sort by

6 publications mentioning hsa-mir-619

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-619. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 87
Other miRNAs from this paper: hsa-mir-1184-1, hsa-mir-1184-2, hsa-mir-1184-3
The miR-619-5p binding sites in the 5’-untranslated regions (5’UTRs), the coding domain sequences (CDSs) and the 3’-untranslated regions (3’UTRs) of several genes were predicted using the MirTarget program [12]. [score:7]
The target genes of the miR-619-5p carry out one or more different functions and are involved in the development of various diseases (Table  1). [score:6]
In the absence of complete complementarity between miR-619-5p and its binding site, miR-619-5p uses a site containing the corresponding mutation in the CDS for the regulation of gene expression. [score:5]
The presence of miR-619-5p binding sites in the CDSs of five genes with different functions and the evolutionary conservation of these sites signify the role of miRNA in the regulation of the expression of these genes. [score:4]
MicroRNA-gene-net analysis indicated that miR-619-5p and other some miRNAs had the most important and extensive regulatory function for Qi-stagnation syndromes and Qi-deficiency syndromes in coronary heart disease [29]. [score:4]
miR-619-5p miRNA mRNA Gene Human Orthologous genes miRNAs participate in the regulation of the expression of protein-coding genes at the post-transcriptional stage [1]. [score:4]
The list of miR-619-5p target genes and the positions of binding sites are outlined in Table  1. miR-619-5p is 22 nucleotides in length and is coded by an intron of the slingshot protein phosphatase 1 (SSH1) gene, which is located on chromosome 12 [17, 18]. [score:3]
Among these umiRNAs, miR-619-5p interacts with the largest number of target genes that have the greatest number of binding sites with complete complementarity of miR-619-5p and mRNAs. [score:3]
This indicates a stronger dependence of the expression of these genes on miR-619-5p. [score:3]
Binding sites of miR-619-5p in the 3’UTRs of all human target genes are also present in the 3’UTRs of orthologous genes of mammals. [score:3]
Some of the human miR-619-5p target genes and their corresponding orthologous genes have two miR-619-5p binding sites in their mRNAs. [score:3]
The majority of miR-619-5p binding sites are located in the 3’UTRs of mRNAs of target genes. [score:3]
It was observed, that hsa-miR-619-5p and hsa-miR-1184 microRNA expression significantly increased in prostatic cancer. [score:3]
It was shown the role of the mir-619-5p in the regulation of different pathological processes [28]. [score:2]
The homologous oligonucleotide of the miR-619-5p binding site in the mRNA of ZNF714 gene codes for an oligopeptide in a different ORF. [score:1]
miR-619-5p binding sites with complete complementarity (ΔG/ΔGm is 100%) to the mRNAs of the four genes are located in the 5’UTRs (Table  2). [score:1]
Variation of nucleotide sequences of mRNA region with miR-619-5p binding sites of genes from LC28A2 to ZNF841 (Conservative binding sites are in bold). [score:1]
miR-619-5p has two binding sites in the 5’UTRs of mRNAs of ANAPC16, CYB5D2, and PRR5 and three binding sites in the mRNA of DNASE1. [score:1]
For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. [score:1]
All of these miR-619-5p binding sites are located in the 3’UTRs. [score:1]
mRNAs of some genes have binding sites for miR-619-5p within their 5’UTRs and 3’UTRs or CDSs and 3’UTRs. [score:1]
Therefore, we have studied a unique miR-619-5p that binds to the mRNAs of several hundred human and orthologous genes. [score:1]
Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. [score:1]
This shows that the interaction of miR-619-5p with mRNAs of these genes is conserved during evolution. [score:1]
It was investigated the correlations between the expression of MALAT1 and miR-619-5p, in addition to the association between the clinicopathological features and survival outcomes of patients with stage II and III colorectal cancer tumors [28]. [score:1]
The nucleotide sequences of miR-619-5p binding sites are located in the CDSs of the C8orf44, C8H8orf44, ISY1, ZNF429, and ZNF714 genes and encode the following oligopeptides (Table  3). [score:1]
The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. [score:1]
Variation of nucleotide sequences of mRNA region with miR-619-5p binding sites of genes from GK5 to HM13 (Conservative binding sites are in bold) (PDF 106 kb) Additional file 3: Figure S3. [score:1]
The majority of miR-619-5p binding sites are located in the 3’UTRs but some genes have miRNA binding sites in the 5’UTRs of mRNAs. [score:1]
The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3’UTR (214 sites), CDS (3 sites), and 5’UTR (4 sites). [score:1]
The nucleotide sequences of specific regions of mRNAs of C8H8orf44, C8orf44, ISY1, ZNF429, and ZNF714 genes that contain miR-619-5p binding sites in the CDSs are homologous among themselves and to the binding sites located in the 5’UTRs and 3’UTRs. [score:1]
Therefore, the energy of interaction of miR-619-5p with mRNA of all the genes listed in the table is the same and equal to ΔG = −121 kJ/mole. [score:1]
The mRNAs of the C17orf75, C8orf44, CIAO1, CPM, CYP20A1, DCAF10, FKBP14, RAB3IP, SYNJ2BP, VHL genes have two complete complementary binding sites for miR-619-5p, and the mRNA of the CACNG8 gene has three such binding sites. [score:1]
The binding sites of miR-619-5p in 3’UTRs, 5’UTRs and CDSs are conservative in the orthologous mammalian genes. [score:1]
Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. [score:1]
For example, ATAD3C, C14orf182, and CYB5RL have miR-619-5p binding sites in the 5’UTRs and 3’UTRs, and C8orf44, ISY1, and ZNF714 have miR-619-5p binding sites in the CDSs and 3’UTRs. [score:1]
The results suggest that miR-619-5p binding sites are highly conserved. [score:1]
The miR-619-5p binding site in the 5’UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. [score:1]
Variation of nucleotide sequences of mRNA region with miR-619-5p binding sites of genes from CSL6 to COX18 (Conservative binding sites are in bold) (PDF 218 kb) Additional file 2: Figure S2. [score:1]
The data given in the 1, 2, 3 and 4 demonstrate the variability of the nucleotides before and after the binding sites of miR-619-5p, which is shown in the Weblogo schemes in the table 8. (PDF 151 kb) CDSs Coding domain sequences miRNAs Micrornas ORF Open reading frame Umirna Unique miRNA We thank Leducq foundation and the European Union project «Muscle Stress Relief». [score:1]
Variation of nucleotide sequences of mRNA region with miR-619-5p binding sites of genes from IFIT3 to SLC26A4 (Conservative binding sites are in bold) (PDF 139 kb) Additional file 4: Figure S4. [score:1]
The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. [score:1]
Nucleotide sequences of human mature miR-619-5p (GCUGGGAUUACAGGCAUGAGCC) were downloaded from the miRBase database (http://mirbase. [score:1]
In the third reading frame, the miR-619-5p binding site has a stop codon. [score:1]
The mRNAs of 27 genes have four binding sites, seven genes have five binding sites, and CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites. [score:1]
Table  6 shows the nucleotide sequences of two miR-619-5p binding sites in the 3’UTR of mRNAs of ERBB3, FBLIM1, and FKBP14 orthologous genes. [score:1]
All mRNAs with complete complementarity to miR-619-5p binding sites (ΔG/ΔGm is 100%) were divided into four groups, and the frequency of occurrence of nucleotides was determined in each group. [score:1]
mRNAs of 201 genes have complete complementary binding sites for miR-619-5p (ΔG/ΔGm = 100%). [score:1]
[1 to 20 of 48 sentences]
2
[+] score: 41
Other miRNAs from this paper: hsa-mir-5585
The presence of miR-619-5p binding sites in the CDSs of three genes with different functions and the evolutionary conservation of these sites testify to the importance of the role of miRNA in the regulation of the expression of these genes. [score:4]
The miR-619-5p, miR-5095, miR-5096, and miR-5585-3p binding sites in the 5′UTRs, CDSs, and 3′UTRs of several genes were predicted using the MirTarget program. [score:3]
The greatest numbers of miR-619-5p, miR-5096, miR-5095, and miR-5585-3p binding sites are located in the 3′UTRs, and it is, therefore, possible that many target genes have umiRNAs binding sites. [score:3]
SSH1, BMP2K, TMEM39B, and SCP2 host genes and target genes of miR-619-5p, miR-5095, miR-5096, and miR-5585 have independent evolution origin. [score:3]
The mRNAs that were targeted by miR-619-5p, miR-5096, miR-5095, and miR-5585-3p were established. [score:3]
For example, the 5′UTRs and 3′UTRs of the ATAD3C and CYB5RL genes have miR-619-5p binding sites. [score:1]
miR-619-5p, miR-5095, miR-5096, and miR-5585-3p have different miRNA binding site origins, lengths, quantities, and miRNA binding site properties, among other features. [score:1]
The nucleotide sequences with lengths of 95 nt that contain multiple miR-619-5p, miR-5096, miR-5095, and miR-5585-3p binding sites are given in Figures 3 and 4. These results testify to the high degree of homology between the umiRNA binding sites in the mRNAs of different genes. [score:1]
The miR-619-5p binding site is located at a distance of six nucleotides downstream of the beginning of the miR-5095 site in the majority of genes containing arranged umiRNA sites. [score:1]
The mRNAs of some genes have binding sites for miR-619-5p, miR-5095, miR-5096, and miR-5585-3p within their 5′UTRs and 3′UTRs or CDSs and 3′UTRs. [score:1]
The miR-5095 and miR-619-5p binding sites partially overlap. [score:1]
The nucleotide sequences of human miR-619-5p, miR-5095, miR-5096, and miR-5585-3p were taken from the miRBase site (http://mirbase. [score:1]
The distances between the positions of the two miR-619-5p binding sites in the mRNAs of these genes are constant at 112 nt. [score:1]
For example, miR-619-5p, miR-5095, miR-5096, and miR-5585-3p were found to be capable of binding more 600 genes each with value Δ G/Δ G [m] ratios of 90% or more. [score:1]
The 5′UTR and 3′UTR of the ATAD3C gene have miR-5095 and miR-619-5p binding sites. [score:1]
The homologous oligonucleotide of the miR-619-5p binding site in ZNF714 mRNA codes for an oligopeptide in other ORF. [score:1]
The degree of homology of the nucleotide sequences containing the miR-619-5p, miR-5096, miR-5095, and miR-5585-3p binding sites is high. [score:1]
The nucleotide sequences of the mRNAs with miR-619-5p, miR-5095, and miR-5585-3p binding sites are highly homologous, which testifies to the strength of the selection pressure on these nucleotide sequences. [score:1]
The data about the locations of the miR-619-5p, miR-5096, miR-5095, and miR-5585-3p binding sites and the degrees of homology of the corresponding nucleotide sequences in the mRNAs of 21 genes are presented in Figure 6. The distances between the miR-5095 and miR-5096 binding sites are all 57–60 nt. [score:1]
However, in another group of mRNAs, the beginnings of the miR-619-5p binding sites are located at distances of seven nucleotides upstream of the miR-5585-3p binding sites (Figure 7). [score:1]
The CDS and 3′UTR of the ZNF714 gene have binding sites for miR-5096 and miR-619-5p, and the C8orf44 mRNA has only an miR-619-5p binding site. [score:1]
miR-5095 and miR-619-5p binding sites were found in the CDS and 3′UTR of the ISY1 gene. [score:1]
The nucleotide sequences of the miR-619-5p binding sites mRNAs of the OPA3 and SPN genes each have four binding locate in the CDSs of the C8orf44, ISY1, and ZNF714 genes'. [score:1]
The detection of a large number of binding sites of miR-619-5p, miR-5095, miR-5096, and miR-5585 in the mRNAs of the genes studied here presumably indicates new functional opportunities. [score:1]
The 5′UTRs and 3′UTRs of the C14orf182 and CYB5RL genes have miR-5096 and miR-619-5p binding sites, respectively. [score:1]
The CDSs and 3′UTRs of the C8orf44, ISY1, and ZNF714 genes have miR-619-5p binding sites. [score:1]
The first two oligopeptides are coded in one open reading frame (ORF), and the amino acids the miR-619-5p binding site codes for are highly conserved (highlighted in bold). [score:1]
Features of miR-619-5p, miR-5096, miR-5585-3p, and miR-5095. [score:1]
Highly conserved miR-619-5p, miR-5095, miR-5096, and miR-5585 binding sites in a large number of genes indicate the emergence of these sites in the early stages of human evolution. [score:1]
There is another group of genes in which the miR-619-5p binding sites are downstream of the miR-5095 sites and upstream of the miR-5585-3p sites (Figure 8). [score:1]
[1 to 20 of 30 sentences]
3
[+] score: 12
To further validate the miRNA microarray results, 5 out of the most obvious up-regulated miRNAs (miR-6723-5p, miR-1285-3p, miR-619-5p, miR-1290 and miR-1273a) and 5 out of the most obvious down-regulated miRNAs (miR-98, miR-7846-3p, miR-668-5p, miR-4738-3p and miR-4654) were selected to determine their relative expression levels on hypertrophic scar tissues to verify the effect of chips. [score:9]
showed that relative expression values of miR-6723-5p, miR-1285-3p, miR-619-5p, miR-1290 and miR-1273a were above 0 and that relative levels of miR-98, miR-7846-3p, miR-668-5p, miR-4738-3p and miR-4654 were below 0 (Fig.   1b). [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 4
For example, SNPs that show evidence for regulating the expression of miRNAs in liver include several replicated clinical associations with response to chemotherapeutic agents, including rs9332377 (cisplatin; miR-619) [30] and rs4880 (cyclophosphamide; miR-199a-5p, miR-376a, miR-450a, miR-590-5p) [31]. [score:4]
[1 to 20 of 1 sentences]
5
[+] score: 3
In In this study, the TargetScanHuman database identified13 miRNAs (miR-1200, miR-378d,e,i,c,h,b,f, miR-422a, miR-3690, miR-619, miR-4446-3p, miR-2909, miR-4777-5p, miR-136, miR-515-5p, miR-4659a,b-3p, miR-494 and miR-593) which were conserved and similar to the CD3G gene. [score:3]
[1 to 20 of 1 sentences]
6
[+] score: 1
In this condition, the TEs were inserted in the proximity of appropriate sequences that are similar to the complementary sequences of the TE head or tail to form the hairpin structure of pre-miRNAs, such as hsa-mir-326, hsa-mir-421 and hsa-mir-619 (S2 Table). [score:1]
[1 to 20 of 1 sentences]