sort by

106 publications mentioning hsa-mir-675 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-675. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 558
Hep3B cells were transfected with pMirTarget-control, pMirTarget-HP1α3′UTR, pMirTarget-mutant HP1α3′UTR, pMirTarget-HP1β3′UTR, pMirTarget-mutant HP1β3′UTR, pMirTarget-HP1γ3′UTR, pMirTarget-mutant HP1γ3′UTR, pCMV-miR, pCMV-miR675, pCMV-mutant miR675 respectively. [score:15]
For examples, miR-675 modulates human gastric cancer cell proliferation by targeting tumor suppressor Runt Domain Transcription Factor1 (RUNX1) [50];miR-675 was found to be upregulated in human colorectal cancer (CRC) tissues and the tumor suppressor retinoblastoma (RB) was confirmed to be a direct target of miR-675 [51]. [score:13]
The effect of H19 in gastric cancer is mediated by the direct upregulation of ISM1 and the indirect suppression of CALN1 expression via miR-675 [30]. [score:10]
To this data, we report that the upregulated expression level of miR675, H19, HP1α, EGR1, PKM2, H-Ras were consistent in liver cancer patients and miR-675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer cells. [score:9]
To address whether miR675 targets for HP1α, β, γ and influences on their expression, we first performs the informatics analysis using MirTarget scanning soft (predicts biological targets of miRNAs by searching for the presence of conserved 8mer and 7mer sites that match the seed region of each miRNA) and BLAST analysis. [score:9]
Firstly, miR675 inhibits the HP1 isoforms expression and activates EGR1; Secondary, miR675 triggers EGR1 occupancy on H19 promoter region and enhances H19 transcription positively; Thirds, miR675 controls PKM2 polymer formation dependent on H19 upregulation. [score:8]
H19 regulates glioma development by deriving miR-675 which modulated Cadherin 13 expression by directly targeting the binding site within the 3′ UTR [5]. [score:8]
Collectively, these observations strongly suggest that miR675 promotes H19 expression through upregulating and activating EGR1 by targeting for HP1 isoforms. [score:8]
At the first time, our results showed that the expression level of miR675, H19, HP1α, EGR1, PKM2, H-Ras were consistent in 10 cases of liver cancer patients and their upregulated expression rate added up to 100% (liver cancer tissue vs paracancerous liver tissue) (Figure 7A). [score:8]
In addition, our results showed that H19 promoter activity and H19 expression were highly enhanced in cells coexpressing with miR-675 and EGR1 expression when compared with cells expressing EGR1. [score:8]
Nevertheless, the HP1γ3′UTR luciferase activity was significantly not altered in Hep3B cell lines transfected with pCMV- mutant miR675 plus pMirtarget-HP1γ3′UTR, pMirtarget-mutant HP1γ3′UTR or pCMV- miR675 plus pMirtarget-mutant HP1γ3′UTR (P > 0.05). [score:7]
Nevertheless, the HP1β3′UTR luciferase activity was significantly not altered in Hep3B cell lines transfected with pCMV- mutant miR675 plus pMirtarget-HP1β3′UTR, pMirtarget-mutant HP1β3′UTR or pCMV- miR675 plus pMirtarget-mutant HP1β3′UTR (P > 0.05). [score:7]
For examples, miR675 was significantly downregulated in the metastatic prostate cancer cell and directly bound with 3′UTR of transforming growth factor β induced protein (TGFBI, an extracellular matrix protein involved in cancer metastasis) mRNA to repress its translation [7]. [score:7]
Nevertheless, the HP1α3′UTR luciferase activity was significantly not altered in Hep3B cell lines transfected with pCMV-mutant miR675 plus pMirtarget-HP1α3′UTR, pMirtarget-mutant HP1α3′UTR or pCMV-miR675 plus pMirtarget-mutant HP1α3′UTR (P > 0.05). [score:7]
Collectively, our findings suggest miR675 targets for HP1 isoforms including HP1α, HP1β, HP1γ and inhibits their expression in liver cancer cells. [score:7]
As shown in Figure 3A, mature miR675 can match 3′ untranslational region on HP1α mRNA (BC006821) via eleven seed sequence (a); mature miR675 can match 3′ untranslational region on HP1β mRNA (BC002609) via nine seed sequence (b);mature miR675 can match 3′ untranslational region on HP1γ mRNA (AB030905) via ten seed sequence (c). [score:7]
Our data suggest that miR675 reduced the HP1α expression on the transcriptional level through targeting for HP1α 3′ untranslational region. [score:7]
This assertion is based on several observations: (1) miR675 upregulates H19, in turn, H19 increased the M2 isoform of pyruvate kinase (PKM2) expression and the formation of the PKM2 monomer, PKM2 dimer, PKM2 tetramer, PKM2 hexamer. [score:6]
Taken together, miR675 upregulates H19 that accelerates hepatocarcinogenesis through activating PKM2 to alter oncogenes expression and function positively. [score:6]
miR675 upregulates H19 expression by increasing the EGR1 occupancy on H19 imprinting control region (ICR). [score:6]
Our present findings open the possibility that targeting miR675 might prove to be an alternative therapeutic strategy, e. g. Baculovirus -mediated miRNA regulation to suppress hepatocellular carcinoma tumorigenicity and metastasis [67]. [score:6]
miR675 was shown to up-regulate the essential cartilage matrix component COL2A1, and overexpression of miR-675 rescued COL2A1 levels in H19- or SOX9 -depleted cells [3]. [score:6]
In conclusion, we first proved that miR675 exerts its effect in part through the upregulation of H19 and PKM2 expression. [score:6]
On the other hand, we also proposed a key role for the miR-675 in upregulation of H19 that may induce and activate PKM2, in turn, responsible for changes in gene expression relevant in hepatocarcinogenesis (e. g. C-myc, Pim1, Ras, CyclinD1, RB1). [score:6]
Mature miR675 overexpression promoted and miR675 knockdown inhibited HepG2 proliferation (P < 0.01) (Figure 1Cb), colony formation ability (75.63±11.74% versus 36.93 ±4.5%;15.46±4.35% versus 40.2±10.63%, respectively, P < 0.01) (Figure 1Cc), Brdu position rate (83.33± 9.22% versus 41.0±10.35%;22.21±3.90% versus 48.03±7.24%, respectively, P < 0.01) (Figure 1Cd). [score:6]
a. Mir675 targets for human HP1 α 3′UTR ; b. Mir675 targets for huamn HP1 β 3′UTR;c. Mir675 targets for HP1 γ 3′UTR. [score:6]
The involvement of miR675 promotion of liver cancer cell growth is supported by results from four parallel sets of experiments: (1) The upregulated expression level of miR675, H19, HP1α, EGR1, PKM2, H-Ras were consistent in liver cancer patients ; miR675 promotes the liver cancer cells malignant proliferation in vitro and accelerates liver cancer growth in vivo. [score:6]
Overexpression of the miR-675 in hepatocellular carcinoma links a dramatic upregulation of proliferative and growth capacity [52]. [score:6]
We confirmed mature miR675 expression using real-time RT-PCR and the results showed that mature miR675 was significantly overexpressed in pCMV6-miR675 transfected Hep3B compared with control (P < 0.01) and the expression of 3# clone is slight higher compared to 6# (Figure 1A a, right, 3#&6#), while mature miR675 was significantly knocked down in pGFP-V-miR675 transfected Hep3B compared the control (P < 0.01) ((Figure 1Ba, left). [score:5]
miR675 inhibits HP1 isoforms (HP1α, HP1β, HP1γ) expression. [score:5]
Moreover, our findings showed that mature miR675 overexpression reduced the expression of Cadherin 13, RUNX1 and RB1 in Hep3B cell lines (Figure 3E). [score:5]
miR675 inhibits HP1 α, HP1 β, HP1 γ expression in human liver cancer cells. [score:5]
pCI-H19, pMirTarget-HP1α, β, γ3′UTR, pMirTarget-mutant HP1α, β, γ3′UTR, pCMV-mutant miR675, pGFP-V-RS-mir675, pGFP-V-RS-H19, pGFP-V-RS-PKM2, pGL3-EGR1, pGL3-H-Ras, pGL3-CyclinD1, pGL3-Pim1, pGL3-RB was constructed by ourselves. [score:5]
C. a. Co-Immunoprecipitation (IP) with anti-SUZ12 followed by western blotting with anti-EZH2, anti-HP1α in miR675 overexpressied, miR675 plus HP1α overexpressed and control Hep3B. [score:5]
Obviously, this is due to a reduction of HP1 expression in miR675 overexpressed Hep3B. [score:5]
B. a. Co-Immunoprecipitation (IP) wih anti-H3k27Ac followed by western blotting with anti-SUV39H1 in miR675 overexpressied, miR675 plus HP1α overexpressed and control Hep3B. [score:5]
H19 gene could inhibit human trophoblast cell proliferation via encoding miR675 that targeted NOMO1 and interferes with Nodal signaling [8]. [score:5]
miR675 upregulates lincRNA H19. [score:4]
The xenograft tumor showed that tumor tissue possessed more poor-differentiation cells in mature mir675 overexpression group than that of control group, and less poor-differentiation cells in mir675 knockdown group than that of control group (Figure 2Cd upper). [score:4]
miR675 upregulates H19 through EGR1 activation. [score:4]
C. a. Real-time RT-PCR for mature miR675 in miR675 overexpressed or knocked-down HepG2 stable cell lines;U6 as internal control ;Data are means of value from three independent experiment, bar±SEM. [score:4]
HP1α expression was significantly reduced in Hep3B cell line transfected with pCMV-miR675 and significantly overexpressed in Hep3B cell line transfected with pCMV-miR675 plus pcDNA3.1-HP1α compared to control (Figure 4Db, the first row from upper to lower). [score:4]
On the contrast, mature miR675 knockdown inhibited Hep3B proliferation (the 2 [nd] day & the 3 [rd] day, P < 0.01) (Figure 1Bb). [score:4]
We selected the GFP positive cell for screening miR675 overexpression or knockdown stable cell lines (Figure 1A a, left and Figure 1B a, right ). [score:4]
As shown in Figure 3C, HP1α, HP1β, HP1γ expression were significantly decreased in mature miR675 overexpressed Hep3B cells compared to control group (pCMV-miR). [score:4]
The tumor formation ability in miR675 overexpressed group is significant higher than in control group (50% vs 0%, n = 6, P = 0.00617) (Figure 2Ab, right), On the other hand, xenograft tumor was not produced in either mature miR675 knocked-down or RNAi control group. [score:4]
In this report, we demonstrate miR675 is involved in the epigenetic regulation of H3K9me3, H3K27me3, H3K27Ac for gene expression during hepatocarcinogenesis. [score:4]
for each Balb/C mouse, miR675 overexpressed Hep3B cells were injected into right lower armpit area, miR control Hep3B cells were injected into left lower armpit area, miR675 knocked-down Hep3B cells were injected into right upper armpit area, RNAi control Hep3B cells were injected into left upper armpit area. [score:4]
Strikingly, it promoted the EGR1 occupancy on H19 imprinting control region (ICR) which ultimately enhances H19 expression, suggesting that HP1 isoforms HP1α acts as the hub of miR675 epigenetic regulation function. [score:4]
b. Chromatin Immunoprecipitation (CHIP) with anti-H3K9me3, anti-H3K27me3, anti-H3K27Ac and anti-HP1α followed by real-time PCR with EGR1 promoter primers in miR675 overexpressied, miR675 pluc HP1α overexpressed and control Hep3B. [score:4]
E. a. Chromatin Immunoprecipitation (CHIP) with anti-H3K9me3, anti-H3K27me3, anti-H3K27Ac and anti-HP1α followed by PCR with EGR1 promoter primers in miR675 overexpressied, miR675 pluc HP1α overexpressed and control Hep3B. [score:4]
For screening miR675 overexpression or knockdown Hep3B or HepG2 stable cell lines, these cells were plated in the selective medium containing 2500 μg/ml G418 (Invitrogen) or 1μg/ml Puromycin (Calbiochem) in forty-eight hours after transfection. [score:4]
The schematic illustrates a mo del that miR675 is involved in the epigenetic regulation of H3K9me3, H3K27me3 for gene expression in tumorigenesis. [score:4]
miR675 induces EGR1 expression through reducing HP1α. [score:3]
Given that pre-miR675 is embedded in H19's first exon, we should consider whether ectopic overexpressed H19 can produce mature miR675. [score:3]
miR675 overexpression promotes liver cancer cell growth in vitro and in vivo. [score:3]
Mechanistically, miR675 decreases the heterochromatin protein HP1α, HP1β, HP1γ expression in human liver cancer cells which causes a marginal decrease of the total histone H3 lysine 9 trimethylation (H3K9me3) and total histone H3 lysine 27 trimethylation (H3K27me3) and a increase of total histone H3 lysine 27 acetylation (H3K27Ac). [score:3]
As shown in Figure 1Ab, mature miR675 overexpression promoted Hep3B proliferation (the 2 [nd] day & the 3 [rd] day, P < 0.01). [score:3]
In this report, we identify heterochromatin protein 1 isoforms are valid targets of miR675 in liver cancer. [score:3]
Next, we constructed the luciferase report vector consisting of HP1α/β/γ 3′UTR containing miR675 targeting site and their corresponding mutant plasmid of HP1α/β/γ 3′UTR, and pCMV-miR mutant miR675. [score:3]
H19 expression was decreased in stable Hep3B cell lines transfected with pCMV-miR675 plus pGFP-V-RS-H19 and increased in stable HepG2 cell line pCI-H19 plus pGFP-V-RS-PKM2 (Figure 7B). [score:3]
Overexpression of miR-675 in a range of embryonic and extra-embryonic cell lines results in their reduced proliferation [2]. [score:3]
The tumor formation ability in miR675 overexpressed group is significant higher than in control group (83.3% vs 16.7%, n = 6, P = 0.0374) Figure 2Bb, right). [score:3]
The Hep3B stable cell lines with altered expression of mature miR675 were injected subcutaneously into Balb/C nude mice. [score:3]
Our present findings clearly demonstrate that miR675 overexpression promotes and silencing miR675 attenuated liver cancer cell growth in vitro and in vivo. [score:3]
Pathological picture (hematoxylin-eosin staining) of three xenograft tumors from mature miR675 overexpressed group showed these tissue possessed poor-differentiation cells (5# & 6# xenograft tumors) or less moderately cancer cells (4# xenograft tumors) (Figure 2Ac), and stronger Proliferating cell nuclear antigen (PCNA) positive staining in 6# xenograft (Figure 2Ad). [score:3]
miR675 overexpression promotes and silencing miR675 attenuated liver cancer cell growth in vitro and in vivo. [score:3]
To explore whether mature miR675 alters EGR1 expression, we consider to reveal whether mature miR675 impacts on the Histone 3 modification in liver cancer cells. [score:3]
We observed that miR675 increased PKM2 expression and its activity through H19. [score:3]
To explore whether miR675 alters long noncoding RNA H19 expression through EGR1 action, we have a reason to consider whether EGR1 may control H19 transcriptional activity. [score:3]
A. a. Co-Immunoprecipitation (IP) with anti-SUV39h1 followed by western blotting with anti-HP1α or anti-Histone3 in miR675 overexpressied and control Hep3B. [score:3]
miR675, a miRNA, embedded in H19's first exon, is expressed exclusively in the placenta. [score:3]
Figure 4 A. a. Co-Immunoprecipitation (IP) with anti-SUV39h1 followed by western blotting with anti-HP1α or anti-Histone3 in miR675 overexpressied and control Hep3B. [score:3]
As shown in Figure 2A (a, b), when mature miR675 was overexpressed, the xenograft tumor were produced in three mice (0.1gram, 0.2gram, 0.5gram, respectively), while there was no xenograft tumor in control group (0.2667±0.2081 gram vs 0 gram, n = 3, P = 0.045376) (Figure 2Ab, left). [score:3]
Figure 8miR675 overexpression promotes and silencing miR675 attenuated liver cancer cell growth in vitro and in vivo. [score:3]
As shown in Figure 2B (a, b), when mature miR675 was overexpressed, the xenograft tumors were produced in five mice (2.6gram, 0.8gram, 0.1gram, 0.1gram, 0.1gram respectively), while there was one xenograft tumor in control group (1.4gram) (0.28±0.62 gram vs 0.74±1.08 gram, n = 5, P ≈ 0.05) (Figure 2Bb, left). [score:3]
HP1α, HP1β, HP1γ expression were significantly increased in miR675 knockdown Hep3B cells compared to control group (pGFP-V-RS) (Figure 3D). [score:3]
Cadherin 11 in fibroblasts and keratinocytes is a target of miR-675, and could be involved in melanogenesis through the induction of N-cadherin during epithelial-mesenchymal transition [4]. [score:3]
pCMV-miR, pCMV-miR675 (MI0005416), pGFP-V-RS, pCMV-AC-GFP, pCMV6-entry-EGR1, pGFP-V-RS-EGR1, pMitTarget were purchased from Origene (Rockville, MD, USA) and pcDNA3.1, pcDNA3.1-HA--HP1α, pcDNA3.1-HA--HP1β, pcDNA3.1-HA--HP1γ, pBS-H19, pGL3-C-myc, were purchased from Addgene (Cambridge MA, USA). [score:3]
What are the recruitment factors, partners of miR675 during genes regulation and control? [score:2]
Significantly, both EGR1 expression and SUM-EGR1 were significantly decreased in Hep3B cell line transfected with pGFP-V-RS-miR675 compared to control. [score:2]
As shown in Figure 2Ca, when mature miR675 was overexpressed, the xenograft tumor weight increased approximately three folds when compared to the corresponding control group (2.195±0.265 grams versus 0.725±0.148 grams, P = 0.000018). [score:2]
HP1α expression was significantly increased in Hep3B cell line transfected with pGFP-V-RS-miR675 compared to control (Figure 4Dd, the first row from upper to lower). [score:2]
Conversely, the percentage of PCNA positive cells was significantly lower in miR675 knockdown tumors (12.08±3.74% versus 36.05±7.69%, P = 0.000704) (Figure 2Cd middle and 2Ce). [score:2]
On the other hand, when mir675 was knocked down, the average xenograft tumor weight decreased to approximately one tenth of the control weight (0.083±0.036 grams versus 0.802±0.108 grams, P = 0.0000047) (Figure 2Cb). [score:2]
However both EGR1 expression and SUM-EGR1 were slightly decreased in Hep3B cell line transfected with pCMV-miR675 plus pcDNA3.1-HP1α compared to control. [score:2]
b. Co-Immunoprecipitation (IP) with anti-SUV39h1 followed by western blotting with anti-HP1α or anti-Histone3 in miR675 knockdown and control Hep3B. [score:2]
Our results showed that mature miR675 was significantly overexpressed in pCMV-miR675 transfected HepG2 compared to control (P < 0.01), while mature miR675 was significantly knocked down in pGFP-V-RS-miR675 transfected HepG2 compared to the control (P < 0.01) (Figure 1Ca). [score:2]
As shown in Figure 3B, the HP1α3′UTR luciferase activity was significantly reduced in mature miR675 overexpressed Hep3B cells compared to control group (p < 0.01) and increased in mature miR675 knocked down Hep3B cells compared to control group (p < 0.01). [score:2]
Moreover, the H19 mRNA expression was significantly drcreased in Hep3B cells transfected with pGFP-V-RS-miR675 compared to pGFP-V-RS control (Figure 5Gb). [score:2]
b. Co-Immunoprecipitation (IP) wih anti-H3k27Ac followed by western blotting with anti-SUV39H1 in miR675 knockdown control Hep3B. [score:2]
As shown in Figure 4Ba, the interplay between SUV39H1 and H3K27Ac, H3K27Ac and HP1α were weakened in mature miR675 overexpressed Hep3B compared to control group. [score:2]
The PCNA -positive cells was significantly higher in miR675 overexpressed tumors compared to the vector control (67.42±15.37% versus 33.33±7.47%, P = 0.0023). [score:2]
PKM2 expression was decreased in stable HepG2 cell lines transfected with pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-PKM2, pCI-H19 plus pGFP-V-RS-PKM2 compared to pCMV-miR control. [score:2]
On the other hand, xenograft tumor was not produced in either mature miR675 knocked-down or control group. [score:2]
As showed in Figure 4G, both EGR1 expression and SUM-EGR1 were significantly increased in Hep3B cell line transfected with pCMV-miR675 compared to control. [score:2]
The HP1γ3′UTR luciferase activity was significantly reduced in mature miR675 overexpressed Hep3B cells compared to control group (p < 0.01) and increased in mature miR675 knocked down Hep3B cells compared to control group (p < 0.01). [score:2]
To date, accumulating evidence indicates that miR675 plays a critical role in cancer development and miR675 possess a strong carcinogen properties. [score:2]
Our results showed that the interplay between SUV39H1 and HP1α, SUV39H1 and Histone3 was attenuated in mature miR675 overexpressed Hep3B compared to control group (Figure 4Aa) and that the interplay between SUV39H1 and HP1α, SUV39H1 and Histone3 was increased in mature miR675 knockdown Hep3B compared to control group (Figure 4Ab). [score:2]
As shown in Figure 5Ga, the H19 mRNA expression was significantly increased in Hep3B cells transfected with pCMV-miR675 and pCMV-miR675 plus pCMV6-entry-EGR1 compared to control. [score:2]
How miR675 regulates PKM2 polymer formation and drives the PKM2 from cytoplasmic yo nuclear? [score:2]
Pathological picture (hematoxylin-eosin staining) of xenograft tumors from mature miR675 overexpressed group showed these tissue possessed poor-differentiation cells (1#, 2#, 4# xenograft tumors) or less moderately cancer cells (3# & 5# xenograft tumors), and pathological picture of xenograft tumor from control group showed these tissue possessed well-differentiation cells (control 1# xenograft tumor) (Figure 2Bc), and stronger Proliferating cell nuclear antigen (PCNA) positive staining in 2# miR675 xenograft tumor compared to 2# control xenograft tumor (Figure 2Bd). [score:2]
The colony-formation rate was significantly increased in mature miR675 overexpressed Hep3B compared to control Hep3B (37.63±2.18% vs 9.93±1.03%, P < 0.01) (Figure 1Ab). [score:2]
The Ki67 -positive cells was significantly higher in miR675 overexpressed tumors compared to the vector control (46.07±12.4% versus 23.58±4.99%, P = 0.003784). [score:2]
Taken together, these observations suggest that mature miR675 reduced the complex output of HP1α-SUV39H1-Histone3, HP1α-SUV39H1-H3K27Ac, HP1α-SUZ12-EZH2 which caused the reduction of H3K9me3, H3K27me3 and increment of H3K27Ac, and increased EGR1 turnout through transcriptional regulation ultimately. [score:2]
B. a. (Left)Real-time RT-PCR for mature miR675 in miR675 knocked down or mock control Hep3B stable cell lines ;U6 as internal control; Data are means of value from three independent experiment, bar±SEM. [score:2]
In addition, the interplay between EZH2 and SUZ12, SUZ12 and HP1α were attenuated in mature miR675 overexpressed Hep3B compared to control group. [score:2]
In Hep3B cells, mature miR675 was significantly overexpressed in Hep3B cell lines transfected with pCMV-miR675 or pCMV-miR675 plus pcDNA3.1-HP1α compared to control (Figure 4Da). [score:2]
Mature miR675 overexpression resulted in early xenograft tumor formation compared to the control group (5.55±1.08 days versus 8.38±0.92 days, P = 0.0050966). [score:2]
b. Co-Immunoprecipitation (IP) wih anti-SUZ12 followed by western blotting with anti-EZH2, anti-HP1α in miR675 knockdown and control Hep3B. [score:2]
Conversely, the percentage of Ki67 positive cells was significantly lower in miR675 knockdown tumors (10.11±3.51% versus 22.56±5.49%, P = 0.000959) (Figure 2Cd lower and 2Cf). [score:2]
The HP1β 3′UTR luciferase activity was significantly reduced in mature miR675 overexpressed Hep3B cells compared to control group (p < 0.01) and increased in mature miR675 knocked down Hep3B cells compared to control group (p < 0.01). [score:2]
Herein, our results showed that miR675 promotes hepatocarcinogenesis and progress through miR675-HP1α-EGR1-H19-PKM2 cascade signaling pathway. [score:1]
miR675 oncogenic action depends on PKM2 activity. [score:1]
A. a. real-time RT-PCR analysis for mature miR675 in Hep3B transfected with pCI-control, pCI-H19. [score:1]
Together, these observations suggest PKM2 determines the miR675 oncogenic action partly, at least in the human liver cancer cells. [score:1]
e. with anti-PKM2 in Hep3B cells transfected with pGFP-V-RS, pGFP-V-RS-miR675 respectively. [score:1]
b. with anti-HP1α, anti-H3K9me3, anti-H3K27me3, anti-pHistone3, H3K27Ac, anti-H3K4me3 in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3-HP1α respectively. [score:1]
At the first time, we performed the Co-immunoprecipitation (Co-IP) to analyse the interaction between SUV39h1 and HP1α, SUV39h1 and Histone3, SUV39H1 and H3K27Ac, EZH2 and SUZ12 in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α. [score:1]
H3K27Ac, pHistone3 and H3K4me3 were significantly increased in Hep3B cell line transfected with pCMV-miR675. [score:1]
It is evident that activation of PKM2 may play an important role in miR675 oncogenic action in liver cancer. [score:1]
However, others resports also showed the different functions of miR675. [score:1]
It follows that H19 is a manipulator for miR675′s oncogenic activity. [score:1]
What is the clinic significance of miR675? [score:1]
In view of this reason, we infer that miR675 and H19 may lead to PKM2 phosphorylation alternation, making PKM2 produce multimers. [score:1]
A. a. (left) The photography of the Hep3B cell lines transfected with pCMV-mir or pCMV-miR675. [score:1]
We presented three miR675 novel mechanisms. [score:1]
It is suggest that miR675 and H19 tumorigenic action may require PKM2 participation. [score:1]
K. analysis for PKM2 and its polymer in Hep3B transfected with pGFP-V-RS, pGFP-V-RS-miR675, pGFP-V-RS-H19, pGFP-V-RS-EGR1, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-EGR1. [score:1]
To our knowledge, this is the first report demonstrating miR675 plays a positive role in liver carcinogenesis through the cascade of miR675-HP1α-EGR1-H19-PKM2 signaling. [score:1]
The interplay between EZH2 and SUZ12, SUZ12 and HP1α were increased in mature miR675 knockdown Hep3B compared to control group (Figure 4Cb). [score:1]
b. RT-PCR analysis for H19 in Hep3B transfected with pGFP-V-RS, pGFP-V-RS--miR675 respectively. [score:1]
According to the aforementioned findings and reports, it is thus clear that miR675 has a strong carcinogenic ability. [score:1]
In contrast, the plate colony-formation rate was significantly decreased in mature miR675 knocked down Hep3B compared to control Hep3B (16.3±4.26% vs 8.63±0.38%, P < 0.01) (Figure 1Bc). [score:1]
Given that miR675 activates PKM2 through H19 in liver cancer cell, we should consider whether. [score:1]
b. real-time RT-PCR analysis for mature miR675 in HepG2 transfected with pCI-control, pCI-H19, pGFP-V-RS, pGFP-V-RS-H19. [score:1]
c. with anti-PKM2 in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3-HP1α respectively. [score:1]
Obviously, this is a new linkage of miR-675-HP1α-ERG1-H19-PKM2 in human liver cancer. [score:1]
Our findings in this study provide novel evidence for an active role of PKM2 in miR675 -mediated promotion of liver cancer cell growth. [score:1]
Although miR675 ‘s oncogenic function was due to decrease the HP1 isoforms and increase H19, PKM2 in liver cancer cells, we further confirm how miR675-HP1-EGR1-H19-PKM2 axis might be played an important role in hepatocarcinogenesis and progression. [score:1]
A. The representative analytic results of in situ hybridization for H19 and miR675, and immunohistochemistry staining for PKM2, HP1α, EGR1 in formalin-fixed, paraffin-embedded human liver cancer tissue (indicated with yellow Dotted circles) and their paired adjacent noncancerous tissues (indicated with Dotted red circles) from the same patient (DAB stainning, original magnification×100). [score:1]
D. analysis using anti-HP1 α, anti-HP1β, anti-HP1γ in Hep3B cell lines transfected with pGFP-V-RS, pGFP-V-RS-miR675, respectively. [score:1]
G. a. RT-PCR analysis for H19 in Hep3B transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1HP1α, pCMV-miR675 plus pcDNA3.1HP1αβγ, pCMV-miR675 plus pGFP-V-RS- EGR1, pCMV-miR plus pCMV6-entry-EGR1, pCMV-miR675 plus pCMV6-entry-EGR1 respectively. [score:1]
C. analysis using anti-HP1 α, anti-HP1β, anti-HP1γ in Hep3B cell lines transfected with pCMV-miR, pCMV-miR675, pGFP-V-RS-miR675, respectively. [score:1]
L. analysis for H-Ras, C-Myc, CyclinD1 in Hep3B transfected with pCMV-mir, pCMV-miR675, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-PKM2, pCI-H19 plus pGFP-V-RS-PKM2. [score:1]
In particular, we also proved miR675 altered the epigenetic modifications on histone through HP1α reduction. [score:1]
Both H3K9me3 and H3K27me3 were significantly decreased in Hep3B cell line transfected with pCMV-miR675. [score:1]
B. DNA pulldown with Biotin-EGR1 followed by with anti-EGR1in Hep3B transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α. [score:1]
Obviously, once PKM2 activity was lost, the tumorigenesis ability of miR675 was caused. [score:1]
To address whether the miR675 alters primary liver cancer cells malignant proliferation capacity, we first established the stable human liver cancer cell lines (Hep3B) transfected with pCMV-miR, pCMV-miR675, pGFP-V-RS, pGFP-V-RS-miR675 respectively. [score:1]
PKM2 determines the miR675 and H19 oncogenic action partly, at least in liver cancer. [score:1]
The interplay between SUV39H1 and H3K27Ac, H3K27Ac and HP1α were enhanced in mature miR675 knockdown Hep3B compared to control group (Figure 4Bb). [score:1]
It is worth mentioning that miR675 play an important role in the occurrence of hepatocellular carcinoma. [score:1]
However, the exact roles of mature miR-675 in hepatocarcinogenesis have not been identified. [score:1]
On the basis of these mechanisms, miR675 exerts a tumorigenic functions through miR675-HP1α-EGR1-H19-PKM2 cascade signaling pathway in liver cancer. [score:1]
Figure 1 A. a. (left) The photography of the Hep3B cell lines transfected with pCMV-mir or pCMV-miR675. [score:1]
d. anti-PCNA immunostainning in xenograft tumor sample (pCMV-miR 2# and pCMV-miR675 2#). [score:1]
miR675 accelerates liver cancer cells growth in vivo. [score:1]
In this report, we focused mainly on the view that miR675 promotes human hepatocarcinogenesis by activating PKM2 dependent on the reduction of HP1 isoforms and the increase of H19. [score:1]
Evidently, miR675 is crucial for cell growth and viability in liver cancer cells. [score:1]
As shown in Figure 5C, the loading of EGR1 on the H19 promoter region was increased in Hep3B cell line transfected with pCMV-miR675. [score:1]
H. with anti-EGR1 and CO-IP with anti-SUM (EGR1 IB) in Hep3B cells transfected with pGFP-V-RS, pGFP-V-RS-miR675, pGFP-V-RS- HP1α respectively. [score:1]
B. for PKM2 and RT-PCR analysis for H19 in HepG2 cell lines transfected with pCMV-miR, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-PKM2, pCCI-H19 plus pGFP-V-RS-PKM2. [score:1]
miR675 promotes liver cancer cells proliferation. [score:1]
d. with anti-HP1α, anti-H3K9me3, anti-H3K27me3, anti-pHistone3, H3K27Ac, anti-H3K4me3 in Hep3B cells transfected with pGFP-V-RS, pGFP-V-RS-miR675 respectively. [score:1]
In this report, we focused mainly on the view that miR675 promotes human hepatocarcinogenesis by activating H19 dependent on reduction of HP1 isoforms. [score:1]
E. a. The photography of xenograft tumors from Balb/C nude mice injected with HepG2 cells transfected with pCMV-mir, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-PKM2, pCI-H19 plus pGFP-V-RS-PKM2 subcutaneously at armpit. [score:1]
miR675 oncogenic function depends on activity of PKM2. [score:1]
Taken together, these observations demonstrate that miR675 accelerates liver cancer growth in vivo. [score:1]
It is worth paying attention that we confirm that deciphering the molecular basis of miR675 in hepatocarcinogenesis is very important for us to apply miR675 in clinic diagnosis and therapy later. [score:1]
In addition, H19 maintain hematopoietic stem cell repopulating ability through a miR-675-IGFR signaling circuit [6]. [score:1]
A a. The photography of xenograft tumors from Balb/C null mouse injected with Hep3B cells transfected with pCMV-miR or pCMV-miR675 subcutaneously at armpit. [score:1]
B. a. The photography of xenograft tumors from Balb/C null mouse injected with Hep3B cells transfected with pCMV-miR or pCMV-miR675 subcutaneously at armpit. [score:1]
These findings sheds light on the significance of miR675-HP1α-EGR1-H19-PKM2 cascade signaling pathway in cancer cells. [score:1]
Figure 7 A. The representative analytic results of in situ hybridization for H19 and miR675, and immunohistochemistry staining for PKM2, HP1α, EGR1 in formalin-fixed, paraffin-embedded human liver cancer tissue (indicated with yellow Dotted circles) and their paired adjacent noncancerous tissues (indicated with Dotted red circles) from the same patient (DAB stainning, original magnification×100). [score:1]
C. a. The photography of xenograft tumors from Balb/C null mouse injected with HepG2 cells transfected with pCMV-miR, pCMV-miR675, pGFP-V-RS or pGFP-V-RS-miR675subcutaneously at armpit. [score:1]
To identify whether miR675 oncogenic activity was caused by H19, we further determine the H19 function in liver cancer cells. [score:1]
miR675 promotes liver cancer cells malignant proliferation. [score:1]
It suggest EGR1 and miR-675 may function on H19 promoter in different pathways. [score:1]
Intriguingly, miR675 helps in discriminating adrenocortical carcinomas (ACCs) from adrenocortical adenomas (ACAs) [9]. [score:1]
These findings are noteworthy that H19 decides in miR675 oncogenic action through mediating various biological processes including cell proliferation, differentiation. [score:1]
It means that H19 may not act as a miR675 precursor. [score:1]
Figure 6 A. a. real-time RT-PCR analysis for mature miR675 in Hep3B transfected with pCI-control, pCI-H19. [score:1]
miR675 accelerates liver cancer cells growth in vivoGiven that the, we further consider to identity the effect of miR675 on hepatocarcinogenesis in vivo. [score:1]
G. RNA Immunoprecipitation (RIP) with anti-PKM2 followed by RT-PCR with H19 mRNA in Hep3B transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α. [score:1]
miR675 accelerates hepatocarcinogenesis via miR675-HP1α-EGR1-H19-PKM2 axis. [score:1]
That is to say that PKM2 determines the carcinogenic effect of miR675 and H19. [score:1]
Although increment of H19 may partly contribute to miR675 medicated promotion of liver cancer cell growth, our findings in this study provide novel evidence for an active role of H19 in miR675 -mediated promotion of liver cancer cell growth. [score:1]
This assertion is based on several observations: (1) miR675 enhanced the H19 transcription although ectopic H19 may not produce the mature miR675. [score:1]
As shown in Figure 4E (a, b), the loading of H3Kme9, H3K27me3, HP1α on the EGR1 promoter region were attenuated in Hep3B cell line transfected with pCMV-miR675. [score:1]
However, we have fully not understood the accuracy mechanism of miR675, such as, how miR675 controls HP1 isoforms dynamics change ? [score:1]
Given that the, we further consider to identity the effect of miR675 on hepatocarcinogenesis in vivo. [score:1]
miR675 enhances EGR1 via reducing HP1 α in human liver cancer cells. [score:1]
Our present approaches provided an unequirocal evidence for critical oncogenic roles of the miR675 in hepaocarcinoma and supported the notion that miR675 may be an alternative bona fide promoting factor of hepatocarcinoma. [score:1]
Collectively, these results suggest that miR675 promotes the liver cancer cells malignant proliferation. [score:1]
In contrast, the time of xenograft tumor appearance was prolonged in the mir675 knockdown group compared to the control group (15.91±2.92 days versus 8.58±1.31 days, P = 0.001512) (Figure 2Cc). [score:1]
Figure 2miR675 accelerates liver cancer cell growth in vivo A a. The photography of xenograft tumors from Balb/C null mouse injected with Hep3B cells transfected with pCMV-miR or pCMV-miR675 subcutaneously at armpit. [score:1]
Strikingly, mono PKM2 (58KD), PKM2 dimer (116KD) and PKM2 tertamer (232KD) were significantly increased in Hep3B cell line transfected with pCMV-miR675. [score:1]
D. analysis using anti-Cadherin 13, anti-RUNX1, anti-RB1 in Hep3B cell lines transfected with pCMV-miR, pCMV-miR675, respectively. [score:1]
D. a. Real-time RT-PCR for mature miR675 in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α respectively. [score:1]
On the other hand, It also suggest EGR1 can enhance miR675 function that triggers H19 transcription. [score:1]
Strikingly, we confirm how miR675-HP1α-EGR1-H19-PKM2 cascade might be played an important role in hepatocarcinogenesis. [score:1]
It is very clear that H19 is connection of miR675-PKM2 axis that may contribute to hepatocarcinogenesis. [score:1]
We infer miR675 may alter early growth response protein1 (EGR1) expersion epigenetically. [score:1]
miR675 accelerates liver cancer cell growth in vivo. [score:1]
G. with anti-EGR1 and CO-IP with anti-SUM (EGR1 IB) in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3-HP1α respectively. [score:1]
[1 to 20 of 206 sentences]
2
[+] score: 536
Down-regulation or up-regulation of miR-675-5p would increase or decrease REPS2 expression which inhibited or promoted RalBP1′s GTPase-activating activity, resulting in suppressing or facilitating RAC1/CDC42 signaling pathway. [score:13]
Figure 5(A, B) The up-regulated REPS2 mRNA and protein in miR-675-5p -inhibition EC9706 cells was significantly down-regulated after transfection with si-REPS2, which mimicked the effect of miR-675-5p up-regulation. [score:12]
Moreover, knockdown of REPS2 expression in miR-675-5p -inhibition EC9706 cells by si-REPS2 (Figure 6A, right, lane 1) abrogated the effects induced by miR-675-5p down-regulation (Figure 6A, left, lane 1), which was similar to the effect of miR-675-5p up-regulation in EC9706 cells (Figure 6A, right, lane 3). [score:12]
In order to investigate whether miR-675-5p exhibit its oncogenic role via regulating RalBP1/RAC1/CDC42 pathway by targeting REPS2 in ESCC, we examined the expression of downstream target genes in REPS2 signaling pathway and found that the expression of RalBP1, RAC1, CDC42, MMP9, MMP2 and CyclinD1 were decreased in ESCC cells that stably down-regulated miR-675-5p. [score:11]
Given that miR-675-5p was up-regulated in ESCC tissues and cell lines, we speculated that down-regulation of miR-675-5p might suppress the malignant phenotypes of ESCC cells. [score:9]
Figure 6(A) In EC9706 and EC109 cells with miR-675-5p down-regulation, the protein levels of RalBP1, RAC1, CDC42, MMP9, MMP2 and Cyclin D1 were significantly decreased compared with the negative control (namely cells transfected with LV-miR-675-5p-NC), whereas these decreased proteins in miR-675-5p -inhibition EC9706 cells were significantly increased when treated with si-REPS2 compared to the negative control (namely miR-675-5p -inhibition+si-NC), which resembled the effect of miR-675-5p up-regulation in EC9706 cells. [score:9]
Inversely, interference of REPS2 in miR-675-5p -inhibition EC9706 cells abrogated the effects induced by miR-675-5p down-regulation, which was similar to the function of miR-675-5p overexpression in EC9706 cells. [score:8]
Figure 2Inhibition of miR-675-5p induced cell G1 arrest, reduced proliferation, colony formation, vitro migration and invasion of ESCC cells(A) The level of miR-675-5p in EC9706 and EC109 cells was significantly down-regulated after transfection with LV-miR-675-5p -inhibition. [score:8]
The miR-675-5p -inhibition EC9706 cells group transfected with si-REPS2 (named miR-675-5p -inhibition+si-REPS2) or the miR-675-5p-precursor group displayed lower expression of REPS2 mRNA and protein compared to the negative control group (named miR-675-5p -inhibition+si-NC or negative control, respectively) (Figure 5A and 5B). [score:8]
According to the qRT-PCR data, the expression of miR-675-5p was classified into high expression (n = 44) and low expression (n = 16). [score:7]
Similarly, ESCC patients with high miR-675-5p expression had shorter disease-free survival (median survival time, 19 versus more than 60 months, P < 0.001) than those with low miR-675-5p expression (Figure 1G). [score:7]
A Spearman correlation test was used for analyzing the correlations between miR-675-5p expression level and the target gene REPS2 expression level. [score:7]
Down-regulation of REPS2 by REPS2 interference dramatically reduced cell G1 arrest and induced cell proliferation, colony formation, migration and invasion, which mimicked the effect of miR-675-5p up-regulation. [score:7]
However, other researchers argue that the H19 is a developmental reservoir of miR-675 that suppresses growth and Igf1r [23], meanwhile down-regulation of miR-675 is found in the group of adrenocortical carcinoma [24]. [score:7]
Furthermore, western blotting analysis showed that REPS2 protein expression was greatly up-regulated in EC9706 and EC109 cells after LV-miR-675-5p -inhibition transfection compared with the negative control (Figure 4C). [score:7]
As noted in our manuscript, knockdown of miR-675-5p in ESCC cells induced cell G1 arrest, down-regulated CyclinD1 which was correlated with G1-S phase transition and inhibited REPS2/RalBP1/RAC1/CDC42 signaling pathway, which might be responsible for the effect of miR-675-5p on proliferation of ESCC cells. [score:7]
The data showed that down-regulation of miR-675-5p suppressed the proliferation of EC9706 and EC109 cells (Figure 2B). [score:6]
To explore the possible mechanism underlying the inhibitory effect on cell growth by down-regulation of miR-675-5p, cell cycle analysis was performed. [score:6]
Results showed that the overall average expression level of miR-675-5p was markedly up-regulated (3.63 times) in tumor tissues than in adjacent normal tissues (Figure 1A). [score:6]
To investigate whether miR-675-5p exerts its oncogenic function by targeting REPS2, we examined whether knockdown of REPS2 expression by REPS2 interference could recover the oncogenic effects of miR-675-5p in miR-675-5p -inhibition EC9706 cells. [score:6]
Interference of REPS2 RNA in miR-675-5p -inhibition EC9706 cells mimicked the oncogenic function of miR-675-5p up-regulation in EC9706 cells. [score:6]
In this study, we found that miR-675-5p was overexpressed in ESCC tissues and cell lines compared to normal esophageal tissue and normal human HEEpic cell line and its expression was correlated with clinicopathological variables including lymph node metastasis, TNM stage, overall and disease-free survival of ESCC. [score:6]
miR-675-5p expression inversely correlated with the expression of REPS2 in ESCC. [score:5]
Expression of RalBP1, RAC1, CDC42 MMP9, MMP2 and CyclinD1 were decreased in miR-675-5p -inhibition EC9706 and EC109 cells (Figure 6A, left and middle, lane 1). [score:5]
Figure 3Inhibition of miR-675-5p inhibited vivo tumorigenicity and tumor metastasis of ESCC cells(A) Representative picture of ESCC subcutaneous implantation mo dels (left), HE staining of the tumor (middle), tumor volumes and tumor growth curves (right) of each group are shown. [score:5]
The data showed that down-regulation of miR-675-5p inhibited cell cycle by inducing G1 arrest and decreased the percentages of EC9706 and EC109 cells in S phase compared to the negative control (Figure 2C and 2D). [score:5]
Compared to negative control group, the protein expression of these genes were not obviously decreased in EC9706 and EC109 cells with stably down-regulated miR-675-5p (Supplementary Figure S1A). [score:5]
We checked the expression of H19 in miR-675-5p -inhibition EC9706 and EC109 cells and negative control cells by qRT-PCR analysis. [score:5]
For analysis of disease-free survival time, N2 classification (P = 0.04), TNM stage (P = 0.013) and miR-675-5p expression (P < 0.001) reached significance in the multivariate survival analysis Cox proportional hazards regression mo del (Table 2). [score:5]
Based on bioluminescence imaging, down-regulation of miR-675-5p inhibited tumorigenic ability compared with those in negative control cells injected mice (Figure 3B, upper left and lower left). [score:5]
As one of the mature miRNAs of miR-675 in a classic Drosha and Dicer splicing dependent manner [16], miR-675-5p down-regulation was demonstrated to promote non-small cell lung carcinoma progression and development [26]. [score:5]
These results confirmed that overexpressed miR-675-5p repressesed endogenous REPS2 expression. [score:5]
Inhibition of miR-675-5p inhibited vivo tumorigenicity and tumor metastasis of ESCC cells. [score:5]
Overexpression of miR-675 also represents a potential new target for cartilage repair in osteoarthritis [21, 22]. [score:5]
Comparative analysis of paired ESCC tissues with paired normal esophageal tissues further revealed that high miR-675-5p expression (more than 2-fold [i. e., log2 (fold change) > 1]) was observed in 73.3% cases (44/60), suggesting that overexpression of miR-675-5p was a frequent event in human ESCC (Figure 1A). [score:5]
In short, our results indicated that decreased expression of miR-675-5p inhibited ESCC cell tumorigenicity and tumor metastasis in vivo. [score:5]
And interestingly, miR-675-5p expression was significantly correlated with lymph node metastasis, TNM stage, overall survival and disease-free survival of ESCC. [score:5]
qRT-PCR was used to detect the expression of miR-675-5p and the expression of primary transcript of REPS2. [score:5]
Furthermore, ESCC patients with high miR-675-5p expression had much shorter overall survival time (median survival time, 24.5 versus more than 60 months, P < 0.001) than those with low miR-675-5p expression (Figure 1F). [score:5]
Knockdown of REPS2 significantly induced proliferation (C), reduced cell G1 arrest (D), promoted colony formation (E), migration and invasion (F) in miR-675-5p -inhibition EC9706 cells, which was similar to the function of up -regulating miR-675-5p in EC9706 cells. [score:5]
The pMIR-REPS2-Mut vector was built with REPS2 that had undergone site-directed mutagenesis of the miR-675-5p target site using the Stratagene Quik-Change site-directed mutagenesis kit (Stratagene, Germany). [score:5]
, China) to generate pGCsil-GFP-miR-675-5p -inhibition (named LV-miR-675-5p -inhibition after virus packaging and production). [score:5]
To confirm whether REPS2 was a direct target of miR-675-5p, a dual-luciferase reporter system was used, employing cotransfection of miR-675-5p and a luciferase reporter plasmid containing the 3′UTR of human REPS2. [score:4]
miR-675-5p mediated the promotion of the RalBP1/RAC1/CDC42 signaling pathway by regulating REPS2 and inversely correlated with the expression of REPS2. [score:4]
Our above study had demonstrated that EC9706 cells transfected with LV-miR-675-5p -inhibition displayed higher expression of REPS2 mRNA and protein and exhibited lower cell proliferation, colony formation, migration and invasion potential when compared with the negative control (Figure 2B–2H, Figure 4C, 4D). [score:4]
These data indicated that miR-675-5p promoted RalBP1/RAC1/CDC42 signaling by inhibiting REPS2 in ESCC, which was involved in tumor development and progression. [score:4]
miR-675-5p was up-regulated in ESCC tissues and cell lines, positively correlated with H19 and associated with ESCC poor prognosis. [score:4]
REPS2 was a direct downstream target of miR-675-5p. [score:4]
Secondly, down-regulation of miR-675-5p significantly increased REPS2 mRNA and protein levels in ESCC cells. [score:4]
In the present study, we firstly found that miR-675-5pwas constantly up-regulated in ESCC tissues and cell lines. [score:4]
Down-regulation of miR-675-5p induced cell G1 arrest, reduced cell proliferation, colony formation, migration, invasion, tumorigenicity and tumor metastasis. [score:4]
More importantly, knockdown of REPS2 gene could mimic the oncogenic effect of overexpressed miR-675-5p. [score:4]
These data indicated that REPS2 was a direct target of miR-675-5p. [score:4]
And we also observed the effect of REPS2 inhibition by up -regulating miR-675-5p (named miR-675-5p-precursor). [score:4]
These data suggested that REPS2 expression was negatively regulated by miR-675-5p. [score:4]
We further demonstrated that REPS2 (also known as POB1) was a direct target of miR-675-5p. [score:4]
miR-675–5p was frequently up-regulated in ESCC, positively correlated with H19 and was a promising prognostic predictor for ESCC. [score:4]
The identification of miR-675-5p and its target genes REPS2 in ESCC would help in a better understanding of the molecular mechanisms underlying ESCC development, which would provide us a wider perspective on ESCC intervention/prevention and treatment. [score:4]
Hence, the initial results indicated that miR-675-5p was up-regulated in ESCC, suggesting that miR-675-5p might contribute to ESCC pathogenesis. [score:4]
As shown in Figure 2A, both in EC109 and EC9706 cells, miR-675-5p was significantly inhibited in miR-675 -inhibition group compared with negative control and blank control group (cells without any treatment); however, no significant difference was found between negative control and blank control group. [score:4]
REPS2 was a direct target gene of miR-675-5p. [score:4]
miR-675-5p acted as an oncogenic miRNA in EC9706 cells by down -regulating REPS2 expression. [score:4]
Interestingly, the miR-675-5p -inhibition+si-REPS2 EC9706 cells exhibited higher cell proliferation, colony formation, migration and invasion potential and lower cell G1 arrest when compared with the miR-675-5p -inhibition+si-NC EC9706 cells, which resembled the miR-675-5p-precursor EC9706 cells (Figure 5C, 5D, 5E, 5F). [score:4]
In conclusion, miR-675-5p was up-regulated in ESCC. [score:4]
To explore whether miR-675-5p exerts its functions through the REPS2/RalBP1/RAC1/CDC42 signaling pathways that contribute to cancer proliferation, development and progression [27– 29, 31], we examined a number of the main REPS2 signaling downstream target genes, including RalBP1 which possessed GAPase activity, RAC1 and CDC42 with GTPase activity, MMP9 and MMP2 which were demonstrated to be associated with tumor dissemination and metastasis and Cyclin D1 correlated with G1-S phase transition. [score:4]
The sequence of hsa-miR-675-5p -inhibition was constructed as follows: (Forward) 5′-TGGTGCGGAGAGG GCCCACAGTG-3′, (Reverse) 5′-CACTGTGGGCCCTC TCCGCACCA-3′. [score:3]
The expression of miR-675-5p was quantitatively analyzed by qRT-PCR in 60 pairs of primary ESCC and corresponding adjacent normal esophageal tissues. [score:3]
miR-675-5p promoted the RalBP1/RAC1/CDC42 signaling pathway by inhibiting REPS2. [score:3]
As above study, REPS2 was identified as a target of miR-675-5p. [score:3]
Furthermore, we have provided the following series of evidence that miR-675-5p induced ESCC cell G1-S transition and promoted tumor growth, proliferation, migration, tumor metastasis and tumorigenicity in part by suppressing REPS2. [score:3]
In addition, qRT-PCR analysis showed that REPS2 mRNA apparently increased after LV-miR-675-5p -inhibition transfection in EC9706 and EC109 cell lines (Figure 4D). [score:3]
microRNA-675 (miR-675) is overexpressed in many human cancers [5– 10], however the function of miR-675-5p is largely unknown in ESCC. [score:3]
Inhibition of miR-675-5p induced cell G1 arrest, reduced proliferation, colony formation, vitro migration and invasion of ESCC cells. [score:3]
Similarly, colony formation assays showed that cell proliferation in both EC9706 and EC109 cells was significantly repressed by down-regulation of miR-675-5p (Figure 2E, 2F). [score:3]
It has been found that miR-675 is up-regulated in human colon cancer [17], serous endometrial tumors and endometrial carcinosarcomas [18], pancreatic cancer [19] and in blood cells of lung cancer patients compared to blood cells of COPD patients [20]. [score:3]
Furthermore, we found that H19 was overexpressed in ESCC tissues and positively correlated with miR-675-5p, which corresponded with other reseachers’ studies [16, 17]. [score:3]
To further explore the role of miR-675-5p on tumorigenicity and tumor metastasis in vivo, miR-675-5p -inhibition EC9706 cells and negative control cells were inoculated into the left upper flank region of nude mice or into the tail veins of nude mice. [score:3]
Moreover, the miR-675-5p expression in advanced TNM stage (III) was higher than in early TNM stage (stage I or stage II) (Figure 1B). [score:3]
The overexpression of miR-675 has been found in human colorectal cancer, pancreatic cancer, serous endometrial tumors and endometrial carcinosarcomas [17– 19]. [score:3]
Thirdly, overexpression of miR-675-5p decreased the luciferase reporter activity of wild-type 3′-UTR but not mutant 3′-UTR of REPS2. [score:3]
In the present study we explored the expression of REPS2 mRNA and miR-675-5p by qRT-PCR analysis. [score:3]
For the other set (named set B) which was classified into 2 groups (n = 5 for each) intravenous injection was performed with 1 × 10 [6] of miR-675-5p -inhibition EC9706 cells or negative control cells, respectively. [score:3]
miR-675-5p appeared to be a promising prognostic predictor and a potential therapeutic target in ESCC. [score:3]
Data analysis showed that miR-675-5p high expression correlated with N Classification (P = 0.014) and TNM stage (P = 0.048) in ESCC (Table 1). [score:3]
The results confirmed that miR-675-5p inhibition induced ESCC cells G1 arrest, and reduced ESCC cells proliferation, colony formation, migration and invasion in vitro, tumorigenicity and tumor metastasis in vivo. [score:3]
The miR-675-5p -inhibition EC9706 cells at 50 to 60% confluency were transfected with 100 nmol/liter siRNA-REPS2 or their corresponding negative control cells by Lipofectamine 2000 in Opti-Mem (Invitrogen, USA). [score:3]
However, Matouk et al. find that there is a positive feedback loop between H19 and Slug mediated by miR-675 which controls E-cadherin expression [54]. [score:3]
Consequently, we selected miR-675 -inhibition group and negative control group for the further analysis. [score:3]
On multivariate survival analysis, N classification (P = 0.042), TNM stage (P = 0.012) and miR-675-5p expression (P < 0.001) reached significance for overall survival (Table 2). [score:3]
The miR-675-5p expression in lymph node metastases (+) (n = 25) ESCC tissues was significantly higher than in lymph node metastases (−) (n = 35) ESCC tissues (Figure 1C). [score:3]
In contrast, few metastatic tumors were detected in mice injected with miR-675-5p -inhibition EC9706 cells (Figure 3B, upper left and lower right). [score:3]
Our results verified that H19 was highly expressed in ESCC tissues and positively correlated with miR-675-5p (r = 0.754, P < 0.001, Figure 1E). [score:3]
Figure 1(A) Expression of miR-675-5p in 60 pairs of ESCC tissues and the adjacent normal esophageal tissues. [score:3]
In current studies, in order to investigate the potential impact of miR-675-5p on proliferation, apoptosis, colony formation, migration, invasion, tumorigenicity and tumor metastasis of ESCC cells, we transfected EC109 and EC9706 cells which had high basal levels of miR-675-5p in ESCC cell lines with LV-miR-675-5p -inhibition (named miR-675-5p -inhibition EC109 or EC9706 cells) or LV-miR-675-5p-NC (named negative control cells). [score:3]
The average tumor volume of miR-675-5p -inhibition group was 772.97 ± 149.44 mm [3], which was significantly smaller than tumors in the negative control group (1436.83 ± 261.45 mm [3]) (Figure 3A, right, on 28th day). [score:3]
In the present study, we have demonstrated REPS2 to be target of miR-675-5p in ESCC. [score:3]
The expression of H19 was found no significant difference in these groups (Supplementary Figure 1B), indicating that there was no feedback in ESCC in H19/miR-675/REPS2 pathway. [score:3]
However, miR-675-5p expression was not related to patients’ age, gender, drinking history, tumor differentiation, tumor size and T classification (Table 1). [score:3]
More importantly, from multivariate analysis, we obtained sufficient evidence to infer that miR-675-5p expression level was an independent prognostic indicator for ESCC patients. [score:3]
Correlations between miR-675-5p expression level and clinicopathological variables of 60 cases of ESCC. [score:3]
As shown in Figure 2G and Figure 2H, compared to the negative control, down-regulation of miR-675-5p could effectively repress the migration ability and invasion capacity of EC9706 and EC109 cells, respectively, indicating oncogenic role of miR-675-5p on the migration and invasion of ESCC. [score:3]
The expression of miR-675-5p was confirmed by qRT-PCR. [score:3]
Tsang et al. infer that there might be an inverse loopback between the expressions of RB and H19/miR-675 in human colorectal cancer [17]. [score:3]
In particular, high expression of miR-675-5p was significantly associated with poor prognosis in advanced stage and lymph node metastasis patients with ESCC, respectively. [score:3]
Moreover, the expression of miR-675-5p was the highest in EC9706 cell line (Figure 1D). [score:3]
Recently, it has been demonstrated that miR-675 have several targets in different cancers, such as c-Cbl and Cbl-b in breast cancer [5], GPR55 in lung carcinoma [26], Rb in colorectal cancer [17], CALN1 in gastric cancer [14], Cadherin 11 in melasma [39]. [score:3]
H19 is overexpressed in ESCC tissues, we speculate that miR-675 might be involved in the tumorigenesis and progression of ESCC induced by H19. [score:3]
Altogether, the oncogenic effects of miR-675-5p on ESCC cells growth and metastasis might contribute to poor prognosis of ESCC patients with higher expression of miR-675-5p. [score:3]
One set (named set A) which was classified into 2 groups (n = 5 for each) was subcutaneously inoculated into the left flanks with 1 × 10 [6] miR-675-5p -inhibition EC9706 cells or negative control cells, respectively. [score:3]
In the present study, we also found that miR-675-5p could regulate Cylin D1, which mediates G1-S phase [53]. [score:2]
Whereas there was no significant difference of apoptotic rate between the cells transfected with LV-miR-675-5p -inhibition and control cells (P > 0.05) by Annexin V fluorescein isothiocyanate (V-FITC) apoptotic assay (data not shown). [score:2]
The histological examination of lung tissue indicated that the number of lung metastatic nodules significantly decreased in mice inoculated with miR-675-5p -inhibition EC9706 cells compared to the negative control (Figure 3B, upper right). [score:2]
We also found that miR-675-5p were overexpressed almost three fold in EC9706, Ec109, EC-1 and TE-1 cell lines compared with in HEEpic cell line (Figure 1D). [score:2]
miR-675-5p possesses the potency to promote ESCC growth and metastasis by regulating REPS2. [score:2]
Greater tumors were detected in mice injected with negative control cells compared with those injected with miR-675-5p -inhibition EC9706 cells (Figure 3A, left and right). [score:2]
The bioluminescent change in miR-675-5p -inhibition group was significantly decreased compared with the negative control (namely cells transfected with LV-miR-675-5p-NC) (upper left and lower left). [score:2]
Interestingly, miR-675 is considered to be a disease remission–induced miRNA in patients with eosinophilic esophagitis [25]. [score:2]
miR-675-5p significantly promoted ESCC cell growth in vitro and in vivo. [score:1]
However, no significant variation in luciferase activity was observed for either the REPS2-Mut or the negative control miR-675-5p cotransfection. [score:1]
Each well was transfected with either 100 ng pMIR-REPS2-Wt or 100 ng pMIR-REPS2-Mut vectors together with 30 pmol hsa-miR-675-5p or negative control. [score:1]
miR-675-5p/REPS2/RalBP1/RAC1/CDC42 signaling pathway might be an important mechanism of tumorigenesis of ESCC. [score:1]
In different cancers, miR-675 induces various phenotypes via diverse signaling pathways [5, 6, 26, 39]. [score:1]
Firstly, the miR-675-5p level was inversely correlated with REPS2 level in ESCC tissues. [score:1]
Therefore, miR-675-5p could play an oncogenic role in ESCC. [score:1]
Moreover, H19 has been shown to be the primary miRNA precursor of miR-675 in both human and mice [16]. [score:1]
The sequence was amplified and cloned into the pGCsil-GFP vector to generate pGCsil-GFP-miR-675 (named LV-miR-675-5p-precursor after virus packaging and production) and the pGCsil-GFP vector alone as negative control. [score:1]
Our findings also suggest that miR-675-5p could potentially be used as a biomarker to clinically predict metastasis, recurrence and survival prognosis for patients with ESCC. [score:1]
miRDB predicted that the 3′UTR of REPS2 mRNA contained a complementary site for the seed region of miR-675-5p (Figure 4A). [score:1]
Recently, miR-675 is demonstrated to activate EGF signaling pathway in breast cancer [5]. [score:1]
So we speculated that miR-675-5p/REPS2/RalBP1/RAC1/CDC42 signaling pathway was an important molecular pathogenesis of ESCC. [score:1]
Anyhow, miR-675-5p might serve as a valuable prognosis biomarker for ESCC patients. [score:1]
As shown in Figure 6B, miR-675-5p was negatively correlated with REPS2 mRNA in the ESCC samples (r = −0.670, P < 0.001). [score:1]
The non-silencing control sequences (Forward: 5′-TTCTCCGAACGTGTCACGT-3′, Reverse: 5′-ACGTG ACACGTTCGGAGAA-3′) was cloned into the pGCsil-GFP vector as negative control (named LV-miR-675-5p-NC after virus packaging and production). [score:1]
In order to disclose the molecular mechanism through which miR-675-5p realizes its tumor-stimulative functions, computational prediction using open access websites including miRDB, DIANA-MICROT, MICRORNA. [score:1]
These data supported REPS2 as a downstream mediator of miR-675-5p functioned in ESCC. [score:1]
The number of visible surface metastatic lesions in miR-675-5p group was greatly decreased than in the negative control group (namely cells transfected with LV-miR-675-5p-NC) (lower right) and HE staining of the lung was presented (upper left). [score:1]
Then we investigated the relevance of miR-675-5p expression and clinicopathological features. [score:1]
The hsa-miR-675-precursor sequence was constructed as follows: (Forward) 5′-ACCGGTGGAGGGCGAAGC-3′, (Reverse) 5′-GAATTCAAAAACTCCTGAGAG-3′. [score:1]
[1 to 20 of 138 sentences]
3
[+] score: 516
Other miRNAs from this paper: hsa-mir-31, mmu-mir-31, mmu-mir-675, hsa-mir-3187
Overexpression of miR-675-5p can lead to the down-regulation of GPR55 and its signaling pathway, whereas the effect can be reversed by down-regulation of miR-675-5p expression. [score:11]
The target prediction of miR-675-5p from websites DIANA TOOL Targetscan and miRanda,the GRP55 score is 0.916(from DIANA TOOL, miTG score), -0.64(from Targetscan),-0.4313 and -0.1271(from miRanda, mirSVR score )and other target genes prediction of miR-675-5p score has been included in Additional file 1: Table S2 or refer to DIANA TOOL, Targetscan and miRanda websites. [score:11]
Down-regulation of the expression of GPR55 influences the effects of miR-675 on NSCLC cells To further ascertain whether GPR55 is a functional target of miR-675-5p, we transfected with LV-miR-675-5p inhibitor into Ltep-a-2 NSCLC cells, which have high endogenous miR-675-5p levels (Figure  1D). [score:10]
In contrast, expression of these genes was significantly up-regulated in NSCLC cells that stably expressed miR-675-5p inhibitor. [score:10]
As a low level of miR-675-5p expression in NSCLC is a common molecular incident and is correlated with progression of the disease, we hypothesize that overexpression of miR-675-5p in NSCLC can exert inhibitory effects on cell growth and proliferation. [score:9]
In the present study, we examined the expression of GPR55 signaling downstream target genes and found that expression of p-ERK, cyclin D1, MMP2 and MMP9 were decreased in NSCLC cells that stably overexpressed miR-675-5p. [score:9]
Therefore, down-regulation of the RhoA-MMP2/9 axis through inhibition of GPR55 is one of the important mechanisms underlying miR-675-5p -mediated inhibition of NSCLC invasion and metastasis. [score:8]
In contrast, expression of these genes was significantly up-regulated in Ltep-a-2 cells with stable down-regulation of miR-675-5p (Figure  7, right, lane 2) compared with negative control cell group (Negative control) (Figure  7, right, lane 1). [score:8]
Compared with control cell group (scrambled sequence), the cells transfected with miR-675-5p inhibitor displayed higher expression of GPR55, whereas the cells with the co-transfection of both LV-miR-675-5p inhibitor and si-GPR55 exhibited lower GPR55 expression (Figure  6A). [score:8]
Thus, down-regulation of cyclin D1 through inhibition of GPR55 could be a mechanism by which miR-675-5p suppresses cell proliferation and promotes cell cycle arrest at the G1 phase. [score:8]
Knockdown of GPR55 inhibited the expression of GPR55 and its main target genes, similar to miR-675-5p (right). [score:8]
miR-675-5p functions as a novel tumor suppressor in NSCLC and the anti-oncogenic activity may involve its inhibition of the target gene GPR55. [score:7]
Down-regulation of miR-675-5p promoted cell growth, proliferation, colony formation, invasion and migration, and promoted the tumorigenicity graft growth of nude mice in vivo (P < 0.01); whereas up-regulation of miR-675-5p had the contrary effects. [score:7]
The hsa-miR-675-5p -inhibition sequence was constructed as follows: (Forward) hsa-miR-675-5p -inhibition-Age I-F AATTCAAAAATGGTGCGGAGAGGGCCCACAGTG, (Reverse) hsa-miR-675-5p -inhibition-EcoR I-R CCGGCACTGTGGGCCCTCTCCGCACCATTTTTG. [score:7]
Up-regulation of GPR55 is inversely associated with down-regulation of miR-675-5p in clinical specimens of NSCLC. [score:7]
Therefore, down-regulation of miR-675-5p suppresses lung cancer progression and metastasis through regulation of GPR55. [score:7]
Moreover, knockdown of the expression of GPR55 using GPR55-specific siRNA (si-GPR55) (Fig6A, lane 4) abrogated the effects induced by miR-675-5p down-regulation (Figure  7, right, lane 4). [score:7]
Therefore, miR-675-5p could be a novel tumor-suppressor miRNA, and its down-regulation might contribute to lung cancer progression and metastasis through regulating GPR55 function. [score:7]
In Ltep-a-2 cells with miR-675-5p down-regulated expression, the protein levels of p-ERK, Cyclin D, GTP-RhoA, MMP9 and MMP2 (right, lane 2) were significantly increased compared with the negative control(right, lane 1) and si-GPR55 treatment abrogated the increased expression of these genes induced by miR-675-5p in the cells (right, lane 4). [score:7]
We are exploring the correlation between miR-675-5p and other target candidates and determining whether miR-675-5p can biologically regulate the potential targets in a different study. [score:6]
The expression of retinoblastoma (RB) protein which a known direct target of miR-675 has not changed in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor. [score:6]
However, the expression of these genes did not change in Ltep-a-2 cells (stable down-regulation of miR-675-5p) transfected with non-specific control siRNA (si-NC) (Figure  7, right, lane 3). [score:6]
However, the protein levels of retinoblastoma (RB) protein, a known direct target of miR-675 in colorectal cancer and another target prediction of miR-675-5p, IkB kinase TBK1 protein, was also reported to be necessary in mediating KRAS -driven tumorigenicity in lung cancer remained unchanged in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor (Additional file 2: Figure S1 and Additional file 3: Figure S2) [18, 19, 27]. [score:6]
In the present study, we first found that miR-675-5p was frequently down-regulated in lung tumor tissues and the reduced miR-675-5p expression was closely related to advanced stage and lymph node metastasis of NSCLC. [score:6]
However, the expression of these genes has not changed in Ltep-a-2 cells (stable down-regulation of miR-675-5p) transfected with non-specific control siRNA (si-NC) (Figure 7, right, lane 3). [score:6]
Moreover, knockdown expression of GPR55 abrogated the effects induced by miR-675-5p -inhibitor. [score:6]
Recent studies have shown that miR-675 expression was up-regulated in several cancer types, such as glioma [15], gastric cancer [16, 17], colorectal cancer [18] and hepatocellular cancer [19]. [score:6]
Upon up-regulation of miR-675-5p, the percentage of A549 and HTB-182 cells in G0/G1 phase increased from 54.7% ± 8.1% in controls to 71.2% ± 8.5% and from 52.6% ± 8.0% in controls to 70.0% ± 8.6%, respectively (P < 0.01), indicating that overexpression of miR-675-5p resulted in G1 phase arrest in NSCLC cells. [score:6]
Overexpression of miR-675-5p inhibits tumor growth of NSCLC cells in vivo. [score:5]
Overexpression of miR-675-5p inhibits proliferation, colony formation, migration, and invasion of NSCLC cells. [score:5]
Figure 2 Overexpression of miR-675-5p inhibited proliferation and colony formation of NSCLC cells. [score:5]
The expression of the non-canonical IkB kinase TBK1 protein which a target prediction of miR-675 has not changed in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor. [score:5]
Therefore, we cannot exclude the possibility that these candidate targets for miR-675-5p besides GPR55 could mediate tumor-suppressive function of miR-675-5p. [score:5]
Figure 4 Overexpression of miR-675-5p inhibits NSCLC in vivo. [score:5]
Furthermore, we demonstrated that miR-675-5p overexpression could suppress NSCLC cell proliferation, migration and invasion in vitro and tumor growth in vivo. [score:5]
Because H19 is unchanged, we speculate down-regulation of miR-675-5p in NSCLC results from post-transcriptional regulation instead of transcriptional repression of miR-675-5p’s primary transcript H19. [score:5]
Another example is pRB, a tumor suppressor that is targeted by miR-675 in colorectal cancer in which miR-675 acts as an oncogene [18, 19] and IkB kinase TBK1 [27]. [score:5]
Using bioinformatics software (DIANA TOOL, Targetscan, miRanda) to predict miR-675-5p potential target gene, combined with the literature and through the test screening, GPR55 was selected as a further object of study. [score:5]
Herein, we showed that miR-675-5p could suppress the carcinogenesis of NSCLC through inhibition of growth, proliferation, migration and invasion. [score:5]
We have provided the following lines of evidence that miR-675-5p inhibits tumor growth, proliferation and migration in part by suppressing GPR55. [score:5]
To explore whether miR-675-5p exerts its functions through the GPR55-ERK and/or GPR55-RhoA pathways that contribute to cancer proliferation, development and progression [28- 31], we examined a number of the main GPR55 signaling downstream target genes, including phosphorylation of extracellular signal regulated kinase (p-ERK), ERK, Cyclin D1 protein (cyclin D1), active form of RhoA (GTP-RhoA), matrix metalloproteinase-2(MMP2), and MMP9. [score:5]
Expression of p-ERK, cyclin D1, GTP-RhoA, MMP2 and MMP9 were decreased in A549 and HTB-182 cells that stably overexpressed miR-675-5p (Figure  7, left and middle, lane 3). [score:5]
To explore the possible mechanism underlying the inhibitory effect on cell growth by overexpression of miR-675-5p, cell cycle analysis was performed (Figure  2B). [score:5]
Therefore, future studies to identify additional novel targets of miR-675-5p and other miRNAs that can also regulate GPR55 will allow us to have deep understanding of the mechanisms underlying the development and progression of NSCLC. [score:5]
These data indicate that miR-675-5p suppresses progression of NSCLC through inhibition of the versatile tumor-promoting GPR55. [score:5]
Furthermore, enforced miR-675-5p expression inhibited lung cancer cell growth, proliferation, clone formation, migration and invasion in vitro, and tumorigenicity in vivo. [score:5]
Up-regulation of miR-675 in the prostate cancer cell line significantly decreased the level of TGFBI and repressed cell migration. [score:4]
Downregulation of miR-675-5p may result from reduced conversion of H19 into pre-miR-675 and/or reduced conversion of pre-miR-675 into mature miR-675-5p. [score:4]
These results indicated that GPR55 was a direct downstream target for miR-675-5p in NSCLC cells. [score:4]
These observations suggest that the effects of miR-675-5p down-regulation on the promotion of cancer cell proliferation, migration and invasion could be diminished by si-GPR55. [score:4]
Furthermore, miR-675-5p overexpression suppressed the migratory and invasive abilities of the NSCLC cells as determined by transwell assay (Figure  3A). [score:4]
Figure 1 Down-regulation of miR-675-5p is inversely associated with advanced stage and lymph node metastasis of NSCLC. [score:4]
GPR55 is a direct downstream target of miR-675-5p. [score:4]
To explore the relationship between miR-675-5p and GPR55 in clinical specimens, we compared GPR55 expression data from immunohistochemistry analysis with results of miR-675-5p expression level from qRT–PCR analysis on specimens of these NSCLC tissues. [score:4]
Interestingly, the cells transfected with LV-miR-675-5p inhibitor displayed higher proliferation, migration and invasion potential when compared with the cells transfected with both LV-miR-675-5p inhibitor and si-GPR55 (Figure  6B-F). [score:4]
Figure 5 GPR55 is a direct downstream target of miR-675-5p. [score:4]
These findings suggest miR-675 regulates its target genes and cancer cell behaviors in a cell or tissue type-specific in cancer. [score:4]
To confirm whether GPR55 was a direct target of miR-675-5p, a dual-luciferase reporter system was used, employing co-transfection of miR-675 mimic and a luciferase reporter plasmid containing the 3′UTR of human GPR55. [score:4]
For the colony formation assay, LV-miR-675-5p -inhibition, LV -negative control transfected A549 and HTB-182 cells or miR-675-5p -inhibition, pGC FU -RNAi-NC-LV (Negative control) transfected Ltep-a-2 cells (1000/well) were allowed to grow in culture dish(10-cm) and maintained in media containing 10% FBS, replacing the medium every 4 days. [score:4]
H19 has been shown to be the primary miRNA precursor of miR-675 in both human and mice and also been identified as a developmental reservoir of miR-675 that suppresses growth [45, 46]. [score:4]
These data indicate that miR-675-5p inhibits GPR55 signaling in NSCLC, which involved tumor development and progression. [score:4]
Therefore, overexpression of miR-675-5p might reduce cell proliferation of NSCLC mainly through G1 phase arrest. [score:3]
Another study found low expression of miR-675 in adrenal cortical carcinoma and metastatic prostate cancer cells [20, 21], implying that miR-675 may play different roles depending on the tumor type. [score:3]
Indeed, we identified at least 12 other potential targets of miR-675-5p using bioinformatic prediction analysis, including some tumor-related genes. [score:3]
Expression of miR-675-5p is inversely associated with advanced stage and lymph node metastasis of NSCLC. [score:3]
Therefore, the low miR-675-5p expression was closely related to the progression and metastasis of NSCLC. [score:3]
Figure 6 Requirement of GPR55 for miR-675-5p induced suppression of NSCLC cell proliferation, migration and invasion. [score:3]
Spearman’s correlation analysis was used to determine correlation between miR-675-5p and GPR55 expression. [score:3]
The expression of miR-675-5p in patients with non-small cell lung cancer had a negative correlation with lymph node metastasis (P < 0.01) and TNM stage (P < 0.05). [score:3]
Expression levels of miR-675-5p were determined by qRT-PCR and normalized against an endogenous control (U6 RNA). [score:3]
LV-miR-675-precursor, LV -negative control transfected A549 and HTB-182 or miR-675-5p -inhibition, or pGC FU -RNAi-NC-LV (Negative control) transfected Ltep-a-2 cells (3000/well) were allowed to grow in 96-well plates. [score:3]
For instance, TGFBI was recently proposed as a biologically relevant miR-675-5p target in prostate cancer [20]. [score:3]
Furthermore, the expression level of miR-675-5p in tumor tissues decreased statistically with increasing stage of NSCLC (P < 0.05) (Figure  1B). [score:3]
We also transfected with si-GPR55 into A549 NSCLC cells, which have high endogenous GPR55 levels (new Additional file 4: Figure S3) and lower endogenous miR-675-5p levels (Figure  1D), and the expression of GPR55 in the cells determined by Western blotting. [score:3]
The relationship between miR-675-5p expression and clinicopathologic parameters was analyzed using the Pearson X [2] test. [score:3]
A549 cells stably expressing miR-675-5p and negative control vector were injected subcutaneously into nude mice. [score:3]
Figure 7 miR-675-5p -mediated inhibition of the GPR55 signaling pathway. [score:3]
The expression of miR-675-5p was analyzed by real-time quantitative PCR (qRT-PCR). [score:3]
The luciferase reporter assay showed that GPR55 was a direct target gene of miR-675-5p. [score:3]
We found that the expression level of miR-675-5p was significantly lower in NSCLC tissues than in the corresponding normal lung tissues, and inversely associated with advanced stage and lymph node metastasis of NSCLC. [score:3]
We noticed that miR-675-5p was underexpressed in NSCLC by using microarray (our unpublished data). [score:3]
Additional file 1: Table S2 79 targets prediction of miR-675-5p from websites DIANA TOOL. [score:3]
In addition, we identified the pro-oncogenic GPR55 gene as a target of miR-675-5p. [score:3]
Next, we searched candidate target genes of miR-675-5p using publicly available databases. [score:3]
However, the antioncogenic properties of miR-675-5p might not solely be explained by its ability to regulate a single gene alone, because a single miRNA can potentially regulate dozens to hundreds of genes in tumorigenesis [42]. [score:3]
In addition, miR-675-5p expression was significantly lower in NSCLC that displayed lymph node metastasis than in NSCLC that did not (P = 0.0055). [score:3]
Furthermore, our evidence suggests that miR-675-5p is a potential therapeutic target in NSCLC. [score:3]
Taken together, miR-675-5p might have tumor-suppressor function. [score:3]
Figure 8 Inverse correlation between the expression of GPR55 and miR-675-5p in clinical specimens of NSCLC. [score:3]
These findings suggest the possibility for miR-675-5p as a therapeutic target in NSCLC. [score:3]
In addition, THE orphan G protein-coupled receptor 55 (GPR55) was identified as a functional target of miR-675-5p. [score:3]
There was an inverse correlation between miR-675-5p and GPR55 expressions in these specimens (Figure  8D, R = -0.825, P < 0.001). [score:3]
GPR55 is identified as a target of miR-675-5p. [score:3]
The versatile functions of miR-675-5p in tumor cell proliferation, migration and invasion suggest its potential application as a prognostic predictor and cancer therapeutic target. [score:3]
Levels of miR-675-5p and GPR55 were normalized to U6 and β-actin, respectively, to yield a 2 [-ΔΔCt] value for relative expression of each transcript. [score:3]
In addition, western blot analysis showed that GPR55 protein expression was clearly decreased in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor (Figure  5 C and D). [score:3]
These results provided further evidence that miR-675-5p plays a tumor suppressive role in NSCLC cancer. [score:3]
The sequence was amplified and cloned into the pGCsil-GFP Vector to generate pGCsil-GFP-miR-675-5p -inhibition. [score:3]
miR-675-5p expression was significantly inversely associated with metastasis and Classification of Malignant Tumours (TNM) classification of the patients (Table  1, P < 0.005). [score:3]
To confirm reduced expression of miR-675-5p in NSCLC, we evaluated the expression of miR-675-5p in 80 pairs of frozen NSCLC tissues and the corresponding normal lung tissues using quantitative reverse transcriptase PCR (qRT-PCR). [score:3]
MiR-675-5p inhibits the GPR55 signaling pathway. [score:2]
Our report revealed a novel miR-675-GPR55 axis in regulation of NSCLC. [score:2]
The expression levels of miR-675-5p in NSCLC tissues were significantly reduced compared to those in adjacent non-cancerous tissues (P < 0.001). [score:2]
qRT-PCR assays were performed to detect miR-675-5p and GPR55 expression using the PrimeScript RT reagent Kit and SYBR Premix Ex Taq (GeneCopoeia, USA) according to the manufacturer’s instructions. [score:2]
For wound-healing assay, cells (1 × 10 [6] cells) were seeded in six-well plates, cultured overnight and transfected with miR-675-precursor, negative control or miR-675-5p -inhibition, pGC FU -RNAi-NC-LV (Negative control). [score:2]
The luciferase reporter assay was used to assess the target genes of miR-675-5p in non-small cell lung cancer cells. [score:2]
Interestingly, methylthiazol tetrazolium assay (MTT) showed that forced expression of miR-675-5p impaired the growth rate of the NSCLC cells (Figure  2A). [score:2]
In A549 and HTB-182 cells with miR-675-5p overexpression, the protein levels of p-ERK, Cyclin D, GTP-RhoA, MMP9 and MMP2 (left and middle, lane 3) were significantly decreased compared with the control. [score:2]
The relative expression levels for miR-675-5p in these six NSCLC cell lines were 0.224, 0.343, 0.378, 0.562, 0.541, and 0.673, respectively, as compared with that of HBE cells, respectively (Figure  1D). [score:2]
Similarly, colony formation assays showed that cell proliferation in both A549 cells and HTB-182 cells were significantly repressed by forced expression of miR-675-5p (Figure  2C). [score:2]
In this study, we aimed to evaluate the possible roles and related target genes of miR-675-5p in tumorigenesis of NSCLC. [score:1]
To validate the hypothesis, we transfected LV-miR-675-precursor or scrambled sequence (negative control) into A549 and HTB-182 NSCLC cells that had low basal levels of miR-675-5p in NSCLC cell lines (Fig1D). [score:1]
This study examined the role of miR-675-5p in non- small cell lung cancer (NSCLC). [score:1]
A549 cells grown in 96-well plate were co -transfected with 50 nM miR-675 mimic or mimic negative control, 100 ng of GPR55-3′UTR-Wt or GPR55-3′UTR-Mut, using the Lipofectamie 2000 (Invitrogen, USA). [score:1]
Intriguingly we did not observe any significant alteration at the protein levels of pRB and TBK1 by miR-675-5p in NSCLC cells (Additional file 2: Figure S1 and Additional file 3: Figure S2). [score:1]
miR-675-5p Progression NSCLC GPR55 Lung cancer is a malignant tumor with the highest morbidity and mortality in the world, which is a serious threat to human health and life security [1]. [score:1]
These data support GPR55 as a downstream mediator of miR-675-5p function in NSCLC. [score:1]
Further studies are required to fully understand the detailed mechanisms of miR-675-5p in NSCLC carcinogenesis and as a potential therapeutic approach. [score:1]
Figure 3 The effect of miR-675-5p on in vitro migration and invasiveness of NSCLC cells. [score:1]
The hsa-miR-675-precursor sequence was constructed as follows: (Forward) hsa-miR-675-Age I-F ACCGGTGGAGGGCGAAGC, (Reverse) hsa-miR-675-EcoR I-R GAATTCAAAAACTCCTGAGAG. [score:1]
The average tumor volume of A549 cells stably transfected with miR-675-5p was 1.23 ± 0.096 cm [3], which was significantly smaller than tumors in the negative control group (1.86 ± 0.132 cm [3]) (Figure  4B). [score:1]
, Shanghai, China) to generate pGCsil-GFP-miR-675 and the pGCsil-GFP Vector only as negative control. [score:1]
We evaluated the expression of miR-675-5p in NSCLC tissues and the corresponding normal lung tissues using quantitative reverse transcriptase PCR. [score:1]
Therefore, GPR55 may mediate cell proliferation, migration and invasion of NSCLC induced by miR-675-5p. [score:1]
Given that miR-675-5p impaired the proliferation, migration and invasion of NSCLC cells in vitro, we examined whether miR-675-5p could affect tumorigenicity in vivo. [score:1]
We also measured miR-675-5p expression in six NSCLC cell lines (95-D, A549, HTB-182, NCI-H1299, SPCA-1, Ltep-a-2) and a normal human bronchial epithelial cell line (HBE). [score:1]
Accumulating evidence suggests that miR-675-5p plays important roles in human carcinogenesis. [score:1]
Among the candidates, GPR55 exhibited one of the highest prediction scores and the most complementary structure with miR-675-5p (Additional file 1: Table S2). [score:1]
The RNA levels of miR-675-5p in NSCLC tissues were less than 30% of that in the matching normal tissues (Figure  1A). [score:1]
[1 to 20 of 129 sentences]
4
[+] score: 140
The authors showed that miR-675 is significantly up-regulated in breast cancer patients compared with controls, but this up-regulation is not correlated with clinical and pathological status including ER and PR expression, age, and lymph node stage. [score:8]
He D. Wang J. Zhang C. Shan B. Deng X. Li B. Zhou Y. Chen W. Hong J. Gao Y. Down-regulation of miR-675-5p contributes to tumor progression and development by targeting pro-tumorigenic GPR55 in non-small cell lung cancerMol. [score:7]
By targeting the tumor suppressor retinoblastoma (RB) protein, miR-675-5p regulates the CRC development [32]. [score:7]
By example, miR-675 was shown to downregulate the expression of RB in human colorectal cancer to promote tumor development [32]. [score:7]
The overexpression of miR-675-5p in breast cancer cells lines induced the downregulation of c-Cbl and Cbl-b proteins and increased the stability and the activation of Epidermal growth factor receptor (EGFR) and c-Met. [score:6]
In conclusion, the lncRNA H19 interacts with miRs pathways not only by being the precursor of miR-675, but also by physically interacting with other miRs to regulate the expression of their targets (Figure 2). [score:6]
Zhuang M. Gao W. Xu J. Wang P. Shu Y. The long non-coding RNA H19-derived miR-675 modulates human gastric cancer cell proliferation by targeting tumor suppressor RUNX1Biochem. [score:5]
Even if the regulation of p53 by H19 in human breast cancer is not yet described, these data, collectively, demonstrate that H19 and miR-675 play a pivotal role in the regulation of cell cycle in cancer as illustrated in Figure 3. The H19-derived miR-675 gives rise to two functional microRNA, miR-675-5p, and miR-675-3p with different validated targets. [score:5]
All the known targets of miR-675-5p and miR-675-3p implicated or not in neoplasia are resumed in Table 1. Some of these targets could explain the oncogenic role of H19 in breast cancer. [score:5]
All the known targets of miR-675-5p and miR-675-3p implicated or not in neoplasia are resumed in Table 1. Some of these targets could explain the oncogenic role of H19 in breast cancer. [score:5]
The two strands of miR-675, miR-675-5p, and miR-675-3p, have been involved in disease development and notably in cancer development (Section 3.1). [score:5]
Kim N. H. Choi S. H. Lee T. R. Lee C. H. Lee A. Y. Cadherin 11, a miR-675 target, induces N-cadherin expression and epithelial-mesenchymal transition in melasmaJ. [score:5]
Keniry A. Oxley D. Monnier P. Kyba M. Dandolo L. Smits G. Reik W. The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1rNat. [score:4]
Gao W. L. Liu M. Yang Y. Xu Y. Li R. Deng Q. Sun H. Wang S. The Imprinted H19 gene regulates human placental trophoblast cell proliferation via encoding miR-675 that targets nodal modulator 1 (NOMO1)RNA Biol. [score:4]
In C-kit [+] cardiac progenitor cells, Cai et al. showed that miR-675 negatively regulates p53 through the targeting of USP10 [38]. [score:4]
The H19-derived miR-675 negatively regulates p53 through an unknown target in bladder cancer cell [26]. [score:4]
Li X. Hao W. Yao B. Xu W. Chen J. Zhou X. lncRNA H19/miR-675 axis regulates cardiomyocyte apoptosis by targeting VDAC1 in diabetic cardiomyopathySci. [score:4]
In human breast cancer, we have identified two ubiquitin ligase E3, c-Cbl, and Cbl-b, as direct targets of miR-675-5p [33]. [score:4]
Hernandez J. M. Elahi A. Clark C. W. Wang J. Humphries L. A. Centeno B. Bloom G. Fuchs B. C. Yeatman T. Shibata D. miR-675 mediates downregulation of Twist1 and Rb in AFP-secreting hepatocellular carcinomaAnn. [score:4]
For example, miR-675 stimulates migration and invasion by targeting TGF-β1 in prostate cancer cells, Cadherin13 in glioma cells, or RUNX1 in gastric cancer cells [42, 44, 47]. [score:3]
Kim N. H. Choi S. H. Kim C. H. Lee C. H. Lee T. R. Lee A. Y. Reduced MiR-675 in exosome in H19 RNA-related melanogenesis via MITF as a direct targetJ. [score:3]
We found that H19 and miR-675 expression enhances breast cancer cell migration [33, 58]. [score:3]
The H19-derived miR-675 gives rise to two functional microRNA, miR-675-5p, and miR-675-3p with different validated targets. [score:3]
Zhai L. L. Wang P. Zhou L. Y. Yin J. Y. Tang Q. Zhang T. J. Wang Y. X. Qin Y. Lin J. Deng Z. Q. Over -expression of miR-675 in formalin-fixed paraffin-embedded (ffpe) tissues of breast cancer patientsInt. [score:3]
The frequency of miR-675 overexpression was higher in the patients with low histological grade (I and II). [score:3]
Although further studies are needed, the targeting of H19 and miR-675 could provide novel opportunities in the treatment of cancer patients. [score:3]
Even if the regulation of p53 by H19 in human breast cancer is not yet described, these data, collectively, demonstrate that H19 and miR-675 play a pivotal role in the regulation of cell cycle in cancer as illustrated in Figure 3. H19 is involved in human breast cancer through interaction with protein, microRNAs, H19-derived miR-675-5p, and H19 antisense lncRNA (91H) but the study of these ncRNAs is not only restrained in cancer cell behavior. [score:3]
RB was also demonstrated as a target of miR-675-5p in hepatocellular carcinomas [48]. [score:3]
Liu C. Chen Z. Fang J. Xu A. Zhang W. Wang Z. H19-derived miR-675 contributes to bladder cancer cell proliferation by regulating P53 activationTumor Biol. [score:2]
In 2007, Cai & Kullen demonstrated that H19 is a precursor of miR-675 [22]. [score:1]
Sun T. Leung F. Lu W. miR-9-5p, miR-675-5p and miR-138-5p damages the strontium and LRP5 -mediated skeletal cell proliferation, differentiation, and adhesionInt. [score:1]
H19: Precursor of miR-675-5p and miR-675-3p. [score:1]
They found that eight microRNAs, including miR-675-5p, were differentially methylated in subjects who went on to develop breast cancer. [score:1]
Dey B. K. Pfeifer K. Dutta A. The H19 long noncoding RNA gives rise to microRNAs miR-675-3p and miR-675-5p to promote skeletal muscle differentiation and regenerationGenes Dev. [score:1]
Zhai et al. investigated the expression of miR-675-5p in formalin-fixed paraffin-embedded (FFPE) tissues of 100 breast cancer patients [34]. [score:1]
Yan J. Zhang Y. She Q. Li X. Peng L. Wang X. Liu S. Shen X. Zhang W. Dong Y. Long noncoding RNA H19/miR-675 axis promotes gastric cancer via FADD/Caspase 8/Caspase 3 signaling pathwayCell. [score:1]
Higher levels of miR-675 are also found in both tumor samples and gastric juice of patients suffering from gastric cancer [86]. [score:1]
However, we showed that miR-675-5p doesn’t interact with RB mRNA in human breast cancer cell lines [33]. [score:1]
Liu G. Xiang T. Wu Q. F. Wang W. X. Long noncoding RNA H19-derived miR-675 enhances proliferation and invasion via RUNX1 in gastric cancer cellsOncol. [score:1]
In those subjects, miR-675-5p was significantly hypomethylated suggesting that miR-675-5p could be used as biomarker for breast cancer. [score:1]
The implication of miR-675 in cancer was firstly shown by Tsang WP et al. in colorectal cancer (CRC). [score:1]
[1 to 20 of 41 sentences]
5
[+] score: 128
Placental explants were incubated with the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate, the miR-675 inhibitor PNA conjugate, the scrambled miR inhibitor or the selective miR-145 inhibitor (50nM) for 24 or 48h. [score:11]
To determine whether miRNA inhibitor conjugates could be used to promote growth signalling in human placental tissue, first trimester and term placental explants were cultured with scrambled-, miR-145 inhibitor- or miR-675 inhibitor conjugates, or with commercially available scrambled- or miR-145 inhibitors that lacked the CCGKRK targeting sequence. [score:11]
In this proof of principle study, we have explored the feasibility of using a miRNA inhibitor as putative therapeutic in pregnancy, designed placental homing peptide-microRNA inhibitor conjugates synthesised from peptide nucleic acids, and demonstrated that targeted inhibition of miR-145 and miR-675 expression within the placenta leads to enhanced CTB turnover in human first trimester explants and increased fetal and placental weights in mice. [score:11]
This could be achieved by two approaches: firstly, as demonstrated in our study, miRNAs that are highly expressed in the first trimester (such as miR-145 and miR-675), and are negative regulators of growth and development, could be targeted for inhibition in women identified as being at high risk of impaired placentation. [score:9]
PCR analysis of miRNA expression in placentas harvested at E18.5 showed that treatment with the miR-675 inhibitor conjugate significantly reduced miR-675 expression (Figure 4G), but median placental miR-145 expression was not significantly changed at this time point (Figure 4H). [score:9]
Three homing peptide-miRNA inhibitor peptide nucleic acid (PNA) conjugates were synthesised by Cambridge Research Biochemicals: (i) a scrambled miRNA inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'- ACCACGCCTCTCGCCAGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'); (ii) a miR-145 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-CAGGTCAAAAGGGTCCTTAGGGA-Cys-Cys-Gly-Lys-Arg-Lys-3'); and (iii) a miR-675 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-ACCACGCCTCTCCCGGGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'). [score:9]
Of interest is our observation that placental miR-675 expression was quite varied in mice treated with the scrambled inhibitor conjugate (Figure 4H); placentas were randomly selected for analysis and expression level did not correlate with placental uterine horn position, the pregnant dam from which the placentas came, or individual fetal or placental weights. [score:7]
miR-145-5p target sequence: 5' GUCCAGUUUUCCCAGGAAUCCCU 3' (conserved sequence between mouse and human); mmu miR-675-5p target sequence: 5' UGGUGCGGAAAGGGCCCACAGU 3'; hsa miR-675-5p target sequence: 5' UGGUGCGGAGAGGGCCCACAGUG 3'. [score:7]
Mice were intravenously injected with 100 µl of vehicle (PBS) or 1 mg/kg of the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate or the miR-675 inhibitor PNA conjugate on E12.5, E14.5 and E16.5 of pregnancy. [score:7]
C57/BL6J mice were intravenously injected with PBS, a scrambled miRNA inhibitor conjugate (1mg/kg), a miR-145 inhibitor conjugate or a miR-675 inhibitor conjugate at three-time points during pregnancy. [score:7]
We have previously demonstrated a reduction in miR-675 expression in the human placenta in the third trimester 16, but its gene targets and function remain to be established. [score:5]
miR-675 expression was not significantly reduced in first trimester explants incubated with the miR-675 inhibitor conjugate (Figure 6C), but this may reflect the small sample size and the inherent biological variability of human tissue samples. [score:5]
Analysis of placental weight distribution indicated that 6 placentas weighed below the 10 [th] centile in PBS treated mice, and 5 placentas weighed below the 10 [th] centile in mice treated with the scrambled inhibitor conjugate, but no placentas fell below the 10 [th] weight centile in either miR-145 or miR-675 inhibitor conjugate -treated mice, suggestive of a growth-promoting effect. [score:5]
Mice injected with the miR-675 inhibitor conjugate exhibited a significant increase in median placental weight at E18.5, compared to mice injected with PBS or the scrambled inhibitor conjugate (Figure 4A). [score:4]
We demonstrate expression of miR-145 in mouse placenta for the first time, propose that this molecule controls placental weight gain and validate a previous report that miR-675 is a negative regulator of murine placental growth 25. [score:4]
3'UTRs 3'-untranslated region CTB cytotrophoblasts DMEM Dulbecco's modified Eagle medium EVT extravillous trophoblast FAM 5(6)-carboxyfluorescein FGR fetal growth restriction IGF-I insulin-like growth factor-I IGF-II insulin-like growth factor-II miR-145 microRNA-145 miR-675 microRNA-675 miRNA microRNA. [score:3]
We have previously shown that microRNA (miR)-145 negatively regulates IGF-I -induced cytotrophoblast proliferation in human placental explants 16, and a recent publication has identified miR-675 as a regulator placental growth/function in the mouse 25. [score:3]
Despite these challenges, we still achieved a significant inhibition of miR-675 with our current dosing regimen. [score:3]
These reasons may also explain why a significant increase in proliferation was not observed in the harvested mouse placentas despite miR-675 inhibition. [score:3]
The miR-145 and miR-675 inhibitor conjugates also significantly increased median fetal weight at E18.5, compared to mice injected with PBS (Figure 4C); however, fetal weight distribution curves showed that the number of fetuses falling below the 10 [th] centile remained unchanged. [score:2]
Work by our group and others has identified numerous miRNAs, including miR-675, miR-145, let-7a, miR-377 and miR-483, that influence events in early pregnancy 15, and can either positively or negatively regulate CTB proliferation in explants of human placental tissue 16- 19. [score:2]
The downstream targets of miR-675 have already been characterised in the mouse placenta and include the igfr1 gene 25. [score:1]
[1 to 20 of 22 sentences]
6
[+] score: 97
Moreover, it was experimentally shown in breast cancer cells that Rb indirectly suppresses H19 expression by repressing E2F1 [68], while in colorectal cancer cells [10] and in hepatocellular carcinoma cells [44], H19 derived miR-675 negatively regulates Rb expression. [score:9]
Interestingly, H19 maternal expression which directly impacts upregulation of Igf2 and Igf1r, together with the repressive effect of miR-675 on Igf1r [5], may take part in the maintenance of adult haematopoietic stem cell quiescence [86]. [score:7]
While increasing proliferation and repressing Rb, miR-675 altered cellular morphology, upregulated epithelial markers and downregulated the mesenchymal ones, reduced invasive potential, and increased anchorage-independent growth capacity. [score:7]
This phenomenon was verified in a transgenic mouse mo del of prostate cancer (Pten and Zbtb7a double knockout mice), in which Sox9 is upregulated and suppresses Rb via miR-675 [50]. [score:7]
Descriptive evidence indicates that miR-675 is upregulated gradually upon murine skeletal muscle injury in vivo to mediate muscle regeneration and differentiation through inhibition of the BMP-pathway components. [score:6]
Moreover, it was recently found in bladder cancer cells that H19 derived miR-675 has a major role in inhibiting p53 and p53 -dependent protein expression [28]. [score:5]
H19's function can be dissected into two major functions; a reservoir of miR-675 that suppresses its targets [5, 6], and a modulator of micro -RNAs or proteins via their binding. [score:5]
H19 promotes cell cycle progression through Rb suppression by its miR-675 or by p57 [kip2] (CDKN1C) suppression or c-Myc activation Metastases are the major cause of cancer related death. [score:5]
For example, miR-675 directly downregulates Igf1r [5], Smad1, Smad5, and Cdc6 [7],Cadherin-11 [8], Cadherin-13 [9], Rb [10], Runx1 [11], Nodal Modulator 1 [12], TGFBI [13] CALN1 [14], and MITF [15]. [score:5]
We have reported that miR-675 is essential for EMT, ablation of epithelial markers and upregulation of mesenchymal markers as found in hepatocellular carcinoma in vitro. [score:4]
However H19 and its derived miR-675 can down-regulate P53 activity, and this temporary P53-deficiency-related stress may be the cause of polyploidy, in accordance with the mechanism suggested above. [score:4]
This suggestion is further strengthened by the fact that P53 negatively regulates the PI3K pathway via transcriptional activation of its pivotal negative regulator, PTEN (which is also a negative regulator of H19 and miR-675 [50]). [score:4]
Indirect targets of miR-675 were also reported and some of them will be mentioned below. [score:4]
In spite of the strong supportive evidence for H19 and miR-675 involvement in EMT, which is regarded as a de-differentiation/trans-differentiation process, there is enough contradictory data to position H19 as a tumor suppressor and a pro-differentiation factor. [score:3]
In prostate cancer cells, miR-675 was also reported to suppress the extra cellular matrix TGF-β induced (TGFBI) protein transcript, which enhances motility and invasion in metastasis. [score:3]
We have also shown that in a pancreatic cancer cell line E-cadherin is totally ablated upon H19 expression as long as H19’s miR-675 seed region is intact. [score:3]
In P53 WT hepatocellular carcinoma (HCC) cells, miR-675 transient overexpression actually increased the rate of tetraploid cells in culture [44]. [score:3]
We have recently shown that numerous bona-fide EMT inducers also induce H19/miR-675 expression [48]. [score:3]
MiR-675 targets a myriad of transcripts in a cellular-context -dependent manner [5]. [score:2]
Liu C, Chen Z, Fang J, Xu A, Zhang W, Wang Z. H19-derived miR-675 contributes to bladder cancer cell proliferation by regulating p53 activation. [score:2]
In addition, hypoxia induces H19 and miR-675 as well as the EMT markers Slug and Snail in breast cancer cells. [score:1]
Those findings also align with the study that claimed a pro-differentiation role for miR-675 in muscle, as mentioned above [7]. [score:1]
An apparently conflicting report indicated that miR-675, in another hepatocellular carcinoma cell line mo del, is an MET promoter [44]. [score:1]
However, one of the most important transcripts in the H19 locus is miR-675, a highly conserved micro -RNA that resides within exon-1 of the H19 gene. [score:1]
H19 miR-675 Tumorigenesis Proliferation Differentiation EMT MET Genomic instability miR-200 let-7 Tumorigenesis is a multistep process that involves both the neoplastic tissue and its surroundings. [score:1]
A recent study contradicts the above findings since it reported pro-differentiation properties of H19 and its derived miR-675 forms in muscle [7]. [score:1]
[1 to 20 of 26 sentences]
7
[+] score: 89
Under normal conditions, miR-675 inhibits human trophoblast cell proliferation by directly downregulating Nodal Modulator 1 (NOMO1) protein expression, binding to the 3′-UTR sequence of NOMO-1. NOMO1 is an antagonist of Nodal, which could attenuate Nodal signaling [12]. [score:9]
Recently, it was observed that no coordinated expression of H19 and miR-675 could be elucidated in tissues that are known to express a high level of H19 RNA during all stages of embryonic development, including the liver, while expressing only low levels of miR-675. [score:8]
Increased levels of miR-675 in the placenta coincide with downregulation of IGF1R that may contribute, at least in part, to the growth inhibiting effect on the placental size [11]. [score:6]
This phenotypic effect of miR-675 could be performed at least in part by targeting the tumor suppressor, RB [13]. [score:5]
The H19 locus, thus, is able to regulate biological processes on separate levels of significance through imprinting, production of miR-675 and also a complex panel of expressions in both sense and antisense directions. [score:5]
Apart from regulating the abundance of IGF2 through imprinting, the H19 locus can also regulate IGF2 abundance through targeting its receptor, IGF1R, by miR-675. [score:5]
Suppression of miR-675 decreased cell growth and soft agar colony formation in human colon cancer cells, while overexpression increased cell growth and soft agar colony formation. [score:5]
As discussed above, miR-675 targets the tumor suppressor, RB. [score:5]
In adult human chondrocytes, expression of H19 (and subsequently miR-675) is driven by SOX9 to positively regulate COL2A1, which encodes a collagen protein important to the cartilage matrix [14]. [score:4]
However, both H19 and miR-675 were found to be upregulated in human colon cancer, both in cell lines and primary colorectal cancer biopsies relative to adjacent non-cancerous tissues. [score:4]
A lot remains to be performed, mainly in the identification of the miR-675 targets and understanding its regulation and function. [score:4]
HuR binds the full-length H19 RNA and inhibits the processing of miR-675, probably at the Drosha step. [score:3]
Moreover, an inverse correlation was observed between the expression of retinoblastoma (RB) and H19/ miR-675. [score:3]
Deeper analysis showed that miR-675 levels decrease in patients with early PE onset, and this decrease was suggested to mediate an increase in NOMO1 protein levels, a suppressor of the anti-proliferative and pro-apoptotic Nodal pathway [12]. [score:3]
However, in the placenta, maternal miR-675 expression is detected with increasing abundance from E11.5 till term [11]. [score:3]
In addition to H19 itself, this locus also produces a microRNA, called miR-675, an antisense protein coding transcript, called H19 opposite tumor suppressor (HOTS), and a long intergenic antisense transcript, called 91H [1– 3]. [score:3]
This suggests the existence of an inhibitory mechanism hindering the processing of miR-675 from H19 RNA. [score:3]
Using a variety of approaches, the protein inhibiting miR-675 processing at least in part was identified as the RNA -binding protein HuR. [score:3]
Furthermore and using an H19 mouse mo del carrying a 3-kb deletion of just the H19 transcription unit, including miR-675 to exclude the effect of IGF2, it was shown that placental overgrowth results, implying that miR-675 is a negative regulator of placental size. [score:2]
Additionally, miR-675 levels were not examined in this study, although they may differ between the groups in the study. [score:1]
Indeed, produced from exon 1 of H19, a miRNA-containing hairpin serves as a template for two distinct miRNAs, miR-675-5p and miR-675-3p [1]. [score:1]
miR-675 has been assigned a contradictory role in the process of proliferation, and it seems to function differently in normal versus cancer cells. [score:1]
Whether H19 and its miR-675 have distinct functions or whether H19 functions through its miR-675 remains to be elucidated. [score:1]
Another possibility is that this alternative spliced variant affects HOTS protein or miR-675 processing. [score:1]
Moreover, it was shown that miR-675 slows cell proliferation and, thus, can limit placental overgrowth, as discussed above. [score:1]
[1 to 20 of 25 sentences]
8
[+] score: 83
The VCR contains a target site for miR-675 [13], a target site for the miR-16 family of microRNAs [24, 25] and a target site for miR-376c [26]. [score:7]
The 4.8-kb gigaloop is a putative structure formed by pairing of VCR and a complementary sequence (cVCR) Figure 2. Conserved sequences of stratum 1 (shared by Homo and Callorhinchus IGF1R 3'-UTRs): (a) the 3' end of the long IGF1R transcript; (b) a miR-7-3p target site that has been lost from the Pelodiscus sequence; (c) let-7-3p target site; (d) miR-186 target site; (e) The VCR with predicted binding sites for miR-376c, miR-675 (derived from the imprinted H19 RNA) and miR-16. [score:7]
We undertook a comparative sequence analysis of vertebrate IGF1R 3'-UTRs to determine the evolutionary history of miR-675 target sequences and to identify conserved features that are likely to be involved in post-transcriptional regulation of IGF1R translation. [score:6]
IGF1R mediates the fetal growth-promoting effects of IGF-II [6] and binding of miR-675-3p to the 3'-UTR of Igf1r mRNA inhibits translation of the receptor [13]. [score:5]
The 3'-untranslated region (3'-UTR) of the mouse Igf1r mRNA is targeted by miR-675-3p derived from the imprinted H19 long noncoding RNA. [score:5]
If the latter scenario is correct, then the VCR is likely to have been an original target of miR-675 and miR-376 which evolved to target its sequence. [score:5]
The 3'-untranslated region (3'-UTR) of the murine Insulin-like growth factor 1 receptor (Igf1r) gene was subsequently found to possess two target sites for miR-675-3p [20]. [score:5]
Therefore, miR-675-3p is predicted to function as a maternally expressed inhibitor of fetal growth. [score:5]
By contrast to the deeply conserved target site for miR-675 in the VCR, the second reported target site for miR-675 [13] is found only in the Igf1r 3'-UTRs of house mice and their close relatives. [score:5]
Either the miR-675 and miR-376 binding sites were targets for unidentified ancient microRNAs, perhaps still present in Pelodiscus and Callorhinchus, or the more recent imprinted microRNAs evolved to target sequences that were conserved for functions unrelated to binding by microRNAs. [score:5]
Although the VCR was ‘disordered’ in many predicted structures, the miR-675 target site was sometimes recovered as part of a strong double helix (15 bp, –25.8 kcal/mol) formed with a complementary sequence (cVCR), 4.5 kb distant located between the stems of the megaloop (Fig.  5b). [score:3]
A comparison to other long transcripts with predicted target sites for miR-675-3p (KCNN3, TAOK1, PYGO1, MRPL19, ANKH and ADAM22) suggests that 185 is a ‘middling’ number of predicted microRNAs for a transcript of this length. [score:3]
The miR-675 and miR-16 target sites are proximal to the polyadenylation site and thus included within the short transcript. [score:3]
It is notable that miR-675 and miR-376 are both imprinted and maternally expressed [12, 27]. [score:3]
The initial impetus for the present study was to examine the evolutionary history of the miR-675-3p target sequences reported for mouse Igf1r mRNA [13]. [score:3]
Third, the VCR is targeted by multiple imprinted microRNAs (including miR-675-3p derived from the H19 RNA). [score:3]
The maternally expressed H19 long noncoding RNA is not only the substrate for the production of miR-675 but also acts as a competing endogenous RNA (ceRNA) or ‘molecular sponge’ for absorbing other microRNAs [74, 75]. [score:3]
These complexities may partly explain the difficulty of assigning an unambiguous function to H19 and miR-675 in the regulation of cell proliferation. [score:2]
By contrast, the miR-675 binding site of the VCR was often located within a long single-stranded bulge or in weakly bonded secondary structures. [score:1]
Stratum 3 also corresponds to the conjectured origin of genomic imprinting and microRNA-675 (Fig.  1a). [score:1]
The 1.3 kb 3'-UTR of the ‘short’ transcript terminates within the VCR, which also includes a conserved miR-675-3p -binding site. [score:1]
One conserved hairpin was shown to be processed as the pre-miRNA for miR-675 [12]. [score:1]
By contrast, miR-675 is known only from marsupial and eutherian mammals [35, 36] and miR-376 only from eutherian mammals [27]. [score:1]
[1 to 20 of 23 sentences]
9
[+] score: 80
Since we found the upregulation of Egr1 in HMGA1P7 overexpressing MEFs performing RNA-seq analysis [1], we tested whether it could be responsible for the miR-483-5p and miR-675-5p upregulation. [score:9]
The results reported in Figure 1 confirm the overexpression of miR-483-5p, miR-483-3p, miR-675-5p, miR-21-3p, and the downregulation of miR-187-3p in HMGA1P7 overexpressing MEFs in comparison with the WT ones. [score:8]
These results suggest that Egr1 could regulate miR-483 and miR-675 expression by upregulating H19 and Igf2 genes. [score:7]
Then, we converged our studies on the miR-483-5p and miR-675-5p, which showed the most upregulated fold-change in HMGA1P7 overexpressing MEFs by miRNA-seq analyses. [score:6]
Moreover, as expected from previous results, qRT-PCR showed upregulation of miR-483-5p and miR-675-5p following HMGA1P7 pseudogene overexpression in NIH3T3 cells (Figure 4A). [score:6]
Furthermore, miR-675-5p has been found overexpressed in metastatic colon cancer cells and it is able to induce resistance to 1,25(OH)2D3 by targeting VDR [24, 34]. [score:5]
These evidences are coherent with the conclusion that HMGA1P7 requires mature miRNAs to regulate Egr1 levels and then upregulates miR-483-5p and miR-675-5p. [score:5]
3.2. miR-483-5p and miR-675-5p are Upregulated in HMGA1P7 Mouse Tissues. [score:4]
Taken together, these data deeply endorse the assumption that HMGA1P7 could act as ceRNA for Egr1, which in turn upregulates miR-483-5p and miR-675-5p. [score:4]
As expected from previous data, qRT-PCR analysis showed that miR-483-5p and miR-675-5p were also upregulated in heart and spleen from HMGA1P7 adult transgenic mice (Figure 2). [score:4]
Here, we demonstrate that HMGA1P7 upregulates miR-483 and miR-675 through the activation of Egr1 by a ceRNA mechanism. [score:4]
Among them, we focused our attention on two of the most overexpressed miRNAs: miR-483 and miR-675. [score:3]
HMGA1P7 Pseudogene Sustains miR-483-5p and miR-675-5p Expression via a ceRNA Mechanism with Egr1. [score:3]
It has been reported that early growth response protein 1 (Egr1) controls the expression of H19 [40] and Igf2 [41] and that, intriguingly, miR-483 is located within the second intron of Igf2 gene [42] and miR-675 is encoded by the first exon of H19 gene [40]. [score:3]
Feng Y. Yang C. Hu D. Wang X. Liu X. miR-675 promotes disease progression of non-small cell lung cancer via activating NF-κB signaling pathwayCell Mol. [score:3]
Intriguingly, it has been extensively demonstrated that miR-483 and miR-675 are two oncomiRs since they have been found overexpressed in many tumours such as prostate [18], gastric [19], Wilms’ [20], adrenocortical [21], esophageal [22], breast [23], colon [24], and lung tumours [25]. [score:3]
In this study, we focused on miR-483-5p and miR-675-5p since they are involved in carcinogenesis and they belong to the H19/ Igf2 locus, which has been already linked to HMGA1P7 ceRNA network [1, 40, 42]. [score:1]
Indeed, Egr1 controls the transcription of H19 and Igf2 whose mRNAs maturation generates miR-483-5p and miR-675-5p [40, 41]. [score:1]
Consequently, H19 and Igf2 mRNAs increase and, with them, so do miR-483-5p and miR-675-5p amounts. [score:1]
[1 to 20 of 19 sentences]
10
[+] score: 64
lncRNA Targets and mechanism of action lncRNA-p21 Inhibition of transcription of target genes involved in apoptosis and cell cycle through hnRNPK; also represses the translation of β-catenin and Jun B mRNA translation through HuR[38, 39, 40] PANDA Interacts with the transcription factor NF-YA to limit expression of proapoptotic genes[41] MEG3 Interacts with p53 to transactive target gene promoters[42, 43, 44, 45, 46] LincRNA-RoR Inhibits translation of p53 mRNA[47, 48] LOC285194 Inhibits function of miR-211[49] MALAT1 Down-regulates p53 and target genes; also up-regulates pro-metastatic genes such as MIA2 and ROBO1[50, 51, 52, 53, 54] p53 -induced eRNAs Promotes p53 target gene transcription[55] H19 Down-regulates RB mRNA translation through miR-675[56] KCNQ1OT1 Inhibits p57 transcription[57, 58, 59, 60, 61, 62, 63] ANRIL Represses the INK4b-ARF-INK4a locus with PRC1/2[64, 65, 66, 67, 68] HULC Sequestration of miR-372, causing derepression of PRKACB; also suppress p18 expression[69, 70]ncRNA [CCNDI] Represses CCND1 transcription with activation of TLS[71] GADD7 Inhibits TDP43 by sequestration of TDP43[72, 73] The p53 pathway is well studied in the context of regulating cell cycle and apoptosis and maintaining genomic integrity. [score:45]
H19 lncRNA transcribed by E2F from H19 locus is processed to yield miR-675, which regulates the translation of RB mRNA. [score:4]
Keniry A. Oxley D. Monnier P. Kyba M. Dandolo L. Smits G. Reik W. The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r Nat. [score:4]
Furthermore, the H19-derived miR-675 may also play a role in negative feedback with pRB by directly inhibiting the RB1-3'UTR (Figure 3) [90]. [score:4]
Given the reported inhibition of IGF1R by miR-675, there is a complex interplay between the suite of ncRNAs located at H19, the pRB pathway, and IGF signaling, and further work will be necessary to clarify the mechanisms by which these RNAs promote cell proliferation and tumorigenesis. [score:3]
It may be the case that the expression of the ncRNAs at the H19 locus- miR-675, H19, and 91H- is highly context -dependent and can exert varying effects in different molecular environments. [score:3]
The H19 transcript is a precursor for miR-675, which is associated with a decreased proliferatory phenotype [56]. [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 38
Of the three miRNAs, miR-675 has been reported to be over expressed and correlates with survival of pancreatic cancer patients [29], and miR-338-3p was down-regulated and associated with prognosis of colorectal carcinoma [30], which supports a similar expression pattern for these miRNAs in other cancers. [score:8]
Of the three miRNAs, miR-675-5p was up-regulated and negatively associated with OS (hazard ratio [HR]: 2.562, confidence interval [CI]: 1.295-4.929), while the other two (miR-652-3p and miR-338-3p) were down-regulated and positively associated with OS (HR: 0.477, CI: 0.247-0.922; HR: 0.498, CI: 0.257-0.966, respectively). [score:7]
Next, a previously developed strategy [15] was used to establish a formula to calculate the risk score for every patient based on the expression level of the three miRNAs, weighted by regression coefficient: Risk Score = (0.93 × expression level of miR-675-5p) + (−0.726 × expression level of miR-652-3p) + (−0.688 × expression level of miR-338-3p). [score:7]
Therefore, we are conducting further studies on the biological function and the regulation of miR-675-5p and miR-652-3p expression in ICC cells. [score:4]
To confirm the miRNA expression level detected by the microarray, we carried out qRT-PCR for miR-675-5p, miR-652-3p, and miR-338-3p in ICC samples and NIBD tissues. [score:3]
Histogram plot indicating that the expression levels of three miRNAs (miR-675-5p, miR-652-3p and miR-338-3p) measured by microarray were concordant with those by qRT-PCR, and Spearman correlation analysis showed the high correlations (see the section for details) between the expression levels of each miRNA detected by microarray and qRT-PCR. [score:3]
Considering that the three miRNAs (miR-675-5p, miR-652-3p and miR-338-3p) are highly dysregulated in ICC and other cancers, these miRNAs may play an important role in ICC carcinogenesis. [score:2]
In decreasing order of performance, the results showed that the predictive performance of the 3-miRNA signature is the best (area under the curve (AUC): 0.747, P = 0.002), followed by single miR-675-5p (AUC: 0.686, P = 0.021), the combination of miR-675-5p and miR-652-3p (AUC: 0.686, P = 0.021), the combination of miR-675-5p and miR-338-3p (AUC: 0.686, P = 0.021), single miR-652-3p (AUC: 0.622, p = 0.130), single miR-338-3p (AUC: 0.622, P = 0.130), and the combination of miR-652-3p and miR-338-3p (AUC: 0.587, P = 0.281). [score:1]
Comparing the 3-mRNA signature with the 30-miRNA signature, we found that miR-675-5p and miR-338-3p were shared between the two signatures, while miR-652-3p was not included in the 30-miRNA signature. [score:1]
Three miRNAs (miR-675-5p, miR-652-3p and miR-338-3p) were found to be significantly associated with OS (P < 0.05). [score:1]
The results showed that the expression levels of the three miRNAs detected by microarray significantly correlated with those measured by qRT-PCR (miR-675-5p, R = 0.566, P = 0.0012; miR-652-3p, R = 0.761, P < 0.0001; miR-338-3p, R = 0.623, P = 0.0009) (Figure  3). [score:1]
[1 to 20 of 11 sentences]
12
[+] score: 33
This strongly suggests that our functional results in conditions of H19 depletion are not due to miR-675 inhibition, but rather to the inhibition of specific functions played by H19 as a lncRNA. [score:5]
We hypothesize that the difference between our results and those described by other Authors [8, 19, 32] may be explained by the different cell lines used, as well as the respective miR-675 expression. [score:3]
Indeed, in the U87 cell line (wi dely employed in previous papers), we only found very low levels of H19 expression, possibly because in those cells H19 is mostly processed as miR-675 precursor. [score:3]
In the context of tumor cells, it was shown to work as a chromatin modifier through the recruitment of EZH2 to the promoter of target genes [4], as a competing endogenous RNA, sponging let-7 [5, 6], and also as the precursor for miR-675, in turn involved in tumorigenesis [7– 12]. [score:3]
However, in both cell lines we found undetectable levels of miR-675-5p expression (data not shown). [score:3]
We demonstrated that endogenous H19 binds to EZH2, and that its depletion is sufficient to induce a general decrease of H3K27 trimethylation that, again, appears to be independent from miR-675 expression. [score:3]
Given that miR-675 is almost undetectable in both A172 and LN229 cell lines, it is unlikely that these functional effects are due to miR-675 expression. [score:3]
In both panels, data are expressed as compared to pCDNA3 -transfected cells, where H19 and miR-675-5p levels are set as = 1. (E) Representative western blot analysis (left) and quantification (right) of H3K27me3 and total H3 (loading control) in the same A172 cells as in D. Results in (C–E) are shown as the mean ± S. D. and represent the average of three experiments performed independently. [score:2]
Imad Matouk, the Hebrew University of Jerusalem, Israel; pCMV-Script H19 mut (BamH1/EcoRI) was generated by mutating the miR-675 sequence within H19 (3 nucleotides in the seed sequence of the miR and 3 nucleotides outside the seed). [score:1]
As H19 is also the precursor of miR-675, we also measured miR-675-5p expression in LN229 and A172 cells, before and after H19 silencing. [score:1]
Even this mutated form of H19, lacking miR-675, was able to increase H3K27 trimethylation (Figure 4E), indicating that miR-675 is not involved in this effect. [score:1]
An important function was shown for H19 in hypoxia -mediated angiogenesis, again via the production of miR-675, which induces HIF1α nuclear translocation and the consequent angiogenic cascade [12]. [score:1]
TBP, ID Hs99999910_m1; NKD1, Hs00263894_m1; RNU6B, ID 001093; hsa-miR-675-5p, 121124_mat. [score:1]
As a further confirmation that H19 plays its role per se, and not simply as the precursor of miR-675, we transfected cells also with p-H19-mut, a vector encoding a mutated form of H19, where miR-675 sequence has been mutated and miR-675 is not produced at all (Figure 4D). [score:1]
In glioblastoma, H19 was first shown to act through its processing into miR-675, in turn repressing Cadherin 13 [8]. [score:1]
The molecular mechanisms described so far for an oncogenic role of H19 in GBM range from H19 processing to produce miR-675 [8, 19] to a function as sponge for miR-29a, in turn boosting tumor angiogenesis [20]. [score:1]
[1 to 20 of 16 sentences]
13
[+] score: 32
Since miR-675 inhibited Nodal Modulator-1 (NOMO-1) expression and overexpression of NOMO-1 rescued the antiproliferative effect of miR-675 [115], it is possible that a mechanism by which miR-675 inhibits trophoblast cell proliferation is to promote Nodal signaling by down -regulating NOMO-1. In addition, targeted deletion of miR-675 in mice resulted in a significant increased in placenta size, accompanied by an increase in miR-675 target genes, including insulin-like growth factor-1 (IGF-1) receptor [124]. [score:14]
IGF-1 is known to promote proliferation and inhibit apoptosis in human trophoblast cells [125], therefore, miR-675 could inhibit placental growth by suppressing IGF signaling. [score:7]
For example, several up-regulated miRNAs in preeclamptic placenta, including miR-210 [83, 105], miR-20b [136], miR-29b [23], miR-16 [25], miR-155 [117] and miR-675 [115], have been demonstrated or suggested to inhibit angiogenesis and/or trophoblast proliferation, migration and invasion. [score:6]
In human choriocarcinoma cell line, JEG-3, inhibition of miR-675 or silencing of H19 promoted cell proliferation [115]. [score:3]
MicroRNA-675, encoded by the imprinted H19 gene, also exerts inhibitory effects on trophoblast cell proliferation. [score:2]
[1 to 20 of 5 sentences]
14
[+] score: 30
Next, we examined whether the inhibition of H19 gene expression affected the expression of miR-675, located at exon 1 of the gene (Figure. [score:7]
Notably, knockdown of H19 gene expression in NCCIT cells had no effect on the expression of miR-675 relative to the control NCCIT cells (Figure. [score:6]
D. miR-675 expression in NCCIT cells was stable, and was not affected by H19 down-regulation as detected by qPCR (n = 3). [score:6]
Notably, H19 knockdown had no effect on mir-675 expression, indicating that the observed effects of H19 knockdown could be attributed exclusively to H19 lncRNA. [score:5]
In addition to the H19 lncRNA, miR-675, a highly conserved microRNA involved in the regulation of developmental genes, is expressed from the H19 gene [2]. [score:5]
The genomic site of miR-675, the target site of H19-shRNA and the primer sites used in qPCR assays are marked. [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 27
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
However, in the present study, our data show that H19mut promotes cell proliferation and upregulates cell-cycle-regulatory genes and there is no difference between the effects of H19wt, which indicates that H19 has other functions in addition to encoding miR-675. [score:5]
Furthermore, transfection of pCDNA-H19wt could increase miR-675 expression by 138-fold, whereas the pCDNA-H19mut vector had no effect on the miR-675 expression (Figure 3E). [score:5]
This difference could be due to different lncRNA molecular mechanisms: 1) H19 contains a microRNA (miR-675) in the first exon [35], which is responsible for its oncogenic activity by regulating the target genes of miR-675 in glioma and prostate cancer. [score:4]
Their work showed that miR-675 enhanced H19 transcription and accelerated hepatocarcinogenesis through H19-target genes, which stimulated us to reveal the biological mechanism of H19 in CRC carcinogenesis. [score:3]
qRT-PCR analysis of H19 and miR-675 levels was performed at 48 h post-transfection and revealed that H19 expression was increased 126-fold after transfection of pCDNA-H19wt and 147-fold of pCDNA-H19mut in CCD-18Co cells, compared with control cells. [score:2]
Because miR-675 is derived from the first exon of H19, a first exon deletion mutant of H19 was also used to examine whether H19 has other functions besides encoding miR-675. [score:1]
Notably, there is no obvious difference between the effects of pCDNA-H19wt and pCDNA-H19mut, which indicates that the effect of H19 on increasing CRC cell proliferation is not mediated by its encoding miR-675. [score:1]
Previously, the oncogenic role of H19 in CRC was reported to be associated with its function as the precursor of miR-675 [14]. [score:1]
This effect of H19 is difficult to explain based on the mechanisms of action that have been previously reported [14] because we did not observe participating of miR-675 in the CRC cells proliferation. [score:1]
Recently, Li and colleagues uncovered some functional relationship between H19 and miR-675 [43]. [score:1]
These data indicate that H19 promotes CRC cell proliferation, and this effect is not associated with its encoding miR-675. [score:1]
Because H19 was reported to be the primary miRNA precursor of miR-675, a mutant H19 transcript vector (pCDNA-H19mut) was also developed by the deletion of the first exon and transfected into CCD-18Co cells to determine whether the function of H19 was due to miR-675 (Figure 3D). [score:1]
The pathological role of H19 in CRC is difficult to explain by the H19/miR-675 mechanism, which has been reported in prostate and glioma carcinoma cells. [score:1]
[1 to 20 of 13 sentences]
16
[+] score: 27
On the other end, H19 serves as a precursor of miR-675 that will in turn, post-translationally regulate a number of targets involved in cell tumorigenicity, including RB, IGFR1, SMAD1, SMAD5, CDC6, NOMO1, or RUNX1 (Cai and Cullen, 2007; Tsang et al., 2010; Gao et al., 2012; Keniry et al., 2012; Dey et al., 2014; Zhuang et al., 2014). [score:6]
The long non-coding RNA H19-derived miR-675 modulates human gastric cancer cell proliferation by targeting tumor suppressor RUNX1. [score:5]
The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. [score:4]
Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. [score:4]
The imprinted H19 gene regulates human placental trophoblast cell proliferation via encoding miR-675 that targets Nodal Modulator 1 (NOMO1). [score:4]
H19 acts on chromatin organization through the recruitment of chromatin modifying complex PRC2 (1) and on post-transcriptional control as a miR decoys sequestering miR-106a and miR-let7 (2) or as a precursor for miR-675-5p and miR-675-3p (3) H19 also interact with p53 (TP53) and inactivate the tumor suppressor protein action (4) Furthermore, possible base pairing between H19 and the antisense transcripts 91H and HOTS may have biological outcomes (5). [score:3]
The H19 long noncoding RNA gives rise to microRNAs miR-675-3p and miR-675-5p to promote skeletal muscle differentiation and regeneration. [score:1]
[1 to 20 of 7 sentences]
17
[+] score: 27
Other miRNAs from this paper: hsa-mir-676
Using bioinformatics miRNA target prediction software indicated hTERT mRNA as a potential, although poorly conserved, target of miR-675-5p. [score:5]
However, no significant change of the expression of miR-675-5p was observed during ATRA treatment of NB4-LR1 cells, which makes it unlikely a direct action of this miRNA on hTERT mRNA level. [score:4]
The expression of miR-675-5p and miR-675-3p was quantified by quantitative RT-PCR. [score:3]
Expression levels of mir-675-5p and mir-675-3p in non -treated (a) and after 1 μM ATRA treatment (b) of NB4-LR1 and NB4-LR1 [SFD] cells. [score:3]
com/miranda-tool), we found that hTERT mRNA was predicted as a potential, target of miR-675-5p, although poorly conserved. [score:3]
Of note only a significant increase of miR-675-3p expression was observed in ATRA -treated NB4-LR1 cells. [score:3]
The expression of miR-675-5p did not exhibit any significant difference either before or after ATRA treatment of NB4-LR1 and NB4-LR1 [SFD]. [score:3]
H19 encodes two conserved miRNAs processed from its first exon, miR-676-5p and miR-675-3p [9]. [score:1]
Quantitative RT- PCR for detection of miR-675-5p and miR-675-3p. [score:1]
H19 as a primary miRNA transcript generates two mature miRNAs, miR-675-3p and miR-675-5p [9]. [score:1]
[1 to 20 of 10 sentences]
18
[+] score: 26
At the same time, due to hypermethylation of the DMR at the Igf2R locus by upregulating expression of the non-signaling IGF-2 receptor (which serves as molecular bin for IGF-2), these cells additionally attenuate responsiveness to circulating IGF-2. During aging, gradual hypermethylation at the Igf2-H19 locus is observed, which leads to an increase in expression of autocrine IGF-2 and a decrease in H19-expressed miR675, which leads to an increase in expression of the IGF-1 and INS receptors. [score:12]
Due to erasure of paternal imprinting at the Igf2-H19 locus, VSELs do not express endogenous IGF-2 and, through the activity of H19 gene-derived miRNA675, downregulate expression of the IGF-1 and INS receptors, which decreases their sensitivity to the circulating IGF-1, INS and IGF-2 activating GH/INS/IGF signaling axis. [score:8]
The same locus also transcribes the non-coding RNA H19, which gives rise to several miRNAs, including miR675-3p and miR675-5p, and these downregulate expression of the respective IGF-1 and INS receptors on VSELs (Fig. 2) [31, 97]. [score:6]
[1 to 20 of 3 sentences]
19
[+] score: 24
Nuclear run on assay showed that excessive CUDR enhanced and CUDR knockdown inhibited the expression of miR21, miR155, miR17, miR675, miR372, miR192 (Figure S5B). [score:5]
3) CUDR overexpression enhanced the expression of miR21, miR155, miR17, miR675, miR372, miR192; 4) CUDR enhanced the loading of pStat3 on the promoter region of CUDR, HOTAIR, MALAT1, HULC, H19. [score:5]
As shown in Figs 6a and S5A, excessive CUDR enhanced and CUDR knockdown inhibited the loading of pStat3 on the promoter region of miR21, miR155, miR17, miR675, miR372, miR192. [score:4]
2) CUDR overexpression increased the miR21, miR155, miR17, miR675, miR372, miR192 promoter luciferase activity. [score:3]
To elucidate whether CUDR alters the expression of microRNAs and lncRNAs through pStat3 under the inflammatory condition, we first performed with anti-pStat3 followed by PCR with miR21, miR155, miR17, miR675, miR372, miR192 promoter primers in IL6 treated hepatocyte-like cells transfected with pCMV6-A-GFP, pCMV6-A-GFP-CUDR, pGFP-V-RS, pGFP-V-RS-CUDR. [score:2]
Excessive CUDR increased and CUDR knockdown decreased the miR21, miR155, miR17, miR675, miR372, miR192 promoter luciferase activity (Fig. 6b). [score:2]
Importantly, the phosphorylated Stat3 loads onto the promoter region of miR21, miR155, miR17, miR675, miR372, miR192, CUDR, HOTAIR, MALAT1, HULC, H19, as well as excessive CUDR and IL6 increases DNA methylation of MEG3, TERRA promoter region. [score:1]
The conclusion is supported by results from nine parallel sets of experiments: 1) CUDR enhanced the loading of pStat3 on the promoter region of miR21, miR155, miR17, miR675, miR372, miR192. [score:1]
That phosphorylated Stat3 loads onto the promoter region of miR21, miR155, miR17, miR675, miR372, miR192, CUDR, HOTAIR, MALAT1, HULC, H19 enhances these noncoding RNAs outcome. [score:1]
[1 to 20 of 9 sentences]
20
[+] score: 24
In addition, Dudek et al. showed that inhibition of H19 downregulated COL2A1, while overexpression of miR-675 rescued COL2A1 expression in H19 -depleted human articular chondrocytes [73]. [score:10]
Katarzyna AD Jérôme EL Aida MS Christopher LM Type II collagen expression is regulated by tissue-specific miR-675 in human articular chondrocytesJ Biol Chem. [score:4]
Co-upregulation of H19, COL2A1, and miRNA-675 was observed in chondrocytes under hypoxic conditions, which were known to stimulate chondrocyte anabolism. [score:4]
When chondrocytes were treated with inflammatory factors IL-1β and TNF-α to induce chondrocyte catabolism, the expression of H19, COL2A1, and miRNA-675 was significantly decreased [72]. [score:3]
Moreover, a significant correlation has been observed among the expression of lncRNA H19, miR-675, and COL2A1 in OA cartilage. [score:3]
[1 to 20 of 5 sentences]
21
[+] score: 23
Additionally, they identified the ubiquitin ligase E3 family (c-CbI and CbI-b) as direct targets of miR-675 in breast cancer cells, providing novel mechanistic insights into a role of lncRNA H19 in breast cancer development [73]. [score:5]
In contrast, it was also reported that miR-675 might represent a MET promoter by downregulating the EMT key mediator Twist-related protein 1 (Twist1) [84, 88, 89]. [score:4]
Moreover, Cai and Cullen have described that H19 is able to function as a precursor of miR-675, suggesting that it might act as a gene -expression regulator at the post-transcriptional level [87]. [score:4]
Hernandez J. M. Elahi A. Clark C. W. Wang J. Humphries L. A. Centeno B. Bloom G. Fuchs B. C. Yeatman T. Shibata D. miR-675 mediates downregulation of Twist1 and Rb in AFP-secreting hepatocellular carcinoma Ann. [score:4]
Vennin and colleagues have shown that an overexpression of H19/ miR-675 enhances breast cancer cell aggressiveness, including an increased proliferation and migration rate in vitro, and increases tumor growth and metastasis in vivo. [score:3]
It has been shown that numerous EMT inducers lead to increased H19/ miR-675 expression. [score:3]
[1 to 20 of 6 sentences]
22
[+] score: 23
Insulin like growth factor 2 (Igf2), which is also targeted by miR-675-3p, is an important regulator of growth and is upregulated in H19 -deficient placenta [88]. [score:7]
H19 is also found to modulate gastric cancer cell proliferation through miR-675, by targeting the gene encoding the tumor suppressor runt domain transcription factor1 (RUNX1). [score:5]
miR-675-3p targets the gene encoding the anti-differentiation TFs smad1 and smad5, which are crucial components of the bone morphogenetic protein (BMP) pathway [86], whereas miR-675-5p targets the gene encoding DNA replication initiation factor Cdc6 [86]. [score:5]
Thus H19/miR-675 regulates the expression of RUNX1 to modulate gastric cancer [89]. [score:4]
In this regard, H19 has a pro-differentiation function in primary myoblasts and regenerating skeletal muscles due to the resulting miR-675-3p and miR-675-5p [86], [87]. [score:1]
Besides the aforementioned roles of H19, exon 1 of H19 also gives rise to miR-675-3p and miR-675-5p (Figure1 D). [score:1]
[1 to 20 of 6 sentences]
23
[+] score: 21
expression is positively correlated with the level of miR-675, and miR-675 down-regulates RB expression [53]. [score:8]
The oncogenic function of/miR-675 is to down-regulate tumor suppressor retinoblastoma (RB) in human CRC cells. [score:6]
This intriguing hypothesis indicates that is derived from miR-675 to regulate CRC development. [score:3]
Fox example, as the precursor of miR-675, can decrease the level of RB [52]. [score:1]
The 3′-UTR of RB mRNA aligned with the sequence of mature miR-675 and the level of RB protein also appears to be negatively correlated with the levels of both and miR-675 in the human colon cancer cells [53]. [score:1]
Furthermore, may form the precursor of miR-675 by an intracellular shearing action [52]. [score:1]
The 3′-UTR of RB mRNA aligns with the sequence of mature miR-675, and the level of RB protein also appears to be negatively correlated with the levels of both and miR-675 in human colon cancer cells [54]. [score:1]
[1 to 20 of 7 sentences]
24
[+] score: 20
Other miRNAs from this paper: hsa-mir-21, hsa-mir-31
For example, the COX-2-lncRNA, PACER, may act as a new potential target for COX-2-modulation in inflammation and cancer[11]; RNAi -mediated knock-down of LINC01081 in normal fetal lung fibroblasts showed that this lncRNA positively regulates FOXF1 transcript level, further indicating that decrease in LINC01081 expression can contribute to development of alveolar capillary dysplasia with misalignment of pulmonary veins[12]; lncRNA HOTAIR may also be a valuable predictor for colon cancer management[13] and MALAT1 might be considered as a potential prognostic indicator and may be a target for diagnosis and gene therapy for pancreatic duct adenocarcinoma [14]; overexpression of lncRNA H19 enhances carcinogenesis and metastasis of gastric cancer and the effect of H19 in GC is mediated by the direct upregulation of ISM1 and the indirect suppression of CALN1 expression via miR-675[15]. [score:20]
[1 to 20 of 1 sentences]
25
[+] score: 18
Li C. et al. (2015) found that miRNA-675, which is derived from the first exon of H19, could regulate the immoderate proliferation and migration of glioma cell lines by inhibiting the expression of CDK6, which is a pivotal regulator of the cell cycle and involved in glioma development (Rader et al., 2013; Sherr et al., 2016). [score:8]
The oncogenic function of H19/miR-675 is dependent on the expression of cancer -associated cadherin 13 (CDH13), which is the direct target of miR-675 (Shi et al., 2014). [score:6]
H19 derived microRNA-675 regulates cell proliferation and migration through CDK6 in glioma. [score:2]
Furthermore, serving as a miRNA precursor, H19 could modulate glioma progression by generating miR-675. [score:1]
Long non-coding RNA H19 promotes glioma cell invasion by deriving miR-675. [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 15
5-Azacytidine inhibits human rhabdomyosarcoma cell growth by downregulating insulin-like growth factor 2 expression and reactivating the H19 gene product miR-675, which negatively affects insulin-like growth factors and insulin signaling. [score:8]
The precise biological role of H19 is unknown, but it has been suggested that mir-675 encoded by H19, has a role in restricting growth or cell proliferation by downregulating Insulin-like growth factor 1 receptor expression [41, 42]. [score:6]
However, the expression level of mir-675 was not measured in this study. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 15
We analyzed the number of validated target genes that were differentially expressed in SCZ individuals and revealed a lower frequency compared with the respective miR-137 targets (Additional file  1: Table S6, differentially expressed targets: let-7a 14%, miR-21-5p 11%, miR-93-5p 14%, miR-451a 0%, and miR-675-5p 0%). [score:10]
We selected the following five microRNAs that are expressed in the DLPFC but are not differentially expressed in SCZ individuals: let-7a, miR-21-5p, miR-93-5p, miR-451a, and miR-675-5p. [score:5]
[1 to 20 of 2 sentences]
28
[+] score: 13
Several miRNAs have been documented to directly inhibit TWIST1, including miR-1-1 [26], miR-33a [27, 28], miR-137 [29], miR-186 [30], miR-300 [31], miR-520d-5p [32], miR-539 [31], miR-543 [31], miR-675 [33], and miR-720 [34]. [score:4]
The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
0168171.g007 Fig 7The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
The expression levels of miR-520d, miR-539, miR-543, and miR-675 in breast cancers were significantly lower than paired normal tissues (Fig 7). [score:3]
[1 to 20 of 4 sentences]
29
[+] score: 13
The possible tumor suppressor-like function of H19 was derived from the observed tumor growth inhibition resulting from the H19 cDNA transfection of G401-transformed kidney cells and the fact that H19 serves as a precursor of microRNA-675 (miR-675) that targets insulin-like growth factor 1 receptor (IGF1R) [24, 25]. [score:7]
Furthermore, H19, as a precursor of miR-675, may antagonize the tumor suppressor function of retinoblastoma (RB) through miR-675 -mediated translational repression, which was reported to be an important mechanism involved in the pathogenesis of human colorectal cancer [42]. [score:5]
Both H19 lincRNA itself and its derived miR-675 has been linked to oncogenesis [23]. [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 12
As shown by a luciferase reporter assay, miR-675 can directly target the voltage -dependent anion channel 1 (VDAC1), thereby forming the H19/miR-675/VDAC1 axis to inhibit apoptosis induced by high glucose. [score:5]
Moreover, H19 can serve as a precursor of miR-675 that will in turn, post-transcriptionally regulate a number of target genes involved in cell proliferation and differentiation [52, 148]. [score:4]
Zhang et al. [144] demonstrated that miR-675 expression was decreased after transfection with H19 siRNA in cardiomyocytes. [score:3]
[1 to 20 of 3 sentences]
31
[+] score: 11
MiR-675 is known to be expressed exclusively in the gestational placenta inhibiting placental growth [56]. [score:4]
Maternal-imprinted H19-derived miR-675 suppresses IGF2-IGFR1 signaling pathway leading to Foxo3 -mediated cell cycle arrest. [score:3]
The expression of miR-675 and H19 has been verified in human cells [57, 58]. [score:3]
From the first exon, H19 transcript produces the oncomir miR-675-5p and miR-675-3p [55]. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 11
Previous reports about H19 in post-transcriptional regulation included that placental specific expression of miR-675 was encoded by H19 at gestational time point to target insulin-like growth factor 1 receptor [55]. [score:6]
Moreover, another reports supported that H19-derived miR-675 targeting TGF-β signaling [40, 56] and tumor suppressor RB [57]. [score:5]
[1 to 20 of 2 sentences]
33
[+] score: 11
H19 is also a precursor for miR-675 and both were found downregulated in HCC cells and their downregulation promotes migration and invasion of HCC via the AKT/GSK-3beta/Cdc25A signaling pathway [77]. [score:7]
Lv J. Ma L. Chen X. L. Huang X. H. Wang Q. Downregulation of lncrnah19 and mir-675 promotes migration and invasion of human hepatocellular carcinoma cells through akt/gsk-3beta/cdc25a signaling pathwayJ. [score:4]
[1 to 20 of 2 sentences]
34
[+] score: 10
This LOI may result in an increase in expression of H19 and mir-675 (a growth suppressor) resulting in SGA and FGR pregnancies. [score:5]
Keniry A. Oxley D. Monnier P. Kyba M. Dandolo L. Smits G. Reik W. The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and IGF1RNat. [score:4]
Two major functions have been described for H19, specifically a modulator for binding small RNAs and proteins [63], and as a source of the miRNA mir-675 [64], this function of H19 has been recently reviewed [65]. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 10
Other miRNAs from this paper: hsa-mir-155, hsa-mir-372, hsa-mir-770
miR-675 is processed from the first exon of and functionally downregulates the tumor suppressor gene retinoblastoma (RB1) in human colorectal cancer, further implying an oncogenic role for [103]. [score:6]
transcripts also serve as a precursor for miR-675, a miRNA involved in the regulation of developmental genes [102]. [score:3]
This arrangement mirrors the presence of miR-675 in, except in that instance the miRNA was exon encoded [102]. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 10
Other miRNAs from this paper: hsa-mir-331
Further adding to the host of oncogenic pathways with the involvement of H19, it serves as a precursor of miR-675, miRNA that down-regulates RB1 tumor suppressor transcript in colorectal cancer (Tsang et al., 2010). [score:6]
Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. [score:4]
[1 to 20 of 2 sentences]
37
[+] score: 9
This region encodes the gene for p57 [KIP2], a key cell cycle inhibitor, as well as the lncRNA, H19, which, in turn, encodes a miRNA (miR-675) that represses expression of the gene for the IGF-1 receptor. [score:5]
Keniry A The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1rNat. [score:4]
[1 to 20 of 2 sentences]
38
[+] score: 9
At the post-transcriptional regulation, lncRNA-H19 could encode the placental specific expression of miR-675 in gestational time point with targeting insulin-like growth factor 1 receptor [53]. [score:6]
Another studies indicated that lncRNA-H19 might work on TGF-β signaling [54] and tumor suppressor RB [55] by miR-675. [score:3]
[1 to 20 of 2 sentences]
39
[+] score: 9
This finding was confirmed in human colon cancer cells, and furthermore, H19/miR-675 was demonstrated to inhibit suppressor RB in colorectal carcinogenesis [45]. [score:5]
In breast cancer, Vennin et al. found that H19, through its mediator-miR-675, could promote tumor growth and metastasis by down -regulating c-Cbl and Cbl-b [46]. [score:2]
Another study also showed that GC metastasis could be enhanced by H19 in vitro and in vivo through H19/miR-675 signalling [22]. [score:1]
H19 was the primary precursor of miR-675 and the biological role of H19 in both humans and mice was also elucidated [44]. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 9
Li et al. illustrated that miR675 inhibits the expression of heterochromatin protein 1α (HP1α), leading to changes in histones. [score:5]
miR675 also upregulates lncRNA H19 via EGR1 activation. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 8
Recently Steck et al reported that expression of this miRNA was elevated in human OA as was the long non-coding RNA, H19, which harbors miR-675 [85]. [score:3]
It will be interesting to further dissect how regulation of chondrocytes by H19/miR-675 and IGF2/miR-483 affects cartilage matrix production and maintenance. [score:2]
In vitro studies showed that miR-675 indirectly affected levels of COL2A1 in differentiated human articular chondrocytes [32]. [score:2]
Interestingly, H19/miR-675 is located within an imprinted domain on human chromosome 11. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 8
Other miRNAs from this paper: mmu-mir-675
However, miR-675 is barely detectable in fetal liver despite the vast levels of H19, suggesting that the expression of miR-675 and H19 is not co-regulated in liver 19. [score:4]
Bottom: qPCR of liver Bcl2, H19, miR-675, and ileum Fgf15 expression in GFP or Bcl2 mice. [score:3]
The miR-675 was encoded in H19 exon1 and was reportedly co-activated with H19 during muscle differentiation 18. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 8
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21a, mmu-mir-675, mmu-mir-21b, mmu-mir-21c
Indeed, Aparna et al. found that the maternal-specific H19-DMR deletion led to the upregulation of Igf2 and to an increase in IGF-1R translation, the latter of which is normally suppressed by H19-derived miR-675 [34]. [score:8]
[1 to 20 of 1 sentences]
44
[+] score: 8
Multiple LncRNAs are demonstrated to be correlated to HCC, Wang et al. [20] indicated that LncRNA-UCA1 up-regulation promotes HCC progression accompanied by miR-216b inhibition, and Lv et al. showed that LncRNA H19 and miR-675 inhibition contributes to migration and invasion of HCC [21]. [score:8]
[1 to 20 of 1 sentences]
45
[+] score: 8
Accordingly, high levels of H19 prompted tumorigenesis by negatively regulating p53 activity in gastric cancer [44], since miR-675, the mature product of H19, can directly target and down-regulate p53 [45]. [score:8]
[1 to 20 of 1 sentences]
46
[+] score: 7
A large number of overexpressed IR-responsive miRNAs that we identified in our work were found to be deregulated in human cancers, such as hsa-mir-513 [55], hsa-mir-744 [56], hsa-mir-92a [57], [58], hsa-mir-1228* [59], hsa-mir-671-5p [60], hsa-mir-638 [38], hsa-mir-370 [61], and hsa-mir-675 [62]. [score:4]
Oncogene 62 Schmitz KJ Helwig J Bertram S Sheu SY Suttorp AC 2011 Differential expression of microRNA-675, microRNA-139-3p and microRNA-335 in benign and malignant adrenocortical tumours. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Another study demonstrated that H19 and hsa-mir-675 were upregulated in human colon cancer cell lines and primary colorectal cancer tissues [43]. [score:4]
For example, lincRNA H19 (H19, imprinted maternally expressed transcript (non-protein coding)), which hosts hsa-mir-675, was implicated in human tumor growth [39] in esophageal [40] and breast cancer [41], and different carcinomas and hepatic metastases [42]. [score:3]
[1 to 20 of 2 sentences]
48
[+] score: 6
Among the fifteen miRNAs in the top group, two miRNAs were highly likely to be upregulated, i. e., hsa-miR-24and hsa-miR-885-5p, whereas thirteen miRNAs were highly likely to be downregulated, i. e., hsa-miR-26b, hsa-let-7b, hsa-miR-185, hsa-miR-142-3p, hsa-miR-29b, hsa-miR-483-5p, hsa-miR-144*, hsa-miR-145*, hsa-miR-629*, hsa-miR-222*, hsa-miR-497, hsa-miR-675 and hsa-miR-106b*, in the eutopic endometrium of patients with endometriosis compared with the controls (Table 2). [score:6]
[1 to 20 of 1 sentences]
49
[+] score: 6
The H19 large intergenic non-coding RNA (lincRNA) is highly expressed in extra-embryonic cell lineages and is a developmental reservoir of miR-675 that suppresses placental growth in the mouse [18]. [score:6]
[1 to 20 of 1 sentences]
50
[+] score: 6
Meanwhile, H19 could serve as precursor of the tumor suppressor gene microRNA-675, attenuating cancer cell motility through the downregulation of TGF-β1 in prostate cancer [17]. [score:6]
[1 to 20 of 1 sentences]
51
[+] score: 6
The most up-regulated miRNAs are: miR-21, miR 17-92 cluster, miR-135a/b, miR-471 and miR-675, whereas miR-143, miR-14, let-7 and miR-101 showed a decreased expression in CRC. [score:6]
[1 to 20 of 1 sentences]
52
[+] score: 6
In addition, H19 serves as a precursor of miRNA-675, which prevents IGF-1R (insulin-like growth factor 1 receptor) expression. [score:3]
Since miRNA-675 may negatively regulate the PI3K-Akt- mTORC1 pathway, this H19/miRNA-675 elevation might contribute to mTORC1 depression in RBS. [score:2]
Moreover, miRNA-675 was also elevated (Fig.   5c), as would be expected based on the elevation in H19. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 6
It would be interesting to investigate if H19 and MIR675 regulate the expression of the GATA3 gene, which is known to play a role in breast cancer development as well as the development and maturation of luminal cells in the mammary gland. [score:4]
H19 is a long non-coding RNA (lncRNA) that harbors the microRNA-675 in its first exon and has been shown to regulate estrogen -induced proliferation of ERα [+] breast cancer cells (Lottin et al. 2002, Cai & Cullen 2007, Keniry et al. 2012). [score:2]
[1 to 20 of 2 sentences]
54
[+] score: 6
It also encodes the conserved microRNAs miR-675-3p and-5p, which target Smad1, Smad5 and Cdc6, and thus promotes skeletal muscle differentiation and regeneration [8]. [score:3]
H19 was shown to promote skeletal muscle differentiation through the Igf2 signaling pathway or miR-675 -mediated gene suppression [8, 9]. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 6
normal controls, four mature miRNAs were significantly differentially expressed: hsa-miR-675-5p was significantly upregulated in UC vs. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
H19 transcripts are precursors for miR-675 which functionally down-regulates the tumor suppressor gene for retinoblastoma in human colorectal cancer [61]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
MiR-675 similarly directly downregulates Twist1 expression, leading to EMT [78] (Figure  2). [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In a rat mo del of selenium deficiency, five miRNAs extracted from harvested heart (miR-374, miR-16, miR-199a-5p, miR-195 and miR-30e*) were identified as upregulated >5-fold in the deficiency group, compared to the selenium-supplemented group, and three were downregulated (miR-3571, miR-675 and miR-450a*). [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 5
Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-424-5p (previous ID: miR-424), miR-221-5p (previous ID: miR-221*), miR-675, miR-647, miR-125a-5p, miR-214-3p (previous ID: miR-214), miR-130b-3p (previous ID: miR-130b), miR-522-3p (previous ID: miR-522), and miR-16-5p (previous ID: miR-16) [18- 21] were found to be up- or downregulated in our analysis. [score:4]
hsa-miR-2355-3p2.000.001622hsa-miR-133b4.300.009926hsa-miR-451a2.200.0108517hsa-miR-4664-3p4.310.000228hsa-miR-130b-3p2.300.0462722hsa-miR-44314.350.003682hsa-miR-486-5p2.320.002088hsa-miR-4804-3p4.360.000235hsa-miR-361-5p2.330.04722Xhsa-miR-18b-3p4.620.00191Xhsa-miR-3156-3p2.500.0072910hsa-miR-675-3p4.680.0002811hsa-miR-4728-3p2.670.0002917hsa-miR-550b-3p4.720.013827hsa-miR-3191-5p2.670.0002019hsa-miR-551a4.750. [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 5
For instance, Zhu M. et al. reported that lncRNA H19-miR-675 axis acts as a suppressor of prostate cancer metastasis by targeting TGFβ1 [39]. [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
Other miRNAs from this paper: mmu-mir-675
Recently, this H19-derived miR-675 was shown to regulate tumor suppressor RB in human colorectal cancer favoring its progression [44]. [score:4]
An evolutionarily conserved microRNA miR675 has been also described in the H19 exon 1 [42], [43]. [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 5
Zhuang M. Gao W. Xu J. Wang P. Shu Y. The long non-coding RNA H19-derived miR-675 modulates human gastric cancer cell proliferation by targeting tumor suppressor RUNX1 Biochem. [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
Several miRNAs are regulated by Sox9 (e. g. miR-140 and miR-455) [13– 15] or regulate Sox9 expression (e. g. miR-675 and miR-145) [16, 17]. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Other miRNAs from this paper: hsa-mir-21, hsa-mir-224
It was found that lncRNA H19 played a trigger role in glioma cell invasion by directly regulating miR-675 expression [23]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
LncRNA Cellular context Function H19 HSC, placentaMaternally expressed imprinted gene important for inhibiting placental growth (69) and maintaining adult hematopoietic stem cell populations (HSC) via miR-675 generation and repression of Igf1r (70) GAS5 T lymphocytes, cancersPlays an essential role in normal growth arrest in T lymphocytes (71). [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
MiR-675 regulates type II collagen in articular chondrocytes [20], miR-18 regulates chodnrocytic phenotype by targeting Ccn2/Ctgf [21]. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Other miRNAs from this paper: hsa-mir-144
H19 is reported to regulate glioma development by driving miR-675 expression, providing important clues for understanding the key roles of the lncRNA-miRNA functional network in glioma [19]. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 4
Other miRNAs from this paper: mmu-mir-675
A recent study has also concluded that H19 plays a crucial role in regulating skeletal muscle differentiation and generation mediated by miR-675-3p and miR-675-5p, which are encoded within H19 by knockdown of H19 in myoblast cells and knockout of H19 in mouse satellite cells, respectively [14]. [score:4]
[1 to 20 of 1 sentences]
69
[+] score: 4
The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. [score:4]
[1 to 20 of 1 sentences]
70
[+] score: 4
Zhu et al. discovered that lncRNA H19 and H19-derived miRNA-675 were significantly downregulated in the metastatic prostate cancer cell line M12 compared with the non-meta-static prostate epithelial cell line [14]. [score:3]
For example, Dey et al. proved that lncRNA H19 would give rise to microRNAs miR-675-3p and miR-675-5p to promote skeletal muscle differentiation and regeneration [7]. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 4
Other miRNAs from this paper: hsa-mir-148a, hsa-mir-152, hsa-mir-184, hsa-mir-148b
Lv J, Lei W, Jin Z, et al. Long noncoding RNA H19-derived miR-675 aggravates restenosis by targeting PTEN. [score:3]
H19 was also documented to stimulate VSMCs proliferation in a miR-675 -dependent manner in the context of restenosis [34]. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 4
miR-675-3p is another recently identified miRNA that promotes muscle differentiation by targeting Smads 1 and 5; interestingly, it is encoded in the exon of a long noncoding RNA, H19, which also plays a critical role in myogenesis [60]. [score:3]
Intriguingly, two conserved miRNAs (miR-675-3p and miR-675-5p) that play important roles during myogenic differentiation were recently found to reside in the first exon of the H19 lncRNA, thus suggesting that H19 lncRNA also serves as a primary miRNA transcript [60]. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 4
Interestingly, H19 encodes miR-675 which regulates tumour suppressor RB in human colorectal cancer 43. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
SET1A cooperates with CUDR to promote liver cancer growth and hepatocyte-like stem cell malignant transformation epigenetically 51. miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer 52. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Other miRNAs from this paper: hsa-mir-137
The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
Other miRNAs from this paper: hsa-mir-122, hsa-mir-370
Liu et al. showed that H19 could regulated the development of cardiac hypertrophy through miR-675/CaMKIIδ pathway [26], indicating that dysregulation of H19 may also contribute to the pathogenesis of ischemic heart failure. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 3
For example, the lncRNA H19 was targeted by miR-29b-3p [35], miR-138-5p [36], miR-141-3p [37], miR-200b/c [38], miR-455-5p [39], and miR-675-5p [40]. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Other miRNAs from this paper: hsa-mir-483, mmu-mir-483, mmu-mir-675
The targets of the Mir483 and Mir675 miRNAs are unknown. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
H19 is capable of regulating the progression of gastric cancer through the H19/miR-675/runt-related transcription factor 1 (RUNX1) signaling axis [69, 70]. [score:2]
Recent studies have shown that transcription of the H19 gene also produces a mature miRNA, namely, miR-675. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 3
Working together with miR-675, H19 promotes HCC invasion so that this type of lncRNA will be a therapeutic target and a potent diagnostic biomarker for hepatocarcinoma [75, 76]. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
For instance, H19-encoded miR-675 could inhibit trophoblast cell proliferation by influencing Nodal signaling (25). [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Other miRNAs from this paper: hsa-mir-483, mmu-mir-483, mmu-mir-675
Bi-maternal misexpression of one or more of these transcripts (too much H19 or Mir675 or missing Igf2as, Mir483 or Ins2) or other, yet unidentied ICR-controlled transcripts, by strict biallelic insulation must contribute to the death of +/(mChβGI) [2] pups. [score:2]
These transcripts, H19 microRNA (Mir675) [75], Igf2 antisense RNAs (Igf2as) [76], [77] and Mir483 within an intron of Igf2 [78] could be also misregulated by biallelic insulation. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 3
Other miRNAs from this paper: mmu-mir-675
H19 sequences that contain miR-675-3p and miR-675-5p were excluded in the probe design to avoid non-specific binding 20. [score:1]
The nucleotide sequences containing miR-675-3p and miR-675-5p were excluded from the design. [score:1]
Dey et al. showed that H19 lncRNA encodes miR-675-3p and miR-675-5p, which stimulate myogenesis. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 3
In these studies, the direct interaction of miR675-5p, HIF1A mRNA and the RNA Binding Protein HuR was also proven [148]. [score:2]
Very recently, a study of Lo Dico and coworkers reported that miR-675-5p embedded in hypoxia -induced long noncoding RNA H19 plays a mandatory role in establishing the hypoxic response and in promoting hypoxia -mediated angiogenesis in human glioma cells [148]. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 3
Zhu et al. reported that lncRNA H19/miR-675 axis represses prostate cancer metastasis by targeting transforming growth factor beta -induced (TGFBI) [10]. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
In addition, miR-675 was identified as a downstream target of lncRNA H19 [21]. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
Verified gene targets of miR-187-3p, miR-486-5p, miR-34a, miR-212-3p, miR-34c-3p, miR-675-5p and miR-3911 were not enriched for GO terms related to cardiac and general toxicity responses. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Eight hsa-miRNAs underwent validation in the discovery samples by qPCR (miR-675-5p, miR-30c-1-3p, miR-483-5p, miR-542-5p, miR-142-3p, miR-223-3p, miR-32-3p, and miR-320a) according to the following criteria: available Exiqon probes, the best hits in bone array (signal intensity and significant differences between the groups), and predicted to target genes involved in bone metabolism. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Dey B. K. Pfeifer K. Dutta A. The H19 long noncoding RNA gives rise to microRNAs miR-675-3p and miR-675-5p to promote skeletal muscle differentiation and regenerationGenes Dev. [score:1]
The lncRNA H19 is enriched in skeletal muscle and encodes two miRNAs, miR-675-3p and miR-675-5p. [score:1]
lncRNAs are also a reservoir of small ncRNAs such as H19 or HULK, which respectively serve as a source for microRNAs miR-675 and miR-37 [28]. [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 3
Other miRNAs from this paper: hsa-mir-145, hsa-mir-125a
For example, lncRNA H19 promotes glioma progression by targeting miR-675 [17]. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 2
Other miRNAs from this paper: hsa-mir-210, hsa-mir-140, hsa-mir-145
Besides the research on miR-140, there are lots of dysregulated miRNAs to be discovered in primary chondrocytes (differentiated versus dedifferentiated cells or normal versus osteoarthritic chondrocytes), such as miR-675 and miR-145 [19– 21]. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
During the preparation of this manuscript, the counterpart was reported as miR-675 in the 293T cell line [56]. [score:1]
The miRNA is sequenced only once from our library, and the novel miRNA ("star" sequence of the miR-675), miR-675b, is sequenced three times. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 1
So far, a variety of miRNAs have been shown to be involved in the pathogenesis of colon cancer, such as miR-34a [33], miR-506 [34], miR-675 [35] and miR-200 [36]. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Dey BK Pfeifer K Dutta A The h19 long noncoding rna gives rise to micrornas mir-675-3p and mir-675-5p to promote skeletal muscle differentiation and regenerationGenes Dev. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
Additionally, a number of the DE miRNAs in this contrast had previously been identified in the pathogenesis of OA including miR-27b [38], miR-483 [39], miR-146 [40], miR-145 [41], and miR-675 [42]. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
This observation is intriguing since H19, a maternally expressed noncoding RNA near Igf2, also is characterized by having an evolutionarily conserved microRNA miR-675 [51]. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Other miRNAs from this paper: hsa-mir-326, hsa-mir-4269
Using this approach, we found four putative extended EST sequences that show high similarity to seven additional small RNAs: hsa-mir-1259, hsa-mir-326, hsa-mir-4269, hsa-mir-675, SNORD12, SNORD12B and SNORD12C. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
However, other microRNAs have not been described in cardiac differentiation, including hsa-mir-675-5p, hsa-mir-585-3p, hsa-mir-1248 and hsa-mir-509-5p. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Other miRNAs from this paper: mmu-mir-675
For example, H19 hosts miR-675 in its first exon 57 58. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
The latter interacts with miR-675 and CaMKII- delta for its cardiac effects, and may form “sponges” for the let-7 miR (Kallen et al., 2013; Liu et al., 2016). [score:1]
[1 to 20 of 1 sentences]