sort by

31 publications mentioning bta-mir-27a

Open access articles that are associated with the species Bos taurus and mention the gene name mir-27a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 56
Over-expressed microRNA-27a suppressed fat synthesis during rat hepatic stellate cell activation [51], and down-regulated the key enzyme genes expression involved in de novo lipid synthesis [52]. [score:10]
Furthermore, six differentially expressed miRNAs were validated by qRT-PCR, and the results supported CASR as a miR-27a-5p direct target gene. [score:6]
Moreover, the mRNA and protein expression levels of the miR-27a-5p -targeted gene CASR were significantly higher in steers than in bulls (Fig.   4B). [score:5]
The expression levels of bta-miR-27a-5p, bta-miR-486, bta-miR-450b, bta-miR-424-5p and bta-miR-34a were significantly higher in bulls than in steers, and the bta-miR-204 expression level was lower in bulls (Fig.   4A), which is consistent with the results of RT-qPCR and Solexa sequencing. [score:5]
Recently, Shirasaki et al. demonstrated that the lipid transporter ABCA1 is a target of miR-27a [50], and that the knockdown of ABCA1 in rat hepatoma cells increased triglyceride secretion to the culture medium and decreased the cellular levels of FFA 53, 54. [score:4]
Here, our results confirmed that the calcium-sensing receptor (CASR) gene was verified to be a direct target gene of miR-27a-5p. [score:4]
Whether the CASR gene is a direct target of miR-27a-5p was verified by a dual-luciferase reporter system. [score:4]
Bta-miR-27a-5p was expressed at low abundance in the SL library compared to expression in the BL library. [score:4]
These results obtained in the liver indicate that miR-27a-5p may increase fat deposition by partly targeting CASR in steers. [score:3]
Figure 3(A) Sequence alignment of miR-27a-5p and 3′-UTR of CASR using the TargetScan and miRDB algorithms. [score:3]
These results indicate that miR-27a-5p may increase fat deposition partly by targeting CASR in steers via facilitating the production of TAG and the secretion of TAG as VLDL in the liver 31– 33, 55– 59. [score:3]
In this study, bta-miR-27a-5p was expressed in high abundance, followed by bta-miR-486, bta-miR-450b, bta-miR-424-5p and bta-miR-34a in the BL library compared to the SL library. [score:2]
A previous study found that miR-27a regulated many lipid metabolism-related transcription factors, including RXRα, PPARγ, FASN, SREBP1, and SREBP2 in human hepatoma cells [50]. [score:2]
Approximately 0.16 ug of CASR -3′ UTR-WT or -MUT vectors were cotransfected with 5 pmol miR-27a-5p mimics or negative control (NC) into 293 T cells using Lipofectamine 2000 reagent (Invitrogen). [score:1]
[1 to 20 of 14 sentences]
2
[+] score: 29
Other miRNAs from this paper: bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-107, bta-mir-140, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-let-7g, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-1-2, bta-mir-1-1, bta-mir-101-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-152, bta-mir-154a, bta-mir-185, bta-mir-199a-2, bta-mir-206, bta-mir-30f, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-370, bta-mir-378-1, bta-mir-432, bta-mir-9-1, bta-mir-9-2, bta-mir-1224, bta-mir-376b, bta-mir-376d, bta-mir-376c, bta-mir-376a, bta-mir-1839, bta-mir-1185, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-199c, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-378-2, bta-mir-2284w, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-3604-1, bta-mir-3604-2, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-376e, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-3432b, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Such an expression pattern indicates that they may have more dramatic functions, e. g., miR-27 in signaling and immune responses [53], miR-103 in the regulation of neuronal migration by modulating Cyclin -dependent kinase 5, regulatory subunit 1 (CDK5R1) expression [54], and let-7 in developmental timing in Caenorhabditis elegans [55]. [score:8]
Over-expressed miR-27 allows activated hepatic stellate cells to restore their ability to accumulate cytoplasmic lipid droplets [50], and miR-27 expression has been found to block the expression of PPARγ and C/EBPa, the two master regulators of adipogenesis [51]. [score:8]
By contrast, miR-27 inhibits the expression of peroxisome proliferator-activated receptor (PPAR) γ and C/EBPα, the two master regulators of adipogenesis [11]. [score:6]
These data strongly suggest that miR-27 represents a new class of adipogenic inhibitors and may play a role in the pathological development of obesity. [score:4]
The expression levels of the 15 miRNAs were determined, and the selected miRNAs included five reported tissue-specific miRNAs (bta-miR-9, miR-124, miR-122, miR-27, and miR-103), seven backfat-predominant miRNAs in fetal and/or adult bovine backfat libraries (let-7a, miR-140, miR-199a, miR-320, miR-2284x, miRn8, and miRn25) as well as three high-read miRNAs (miR-154, miR-1839, and miRn26) in backfat that were compared with the muscle library. [score:2]
In addition to miR-122, miR-370, miR-378/378*, miR-27, and miR-335 have also been recently associated with lipid metabolism and adipocyte differentiation [8]– [12]. [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 16
TargetScan predicts 1106 conserved targets for miR-27a/b in the cow, of which MSTN is ranked 82th on the basis of total context score. [score:5]
Mature miR-27 sequence, as predicted by Targetscan, is well conserved among a wide range of mammalian species, and our data are comparable to those obtained recently in mouse, where MSTN 3 [′]UTR was demonstrated to be targeted by miR-27a/b [23]. [score:5]
Although the specific functions and targets of miR-27 in hypertrophic pathway are largely unexplored, in this work we suggest that in Piedmontese cattle, MSTN is further regulated at post-transcriptional level by this miRNA. [score:4]
A 79% of 3 [′]UTR MSTN knock down of luciferase activity is an exceptional down regulation compared to the 48% that Huang and colleagues have shown for miR-27a on murine MSTN 3 [′]UTR. [score:2]
[1 to 20 of 4 sentences]
4
[+] score: 13
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-320a-2, bta-mir-99a, bta-mir-125a, bta-mir-181a-2, bta-mir-27b, bta-mir-10a, bta-mir-139, bta-mir-140, bta-mir-181b-2, bta-mir-487a, bta-let-7d, bta-mir-124a-1, bta-mir-181c, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-154a, bta-mir-181d, bta-mir-184, bta-mir-206, bta-mir-29d, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-486, bta-mir-495, bta-mir-95, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2286, bta-mir-2300a, bta-mir-2300b, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2319a, bta-mir-2319b, bta-mir-2284n, bta-mir-2284g, bta-mir-2329-1, bta-mir-2329-2, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2396, bta-mir-2285c, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2443, bta-mir-2284h, bta-mir-2450c, bta-mir-2450b, bta-mir-2450a, bta-mir-2404-2, bta-mir-2284o, bta-mir-2484, bta-mir-2284e, bta-mir-320a-1, bta-mir-2887-1, bta-mir-2887-2, bta-mir-2284w, bta-mir-3431, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-574, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac, bta-mir-3432b, bta-mir-2450d
Ectopic expression of miR-27 inhibited the expression of PPARγ and C/EBPα in 3 T3-L1 cells [55]. [score:7]
The results showed that miR-29a, miR-27a, and let-7i were highly expressed in MDSC-P; in contrast, miR-320, miR-1, and miR-206 were highly expressed in MDSC-D3. [score:5]
Additionally, miR-27 could modulate the entry of cells into the myogenic differentiation program [11]. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 9
The over -expression of miR-27a or miR-103 in goat mammary epithelial cells led to a change in fat droplet and triglyceride accumulation, lowered the unsaturated/saturated fatty acids ratio and markedly affected the expression of genes associated with lipid metabolism [33, 34]. [score:5]
Mir-27a suppresses triglycerides accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells. [score:4]
[1 to 20 of 2 sentences]
7
[+] score: 9
A number of roles have been suggested for miR-27, which is expressed in a cluster with miR-23 and -24 [30]. [score:3]
GO analysis also revealed potentially novel regulation, such as that of miR-27 in transcriptional and membrane/vesicle -associated processes, miR-30 in immune homeostasis and cellular metabolism and transport, and miR-33 in cardiac development. [score:3]
Annotation clusters with enrichment scores >1 (>1.5 for the miR-27a-3p and let-7a families) were plotted. [score:1]
By analyzing AGO-bound miRNAs in MDBK cells, we found the abundance profile dominated by members of the miR-30, let-7, miR-17, miR-374, miR-21, miR-27 and miR-15 families together accounting for more than 50% (Supplementary Fig.   S2a) [14]. [score:1]
Type Gene ceRNA Ann cow miRNA MDBK 3′UTR miRNA chimeras Non-coding H19 Yes let-7 let-7 Coding PTEN PTENP1 No miR-21 Various miRNAs, mostly miR-27 CNOT6L Yes miR-17, miR-19 miR-17 and miR-25 VAPA Yes miR-17, miR-19 miR-17 ZEB2 Yes miR-26, miR-25 None KRAS KRAS1P Yes let-7 let-7 present, but mostly miR-27 and miR-222 HMGA2 No let-7 let-7 TGFBR3 No let-7 let-7 peak in exon, miR-15, -17, -21, -27 and -31 peaks in 3′UTRDefinitions of previously described ceRNAs in human or mouse were obtained from ref. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 9
It was shown that miR-145 regulate lipogenesis via targeting the INSIG1 gene 59; miR-27a suppress triglyceride accumulation via targeting PPARɣ gene 60 while miR-152 enhance viability and multiplication capacity of cow mammary gland cells through regulation of DNMT1 gene 10. [score:9]
[1 to 20 of 1 sentences]
9
[+] score: 8
In addition, miR-27a has been reported regulating adipogenesis via targeting PPARγ 42. miR-23a was also reported to regulate adipogenesis in 3T3-L1 cells and down-regulated during adipogenesis, but the mechanism was not clarified 43. [score:8]
[1 to 20 of 1 sentences]
10
[+] score: 7
MiR-205 over -expression leads to an expansion of the progenitor-cell population and increased cellular proliferation [26], while miR-27 reduces lipid accumulation by targeting peroxisome proliferator-activated receptor γ (PPARγ) in human adipocyte cells [27], and miR-33 represses sterol transporters in human liver cells [28]. [score:5]
From the top 30 miRNAs, we found six miRNAs (e. g., miR-23a, miR-27b, miR-103, miR-200a/b/c) to be related to lipid metabolism in human adipocyte cells: miR-23 enhances glutamine metabolism [38]; miR-27 decreases fat accumulation [27]; miR-103 regulates triglyceride content during cell differentiation [39]; and miR-200 affects insulin signaling [40]. [score:2]
[1 to 20 of 2 sentences]
11
[+] score: 7
The mechanism responsible for such effect is through MIR27 directly targeting the 3’ untranslated region (UTR) of PPARG mRNA, decreasing its abundance [14], which does not agree with our PPARG results. [score:6]
The pattern of response of MIR27AB observed in this study is in agreement with previous reports demonstrating a negative correlation among MIR27 and genes related to fatty acid and TAG synthesis in goat mammary gland [44] and murine cells [14]. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Furthermore, several miRNAs including miR-27a and miR-92b are differentially expressed during the development of the placenta, where they have been associated with trophoblast differentiation and vascularisation [12, 13]. [score:4]
We detected a total of 208 miRNAs in bovine plasma (based on mean Cq < 35 across all sample pools; Fig.   4a), the most abundant of which (Fig.   4b) corresponded to miRNAs reportedly expressed at high levels in blood cells including erythrocytes (miR-451, miR-486, miR-16), leukocytes (miR-150, miR-27a, miR-23a) and thrombocytes (miR-223, miR-20a, miR-24), and which are putatively released into the plasma through apoptosis, lysis or active secretion [36– 38]. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
Among the down-regulated miRNAs, miR-361-5p [47] and miR-27b (homologous to miR-27a, sharing 20 out of 21 nts) [48] were reported as tumor suppressors. [score:6]
[1 to 20 of 1 sentences]
14
[+] score: 4
Control animals, however, also displayed similar miR-205 increases (2-fold) and miR-432 decreases (2-fold) at the 6 month time-point but were also accompanied by subtle increases (~1.5 fold) in expression for miR-27a, miR-92b, miR-10b, miR-143 and miR-126-5p (Table 3). [score:3]
Comparing the 0 to the six month time-points within each group revealed similar read count profiles for miR-205, miR-10b, miR-92b, miR-432, miR-27a, miR-127, miR-126 and miR-143. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 4
Crist C. G. Montarras D. Pallafacchina G. Rocancourt D. Cumano A. Conway S. J. Buckingham M. Muscle stem cell behavior is modified by microRNA-27 regulation of Pax3 expression Proc. [score:4]
[1 to 20 of 1 sentences]
16
[+] score: 4
Interestingly, STAT3 is also directly targeted by miR-27a-5p of the TURQUOISE module. [score:4]
[1 to 20 of 1 sentences]
17
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Most of the detected top expressed miRNAs are conserved in human, mouse, and bovine, and belong to several miRNA families, vis, miR-31, miR-26a, miR-27a-3p/27b, let-7a-5p/7f/7i, miR-21-5p, miR-22-3p, miR-184, miR-186, miR-191, miR-205 and miR221/222. [score:3]
41%bta-miR-312613032.80%2.92%2.80%2.60%bta-let-7a-5p1906682.04%2.19%1.81%2.05%bta-miR-2221723921.85%1.88%1.84%1.80%bta-let-7i1664401.78%1.73%1.75%1.92%bta-miR-2211418211.52%1.57%1.51%1.44%bta-miR-26a1294201.39%1.45%1.39%1.28%bta-miR-148a1232041.32%1.24%1.40%1.37%bta-miR-27a-3p1180121.26%1.34%1.26%1. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 3
The miRNAs which were most abundant in plasma (Fig 3B) in our experiment are reportedly expressed at high levels in blood cells, including erythrocytes (miR-451, miR-16b), leukocytes (miR-150, miR-27a, miR-23a) and thrombocytes (miR-223, miR-20a, miR-24) and are putatively released into the plasma through apoptosis, lysis or active shedding [41, 42, 14]. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Indeed, it was shown that expression of SV40 stAg results in an induction of the human hsa-miR-27a in a PP2A dependent way, with hsa-miR-27a being a potent tumor promoter involved in cell proliferation [88]. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Wang T. Li M. Guan J. Li P. Wang H. Guo Y. Shuai S. Li X. MicroRNAs miR-27a and miR-143 regulate porcine adipocyte lipid metabolism Int. [score:2]
These miRNAs include: miR-33 [7], miR-122 [8], miR-370 [9], miR-378/378* [10], miR-27 [11], miR-143 [12], miR-335 [13], miR-103 [14] and so on. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 2
Additionally, other miRNAs, such as bta-miR-27a and bta-miR-92b, have variable abundance levels during placental development and are associated with trophoblastic differentiation and vascularization 26, 27. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 2
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Moreover, published report showed that miR-196, miR-214, miR-199b, miR-186, miR-101 and miR-27a were related to bovine backfat thickness [36]. [score:1]
Several miRNAs such as let-7, miR-27 and miR-103 are reported to perform very important functions in adipogenesis [33]– [35]. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
In the goat, a potential role for miR-103 and miR-27a in the regulation of milk fat synthesis in mammary epithelial cells has been reported [34, 35]. [score:2]
[1 to 20 of 1 sentences]
24
[+] score: 2
Coordinate regulation of FOXO1 by miR-27a, mir-96, and miR-182 in breast cancer cells. [score:2]
[1 to 20 of 1 sentences]
25
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
In dairy goats, miR-27a and miR-103 have been found to function as regulators of milk fat metabolism and lactation cycle [26, 27]. [score:2]
[1 to 20 of 1 sentences]
26
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
As described in other studies [51], some small RNAs were generated from the loop or the region between the loop and stem (ssc-let-7e, ssc-miR-27a and ssc-miR-30a) (Figure 10A–C). [score:1]
Interestingly, we observed that three miRNAs (ssc-let-7e, ssc-miR-27a, and ssc-miR-30a) could be generated from miRNA-offset RNAs (moRNAs). [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 1
We also identified two miRNAs (bta-mir-23b and bta-mir-27a) that demonstrated nearly equal number of sequence reads originating from the 5′ and 3′ arms of the miRNA hairpin precursor (Supplemental Table S1). [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
We have identified 13 highly abundant miRNAs with Ct numbers between 10–25 Ct (bta-miR-615, bta-miR-27a-5p, bta-miR-631, bta-miR-323, bta-miR-574, bta-miR-767, bta-miR-320a, bta-miR-411b, bta-miR-421, bta-miR-99b, bta-miR-382, bta-miR-669 and bta-miR-760-5p) (Table 3). [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Most of the miRNAs were cloned multiple times, in which let-7a, let-7b, let-7c, miR-21, miR-23b, miR-24, miR-27a, miR-126 and miR-143 were cloned 10, 28, 13, 4, 11, 7, 6, 4 and 11 times, respectively. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
We observed no change in reporter activity between psiCHECK2-UTR-B and psiCHECK2-UTR-C for miR-138-1-3p, miR-149-5p, miR-204-3p, miR-212-5p, miR-219-1-3p, miR-27a-3p, miR-324-3p, miR-328-3p, miR-668-5p, and miR-668-3p. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
These miRNAs represent seven different miRNA families; miR-let-7 (bta-let-7i & bta-miR-3596), miR-21 (bta-miR-21), miR-27 (bta-miR-27a & bta-miR-27b), miR-28 (bta-miR-151), miR-184 (bta-miR-184), miR-200 (bta-miR-200a & bta-miR-200b), and miR-205 (bta-miR-205). [score:1]
[1 to 20 of 1 sentences]