sort by

19 publications mentioning bta-mir-181c

Open access articles that are associated with the species Bos taurus and mention the gene name mir-181c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 35
Our results demonstrated that when isolated bovine neutrophils were supplemented with quercetin and later stimulated by E. coli LPS, some miRNA gene expression levels were downregulated, mainly under the control of aforementioned quercetin action, regardless of the inflammatory miRNAs (MIR24-2, MIR181C) or anti-inflammatory miRNAs (MIR146A) [31]. [score:6]
-treated neutrophils exhibited a remarkable suppression in MIR24-2, MIR146A, and MIR181C expression. [score:5]
As outlined in Table-1, quercetin -treated neutrophils exhibited a remarkable suppression in MIR24-2, MIR146A and MIR181C expression as compared with the untreated cells (Table-1). [score:4]
In this regard, IL6, IL8, and miR-181 expression were found to have an inversely proportional relationship [41, 42]. [score:3]
According to Galicia et al. [41] and Zhang et al., [42] the miR-181 family is differentially expressed in the presence of LPS -induced inflammation. [score:3]
Besides TLR4 and TNF, which are postulated to be the targets of MIR146A and MIR181C, respectively, IL1B, IL6, and CXCL8 may also be partially controlled and linked by MIR146A and MIR181C. [score:3]
For miRNA gene expression, a positive correlation has been significantly observed between MIR146A and MIR181C; however, a negative correlation was found between MIR24-2 and MIRLET7E. [score:3]
Many proinflammatory genes (IL1B, IL6, and CXCL8) and the pathogen receptor TLR4 had a negative correlation with MIR146A and MIR181C as revealed by Pearson correlation. [score:1]
To investigate gene expression of microRNA (miRNA) milieus (MIRLET7E, MIR17, MIR24-2, MIR146A, and MIR181C), inflammatory cytokine genes (interleukin 1β [IL1B], IL6, CXCL8, and tumor necrosis factor [TNF]), and the pathogen receptor toll-like receptor (TLR4) in bovine neutrophils under quercetin supplementation. [score:1]
The elevated level of MIR181C may contribute to the reduction of CXCL8. [score:1]
miRNAs PBS p value MIRLET7E 1.001±0.013 (n=11) 1.171±0.071 (n=11) 0.028 MIR17 0.994±0.014 (n=10) 1.185±0.247 (n=10) 0.447 MIR24-2 1.000±0.009 (n=12) 0.723±0.118 (n=12) 0.029 MIR146A 1.000±0.006 (n=11) 0.784±0.086 (n=11) 0.021 MIR181C 1.001±0.004 (n=12) 0.855±0.066 (n=12) 0.037 PBS=Phosphate buffered saline, miRNAs=MicroRNA Quercetin clearly possesses an anti-inflammatory property toward proinflammatory cytokine genes in mammalian neutrophils, macrophages, and macrophage cell lines [19, 20, 24, 26, 27]. [score:1]
Similarly, the miR-181 family and IL8 are also linked to TLR activation. [score:1]
This study was designed to investigate the gene expression of miRNAs (MIRLET7E, MIR17, MIR24-2, MIR146A, and MIR181C) and inflammatory cytokine genes (IL1B, IL6, CXCL8, toll-like receptor [TLR4], and TNF) in bovine neutrophils under supplementation of quercetin during the induction of inflammation by bacterial lipopolysaccharide (LPS). [score:1]
miRNAs PBS p value MIRLET7E 1.001±0.013 (n=11) 1.171±0.071 (n=11) 0.028 MIR17 0.994±0.014 (n=10) 1.185±0.247 (n=10) 0.447 MIR24-2 1.000±0.009 (n=12) 0.723±0.118 (n=12) 0.029 MIR146A 1.000±0.006 (n=11) 0.784±0.086 (n=11) 0.021 MIR181C 1.001±0.004 (n=12) 0.855±0.066 (n=12) 0.037 PBS=Phosphate buffered saline, miRNAs=MicroRNA clearly possesses an anti-inflammatory property toward proinflammatory cytokine genes in mammalian neutrophils, macrophages, and macrophage cell lines [19, 20, 24, 26, 27]. [score:1]
On the contrary, MIR24-2, MIR146A, MIR181C and IL1B, TLR4, TNF demonstrated an opposite trend. [score:1]
[1 to 20 of 15 sentences]
2
[+] score: 23
Specifically, miR181-a is present in both bovine oocytes and embryos with increased expression in early stages of development then drops to low levels in the blastocyst and is thought to regulate nucleoplasmin2 a protein important in nuclear organization (Lingenfelter et al., 2011). [score:5]
Activin and TGF beta regulate expression of the microRNA-181 family to promote cell migration and invasion in breast cancer cells. [score:4]
Cutting edge: microRNA-181 promotes human NK Cell development by regulating notch signaling. [score:3]
MiR-181 and miR-370 were found to be expressed in the control media regardless of BSA supplementation (Table 3). [score:3]
When BSA was not supplemented in SOF media, miR-181 showed expression though right at threshold cut off in one blastocyst pool and was not detected in the second pool making the data not conclusive. [score:3]
In BSA supplemented media, the expression of both miR-181 and miR-370 was detected though not statistically significantly different between embryos of varying quality or above the baseline control. [score:3]
MiR-181 has been associated with roles in genes relating to cancer (Neel and Lebrun, 2013), immune function through NK cell development (Cichocki et al., 2011) and embryonic development (Lingenfelter et al., 2011). [score:2]
[1 to 20 of 7 sentences]
3
[+] score: 23
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
In addition, the expression of 12 miRNA families including miR-130 (a, b), bta-miR-181 (a, b, c, d), bta-miR-199 (a-3p, a-5p, b, c), bta-miR-2285 (k, t), bta-miR-2411 (- 3p,-5p), bta-miR-2483 (- 3p,-5p), bta-miR-29 (a, b), bta-miR-339 (a, b), bta-miR-365 (- 3p,-5p), bta-miR-455 (- 3p,-5p), bta-miR-92, and bta-miR-99 (a,-5p, b) were differentially expressed between the granulosa cells of SF and DF (Table 1). [score:5]
Thus, alteration in the expression of miR-181 family may result in dysregulation of programmed cell death and cell proliferation in granulosa cells of the subordinate follicles. [score:4]
Similar to miR-199 families, the miR-181 family members namely, miR-181a,-miR-181b, miR-181c, miR-181d were also downregulated in granulosa cells of SF. [score:4]
Moreover, the expression of 13 miRNA families including bta-miR-29 (a, b, c, d), bta-miR-449 (a, b, c), bta-miR-181 (a, b, c, d), bta-miR-455 (-3p,-5p), bta-miR-99 (b, a-5p) and bta-miR-2483 (-5p,-3p) were co -overexpressed or co-repressed at day 7 compared to day 3 (Table 2). [score:4]
The other family member of miR-181, namely, miR-181b is also associated with cell proliferation and inhibited cell apoptosis in cervical cancer cells [56]. [score:3]
In the current study, the bioinformatic analysis showed that ACTR2A gene was found to be potentially targeted by all these miR-181 family members. [score:3]
[1 to 20 of 6 sentences]
4
[+] score: 16
MiR-181a overexpression or SIRT1 knockdown impairs glucose and lipid metabolism in vivoTo explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:9]
To explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:6]
uk/) showed that four miR-181s, namely, miR-181a, miR-181b, miR-181c, and miR-181d, have been identified previously. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 11
miR-181, for example, promotes myoblast differentiation by down -regulating the translation of homeobox protein Hox-A11, which inhibits MyoD expression [37]. [score:8]
Naguibneva I. Ameyar-Zazoua M. Polesskaya A. Ait-Si-Ali S. Groisman R. Souidi M. Cuvellier S. Harel-Bellan A. The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation Nat. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
It was reported that miR-181c/d can inhibit cell cycle and proliferation and that miR-181c regulates TNF-α[65]. [score:4]
The miR-181 (181a/b/c/d) family is related to the development of different cells. [score:2]
Among all miRNAs clusters, there were several pre-miRNAs with intervening sequences of less than 1 kb, including 10 known clusters (miR-99b/let-7e/125a, miR-24-2/27b/23b, miR-99a/let-7c, miR-29b/29a, miR-221/222, miR-98/let-7f, miR-181c/d, miR-363/92a/19b-2/106a, miR-363/92a/19b-2, miR-181b-1/181a-1 and miR-17/18a/19b-1/92a-1) and 4 novel miRNAs clusters (cluster 3, 9, 12, 22). [score:1]
In the miR-181 family, miR-181a and miR-181b were dominant types with 13,345 reads and 3,333 reads, respectively. [score:1]
The let-7 family had 9 members, miR-181 family had 4 members (miR-181a/b/c/d) and miR-30 family had 5 members (miR-30a/b/c/d/e). [score:1]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 8
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-151, bta-mir-30d, bta-mir-320a-2, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-34b, bta-mir-107, bta-mir-15b, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-138-2, bta-mir-214, bta-mir-455, bta-mir-93, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-105b, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-138-1, bta-mir-152, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-206, bta-mir-30f, bta-mir-409a, bta-mir-432, bta-mir-486, bta-mir-495, bta-mir-543, bta-mir-9-1, bta-mir-9-2, bta-mir-1185, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2384, bta-mir-2284v, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2424, bta-mir-2284r, bta-mir-2284h, bta-mir-2404-2, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-424, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac
Similarly, overexpression of miR-181 during muscle differentiation is important to promote myogenesis by down -regulating the homeobox protein Hox-A11, an inhibitor of muscle differentiation [12]. [score:6]
This was also the case for some other miRNA families, such as bta-let-7 (from 6 to 1,434,682 reads), bta-miR-30 (from 34 to 12,681 reads) and bta-miR-181 (from 376 to 20,258 reads). [score:1]
The largest miRNA family size identified was miR-2284, which consisted of 12 members, and let-7, miR-30, and miR-181/376 possessed 9, 7, and 4 members, respectively; whereas other miRNA families such as miR-1, miR-31, miR-93, and miR-206 had only one member (Additional file 1). [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 7
For example, miR-29, miR-181 and miR-148a can promote myoblast differentiation by inhibiting the expression of downstream target genes Akt3, Hox-A1 and ROCK1 at protein levels [10– 12]. [score:7]
[1 to 20 of 1 sentences]
9
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
10
[+] score: 6
Similarly, overexpression of miR-181 during muscle differentiation is important to promote myogenesis by down -regulating the homeobox protein Hox-A11, an inhibitor of muscle differentiation [10]. [score:6]
[1 to 20 of 1 sentences]
11
[+] score: 6
MiR-141 mimic, miR-141 inhibitor, miR-181 mimic, miR-199a mimic, miR-484 mimic and miR-500 mimic were individually transfected into Mac-T cells. [score:3]
Mimics of miR-125b, miR-141, miR-181, miR-199a, miR-484 and miR-500 and the antisense inhibitor miR-141 were transfected by Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s protocol. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Interestingly, the expression level of certain miRNA families namely, the let 7 family (let-7a, let-7c, let-7d, let-7d*, let-7e, let-7f, let-7i), miR-181 family (miR-181a, miR-181b), miR-30 family (miR-30b*, miR-30c-2*, miR-30e ), miR-425 family (miR-425, miR-425*), miR-92 family (miR-92a, miR-92a-1*, miR-92b) and miR-196 family (miR-196a, and miR-196b) were repressed in SE animal group. [score:3]
However, 29 miRNAs such as miR-890*, miR-296-5p, miR-617, miR-181c*, miR-889, miR-520a-5p and miR-641 were absent in SE but these miRNAs were detected in HE and CE animals (Fig.   6). [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 4
In the mammary glands of lactating goats, we found that miRNAs associated with cell proliferation (miR-26a, miR-21), conferring epithelial phenotype (miR-29a, miR-30a/d), immune response and development (miR-181, let-7a/b/f/g/i) were abundantly expressed, as well as miRNAs involved in lipid metabolism (miR-103, miR-23a, miR-27b, miR-200a/b/c). [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 2
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Sea louse Caligus rogercresseyi, which affects Chilean aquaculture, were studied during infestation in Atlantic salmon and the most abundant families were mir-10, mir-21, mir-30, mir-181, and let7 in skin, head and kidney (Valenzuela-Muñoz et al., 2017). [score:1]
The miRNA families miR-181, miR-143, and miR-21 were the most abundant in control groups, while miR-21, miR-181, and miR-30 were the most abundant in animals infected with P. salmonis (Valenzuela-Miranda et al., 2017). [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 2
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-27a, bta-mir-320a-2, bta-mir-99a, bta-mir-125a, bta-mir-181a-2, bta-mir-27b, bta-mir-10a, bta-mir-139, bta-mir-140, bta-mir-181b-2, bta-mir-487a, bta-let-7d, bta-mir-124a-1, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-154a, bta-mir-181d, bta-mir-184, bta-mir-206, bta-mir-29d, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-486, bta-mir-495, bta-mir-95, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2286, bta-mir-2300a, bta-mir-2300b, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2319a, bta-mir-2319b, bta-mir-2284n, bta-mir-2284g, bta-mir-2329-1, bta-mir-2329-2, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2396, bta-mir-2285c, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2443, bta-mir-2284h, bta-mir-2450c, bta-mir-2450b, bta-mir-2450a, bta-mir-2404-2, bta-mir-2284o, bta-mir-2484, bta-mir-2284e, bta-mir-320a-1, bta-mir-2887-1, bta-mir-2887-2, bta-mir-2284w, bta-mir-3431, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-574, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac, bta-mir-3432b, bta-mir-2450d
This was also the case for some other miRNA families, such as bta-let-7 (1442–1,331,479 reads), bta-miR-10 (24–10,950 reads), bta-miR-29 (1–153,254 reads) and bta-miR-181 (1–4694 reads). [score:1]
The largest miRNA family identified was miR-2284, which consisted of 63 members, and miR-154, let-7, and miR-181/30 possessed 18, 12, and 6 members, respectively; other miRNA families, such as miR-122, miR-1249, miR-140, and miR-486, had only one member, whereas miR-1940, miR-2286, miR-3431, and miR-574 did not belong to any gene family (Additional file 8). [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 1
Other miRNAs from this paper: bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-34b, bta-mir-127, bta-mir-181b-2, bta-mir-215, bta-mir-218-2, bta-mir-30e, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-30a, bta-mir-200b, bta-mir-122, bta-mir-34c, bta-mir-125b-2, bta-mir-34a, bta-mir-128-2, bta-mir-143, bta-mir-146b, bta-mir-154a, bta-mir-181d, bta-mir-199a-2, bta-mir-218-1, bta-mir-32, bta-mir-326, bta-mir-429, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-504, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-449d, bta-mir-424, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
By conducting a literature search, we identified 10 known DNA damage response miRNAs, including miR-504-5p, miR-34a, miR-215, miR-192, miR-128, miR-181, et al (Fig. S4A). [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
However, in our study, several previously reported miRNAs 19, 22– 24, such as bta-miR-100, miR-1388-3p, miR-141, miR-148a, miR-181c, miR-181d, miR-199a-3p, miR-199b, miR-200b, miR-221, miR-32, miR-362-3p, miR-375, miR-20b, miR-215 and miR-9-5p, were also detected. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
04.152:123191: 123211:1 [h] Intronic bomir-C1931-5p 23 gma-miR1523 1 +CCUGCUGAUCUCACAUUAAUUCA26:12405838: 12405860:1 [h] Intergenic bomir-A2143-3p 18 oan-miR-181c* 1 +CGGCAGAUGAAGUCCAUC16:47801336: 47801353:1 [h] Intronic bomir-F2422-5p 20 hsa-miR-659 1 +GGUGGGAGGGUCCCACCGAG18:53584142: 53584161:1 [h] Intragenic bomir-F2531-3p 18 ppt-miR1030i 3 +UGGUGGAGAUGCCGGGGA8:77307661: 77307678:1 [g] Intergenic bomir-G2511-3p 18 bmo-miR-92 1 +AGGCGGGCCGGGGUUGGA18:41190536: 41190553:1 [h] Intergenic bomir-E2664-3p 20 mml-miR-638 1 -AGGGCGGGCGGCGACUGGAA18:64361001: 64361020:-1 [h] Intragenic bomir-D3011-3p 21 mml-miR-650b 1 +CCGAGUGCUCCCGCGAGCGCU18:39424938: 39424958:1 [g] Intragenic bomir-A3341-1-3p 22 bta-miR-487a 1 +GUGGCUGUCCCUGGAGGUGGG3:124988008: 124988028:1 [h] IntergenicUn. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
There appears to be an increase in miR-181 in oocytes during the transition from GV to MII stage. [score:1]
[1 to 20 of 1 sentences]