31 publications mentioning gga-mir-21

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-21. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

When compared to the negative control of miRNA inhibitor, transfection with anti-miR-21 inhibitor increased PTEN expression, demonstrating that miR-21 inhibitor affects miR-21 direct target expression in DU145 cells (Fig. 2A).

Taken together, our studies demonstrate that: 1) miR-21 up-regulated HIF-1α and VEGF expression and induced angiogenesis in prostate cancer cells; 2) miR-21 induced HIF-1α and VEGF expression through targeting PTEN, thus regulating AKT and ERK pathways; 3) both PI3K/AKT and ERK pathways are required for miR-21-inducing angiogenesis; 4) HIF-1α is an essential downstream effecter of miR-21 in mediating angiogenesis, and HIF-1α is regulated by miR-21 through the activation of AKT and ERK in the cells.

In consistent with the overexpression results, inhibition of miR-21 expression in DU145 cells partially decreased AKT and ERK1/2 activation, abolished HIF-1α expression, and inhibited VEGF level to 50%.

In this study, we want to study: 1) whether miR-21 regulates hypoxia inducible factor-1 (HIF-1) and vascular endothelial growth factor (VEGF) expression; 2) whether miR-21 regulates tumor angiogenesis in prostate cancer cells; 3) the signaling molecules and pathways that are regulated by miR-21 for mediating HIF-1 and VEGF expression; and 4) whether HIF-1 is the miR-21 target for regulating tumor angiogenesis.

In accord with previous study, PTEN overexpression notably blocked miR-21 -induced tumor angiogenesis, confirming that miR-21 exhibits its role partly by inhibiting PTEN expression and the recovery of PTEN expression restored its function of tumor suppressor.

Treatment of the cells with PI3K or ERK1/2 inhibitor LY294002 or U0126, respectively, prohibited miR-21-inducing HIF-1α and VEGF expression and angiogenesis, suggesting that both PI3K and ERK are required for miR-21-inducing angiogenesis through the downregulation of HIF-1α and VEGF expression.

These results further confirm that the downregulation of miR-21 inhibits AKT and ERK activation, and HIF-1 and VEGF expression; then inhibits miR-21-inducing angiogenesis, demonstrating the vital role of miR-21 in inducing tumor angiogenesis.

To determine whether it can inhibit tumor angiogenesis and the expression of HIF-1 and VEGF by blocking AKT and ERK1/2 pathways, DU145 cells were transfected with anti-miR-21 inhibitor and the negative control of miRNA inhibitor.

Taken together, miR-21 inhibited PTEN expression, which in turn decreased AKT and ERK activation for inhibiting HIF-1α and VEGF expression, thus inducing tumor angiogenesis.

Recent studies indicated that several tumor suppressors including phosphatase and tensin homolog deleted on chromosome ten (PTEN) [4], tumor suppressor gene tropomyosin 1 [5], programmed cell death 4 [6], [7], maspin [8], and matrix metalloproteinases inhibitors RECK and TIMP3 [9] were targets of miR-21, suggesting that miR-21 is an important oncogenic miRNA which is closely related to tumor growth and metastasis.

To further test the role of miR-21 in regulating tumor angiogenesis, we overexpressed miR-21 inhibitor, which is chemically modified, single stranded nucleic acids designed to specifically bind to and inhibit endogenous miR-21 molecules.

Recent study indicated that miR-21 inhibited the function of tumor suppressor PTEN expression by binding its 3′ UTR [4].

The anti-miR-21 inhibitor also decreased VEGF expression to 66% (Figs. 2B and C), and significantly inhibited the angiogenesis responses induced by DU145 cells (Figs. 2D and E).

The inhibitor of miR-21 inhibited miR-21-inducing expression of HIF-1α and VEGF, activation of AKT and ERK1/2, and angiogenesis.

MiR-21 inhibitor decreased miR-21-inducing HIF-1 and VEGF expression, and inhibited tumor angiogenesis.

Consistent with previous study, overexpression of miR-21 suppressed PTEN expression [4].

Moreover, anti-miR-21 suppressed both cell growth of breast cancer in vitro and tumor growth in the xenograft mo del partially through downregulating of the antiapoptotic factor, B-cell lymphoma 2 (Bcl-2) [12].

The relative angiogenesis was also inhibited 50% by the anti-miR-21, indicating that miR-21 plays an important role in mediating angiogenesis through regulating AKT and ERK activation, and HIF-1α and VEGF expression.

These results suggest that miR-21 induces tumor angiogenesis by upregulating the expression of HIF-1α and VEGF.

To further study the role of AKT and ERK in regulating HIF-1α and VEGF expression, DU145 cells were transfected with pre-miR-21 and treated with the inhibitors of AKT and ERK1/2, LY294002 and U0126 at 10 µM, respectively.

These results suggest that upregulation of HIF-1α expression is necessary for miR-21 to induce tumor angiogenesis.

To further study the role of miR-21 in inducing prostate tumor angiogenesis, we used the inhibitor of miR-21, which can specifically bind to and inhibit endogenous miR-21 molecules, or its negative control oligomer, to transfect DU145 cells.

To determine whether overexpression PTEN can inhibit miR-21 inducing prostate tumnor angiogenesis, DU145 cells were infected with adenoviruses carrying GFP or PTEN (Ad-PTEN).

The miR-21 inhibitor treatment decreased the endogenous AKT and ERK activation, and HIF-1α but not HIF-1β expression in the cells (Fig. 2A).

HIF-1α expression is required in miR-21 inducing VEGF expression and tumor angiogenesis.

MicroRNA miR-21 overexpression increased HIF-1α and VEGF expression and induced tumor angiogenesis.

To alter miR-21 levels in prostate cancer cells, DU145 cells were cultured to 50–60% confluence, and transfected with the pre-miR-21, the negative control precursor miRNA, anti-miR-21 inhibitor, and the negative control of anti-miRNA inhibitor (Ambion, Forster City, CA) using X-tremeGENE transfecting reagent (Roche Applied Science, Indianapolis, IN) in serum-free Opti-MEM medium according to the manufacturer's instruction.

Pre-miR-21 and negative control precursor miRNA, anti-miR-21 inhibitor and the negative control of anti-miRNA inhibitor were purchased from Ambion (Foster City, CA).

This result demonstrated that miR-21 was sufficient to induce angiogenesis through modulating the expression of HIF-1α and VEGF, providing the direct evidence that miR-21 is able to regulate tumor angiogenesis.

Growing evidence shows that miR-21 overexpression is detected in various kinds of human cancers including prostate cancer, and is associated with tumor metastasis [3], [4], [41]– [46], but the direct role of miR-21 in regulating tumor angiogenesis remains to be elucidated.

In this study, we demonstrated that overexpression of miR-21 in human prostate cancer cells increased the expression of HIF-1α and VEGF, and induced tumor angiogenesis.

We found that overexpression of miR-21 strongly increased expression of HIF-1α, but not HIF-1β (Fig. 1B).

Cells transfected with pre-miR-21, pre-miRNA negative control, anti-miR-21 inhibitor, or negative control miRNA inhibitor were resuspended in serum-free medium, and mixed with equal volume of Matrigel (BD Biosciences, Bedford, MA).

To test whether miR-21 overexpression affects HIF-1 expression, prostate cancer cells DU145, the PTEN wild type cells, were transfected with Pre-miR-21 or negative control precursor miRNA.

MiR-21 targeted PTEN in inhibiting tumor angiogenesis.

Consistent with previous study showing that HIF-1α is the regulator of VEGF, HIF-1α siRNA also decreased miR-21-inducing VEGF mRNA expression in the cells (Fig. 6B).

This data suggests that HIF-1α is a key downstream target of miR-21, which is required for inducing angiogenesis, and is downstream of both AKT and ERK pathways in regulating miR-21-inducing angiogenesis.

MiR-21 overexpression increased HIF-1 and VEGF expression, and induced angiogenesis.

HIF-1α is an important downstream target of miR-21, and is regulated by both AKT and ERK during miR-21-inducing angiogenesis.

These data, taken together, support an important role of altered miR-21 expression during tumor development.

Taken together, our results demonstrated that miR-21 regulates tumor angiogenesis through inducing HIF-1α and VEGF expression; activates both AKT and ERK pathways for mediating angiogenesis.

The expression of miR-21 increased to 37-fold after pre-miR-21 transfection when compared to the negative control, indicating that transfection of pre-miR-21 increased mature miR-21 expression (Fig. 1A).

These data suggest that both AKT and ERK1/2 are required for miR-21 in inducing angiogenesis, indicating that AKT and ERK1/2 pathways are two parallel downstream pathways of miR-21 for regulating HIF-1α and VEGF expression and angiogenesis.

To determine the signaling molecules that are involved in miR-21-inducing HIF-1α and VEGF expression and angiogenesis, we found that overexpression of miR-21 induced AKT and ERK1/2 activation when compared to the negative control of precursor miRNA group by Western blotting (Fig. 4A).

Consistent with that PTEN is one of the miR-21 targets, miR-21 induced tumor angiogenesis (Ad-GFP+ negative control precursor miRNA group versus Ad-GFP+pre-miR-21 group: 100%±9.24% versus 176%±12.01%, n = 6); overepression of PTEN by adenovirus decreased miR-21 -induced angiogenesis (Ad-GFP+pre-miR-21 group versus Ad-PTEN+pre-miR-21 group: 176%±12.01% versus 103.71%±22.1%, n = 6).

PTEN was the downstream target of miR-21 in inducing angiogenesis.

Finally, given the important role of HIF-1 and VEGF in mediating tumor growth and angiogenesis, we hypothesize that HIF-1 is a downstream target required for miR-21-inducing angiogenesis.

miR-21 induced the activation of AKT and ERK1/2, and the expression of HIF-1α and VEGF.

To further evaluate whether the increase of miR-21 also increased VEGF expression at mRNA level, the expression of VEGF and GAPDH was tested by semi-quantitative and real-time.

The anti-miR-21 decreased 70% of endogenous miR-21 expression in the cells.

Both LY294002 and U0126 treatment abolished miR-21-inducing HIF-1α expression (Fig. 4B).

The expression of miR-21 is also associated with prognosis and the chemosensitivity and therapeutic outcome in colon adenocarcinoma [10], [11].

Recent study has demonstrated that miR-21 increased cell proliferation, migration and invasion through modulating tumor-suppressor gene PTEN (4), but the role of PTEN in miR-21 inducing tumor angiogenesis remains to be elucidated.

LY294002 treatment abolished miR-21-inducing AKT activation, while U0126 inhibited miR-21-inducing ERK1/2 activation.

In previous studies, we identified that miR-21 induced HIF-1 and VEGF expression through activating AKT and ERK1/2 pathways.

Similarly, the miR-21-inducing VEGF mRNA levels were inhibited by LY294002 and U0126 in the cells by 44% and 53%, respectively (Figs. 4C and D).

We also found that overexpression of miR-21 led to the activation of AKT and ERK1/2.

Cells were transfected with pre-miR-21, miR-21 inhibitor or their control oligomers.

Representative plugs from the negative control and miR-21 inhibitor treated groups were shown.

After the transfection for 36 h, cells were collected and subjected to qRT-PCR for miR-21 expression.

MiR-21 increased HIF-1 and VEGF expression through AKT and ERK1/2 pathways.

However, the role of miR-21 in regulating angiogenesis remains to be elucidated.

This study shows a direct role and novel mechanism of miR-21 in inducing angiogenesis and the information may be useful to develop a new anti-angiogenesis therapy for prostate cancer treatment in the future.

Given the crucial role of HIF-1α and VEGF in regulating tumor angiogenesis, we hypothesized that miR-21 can induce angiogenesis.

AKT, ERK1/2, and HIF-1 are required for miR-21-inducing angiogenesis.

The miR-21-inducing angiogenesis was decreased to less than 40% when the cells were treated with 10 µM of LY294002 or U0126 (Figs. 5A and B).

After 24 h, cells were transfected with pre-miR-21 or scrambled control.

0019139.g005 Figure 5(A) DU145 cells were transfected with pre-miR-21.

To further determine whether HIF-1α is an essential downstream molecule in mediating miR-21-inducing angiogenesis, DU145 cells were transfected with pre-miR-21 and cultured overnight.

0019139.g006 Figure 6(A) DU145 cells were transfected with pre-miR-21.

The representative plugs from treatments of Ad-GFP plus scrambled control, Ad-GFP plus pre-miR-21, and Ad-PTEN plus pre-miR-21 were shown in the picture.

Among these miRNAs, miR-21 is one of the well characterized miRNAs and overexpressed in various solid tumors including prostate cancers [3].

As we expected, the number of branches of microvessels in the pre-miR-21 -transfected cells increased to 3.5-fold of the control (Figs. 1E and F).

To further test whether the knockdown of HIF-1α is sufficient to decrease miR-21-inducing angiogenesis, the cells infected by the adenoviruses carrying scrambled siRNA and HIF-1α siRNA at 20 MOI were used for the angiogenesis assay in the CAM.

As shown in Figs. 6C and D, the infection of DU145 cells by Ad-siHIF-1α decreased miR-21-inducing angiogenesis to 40% of the control group.

Representative plugs from negative control and miR-21 treatment groups were shown.

The results suggest that PTEN mediates miR-21 -induced tumor angiogenesis in CAM mo del (Figs. 3A and 3B).

miR-21 induced angiogenesis through mediating AKT and ERK1/2 activation.

To test our hypothesis, human prostate cancer cell DU145 was transfected with pre-miR-21 or pre-miRNA negative control.

0019139.g001 Figure 1(A) Human prostate cancer cells DU145 were transfected with pre-miRNA negative control or pre-miR-21 at 25 nM.

When cells were 60% confluence, cells were transfected with pre-miRNA negative control or pre-miR-21 as described above.

2

The expression patterns of gga-miR-1a and gga-miR-21 were similar in the different developmental stages; relatively lower expression was observed from 42-d to 110-d compared with 162-d and increased dramatically to peak in 162-d. However, the expression dynamics of gga-miR-26a were different; the highest expression level was found in the 42-d ovary, then decreased from 70-d to 110-d, and finally increased in the 162-d ovary although still lower than 42-d. The expression of gga-miR-137 and gga-miR-375 in ovary decreased significantly from 42-d to 162-d. Figure 4 Expression patterns of gga-miR-1a, gga-miR-21, gga-miR-26a, gga-miR-137 and gga-miR-375 in different developmental stages of ovary and in different sized follicle in chicken by qRT-PCR assays.

The expression patterns of gga-miR-1a and gga-miR-21 were similar in the different developmental stages; relatively lower expression was observed from 42-d to 110-d compared with 162-d and increased dramatically to peak in 162-d. However, the expression dynamics of gga-miR-26a were different; the highest expression level was found in the 42-d ovary, then decreased from 70-d to 110-d, and finally increased in the 162-d ovary although still lower than 42-d. The expression of gga-miR-137 and gga-miR-375 in ovary decreased significantly from 42-d to 162-d. Figure 4 Expression patterns of gga-miR-1a, gga-miR-21, gga-miR-26a, gga-miR-137 and gga-miR-375 in different developmental stages of ovary and in different sized follicle in chicken by qRT-PCR assays.

In follicles (Figure  4), the expression patterns of gga-miR-1a and gga-miR-21 were similar; during the development from LW to F1, the expression levels of the two miRNAs increased progressively with F1 having the highest level, which suggests that gga-miR-1a and gga-miR-21 may be involved in the follicular growth or ovulation mechanism in the chicken.

To validate the Illumina small RNA deep sequencing data, five differentially expressed miRNAs (gga-miR-1a, gga-miR-21, gga-miR-26a, gga-miR-137 and gga-miR-375) were selected, and their expression levels were quantified using real-time quantitative RT-PCR (qRT-PCR).

A previous study reported that miR-21 was significantly up-regulated in murine granulosa cells before and 4 h after the hCG/LH surge and that it plays a role in preventing apoptosis in periovulatory granulosa cells as they transit to luteal cells.

Some studies have shown that miR-21 was down-regulated by estradiol in MCF7 cancer cells [43, 44].

In the sexually mature chicken ovary library, gga-miR-10a and gga-miR-21 were the two most frequently sequenced miRNAs, and the let-7 miRNA family was another abundant cluster with let-7a being the most abundantly expressed miRNA.

To further characterize the functionality of these differentially expressed miRNAs identified from the chicken ovary, the expression levels of gga-miR-1a, gga-miR-21, gga-miR-26a, gga-miR-137 and gga-miR-375 were further examined in ovary tissues from 42-, 70-, 90-, 110- and 162-day-old White Leghorn hens (n =3), as well as in follicles isolated from ovaries of 162-day-old White Leghorn hens, namely, a large white follicle (LW, diameter =2-4 mm), small yellow follicle (SF, diameter =6-8 mm), F6 (diameter =12-14 mm), F4 (diameter =22-24 mm), F2 (diameter =30-31 mm) and F1 (diameter =34 mm) follicles.

The following 15 miRNAs were dominantly expressed in the two libraries: gga-miR-10a, gga-miR-146c, gga-miR-101, gga-miR-21, gga-let-7a, gga-let-7b, gga-let-7c, gga-let-7j, gga-let-7f, gga-let-7 k, gga-miR-30a-5p, gga-miR-30e, gga-miR-148a, gga-miR-100 and gga-miR-126.

Knockdown of miR-21 in granulosa cells resulted in increased apoptosis and was associated with a reduced ovulation rate [41, 42].

The most abundant miRNA in the mature ovary was gga-miR-10a, which had 1,177,256 reads, followed by gga-miR-21, which had 929,545 reads.

The three most abundant miRNAs in the chicken ovary are gga-miR-10a, gga-let-7 and gga-miR-21.

3

Comparing the inhibition of luciferase activity by the lentiviral expressed and endogenously expressed miRNAs, these results show that 1) the lentiviral expressed miR126 (both sense and antisense strands) and miR140 antisense strand exhibit potent RNAi activity; 2) the lentiviral expressed miR451 antisense strand does not have any RNAi activity; 3) the observed RNAi activity of lentiviral expressed miR21 (both sense and antisense strands) and miR140 sense strand could be due to endogenous miRNAs.

The results showed that miR126-NP inhibited luciferase activity by 95% (Figure 3c); miR21-NP-shRNA by 70%; whereas miR21-NP and miR126-NP-shRNA exhibited only minor or no inhibition.

Expression of both the sense and antisense strands of gga-miR21, gga-miR126 and gga-miR140 led to the inhibition of Renilla luciferase activity (Figure 2a).

The other design replaces the entire pre-miRNA stem-loop with one that is commonly used to express shRNA driven by Pol III promoters (miR21-NP-shRNA and miR126-NP-shRNA) (Figure 3b) [24].

As shown in Figure 2b, Renilla luciferase activity was inhibited by ∼98% by the sense strand of gga-miR21, ∼20% by the antisense strand of gga-miR21, and ∼60% by the sense strand of gga-miR140.

Because gga-miR21, gga-miR126, gga-miR140 and gga-miR451 are generally expressed, we assayed their activity in DF-1 cells by directly transfecting the reporter plasmids into DF-1 cells.

Based on these results, we selected gga-miR21 and gga-miR126 to construct lentiviral vectors to express NP miRNA.

Based on literature reports and the miRNA database (miRBase), we chose four endogenous chicken miRNAs gga-miR21, gga-miR126, gga-miR140 and gga-miR451 that are expressed in many different tissues of adult chicken and chicken embryo [22].

Therefore, we constructed miR21-NP and miR126-NP lentiviral vectors (Figure 3a) where the anti-influenza NP sequences replaced the miR21 sense or miR126 antisense strand, respectively.

The miR21-NP-shRNA was able to generate functional RNAi but miR126-NP-shRNA was not (Figure 3c).

Because the length of miR21 and miR126 sequences are different, slightly different anti-influenza NP sequences, both containing a 20 nucleotide core sequence of UUGUCUCCGAAGAAAUAAGA, were used to replace them (Figure 3a).

In a reverse correlation, artificial miRNA transcribed from miR126 -based design produced potent RNAi activity while that from miR21 -based design did not.

Figure S3 Complete sequences of miR21-NP, miR126-NP, miR-NP-shRNA and miR126-NP-shRNA.

Mature miR21 or miR126 sequences were replaced with anti-influenza NP sequences (blue).

We show that endogenous gga-miR21 is highly active in the DF-1 cells while gga-miR126 is not (Figure 2b).

For gga-miR21, the more abundant one is the sense strand and for gga-miR126, the antisense strand.

0022437.g003 Figure 3(a) Structures and sequences of the miR21-NP and miR126-NP.

According to the miRBase, both sense and antisense strands of gga-miR21 and gga-miR126 can produce mature miRNAs.

4

Out of the 718,959 sequences in HD11 cells that mapped to the mature miRNAs in miRBase, the highest level of expression was observed for gga-miR-21, which accounted for 28.8% of all miRNAs expressed in these cells.

However, increased miR-21 expression is not unique to the chicken ES cell line, as high levels of expression of miR-21 have been detected in a number of human cancer cell lines (Slaby et al., 2007; Jiang et al., 2008).

Another miRNA expressed at high levels in the BP25 cell line is gga-miR-21 that accounted for 23.3% of the miRNAome.

Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer.

Expression levels of miRNAs obtained from the deep sequencing data were validated by carrying out quantitative RT-PCR on gga-miR-21, gga-miR-26a, gga-miR-142-3p and gga-miR-155 using RNA extracted from different cell types.

BP25 cell line also showed high levels of expression of gga-miR-21 accounting for 23.3% of the miRNAome.

However, miR-21 is highly expressed in normal macrophages as well as the cESC line BP25.

Validation of expression levels of gga-miR-21, gga-miR-26a, gga-miR142-3p, gga-miR-155 and gga-miR-223 was carried out by quantitative RT-PCR using procedures described (Yao et al., 2008).

Among all the miRNAs expressed in these cells, gga-miR-21 alone accounted for nearly a third (28.8%).

The miRNAs which showed significant increase upon CD40L-stimulation included gga-miR-21, gga-miR-155, gga-miR-146a, gga-miR-20b, gga-miR-106, gga-miR-222 and gga-miR-22 (Figure 2).

The high level of gga-miR-21 was demonstrated in normal macrophages also (Figure 4B).

miR-21: a small multi-faceted RNA.

Of those, a large majority matched with the gga-miR-21 (33.4%).

The miRNAs which showed significant increase upon CD40L-stimulation included gga-miR-21, gga-miR-155, gga-miR-146a, gga-miR-20b, gga-miR-106, gga-miR-222, and gga-miR-22.

Unlike in the BP25 cESC line, miR-21 levels are low in mammalian ES cells (Gunaratne, 2009), although the potential functional significance is not known.

5

Lin L. Gan H. Zhang H. Tang W. Sun Y. Tang X. Kong D. Zhou J. Wang Y. Zhu Y. MicroRNA-21 inhibits SMAD7 expression through a target sequence in the 3′ untranslated region and inhibits proliferation of renal tubular epithelial cells Mol.

Among these miRNAs, miR-21 was found to be highly expressed in many species, and associated with cardiac disease and a wide variety of human cancers [44, 45].

Papagiannakopoulos T. Shapiro A. Kosik K. S. MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells Cancer Res.

One recent study showed that miR-21 can inhibit cell proliferation [46], suggesting that it might be a negative regulatory factor for chicken growth.

In this study, miR-21 was upregulated in low-body weight of both WRR and XH chickens.

Different expression levels of miR-21 were found in chicken skeletal muscle of different growth periods [26], and in skeletal muscle between broiler and layer [37].

CISH is a target of miR-21, miR-383 and miR-205a.

However, with the exception of miR-21, most of these miRNAs were little known in terms of growth.

6

The expression of miR-21 was upregulated (about 1.5-fold) after gemcitabine, but significantly downregulated (0.5- and 0.2-fold) after exposure to crizotinib and to the gemcitabine-crizotinib combination, respectively.

In addition, the analysis of miRNA modulation allowed for the validation of two synergistic mechanisms related to miR-21 downregulation and miR-155 upregulation, as described in the Fig. 5C.

Therefore, the inhibition of c-Met by crizotinib, which caused miR-21 downregulation, as reported previously in NSCLC mo dels 40, might favor gemcitabine cytotoxicity.

Additionally, in the CAM tumors collected on EDD19, we determined how the treatment with gemcitabine and crizotinib affected the expression of miR-155 and miR-21 (Fig. 5B).

MiR-21 expression has been correlated to gemcitabine chemoresistance and reduced apoptosis-induction 39.

Furthermore, we included in our analysis two miRNAs that have been commonly associated with PDAC pathogenesis and gemcitabine chemoresistance, namely miR-155 and miR-21 46 50.

7

Previously, gga-miR-21 was suggested to inhibit the replication of IBDV by targeting and suppressing VP1 mRNA translation [30].

This suggests that, in chickens, gga-miR-21 is upregulated as a defence mechanism to fight against IBDV by inhibiting viral replication.

In addition, of the 10 tested miRNAs, those with significantly increased levels due to IBDV stimulation were gga-miR-let7g, gga-miR-1603, gga-miR-1635, gga-miR-1644 and gga-miR-21-5p, whereas gga-miR-1a-3p, gga-miR-1715, gga-miR-196-2, gga-miR-1778 and gga-miR-302b were downregulated (Fig.   5a).

Of these miRNAs, gga-let-7 g, gga-miR-196-2, gga-miR-1635, gga-miR-1603 and gga-miR-21 were significantly upregulated in IBDV-infected DCs.

8

As shown in Fig. 2, the levels of miR-192, miR-194 and miR-122 in serum do not change between 4–12 weeks post infection, whereas five of the miRNAs that are up-regulated in the liver are also significantly elevated in serum at 12 weeks post infection (p<0.05), ranging from 2.6 fold (miR-21) to 4.7 fold (miR-214) (Table S2).

Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45].

In contrast, the miRNAs up-regulated in the liver (miR-199-3p, miR-199-5p, miR-21, miR-214 and miR-210) showed significantly higher levels in mouse serum at 12 weeks post infection (Fig. 2), however these failed to differentiate S. mansoni infected from uninfected humans (Fig. S4).

Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection.

Thirty-three mouse miRNAs were differentially expressed in infected compared to naïve mice (>2 fold change, p<0.05) including miR-199a-3p, miR-199a-5p, miR-214 and miR-21, which have previously been associated with liver fibrosis in other settings.

Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1).

The 5 host miRNAs were detectable in serum (miR-21, miR-199-3p, miR-199-5p, miR-210, miR-214) but showed variable abundance and failed to differentiate ‘egg -positive’ and ‘egg -negative’ participants (Fig. S4).

9

These miRNAs were divided into three groups according to their expression levels in the fat broiler line, 4 highly expressed (gga-miR-21, gga-miR-148a, gga-miR-103, gga-miR-101) (2 [-ΔCt] >0.7), 4 moderately expressed (gga-miR-100, gga-miR-146a, gga-miR-92, gga-miR-2188) (0.7>2 [-ΔCt]>0.08), and 7 lowly expressed (gga-miR-1a, gga-miR-130a, gga-miR-221, gga-miR-19a, gga-miR-181b, gga-miR-458, gga-miR-17–3p) (2 [-ΔCt]<0.08) (Table 2).

In mammals, a number of miRNAs have been demonstrated to target genes involved in adipogenesis and lipid metabolism, such as the regulation on the proliferation of adipose tissue-derived mesenchymal stem cells by miR-21 and miR-196a [4– 6]; the enhancement of adipogenesis by miR-103, miR-224 and the miR-17–92 cluster [7– 9]; the impairment of adipogenesis by the let-7 family, miR-448, miR-15a and miR-27 [10– 13]; the regulation of adipocyte lipid metabolism by miR-27a and miR-143 [13– 15]; and the important role of miR-33 on the repression of sterol transporters reported in numerous studies [16– 24].

In contrast, gga-miR-21 was more abundant in the fat line.

The top 10 abundant miRNAs included the let-7 miRNA family (let-7a, j, b, f, c, and k), gga-miR-148a, gga-miR-146c, gga-miR-10a, and gga-miR-21.

10

From this analysis, miR-202-3p/5p showed the highest expression in Sp and miR-147 and miR-100-5p, miR-21-5p present the high expression in SSCs.

In mouse, miR-21 was shown to be important in maintaining the SSC population; suppression of miR-21 resulted in large numbers of germ cells undergoing apoptosis and significantly reduced the number of donor-derived colonies of spermatogenesis [11].

The miRNAs predicted to target these genes were mainly miR-21-5p, miR-100-5p, miR-148a-3p, let-7f-5p, and miR-10a-5p.

The most frequently sequenced known miRNA in the PGCs and SSCs libraries was miR-21-5p, which made up 25.87% and 28.23% of the reads, respectively, while in the Sp library miR-100-5p was the most frequently sequenced, making up 11.93% of the reads.

Our Venn analysis of the most abundant mature miRNAs with counts >= 10000 in the PGCs, SSCs, and Sp cells identified 11 miRNAs that were common in the three types of cells, including miR-21-5p and miR-10a-5p.

We also found that the 11 miRNAs that were common in the three types of cells showed a significant relationship with spermatogenesis; in particular, miR-21-5p and miR-100-5p, which were present in high abundance in PGCs and SSCs.

Venn analysis of the group with counts >= 10000 (Fig 5a) showed that 11 of the miRNAs in this group were present in the three libraries, including miR-21-5p and miR-100-5p (marked with red in S1 Table).

Further, deep sequencing detected let-7, miR-21, and miR-30 in rainbow trout eggs, which indicated that these miRNAs may play roles in controlling egg quality [21].

11

Marquez RT Wendlandt E Galle CS Keck K McCaffrey AP MicroRNA-21 is upregulated during the proliferative phase of liver regeneration, targets Pellino-1, and inhibits NF-κB signalingAm J Physiol Gastrointest Liver Physiol.

By using three different endogenous control miRNAs (U6, 5S, and 18S), the results have all showed that two miRNAs (gga-miR-181b-5p_R + 1 and gga-miR-30b-5p) had significantly lower expression levels in matured livers than the postnatal livers, and the expression level of another four miRNAs (gga-let-7a-5p, gga-miR-2954_R + 2, gga-miR-21-5p, and gga-miR-122-5p) were significantly increased in matured livers (Fig.   3), which were consistent with the miRNA-seq data.

In additional, of the top 10 abundantly differentially expressed miRNAs identified in this study, some of them, such as miR-21 [20], miR-30c [14], miR-191 [21], let-7a and miR-22 [22] have also been reported to play important roles in the liver development.

12

Over -expression of microRNA gga-miR-21 in chicken fibroblasts suppresses replication of infectious bursal disease virus through inhibiting VP1 translation.

In HCV- or HIV-infected cells, the up-regulation of miR-155 and miR-21 represses the NF-κB signaling pathway (Houzet et al., 2008; Marquez et al., 2010; Zhang Y. et al., 2012).

miR-21, miR-17 and miR-19a induced by phosphatase of regenerating liver-3 promote the proliferation and metastasis of colon cancer.

13

In CEF cells, we observed that poly (I:C) stimulation had no effect on the expression of miR-21,but it could upregulate the expression of miR-155 with dose dependence (from 0.1 μ g/ml to 10 μ g/ml, Fig 4a) at 24 h after stimulation.

miR-21 expression was used as the control.

In TLR ligands treated HD11 cells (an avian macrophage cell line), TLR2 and TLR4 Ligands stimulation resulted in higher expression of gga-miR-155 at 24h while had little effect on the amount of gga-miR-21 (Fig 3a and 3b).

14

miRNA-21, on the other hand can promote IL-10 production by regulating PDCD4 (programmed cell death 4), an inhibitor of IL-10 production [90].

Expression of miRNA21, miRNA146b and miRNA146c1 did not differ from media controls at any time point in any exposure group (data not shown).

No difference in expression was observed for miRNA146b, miRNA146c1 or miRNA21.

Expression analysis of four miRNA genes including mir-21, mir-146a, mir-146b, and mir-146c1, as well as IL-10 was assessed in TECs exposed to either LAMPs or live organisms.

15

In smooth muscle cells, wild type SPRY2 inhibits migration and proliferation [24] and downregulation of its function by mir-21 in cardiomyocytes, promotes proliferation and cellular outgrowths [40].

Sequence alignments show miR predicted targets sites within the 3’UTR of chick Spry2 and chick microRNA sequences of mir-21, mir-23, mir-27, mir-122, and miR-128.

RNA was transferred to five membranes (Hybond NX, Amersham Biosciences) then hybridized to [32]P-labeled antisense probes (end -labelled with [γ- [32]P]ATP and T4 kinase) complementary to the mature mirRNA of gga-miR-21, gga-miR-23, gga-miR-27, gga-miR-122 and gga-miR-128 that cover the entire length of the miRNAs.

The analysis showed that mir-21, mir-23, mir-27, mir-122 and mir-128 can potentially interact with Spry2 through binding to its 3’UTR (Figure 6A).

16

Wang Y. S. Ouyang W. Pan Q. X. Wang X. L. Xia X. X. Bi Z. W. Wang Y. Q. Wang X. M. Overexpression of microRNA gga-miR-21 in chicken fibroblasts suppresses replication of infectious bursal disease virus through inhibiting VP1 translation Antivir.

17

For example, a comparison of miRNA expression profiles in proliferating myoblasts and differentiated myotubes revealed that miR-221 and miR-222 are down-regulated upon differentiation of primary and established myogenic cells, whereas miR-21, miR-103, miR-130, miR-99, miR-30 and miR20 are up-regulated [19, 33], suggesting that these miRNAs play important roles in the transition between proliferation and differentiation of muscle cells.

In addition to miR-206, miR-1 and miR-181, nine other miRNAs among the most abundant in these libraries (miR-221, miR-222, miR-21, miR-103, miR-130, miR-99, miR-30, miR20, and miR128) have been implicated in the proliferation and differentiation of muscle cells (Table 1) [15, 19, 33].

18

The first discovered mammalian miRNA, miR-21, has been implicated in a wide variety of cancers as it targets tumor suppressors for repression [34- 36] (Figure  2C).

A) Gga-mir-155, B) Gga-mir-148a and C) Gga-mir-21 display significantly increased H3K4me3 marks in the resistant line L6 [3] at the latent stage of infection.

Similar to gga-miR-155, strong H3K4me3 marks were observed at the promoter of gga-miR-21 in all samples, with a slight reduction in line L7 [2] at 10 dpi (Figure  2A).

19

Based on other immune related miRNA studies in mammals [11, 66], differentially expressed miRNAs of their mammalian homologs and their targets are presented in Table 9. MiR-15a, miR-21 and miR-181a have important functions in lymphocytes development and modulations while miR-122 and miR-24 are related to virus infection and miR-146a, induced by macrophages, can activate Toll like receptor (TLR) and expose antigens to interleukin-1 beta.

20

MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer.

21

These two genes were targeted by the highest numbers of miRNAs, including miR-101-3p and miR-21-3p.

In addition, some other miRNAs, such as miR-148a, miR-122, miR-21-5p, Let-7f-5p, miR-26a-5p, miR-126-5p, miR-30d, and miR-10a-5p, were also highly abundant in chicken liver.

A previous study demonstrated that miR-148a, miR-122, and miR-21-5p were the most abundant miRNAs in porcine liver 32.

22

MiR-21, the 11th most highly expressed miRNA, negatively regulates BMP4 and has been reported in the epidermis and hair follicle epithelium of normal mouse skin [36].

23

MiR-21, miR-146a/b and miR-155 were obviously up-regulated in rat’s mononuclear cells after Salmonella infection [14, 15].

24

Liver PPARA expression is also regulated by miR-21 and miR-27b in humans [42].

25

This research highlighted the potential role of specific miRNAs in disease progress [23], like miR-21, miR-204, miR-17, miR-155, miR-138 and miR-30c in human and rat mo dels of PAH [7, 8, 28, 29].

26

The top five highly expressed miRNAs were gga-miR-215-5p, gga-miR-10b-5p, gga-miR-21-5p, gga-miR-26-5p, and gga-miR-22-3p, accounting for 40.54, 7.76, 6.78, 6.43, and 6.35% of total known miRNA reads, respectively.

27

Ten mature miRNAs with the highest expression comprised approximately 50% of all miRNAs, showing a relatively abundant distribution (Fig.   5D), while miR-21, miR-26a, miR-125b, miR-101, and miR-199 were the most abundant miRNAs overall, together accounting for 33% of the total.

28

For example, hsa-miR-21-5p has been documented in nearly 400 Pubmed articles and is associated with 124 human disease phenotypes and has homologs in four animals including chicken.

29

This set includes five mature miRNAs (hsa-let-7a-3p, ccr-miR-133a-5p, mmu-miR-144-5p, aca-miR-21-3p and hsa-miR-30c-2-3p), which are present in miRBase as Gallus gallus mature miRNAs with a different 3′ editing (Table 2).

d Difference with aca-miR-21-3p: extra C in 3′.

30

Hayashita and Frankel reported that miR-21 and the miR-17-92 cluster function as antiapoptotic miRNAs in various cancers [64], [65].

31

miR-125b is critical for the proliferation of some human cell lines [25], and mir-21 is thought to function as an oncogene by decreasing apoptosis [26].