sort by

12 publications mentioning bta-mir-193a

Open access articles that are associated with the species Bos taurus and mention the gene name mir-193a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 55
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Within 6 hrs of the presence of E. coli, the expression of 6 miRNAs in MAC-T cells was significantly altered (P < 0.05), three were down regulated (bta-miR-193a-3p, miR-30c and miR-30b-5p) while three were up-regulated (bta-miR-365-3p, miR-184 and miR-24-3p) (Table  3). [score:7]
The three miRNAs (bta-miR-193a-3p, miR-30c and miR-30b-5p) that were significantly down regulated or one miRNA (bta-miR-365-3p) that was significantly up regulated within 6 hrs of E. coli presence only showed a retarded significant down regulation by 24 or 48 hrs (bta-miR-193a-3p, 30c and 30b-5p) or up regulation (bta-miR-365-3p) by 48 hrs in the presence of S. aureus. [score:5]
The up-regulation of miR-193a-3p and miR-30b-5p may play regulatory roles in cell death which need to be further confirmed in the context of mastitis. [score:5]
The expression of bta-miR-193a-3p was the most regulated over time, increasing lineally and reaching 8.03 fold increase (P < 0.0001) within 48 hrs of cell growth. [score:4]
It is not surprising owing to their involvement in almost all biological processes as demonstrated by GO functional annotation of the target genes of three (bta-miR-193a-3p, miR-423-5p and miR-30b-5p) of these miRNAs. [score:3]
GO functional annotation of target genes of bta-miR-193a-3p and miR-30b-5p showed enriched genes related to cell growth and death, e. g. growth arrest specific gene 1 (GAS1), myeloid cell factor 1 (MCL1, also BCL2 related), BCL2-like 11 (apoptosis facilitator) and programmed cell death 10 (PDCD10). [score:3]
The expression of bta-miR-193a-3p and bta-miR-423-5p in control cells was further validated by qRT-PCR. [score:3]
Click here for file Confirmation of the expression of bta-miR193a-3p and miR-423-5p in control cells by qRT-PCR. [score:3]
For example, bta- miR-193a-3p and miR-365-3p for E. coli at 6 h, miR-21-3p and miR-423-5p for E. coli at 12 h, miR-423-5p for E. coli at 24 h, miR-193a-3p for E. coli at 48 h, miR-21-3p for S. aureus at 24 h, and miR-193a-3p and miR-365-3p for S. aureus at 48 h were similarly differentially expressed (P < 0.05) with both methods. [score:3]
The expression of bta-miR-21-3p, miR-365-3p, miR-193a-3p, miR-423-5p and miR-486 in challenged cells was further confirmed by qPCR. [score:3]
Confirmation of the expression of bta-miR193a-3p and miR-423-5p in control cells by qRT-PCR. [score:3]
Five differentially expressed miRNAs (bta-miR-193a-3p, miR-423-5p, miR-21-3p, miR-365-3p and miR-486) were validated by quantitative RT-PCR using TaqMan [®] miRNA Assays following manufacturer’s recommendations (Applied Biosystems, Foster City, CA, USA). [score:2]
The most regulated miRNA after infection was bta-miR-193a-3p (-2.67 fold change in E. coli at 6 hrs and -4.93 fold change in S. aureus at 48 hrs). [score:2]
We observed that five miRNAs (bta-miR-193a-3p, miR-423-5p, miR-30b-5p, miR-29c and miR-un116) were differentially expressed (P < 0.05) in at least two time points in control cells as compared to 0 hr (Figure  2). [score:2]
In addition, our study revealed a temporal differential regulation of five miRNAs (bta-miR-193a-3p, miR-423-5p, miR-30b-5p, miR-29c and miR-un116) in unchallenged cells. [score:2]
The expression of bta-miR-30b-5p and bta-miR-29c also increased over time but to a lesser magnitude as compared to bta-miR193a-3p. [score:2]
For example, bta-miR-193a [36] (miRBase Release 19), generated from bta-mir-193a-2, is reversely complementary to bta-miR-193a-3p from 1 to 19 nucleotides but not correctly named. [score:1]
4100.0921.2220.066 0.040 bta-miR-365-3p1.0510.3580.8790.8900.0960.478 bta-miR-423-5p1.8380.252 0.0461.3040.2970.336 bta-miR-4861.0990.0300.5450.8670.1190.48048hbta-miR-193a-3p0.3530.053 0.0200.3360.026 0.021 bta-miR-21-3p1.0830.1920.6791. [score:1]
010 bta-miR-21-3p2.1540.276 0.0171.0620.2720.819 bta-miR-365-3p0.9300.1150.5680.9940.1060.962 bta-miR-423-5p0.6290.046 0.0040.8120.1060.111 bta-miR-4861.6140.168 0.0321.6300.3420.14224hbta-miR-193a-3p1.2060.0520.0171.3270.1710.140 bta-miR-21-3p1.9420. [score:1]
[1 to 20 of 19 sentences]
2
[+] score: 14
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Of the 21 miRNAs that we identified as being differentially expressed in response to the Gram -positive S. uberis, only 9 of these (bta-let-7d, bta-let-7b, bta-mir-98, bta-miR-100, bta-mir-130a, bta-miR-193a, bta-miR-210, bta-miR-494, bta-miR-652) have also been reported to be differentially expressed in response to LPS in other species. [score:5]
Additionally, bta-miR-15a, bta-miR-17, bta-miR-26a-2, bta-miR-29a, bta-miR-29b-1, and bta-miR-193a were identified as down-regulated in the normalised data (both methods), but not in the un-normalised data. [score:4]
At 4 hpi, bta-miR-29b-2, bta-miR-193a, and bta-miR-130a were down-regulated. [score:4]
Furthermore, 5 of these 9 (bta-miR-98, bta-miR-100, bta-miR-193a, bta-miR-210, bta-miR-494) show an inverse response to S. uberis infection in comparison to LPS. [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 14
In biological verification the trend of the upregulated miRNAs (bta-miR-25, -miR-106b, miR-93, -let 7i) was confirmed while downregulated miRNAs did not exhibit the same trend (bta-miR-2898, bta-miR-193-5p, bta-miR-125b, bta-miR-200b and bta-miR-200c) (Table 4). [score:7]
miR-193a-5p is involved in the endometrial and oocyte development [53, 70] and miR-223 and miR-125a have been found in extracellular uterine fluid vesicles [54]. [score:2]
13 miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i (MC); bta-miR-20a, bta-miR-29b, bta-miR-92 (SM)) which were found to be regulated during early pregnancy using NGS resutling, in case of MC miRNAs, in separation of cyclic and pregnant animals in PCA, were validated with RT-qPCR. [score:2]
Consequently, Day 18/Day 4 ratios of cyclic (18c/4c) and pregnant animals (18p/4p) of a set of miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i) were used in a PCA. [score:1]
C) PCA of log2 fold-change of the miRNAs: bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i between days 4 and 18 (Day 18/Day 4) showing the separation of cyclic and pregnant animals. [score:1]
Using day 18 to day 4 ratio in MC sequencing data of a set of ten miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i) discrimination between pregnant and cyclic animals was achieved in a PCA. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 12
A number of miRNAs related to lipid metabolism and adipogenesis were differentially expressed between bulls and steers, which included downregulated miRNAs, such as miR-224, miR-33a, miR-1, and miR-141, and upregulated miRNAs, such as miR-10b, miR-193, and miR-181b. [score:9]
Fig 8 shows that only 9 DE miRNAs (bta-let-7i, bta-miR-1296, bta-miR-141, bta-miR-150, bta-miR-151-3p, bta-miR-193a-3p, bta-miR-224, bta-miR-2890, and bta-miR-454) and 42 DE target genes were observed. [score:3]
[1 to 20 of 2 sentences]
5
[+] score: 10
Whereas, bta-miR-193a was reported to promoted apoptosis and inhibited BVDV replication by target the 3′-untranslated region (UTR) of B-cell lymphoma-2 -associated X protein (BAX) mRNA. [score:7]
In the current study, we found that bta-miR-29b and bta-miR-193a were down regulated upon CPIV3 infection. [score:2]
These results indicate the possibility that bta-miR-29b and bta-miR-193a likely participate in host-virus interaction in MDBK cells. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
APRIL was the predicted target of miR-193a-5p, which is essential to triggering IgA [2] class switch in human B cells. [score:3]
Notably, some miRNAs among the top 10 identified here have been reported to be related to immunity (miR-320, miR-181a, miR-30a-3p, let-7a, let-7f and let-7c) and development (miR-193a-3p, miR-378 and miR-191). [score:2]
MiR-193a-3p was demonstrated to regulate cell proliferation, cell cycle progression in vitro and in nude mice [69]. [score:1]
With 67,154 counts (29.6%, average count: 460.6) (Figure 5B), ssc-miR-193a-3p ranked first among all miRNAs reads. [score:1]
For example, ssc-miR-193a-3p had 67,154 counts, ranking first among all miRNAs, while ssc-miR-193a-5p had 2,538 counts. [score:1]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 7
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
For example, miR-146b-5p and miR-378a-3p were highly expressed in mouse but they were present at a low level of expression in bovine; inversely, miR-199b-5p, miR-423-5p and miR-193a-5p were weakly expressed in mouse but highly in bovine (Table S2). [score:7]
[1 to 20 of 1 sentences]
8
[+] score: 2
bomir-143-3p 22 ggo-miR-143 11 +/-UGAGAUGAAGCACUGUAGCUCG7:60268857:60268878:1 [f] Intergenic bomir-152-5p 21 hsa-miR-152 1 -CCAAGUUCUGUCAUGCACUGA19:39650399:39650419:-1 [f] Intragenicbomir-193a-2-3p [c] 19 bta-miR193a 1 -GGGACUUUGUAGGCCAGUU14:889828:889846:-1 [f] Intronic bomir-378-1-3p 21 hsa-miR-378 1 +CUGGACUUGGAGUCAGAAGGC7:60536513:60536533:1 [f] Intronic bomir-378-2-5p 21 hsa-miR-378 - - +CUGGACUUGGAGUCAGAAGGC4:11116898:11116918:1 [h] Intronic bomir-382-3p 22 hsa-miR-382 1 -GAAUCCACCACGAACAACUUC21:66031757:66031777:-1 [f] Intronic bomir-409-5p 22 hsa-miR-409 2 -GGGGUUCACCGAGCAACAUUC21:66042162:66042182:-1 [f] Intronic bomir-424-3p 22 hsa-miR-424* 1 -CAAAACGUGAGGCGCUGCUAUUn. [score:1]
04.2732:16069: 16087:-1 [f] Intergenic [a]: Cloned sequence is homolog to has-miR 22 but not to bta-miR-22, may bta-miR-22 presented in miRBase v. 12 is bta-miR-22*, [b]: Cloned sequence is homologue to has-miR-140 but not to bta-miR-140, may bta-miR-140 presented in miRBase v. 12 is bta-miR-140* [c]: Sequence is smaller than bta-miR-193a and has different genomic locus. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 1
Let-7e, as well as several other DE miRNAs in our study (bta-miR-200c, bta-miR-210, and bta-miR-193a), have also previously been identified as DE in bovine mammary epithelial cells stimulated with S. uberis in vitro (Lawless et al. 2013). [score:1]
[1 to 20 of 1 sentences]
10
[+] score: 1
In five cases (bta-mir-30b, bta-mir-193a, bta-mir-345, bta-mir-365, bta-mir-423) we discovered that miRNA* are more abundant than corresponding miRNA as evidenced by higher counts of sequence reads originating from miRNA* arms of the microRNA precursor sequences (Supplemental Table S1). [score:1]
[1 to 20 of 1 sentences]
11
[+] score: 1
We detected that eight exosomal-miRNAs (bta-let-7i, bta-miR-140, bta-miR-193a-5p, bta-miR-222, bta-miR-23a, bta-miR-24-3p, bta-miR-423-5p and bta-miR-658) were with different abundance levels among the cows at embryo transfer. [score:1]
[1 to 20 of 1 sentences]
12
[+] score: 1
They included bta-miR-193a-3p, bta-miR-33a, bta-miR-21*, bta-miR-152, bta-miR-29, bta-miR-224, bta-miR-222 and bta-miR-877. [score:1]
[1 to 20 of 1 sentences]