sort by

29 publications mentioning hsa-mir-654

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-654. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 98
Importantly, restoration of miR-654-3p upregulated the expression of the metastasis-suppressor genes BRMS1, MTSS1, KISS1 and NME1, and downregulated the expression of several genes related to tumor progression and metastasis, including MTA1, MTA2, SERPINE1, SSTR2 and CD44. [score:13]
Known tumor suppressor genes were upregulated after transfection of mimetic miR-654-3p, including CASP8, PTEN, DAPK1, RB1 and the cell cycle regulator CDKN2A. [score:7]
Importantly, the miRNAs miR-495-3p, miR-654-3p, miR-376a-3p and miR-487b-3p exhibited marked downregulation after 5 weeks in contrast to a slight reduction of expression observed for most miRNA genes from this region. [score:6]
miR-654-3p, which has been described as a tumor suppressor miRNA in prostate cancer cell lines [28], is downregulated during PTC progression in the Tg-Braf mo del and in human PTC samples. [score:6]
miR-654-3p is downregulated during tumor progression of PTC in vivo and regulates cell proliferation and migration of PTC in vitro. [score:5]
Figure 4 miR-654-3p is downregulated during tumor progression of PTC in vivo and regulates cell proliferation and migration of PTC in vitro a. Thyroid tissue extracted from 5-,12- and 30-weeks old animals (Tg-Braf and WT) was homogenized and total RNA extracted was used for cDNA synthesis. [score:5]
Among the differentially expressed miRNAs from the 14q32 region, we observed that miR-654-3p levels decrease with long-term PTC progression in Tg-Braf mice and inversely correlate with the expression of the EMT markers Zeb1, Zeb2, Snai1 and Snai2 (Figure 4a). [score:5]
Although no morphological changes were observed, transfection of miR-654-3p increased the expression of CDH1 and CTNNA1, and decreased the expression of SNAI2, which is consistent with an “epithelial” genetic program. [score:5]
Our functional analysis indicates that miR-654-3p markedly decreases cell proliferation and increases apoptosis, possibly by restoring the expression of key tumor suppressor genes. [score:5]
Moreover, key genes involved in cell adhesion, migration and ECM remo deling were downregulated after transfection of mimetic miR-654-3p, such as LAMB1 and MMP9. [score:4]
The analysis of randomly-chosen miRNAs from clusters 1 and 2 (miR-654-3p, mir-369-3p, miR-495, miR-370-5p, miR-127-5p and miR-376c-3p) in tumor cell lines confirmed their downregulation (Figure 1d). [score:4]
Furthermore, we show tumor suppressor properties for miR-654-3p in vitro, which could open perspectives for new therapeutic strategies for PTC. [score:3]
The restoration of miR-654-3p expression using commercial mimetic miRNA markedly decreased cell proliferation and migration, and increased apoptosis in normal and tumor thyroid cell lines (Figure 4b and 4c). [score:3]
The miR-654-3p -transfected cells showed increased expression levels of the epithelial cell markers CDH1 and CTNNA1 and decreased levels of SNAI2, with no significant changes in ZEB1, ZEB2, SNAI1 and VIM levels (Figure 4d). [score:3]
To evaluate the participation of miR-654-3p in PTC progression, we analyzed the impact of ectopic expression of miR-654-3p on the expression of several genes involved in tumor establishment and progression using a Taqman® Human Tumor Metastasis qPCR Array. [score:3]
Values in Y axis reflect the log [2] fold change expression levels between BCPAP cells transfected miR-654-3p mimetic with those not transfected. [score:3]
Finally, in vitro functional analyses highlight tumor suppressor properties for miR-654-3p in PTC. [score:3]
Tumor suppressor properties of miR-654-3p in thyroid cell lines. [score:3]
Importantly, the levels of key modulators of tumor progression, such as ECM and ECM-remo deling genes, as well as metastasis-suppressing and -promoting genes, were restored after transfection of a miR-654-3p mimetic. [score:3]
No morphological changes were observed through light microscopy after transfection of miR-654-3p (data not shown). [score:1]
b. N-Thy-ORI and TPC-1 cells were transfected or not with miR-654-3p mimetic and after 24, 48, and 72 h, cells were trypsinized and counted. [score:1]
c. TPC-1, BCPAP and KTC-2 cells transfected or not with miR-654-3p mimetic were seeded into the upper compartment of modified Boyden chambers with 8 μm pore inserts as described in Methods section. [score:1]
Altogether, these data suggest that restoration of miR-654-3p could contribute to a more differentiated, less aggressive phenotype in PTC. [score:1]
Normal and tumor thyroid cells were transfected with miR-654-3p miRVana mimic (Life Technologies) at concentration of 10-30nM. [score:1]
Also, decreased levels of HRAS, FGF2, FGFR4 and IL1B, as well as increased NF1, components of MAPK signal transduction, were observed after transfection of miR-654-3p. [score:1]
snRNA U6 and RPL19 were used for normalization of miR-654-3p and Zeb1 Zeb2, Snai1 and Snai2 respectively. [score:1]
d. BCPAP cells were transfected with 30nM miR-654-3p mimetic. [score:1]
Transient transfection of miR-654-3p mimetic. [score:1]
[1 to 20 of 28 sentences]
2
[+] score: 51
Based on the criteria mentioned in material and methods part we found ITGA3 (as target of miR-654-5p), SOCS4 & MAP3K1 (as target of miR-640), BRMS1L & ZNFX1 (as target of miR-526b*) and CD44 & VEGFA (as target of miR-373). [score:9]
Expression patterns of miR-654-5p and miR-640 (up-regulated in exosomal fraction follicular fluid derived from follicles containing BCB- oocytes) and miR-526b* and miR-373 (up-regulated in exosomal fraction of follicular fluid from BCB+ groups) were investigated in surrounding follicular cells namely: cumulus oocyte complex (COCs), granulosa cells (GC), and theca cells (TC) from the same category of follicle which were used for miRNA PCR array analysis. [score:7]
0078505.g004 Figure 4Expression patterns of miR-654-5p and miR-640 (up-regulated in exosomal fraction follicular fluid derived from follicles containing BCB- oocytes) and miR-526b* and miR-373 (up-regulated in exosomal fraction of follicular fluid from BCB+ groups) were investigated in surrounding follicular cells namely: cumulus oocyte complex (COCs), granulosa cells (GC), and theca cells (TC) from the same category of follicle which were used for miRNA PCR array analysis. [score:7]
Among the up-regulated miRNAs, miR-654-5p & miR-640, and down-regulated miRNAs, miR-373 & miR-526b*, displayed the greatest fold change difference in the exosomal fraction of follicular fluid. [score:7]
We choose miR-654-5p, miR-640, miR-526b* and miR-373 because these miRNAs were differentially expressed in exosomal fraction of follicular fluid and they were also substantially expressed in exosomes. [score:5]
0078505.g003 Figure 3 The amplification plot and melting curve was generated during analysis og the expression of miR-654-5p and the two endogenous controls (miR-103 and U6) in granulosa cells co-cultured with exosomes derived from follicular fluid containing growing (BCB-) oocytes. [score:3]
However, no significant difference was observed in the expression level of miR-654-5p across different cell types (upper panel of Figure 4 ). [score:3]
However, no significant differences were observed across different cell types in the expression of miR-654-5p and miR-29c. [score:3]
The amplification plot and melting curve was generated during analysis og the expression of miR-654-5p and the two endogenous controls (miR-103 and U6) in granulosa cells co-cultured with exosomes derived from follicular fluid containing growing (BCB-) oocytes. [score:3]
Then the expression level miR-654-5p and miR-640 (enriched in exosomes derived from BCB- follicular fluid) and miR-526b* and miR-373 (enriched in follicular fluid derived from follicles with BCB+ oocyte) were investigated by real time PCR. [score:1]
Importantly, we found that miR-654-5p, miR-640 and miR-526b*, and miR-373 were more abundant in exosomes from follicular fluid of follicles containing BCB- and BCB+ oocytes, respectively (Figure 7 ). [score:1]
Representative amplification plot (A) and melting curve (B) of miR-654-5p, miR-103 and U6. [score:1]
The PCR array results revealed that, in follicular fluid from follicles containing growing oocytes (BCB-), miR-654-5p and miR-640 (in exosomal) and miR-19b-1* and miR-29c (in non exosomal) were highly abundant (Table 2 ). [score:1]
[1 to 20 of 13 sentences]
3
[+] score: 34
The upregulated miR-654 was associated with 99 of its target genes that were downregulated in activated HMCs (Supplementary Table  2). [score:9]
The KEGG analysis pathway of miR-654 putative target genes that were downregulated in HMCs showed no significant relevant pathway (Fig.   4A and B). [score:6]
The qPCR results confirmed that miR-10a/b, miR-30a and let-7a were significantly downregulated, while miR-654 was significantly upregulated in HMCs upon anti-dsDNA IgG antibody stimulation compared to IgG control. [score:6]
We performed integrative analysis between mRNA profile with putative target genes of miR-10a, miR-10b (noted that they have similar seed region and target genes), let-7a, miR-30a and miR-654. [score:5]
However, when we analysed putative target genes of miR-654 that were down regulated in HMCs treated with anti-dsDNA IgG antibodies, there was no significant pathways that was related to SLE pathogenesis. [score:4]
The miR-654 was the only miRNA that was significantly upregulated by qPCR in this study. [score:4]
[1 to 20 of 6 sentences]
4
[+] score: 13
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
In the Hh signalling pathway, we detected mir-495 and mir-383 for Gas1 and mir-654-5P for Gli3. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 11
Expressions of 12 of 13 members of a miRNA cluster located at human chromosome 14q32.31 were down-regulated in infertile men, with only miR-654-5p up-regulated (See additional file 3: Table S3 for Several differentially expressed miRNA clusters in NOA patients. [score:11]
[1 to 20 of 1 sentences]
6
[+] score: 9
To confirm the miRNA array data in PC3 cells, qRT-PCR (Taqman technique) was used to confirm the differential expression of three miRNAs (miR-555, miR-654 and miR-182) identified as up-regulated by ATO and three miRNAs (miR-494, miR-1255a and miR-550a) that were down-regulated by ATO. [score:9]
[1 to 20 of 1 sentences]
7
[+] score: 8
Several cellular miRNAs, such as miR-323, miR-491, miR-654, and Let-7c have recently been reported to inhibit H1N1 influenza A virus replication by downregulating the viral gene expression in infected MDCK or A549 cells [19, 20]. [score:8]
[1 to 20 of 1 sentences]
8
[+] score: 6
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
According to another study, miR-31, miR-148a, and miR-27b were among the downregulated, and miR-617, miR-370, and miR-654 were among the upregulated miRNAs in 23 MCL cases as compared to 11 reactive lymphoid tissues [57]. [score:6]
[1 to 20 of 1 sentences]
9
[+] score: 6
For example, a few miRNAs, such as let-7c, miR-2911, miR-323, miR-491, and miR-654 had been found to inhibit IAV replication by directly targeting viral genes (Song et al., 2010; Ma et al., 2012; Zhou et al., 2015). [score:6]
[1 to 20 of 1 sentences]
10
[+] score: 6
o.   fold changep-valuehsa-miR-654-5p3.880.00014hsa-miR-493*3.100.00016hsa-miR-4102.930.00029hsa-miR-376a*2.660.00072hsa-miR-7582.870.00073hsa-miR-3812.390.00094hsa-miR-5432.070.00119hsa-miR-5393.060.00124hsa-miR-487b2.020.00186hsa-miR-337-5p2.540.00195hsa-miR-136*2.790.00246hsa-miR-154*2.270.00337hsa-miR-330-3p2.440.00759 hsa-miR-421 2.45 0.01282We also identified miRNAs with expression levels that varied according to gender and age. [score:3]
In regards to age, we discovered that the expression levels of 14 miRNAs (miR-654-5p, miR-493*, miR-410, miR-376a*, miR-758, miR-381, miR-543, miR-539, miR-487b, miR-337-5p, miR-136*, miR-154*, miR-330-3p, and miR-421) were significantly higher in HCC up to 66 years old than in HCC over 67 years old. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 6
Expression of the most upregulated miRNA, miR-654, changed ∼30-fold during differentiation. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 5
For the efficient target FBXO5, miR-654-3p repressed it only in CIN I stage, and it had contribution to the ‘microtubule polymerization’ process only in CIN III stage. [score:3]
Our finding suggests that due to miR-654-3p’s differential regulation on FBXO5, the cell proliferation as well as genomic instability may be enhanced in CIN III stage. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 5
Instead, miR-378, miR-10b and miR-95 were expressed mainly in HLSCs and miR-369-5p, miR-594 and miR-654, were expressed mainly in MSCs rather than in their MVs, suggesting that these miRNAs were not compartmentalized within MVs and therefore not secreted. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 4
As found for 10-87 HP cells and 10-87 T cells, SF-VERO cells and A4497 VERO cells expressed increased levels of miR-376a, miR-654-3p, miR-543, and miR-382 over the levels found in pAGMK cells (Table 4). [score:3]
qRT-PCR analysis confirmed that miR-376a, miR-654-3p, miR-543, miR-382, miR-31, miR-200c, miR-218, and miR-183 paralleled the microarray miRNA levels. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 3
Recently, many antiviral miRNAs (miR-323, miR-491, miR-654, and Let-7c) have been found to reduce IAV replication by targeting the viral genome 10 11. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
This miRNA is part of a large cluster, two of which (miR-654/376b) were found to be expressed strongly in murine embryonic cartilage [74]. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Influenza virus infection modulates multiple cellular miRNAs, and miR-323, miR-491, and miR-654 have been shown to inhibit viral replication by binding to the viral PB1 gene [48], while miR-507 and miR-136 have potential binding sites within the viral PB2 and HA genes [49]. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
In another report, results showed that miR-323, miR-491 and miR-654 could inhibit replication of H1N1 influenza A virus through binding to the conserved region of the PB1 gene [16]. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
However, we identified maternally-expressed miRNAs (miR-299 and miR-654) in both offspring (Fig.   4d). [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
It also has been shown that cellular miR-323, miR-491, and miR-654 could inhibit replication of the H1N1 influenza A virus through binding to the PB1 gene [6]. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
Song et al. screened host miRNAs and found that miR-323, miR-491 and miR-654 inhibit the replication of the H1N1 IAV in MDCK cells by binding to the 3′ coding region rather than the 3′-UTR of the PB1 gene. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Moreover, several studies have demonstrated that cellular microRNAs (miR-323, miR-491, miR654, miR-146a) inhibit influenza virus replication or propagation [23, 24]. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
Additionally, prior studies from various mo dels of retinal degeneration identified over 300 differentially expressed miRNAs 63– 90, a total of 16 common miRNAs were identified (miR-1187, miR-125b-5p, miR-331-3p, miR466d-3p, miR-467f, miR-542-3p, miR-574-5p, miR654-3p, miR669h-3p, miR-882, miR-342-3p, miR-466a-5p, miR-466d-5p, miR-706, miR-345-3p, miR532-5p). [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
In 2010, Song’s group reported that miR-323, miR-491 and miR-654 could target the viral PB1 gene [34]. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 2
Wei J. Q. Chen H. Zheng X. F. Zhang B. X. Wang Y. Tang P. F. She F. Song Q. Li T. S. Hsa-miR-654–5p regulates osteogenic differentiation of human bone marrow mesenchymal stem cells by repressing bone morphogenetic protein 2 J. Southern Med. [score:2]
[1 to 20 of 1 sentences]
26
[+] score: 2
Formosa A, Markert EK, Lena AM, Italiano D, Finazzi-Agro E, Levine AJ, et al. s, miR-154, miR-299-5p, miR-376a, miR-376c, miR-377, miR-381, miR-487b, miR-485-3p, miR-495 and miR-654-3p, mapped to the 14q32.31 locus, regulate proliferation, apoptosis, migration and invasion in metastatic prostate cancer cells. [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 2
A cell proliferation assay revealed that four of the miRNAs (miR-124, miR-193, miR-379 and miR-654) could significantly inhibit HEK-293 T cell growth, and miR-124 exerted the most striking effect (Fig. 7a). [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 1
A previous report discovered that three miRNAs: miR-323, miR-491, and miR-654, were able to decrease H1N1 production in madin darby canine kidney (MDCK) cells via binding to a same conservative site on PB1 mRNA and subsequently inducing mRNA degradation [26]. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Sequences 200 nucleotides upstream to the transcription start site of miR-654, miR-431, miR-127, miR-432, miR-411, miR-544, miR-369-3p, miR-382 and miR-134 were then amplified using qPCR from DNA present in the immune complexes. [score:1]
[1 to 20 of 1 sentences]