44 publications mentioning rno-mir-499

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-499. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Expression of CnA and calcineurin activity was suppressed with miR499 overexpression; whereas, expression of dephosphorylated dynamin-related protein 1 (Drp1) was suppressed with miR499 overexpression and CnA siRNA.

Mechanical stretch downregulated miR499 expression, and enhanced the expression of CnA protein and mRNA after 12 hours of stretch.

Overexpression of miR499 significantly inhibited CnA expression (Fig 2A and 2B) and Calcineurin cellular activity (S2 Fig) compared with stretch only; whereas, the addition of mutant miR499 had no effect on CnA expression and calcineurin activity induced by mechanical stretch for 8 hours.

The in vivo aorta-caval shunt also showed downregulated myocardial miR499 and overexpression of miR499 suppressed CnA and cellular apoptosis.

CnA is a direct target of miR499 and miR499 inhibits cardiomyocyte apoptosis through the suppression of CnA -mediated Drp1, thereby decreasing Drp1 -mediated activation of mitochondrial fission.

The addition of antagomir499 alone increased expression of Drp1 more than stretch alone; whereas, antagomir499 attenuated the effect of miR499 overexpression on Drp1 inhibition.

Antagomir499 alone did not affect the expression of CnA and calcineurin activity induced by stretch; however, antagomir499 attenuated the inhibitory effect of miR499 overexpression on CnA and calcineurin cellular activity.

[8, 9] miR499 has been demonstrated to be involved in the pathogenesis of valvular heart disease, ischemic heart disease, and heart failure.

Mechanical stretch inhibits miR499, but increases Calcineurin A (CnA) mRNA, CnA, and unphosphorylated Drp1 protein expression in cardiomyocytes.

In addition, antagomir499 abolished the suppression of caspase 3 activity under stretch by miR499 overexpression.

0148683.g002 Fig 2 (A and B) Representative Western blot and quantitative analysis for the expression of CnA in cardiomyocytes subjected to 20% stretch for 8 hours with the overexpression of miR499, mutant miR499, or antagomir499 (n = 4 per group).

Overexpression of miR499 significantly decreased myocardial CnA, MHCß, and BNP expression induced by AV shunt.

AV shunt inhibits myocardial miR499, but increases calcineurin A (CnA) protein expression.

Overexpression of miR499 decreased the expression of CnA, which could be reversed by adding antagomir 499.

Overexpression of antagomir-499 or mutant miR499 (mut-499) did not have an effect on myocardial CnA protein expression.

Inhibition of p53 increases miR499 expression.

Antagomir499 enhanced cardiomyocyte apoptosis that had been suppressed by the overexpression of miR499.

The involvement of p53 in the regulation of miR499 expression in mechanical stretch was examined.

Adding p53 siRNA reversed the downregulation of miR499 when stretched.

[23, 43] Correspondingly, the addition of p53 siRNA reversed the downregulation of miR499 during mechanical stretch.

Mechanical stretch of 20% for 2 hours resulted in significant miR499 expression compared with control cells, however stretch for 4 to 12 hours significantly down regulated miR499 expression (Fig 1A) compared with the control and 2 hour stretch condition (Fig 1A).

We also observed the down regulation of miR499 expression by p53 transcription when placed under mechanical stretch.

The promoter activity analysis verified the regulation of miR499 expression at the transcriptional level when cardiomyocytes were placed under mechanical stretch.

[24] The expression of miR499 and its regulation of CnA in stretched cardiomyocytes remains to be fully elucidated.

[23, 43] These findings led us to examine whether p53 is involved in the regulation of miR499 expression with mechanical stretch.

These data suggest that p53 can negatively regulate miR499 expression.

These findings suggest that myocardial miR499 levels are downregulated in volume overloaded heart.

Therefore, it is likely that enhanced p53 activity associated with mechanical stretch down-regulates miR499 transcription, which results in relief of repression of CnA, and thereby an increase in dephosphorylated Drp1, leading to mitochondrial fission and cardiomyocytes apoptosis.

Increases in TUNEL positive nuclei of cardiomyocytes induced by AV shunt were significantly reversed by overexpression of miR499.

0148683.g007 Fig 7 (A) Representative microscopy images of myocardium after volume overload heart, addition of miR499 overexpression, mutant miR499 or Antagomir499 before being stretched.

Mechanical stretch increases p53 DNA binding activity and suppresses miR499 promoter activity.

The 200bp amplified product was digested using EcoRI and BamHI restriction enzymes and ligated into pmR-ZsGreen1 plasmid vector (coexpression miR499 and green fluorescent protein, Clontech Laboratories, Mountain View, CA, USA).

[2– 5] Global miRNA expression profiling studies have identified miRNA-499 (miR499) in the heart;[6, 7] however, miR499 function is not fully elucidated.

MiR499 expression may be down regulated by mechanical stretch.

[23] CnA is one of the target genes of miR499.

Overexpression of miR499 significantly decreased the immunoreactive signal induced by AV shunt.

Mechanical stretch increased the binding activity of p53 to DNA and the removal of the p53 -binding site in the miR499 promoter area abolished the suppression effect of p53 on miR499 promoter activity.

Mutant miR499 had no effect on the expression of Drp1 induced by stretch.

Construction and delivery of miR499, antagomir499, and mutant-miR499 expression vector into cultured cardiomyocytes and ventricular myocardium.

Calcineurin cellular activity in cardiomyocytes with 20% stretch for 8 hours with the overexpression of miR499, mutant miR499, or antagomir499 (n = 5 per group).

These results suggest that the p53 binding site in the miR499 promoter is essential for the transcriptional regulation induced by mechanical stretch and that mechanical stretch regulates the miR499 promoter via the p53 pathway.

The influence of miR499 on the expression of CnA in vivo was examined.

An in vivo mo del of volume overload with aorta-caval shunt in adult rats was used to study miR499 expression.

Immunohistochemical staining of left ventricular myocardium after induction of aorta-caval (AV) shunt with or without overexpression of mir499 or antagomir 499 treatments.

Mechanical stretch increases expression of CnA, unphosphorylated Drp1, and Calcineurin cellular activity via miR499.

The expression of miR499 in cardiomyocytes with and without the addition of p53 siRNA resulting from mechanical stretch is shown in Fig 3B.

This result indicated that miR499 was suppressed at the transcriptional level when cells were exposed to mechanical stretch.

Whether miR499 has other potential targets in protecting cardiomyocytes from apoptosis remains to be determined.

When the p53 binding sites were mutated, the inhibition of miR499 promoter activity by stretch at 8 hours was abolished.

Quantitative analysis of Caspase 3 activity in the stretched cardiomyocytes with overexpression of miR499, mutant miR499, and antagomir499.

We currently hypothesize that CnA may be a target of miR499 in stretched cardiomyocytes in response to stress.

The observed annexin V increases were significantly reversed by overexpression of miR499.

MicroRNA 499 (miR499) is highly enriched in cardiomyocytes and targets the gene for Calcineurin A (CnA), which is associated with mitochondrial fission and apoptosis.

[38] The present study is the first to demonstrate that miR499 is actively involved in the inhibition of apoptosis induced by mechanical stretch and volume overload heart failure.

When the miR499 promoter p53 -binding site was mutated, the inhibition of miR499 promoter activity with stretch was reversed.

To investigate the effect of miR499 on myocardial CnA expression, overexpression of miR499, antagomir-499, and mutant type miR499 (mut-499) in the left ventricle was performed.

A transient transfection of this reporter gene into cardiomyocytes revealed that mechanical stretch at 2 hours induced miR499 promoter activation but stretch at 8 hours suppressed its activation (Fig 3E).

Overexpression of miR499 reduced CnA and dephosphorylated Drp1 protein levels, whereas application of antagomir-499 caused a robust increase in CnA and consequent dephosphorylated Drp1 protein, indicating a relief of tonic repression of CnA and dephosphorylated Drp1 by miR499.

The heart weight, heart weight/body weight ratio, LVEDD and LVESD were significantly improved after overexpression of miR499.

0148683.g004 Fig 4 (A) Cardiomyocytes were subjected to mechanical stretch for 8 hours with miR499, mutant miR499, or antagomir499 overexpression.

MiR499 regulation of Drp1 accumulation in cardiomyocytes through its effects on CnA expression was also examined.

The miR499-controlled apoptotic pathway involving CnA and Drp1 in stretched cardiomyocytes may be regulated by p53 through the transcriptional regulation of miR499.

0148683.g005 Fig 5 Representative expression of miR499 (A) and CnA protein (B) of left ventricular myocardium in aorta-caval (AV) shunt rats for 1 to 28 days.

The aims of the current study were to investigate whether the expression of miR499 in cardiomyocytes can be regulated with mechanical stretch and a rat mo del of volume-overload induced heart failure caused by aorta-caval shunt, and to evaluate the molecular mechanism for regulating miR499 on gene and protein expression.

0148683.g001 Fig 1(A) Representative expression of miR499 in cardiomyocytes subjected to 10% or 20% mechanical stretch for 0–12 hours.

Moreover, the addition of p53 siRNA reversed the inhibition of miR499 promoter activity under stretch at 8 hours.

Using transfection reagent for delivery of miR499 expression vector into cultured cardiomyocytes, the transfection efficiency is around 30–40%.

Overexpression of miR499 attenuated cardiomyocyte apoptosis in heart failure induced by volume overload.

To study whether the repression of miR499 by mechanical stretch is regulated at the transcriptional level, we cloned the promoter region of rat miR499 and constructed a luciferase reporter plasmid (pGL3-Luc).

[44] In the present study, miR499-controlled apoptotic pathway involving CnA and Drp1 in cardiomyocytes under mechanical stretch may be regulated by p53.

AV shunt significantly increased myocardial miR499 expression from 1 day to 5 days after shunting, but later decreased significantly from 7 days to 28 days compared to AV shunt at 5 days (Fig 5A).

The mutant miR499 promoter has a mutation of p53 -binding sites.

[23] The regulatory effects of p53 on miR499 may occur as late as 4 to 12 hours after mechanical stretch.

In the present study, while miR499 was down regulated 4 to 12 hours after mechanical stretch, CnA and dephosphorylated Drp1 protein levels were consistently increased after 6 to 12 hours of stretch.

The addition of p53 siRNA significantly reversed the expression of miR499 with mechanical stress for 4 to 12 hours compared with cardiomyocytes without p53 siRNA.

MiR499 overexpression attenuated Drp1 accumulation in stretched cardiomyocytes.

The mechanism regulating miR499 in stretched cardiomyocytes and in volume overloaded heart is unclear.

The mutant miR499 promoter has a mutation of p53 -binding sites in the miR499 promoter region as indicated.

We currently demonstrate significant miR499 down regulation with mechanical stretch and volume overload.

Mir499 mediates the myocardial Calcineurin A (CnA) expression.

These results suggest that miR499 attenuated Drp1 accumulation via CnA in stretched cardiomyocytes.

Modulation of miR499 levels could provide a therapeutic approach for treating heart failure.

Taken together, these results suggest that miR499 plays an essential role in the synthesis of CnA and dephosphorylated Drp1 when placed under mechanical stretch and may provide important new information on the role of miR499 in CnA-Drp1–mediated apoptosis.

The miR499 promoter contained p53 conserved sites (CTAG) at -694 to -690bp.

The addition of miR499 to cardiomyocytes decreased caspase 3 activity.

S1 Fig The green spot is miR499 in situ image.

Mutant miR499 alone had no effect on apoptosis.

AV shunt increased myocardial cellular apoptosis via miR499.

Adding antagomir 499 attenuated the effect of miR499, while mutant miR499 have no effect on heart size after AV shunt.

A bp -941 to -442 rats miR499 promoter construct was generated as follows.

These finding suggest the decreased transcriptional activity of the miR499 promoter due to mechanical stretch is depended on p53.

The CnA promoter contained miR499 conserved sites (AAGCAGTCATGCAATGGCTTAA) at 908 to 929 bp.

Mutant miR499 did not change myocardial CnA after AV shunt.

The current study is the first to demonstrate a link between p53, miR499, CnA, and Drp1 and cardiomyocyte apoptosis when placed under mechanical stretch.

[37] Control of the CnA-Drp1 apoptotic pathway by miR499 may play a role in blocking the effects of pathological insults to the heart.

At 14 days after AV shunt, the presence of miR499 in cardiomyocyte cytoplasm was confirmed using in situ hybridization (S5 Fig).

The green spot is miR499 in situ image.

S5 Fig Representative microscopic images showing the presence of miR499 (green color) in the cytoplasm of cardiac myocytes from left ventricular myocardium in AV shunt rats.

These findings demonstrate that miR499 mediates myocardial cellular apoptosis induced by AV shunt.

The sham groups or scrambled probe did not detect the presence of miR499.

However, these findings suggested miR499 may protect cardiomyocytes from apoptosis induced by different stress, such as reactive oxygen species (ROS) and mechanical stretch.

These results indicate that miR499 plays an essential role in cardiomyocyte apoptosis when exposed to mechanical stretch.

Adding antagomir 499 attenuated the effect of miR499, while mutant miR499 did not have an effect on myocardial cellular apoptosis after AV shunt.

When cardiomyocytes were stretched to 10% of elongation, miR499 levels were similar to those of control cells (no stretch).

The miR499 promoter construct contained AP-1-, p53-, Oct-1, Smad3/4-, and Myc-Max -binding sites (Fig 3D).

For the mutant, the p53 binding sites in miR499 promoter and miR499 binding site in CnA promoter were mutated using a mutagenesis kit (Stratagene, La Jolla, CA, USA).

MiR499 is an evolutionarily conserved muscle-specific miRNA that is encoded within the intron of myosin heavy chain 7B (Myh7B) and is highly enriched in cardiac ventricular myocytes.

Previous study by Wang J et al had demonstrated that miR499 protects cardiomyocytes from H [2]O [2] -induced injury via its effects on Pdcd4 and Pacs2.

Mechanical stretch -induced apoptosis is mediated by miR499 in cardiomyocytes.

2

MiR-499-5p inhibits cardiomyocytes apoptosis induced by hypoxia in vitroTo demonstrate the effect of miR-499-5p on cardiomyocytes apoptosis, we transiently transfected the cultured neonatal rat cardiomyocytes with miR-499-5p mimics, inhibitor, or control, and then the cardiomyocytes were induced by hypoxia for 6 h. As shown in Figure 2A, transfection of miR-499-5p mimics or inhibitor could significantly increase or decrease the miR-499-5p expression level (p < 0.05).

Furthermore, ectopic overexpression or inhibition of miR-499-5p could inhibit or increase the PDCD4 expression at both the mRNA and protein levels (Figure 5C-5D, p < 0.05).

α Overexpression of miR-499-5p in vivoMiR-499-5p agomir (RiboBio) was delivered into hearts to upregulate the miR-499-5p expression through a local delivery method as previously described [9].

As shown in Figure 1A, compared with noninfarcted myocardial tissues, quantitative RT-PCR showed that the expression level of miR-499-5p was significantly downregulated in infarcted myocardial tissues at 1 h, 6 h, and 24 h after AMI (all p < 0.05), whereas its expression was not changed in the sham operated rats group (0 h).

To demonstrate the effect of miR-499-5p on cardiomyocytes apoptosis, we transiently transfected the cultured neonatal rat cardiomyocytes with miR-499-5p mimics, inhibitor, or control, and then the cardiomyocytes were induced by hypoxia for 6 h. As shown in Figure 2A, transfection of miR-499-5p mimics or inhibitor could significantly increase or decrease the miR-499-5p expression level (p < 0.05).

To address the molecular mechanism of miR-499-5p involved in its protective effects against cardiomyocytes apoptosis, we searched for potential target genes of miR-499-5p with a publicly-available database TargetScan, and found that PDCD4 (programmed cell death 4) was predicted as a target of miR-499-5p as it has three potential binding sites within its 3′UTR (Figure 5A).

The luciferase report assay confirmed that PDCD4 was a direct target of miR-499-5p because ectopic overexpression or inhibition of miR-499-5p could increase or decrease the luciferase activities of the wild type PDCD4 3′UTR reporter vector but not the mutant reporter vector (Figure 5B, P < 0.05).

In this study, the luciferase report assay also validated that PDCD4 was a direct target of miR-499-5p because ectopic overexpression or inhibition of miR-499-5p increased or decreased the luciferase activities of cardiomyocytes transfected with the wild type PDCD4 3′UTR reporter vector rather than the mutant reporter vector, which is also validated by two recent researches [34– 35].

To define the effect of miR-499-5p on the myocardial infarct size of AMI, we delivered the miR-499-5p agomir or control into the rat hearts to upregulate the miR-499-5p expression before the rat AMI mo dels were established.

α MiR-499-5p agomir (RiboBio) was delivered into hearts to upregulate the miR-499-5p expression through a local delivery method as previously described [9].

Then, the cardiomyocytes were co -transfected with the wild type or mutant PDCD4 3′UTR plasmid and miR-499-5p mimics, inhibitor, or control using Lipofectamine 2000 (Invitrogen), together with the Renilla luciferase -expressing vector pRL-TK (Promega) used as a spiked-in control to normalize the transfection efficiency.

The change of miR-499-5p expression level during the process of AMI might be important in the modulations of the expression of multiple genes and signaling transduction pathways.

In addition, we found that the protective effect of miR-499-5p overexpression on cardiomyocyte apoptosis induced by hypoxia was blocked after ectopic overexpression of PDCD4 without the miR-499-5p binding site.

A. Expression levels of miR-499-5p in cultured cardiomyocytes transfected with control, miR-499-5p mimics or inhibitor.

To detect the effect of hypoxia on miR-499-5p expression in cultured cardiomyocytes, we collected RNA from cultured neonatal rat cardiomyocytes induced by hypoxia for 0 h, 1 h, 6 h, and 24 h. As shown in Figure 1B, quantitative RT-PCR demonstrated that the expression level of miR-499-5p was remarkably reduced in cardiomyocytes induced by hypoxia for 1 h, 6 h, and 24 h than those not induced by hypoxia (0 h) (all p < 0.05).

D. Quantification of PDCD4 protein expression in cultured cardiomyocytes transfected with miR-499-5p mimics, inhibitor or control.

In the current study, we predicted the potential target genes of miR-499-5p using computational bioinformatic analysis, and found that PDCD4 might be a miR-499-5p target.

Figure 2 A. Expression levels of miR-499-5p in cultured cardiomyocytes transfected with control, miR-499-5p mimics or inhibitor.

C. Quantification of PDCD4 mRNA expression in cultured cardiomyocytes transfected with miR-499-5p mimics, inhibitor or control.

In addition, each miRNA often has hundreds of target genes, thus, it is essential to explore the target network of miR-499-5p that involved in maintaining the cardiac function after AMI.

PDCD4 was verified as a direct target of miR-499-5p.

PDCD4 is verified as a direct target of miR-499-5p.

Based on previous microarray analysis, miR-499-5p was found to be downregulated in the infarcted area of rat heart [9].

Ectopic overexpression of miR-499-5p reduced the apoptotic rates of cardiomyocytes induced by hypoxia, whereas knockdown of endogenous miR-499-5p added the apoptotic rates of cardiomyocytes.

The results displayed that miR-499-5p mimics or inhibitor transfection could greatly inhibit or promote the cultured cardiomyocytes apoptosis induced by hypoxia compared with the control transfection (Figure 2C, p < 0.05).

Functional studies revealed that miR-499-5p could protect cardiomyocytes against apoptosis by directly targeting the pro-apoptotic factor PDCD4.

Overexpression of miR-499-5p in vivo.

The expression levels of miR-499-5p in the infarcted hearts and neonatal rat cardiomyocytes under hypoxia.

A. Relative expression of miR-499-5p in the uninfarcted and infarcted areas of ischaemic heart was assessed by quantitative RT-PCR at the indicated times (n=6, each time-point per group).

The results showed that the myocardial infarct sizes were significantly inhibited by miR-499-5p agomir (Figure 3C, p < 0.05).

MiR-499-5p inhibits cardiomyocytes apoptosis of AMI in vivoTo further define the potential cellular mechanism involved in miR-499-5p -mediated protective effects against myocardial infarction in vivo, we performed immunofluorescence with TUNEL staining to determine the apoptosis in infarcted rat heart sections treated with miR-499-5p agomir or control.

In addition, overexpression of miR-499-5p in the rat mo dels with agomir decreased the myocardial infarct sizes by reducing the cardiomyocytes apoptosis in the infarcted area of rat hearts.

The PDCD4 plasmid encoded the full-length coding sequences of PDCD4 without its 3′UTR, thus could not be suppressed by miR-499-5p.

To quantify the expression level of miR-499-5p in infarcted myocardial tissues of AMI rats, we isolated RNA from infarcted and noninfarcted myocardial tissues at 0 h, 1 h, 6 h, and 24 h after AMI.

The findings may help to further clarify the molecular mechanisms involved in the process of AMI, and provide evidence for the miR-499-5p/PDCD4 pathway as a potential therapeutic target for patients with AMI.

Figure 3 A. Expression levels of miR-499-5p in cardiomyocytes treated with control or miR-499-5p agomir.

To demonstrate whether, we firstly transfected the cultured neonatal rat cardiomyocytes with miR-499-5p mimics to overexpress miR-499-5p, and then transfected it with PDCD4 plasmid or its empty vector.

As shown in Figure 3A, miR-499-5p agomir could remarkably enhance the expression level of miR-499-5p in the infarcted myocardial tissues of rats (p < 0.05).

Representative TUNEL stained photomicrographs of cultured cardiomyocytes transfected with miR-499-5p mimics, inhibitor, or control were shown in Figure 2B.

The results displayed that the apoptosis of cardiomyocytes in the infarcted area was significantly inhibited in the miR-499-5p agomir treated group than the control group (Figure 4B, p < 0.05).

After seeded into 6-well plates, cells were transfected with miR-499-5p mimics (50 nM), miR-499-5p inhibitor (100 nM), or PDCD4 plasmid (2 μg) using Lipofactamine 2000 reagent (Invitrogen) according to the manufacturer's instruction.

We further detected the miR-499-5p expression in cultured neonatal rat cardiomyocytes induced by hypoxia, and found that the miR-499-5p level was remarkably reduced in cardiomyocytes induced by hypoxia than those not induced by hypoxia.

The miR-499-5p mimics, inhibitor, and control were purchased from GenePharma.

B. Relative luciferase activity in cultured cardiomyocytes after cotransfected with wild type or mutant type 3′UTR and miR-499-5p mimics, inhibitor or control.

Recent studies have identified and verified several target genes of miR-499-5p, such as Sox6, Cyclin D1, calcineurin, dynamin-related protein-1, and phosphofurin acidic cluster sorting protein 2 [25, 27, 29].

A. Expression levels of miR-499-5p in cardiomyocytes treated with control or miR-499-5p agomir.

The effect of miR-499-5p overexpression on myocardial infarct size.

B. Representative TUNEL-stained photomicrographs of cardiomyocytes treated with control, miR-499-5p mimics or inhibitor.

C. Apoptotic rates of cardiomyocytes treated with control, miR-499-5p mimics or inhibitor.

We first establisheds and quantified the miR-499-5p expression in infarcted and noninfarcted myocardial tissues at 0 h, 1 h, 6 h, and 24 h after AMI using quantitative RT-PCR.

Furthermore, the mRNA and protein expression of PDCD4 in cardiomyocytes is able to be modulated by miR-499-5p as detected by both gain-of-function and loss-of-function strategies.

Figure 1 A. Relative expression of miR-499-5p in the uninfarcted and infarcted areas of ischaemic heart was assessed by quantitative RT-PCR at the indicated times (n=6, each time-point per group).

B. miR-499-5p expression in neonatal rat cardiomyocytes exposed to anoxia was analyzed at different time points.

These results suggested that miR-499-5p could protect against myocardial apoptosis via its functional target PDCD4.

A fragment of the PDCD4 wild type 3′UTR containing the putative miR-499-5p binding sequence was cloned into a firefly luciferase reporter vector psiCHECK™ (Promega), and the PDCD4 mutant 3′UTR plasmid was subsequently generated by site-directed mutagenesis and used as a control.

It has also been reported that miR-499-5p could regulate cardiomyocytes proliferation and differentiation [25– 26], and it could protect cardiomyocytes from H [2]O [2] -induced apoptosis [27].

MiR-499-5p inhibits cardiomyocytes apoptosis induced by hypoxia in vitro.

MiR-499-5p expression was normalized to U6 snRNA.

MiR-499-5p inhibits cardiomyocytes apoptosis of AMI in vivo.

PDCD4 was involved in miR-499-5p -mediated cardiomyocytes apoptosis.

More interesting, this phenomena was verified in humans, and serum miR-499-5p could serve as a diagnostic biomarker for AMI patients based on our and other studies [20– 24].

Thus, the objective of this work is to study the role of miR-499-5p in AMI and its potential molecular mechanisms.

B. Apoptotic rates of cardiomyocytes treated with control or miR-499-5p agomir.

Our results verified that the miR-499-5p level was obviously decreased in the infarcted myocardial tissues than noninfarcted myocardial tissues, suggesting that miR-499-5p in the non-infarcted area might participate in the pathophysiological response to AMI.

Our and several other recent studies have reported that miR-499-5p might leak out of the necrotic myocardium and into the circulation during early stages of AMI; furthermore, the level of circulating miR-499-5p decreases to normal level at the time of hospital discharge.

C. Infarcted size in rat hearts treated with control, miR-499-5p agomir or antagomir.

Therefore, miR-499-5p has important role in the pathophysiology of AMI.

Based on our present study, we would like to point out that there was still no enough data on modulating miR-499-5p to protect against cardiomyocytes apoptosis.

Representative TTC-stained heart slices from rats treated with miR-499-5p agomir or control were displayed in Figure 3B.

The effect of miR-499-5p on neonatal rat cardiomyocytes apoptosis under hypoxia.

Representative TUNEL stained photomicrographs of infarcted heart sections treated with miR-499-5p agomir or controls were displayed in Figure 4A.

To further define the potential cellular mechanism involved in miR-499-5p -mediated protective effects against myocardial infarction in vivo, we performed immunofluorescence with TUNEL staining to determine the apoptosis in infarcted rat heart sections treated with miR-499-5p agomir or control.

Figure 4 A. Representative TUNEL-stained photomicrographs of cardiomyocytes treated with control or miR-499-5p agomir.

Briefly, the aorta and pulmonary arteries were identified and clamped after anaesthetized and thoracotomy, and the solution containing miR-499-5p agomir (10 nM, RiboBio) or control dissolved in 200 μl PBS was injected through a catheter which injected from the apex of the left ventricle to the aortic root.

B. Representative TTC-stained heart slices from rats treated with control or miR-499-5p agomir.

The effect of miR-499-5p on cardiomyocytes apoptosis in the infarcted hearts.

In addition, it was reported that the plasma level of miR-499-5p was significantly increased in AMI rats [20].

As a cardiac-abundant miRNA under physiological conditions, miR-499-5p was found to be decreased in the infarcted area of rat heart by microarray analysis [9].

A. Representative TUNEL-stained photomicrographs of cardiomyocytes treated with control or miR-499-5p agomir.

Taken together, these results demonstrated that miR-499-5p had a protective effect on myocardial infarction during AMI.

In conclusion, our current work demonstrated that miR-499-5p was reduced in infarcted myocardial tissues of AMI and in cultured cardiomyocytes induced by hypoxia.

Thus, the circulating miR-499-5p is useful as biomarker for the diagnosis of AMI [20– 24].

PDCD4 is involved in miR-499-5p -mediated cardiomyocytes apoptosis.

Figure 5 A. Three putative binding sites of miR-499-5p in the 3′UTR of PDCD4.

A. Three putative binding sites of miR-499-5p in the 3′UTR of PDCD4.

3

By gain- and loss-of-function methods, including stable overexpression of miR-499 and Sox6 and transient down-regulation of miR-499 and Sox6, we demonstrate that Sox6, as a repressor of cyclin D1, arrests cardiomyocyte proliferation and facilitates cell cycle exit; miR-499 on the other hand downregulates the expression of its target protein, Sox6, to an appropriate level so as to prevent cardiomyocyte apoptosis.

During skeletal muscle atrophy, increased expression of Sox6 was associated with down-regulation of miR-499 [18]; in neonatal rat cardiomyocytes, Sox6 mRNA expression was significantly reduced after miR-499 overexpression [18, 19].

As miRNAs usually show pronounced spatial and temporal expression patterns, we analyzed the time course of miR-499 expression and the expression of its target gene Sox6 during cardiomyocyte differentiation in the P19CL6 in vitro differentiation system.

Sox6 overexpression inhibited cell proliferation, which means that it might be required for the terminal differentiation of cells; at the same time, overexpression of Sox6 resulted in increased cell apoptosis, which was also observed in the case of miR-499 knock-down.

The results demonstrated that although miR-499 was overexpressed in these cells, the overexpression of Sox6 could inhibit the proliferation induced by miR-499, and the proliferation rate returned to normal.

Two groups [7, 16] have documented that miR-499 overexpression reduces proliferation and enhances differentiation of cardiac stem cells or cardiomyocyte progenitor cells; it increases the expression of cardiac troponin T, α-cardiac actinin, and MLC-2v or the expression of Nkx-2.5 and GATA4.

The expression profile of Sox6 indicated that Sox6 was not detected until day 8 of induction, and that its expression reached the highest value on day 10 (Figure 4E ), by which time miR-499 expression started to increase (Figure 1C ).

In addition, the effects of anti-499 were further examined by: miR-499 knock-down resulted in increased Sox6 expression, thus reduced cyclin D1 expression (Figure 7D ).

Sox6 was identified as a direct target of miR-499 and its expression was detected from day 8 or day 10 of cardiac differentiation of P19CL6 cells.

miR-499 is an miRNA that is abundantly found in cardiac cells and is essentially undetectable in human cardiac stem cells (hCSCs) or human embryonic stem cells (hESCs), but is expressed in differentiated or post-mitotic cardiomyocytes and continues to be expressed in fetal, neonatal, and adult cardiomyocytes [7– 9].

The inhibitory effect of miR-499 on Sox6 translation might also be observed in cardiac differentiation of P19CL6 cells.

In contrast, the data from our study showed that miR-499 overexpression has no remarkable effect on the expression of GATA4 and Nkx-2.5; moreover, the cell proliferation was significantly enhanced in P-499 cells.

P19CL6 cells at 0 d. Given that miR-499 might participate in the cardiac differentiation of P19CL6 cells, we established a cell line that stably overexpressed miR-499 (P19CL6-miR-499, hereafter referred to as P-499) in order to observe the impact of persistent miR-499 expression on cardiac differentiation.

In P19CL6 and P-c3.1 cells, the percentage of cells in the G1 phase increased from 72.27% and 74.30% respectively at day 8, to 76.76% and 77.31% respectively at day 10, indicating that the cells had almost stopped proliferating and might have started undergoing terminal differentiation; on the other hand, in P-499 cells, the percentage of cells in the G1 phase on day 8 (63.09%) and day 10 (61.5%) were at the same level as on day 6, which suggests that overexpression of miR-499 may maintain cell proliferation and thus inhibit terminal differentiation (Figure 2B, S2A).

As a potential target of miR-499, the expression of Sox6 is also late stage-specific.

As three highly conserved predicted miR-499 -binding sites are reportedly present in Sox6-3’UTR and because of the known association between Sox6 and heart development, Sox6 is the most likely target gene of miR-499.

Next, we performed an annexin V-FITC binding assay (Figure 6C, S4C) in the P-499 cell line to determine whether miR-499 inhibited apoptosis through its target Sox6.

MiR-499 knock-down enhanced apoptosis in the late differentiation stage in P19CL6 cells, but overexpression of miR-499 resulted in a decrease in the apoptosis rate.

In our experiments, not only did the endogenous Sox6 protein level decrease as a result of pre-miR-499 transfection, but also anti-499 transfection could upregulate the Sox6 protein level in P19CL6 cell-derived cardiomyocytes during the late stage of differentiation.

Meanwhile, miR-499 knock-down in P19CL6 cells had similar effects to Sox6 overexpression.

Furthermore, when we knockdown the endogenous miR-499, the expression of Sox6 was increased.

Next, we tested whether knock-down of endogenous miR-499 could influence endogenous Sox6 expression.

In conclusion, our results provide evidence for Sox6 being a target of miR-499, and for the role of both Sox6 and miR-499 in neonatal heart development.

The early stage witnessed steady proliferation even as the cells began to differentiate; the expression of miR-499 and Sox6 was very low or undetectable at this stage.

It is believed that one of the targets of miR-499 is Sox6, which is a member of the Sox transcription factor family and has been detected in a number of tissues [10, 11].

Numerous studies have demonstrated that miR-499 could target Sox6 via Sox6-3’UTR luciferase reporters [7, 8, 16, 17].

In P-499 cells, as Sox6 levels were markedly decreased by overexpression of miR-499, cyclin D1 was consequently maintained at a higher level than in P19CL6 cells, leading to continuous proliferation of differentiating cardiomyocytes during the late stage of differentiation.

Using a well-established in vitro cardiomyocyte differentiation system, mouse P19CL6 cells, we found that miR-499 was highly expressed in the late stage of cardiac differentiation.

Identification of P19CL6-miR-499 and P19CL6-Sox6 stable cell lines was performed by examination for expression of miR-499 and Sox6, respectively.

It has been reported that transgenic mice expressing a high level of miR-499 had larger hearts and displayed contractile dysfunction.

To examine the temporal expression profile of miR-499 during cardiomyocyte differentiation, qRT-PCR for miR-499 was performed.

We first determined whether miR-499 promoted proliferation through its target Sox6.

Therefore, miR-499 overexpression promotes cell proliferation.

It should be noted that the endogenous miR-499 and Sox6 showed the opposite expression trend during the cardiac differentiation of P19CL6 cells.

These results indicate that miR-499 may target cyclin D1 via Sox6.

The overexpression of Sox6 could reverse the proliferation and anti-apoptosis effects of miR-499.

MiR-499 might regulate cyclin D1 expression via its influence on Sox6.

There are also some indications that miR-499 may target cyclin D1 via Sox6.

Transgenic expression of miR-499 also effectively reduced the elevated Sox6 mRNA level in miR-208a [-/-] hearts and reduced the Sox6 mRNA level in skeletal muscles of MCK-miR-499 transgenic mice [19].

After 48 h of anti-499 transfection, Sox6 protein level was upregulated compared to the control groups (Figure 4D ), suggesting that the presumed repression of Sox6 by endogenous miR-499 could be attenuated by exogenous anti-499.

We found that Sox6 and miR-499 are highly expressed during cardiomyocyte terminal differentiation.

This supports already available evidence that Sox6 is a target of miR-499.

Mouse Sox6-3’UTR has seven miR-499 target sites, three of which are conserved in its human, mouse, rat, dog and chicken counterparts.

This is supported by our finding that overexpression of Sox6 reversed the enhanced proliferation and anti-apoptotic effects of miR-499.

The expression of miR-499 was almost undetectable at day 0 and day 6, but increased gradually from day 8, indicating that miR-499 might have some biological function in the late stage of cardiac differentiation of P19CL6 cells (Figure 1C ).

The results are given as relative value to the miR-499 expression level in P19CL6 cells at day 0 (0 d).

Employing the same strategy described previously, after another 2 days of culture, we found that when Sox6 was overexpressed, the lower apoptosis rate induced by miR-499 was reversed to normal.

In agreement with this, several studies have also reported that miR-499 is highly expressed in differentiated or post-mitotic cardiomyocytes but is almost absent or barely detectable in undifferentiated hCSCs [7], human cardiomyocyte progenitor cells (hCMPCs) [16] and hESCs [9].

As the maximum level of miR-499 expression was observed on day 12 of differentiation (Figure 1C ), P19CL6 cells were replated at day 12 of differentiation for anti-499 transfection.

It was also found that miR-499 might exert its function by regulating cyclin D1 via its influence on Sox6.

This indicates that the regulation of Sox6 by miR-499 is not only associated with cardiomyocyte differentiation but is also late stage-specific.

miR-499 probably regulates the proliferation and apoptosis of P19CL6 cells in the late stage of cardiac differentiation via its effects on Sox6 and cyclin D1.

MiR-499 was highly expressed in the late stage of cardiac differentiation in P19CL6 cells.

Therefore, miR-499 knock-down increased the apoptosis rate of cells at the late differentiation stage.

MiR-499 targeted Sox6 at the late stage of cardiac differentiation.

MiR-499 is a cardiac-abundant miRNA.

Pre-miR-499 duplex or scrambled negative control at a final concentration of 50 nM with Lipofectamine 2000 was added into each well.

Therefore, we replated P19CL6 cells at day 8 of differentiation, for pre-miR-499 transfection.

The flow cytometry analysis indicated that miR-499 had significant effects on cell proliferation in the late stage of differentiation but not in the early stage.

The ventricular cardiomyocytes were transfected with pre-miR-499 or scrambled oligonucleotides.

Sox6 reversed the proliferation and anti-apoptosis effects of miR-499.

MiR-499 knock-down enhanced apoptosis of cells in the late differentiation stage.

P-499, P19CL6 cells stably transfected with pcDNA3.1-miR-499 recombinant plasmid; Empty, P-499 cells transfected with pcDNA3.1 plasmid; Sox6, P-499 cells transfected with pcDNA3.1-Sox6 recombinant plasmid.

Synthesis of pre-miR-499, anti-miR-499 and Sox6 siRNA oligonucleotides.

In cells stably transfected with miR-499 (P-499 cells), it was found that miR-499 could promote the differentiation into cardiomyocytes at the early stage of cardiac differentiation.

Moreover, under cardiac pressure overload by thoracic aortic banding, the hearts of miR-499 transgenic mice demonstrated accentuated cardiac enlargement and severe contractile dysfunction, but the cardiomyocyte size was almost normal [19].

The main aim of our study was to determine the association between Sox6 and miR-499 and its role during the process of cardiomyocyte differentiation and maturation.

However, miR-499 and Sox6 were both highly expressed in the late stage, which is characterized by gradual decrease in proliferation.

However, how miR-499 is turned on in the cardiac differentiation system is still unclear.

Thus, a balance between cell proliferation and apoptosis is required, and miR-499 probably plays a role in this.

When the cells reached approximately 50% confluence, P19CL6 cells were transfected with 2 µg pcDNA3.1-Sox6 plasmid, pcDNA3.1-miR-499 plasmid, or the control pcDNA3.1 plasmid using Lipofectamine 2000.

However, the biological functions of miR-499 in differentiated cardiomyocytes or in cardiomyocyte differentiation is not very clear.

To construct the miR-499 expression plasmid, a 453-bp DNA fragment encompassing pri-miR-499 was amplified by PCR from mouse genomic DNA, using the forward primer (XhoI site underlined) 5′-acac CTCGAGAGGTGAGGTCCAGACTGGGG-3′ and reverse primer (HindIII site underlined) 5′-gtac AAGCTTTGGTTAGGGAC CAGAGGGGA-3′.

Anti-miR-499 is a 2′- O-methyl -modified single-stranded RNA: 5′-AAACAUCACUGCAAGUCUUAA-3′.

We have noticed some controversial reports on the function of miR-499.

Pre-miR-499, anti-miR-499, Sox6 siRNA and scrambled negative control were chemically synthesized by Genechem Co.

Pre-miR-499 is single-stranded nucleotides containing two sequences that one is identical to mature miR-499, 5′-UUAAGACUUGCAGUGAUGUUU-3′, and another mimics the endogenous stem-loop.

However, the biological functions of miR-499 in differentiated cardiomyocytes or in the cardiomyocyte differentiation process is not very clear.

The Sox6-3’-UTR luciferase reporter was prepared by amplifying the 720-bp DNA fragment of Sox6-3’UTR, which harbors three highly conserved predicted miR-499 -binding sites.

In addition, Sox6 mRNA levels were significantly reduced in neonatal rat cardiomyocytes after miR-499 transfection [17].

P-c3.1, P19CL6 cells stably transfected with pcDNA3.1 plasmid; P-499, P19CL6 cells stably transfected with pcDNA3.1-miR-499 recombinant plasmid; P-Sox6, P19CL6 cells stably transfected with pcDNA3.1-Sox6 recombinant plasmid.

The plasmid was designated pcDNA3.1-miR-499.

To further confirm that miR-499 could promote cardiomyocyte proliferation during terminal differentiation, we tested whether miR-499 could promote proliferation of neonatal rat cardiomyocytes.

P-c3.1, P19CL6 cells stably transfected with pcDNA3.1 plasmid; P-499, P19CL6 cells stably transfected with pcDNA3.1-miR-499 recombinant plasmid.

These results promoted us to investigate whether Sox6 is the target of miR-499 during cardiac differentiation of P19CL6 cells.

0074504.g004 Figure 4. (A) A schematic diagram showing the three highly conserved predicted miR-499 -binding sites of Sox6-3’UTR.

Using the annexin V-FITC binding assay, we found that miR-499 overexpression resulted in a decreased apoptosis rate in P-499 cells compared with P19CL6 and P-c3.1 cells from day 6 to day 12 (Figure 3A, S2C).

P-499, P19CL6 cells stably transfected with pcDNA3.1-miR-499 recombinant plasmid; Empty, P-499 or mir-499 cells transfected with pcDNA3.1 plasmid; Sox6, P-499 or mir-499 cells transfected with pcDNA3.1-Sox6 recombinant plasmid.

How the association between miR-499 and Sox6 is related with the differentiation process of cardiomyocytes needs to be elucidated.

After 48 h of pre-miR-499 transfection, showed that the Sox6 protein level was reduced dramatically (Figure 4C ).

4

MiR-499 inhibited the expression of pro-apoptotic genes and upregulated expression of the anti-apoptotic gene BCL- XL.

LPS stimulation upregulated SOX6 and PDCD4 expression and enhanced cardiomyocyte apoptosis by suppressing miR-499.

Thirteen miRNAs, including miR-21, were upregulated in early-stage dilated cardiomyopathy, whereas 11 miRNAs including miR-499 were downregulated [39].

We discovered that LPS stimulation reduced miR-499 expression, thereby relieving the inhibitory effect on its target genes SOX6 and PDCD4, which then activated the BCL-2 family pathway to participate in LPS -induced apoptosis.

Data represent the results of three independent experimentsIn LPS -treated rat cardiomyocytes, miR-499 overexpression inhibited Bad, Bax, and Bid mRNA level, and promoted Bcl- xL level (Fig.   5c); meanwhile, the expression of these genes was not affected significantly by miR-499 without LPS treatment (data not shown).

Previously, we discovered that PDCD4 (programmed cell death 4) was a target of miR-499 in the regulation of hydrogen peroxide (H [2]O [2]) -induced apoptosis [21], where PDCD4 is upregulated during apoptosis [22].

Data represent the results of three independent experiments In LPS -treated rat cardiomyocytes, miR-499 overexpression inhibited Bad, Bax, and Bid mRNA level, and promoted Bcl- xL level (Fig.   5c); meanwhile, the expression of these genes was not affected significantly by miR-499 without LPS treatment (data not shown).

In LPS -treated rat cardiomyocytes, the cotransfection of Sox6 or Pdcd4 with miR-499 reversed the miR-499 -mediated cardiac protective effects, which included upregulation of Bad, Bax, and Bid mRNA/protein, and downregulating Bcl- xL mRNA/protein (Fig.   5d–f), indicating the existence of an miR-499- Sox6/ Pdcd4-apoptosis pathway.

Additionally, in rat myocardial infarction area induced by anoxia and ischemia, miR-499 inhibited cardiomyocyte apoptosis through regulation of mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1 [40].

SOX6 and PDCD4 reversed these effects, suggesting that miR-499 regulates BAD, BAX, BID, and BCL- XL expression by inhibiting SOX6 and PDCD4, thereby playing a key role in LPS -induced cardiomyocyte apoptosis.

MiR-499 and miR-21 were downregulated in LPS -induced cells in a dose- and time -dependent manner, while there was no significant change to miR-1, miR-133, and miR-208 expression.

Meanwhile, Western blot analysis indicated that miR-499 Mimic attenuated SOX6 and PDCD4 expression, whereas miR-499 Inhibitor elevated it (Fig.   4d).

f BAD, BAX, BID, and BCL-XL expression in H9c2 cells cotransfected with miR-499 Mimic in combination with SOX6 or PDCD4 overexpression plasmid, respectively, and then exposed to 1 μg/mL LPS for 6 h. GAPDH was used as the internal control.

In the present study, LPS stimulation suppressed miR-499 expression, which led to elevation of the cardiomyocyte apoptosis rate.

Short exposure (6 h) to LPS decreased miR-499 expression, but did not alter expression of the other miRNAs significantly.

In summary, LPS stimulation relieved the inhibitory effect of miR-499 on its target genes SOX6 and PDCD4, which enhanced LPS -induced cardiomyocyte apoptosis through the BCL-2 family members.

These results suggest that SOX6 and PDCD4 both are direct miR-499 targets.

In our previous work, we showed that miR-499 and miR-21 were upregulated in H [2]O [2] -induced cardiomyocyte apoptosis [21].

MiR-499 regulates apoptosis through multi-gene targeting.

MiR-499 levels were downregulated in response to LPS stimulation.

It should be noticed that we used H9c2 cells for the most experiments to demonstrate SOX6 and PDCD4 as the targets of miR-499.

SOX6 and PDCD4 were targets of miR-499 in LPS -induced apoptosis.

The LPS -induced expression of miR-499 in the cardiomyocytes was concentration- and time -dependent (Fig.   1b, c).

A scrambled 22-nucleotide (nt) miRNA (negative control [NC]), miR-499 Mimic and miR-499 Inhibitor were obtained from RiboBio (Guangzhou, China).

a MiR-499 level in cardiomyocytes after 48-h transfection with miR-499 Mimic or Inhibitor.

Because pcDNA3.1- Sox6 and pCMV-SPORT- Pdcd4 constructs do not contain 3′-UTR in which the miR-499 binding sites locate, they were not targeted by miR-499.

MiR-499 was also downregulated in cardiomyocytes exposed to anoxia [40].

Fig.  5LPS inhibits miR-499 to activate the SOX6 and PDCD4 pathways.

Data represent the results of three independent experiments To investigate whether miR-499 inhibited cardiomyocyte apoptosis by suppressing SOX6 and PDCD4, we performed a rescue experiment in miR-499 -treated cells by transfecting pcDNA3.1- Sox6 or pCMV-SPORT- Pdcd4 plasmids.

Our previous research demonstrated that miR-499 inhibited apoptosis during cardiac differentiation of P19CL6 cells [10].

In the myocardium of rats with acute myocardial infarction, the expression of some miRNAs was altered, including cardiac-abundant miRNAs such as miR-1, miR-133, miR-208, and miR-499 [15– 17].

b Representative flow cytometry images of annexin V/PI-stained cardiomyocytes treated with miR-499 Mimic or Inhibitor, and then exposed to 1 μg/mL LPS for 6 h. c Quantitative results for annexin V -positive cardiomyocytes from three independent experiments.

d Representative images of TUNEL-stained cardiomyocytes treated with miR-499 Mimic or Inhibitor, and then exposed to LPS as above.

Data represent the results of three independent experimentsTo investigate whether miR-499 inhibited cardiomyocyte apoptosis by suppressing SOX6 and PDCD4, we performed a rescue experiment in miR-499 -treated cells by transfecting pcDNA3.1- Sox6 or pCMV-SPORT- Pdcd4 plasmids.

e Expression of SOX6 (left) and PDCD4 (right) in H9c2 cells cotransfected with miR-499 Mimic in combination with SOX6 or PDCD4 plasmid, respectively.

Overexpression of miR-499 protected cardiomyocytes against LPS -induced apoptosis.

b, c Luciferase analysis of the effect of miR-499 on its potential targets.

a Schematic illustration indicates the seed sequences on the 3′-UTR of SOX6 or PDCD4, which are potential target genes of miR-499.

To investigate whether miR-499 affects the expression of the endogenous target genes, we analyzed the SOX6 and PDCD4 sequences and generated luciferase reporters with the 3′-UTR of SOX6 and PDCD4, and the constructs contained a mutated segment of SOX6 (seed sequence AGUC UUA was mutated to AGUC CUA) and PDCD4 (seed sequence AGUCU UA was mutated to AGUCU GC), respectively (Fig.   4a).

d SOX6 and PDCD4 protein level in cardiomyocytes treated with miR-499 NC, Mimic, or Inhibitor.

Fig.  4 SOX6 and PDCD4 are targets of miR-499.

To elucidate the molecular mechanisms by which miR-499 regulates apoptosis, we focused on SOX6 and PDCD4, which play important roles in cardiomyocyte differentiation of P19CL6 cells [10] and in protecting adult cardiomyocytes against oxidative stress [21], respectively.

Our experiments also showed that the BCL-2 family is involved in miR-499- SOX6- PDCD4 apoptotic regulation.

To investigate how LPS downregulates miR-499, sequence analysis of the promoter region of MYH7B, the host gene of miR-499, was performed.

Cardiac-abundant miRNAs such as miR-1, miR-133, miR-208, and miR-499 regulate diverse aspects of cardiac function, including cardiomyocyte proliferation, differentiation, contractility, and stress responsiveness.

MiR-499, which is specifically expressed in skeletal muscle and the heart, was first described in 2005 [18].

miR-499 activated the SOX6 and PDCD4 pathways.

d, e mRNA Level of BAD, BAX, BID, and BCL- XL in H9c2 cells cotransfected with miR-499 Mimic in combination with SOX6 (d) or PDCD4 (e) plasmid, respectively.

SOX6 PDCD4 LPS miR-499 Cardiomyocyte Apoptosis Sepsis -induced myocardial functional disorder is one of the main predictors of morbidity and mortality of sepsis [1]; apoptosis is one of the major contributors to the pathophysiology of sepsis [2].

Several reports demonstrated that transient transfection of miR-1 and miR-499 reduced proliferation and enhanced differentiation into cardiomyocytes in human cardiac progenitor cells and embryonic stem cells [6].

Currently, whether PDCD4 can be controlled by cardiac-abundant miR-499 in LPS-stimulated cardiomyocyte apoptosis is unclear.

c Endogenous mRNA level of BAD, BAX, BID, and BCL- XL in response to 6-h stimulation with 1 μg/mL LPS in H9c2 cells transfected with miR-499 NC, Mimic.

Whether miR-499 participates in LPS -induced apoptosis is unknown, as is the possible mechanism involved.

In a transgenic mouse mo del, elevated miR-499 levels affected Egr1 and Fos, the immediate early genes in the response to cardiac stress [31].

5

If the relaxin-3/RXFP3 system were to compensate for the reduced levels of relaxin-3 following infusion of rAAV1/2 EmGFP miR499, one mechanism could be the up-regulation of RXFP3 expression in nuclei that receive relaxin-3 projections.

Despite substantial and significant reductions in hindbrain relaxin-3 expression, expression of RXFP3 was unchanged in the hindbrain of rAAV1/2 EmGFP miR499 treated animals (Figure 5C).

Together, these results suggest neurons transduced by rAAV1/2 EmGFP miR499 are relatively healthy as they are still capable of expressing proteins other than relaxin-3. Therefore, the silencing of relaxin-3 is specific and unlikely to be due to effects on neuronal health or protein expression.

In vitro, all three miRs significantly reduced relaxin-3 expression, with miR499 (Figure S1) exerting the greatest silencing effect resulting in a 5-fold reduction in expression.

rAAV1/2 EmGFP miR499 infusion reduced hindbrain relaxin-3 expression to between 7.2 and 21.1% of the average level of the saline infused group, which corresponds to an average expression of 13.4% across the group.

Three weeks after bilateral infusion of rAAV1/2 EmGFP miR499 into the NI, the EmGFP transgene was robustly expressed, indicating viral transduction and coexpression of miR499 (Figure 2D).

For example, if the relaxin-3/RXFP3 system were to compensate for the reduced levels of relaxin-3 following infusion of rAAV1/2 EmGFP miR499 by up -regulating expression of RXFP3 in nuclei that receive relaxin-3 projections, function could be maintained.

0042300.g002 Figure 2 EmGFP transgene expression (A, D, G) and relaxin-3-like immunoreactivity (B, E) in no infusion controls (A, B, C) and following bilateral infusion of rAAV1/2 EmGFP miR499 (D, E, F) or rAAV1/2 EmGFP miRC (G, H, I).

Thus, our current understanding of the stimuli responsible for relaxin-3 expression leads to the hypothesis that although relaxin-3 mRNA and peptide is reduced following administration of rAAV1/2 EmGFP miR499, in the absence of stimuli for relaxin-3 release, the residual peptide might accumulate in the neuron and when release occurs, levels are not substantially impaired.

EmGFP (green) is expressed in cells transduced by rAAV1/2 EmGFP miR499.

0042300.g004 Figure 4 EmGFP (green) is expressed in cells transduced by rAAV1/2 EmGFP miR499.

In rats that received an infusion of rAAV1/2 EmGFP miR499 6 weeks prior (n = 4), there was strong expression of NeuN, in the presence of EmGFP and the absence of relaxin-3-LI (Figure S2A).

The average relaxin-3 expression in rats of the rAAV1/2 EmGFP miR499 treatment group was only 13% of the equivalent saline infusion control group, verifying the KD already observed using immunohistochemistry.

In vivo Silencing of Relaxin-3 Expression with rAAV1/2 EmGFP miR499.

In several rats, the complete absence of relaxin-3-LI in the NI following a successfully targeted infusion of rAAV1/2 EmGFP miR499 indicated that the levels of relaxin-3 in the NI were substantially reduced.

Time Course of Relaxin-3 Silencing and Transgene Expression Following rAAV1/2 EmGFP miR499 Treatment.

EmGFP transgene expression (A, D, G) and relaxin-3-like immunoreactivity (B, E) in no infusion controls (A, B, C) and following bilateral infusion of rAAV1/2 EmGFP miR499 (D, E, F) or rAAV1/2 EmGFP miRC (G, H, I).

The structure of the engineered miR499 pre-miRNA sequence includes the antisense target sequence (light purple), the loop sequence (light blue) and the sense sequence with a two-nucleotide deletion (Δ2nt, orange).

Whilst it was interesting to note, the neurons of the neighbouring dorsal tegmental nucleus remained untransduced, it was not important to restrict transduction to the NI, as the expression of miR499 would be expected to have no effect on neurons that did not produce relaxin-3. Immunohistochemical analysis of relaxin-3 following infusion of rAAV1/2 EmGFP miR499 established that the silencing observed in vitro [30] was recapitulated in vivo.

In order to determine the optimal time to begin phenotypic analyses following vector infusion, we investigated the temporal profile of EmGFP transgene expression and relaxin-3 silencing following bilateral infusion of rAAV1/2 EmGFP miR499 (6×10 [7] gc, n = 4 rats per time point).

However, in rats that received NI infusions of rAAV1/2 EmGFP miR499, the density of relaxin-3-LI fibres in the MS is markedly reduced.

Success in using rAAV1/2 EmGFP miR499 treatment to produce adult rats with reduced relaxin-3 enabled examination of endogenous relaxin-3 function.

Cells were transfected using the calcium phosphate method with 50 µg DNA consisting of equimolar amounts of pAM-EmGFP (vector, miRC or miR499) and the two helper plasmids, pDPI and pDPII [45].

In rAAV1/2 EmGFP miR499 transduced neurons of the NI, high power images demonstrate the Nissl substance was localised in the neuronal soma (Figure S2B).

Holm-Sidak post-hoc analysis revealed that the rAAV1/2 EmGFP miR499 treated group had significantly less hindbrain relaxin-3 than all other groups (vs EmGFP, t = 11.266, p = 2.31×10 [−10]; vs EmGFP miRC, t = 10.899, p = 4.21×10 [−10]; vs Saline, t = 10.477, p = 8.52×10 [−10]).

A and B received no infusion, n = 4. C and D are 3 weeks following bilateral infusion of rAAV1/2 EmGFP miR499, n = 4. Scale bars indicate 1.5 mm (A, C) and 150 µm (B, D).

Both rAAV1/2 EmGFP and rAAV1/2 EmGFP miRC treatment groups demonstrated greater variability in relaxin-3 mRNA levels than either saline or rAAV1/2 EmGFP miR499 treated groups.

Four treatment groups were used in behavioural and biochemical studies; saline (n = 13), rAAV1/2 EmGFP (n = 14), rAAV1/2 EmGFP miRC (n = 13) and rAAV1/2 EmGFP miR499 (n = 14).

0042300.g003 Figure 3 A and B received no infusion, n = 4. C and D are 3 weeks following bilateral infusion of rAAV1/2 EmGFP miR499, n = 4. Scale bars indicate 1.5 mm (A, C) and 150 µm (B, D).

These results indicate that miR499 induced silencing of relaxin-3, reduces relaxin-3 at both the site of synthesis and in nerve fibres and terminals near the site of relaxin-3 release.

It was initially thought that analysing data from rats based simply on their treatments may have influenced the results, as not all rats in the rAAV1/2 EmGFP miR499 group would have identical KD.

Given the role identified for the relaxin-3/RXFP3 system in the MS and the generation of hippocampal theta rhythm, it was important to assess the anxiety of rats following administration of rAAV1/2 EmGFP miR499.

Holm-Sidak post-hoc analysis revealed that rAAV1/2 EmGFP miR499 had significantly higher blood glucose levels than rAAV1/2 EmGFP treated rats (difference of means = 0.530, t = 2.980, p = 0.007).

Thus, miR499 was adopted for in vivo studies.

On the basis of these findings, rAAV1/2 EmGFP miR499 infusion and the resultant reductions in relaxin-3 were hypothesised to impair spatial learning and memory.

Saline n = 13, EmGFP n = 14, miRC n = 13, miR499 n = 14.

rAAV1/2 EmGFP miR499 reduces relaxin-3-like immunoreactivity in nucleus incertus.

The EmGFP miR499 cassette from pcDNA6.2 was cloned into the pAM plasmid, which was packaged into mosaic serotype 1/2 capsids.

Hindbrain relaxin-3 mRNA is reduced following rAAV1/2 EmGFP miR499 treatment whereas RXFP3 mRNA remains unchanged.

The same was true for both 6 and 9 weeks following rAAV1/2 EmGFP miR499 infusion (Figure 4C, D).

To test the silencing efficacy of rAAV1/2 EmGFP miR499 in vivo, male Sprague Dawley rats received bilateral infusions of rAAV1/2 EmGFP miR499 (6×10 [7] gc, n = 4) into the NI, whereas control rats received either no infusion or rAAV1/2 EmGFP miRC (2.4×10 [8] gc, n = 4).

rAAV1/2 EmGFP miR499 reduces relaxin-3-like immunoreactivity in fibres of the septum.

Bilateral infusions of 2 µl rAAV (rAAV1/2 EmGFP 1.1×10 [8] gc/µl, rAAV1/2 EmGFP miRC 4.5×10 [7] gc/µl, rAAV1/2 EmGFP miR499 5×10 [7] gc/µl) or saline were made into the NI (AP −9.5 mm, ML±0.5 mm, DV −7.6 mm from bregma according the rat stereotaxic atlas [49]).

Figure S1 Schematic representation of parent miR499 construct.

Consequently, we tested whether administration of rAAV1/2 EmGFP miR499 and relaxin-3 silencing affected RXFP3 mRNA levels in hindbrain mRNA samples from the same subset of rats used for relaxin-3 mRNA quantitation.

Figure S2 Histological assessment of neuronal health following rAAV1/2 EmGFP miR499 infusion.

rAAV1/2 EmGFP miR499 reduces relaxin-3-like immunoreactivity from one week post infusion.

6

To identify the miRNAs with regulating effect on Gadd45α from these differentially-expressed miRNAs, 20 miRNAs being predicted to regulate Gadd45α by MicroCosm Targets, Targetscan, and Pictar were presented in Table 3. Furthermore, miRNAs microarray results indicated miR-499 was the single differentially-expressed miRNA among these regulating miRNAs of Gadd45α (Fig. 5A).

Increased expression of miR-499 in diabetic cardiomyopathy (DCM) and the effect of miR-499 on the expression of Gadd45α.

Nonetheless, the differentially-expressed miR-target pair, miR-499 :: Gadd45α, was identified in DCM and DM -induced baroreflex dysfunction by the combination of bioinformatics and biological experiments.

In conclusion, increased miR-499 level accompanied with reduced Gadd45α protein expression was observed in the present study, which suggests that miR-499 :: Gadd45α might participate in the process of diabetic heart disease in STZ -induced diabetic rats.

These results implied that miR-499 might repress Gadd45α expression by inhibiting transcription.

The present study suggests that co-differentially-expressed miR-target pair, miR-499::Gadd45α, might be involved in the tissue-tissue communication between DCM and DM -induced baroreflex dysfunction by an innovative incorporation of bioinformatics, miRNAs microarray analysis and biological experiments, and therefore provides a potential preventive strategy for SCD in DM.

However, miR-499 significantly suppressed the protein expression of Gadd45α by 56% (P<0.05, vs NC), which could be partially reversed by co-transfection of AMO-499 (P<0.05, vs miR-499) (Fig. 5F).

MiR-499 and Gadd45α, a co-differentially-expressed miR-target pair in heart and NA.

In addition, Gadd45α and miR-499 were co-differentially expressed in diabetic heart and NA, and Gadd45α is negatively regulated by miR-499.

Among these micoRNAs only miR-499 is computationally predicted to target Gadd45α.

These findings suggest that the decreased Gadd45α protein level result from elevated miR-499 expression might potentially contribute to SCD in DM by their congenerous effects on diabetic heart and baroreceptor reflex.

In the present study, increased miR-499 expression was verified by both miRNAs microarray analysis and qRT-PCR in diabetic samples.

As miR-499 and Gadd45α displayed complementarity (Fig. 5C), luciferase analysis was performed to directly verify the regulating effect of miR-499 on Gadd45α.

The 3′UTR of Gadd45α holding miR-499 binding sites were cloned downstream of the luciferase reporter in pMIR-REPORT™ luciferase miRNA expression reporter vector (Ambion, Inc.

Consistent with miRNAs microarray results, the subsequent qRT-PCR detection showed that DM led to miR-499 expression increased by 1.61±0.12 folds (P<0.05) and 1.83±0.18 folds (P<0.05) in diabetic heart and NA, respectively (Fig. 5B).

Interestingly, inconsistent with our observation of increased miR-499 in left ventricle and NA from 4-week STZ -induced diabetic rats, it is reported miR-499 expression was repressed in the retinas of 3-month STZ -induced diabetic rats [43].

The mRNA (E) and protein (F) expression of Gadd45α in miR-499 treated neonatal cardiac myocytes.

In addition, the expression of miR-499 was increased at circulating level after acute myocardial infarction [41], [42].

As demonstrated in Fig. 5E, transfection of miR-499 or AMO-499 showed no significant effect on the Gadd45α expression at mRNA level (P>0.05 vs NC).

The reversed alternations in miR-499 expression might be largely attributing to the different time courses (4 weeks vs 3 months) of DM.

NR_032141) mimics (sense: 5′-UUAAGACUUGCAGUGAUGUUUGU-3′, antisense: 5′-AAACAUCACUGCAAGUCUUAAAU-3′), and rat miR-499 inhibitors (antisense oligonucleotides of mature miR-499, AMO-499: 5′-+A+C+A+A+ACATCACTGCAAGT+C+T+T+A+A-3′) were synthesized by Integrated DNA Technologies, Inc.

For luciferase assay, HEK293 cells were first starved in serum-free medium for 12 h, then transfected with 100 ng the chimeric plasmid (firefly luciferase vector), 20 ng PRL-TK (TK -driven Renilla luciferase expression vector) and 50 nM miR-499, AMO-499 or NC using X-treme GENE siRNA transfection reagent.

The expression levels were compared with the value of Gadd45α and miR-499 normalized to the amounts of respective endogeneous controls (β-actin and U6).

Rat miR-499 (GenBank acc.

MiR-499 negatively regulating Gadd45α.

And then, cells (2×10 [5]/well) were transfected with 50 nM miR-499, AMO-499 or negative control (NC) with X-treme GENE siRNA transfection reagent (Roche, Cat.

To further investigate the biological effect of miR-499 on the Gadd45α expression, neonatal rat cardiac myocytes were used and transfected with miR-499, AMO-499 or NC.

As shown in Fig. 5D, miR-499 transfection resulted in a notable decrease in luciferase activity of the chimeric luciferase vectors of Gadd45α (P<0.05, vs NC), which was significantly alleviated by co -transfected with AMO-499 (P<0.05, vs miR-499).

MiR-499 has been established to reflect myocardial damage [35], [36], blunt the cardiac stress response [37], facilitate ventricular specification of human embryonic stem cells (hESCs) [38], be associated with cardiac differentiation [39], and regulate differentiation and proliferation in human-derived cardiomyocyte progenitor cells [40].

7

[51] Brain-expressed target genes of miR-499-5p exhibited an enrichment in biological processes related to cerebral development, which might however, at least partly, reflect the fact that our pathway analysis was restricted to brain-expressed genes.

The results of the present miRNA and target gene analyses suggest that the brain-expressed miRNAs miR-499, miR-708 and miR-1908 may contribute to the development of BD.

The target gene enrichment analysis showed no significant enrichment of BD -associated genes within the targets of miR-499, miR-708 or miR-1908 (Table 2).

After Bonferroni correction, miR-1908 had one (KLC2) and miR-708 had two significant target genes (NRAS and CREB1), whereas miR-499 had four significant target genes (GPC6, C16orf72, WDR82 and CACNB2).

[35] The regional association plots and the miRNA expression data in human brain tissue suggest that the three brain-expressed miRNAs, that is, miR-499, miR-708 and miR-1908, are the most promising candidates for further analyses.

The subsequent analyses were restricted to brain-expressed target genes of miR-499, miR-708 and miR-1908, with a gene -based association P-value of <0.05.

Our target gene analysis revealed that miR-499 had four significant target genes, including the previously reported genome-wide significant risk gene for psychiatric disorders CACNB2.

[46] A recent study demonstrated an upregulation of miR-499 in the prefrontal cortex of patients with depression.

Regional association plots and expression data suggest that the miRNAs miR-499, miR-708 and miR-1908 are the most promising candidates in terms of the development of BD.

[47] In a study of exosomal miRNA expression, miR-499 showed differential expression in the post-mortem brains of BD patients compared with controls.

Target gene and pathway analysis for miR-499, miR-708 and miR-1908.

Alternative strategies for miR-708 expression, together with miR-499/708 loss-of-function approaches, must be tested before definite conclusions regarding the role of these miRNAs in dendritic spine morphogenesis can be drawn.

Three of these (miR-499, miR-708 and miR-135a-1) were also found to be expressed in the rat forebrain.

Overexpression of miR-499 led to a small and statistically nonsignificant increase in spine volume (Figure 3), but no effect on spine density was observed.

Eight of the nine associated miRNAs were located in a host gene, including the three brain-expressed miRNAs miR-499, miR-708 and miR-1908.

To test the possible involvement of miR-499 or miR-708 in the regulation of synaptic function, experiments were performed to investigate the effect of miR-499 and miR-708 overexpression on dendritic spine morphogenesis in primary rat hippocampal neurons.

However, only the results for miR-499 can be considered robust, as the miR-708 expression construct did not increase miR-708 in primary neurons effectively.

In addition, our pathway analysis indicates a potential role of miR-499 in the regulation of the actin cytoskeleton.

The target genes that drive a particular pathway are listed in Supplementary Table 3. Luciferase assays revealed efficient processing of pri-miR-499, but not pri-miR-708, upon transfection of the respective constructs in neurons (Supplementary Figure 6).

[45] However, miR-499 represents a very promising candidate in this region.

[45] As miR-499 is located in a region of high LD, which includes the genes GSS, MYH7B and TRPC4AP (Figure 2), further analyses of this chromosomal region are required to refine the association signal.

Functional analyses of miR-499 and miR-708 in rat hippocampal neurons.

53, 54, 55, 56 These combined data suggest that miR-499 is an interesting candidate for BD pathogenesis.

The results of the functional analyses of miR-499 and miR-708 in rat hippocampal neurons revealed no major contribution of these miRNAs to the morphogenesis of dendritic spines, which represent the major sites of synaptic contact.

[48] When considering a possible pathomechanism, it is important to note that a common SNP (rs3746444) is located in the seed region of the mature miR-499-3p.

The miRNA miR-499 is located in a region on chromosome 20q11 that showed genome-wide significant association in a previous GWAS of BD.

To investigate the potential involvement of miR-499-5p and miR-708-5p in dendritic spine morphogenesis, hippocampal neurons of embryonic day-18 Sprague–Dawley rats (Charles River Laboratories, Sulzfeld, Germany) were transfected with miRNA -overexpressing constructs for 6 days before fixation.

Taken together, these results suggest that increasing levels of the BD -associated miR-499 have no—or only minimal—modulatory function during dendritic spine morphogenesis.

MiR-499 regulates apoptotic pathways involving the calcium -dependent protein phosphatase calcineurin.

8

Among those seventeen deregulated miRNAs miR-31 was up-regulated on day 2, day 7 and day 14. miR-199a was up-regulated on day 7 and day 14. miR-214 was up-regulated on day 7 and day 14. miR-499 was down-regulated on day 2 and day 7. Table 1 miRNAs differentially expressed in the myocardial tissues of rats with acute myocardial infarction.

Among those seventeen deregulated miRNAs miR-31 was up-regulated on day 2, day 7 and day 14. miR-199a was up-regulated on day 7 and day 14. miR-214 was up-regulated on day 7 and day 14. miR-499 was down-regulated on day 2 and day 7. Table 1 miRNAs differentially expressed in the myocardial tissues of rats with acute myocardial infarction.

miRNA Host gene Function of host gene miR-923 UNC45B UNC45B plays a role in myoblast fusion and sarcomere organization miR-126 EGFL7 blood vessel development; angiogenesis; and vasculogenesis miR-26b CTDSP1 n/a miR-199a DNM2/DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-214 DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-499 MYH7B cardiac muscle, striated muscle contraction, striated muscle thick filament miRNA regulates gene expression by binding and modulating the translation of specific miRNAs.

Expression levels of miR-126 and miR-499 were greatly down-regulated after AMI, whereas expression levels of miR-31 and miR-214 increased after AMI (Figure 3 and Additional File 4).

On day 2, miR-31, miR-223, miR-18a, and miR-18b were up-regulated, whereas miR-451 and miR-499-5p were down-regulated.

On day 7, miR-31, miR-214, miR-199a-5p, and miR-199a-3p were up-regulated, whereas miR-181c, miR-29b, miR-26b, miR-181d, mir-126, mir-499-5p, and miR-1 were down-regulated.

miRNA Host gene Function of host gene miR-923 UNC45B UNC45B plays a role in myoblast fusion and sarcomere organization miR-126 EGFL7 blood vessel development; angiogenesis; and vasculogenesis miR-26b CTDSP1 n/a miR-199a DNM2/DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-214 DNM3 filopodium formation; centronuclear myopathy; growth and development of megakaryocytes miR-499 MYH7B cardiac muscle, striated muscle contraction, striated muscle thick filament Microarray data mining and differential analyses resulted in 17 significantly deregulated miRNAs associated with AMI (Table 1, Figure 1).

Two of these aberrantly expressed miRNAs (miR-223, mir-499) have been reported to be associated with inflammation [23- 25].

Some of the deregulated miRNAs (miR-181, miR-26, miR-1, mir-29, miR-214, miR-126, and miR-499) are reported to be related to hypoxia, cell development, and cell growth [1, 5, 7, 25].

9

Expression analysis of conserved miRNAs in 14 different tissue types revealed heart-specific expression of miR-499 and miR-208 and liver-specific expression of miR-122.

A few notable exceptions are miR-499, an miRNA abundantly expressed in the heart (Figure 2A), which is represented by only one read (Table 2), and the miR-133 family, which is preferentially and abundantly expressed in the heart (Figure 2), and represented by only 7 reads (Table 1).

Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns.

miR-499 is abundantly and specifically expressed only in the heart and could not be detected in other tissues (Figure 2A).

Because of their location within the introns of myosin genes and their specific expression in myogenic cells, miR-208 and miR-499 were referred to as MyomiRs [47].

Similar observations have been reported for miR-499 in zebra fish [50].

Similarly, miR-499 is another intronic-derived miRNA located in the Myh7b gene (MHC 7b).

10

It is noteworthy that miR-1, miR-133, miR-30, miR-208a, miR-208b, mir-499, miR-23a, miR-9 and miR-199a have previously been shown to be functionally involved in cardiovascular diseases such as heart failure and hypertrophy [40], [41], [42], [43], [44], and have been proposed as therapeutic- or disease-related drug targets [45], [46].

Although the 3 myomiRs miR-208a/miR-208b/miR-499 contain almost identical seed sequences, miR-499 was considerably less potent at inhibiting luc-Csnk2a2 expression than miR-208a/miR-208b, suggesting a functional role for 3′ compensatory interactions between the myomiRs and Csnk2a2 (Figure 7D and H).

In particular, several microRNAs that are preferentially expressed in different types of muscles (e. g. miR-1, miR-133, and the myomiRs miR-208, miR-208b and miR-499) play a pivotal role in maintenance of cardiac function [17], [18], and the ablation of microRNAs-RISC machinery can have dramatic effects on cardiac development [19], [20], [21].

0052442.g007 Figure 7 (A–D) Real-Time RT-PCR of Timp3, Rbm24, Tgfbr2 and Csnk2a2 in HPASM cells transfected with mimics for miR-1, miR-125b-5p, miR-204, miR-499 and miR-208b or with a mimic microRNA negative control.

Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey.

Furthermore, ventricular microRNAs (miR-1, miR-133, miR-208b and miR-499) have been found to be increased in the plasma of patients with myocardial infarction, and might represent a useful alternative to the classical cardiac troponin (cTnI) biomarker [57], [58], [59], [60], [61].

An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A).

11

Examples of the expression profiles of miRNAs that change with age and/or sex are shown in Figures  5 and 6. Female-biased miRNA expression is illustrated by miR-421*, miR-499, and miR-208* (Figure  5A-C), all of which showed female-biased expression at 15 and 21 weeks.

For example, both miR-499 and miR-421*, which showed the most female-biased expression at 15, 21, and 78 weeks of age (Figure  5), have been shown to regulate proliferation and apoptosis via different cellular pathways [48, 49].

The miRNAs showing the most consistent sex difference in expression (sex differences in at least three contiguous age groups) were miR-421* and miR-499.

Female-biased miRNAs feature some of the most promising candidates (miR-421*, miR-499, miR-208*) to further investigate the potential impact of sex-biased expression of miRNAs in the kidney.

MiR-499 also exhibited female bias at 78 weeks of age and miR-421* at 78 and 104 weeks of age.

12

Cheng et al. [2] reported that miR-21 inhibits cell death under H/R conditions by regulating expression of the programmed cell death 4 (PDCD4) gene, which is also targeted by miR-499 [2].

Additionally, they found that miR-499 mitigates lipopolysaccharide -induced cardiac cell death by inhibiting the translation of PDCD4 and sex-determining region Y- (SRY-) box 6 mRNA [15].

13

In agreement, we showed that the expression of rno-miR-192, rno-miR-194, and rno-miR-499 was higher in the stone-forming group while their potential target gene chemokine receptor 2 (CCR2) was lower.

Therefore, we proposed that, in the process of kidney stone formation, the overexpression of CCR2 mediated by relevant miRNAs, such as rno-miR-192, rno-miR-194, and rno-miR-499, would induce the inflammation and damage to the renal tubular epithelial cells and promote nephrolithiasis.

Among these differentially expressed miRNAs, rno-miR-130b-3p, rno-miR-132-3p, rno-miR-181a-1-3p, rno-miR-222-3p, rno-miR-351-5p, and rno-miR-21-3p had the largest positive fold changes, while rno-miR-335, rno-miR-192-3p, rno-miR-194-5p, rno-miR-192-5p, rno-miR-499-5p, and rno-miR-210-3p had the largest negative fold changes (Table 1).

14

For the first time we report that not only are the four cardiac-enriched miR-1, miR-133, miR-499 and miR-208 highly expressed in sheep LV, but also provide information on their isomiRs.

Hsa-/mmu-/rno-miR-499a-5p and hsa-499b-3p were plentiful in sheep heart whereas the expression of other forms of miR-499 were low.

Four myocardial-enriched miRNAs, miR-1, miR-133, miR-499 and miR-208, were confirmed to be highly expressed in ovine heart tissue.

Cardiac-enriched miR-1-3p, miR-133a-3p, miR-133b-3p, miR-208b-3p and miR-499-3p were screened.

MiR-1, miR-133, miR-499 and miR-208 are highly enriched myocardial miRNAs 27, 28 and are highly conserved across multiple species including human [29], mouse [30] rat [31] and porcine [32].

15

In the mo del group, 17 miRNAs were downregulated, including miR-1, miR-133, miR-29, miR-126, miR-212, miR-499, miR-322, miR-378, and miR-30 family members, whereas the other 18 miRNAs were upregulated, including miR-21, miR-195, miR-155, miR-320, miR-125, miR-199, miR-214, miR-324, and miR-140 family members.

Among these differentially expressed miRNAs, miR-1, miR-133, miR-29, miR-126, miR-499, miR-30, miR-21, miR-195, miR-155, miR-199, miR-214, and miR-140 have been reported to be related to MI [25– 36], while the other miRNAs have not been reported directly in MI.

16

For example, rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p are most highly expressed in both HF and control group in our study, which was consistent with the previous studies that rno-miR-133, rno-miR-1 and rno-miR-499 are highly expressed in the heart[26], and miR-1, let-7 and miR-133 are highly expressed in the murine heart[27].

The most highly expressed miRNAs were rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p in both HF and control group.

17

miR-499 inhibited cardiomyocyte apoptosis in I/R; the putative targets of miR-499 are α and β isoforms of the calcineurin catalytic subunit, and miR-499 protected cardiomyocyte by suppressing calcineurin -mediated dephosphorylation of dynamin-related protein 1 [36].

18

In line with these results, we found that miR-208a-3p and miR-499-5p -both cardiac specific and highly abundant in the heart [23]- were either undetectable or very lowly expressed in the circulation of mice.

Of the cardiac specific miRNAs, miR-208a-3p was not detectable in the plasma of ischemic heart failure mice and miR-499-5p showed the lowest miRNA expression levels in plasma compared to the other miRNAs (Fig 3 and S4 Table).

In addition to the cardiac specific miR-208a-3p and miR-499-5p, we found that the expression of let-7i-5p, miR-16-5p, miR-27a-3p, miR-199a-3p and miR-223-3p was significantly higher in the heart compared to the kidney, independent of the presence of ischemic heart failure (S4 Fig and S5 Table).

19

After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127.

20

Over -expression of miR-499 inhibits cardiac apoptosis by suppressing the mitochondrial fission process [22].

21

Three miRNAs profiles were found with (A) rno-miR-133b-3p, rno-miR-378a-3p, and rno-miR-434-3p equally expressed in both muscle types, (B) rno-miR-1-3p and rno-miR-133a-3p with higher expression in EDL and (C) rno-miR-206-3p, mmu-miR-208b-3p, and rno-miR-499-5p with higher expression in SOL.

22

And 17 miRNAs are downregulated as shown in the lower part of this figure, let-7d, miR-665, miR-125b*, let-7b*, miR-124*, miR-770, miR-383, miR-29b-2*, miR-760-3p, miR-324-3p, miR-135b, miR-21, miR-409-5p, let-7f-1*, miR-28, miR-499*,let-7i* (Table 2).

Compared to the other 2 groups, 21 miRNAs are upregulated in 6-hour group as shown in the upper portion of Fig. 2, miR-9, miR-204, miR-335, miR-23a, miR-708, miR-146a, miR-325-5p, miR-106b, miR-143, miR-140, miR-376b-3p, miR-7a, miR-541, miR-185, miR-499, miR-127*, miR-320, miR-140*, miR-145*, miR-423*, miR-378.

23

In contrast, 3 miRNAs (miR-499, miR-1, miR-133a, and miR-466b) were upregulated in the denervated muscle and 3 miRNAs (miR-329, miR-204, and miR-139-3p) were downregulated after 6 months.

24

Notably, cardiac-specific miR-1, miR-133, miR-208 and miR-499 were all suppressed by two or more orders of magnitude [34], [35], as were the stemness and cell cycle repressors miR-141 and miR-137 [36]; in contrast, the proliferative miRNAs, miR-222 [37], increased dramatically in MDCs, and miR-221 was undetectable in myocytes but highly expressed in MDCs (Figure 5D).

25

The expression level of miR-499 is similar to that of U6-snRNA.

pri-mir499 forward: 5'-gcatgtgaacatcacagcaag-3', pri-mir499 reverse: 5'-ccaaacaccacctaagtcttc-3'.

26

miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1. Nat.

27

Among these miRNAs, miR-499 enhances the expression of the β-myosin heavy chain, which promotes muscle development 39.

28

In comparison, the elevated expression of miR-210 and miR-499 are more in favor with cell survival.

MiR-210 induces angiogenesis and miR-499 stimulates cardiac stem cells to commit into mature working cardiomyocytes, [49– 51] albeit cardiomyocytes are terminally differentiated in mature adult hearts and there are minimal cardiac stem cells to be stimulated.

29

In the chronic liver injury mo dels including the HFD, MCDD, and CCl [4] groups, we found that 3 miRNAs (miR-10b*, miR-410, miR-499) were commonly down-regulated, but were not affected in the acute liver injury mo dels (Fig. 4), suggesting that these miRNAs might serve as biomarkers of steatosis.

30

In addition, miR-125b protected heart from I/R injury by the prevention of apoptotic signaling [14], meanwhile miR-499 mediates cardiac protection against I/R injury by targeting the called programmed cell death 4 (PDCD4) during ischemia postconditioning [15].

31

Similarly, miR-133b, miR-137, miR-155, and miR499 were exclusively expressed in the caudal region of the mouse epididymis but were wi dely distributed throughout the rat and/or human epididymis (S4 Table).

32

A total of 22 miRNAs (Additional file 6: Figure S5) were selected for qPCR validation including the following 14 biomarker candidates of organ toxicity: liver (cfa-miR-122 and -885), pancreas (cfa-miR-216a/b); heart (cfa-miR-499); muscle (cfa-miR-206); heart/muscle (cfa-miR-1, -133a/b, and -208); testis (cfa-miR-34b/c); and brain and sciatic nervous tissues (cfa-miR-212, -432, and -885), and 5 miRNAs reported in the literature (cfa-miR-21, -192, -193a/b, and -200).

Enrichment of miR-499 in the heart has been demonstrated in rat, monkey, and human [36, 37].

A single HTE miRNA was identified in the dog heart (cfa-miR-499) and in skeletal muscle (cfa-miR-206), and both tissues had the same 5 TE miRNAs (cfa-miR-1, -133a-5p, -133a-3p, -133b, and -208) (Fig.   3).

33

MicroRNAs have been proved to be potential biomarkers for ischemic heart disease, such as mir-1, mir-133, mir-208, and mir-499 [4– 6].

34

Name Primers U6F: 5′-GCTTCGGCAGCACATATACTAAAAT-3′ R: 5′-CGCTTCACGAATTTGCGTGTCAT-3′ rno-miR-500-3pGSP: 5′-GGAAGGCACCTGGGCAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-499-3pGSP: 5′-GGGGAACATCACAGCAAGTC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-214-3pGSP: 5′-GGGGACAGCAGGCACAGAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-20b-5pGSP: 5′-GGGGCAAAGTGCTCATAGTG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-877GSP: 5′-GGGGAAGTAGAGGAGATGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-451-5pGSP: 5′-GGGGGAAACCGTTACCATTAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-3577GSP: 5′-GGGTTCTGTCCCTCTTGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-370-3pGSP: 5′-AGCCTGCTGGGGTGGAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-181d-5pGSP: 5′-GGGGCATTCATTGTTGTCG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-23b-3pGSP: 5′-GGGATCACATTGCCAGGG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-191a-5pGSP: 5′-GGCAACGGAATCCCAAAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-200c-3pGSP: 5′-GGGGTAATACTGCCGGGTAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-328a-3pGSP: 5′-AACTCGCCCTCTCTGCCC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ nutrients-07-01333-t002_Table 2 Table 2 Primers of mRNA targets.

Name Primers U6F: 5′-GCTTCGGCAGCACATATACTAAAAT-3′ R: 5′-CGCTTCACGAATTTGCGTGTCAT-3′ rno-miR-500-3pGSP: 5′-GGAAGGCACCTGGGCAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-499-3pGSP: 5′-GGGGAACATCACAGCAAGTC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-214-3pGSP: 5′-GGGGACAGCAGGCACAGAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-20b-5pGSP: 5′-GGGGCAAAGTGCTCATAGTG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-877GSP: 5′-GGGGAAGTAGAGGAGATGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-451-5pGSP: 5′-GGGGGAAACCGTTACCATTAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-3577GSP: 5′-GGGTTCTGTCCCTCTTGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-370-3pGSP: 5′-AGCCTGCTGGGGTGGAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-181d-5pGSP: 5′-GGGGCATTCATTGTTGTCG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-23b-3pGSP: 5′-GGGATCACATTGCCAGGG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-191a-5pGSP: 5′-GGCAACGGAATCCCAAAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-200c-3pGSP: 5′-GGGGTAATACTGCCGGGTAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-328a-3pGSP: 5′-AACTCGCCCTCTCTGCCC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ nutrients-07-01333-t002_Table 2 Table 2 Primers of mRNA targets.

35

The identity, fold-change variation, direction of alteration, and biological function of these miRNAs are reported in Table 2. In mice bearing adenomas, 5 miRNAs (miR-34b, miR-106a, miR-499, miR-466, and miR-493) were altered in the blood serum but not in lung.

36

Several miRNAs, including miR-21 [11], miR-1, miR-206 [12], miR-31, and miR-499-5p [13] are reported to be dysregulated in myocardial infarction, suggesting a fundamental role in AMI.

37

MiRNAs such as hsa-let-7f, hsa-miR-499, hsa-miR-373, hsa-miR-372, hsa-miR-371, hsa-miR-369-5p, hsa-miR-34c, hsa-miR-34b, hsa-miR-34a, hsa-miR-29c, hsa-miR-217, and hsa-miR-20a might influence senescence or aging [42].

38

A few miRNAs are found to be enriched in the heart including miR-1, miR-133, miR-208a, miR-208b, and miR-499.

39

MicroRNA-208b, encoded from the intron 28 of rat Myh7, is associated to maintenance of myocardial performance together with 2 other myomirs, i. e. miR-208a/miR-499, which play a pivotal role in the myosin balance [40].

40

Other important myomiRs, namely miR-208b, miR-486 and miR-499, have been identified [17].

41

It has also been reported that plasma levels of some miRNAs (mir-1, mir-208, mir-133a, mir-423-5p, mir-499) can be used as biomarkers for myocardial injury [90– 92].

42

Likewise, a combination of miR-1, miR-133, miR-208 and miR-499 is capable of reprogramming fibroblasts into cardiomyocytes [21].

43

Cycling acute or chronic exercise did not change the serum levels of muscle-enriched miRNAs (miR-1, miR-133a, miR-133b, miR-206, miR-208b, miR-486, and miR-499) with an exception for miR-486, which showed a significant negative correlation with VO [2max] (Pedersen et al., 2007).

44

Furthermore, several miRNAs, such as miR-199a and miR-214 [14], miR-494 [15], miR-499 [16], and miR-24 [17] are known to protect cells from hypoxia- or ischemia -induced damage.