miRNA Search Results

sort by 10 publications mentioning mmu-mir-743a Open access articles that are associated with the species Mus musculus and mention the gene name mir-743a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.
1	[+] score: 36 Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-26b, mmu-mir-141, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-200b, mmu-mir-290a, mmu-mir-291a, mmu-mir-292a, mmu-mir-293, mmu-mir-294, mmu-mir-295, mmu-mir-302a, hsa-mir-141, mmu-mir-200a, mmu-mir-26a-1, mmu-mir-26b, hsa-mir-200c, mmu-mir-200c, mmu-mir-26a-2, mmu-mir-199a-2, mmu-mir-199b, hsa-mir-200a, hsa-mir-302a, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, rno-mir-26a, rno-mir-26b, rno-mir-141, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-205, rno-mir-290, rno-mir-291a, rno-mir-292, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-463, mmu-mir-465a, mmu-mir-471, mmu-mir-367, mmu-mir-291b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-741, mmu-mir-743b, mmu-mir-871, mmu-mir-880, mmu-mir-881, mmu-mir-883a, mmu-mir-883b, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-878, rno-mir-743b, rno-mir-871, rno-mir-878, rno-mir-880, rno-mir-881, rno-mir-883, rno-mir-463, rno-mir-471, rno-mir-743a, hsa-mir-302e, hsa-mir-302f, rno-mir-293, rno-mir-294, rno-mir-295-1, rno-mir-465, rno-mir-3551, rno-mir-291b, rno-mir-3580, rno-mir-741, rno-mir-295-2, rno-mir-6325, mmu-mir-292b, mmu-mir-465d, mmu-mir-290b Several miRNAs, such as members of the miR-183-96-182 cluster, miR-741, miR-881, miR-878, miR-743a, miR-743b, miR-465, miR-871, miR-880, are known to be expressed in mouse ESCs and were also expressed in rat PSCs; however, their function in pluripotency induction and regulation has not been directly shown 48– 50. [score:7] We also analysed the expression of the rno-miR-novel-8 miRNA, rno-miR-sno-57 miRNA, miR-741-3p, and miR-743a-3p, which are upregulated in PSCs during differentiation. [score:6] Using qPCR, we have shown that members of the miR-741-3p and miR-743a-3p clusters were expressed at high levels in rat ESCs and iPSCs and were downregulated during differentiation. [score:6] rno-miR-novel-8, rno-homolog-miR-26, and rno-homolog-miR-199 miRNAs were selected from Tier 1, and rno-miR-sno-57 miRNA was selected from Tier 2. In addition, we analysed the expression of miR-741-3p and miR-743a-3p and found that, in accordance with sequencing data, they were highly expressed in rat PSCs. [score:5] qRT-PCR analysis demonstrated that the rno-miR-novel-8 and rno-miR-sno-57 miRNAs as well as the known miRNAs miR-741-3p and miR-743a-3p were expressed in rat PSCs and absent in rat EFs (Fig. 4a). [score:3] We found that miR-741-3p, miR-743a-3p, and rno-miR-novel-8 miRNA were expressed in the testis at levels comparable to that in PSCs. [score:3] A cluster of miRNAs, comprised of miR-463, miR-465, miR-471, miR-741, miR-743a, miR-743b, miR-871, miR-878, miR-880, miR-881, and miR-883, was located on the X chromosome and was expressed at a high level in rat PSCs according to the sequencing data. [score:3] We found that rat miR-295-3p, miR-741-3p and miR-743a-3p expression was significantly decreased during ESC and iPSC differentiation (Fig. 4b). [score:3] [1 to 20 of 8 sentences]
2	[+] score: 34 Other miRNAs from this paper: mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-140, mmu-mir-34c, mmu-mir-351, mmu-mir-10a, mmu-mir-222, mmu-mir-125b-1, mmu-mir-700 Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 To test whether inhibition/overexpression of these candidate miRNAs in the F28-7 cells modulate FUdR -induced cell death, we have done transfections of the miRNA inhibitors and/or the synthetic miRNA mimics. [score:7] Using 1.5-fold cut-off, the analysis identified seven differentially expressed miRNAs: in F28-7-A (apoptosis-fated cell), four mature miRNAs (miR-700, miR-743a, miR-140, miR-351) were expressed at higher levels, and three mature miRNAs (miR-222, miR-34c, miR-132) were expressed at lower levels than in F28-7 (necrosis-fated cell). [score:7] These findings suggest that the expression of miR-743a plays a key role in FUdR -induced apoptosis. [score:3] As shown in Fig 1A–1D, miR-700, miR-743a, miR-140, and miR-351 were expressed at higher levels in F28-7-A than in F28-7 cells. [score:3] Furthermore, this phenotypic screening by using miRNA mimics showed that the higher expression of miR-743a in F28-7 by the synthetic miR-743a mimic can cause a shift from FUdR -induced necrosis to apoptosis (S1 Fig). [score:3] Higher expression of miR-743a shifts the FUdR -induced cell death morphologies from necrosis to apoptosis. [score:3] Expression of (A) miR-700, (B) miR-743a, (C) miR-140, (D) miR-351, (E) miR-222, (F) miR-34c, (G) miR-132, and RNU6B were analyzed by quantitative real-time PCR using primers for miR-700-3p, miR-743a-3p, miR-140-3p, miR-351-5p, miR-222-3p, miR-34c-3p, miR-132-3p, and RNU6B (see ). [score:2] Therefore, we assumed that the miR-700, miR-743a, miR-140, miR-351, miR-222, and miR-132 were candidate miRNAs as cell-death regulators in necrosis and apoptosis. [score:2] S1 Fig(A) F28-7 cells were transfected with nonsilencing siRNA (NSsi), and with mature miR-743a-3p mimic (miR743am). [score:1] It is important to further investigate the relationship between the miR-743a expression and these two-types of cell death, necrosis and apoptosis. [score:1] Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 Total small RNA fractions were prepared from F28-7 and F28-7-A cells (no drug, no incubation). [score:1] At 48 h after the transfection, the levels of miR-743a-3p and RNU6B (an internal standard) were analyzed by quantitative real-time PCR. [score:1] [1 to 20 of 12 sentences]
3	[+] score: 16 Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-132, mmu-mir-145a, mmu-mir-146a, mmu-mir-181a-2, mmu-mir-205, mmu-mir-143, mmu-mir-296, mmu-let-7d, mmu-mir-130b, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-17, mmu-mir-25, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-181b-2, mmu-mir-434, mmu-mir-465a, mmu-mir-592, mmu-mir-181d, mmu-mir-743b, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-465d Several members of the miR-465 and miR-743 families were up-regulated in both young and aged df/df mice, although they were expressed at lower levels than the previously discussed miRNAs. [score:6] While little is known about miR-743, one study demonstrated that miR-743 is down-regulated by increased oxidative stress, which in turn increases translation of genes involved in cellular protection mechanisms [67]. [score:6] Up-regulation of the mitochondrial malate dehydrogenase by oxidative stress is mediated by miR-743a. [score:4] [1 to 20 of 3 sentences]
4	[+] score: 10 Other miRNAs from this paper: mmu-mir-152, mmu-mir-465a, mdo-mir-152, mmu-mir-743b, mmu-mir-880, mmu-mir-883b, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-465d The miRNA expression profiling of sterile (PWD×B6)F1 and fertile (B6×PWD)F1 14.5dpp testes showed 1.5- to 2-fold upregulation of Mir883b-3p, Mir465a/b/c-3p and Mir465a/b-5p in sterile males, while Mir743a, Mir743-5p, Mir880 and Mir465c-5p showed 1.2- to 4-fold down-regulation (Figure 3C, D). [score:9] Search of miRNA sequences revealed one SNP in the seed sequence of Mir743a, changing AAAGACA in B6 to AAAGACG in PWD (Table 1). [score:1] [1 to 20 of 2 sentences]
5	[+] score: 9 Other miRNAs from this paper: mmu-mir-134, mmu-mir-152, mmu-mir-10b, mmu-mir-200a, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-431, mmu-mir-369, mmu-mir-1224, mmu-mir-679, mmu-mir-495 The second gene of interest is Nmnat1, which was downregulated (–1.24-fold change and P=0.01), whereas its three predicted target miRNAs (mir-1224, mir-431 and mir-743a) were upregulated (Fig. 7). [score:9] [1 to 20 of 1 sentences]
6	[+] score: 4 Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-24-1, mmu-mir-190a, mmu-mir-122, dme-mir-133, mmu-let-7d, dme-let-7, dme-mir-125, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-322, mmu-mir-345, mmu-mir-135b, mmu-mir-17, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-125b-1, mmu-mir-133a-2, mmu-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-465a, mmu-mir-486a, mmu-mir-547, mmu-mir-3099, mmu-mir-449c, mmu-mir-700, mmu-mir-450b, mmu-mir-190b, dme-mir-190, mmu-mir-1195, mmu-mir-486b, mmu-mir-133c, mmu-let-7j, mmu-let-7k However, the particular cluster on the X chromosome highly expressed in ovaries (miR-450b to miR-322) is centromeric to a similar cluster in testes (miR-743a to miR-465a). [score:3] This region (including mir-743a to mir-547) represents a discontinuity in the synteny between rodents and primates. [score:1] [1 to 20 of 2 sentences]
7	[+] score: 3 Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-125b-2, mmu-mir-128-1, mmu-mir-134, mmu-mir-146a, mmu-mir-155, mmu-mir-143, mmu-let-7d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-34a, mmu-mir-98, mmu-mir-330, mmu-mir-350, mmu-mir-210, mmu-mir-125b-1, mmu-mir-128-2, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-146b, mmu-let-7j, mmu-let-7k, mmu-mir-692-3 No significant correlations were found between the miR-350 mimic or inhibitor and the level of Mmp3, and likewise for miR-743a and Mmp10 and for miR-143/miR-692 and Mmp13 (Figure 2C). [score:3] [1 to 20 of 1 sentences]
8	[+] score: 3 Other miRNAs from this paper: mmu-mir-34c, mmu-mir-718, mmu-mir-743b, mmu-mir-878 To test this possibility, we first examined the levels of miRNAs known to be expressed in spermatocytes (miR-34C, miR-743, and miR-878) and spermatogonia (miR-718) [33, 40] by Taqman analysis. [score:3] [1 to 20 of 1 sentences]
9	[+] score: 1 Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-30a, hsa-mir-100, mmu-let-7g, mmu-let-7i, mmu-mir-30a, mmu-mir-30b, mmu-mir-182, mmu-mir-187, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-182, hsa-mir-187, mmu-mir-290a, mmu-mir-294, mmu-mir-299a, mmu-mir-302a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-30b, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-17, mmu-mir-100, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-371a, hsa-mir-372, hsa-mir-373, mmu-mir-133b, hsa-mir-133b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-520e, hsa-mir-515-1, hsa-mir-519e, hsa-mir-515-2, hsa-mir-519c, hsa-mir-520a, hsa-mir-519b, hsa-mir-520b, hsa-mir-517a, hsa-mir-519d, hsa-mir-521-2, hsa-mir-521-1, mmu-mir-367, hsa-mir-628, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-743b, hsa-mir-888, hsa-mir-302e, hsa-mir-302f, hsa-mir-371b, mmu-mir-299b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-290b In contrast, miR-743-5p showed no difference, probably because this miRNA had an extremely low value in TTF. [score:1] [1 to 20 of 1 sentences]
10	[+] score: 1 Other miRNAs from this paper: mmu-mir-201, mmu-mir-463, mmu-mir-471, mmu-mir-547 We focused on nine miRNAs (cluster 1: miR-743A, -471-5p, -741, -463, -880, -878-5p and -871; cluster 2: miR-201 and -547) located in two clusters on the X chromosome. [score:1] [1 to 20 of 1 sentences]

sort by

10 publications mentioning mmu-mir-743a

Open access articles that are associated with the species Mus musculus and mention the gene name mir-743a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 36

Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-26b, mmu-mir-141, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-200b, mmu-mir-290a, mmu-mir-291a, mmu-mir-292a, mmu-mir-293, mmu-mir-294, mmu-mir-295, mmu-mir-302a, hsa-mir-141, mmu-mir-200a, mmu-mir-26a-1, mmu-mir-26b, hsa-mir-200c, mmu-mir-200c, mmu-mir-26a-2, mmu-mir-199a-2, mmu-mir-199b, hsa-mir-200a, hsa-mir-302a, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, rno-mir-26a, rno-mir-26b, rno-mir-141, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-205, rno-mir-290, rno-mir-291a, rno-mir-292, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-463, mmu-mir-465a, mmu-mir-471, mmu-mir-367, mmu-mir-291b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-741, mmu-mir-743b, mmu-mir-871, mmu-mir-880, mmu-mir-881, mmu-mir-883a, mmu-mir-883b, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-878, rno-mir-743b, rno-mir-871, rno-mir-878, rno-mir-880, rno-mir-881, rno-mir-883, rno-mir-463, rno-mir-471, rno-mir-743a, hsa-mir-302e, hsa-mir-302f, rno-mir-293, rno-mir-294, rno-mir-295-1, rno-mir-465, rno-mir-3551, rno-mir-291b, rno-mir-3580, rno-mir-741, rno-mir-295-2, rno-mir-6325, mmu-mir-292b, mmu-mir-465d, mmu-mir-290b

Several miRNAs, such as members of the miR-183-96-182 cluster, miR-741, miR-881, miR-878, miR-743a, miR-743b, miR-465, miR-871, miR-880, are known to be expressed in mouse ESCs and were also expressed in rat PSCs; however, their function in pluripotency induction and regulation has not been directly shown 48– 50. [score:7]

We also analysed the expression of the rno-miR-novel-8 miRNA, rno-miR-sno-57 miRNA, miR-741-3p, and miR-743a-3p, which are upregulated in PSCs during differentiation. [score:6]

Using qPCR, we have shown that members of the miR-741-3p and miR-743a-3p clusters were expressed at high levels in rat ESCs and iPSCs and were downregulated during differentiation. [score:6]

rno-miR-novel-8, rno-homolog-miR-26, and rno-homolog-miR-199 miRNAs were selected from Tier 1, and rno-miR-sno-57 miRNA was selected from Tier 2. In addition, we analysed the expression of miR-741-3p and miR-743a-3p and found that, in accordance with sequencing data, they were highly expressed in rat PSCs. [score:5]

qRT-PCR analysis demonstrated that the rno-miR-novel-8 and rno-miR-sno-57 miRNAs as well as the known miRNAs miR-741-3p and miR-743a-3p were expressed in rat PSCs and absent in rat EFs (Fig. 4a). [score:3]

We found that miR-741-3p, miR-743a-3p, and rno-miR-novel-8 miRNA were expressed in the testis at levels comparable to that in PSCs. [score:3]

A cluster of miRNAs, comprised of miR-463, miR-465, miR-471, miR-741, miR-743a, miR-743b, miR-871, miR-878, miR-880, miR-881, and miR-883, was located on the X chromosome and was expressed at a high level in rat PSCs according to the sequencing data. [score:3]

We found that rat miR-295-3p, miR-741-3p and miR-743a-3p expression was significantly decreased during ESC and iPSC differentiation (Fig. 4b). [score:3]

[1 to 20 of 8 sentences]

[+] score: 34

Other miRNAs from this paper: mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-140, mmu-mir-34c, mmu-mir-351, mmu-mir-10a, mmu-mir-222, mmu-mir-125b-1, mmu-mir-700

Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 To test whether inhibition/overexpression of these candidate miRNAs in the F28-7 cells modulate FUdR -induced cell death, we have done transfections of the miRNA inhibitors and/or the synthetic miRNA mimics. [score:7]

Using 1.5-fold cut-off, the analysis identified seven differentially expressed miRNAs: in F28-7-A (apoptosis-fated cell), four mature miRNAs (miR-700, miR-743a, miR-140*, miR-351) were expressed at higher levels, and three mature miRNAs (miR-222, miR-34c*, miR-132) were expressed at lower levels than in F28-7 (necrosis-fated cell). [score:7]

These findings suggest that the expression of miR-743a plays a key role in FUdR -induced apoptosis. [score:3]

As shown in Fig 1A–1D, miR-700, miR-743a, miR-140*, and miR-351 were expressed at higher levels in F28-7-A than in F28-7 cells. [score:3]

Furthermore, this phenotypic screening by using miRNA mimics showed that the higher expression of miR-743a in F28-7 by the synthetic miR-743a mimic can cause a shift from FUdR -induced necrosis to apoptosis (S1 Fig). [score:3]

Higher expression of miR-743a shifts the FUdR -induced cell death morphologies from necrosis to apoptosis. [score:3]

Expression of (A) miR-700, (B) miR-743a, (C) miR-140*, (D) miR-351, (E) miR-222, (F) miR-34c*, (G) miR-132, and RNU6B were analyzed by quantitative real-time PCR using primers for miR-700-3p, miR-743a-3p, miR-140-3p, miR-351-5p, miR-222-3p, miR-34c-3p, miR-132-3p, and RNU6B (see ). [score:2]

Therefore, we assumed that the miR-700, miR-743a, miR-140*, miR-351, miR-222, and miR-132 were candidate miRNAs as cell-death regulators in necrosis and apoptosis. [score:2]

S1 Fig(A) F28-7 cells were transfected with nonsilencing siRNA (NSsi), and with mature miR-743a-3p mimic (miR743am). [score:1]

It is important to further investigate the relationship between the miR-743a expression and these two-types of cell death, necrosis and apoptosis. [score:1]

Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 Total small RNA fractions were prepared from F28-7 and F28-7-A cells (no drug, no incubation). [score:1]

At 48 h after the transfection, the levels of miR-743a-3p and RNU6B (an internal standard) were analyzed by quantitative real-time PCR. [score:1]

[1 to 20 of 12 sentences]

[+] score: 16

Several members of the miR-465 and miR-743 families were up-regulated in both young and aged df/df mice, although they were expressed at lower levels than the previously discussed miRNAs. [score:6]

While little is known about miR-743, one study demonstrated that miR-743 is down-regulated by increased oxidative stress, which in turn increases translation of genes involved in cellular protection mechanisms [67]. [score:6]

Up-regulation of the mitochondrial malate dehydrogenase by oxidative stress is mediated by miR-743a. [score:4]

[1 to 20 of 3 sentences]

[+] score: 10

Other miRNAs from this paper: mmu-mir-152, mmu-mir-465a, mdo-mir-152, mmu-mir-743b, mmu-mir-880, mmu-mir-883b, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-465d

The miRNA expression profiling of sterile (PWD×B6)F1 and fertile (B6×PWD)F1 14.5dpp testes showed 1.5- to 2-fold upregulation of Mir883b-3p, Mir465a/b/c-3p and Mir465a/b-5p in sterile males, while Mir743a, Mir743-5p, Mir880 and Mir465c-5p showed 1.2- to 4-fold down-regulation (Figure 3C, D). [score:9]

Search of miRNA sequences revealed one SNP in the seed sequence of Mir743a, changing AAAGACA in B6 to AAAGACG in PWD (Table 1). [score:1]

[1 to 20 of 2 sentences]

[+] score: 9

Other miRNAs from this paper: mmu-mir-134, mmu-mir-152, mmu-mir-10b, mmu-mir-200a, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-431, mmu-mir-369, mmu-mir-1224, mmu-mir-679, mmu-mir-495

The second gene of interest is Nmnat1, which was downregulated (–1.24-fold change and P=0.01), whereas its three predicted target miRNAs (mir-1224, mir-431 and mir-743a) were upregulated (Fig. 7). [score:9]

[1 to 20 of 1 sentences]

[+] score: 4

However, the particular cluster on the X chromosome highly expressed in ovaries (miR-450b to miR-322) is centromeric to a similar cluster in testes (miR-743a to miR-465a). [score:3]

This region (including mir-743a to mir-547) represents a discontinuity in the synteny between rodents and primates. [score:1]

[1 to 20 of 2 sentences]

[+] score: 3

Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-125b-2, mmu-mir-128-1, mmu-mir-134, mmu-mir-146a, mmu-mir-155, mmu-mir-143, mmu-let-7d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-34a, mmu-mir-98, mmu-mir-330, mmu-mir-350, mmu-mir-210, mmu-mir-125b-1, mmu-mir-128-2, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-146b, mmu-let-7j, mmu-let-7k, mmu-mir-692-3

No significant correlations were found between the miR-350 mimic or inhibitor and the level of Mmp3, and likewise for miR-743a and Mmp10 and for miR-143/miR-692 and Mmp13 (Figure 2C). [score:3]

[1 to 20 of 1 sentences]

[+] score: 3

Other miRNAs from this paper: mmu-mir-34c, mmu-mir-718, mmu-mir-743b, mmu-mir-878

To test this possibility, we first examined the levels of miRNAs known to be expressed in spermatocytes (miR-34C, miR-743, and miR-878) and spermatogonia (miR-718) [33, 40] by Taqman analysis. [score:3]

[1 to 20 of 1 sentences]

[+] score: 1

Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-30a, hsa-mir-100, mmu-let-7g, mmu-let-7i, mmu-mir-30a, mmu-mir-30b, mmu-mir-182, mmu-mir-187, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-182, hsa-mir-187, mmu-mir-290a, mmu-mir-294, mmu-mir-299a, mmu-mir-302a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-30b, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-17, mmu-mir-100, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-371a, hsa-mir-372, hsa-mir-373, mmu-mir-133b, hsa-mir-133b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-520e, hsa-mir-515-1, hsa-mir-519e, hsa-mir-515-2, hsa-mir-519c, hsa-mir-520a, hsa-mir-519b, hsa-mir-520b, hsa-mir-517a, hsa-mir-519d, hsa-mir-521-2, hsa-mir-521-1, mmu-mir-367, hsa-mir-628, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-743b, hsa-mir-888, hsa-mir-302e, hsa-mir-302f, hsa-mir-371b, mmu-mir-299b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-290b

In contrast, miR-743-5p showed no difference, probably because this miRNA had an extremely low value in TTF. [score:1]

[1 to 20 of 1 sentences]

[+] score: 1

Other miRNAs from this paper: mmu-mir-201, mmu-mir-463, mmu-mir-471, mmu-mir-547

We focused on nine miRNAs (cluster 1: miR-743A, -471-5p, -741, -463, -880, -878-5p and -871; cluster 2: miR-201 and -547) located in two clusters on the X chromosome. [score:1]

[1 to 20 of 1 sentences]

miRBase

10 publications mentioning mmu-mir-743a