mir-574-5p inhibited the replication of SARS coronavirus, whereas miR-214 contribute to immune escape of the bronchial alveolar stem cells (BASC) (Mallick et al., 2009).

18

Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42].

19

For example, BH3 interacting domain death agonist, or Bid, a member of the Bcl-2 family of cell death regulators and a mediator of mitochondrial pathway induced caspase-8, is a predicted target of miR-574-3p and miR-494.

miRNAs that were differentially expressed only in the LW during aging include miR-29c, miR-705, miR-99a, miR-127, miR-130a, miR-145, miR-151-5p, miR-379, miR-467a, and miR-574-3p.

20

We also found that genistein down-regulates the RAC1 and EP300 genes that are important regulators of VEGF -mediated angiogenesis [23], [24] and the EGFR gene by up -regulating miR-574-3p [25].

21

1 regulates CD44 as a molecular decoy for miR211-3p 26974151 miR-32-3p −54 Acts a a tumor suppressor in NSCLC 26229485 miR-3082-5p −55 Unknown miR-3960 −56 miR-3960 regulated cellular growth and proliferation through a regulatory feedback loop with miR-2861, respnse to oxidative stress 21324897, 26539117 miR-466i-5p −49 Unknown miR-468-3p −57 Unknown miR-574-5p −53 Oncogene in various cancer types, incl.

22

Seven miRNAs (mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p and mmu-miR-5119) were upregulated and the other five (mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p) were downregulated in the CCl [4] group compared with the control (Fig. 1a,b).

23

Zhou et al. [25] demonstrated that high serum expression of miR-574-5p was an independent predictor of poor prognosis in patients with SCLC.

Zhou R MicroRNA-574-5p promotes metastasis of non-small cell lung cancer by targeting PTPRUSci.

24

We found that 86.11% (31 of 36) of the relative real-time RT-PCR results were consistent with those obtained in the microRNA microarray analysis in terms of direction of regulation at one or more time points except the results of miR-574-3p in BJ501-infected lung on 2 dpi, miR-1 in PR8-infected lung on 2 dpi, miR-1 in BJ501-infected lung on 5 dpi, miR-133a in PR8-infected lung on 2 dpi and miR-133b in PR8-infected lung on 2 dpi (Figure 5).

Nine microRNAs (miR-1, miR-1187, miR-133a, miR-133b, miR-155, miR-2137, miR-223, miR-30d and miR-574-3p) were selected for validation.

25

Furthermore, in this study, eight miRNAs (mmu-miR-711, mmu-miR-712, mmu-miR-713, mmu-miR-714, mmu-miR-715, mmu-miR-716, mmu-miR-717, and mmu-miR-574) were upregulated in DIO mice.

26

Eight of the significantly modulated miRNAs, miR-106b, miR-199a-3p, miR-214, miR-218, miR-31, miR-434-3p, miR-671-3p, and miR-574-3p were predicted to significantly modulate several nervous system function and disease related pathways.

27

miRNA Fold change at 3 dpi Fold change at 5 dpi mmu-miR-466h-3p NS (Not significant) 14.311053 mmu-miR-346-5p NS 3.4766614 mmu-miR-877-3p NS 3.416667 mmu-miR-7a-5p NS 2.1413074 mmu-miR-5107-5p NS −2.047792 mmu-miR-3473a −2.2872427 −2.1317267 mmu-miR-150-5p NS −2.1770155 mmu-miR-3473b −3.2475147 −2.282881 mmu-miR-721 NS −2.6864858 mmu-miR-669b-5p NS −2.9408455 mmu-miR-709 NS −3.0065749 mmu-miR-669n NS −3.0094464 mmu-miR-468-3p NS −3.40051 mmu-miR-466m-5p NS −4.33538 mmu-miR-32-3p NS −4.5324426 mmu-miR-466h-5p NS −4.9673104 mmu-miR-3082-5p NS −6.01648 mmu-miR-466i-5p NS −7.6776285 mmu-miR-1187 NS −8.772696 mmu-miR-574-5p NS −9.259378 To confirm the validity of the differentially expressed miRNAs that had been identified by microarray analysis, we performed real-time PCR on all 20 of these miRNAs using the polyA tailing technique.

28

miRNA p-value Fold-Change miR-146a 1.15E-09 −4.82 miR-31 9.66E-08 −4.95 miR-155 1.97E-07 −3.82 miR-2134 2.13E-07 −2.05 miR-711 1.63E-06 −4.10 miR-3473 1.95E-06 −5.62 miR-574-3p 3.32E-06 −2.55 miR-1195 6.59E-06 2.26 miR-27a* 6.89E-06 14.92 miR-27b* 7.35E-06 2.92 miR-34c 1.80E-05 −3.43 miR-1931 3.34E-05 −2.30 miR-874 4.07E-05 −2.01 miR-196b 7.99E-05 2.59 miR-181a-1* 8.02E-05 4.15 miR-187 8.11E-05 2. 02List of miRs whose expression is altered, identified from microarray analysis by comparison of levels in TM [+] and TM [−] DCs which change >2 fold with p<0.0001.

29

Additionally, prior studies from various mo dels of retinal degeneration identified over 300 differentially expressed miRNAs 63– 90, a total of 16 common miRNAs were identified (miR-1187, miR-125b-5p, miR-331-3p, miR466d-3p, miR-467f, miR-542-3p, miR-574-5p, miR654-3p, miR669h-3p, miR-882, miR-342-3p, miR-466a-5p, miR-466d-5p, miR-706, miR-345-3p, miR532-5p).

30

Among these 17 dynamically regulated miRNAs, the top 5 with the greatest fold change were miR-126 (23-fold), miR-34c (17-fold), miR-130a (12-fold), miR-574 (9-fold) and miR-193b (8-fold).

31

Three of the newly identified editing sites show higher editing levels in the absence of ADAR2 (miR-542-3p, position 16; let-7e, position 19; and miR-574-5p, position 17), showing that these miRNAs are preferentially edited by ADAR1 (Table 4).

32

Here, 15 miRNAs (miR-let-7e*, miR-15a*, miR-19b-1*, miR-30e*, miR-130b*, miR-149, miR-296-5p, miR-362-5p, miR-378, miR-425, miR-432, miR-484, miR-574-3p, miR-671-5p, and miR-1249) established interactions with 19 mRNAs.

33

miR-1254 and miR-574-5p Serum-Based microRNA Biomarkers for Early-Stage Non-small Cell Lung Cancer.

34

Two orthologous miRNAs (bta-miR-574-3p and -652) were detected more than two times and in at least two different tissues but were not mapped to the bovine genome (ucsc_btau4) (Additional file 3).

35

Moreover, drug-resistant breast cancer cells may spread resistance to sensitive cells by releasing exosomes containing specific miRNAs (miR-4443, miR-574-3p, and others) [30].

36

380265down−1.051992mmu-miR-132_stMIMAT0000144mmu-miR-132-3p5.4555526.673903down−1.218351mmu-miR-466f_stMIMAT0005844mmu-miR-466f5.6427886.931221down−1.288433mmu-miR-182_stMIMAT0000211mmu-miR-182-5p4.4080605.698591down−1.290531mmu-miR-466f-5p_stMIMAT0004881mmu-miR-466f-5p5.7116187.241209down−1.529591mmu-miR-466j_stMIMAT0005848mmu-miR-466j5.6098547.204075down−1.594221mmu-miR-15a-star_stMIMAT0004624mmu-miR-15a-3p4.4562016.089243down−1.633042mmu-miR-31_stMIMAT0000538mmu-miR-31-5p4.8992046.755762down−1.856558mmu-miR-574-5p_stMIMAT0004893mmu-miR-574-5p5.8948177.919928down−2.025111mmu-miR-1187_stMIMAT0005837mmu-miR-11875.8475687.887634down−2.040066mmu-miR-16-star_stMIMAT0004625mmu-miR-16-1-3p5.5245158.019949down−2.495434mmu-miR-15b_stMIMAT0000124mmu-miR-15b-5p6.

37

For example, Fan et al. [24] reported the ability of PTCSC3 to bind hsa-miR-574-5p as ceRNA.

38

The expression of mature miRNAs was assayed using TaqMan MicroRNA Assays (Applied Biosystems, Foster City, CA) specific for hsa-miR-486 (ID 001278), hsa/mmu-miR-21a (ID 000397), hsa-miR-455 (ID 001280), hsa-miR-151-3p (ID 002254), mmu-miR-1a (ID 002222), mmu-miR-133b (ID 002247), mmu-miR-5128 (ID 462199_mat), mmu-miR-223 (ID 002295), mmu-miR-146b (ID 001097), mmu-miR-133a (ID 001637), mmu-miR-449a (ID 001030), mmu-miR-122 (ID 002245), mmu-miR-351-3p (ID 464446_mat), mmu-miR-193a-5p (ID 002577), mmu-miR-151-3p (ID 001190), mmu-miR-574-3p (ID 002349), mmu-miR-3107/486 (ID 001278).