126 publications mentioning rno-mir-1 (showing top 100)

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

The data from mRNA and miRNA microarray analysis indicated that following sciatic nerve injury, the mRNA expression levels of BDNF were dramatically up-regulated with a peak value at 7 d PNI while the expression levels of miR-1 were dramatically down-regulated with a valley value at 7 d PNI, both compared to that at 0 h PNI (Fig. 1A).

Moreover, miR-1 over -expression -induced decrease in BDNF protein expression was greater than that in BDNF mRNA expression, suggesting that BDNF was negatively regulated by miR-1 possibly through both mRNA degradation and translation repression.

To determine whether BDNF was regulated by miR-1 through direct binding to its 3′-UTR, the wild-type and mutant 3′-UTR of BDNF, including single target site mutant (mut1, mut2, and mut3), double target site mutant (mut1&2, mut1&3, and mut2&3), and triple target site mutant (mut1&2&3) were constructed and inserted into the downstream region of the luciferase reporter gene (Fig. 1C,D).

In summary, we identified that miR-1 was down-regulated at 4, 7, and 14 d following sciatic nerve injury, reaching a valley value at 7 d. The reduced expression of miR-1 increased the expression and secretion of BDNF, and promoted SC proliferation and migration.

The relative luciferase activity was significantly decreased when miR-1 mimic was co -transfected with the wild-type, single target site mutant, or double target site mutants, but was not altered when miR-1 mimic was co -transfected with triple target site mutants (Fig. 1E).

miR-1 inhibited BDNF expression through both mRNA degradation and translation repression.

qRT-PCR analysis showed that the mRNA expressions of BDNF were significantly suppressed by over -expression of miR-1, and were significantly enhanced by silencing of miR-1 (Fig. 2A).

miR-1 suppressed BDNF expression by mRNA degradation as well as translation repression.

After primary SCs were co -transfected with BDNF siRNA and miR-1 inhibitor, miR-1 inhibitor -induced increase in cell proliferation and migration was significantly abrogated by BDNF knockdown (Fig. 6C,D).

Then, we demonstrated that miR-1 inhibited both the mRNA and the protein levels of BDNF by directly targeting the 3′-UTR of BDNF, and showed that miR-1 also reduced the abundance of endogenous BDNF synthesized by SCs.

Temporal expression changes of BDNF were inversely associated with those of miR-1. miR-1 inhibited BDNF secretion from SCs.

To identify the effect of miR-1 on the expression of BDNF, miR-1 mimic or inhibitor was transfected in cultured SCs, respectively.

We found that over -expression and silencing of miR-1 caused suppressing and promoting effects on SC proliferation and migration respectively.

Using miRNA target prediction softwares, we found that miR-1 could target the 3′-UTR of BDNF.

Primary SCs were transfected with miR-1 mimic (miR-1), miR-1 inhibitor (Anti-miR-1), mimic control (miR Con), or inhibitor control (Anti-miR Con) respectively.

miR-1 negatively regulated BDNF by directly targeting its 3′-UTR.

miRNA target prediction programs (TargetScan and MiRanda) were used to predict the binding sites of miR-1 on BDNF.

showed that the protein expressions of BDNF were also reduced by over -expression of miR-1, and increased by silencing of miR-1 (Fig. 2B,C).

Transwell migration assay results showed that SCs transfected with miR-1 mimic or miR-1 inhibitor induced a significant decrease or increase in cell migration rate compared to SCs transfected with non -targeting negative controls, respectively, suggesting that miR-1 could also suppress SC migration (Fig. 5B).

Although all 3 target sites were involved in miR-1 binding, target site 3 might be the most effective among all sites.

We noted that BDNF knockdown significantly attenuated miR-1 inhibitor -induced changes in SC proliferation and migration, suggesting that BNDF was a functional mediator of miR-1 in regulating SC phenotype.

EdU incorporation results showed that over -expression of miR-1 reduced the proliferation rate of SCs to less than 50% of the control value while silencing of miR-1 increased the proliferation rate of SCs to nearly 1.5 fold the control value, suggesting that miR-1 could suppress SC proliferation (Fig. 5A).

This level was reduced when cultured SCs were co -transfected with miR-1 plus BDNF 3′-UTR containing no mutant target site 3 (including wild-type, mut1, mut2, and mut1&2), but this level was not significantly changed when cultured SCs were co -transfected with miR-1 plus BDNF 3′-UTR containing mutant target site 3 (mut3, mut2&3, and mut1&3).

An inter-similar reduction in the relative luciferase mRNA level was observed in cultured SCs co -transfected with miR-1 mimic plus mut1, mut2, or mut1&2, respectively, but no change in the relative luciferase mRNA level was found in cultured SCs co -transfected with miR-1 mimic plus mut3, mut2&3, or mut1&3 (mut3-containing BDNF 3′-UTR) (Fig. 2D), suggesting that miR-1 induced BDNF mRNA degradation primarily through binding to target site 3 rather than target site 1 or 2 of BDNF 3′-UTR.

Primary SCs (A) and RSC96 SCs (B) were transfected with miR-1 mimic (miR-1), miR-1 inhibitor (Anti-miR-1), mimic control (miR Con), or inhibitor control (Anti-miR Con), respectively.

BDNF knockdown led to a significant reduction in cell proliferation or cell migration, which was similar to the influence of miR-1 over -expression (Fig. 6B).

Target prediction algorithm as well as dual-luciferase reporter assay suggested that BDNF was a binding target of miR-1 and there were 3 binding sites of miR-1 at BDNF 3′-UTR.

Taken together, these observations suggested that miR-1 targeted BDNF through its direct binding to the 3′-UTR of BDNF.

Inversely, transfection of either primary SCs or RSC96 SCs with miR-1 inhibitor significantly increased the cellular secretion of BDNF compared to that with non -targeting negative control (Fig. 4A,B).

We identified that miR-1 mediated phenotype modulation of SCs by targeting BDNF, providing further evidence for miRNA -mediated post-transcriptional regulation of peripheral nerve regeneration.

Primary SCs were transfected with miR-1 mimic, miR-1 inhibitor, and non -targeting negative controls, respectively, and then subjected to cell proliferation and migration assays.

How to cite this article: Yi, S. et al. Regulation of Schwann cell proliferation and migration by miR-1 targeting brain-derived neurotrophic factor after peripheral nerve injury.

BDNF was a direct target of miR-1..

To verify the correlation between miR-1 and BDNF expressions, the expression profiles of miR-1 and BDNF mRNA following sciatic nerve injury were investigated by qRT-PCR.

The effect of miR-1 on BDNF mRNA expression was further determined.

Moreover, cultured SCs were transfected with miR-1 inhibitor in the presence or absence of BDNF siRNA.

All 3 target sites of BDNF were critical for the formation of miR-1-BDNF complex but with unequal significance.

The above analyses provided further evidence that that after peripheral nerve injury, the temporal expression profile of miR-1 was roughly inversely correlated with that of BDNF.

To determine the biological role of miR-1 in phenotype modulation of SCs, cultured SCs were transfected with miR-1 mimic and with miR-1 inhibitor respectively.

In contrast, the relative luciferase mRNA level in cells transfected with miR-1 mimic plus mutant BDNF triple target site (mut 1&2&3) was not significantly changed (Fig. 2D).

SC cultures were transfected with miR-1 mimic, miR-1 inhibitor, or BDNF siRNA (Ribobio, Guangzhou, China), respectively, using Lipofectamine RNAiMAX transfection reagent (Invitrogen) according to the manufacturer’s instructions.

To further determine whether the effects of miR-1 on BDNF secretion were through targeting the 3′-UTR of BDNF, miR-1 mimic and BDNF 3′-UTR plasmid were co -transfected into RSC96 SCs.

Relative expressions of miR-1 and BDNF were conducted using the comparative 2 [−∆∆Ct] method with U6 and GAPDH as the reference gene, respectively.

Primary SCs or RSC96 SCs were transfected with miR-1 mimic and control, miR-1 inhibitor and control, BDNF siRNA and control, respectively, using Lipofectamine RNAiMAX transfection reagent (Invitrogen).

miR-1 suppressed SC proliferation and migration.

The temporal expression profile of miR-1 following sciatic nerve crush was negatively correlated with that of BDNF.

In the current study, we performed qRT-PCR and Western blot analyses to verify the inverse association between the expressions of miR-1 and BDNF.

Transfection of either primary SCs or RSC96 SCs with miR-1 mimic significantly decreased the cellular secretion of BDNF compared to that with non -targeting negative control.

BDNF knockdown recapitulated miR-1 effects on phenotype modulation of SCs.

The BDNF secretion from both primary SCs and RSC96 SCs transfected with miR-1 mimic was significantly decreased, while the BDNF secretion from both primary SCs and RSC96 SCs transfected with miR-1 inhibitor was significantly increased, as compared to that from both primary SCs and RSC96 SCs transfected with control.

BDNF knockdown attenuated the effect of miR-1..

Collectively, all the results further demonstrated that BDNF was a functional mediator for miR-1 regulation of SC phenotype.

In other words, miR-1 negatively regulated BDNF in the injured peripheral nerves.

A total amount of 20 ng RNA samples was reversely transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) and stem-loop RT primers (Ribobio) according to manufacturer’s instructions to determine miR-1 expression.

To further investigate whether the effects of miR-1 on SC proliferation and migration were recapitulated through down-regulation of BDNF, primary SCs were transfected with BDNF siRNA.

The expression of miR-1 in the injured nerve was nearly unchanged at 1 d PNI and then drastically decreased at 4, 7, and 14 d PNI with a valley value at 7 d PNI, compared to that at 0 h PNI (Fig. 3A).

miR-1 depressed the secretion of BDNF.

Histogram (C) showing that miR-1 -induced reduction of BDNF secretion was rescued by co-transfection with miR-1 mimic plus BDNF 3′-UTR plasmid.

miR-1 decreased the proliferation and migration of SCs.

Transfection with miR-1 mimic alone significantly decreased BDNF secretion, but this reducing effect of miR-1 mimic was attenuated by co-transfection with BDNF 3′-UTR plasmid (Fig. 4C).

Among cells co -transfected with miR-1 mimic plus mut1, mut2, or mut3, the reduction in relative luciferase activity was the least robust in cells co -transfected with miR-1 mimic plus mut3 (p = 0.0147), while the reduction in relative luciferase activity was the most significant in cells co -transfected with miR-1 mimic plus mut1 (p = 0.0031) (Fig. 1E).

miR-1 mimic and p-Luc-UTR constructs were co -transfected into HEK 293T cells to analyze the relative luciferase activity.

Sequence alignment of these 3 miR-1 binding sites suggested that they were not conserved across all species (Fig. 1B).

2

The main findings of this study document that: i) connexin 43 expression and activity (with its consequent displacement from the gap junction) increases in response to hypertrophic stress in cardiomyocytes in vitro and in vivo; ii) miR-1 directly targets for Cx43 repression and it is concurrently down-regulated in hypertrophic cardiomyocytes in vitro and in vivo; iii) molecular myocyte remo deling in cardiac hypertrophy increases MAPK-ERK1/2 activation, which in turn hyper-phosphorylated Cx43 and this shift redistributes Cx43 away from the intercalated disks favoring gap junction disassembling; iv) the hypertrophic myocardium is therefore prone to ventricular tachyarrhythmia (VT); v) angiotensin II type 1 receptor (AT1R) blockade reduces the maladaptive hypertrophic signaling inhibiting ERK1/2 activation while maintaining the pro-survival Akt function, attenuating miR-1 down-regulation and Cx43 displacement from the gap junction.

Thus, Cx43 mRNA and protein levels are up-regulated with a concurrent down-regulation of miR-1 levels in aortic banded hearts in vivo as it is expected by miR-1 direct targeting of Cx43 [32].

Among the highly expressed miRs in the myocardium, miR-1 has an essential regulatory role in the development of cardiac hypertrophy and it controls cardiac electrophysiology for its ability to modulate the expression levels of molecular targets that adjust the electrical coupling of the cardiac fiber cells [17].

In conclusion, this study provides in vivo and in vitro evidences that the selective AT1R inhibition reduces total and phosphorylated levels of Cx43 through miR-1 expression normalization and ERK1/2 inhibition in hypertrophic stressed cardiomyocytes.

Thus, it is tempting to speculate that ERK1/2 dependent signaling stimulated by cardiac stretch and AngII release mediates miR-1 down-regulation and Cx43 increased expression.

Intriguingly, MAPKs are known regulators of miR-1/miR-133 biogenesis [52] and we have recently shown in vascular smooth muscle cell that ERK1/2 activation suppresses miR-133 expression [13], the miR-1 cognate bicistronic gene.

Overall these data indicate that a hypertrophic stimulus on cardiomyocytes induces miR-1 down-regulation increasing the expression of Cx43, which in turn is phosphorylated by the hypertrophic stress -induced MAP kinases and so drifted away from the gap junction.

Indeed, we speculate that miR-1 overexpression leads to inhibition of ERK 1/2 phosphorylation in vivo, and the latter in turn prevents Cx43 phosphorylation and displacement from the gap junction.

MiR-1 is abundantly expressed in skeletal and cardiac muscle, and it directly targets Cx43 for repression [34, 35].

C: immunohistochemistry and confocal microscopy in murine normal and hypertrophic heart sections; panels a-b show normal Cx43 expression in the gap junction (a) and very low level of its phosphorylation at Ser279/Ser282; ISO -induced LVH determined hyper-phosphorylation of Cx43 and its displacement from the gap junction to the cytoplasm of hypertrophic cardiomyocytes (c); panel d shows a significant reduction of phospho-Cx43 and its stabilization within the gap junction by adenovirus -mediated miR-1 selective intra-myocardial overexpression (red: α-sarcomeric actin, α-SA; green: Cx43 or p-Cx43; blue: DAPI).

The latter molecular adaptation provides a potential explanation of our findings showing that miR-1 regulates not only Cx43 expression through the expected gene silencing mechanism but it also indirectly modulates Cx43 activity.

Furthermore, miR-1 overexpression inhibits MAPK-ERK1/2 phosphorylation in hypertrophic cardiomyocytes in vivo [53].

Accordingly, the development of LVH, occurrence of hyperkinetic VT and reduction in cardiac function after pressure overload in an experimental rat mo del of ascending aortic banding are prevented by AT1R which is associated with the attenuation of miR-1 down-regulation and the consequent stabilization of Cx43 activity within the gap junction.

Here we confirm these data and provide the first evidence that AT1R blockade prevents miR-1 down-regulation in hypertrophic stressed cardiomyocytes.

Levels of miR-1 are significantly up-regulated in cardiac muscle already at 48-72 hours (data not shown).

In particular, Cx43 is a direct target of miR-1 gene-silencing activity [34, 35].

222±11µm [2] in Con; p<0.05) and miR-1 down-regulation in Ad-Empty mice (Figure 8A).

all, N=6), whereas Valsartan administration reduced miR-1 down-regulation by AngII treatment in vitro (Figure 7A, right panel).

Furthermore, AngII stimulation significantly down-regulated (-68% decrease) miR-1 levels in cultured myocytes vs.

Importantly, in agreement with the data on rat LV hypertrophy by aortic banding, miR-1 down-regulation by Iso -mediated hypertrophy was associated with Cx43 increased protein levels and enhanced phosphorylation (Figure 8B).

However, it is still unknown whether miR-1 and Cx43 are interconnected in the pro-arrhythmic context of left ventricular hypertrophy (LVH) and whether miR-1 expression and activity can be regulated by an anti-hypertrophic treatment, such as AT1R antagonization.

In an additional set of experiments to assess the direct role of miR-1 on Cx43 expression and activity, myocyte hypertrophy was induced in 8-12 weeks old C57BL/6 mice by Isoproterenol daily injection (Iso, 50mg/kg body weight i. p. ) for 14 days [19].

Therefore, the purpose of this study was to examine: (i) whether miR-1 and Cx43 dysfunctions underlie the onset of VT associated to cardiac hypertrophy in a rat mo del of pressure overload; (ii) whether miR-1 directly modulates Cx43 expression and activity in hypertrophic myocytes in vitro and in vivo; (iii) to assess whether the treatment of pathologic LVH by AT1R blockade could normalize miR-1 levels, limit the adverse electrical remo deling of Cx43 and reduce the induction of life-threatening VT.

MiR-1 was significantly down-regulated in hypertrophic and arrhythmic group of rats (LVH) in contrast to sham-operated rats (-61% decrease, p<0.01 vs.

On the other hand, Ad-miR-1 overexpression prevented cardiomyocyte hypertrophic response to Iso treatment (cross sectional area, 233±12µm [2]; p=NS vs.

Cx43 has been already established as a target of miR-1 [34].

Importantly, miR-1 overexpression significantly reduced Cx43 protein levels with a concomitant significant reduction of its phosphorylated levels (Figure 8B).

0070158.g008 Figure 8 A: cardiac levels of miR-1 after adenovirus -mediated cardiac overexpression in control saline -injected (Saline-Con) and in Iso -induced hypertrophic mice (Iso-LVH, *p<0.05 vs.

C: cultured cardiomyocytes provided additional evidences, through gain- and loss-of-function assays, that Cx43 is a direct target of miR-1; cardiomyocytes were grown on 6-well plates to 70% confluence.

A: cardiac levels of miR-1 after adenovirus -mediated cardiac overexpression in control saline -injected (Saline-Con) and in Iso -induced hypertrophic mice (Iso-LVH, *p<0.05 vs.

In hypertrophic rats treated with VAL, the expression levels of miR-1 were increased (115%) returning to the normal baseline values of the sham-operated groups (-16% decrease, p=NS).

miR-1 modulates Cx43 expression and phosphorylation in hypertrophic cardiomyocytes.

At sacrifice, miR-1 was correctly over-expressed in Ad-miR-1 treated mice when compared to Ad-Empty (Figure 8A).

Finally, we tested whether miR-1 plays a direct role in the modulation of Cx43 activity in an in vivo hypertrophic heart.

Thus, these data above provide the first direct evidence that miR-1 plays a major role in the modulation of Cx43 activity and location in in vivo cardiac hypertrophy.

Indeed, we confirmed through gain (using a miR-1 mimic) and loss (Anti-miR-1) of function in vitro experiments that miR-1 directly modulates Cx43 levels (Figure 7C).

Briefly, in a group of mice (n=7) an Adenoviral vector (10 [11] pfu/mL) carrying a miR-1 construct under the ubiquitous CMV promoter (Ad-miR-1) [11] was intra-myocardially released by 5 direct epicardial injections of 3µL each in the anterior LV and apical region, followed by delivering of 30µL of adenoviral construct dissolved in 30% pluronic F127 gel (Sigma), in order to cover the entire LV wall.

Right panel: cardiomyocytes stimulated with Angiotensin II showed lower expression levels of miR-1 compared to unstimulated cardiomyocytes (Con), with increased miR-1 levels in AngII+Val group (*p<0.03 vs.

Real time RT-PCR for miR-1 (A) and for Connexin 43 (B) levels.

0070158.g007 Figure 7Real time RT-PCR for miR-1 (A) and for Connexin 43 (B) levels.

Moreover, cardiac miR-1 levels have been found reduced in pathological conditions such as acromegaly [51].

To this aim, either an Ad-miR-1 or an Ad-Empty intra-myocardial deliver was performed in C57BL/6 mice and 72 hrs later the adenoviral-infected mice were treated with Isoproterenol (Iso) to induce LVH or just saline as control (Con) for 14 days.

Specific miR-1 mimic (30nM per well), and Anti-miR-1 (60nM per well) were transfected using siPORT NeoFX Transfection Agent (Ambion) according to the manufacturer’s protocol.

Thus, 72 hours later, 8 adenovirus -transfected mice were administered Iso as above described (n=4, Ad-Empty+Iso and n=4, Ad-miR-1+Iso) while 6 mice were administered only saline solution (n=3 Ad-Empty+Saline and n=3 Ad-miR-1+Saline).

Accordingly, the gap-junction displaced and myocyte cytoplasmic accumulated hyper-phosphorylated Cx43 in hypertrophic hearts was significantly reduced in the Ad-miR-1 treated mice (Figure 8C).

B: total and phosphorylated (Ser279/Ser282) Cx43 levels in normal and hypertrophic mouse hearts after Adeno-Empty or Adeno-miR-1 myocardial release (*p<0.05 vs.

miR-1 modulates Cx43 activity in cardiac hypertrophy.

To investigate the relationship between electrical remo deling of pressure-overloaded hypertrophic hearts and miR-1 levels, we first assessed the differential expression of this miRNA in SHAM, SHAM+VAL, LVH and LVH+VAL rats.

3

In addition, results of Western blot assay showed that miR-1 significantly enhanced Bax expression and inhibited Bcl-2 expression; however, blockage of miR-1 function by miR-1 inhibitor significantly decreased Bax expression and increased Bcl-2 expression (all p < 0.05).

In addition, miR-1 mimic could inhibit Hsp90aa1 protein expression, and miR-1 inhibitor could increase Hsp90aa1 protein expression, without significantly affecting Hsp90 aa1 mRNA expression.

Apoptosis associated genes expression in cardiomyocytes after enforced expression of microRNA-1 (miR-1) mimic or miR-1 inhibitor.

Moreover, in parallel with Hsp90aa1 siRNA, over -expression of miR-1 could also increase the levels of Bax and cleaved caspase-3, and suppress Bcl-2 expression in OGD -treated NRVCs, resulting in the enhancement of OGD-promoted apoptosis of cardiomyocytes.

Additionally, both miR-1 mimic and Hsp90aa1 siRNA significantly increased the levels of Bax and active caspase-3, and inhibited Bcl-2 expression in OGD -treated NRVCs (p < 0.01) (Fig. 4E).

Bcl-2 was reported as a target gene of miR-1 8. Consistently, the in vitro experimental data in this study revealed that inhibition of miR-1 resulted in increases of Bcl-2 (Fig. 2) and Hsp90aa1 (Fig. 3D), therefore, the significant decrease of miR-1 may contribute to recoveries of Hsp90aa1 and Bcl-2 protein in rat myocardia on day 3 and day 7 post-I/R.

Next, we detected the expression of Hsp90aa1 in NRVCs transfected with miR-1 mimic and miR-1 inhibitor, respectively.

MicroRNA-1 (miR-1) inhibits Hsp90aa1 expression, contributing to apoptosis of cardiomyocytes under conditions of OGD.

org) showed that Hsp90aa1 and Hsp90b1 were potential target genes of miR-1. The matching positions for miR-1 within 3′-UTR of the targeted mRNAs are shown in Fig. 3A.

Data are shown as mean ± Standard Deviation, ** p < 0.01 vs pGl3-promoter vector control, N = 3. MRNA expression (C) and protein expression (D) of Hsp90aa1 in miR-1 mimic and inhibitor -modified neonatal rat ventricular cells were assessed by quantitative reverse transcription-PCR assay and Western blot assay, respectively.

Hsp90aa1 protein expression was significantly reduced in miR-1 mimic -modified NRVCs, but was significantly increased in miR-1 inhibitor -modified NRVCs (p < 0.01) (Fig. 3D).

No significant change in Hsp90aa1 mRNA expression was found in miR-1 mimic- or miR-1 inhibitor -modified NRVCs (Fig. 3C).

Together, the present study demonstrated that miR-1 is decreased in rat myocardia undergoing I/R, and also identified that Hsp90aa1 is a novel target of miR-1. Attenuation of miR-1 may be required for recovery of Hsp90aa1 during myocardial I/R, moreover, suppression of miR-1 and recovery of Hsp90aa1 contribute to protection against myocardial I/R injury.

Previous studies revealed that miR-1 enhances apoptosis of cardiomyocytes by inhibiting the expression of anti-apoptosis genes, including PKCε 7, Bcl2 8, IGF-1 11 and Hsp60 7 12.

Collectively, miR-1 inhibited the expression of Hsp90aa1, but not Hsp90b1, in NRVCs at the posttranscriptional level.

These results suggest that either miR-1 over -expression or the knockdown of Hsp90aa1 can similarly increase apoptosis of NRVCs exposed to OGD treatment.

Here, we found that miR-1 was significantly down-regulated in rat myocardium on day 3 and day 7 post-I/R.

Specifically, several lines of evidence derived from the current study support the notion that miR-1 negatively regulates Hsp90aa1 expression.

Effect of miR-1 on apoptosis-related gene expression in rat cardiomyocytes.

Fifty nM miR-1 mimic, 50 nM Hsp90aa1 siRNA and 100 nM miR-1 inhibitor (Ribobio, Guangzhou, China) were transfected into NRVCs by oligofectamine reagent (Invitrogen, Carlsbad, CA).

demonstrated that Hsp90aa1 protein expression was consistently decreased in NRVCs with transfection of miR-1 mimic or Hsp90aa1 siRNA.

As expected, in this study, we confirmed that over -expression of miR-1 enhanced the apoptosis of NRVCs.

N = 3. (A) The predicted miR-1 seed sequence matches to potential target gene mRNAs.

Fifty nM miR-1 mimic and 100 nM miR-1 inhibitor were transfected into NRVCs to assess the effect of miR-1 on apoptosis of cardiomyocytes.

Data on luciferase activity show the interaction between miR-1 and 3′UTRs of target genes.

MicroRNA-1 (miR-1) negatively modulates Hsp90aa1 expression.

Verification of Hsp90aa1 as a target gene of miR-1. MiR-1 and Hsp90aa1 siRNA enhanced the apoptosis of cardiomyocytes undergoing the oxygen-glucose deprivation (OGD) treatment.

MicroRNA-1 (miR-1) expression in the myocardium of a rat mo del of ischemia/reperfusion (I/R).

of in silico analysis suggest the presence of miR-1 target sites in the genes of Hsp90aa1 and Hsp90b1.

Expressions of miR-1, Hsp90aa1, Hsp90b1 and apoptosis-related genes in the myocardium post-I/R.

At 24 h post-transfection of miR-1 mimic or miR-1 inhibitor, NRVCs were washed thrice with PBS (pH 7.2, 1 mL), then incubated for 15 min with 3 μM rhodamine 123 (Molecular Probes, USA) in PBS.

The in vitro experimental data in this study revealed that inhibition of miR-1 resulted in increases of Hsp90aa1 (Fig. 3D) and Bcl-2 (Fig. 2), therefore, the significant decrease of miR-1 may contribute to recoveries of Hsp90aa1 and Bcl-2 protein in rat myocardia on day 3 and day 7 post-I/R.

How to cite this article: Zhu, W. S. et al. Hsp90aa1: a novel target gene of miR-1 in cardiac ischemia/reperfusion injury.

of qRT-PCR assay revealed that miR-1 was dramatically increased in miR-1 -modified NRVCs, but was markedly decreased in miR-1 inhibitor -modified NRVCs (Fig. 2A).

Compared with the scramble control, miR-1 significantly increased the amount of the cleaved caspase-3, but miR-1 inhibitor significantly decreased the amount of the cleaved caspase-3 (p < 0.01, p < 0.05, respectively) (Fig. 2C).

Using a site-directed mutagenesis kit (TransGen, Beijing, China), the miR-1 binding site sequence CATTCC was replaced with CTAAGC to construct recombinant luciferase reporter plasmids containing the mutant potential miR-1 binding sequences.

The in silico prediction indicated that Hsp90aa1 and Hsp90b1 were potential targets of miR-1, however the results of dual luciferase assay showed that miR-1 specifically binds to the 310-315 site in the 3′-UTR of Hsp90aa1.

Activities of firefly luciferase (FL) and Renilla luciferase (RL) were measured 24 hr after transfection, and the relative ratio of the FL /RL was used to indicate the miR-1 -mediated knockdown of target genes.

The seed sequence of miR-1 is GGAAUGU, and the complementary nucleotide sequences are shown in bold.

To normalize RNA content, β-actin was used for coding genes template normalization and U6 was used for miR-1 template normalization.

Human embryonic kidney (HEK) 293 cells (3 × 10 [5] cells per well in 12-well plate) were co -transfected with 200 ng of recombinant luciferase reporter plasmid, 50 nM miR-1 mimic, and 20 ng of pRL-TK as an internal control (Promega, Madison, WI).

qRT-PCR for miR-1 was performed on cDNA generated from 0.5 μg total RNA according to the manufacturer’s protocol (Ribobio, Guangzhou, China).

MiR-1 mimic and Hsp90aa1 siRNA were transfected into NRVCs, followed by TUNEL assay and an examination of protein expression of apoptosis-related genes.

Protein levels of Hsp90aa1 and Bcl-2 were decreased with no significant decrease of miR-1 on day 1 post-I/R, but were reversed with significant decrease of miR-1 on day 3 and day 7 post-I/R.

As in our previous report 12, the recombinant luciferase reporter plasmids containing the potential miR-1 binding site sequences of the Hsp 90aa1 and Hsp90b1 genes were prepared.

Consistently, Hsp90aa1 and Bcl-2 were negatively modulated by miR-1 in rat myocardia post-I/R.

The 2- [∆∆Ct] method was used to calculate relative expression levels of coding genes and miR-1 between treatments 18.

of qRT-PCR analysis showed that miR-1 was markedly decreased on day 3 and day 7 post-I/R (Fig. 1B).

MiR-1 level was markedly increased in NRVCs with transfection of miR-1 mimic (Fig. 4C), while Hsp90aa1 was significantly decreased in NRVCs with transfection of Hsp90aa1 siRNA (Fig. 4E).

4

To the best of our knowledge, the present study is the first to show a marked upregulation of Cx43 within the endoneurium of injured nerves which might—besides a transcriptional activation of Cx43 expression—in part be explained by a downregulation of miR-1. This differential regulation of miR-1 in the peripheral nerve, most likely in Schwann cells, might contribute to hypersensitivity following nerve damage.

This is accompanied by an upregulated protein expression of Connexin 43 (Cx43) and brain derived neurotrophic factor (BDNF) which are well established miR-1 targets.

Likewise, protein expression of the miR-1 targets BDNF and Cx43 was upregulated in the sciatic nerve and DRG after CCI.

Expression of miR-1 in acute, inflammatory pain, as well as axotomy revealed time- and stimulus -dependent changes in expression patterns which underline the complexity of expression changes in different pain states.

Expression of miR-1 is time dependently downregulated in sciatic nerve and unchanged in DRG and spinal cord.

However, the dysregulation of miR-1 expression in injured nerves could at least in part be involved in the expression of Cx43 in nerves.

Similarly, connexin-43, another established miR-1 target [10] was upregulated in peripheral nerves and DRG.

Furthermore, as a consequence of CCI leading to mechanical allodynia, we found miR-1 to be time -dependently downregulated in the sciatic nerve at the site of the constriction, whereas expression in the ipsilateral DRG and spinal cord remained unchanged.

BDNF, a previously established target of mir-1 [11] was significantly upregulated in the sciatic nerve and DRG.

In the present study, expression profiles of miR-1 and the pain-relevant targets, brain derived neurotrophic factor (BDNF) and Connexin 43 (Cx43), were studied in peripheral neuropathic pain, which was induced by chronic constriction injury (CCI) of the sciatic nerve in rats.

Expression level of miR-1 was higher in sciatic nerves than in DRG (relative expression DRG vs.

Protein expression of the miR-1 targets Cx43 and BDNF.

Cx43 and BDNF are well known targets of miR-1. We therefore analyzed the protein expression of Cx43 and BDNF in sciatic nerves and DRG.

Furthermore we show that constriction injury of the sciatic nerve leads to a time dependent downregulation of miR-1 in injured nerves.

In neuropathic rats, CCI lead to a time -dependent downregulation of miR-1 in the sciatic nerve but not in DRG and spinal cord.

Viader et al. [29] identified 87 miRNAs in the sciatic nerve of mice, including mir-1, most of which were downregulated upon peripheral nerve injury.

The relative expression of miR-1 in sciatic nerve was compared to miR-1 expression in DRG and ipsilateral spinal cord of naïve rats.

In the sciatic nerve CCI lead to a marked downregulation of miR-1 12 days after nerve ligation (0.10 vs.

This regulation is associated with alterations in the expression and localization of the miR-1 dependent pain-relevant proteins BDNF and Cx43.

After partial sciatic nerve ligation, a mo del of neuropathic pain, miR-1 was time -dependently down-regulated in the DRG.

Figure 2qPCR data demonstrating the expression of miR-1 in sciatic nerve (left), dorsal root ganglion (DRG, middle) and ipsilateral spinal cord (right) of naive rats.

After 6 days, the expression level of miR-1 in sciatic nerve was 0.28 vs.

In the present study we could demonstrate that miR-1 is expressed in the sciatic nerve of rats.

Figure 3qPCR showing the time course of miR-1 expression following CCI in a sciatic nerve, b DRG, c ipsilateral spinal cord.

Our results obtained in the spinal cord are in line with those described by Kusuda et al. In contrast, we found no changes of miR-1 expression in the DRG, which might result from the differences in species or surrogate mo del of neuropathic pain.

Brandenburger T Grievink H Heinen N Barthel F Huhn R Stachuletz F Effects of remote ischemic preconditioning and myocardial ischemia on microRNA-1 expression in the rat heart in vivoShock.

In this study we show that miR-1 is well expressed in sciatic nerves of rats.

Expression of miR-1 and Cx43 and BDNF messenger RNA.

microRNA miR-1 Connexin 43 (Cx43) BDNF Neuropathic pain Chronic constriction injury (CCI) Neuropathic pain is caused by a lesion or disease of the somatosensory system involving alterations in the peripheral and the central nervous system [1].

In sciatic nerves of naïve rats, expression levels of miR-1 were more than twice as high as in DRG and spinal cord.

If these findings are confirmed in future studies, a local therapy with compounds regulating miR-1 or other relevant miRNAs could be a theoretical approach for the treatment of neuropathic pain.

In summary, our findings suggest an involvement of regulated miR-1 in the peripheral nerve in neuropathic pain.

The expression of miR-1 is higher in peripheral nerve compared to DRG and spinal cord.

This study demonstrates that CCI leads to a regulation of miRNAs (miR-1) in the peripheral nervous system.

However, also the transcriptional activation of Cx43 mRNA might contribute to the protein changes observed in nerves after CCI and further studies are needed to clarify the impact of the miR-1 dysregulation in nerves.

Likewise, at the early time points after CCI surgery, miR-1 was not significantly altered in sciatic nerves (4 h: 1.29 vs.

One of the miRNAs being involved in neuropathic pain is miR-1. This miRNA has been shown to be involved in the induction of neuropathic pain [9].

The expression of miR-1 was investigated in the sciatic nerve, dorsal root ganglion (DRG) and the ipsilateral spinal cord by qPCR.

Additionally, miR-1 interacts with the two highly pain-relevant proteins Cx43 and BDNF [10, 11].

Kusuda and co-workers [9] investigated the expression of mir-1 in the DRG and spinal cord in different experimental mo dels of acute and chronic pain.

5

A contusion injury down-regulated expression of miR1, miR124, mi129-2, and up-regulated miR21, 1–7 days after treatment.

Interestingly, shock treatment shifted the regional distribution miRNA expression in contused rats, leading to decreased expression of miR124 in the dorsal region and at 7 days, a region-specific up-regulation of miR1 (ventral) and miR129-2 (dorsal) relative to unshocked animals.

miR1 remained down-regulated in the ventral region at 7 days and miR129-2 was down-regulated in both the dorsal and ventral regions.

This overall pattern replicates key components of our earlier study (Strickland et al., 2011), which showed that a contusion injury down-regulates miR1, miR129, and miR124, and up-regulates miR21 and miR146a.

At 7 days, only shocked-contused rats exhibited a significant down-regulation of miR1 and miR124 in the dorsal region, whereas miR129-2 was down-regulated in both regions.

In addition, differences in expression of miR124 were accounted for by variation in the expression of miR1, miR129-2, and miR146a, suggesting that these miRNAs may be co-regulated.

At day 7 following nociceptive/shock stimulation, miR1 expression in dorsal spinal cord in animals that had only received SCI were not different from controls, whereas IGF-1 mRNA expression was significantly increased.

FIGURE 4 Correlation analyses to assess the relationship between miR146a miRNA expression and expression of miR1, miR21, and miR124 following SCI.

As miR1 is further modified by uncontrollable intermittent tailshock following contusion, we assessed the extent to which changes in miR1 expression corresponded to modulation of potential neurotrophin and growth factor mRNA targets.

While uncontrollable nociceptive stimulation in SCI animals attenuated this decrease in miR1 observed following SCI alone, effectively resulting in increased miRNA expression, the expression of IGF-1 remained unchanged from the shock-only condition.

As BDNF and IGF-1 can be mRNA targets of miR1, we hypothesized that a statistical relationship would exist between expression changes in miR1 and that of BDNF and IGF-1. Pearson’s product–moment correlations (combining data for dorsal and ventral spinal cord and for day 1 and 7 post-shock) indicated two groups of significant correlations between SCI-sensitive miRNAs, BDNF, and IGF-1. There were significant correlations between BDNF and both miR21 and miR124, and between IGF-1 and miR1, miR124, and miR129-2 (Table 4).

At 1 day, the contusion injury down-regulated miR1, miR124, and miR129-2 in the ventral region of unshocked subjects.

The SCI [shock] rats alone exhibited a significant down-regulation of miR1 and miR124 in the dorsal region of the spinal cord at 7 days posttreatment.

Post hoc planned comparisons also indicated that the contusion injury per se decreased the expression of miR1 in the ventral/motor tissue, but this effect was significantly attenuated by uncontrollable shock; expression of miR1 was increased in the SCI [shock] group compared with SCI [unshock] treatment.

Our previous study showed that miR1, miR124, and miR129 were significantly down-regulated following a spinal cord contusion, while miR146a and miR21 were transiently induced (Strickland et al., 2011), and that these miRNAs were sensitive to opioid analgesics like morphine (Strickland et al., 2014).

For example, consistent with our own observation showing delayed reduction in miR1, others have reported that peripherally applied nociceptive and inflammatory stimuli also result in long term reduction of miR1 expression in dorsal root ganglia (Kusuda et al., 2011).

We found that miR1, miR124, and miR129-2 expression was significantly decreased following spinal cord trauma, irrespective of exposure to uncontrollable intermittent tailshock (p [miR1] < 0.001, p [miR124] < 0.001, and p [miR129-2] < 0.001; Figures 2 and 3).

At 7 days, shock treatment significantly increased the expression of miR1 (ventral region) and miR129-2 (dorsal region), relative to injured, unshocked controls.

One prediction is that the persistent decrease in miR1 expression following SCI may lead to increased vascular permeability and consequently be permissive for leukocyte infiltration.

There was also a significant interaction effect of time and treatment on miR124 expression, and of time, treatment, and spinal region on miR1, miR129-2, and miR146a (all Fs > 3.68, p < 0.05).

Intriguingly, in the above report, antisense -mediated suppression of miR1 had the same neuroprotective effect.

FIGURE 3 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 7 days following tailshock treatment.

In this context, it is important to note that miR1 is also highly expressed in the vascular system and increases the barrier capacity of endothelial cells (Wang et al., 2013).

In the early stages of injury, the suppression of miR1 may well have a protective effect, since the predicted increase in leukocyte infiltration may limit tissue damage and promote clearance of debris (Peruzzotti-Jametti et al., 2014).

miR1 and miR146a exhibited an overall difference across spinal regions because expression was somewhat less in the ventral portion.

FIGURE 1 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 1 h following tailshock treatment.

FIGURE 2 Bar graphs depicting qRT-PCR analysis of miRNA expression of miR1, miR21, miR124, miR129-2, and miR146a at the lesion site for sham animals and after unshocked or shock treatment in contused animals at 1 day following tailshock treatment.

Modulation of miR1 activity may play a significant role in regulating BDNF signaling after SCI and, importantly for this study, in mediating the effects of intermittent noxious stimulation on recovery after SCI.

Interestingly, miR1, a member of the miR1/miR206 family has been shown to regulate important growth-promoting neurotrophic factors like BDNF (Lewis et al., 2003; Lee et al., 2012).

Since the dorsal spinal cord is likely to be the primary recipient of nociceptive input, the inverse relationship between miR1 and IGF-1 may represent a direct sensory modulation of SCI and SCI-sensitive miRNA function.

Surprisingly, though miR1 and IGF-1 were both responsive to uncontrollable nociception variation in miR1 did not account for a significant proportion of the variation in IGF-1 (or BDNF).

MiR1, miR124, and miR129-2 were not significantly altered at the lesion site, either by contusion or by intermittent tail-shock at 1 h post-stimulation.

Conversely, uncontrollable nociceptive stimulation effectively increases miR1 at least in dorsal spinal cord, and may therefore adversely influence functional recovery.

Pearson’s correlations indicated a significant correlation between miR1 (black diamonds), miR21 (white squares), and miR124 (gray triangles), and miR146a (Pearson’s r = 0.59, P < 0.001, Pearson’s r = 0.69, P < 0.001, and Pearson’s r = 0.39, P < 0.005, respectively).

MicroRNA-1 prevents high-fat diet -induced endothelial permeability in apoE knock-out mice.

Three main clusters of miRNAs correlate significantly together: miR1 correlates with miR21, miR124, miR129-2, and miR146a, miR124 correlates with miR1, miR129-2, and miR146a, and miR146a correlates with miR1, miR21, and miR124.

Uncontrollable nociception resulted in a significant decrease in miR1 while further increasing IGF-1 mRNA.

miR1 miR21 miR124 miR129-2 miR146a miR1 Pearson correlation 0.282* 0.575** 0.349** 0.589** Sig.

Post hoc univariate ANOVAs indicated a main effect of time on miR1, miR21, miR124, and miR146a, a main effect of treatment on miR1, miR21, miR124, and miR129-2, and a main effect of spinal region on miR1 and miR146a (all Fs > 9.14, p < 0.005).

In combined analysis of data obtained from both dorsal and ventral spinal cord, and at both 1 and 7 days, there were significant correlations between miR1 and miR21, miR124, miR129-2, and miR146a (Figure 4A), between miR124 and miR1, miR129-2, and miR146a, and between miR146a and miR1, miR21, and miR124 (for all Pearson’s rs, p < 0.05, see Table 3; Figure 4B).

We previously reported that miR1, miR21, miR124, miR129-2, and miR146a were significantly affected by a spinal cord contusion (Strickland et al., 2011).

mRNA Primers Forward Reverse BDNF TGGACATATCCATGACCAGAAA CACAATTAAAGCAGCATGCAAT IGF-1 CCGCTGAAGCCTACAAAGTC GGGAGGCTCCTCCTACATTC GAPDH AGTATGTCGTGGAGTCTACTG TGGCAGCACCAGTGGATGCAG miRNA Primers/cat# Target Sequence Sequence reference hsa-miR-1/#204344 UGGAAUGUAAAGAAGUAUGUAU MIMAT0000416 hsa-miR-21-5p/#204230 UAGCUUAUCAGACUGAUGUUGA MIMAT0000076 hsa-miR-124-3p/#204319 UAAGGCACGCGGUGAAUGCC MIMAT0000422 hsa-miR-129-2-3p/# 204026 AAGCCCUUACCCCAAAAAGCAU MIMAT0004605 hsa-miR-146a-5p/# 204688 UGAGAACUGAAUUCCAUGGGUU MIMAT0000449 U6 snRNA/# 203907 All data were analyzed using SPSS software version 18 (SPSS; Chicago, IL, USA).

However, in ventral spinal cord, at 7 days following uncontrollable shock, animals that received SCI alone exhibited a significant decrease in miR1 and an increase in IGF1.

These data suggest that the decrease in miR1 and increase in IGF-1 mRNA following SCI may represent a neuroprotective adaptation.

IGF-1 prevents oxidative stress induced-apoptosis in induced pluripotent stem cells which is mediated by microRNA-1. Biochem.

miR1 miR21 miR124 miR129-2 miR146a BDNF mRNA Pearson correlation 0.069 0.332** -0.289* -0.164 0.154 Sig.

Glucose induces apoptosis of cardiomyocytes via microRNA-1 and IGF-1. Biochem.

6

We observed that approximately 1/10 of the recently identified 578 miRNAs are highly expressed in the mouse heart; SRF overexpression in the mouse heart resulted in altered expression of a number of miRNAs, including the down-regulation of mir-1 and mir-133a, and up-regulation of mir-21, which are usually dysregulated in cardiac hypertrophy and congestive heart failure [3, 13- 16].

In conclusion, our current study demonstrates that cardiac-specific overexpression of SRF leads to altered expression of cardiac miRNAs, especially the down-regulation of miR-1 and miR-133a, and up-regulation of miR-21, the dysregulation of which is known to contribute to cardiac hypertrophy.

The pri-mir-1-1 is expressed at 6-fold higher than pri-mir-1-2. Therefore, the contribution of pri-mir-1-1 to the mature miR-1 pool may be greater than that of pri-mir-1-2. Given the fact that targeted mutation of mir-1-2 gene resulted in embryonic myocardial dysfunction and half of the mutant mice suffered early death due to ventricular septal defect (VSD) [4], one might speculate that a targeted mutation of mir-1-1 gene would also cause equally (or more) severe consequences.

Real-time RT-PCR analysis revealed that mildly reduced SRF resulted in the down-regulation of miR-21 expression, but up-regulation of both miR-1 and miR-133a (Figure 5A).

As shown in Figure 6, when pri-mir-1-1 and pri-mir-1-2 transcripts were down-regulated, so was miR-1 mature form; when pri-mir-133a1 and pri-mir-133a2 transcripts were down-regulated, the same was true for miR-133a mature form.

Our findings demonstrate for the first time that it is possible to regulate at the same time the expression of three miRNAs, miR-1, miR-133a and miR-21, through targeting the components of SRF -mediated signaling pathway.

The up-regulation of miR-21, and the down-regulation of miR-1 and miR-133a were observed in SRF-Tg compared to wild-type (WT) mouse heart (P < 0.01**, n = 3).

Reducing cardiac SRF level using the antisense-SRF transgenic approach led to the expression of miR-1, miR-133a and miR-21 in the opposite direction to that of SRF overexpression.

Interestingly, the down-regulation of miR-21, but up-regulation of miR-1 and mir-133a were observed in Anti-SRF-Tg compared to wild-type mouse heart (p < 0.01**, n = 3).

When the mouse cardiac SRF level was reduced using the antisense-SRF transgenic approach, we observed an increase in expression of miR-1 and miR-133a miRNA, and a decrease in expression of miR-21.

The miR-1 was ranked number one in the level of expression among all the microRNAs detected, and it alone accounted for 7% of all the microRNA expression signals, and 9% of the 50 cardiac-enriched microRNA signals.

miR-1 ranks number 1 in expression, miR-133a ranks number 7 in expression.

The down-regulation of miR-1 correlates closely with that of miR-133a in SRF-Tg at various time points from 7 days to 6 months of age (p < 0.05, n = 3 for all time points, except n = 6 for miR-21 at 6 months).

Mir-1 and mir-133a are down-regulated in cardiac hypertrophy and cardiac failure, suggesting that they may play a role in the underlying pathogenesis [14, 43].

SRF is known to regulate mir-1, which regulates certain critical cardiac regulatory proteins that control the balance between differentiation and proliferation during cardiogenesis [4].

These findings suggest that SRF may regulate these two miRNAs at the level of polycistronic transcription, rather than at each individual miRNA (pri-mir-1 or pri-mir-133a) transcription, thereby keeping the expression of both miRNAs closely correlated.

Our data revealed that the down-regulation of miR-1 correlates closely with that of miR-133a in the SRF-Tg at various time points from 7 days to 6 months of age (Figure 7B).

The expression levels of miR-1, miR-133a and miR-21 were observed to be in the opposite direction with reduced cardiac SRF level in the Anti-SRF-Tg mouse.

The miR-1 is the most abundant miRNA that is expressed in the heart.

In addition, serum response factor (SRF), an important transcription factor, participates in the regulation of several cardiac enriched miRNAs, including mir-1 and mir-133a [4, 6].

Generally, the pri-miRNA transcript contains one miRNA (e. g pri-mir-21), but it can also contain more than one miRNAs (e. g. mir-1 and mir-133a).

Both miR-1 and miR-133a are produced from the same polycistronic transcripts, which are encoded by two separate genes in the mouse and the human genomes [42].

Our present study revealed that miR-1 accounted for 7% of all the 578 miRNAs detected by the microarray.

Both pri-mir-1-1 and pri-mir-1-2 are processed into mature miR-1, but pri-mir-1-1 transcript level is 6-fold higher than that of pri-mir-1-2 (n = 3, p < 0.05*).

For examples, the mature miR-1 is processed from pri-mir-1-1 and pri-mir-1-2 transcripts that are transcribed from two genes, mir-1-1 (on chromosome 2) and mir-1-2 (on chromosome 18), respectively.

It is plausible that increasing mir-1 and mir-133a level at a specific time point may have potentially beneficial effects against the pathological conditions.

7

It was reported that IPre up-regulated miR-1, miR-21 and miR-24, and the protein expression of HSP70 was up-regulated by pretreatment of these miRNAs.

It was found in our study that IPost up-regulated miR-1 and attenuated IR -induced INF together with dysregulating apoptosis-related gene, suggesting that IPost may protect the myocardium during IR by up -regulating miR-1, and then regulated apoptotic genes indirectly.

For example, miR-208 was up-regulated, while miR-1 and miR-133a were down-regulated in MI [14].

MiRNA-microarray and RT-PCR showed that myocardial-specific miR-1 and miR-133a were down-regulated by IR, and up-regulated by IPost compared with IR.

MiR-1 and miR-133a were down-regulated in IR group, while IPost up-regulated them as compared with IR group (n = 10, *P < 0.05, compared with Con group; [▲]P < 0.05, compared wit IR group).

IPost can up-regulate miR-1 and miR-133a, and decrease apoptosis of cardiomyocyte.

It was found that myocardial-specific miR-1 and miR-133a were down-regulated after IR.

We also found that miR-1 was up-regulated by IPost compared with IR, which is consistent with other reports of miR-1 regulated by IPre or heat-shock pretreatment [22, 29, 30].

Among these miRNAs, miR-1 was down-regulated by IR, which is consistent with other reports [14, 28].

Furthermore, not only IPre but also heat-shock pretreatment, which can protect the heart against IR injury, could up-regulate miR-1 [22, 30].

And up-regulation of miR-1 and miR-133a can decrease cardiomyocyte apoptosis.

MiR-1 promoted cell aopoptosis during IR, but miR-133a inhibited cell apoptosis during IR.

The results of flow cytometry and TUNEL assay showed that up-regulation of miR-1 and miR-133a decreased apoptosis of cardiomyocytes.

IPost up-regulated miR-1 and miR-133a compared with IR (P < 0.05, Figure 5).

The most significant findings are up-regulation of miR-1 and miR-133a in IPost compared with IR hearts.

MiR-1 is a myocardial-specific miRNA, which has been demonstrated to be associated with apoptosis-related genes such as heat shock protein (HSP), and indirectly regulate eNOs.

Among the miRNAs, miR-1 and miR-133 are specifically expressed in cardiac and skeletal muscles [14, 15].

Figure 5 Regulation of miR-1 and miR-133a by IPost.

In summary, our results confirm that myocardial-specific miR-1 and miR-133a play an important role in IPost protection against myocardial IR injury by regulating apoptosis-related genes.

So we think that miR-1 may protect cardiomyocytes against IR through regulating some apoptosis-related genes.

Dysregulated miR-1 and miR-133a were validated by quantitative real-time RT-PCR in duplicates using Rotor Gene 3000 (Corbett Research, Sydney, Australia).

MiRNA-1 and miRNA-133a regulate apoptosis of cardiomyocytes.

Myocardial-specific miR-1 and miR-133a may play an important role in IPost protection by regulating apoptosis-related genes.

The present study was undertaken to see whether miRNAs, especially myocardial-specific miR-1 and miR-133a, were involved in the protective effect of myocardial IPost by regulating apoptosis-related genes.

MiR-133a and miR-1 are clustered on the same chromosome loci and transcribed together in a tissue-specific manner [32].

MiR-1 and miR-133 produced opposing effects on apoptosis induced by H [2]O [2 ][15].

The sequences of miRNA mimics and AMOs are showed in Table 2. Table 2 The sequences of miRNA mimics and AMOs miR-1 mimic 5'-UGGAAUGUAAAGAAGUGUUAUACACACUUCUUUACAUUCCAUU-3' AMO-1 5'-AUACACACUUCUUUACAUUCCA-3' miR-133a mimic 5'-UUUGGUCCCCUUCAACCAGCUGGCUGGUUGAAGGGGACCAAAUU-3' AMO-133a 5'-CAGCUGGUUGAAGGGGACCAAA-3' were performed as previously described [22].

It was reported that the level of miR-1 was increased in response to oxidative stress [15].

Treatment with miR-1 or miR-133a mimic significantly decreased AP of cardiomyocytes induced by IR, while IR -induced apoptosis was increased by AMO-1 or AMO-133a pretreatment.

The annealing temperature of miRNA-1 and miRNA-133a was set at 60°C, and that of Bcl-2 and Bax was set at 58°C.

: rno-miR-1, NR 032116.1; rno-mir-133a, NR 031879.1) and AMOs (AMO-1 and AMO-133a) were synthesized by Jima Inc (Shanghai, China).

We transferred the mimic and AMO of miR-1 into the cardiomyocytes 48 h before IR, and found that miR-1 mimic attenuated cell apoptosis, and AMO-1 increased apoptosis, as shown by flow cytometry.

These results indicated that miR-1 and miR-133a had a cytoprotective effect against IR -induced apoptosis (P < 0.05, Figure 10).

The sequences of miRNA mimics and AMOs are showed in Table 2. Table 2 The sequences of miRNA mimics and AMOs miR-1 mimic 5'-UGGAAUGUAAAGAAGUGUUAUACACACUUCUUUACAUUCCAUU-3' AMO-1 5'-AUACACACUUCUUUACAUUCCA-3' miR-133a mimic 5'-UUUGGUCCCCUUCAACCAGCUGGCUGGUUGAAGGGGACCAAAUU-3' AMO-133a 5'-CAGCUGGUUGAAGGGGACCAAA-3' Mimic and AMO of miRNA pretreatment in vivo were performed as previously described [22].

To demonstrate the effect of miR-1 and miR-133a on IR -induced apoptosis of cardiomyocytes, miRNA's mimics and AMOs (50 nM) were transferred into the cardiomyocytes with lipofectamine 2000 (Invitrogen) 48 h before IR.

8

The seed mutation of Timp3 miR binding site 1 (pmiR-GLO-Timp3-S1-MUT), but not site 2 (pmiR-GLO-Timp3-S2-MUT), could rescue expression of the reporter gene luciferase, suggesting that site 2 is not involved in the regulation of this gene by miR-1. Limana et al. [26] previously reported that the site 2, but not site 1, was targeted by miR-206, which has identical 5′ seed to miR-1, whilst site 1 did not respond to miR-206 over expression.

Figure S5 Conservation of (A) Timp3 miR-1/206 targeting seed, (B) Rbm24 miR-125b-5p targeting seed, (C) Tgfbr2 miR-204 targeting seed, (D) Csnk2a2 miR-208b targeting seed.

It is noteworthy that miR-1, miR-133, miR-30, miR-208a, miR-208b, mir-499, miR-23a, miR-9 and miR-199a have previously been shown to be functionally involved in cardiovascular diseases such as heart failure and hypertrophy [40], [41], [42], [43], [44], and have been proposed as therapeutic- or disease-related drug targets [45], [46].

Interestingly, Timp3 has two predicted binding sites for the miR-1/206 family and despite miR-1 and miR-206 (an already known regulator of Timp3) having identical seed sequences, miR-206 specifically targets the second site [26], while miR-1 specifically targets the first site (Figure 6).

In particular, miR-1 and miR-133, which are abundant microRNAs in the heart, are implicated in cardiovascular development and myocardial lineage differentiation, as they tightly control expression of muscle genes and repress ”unwanted” gene transcription through a network of target transcription factors [36], [37], [38], [39].

We demonstrate that miR-1 can directly regulate Timp3 expression at the post-transcriptional level.

Expression profiles of miR-1/Timp3 and miR-125b-5p/Rbm24 were also anti-correlated with microRNA expression in the dog (Figure S2) and cynomolgus monkey (Figure S3).

A subset of microRNAs (miR-1, miR-125b-5p, miR-204 and miR-208b) was selected for further cross-species analysis and their expression level relative to heart apex is shown in Figure 4. MiR-1 was highly expressed in all rat, dog and cynomolgus monkey heart structures except valves.

Human Timp3 was down-regulated by miR-1 over expression in HeLa cells by Lim and colleagues [2], but the authors did not further investigate whether the effect was directly mediated by miR-1 at the post-transcriptional level.

In particular, several microRNAs that are preferentially expressed in different types of muscles (e. g. miR-1, miR-133, and the myomiRs miR-208, miR-208b and miR-499) play a pivotal role in maintenance of cardiac function [17], [18], and the ablation of microRNAs-RISC machinery can have dramatic effects on cardiac development [19], [20], [21].

We selected 4 genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2), respectively targeted by miR-1, miR-125b, miR-204 and miR-208b, for further analysis.

MiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR.

PLoS Genet 7. 39 Zhao Y, Ransom JF, Li A, Vedantham V, von Drehle M, et al (2007) Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1–2.

We have also identified novel microRNA -mediated post-transcriptional mRNA regulatory interactions with potentially important roles in cardiac/muscle physiopathology including miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2.

In summary, we have demonstrated that four genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2) important for cardiac/muscular physiology are post-transcriptionally regulated by miR-1, miR-125b-5p, miR-204 and miR-208b and exhibit conserved cardiac tissue miR-mRNA interactions across species.

0052442.g006 Figure 6 Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D).

Interestingly, we demonstrated that only one of two predicted miR-1 binding sites within Timp3 was active.

Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D).

Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in cardiac structures across species.

Furthermore, ventricular microRNAs (miR-1, miR-133, miR-208b and miR-499) have been found to be increased in the plasma of patients with myocardial infarction, and might represent a useful alternative to the classical cardiac troponin (cTnI) biomarker [57], [58], [59], [60], [61].

While signals for miR-1 and miR-125b-5p were strong, miR-204 was at the limit of detection, consistent with its relatively low abundance as determined by microRNA sequencing (Table S8).

The ISH signal for miR-1 was more intense in the myocardium than in the valves (Figure 5G, H and I), and staining for miR-204 and 125b-5p was more intense in the valves than in the rest of the heart (Figure 5A to F), ISH of the liver-enriched miR-122 was performed and used as a negative control (Figure 5J, K and L).

An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A).

Here we focused on the characterization of four microRNAs, including myocardial specific miR-1 and miR-208b and valve enriched mir-204 and miR-125b-5p, based on their distinct heart-structure-specific distribution patterns and known roles in cardiac physiology, disease and pathological remo deling.

Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization.

Staining for miR-1 was intense and uniform in the cardiomyocytes of the ventricle, while no signal could be detected in the cardiac valves (Figure 5G, H and I and Table S2).

Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey.

0052442.g007 Figure 7 (A–D) Real-Time RT-PCR of Timp3, Rbm24, Tgfbr2 and Csnk2a2 in HPASM cells transfected with mimics for miR-1, miR-125b-5p, miR-204, miR-499 and miR-208b or with a mimic microRNA negative control.

0052442.g005 Figure 5Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization.

Figure S6 Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in the cardiac structures in 1 human donor.

miR-1 in valves (G–H) and ventricle (I).

9

The high expression of MLCK in Caco-2 cells induced by IL-1β was significantly decreased by Sal B treatment, however, after cell transfection with miR-1 inhibitor, the inhibitory effect of Sal B on MLCK expression was significantly blocked (Figure 7C).

Thus, we concluded that Sal B targeted miR-1, induced downregulation of MLCK and finally resulted in restoration of defective tight junction barrier function in rat colitis mo del.

In this study, we found that Sal B targeted miR-1, induced downregulation of MLCK and finally resulted in restoration of defective tight junction barrier function in rat colitis mo del.

MicroRNA-1(miR-1) was shown to protect endothelial permeability through inhibition of myosin light chain kinase in cardiovascular disease (Hua et al., 2013).

These effects of Sal B on claudin-2, ZO-1 expression and TER changes were also significantly blocked by miR-1 inhibition.

MiR-1 expression in Caco-2 cells was significantly increased by Sal B incubation and this effect could be blocked by cell transfection with miR-1 inhibitor (Figure 7B).

Sal B treatment reversed the changes of expression of miR-1 and MLCK respectively, however, SASP did not alter miR-1 and MLCK expression in rat colitis mo del (Figure 6).

Figure 8Sal B -induced restoration effects was abolished by microRNA-1(miR-1) inhibition in vitro.

As shown in Figure 6, miR-1 expression was decreased in TNBS mo del group, while MLCK protein content was significantly increased.

And the expression levels of miR-1 and MLCK were also determined.

Our previous results showed that Sal B treatment affected the expression of miR-1 in vitro.

Figure 6 Salvianolic acid B (Sal B) reversed the altered microRNA-1(miR-1) and MLCK expression.

Luciferase activity was significantly decreased by Sal B treatment and this effect was significantly blocked by miR-1 inhibitor.

Figure 7 MicroRNA-1(miR-1) mediated Sal B -induced restoration effects by targeting of MLCK.

MiR-1 mediated sal B -induced restoration effects by targeting of MLCK.

SASP, sulfasalazine; Sal B(L), 20 mg/kg Sal B; Sal B(H), 80 mg/kg Sal B. To test our hypothesis that Sal B -induced restoration of barrier function is mediated by miR-1/MLCK pathway, we measured the effects of Sal B on miR-1 and MLCK expressions in colitis rat mo del.

Plasmid DNA (wt-Luc-MLCK, mut-Luc-MLCK, or control vector) and antago-miR-1 or the antago-miR negative control were co -transfected into Caco-2 cells.

Effects of Sal B on the expression of (A) miR-1 and (B) MLCK in rat colitis mo del was measured.

Therefore, miR-1 may alleviate IBD symptoms through restoring the impaired barrier function.

miR-1 or MLCK before Sal B treatment respectively.

In the present study, we determine whether Sal B could restore the impaired barrier function in rat colitis mo del through modulation of miR-1. Salvia miltiorrhiza, also known as Danshen, has been wi dely used for thousands of years in traditional Chinese medicine, with little reported toxicity (Kim et al., 2005).

The serious imbalance between the production of free radicals and antioxidant defense in colitis could be significantly reversed by Sal B. HE-staining results showed that the alterations in the TNBS control group, including epithelial necrosis, impaired mucosa involving submucosa with hyperemia and edema, and ulceration accompanied with numerous inflammatory cell infiltrations, were alleviated by gavage administration of Sal B. In conclusion, Sal B could restore barrier function, which was mediated by the activation of miR-1 and the subsequent MLCK inactivation.

MicroRNA-1 prevents high-fat diet -induced endothelial permeability in apoE knock-out mice.

To further elucidate the cellular effects of Sal B on MLCK, Caco-2 cells with antago-miR-1 were transfected in the presence or absence of Sal B, respectively.

SASP, sulfasalazine; Sal B(L), 20 mg/kg Sal B; Sal B(H), 80 mg/kg Sal B. Antago-miR-1 and luciferase reporter plasmids containing the miR-1-MLCK response element (wt-Luc-MLCK) or a mutant miR-1-MLCK response element (mut-Luc-MLCK) were co -transfected to Caco-2 cells in the presence or absence of Sal B, respectively.

Therefore, miR-1 may alleviate colitis symptoms through restoring the impaired barrier function.

10

Our study provides support to this finding and also demonstrates that, in an in vivo mo del of hepatocarcinogenesis, miR-1 expression is down-regulated in KRT-19 [+] nodules expressing high levels of NRF2-target genes [26].

F. qRT-PCR and WB analysis of G6PD expression in RH cells transfected with pre-miR-1. In agreement with recent findings proposing that NRF2 indirectly induces G6PD expression by down -regulating miR-1 [33], microarray analysis performed in microdissected preneoplastic KRT-19 [+] nodules showed an inverse correlation between miR-1 and its target gene, G6PD, (Supplementary Figure S8A).

Remarkably, the translational value of the present results can be inferred by the observation that, similar to rat pre- and neoplastic lesions, in human HCCs high G6PD expression is associated with miR-1 down-regulation and correlates with tumor grading, metastatic status and poor prognosis.

NRF2 regulates antioxidant genes, thus protecting cells from excessive ROS damage and, as recently shown, sustained activation of NRF2 signaling in cancer cells attenuated miR-1 expression, leading to enhanced expression of PPP genes [38].

Accordingly, in NRF2-silenced RH cells, we observed an increased expression of miR-1, paralleled by G6PD down-regulation (Figure 6B).

Having shown induction of G6PD and miR-1 down-regulation in both preneoplastic and neoplastic rat hepatocytes, we wished to determine whether these results could be of translational value for human HCC.

Our data also show that NRF2 silencing decreased G6PD expression and concomitantly increased miR-1, while transfection with miR-1 mimic abolished G6PD expression.

Since it was not possible to collect a significant number of human early dysplastic lesions and in consideration of the finding that miR-1 and G6PD expression were dysregulated all throughout the rat carcinogenic process, we determined miR-1 expression and G6PD mRNA levels in a cohort of 59 patients subjected to liver resection for HCC (study population characteristics are described in Supplementary Table S1A).

E. qRT-PCR analysis of miR-1 expression in KRT-19 [+] nodules.

Similarly to what observed in rats, qRT-PCR analysis showed a significant down-regulation of miR-1 levels (Supplementary Figure S8B) (P <0.05) in 78% of HCCs, when compared to matched non-cancerous liver cirrhotic (LC) tissues.

F. qRT-PCR and WB analysis of G6PD expression in RH cells transfected with pre-miR-1. A. Top.

NRF2 modulates G6PD and miR-1 expression.

Moreover, inhibition of miR-1 following induction of the transcription factor NRF2 and accumulation of glycolytic intermediates increase PPP activity [13, 14].

In agreement with the decreased miR-1 levels, we observed a concomitant increase of G6PD expression in the same human HCCs compared to LC (P <0.05) (Figure 7A).

Conversely, RH cells transfected with pre-miR-1 showed a significant decrease of G6PD mRNA and protein levels (Figure 6F).

RH cells were transiently transfected with 200 pmol of miR-1 mimic (Ambion, Austin, TX) or 200 pmol of siRNAs (control siRNA or NRF2 siRNA, Ambion) using Lipofectamine 2000 (Invitrogen, Paisley, UK).

B. qRT-PCR analysis of NRF2, G6PD and miR-1 RNA levels in RH cells upon NRF2 silencing.

miR-1 is involved in NRF2 induced activation of the PPP pathway.

11

miR-1 has been demonstrated to suppress HDAC4 expression in the skeletal myoblast[29], which may explain the increased expression of miR-1 with the lower HDAC4 protein level in the HH group compared with the NC group.

miR-1 promotes muscle differentiation by targeting histone deacetylase 4 (HDAC4), a transcriptional repressor of muscle gene expression, and PGC-1alpha (PGC-1α); it also controls the muscle cell phenotype via the regulation of insulin-like growth factor 1 (IGF-1); in contrast, miR-133 modulates muscle proliferation via the repression of serum response factor (SRF)[13, 14].

Analyses of the expression of miR-1, miR-133a and miR-133b were performed by qRT-PCR and normalized to the expression of 5S RNA in the same sample, as described in the Methods section.

We therefore analyzed muscle-specific miRNA expression, the expression of miR-1 (an miRNA associated with IGF-1, HDAC4 and PGC-1α in skeletal muscle) and miR-133a/b (SRF -dependent miRNAs).

It may explain the observation from our study that significantly increased miR-1 expression accompanied reduced p-AKT protein expression in the HH group.

The findings presented here demonstrate that the CIHH rats exhibited a significant reduced running capacity and prominent slow-to-fast muscle fiber shift, which was accompanied by significant increased in miR-1, miR-133 expression and significant reduced in PGC-1α, HDAC4, p-AKT and SRF expression.

HDAC4 is one of the main targets of miR-1 in the regulation of muscle differentiation[13, 29].

We also determined the expression of HDAC4 and PGC-1α, which are involved in the regulation of the another target pathway of miR-1[13]; the nuclear HDAC4 protein was assessed to measure the deacetylase activity of HDAC4, which controls its subcellular localization[24].

However, these changes was reversed by electrical stimulation,in HE group, miR-1 expression was reduced and p-AKT expression was increased compared with HH group.

3. Changes in miR-1-related protein expression.

Effects of electrical stimulation on the CIHH -induced expression of miR-1, miR-133a and miR-133b.

miR-1 has an important role in the mediation of the IGF-1 pathway, which comprises a negative feedback loop between miR-1 expression and the IGF-1 signal transduction cascade[14].

On the other hand, the miR-1 expression was extremely high in HH group.

IGF-1 is one target of miR-1; therefore, we analyzed the activity of the IGF-1 pathway by examining the p-AKT[14].

Electrical stimulation not only prevented the increase in miR-1(p<0.05) but also significantly decreased the miR-133a expression in HE group compared with the HH group (p<0.05).

However, the miR-1 expression in the HE group remained increased compared with the NC group (p<0.05).

The HE group exhibited downward trends in the miR-1 and miR-133a expression compared with the HH group; but, these changes were not significant.

At 2 weeks (Fig 2A), the relative miR-1 and miR-133a expression of the HH group were significantly increased compared with the NC group (p<0.05).

Four weeks of CIHH exposure (Fig 2B) significantly increased the relative miR-1 (p<0.05) and miR-133a (p<0.05) expression in the HH group compared with the NC group.

It is reasonable to speculate a priority that miR-1 and miR-133 may have roles in the response of CIHH-impaired muscle to changes during electrical stimulation via regulation of related signaling pathways.

miR-1 and miR-133 have distinct roles in the modulation of skeletal muscle proliferation and differentiation[13].

An excellent study demonstrated that the IGF-1, SRF and HDAC4 signaling pathways, which are related to miR-1, have roles in muscle dysfunction in COPD patients[5].

MyomiRs represent a suite of miRNAs that are highly enriched in cardiac and/or skeletal muscle which including miR-1, miR-133a, miR-133b and so on[12].

12

To reveal the specific regulation mechanism of WXKL in improving Cx43 expression and phosphorylation, we further detected the expression of miR-1, PKC, and related proteins.

miR-1 was also downregulated in patients with symptomatic heart failure and its expression decreased according to the severity of New York Heart Association (NYHA) class [43].

SRF, a cardiac enriched transcription factor, might regulate the expression of miR-1 directly [48].

Additionally, inhibiting miR-1 expression might induce cardiac hypertrophy and arrhythmia [40].

miR-1 was downregulated in autopsy samples of infarcted heart tissue from patients with MI [42].

miR-1 is involved in the occurrence of arrhythmia via the posttranscriptional regulation of connexin expression [41].

In the present study, we demonstrated that the relative expression of miR-1 decreased in the ischemic heart after 4 weeks of MI.

The results showed that WXKL increased the expressions of miR-1, PKC, phospho-p44/42 MAPK, phospho-ELK-1, and SRF significantly.

miR-1 targets GJA1, which encodes Cx43 [44].

The present study provided direct evidence that WXKL could protect the ultrastructure of gap junctions and their constituent Cx43 by regulating miR-1 and PKC mediated signal transduction, while also significantly increasing the VFT in a rat MI mo del.

The relative expression of miR-1 was normalized against that of the U6 endogenous control.

As indicated in present study, WXKL significantly increased the expression of miR-1, PKC, phospho-p44/42 MAPK, phospho-ELK-1, and SRF.

Relative Expression of miR-1. 3.5.

Quantitative real-time PCR was performed to examine the relative expression of miR-1 in left ventricular tissue among the five experimental groups.

When miR-1 was overexpressed in normal and infarcted rat hearts, conduction slowed and susceptibility to arrhythmia increased [41].

miR-1 is one of the most abundant miRNAs in the heart and has been reported to regulate cardiac electrical remo deling and structural remo deling, which are identified mechanisms underlying the generation of arrhythmia [38].

Compared with the mo del group, the relative expression of miR-1 increased in the high dose WXKL group (P = 0.005) (Figures 4 and S1 in available online at https://doi.

Compared with the control group, the relative expression of miR-1 decreased in the mo del, metoprolol, and low dose WXKL groups (P = 0.002, P = 0.032, and P = 0.046, resp.

Thus, the present study focused on gap junctions and miR-1, two of the arrhythmia generating conditions, in an attempt to provide additional evidence of WXKL utility to prevent and treat MI.

Detection of miR-1. 2.8.

The standard curve, the amplification plot, and the melt curve plot of miR-1. The authors gratefully acknowledge the financial support from the National Natural Science Foundation of China (nos.

These findings provide one possible mechanism by which WXKL protects Cx43 and that this protection is dependent on miR-1 and PKC mediated signal transduction.

Evidence supporting a role for miR-1 in arrhythmogenesis came from a mouse mo del lacking miR-1-2; these mice had a spectrum of abnormalities, including ventricular septal defects in a subset that suffered early lethality, and cardiac rhythm disturbances in those that survived [39].

miR-1 is absolutely required to maintain cardiac rhythms.

However, the effect of miR-1 on arrhythmogenesis is a matter of debate.

The expression levels of miR-1 were normalized to U6 and were calculated using the 2 [−ΔΔCt] method [20].

13

Fig. 2Expression of cardiacmRNA of the Serca-2a (a), mRNA of the NCX (b), miRNA-1 (c) and −214 (d) by real-time PCR reaction and expression of NCX (e) and Serca-2a protein expression (f) by western blot (blot above showed), in remote myocardium of the infarcted.

The microRNA-1, which targets sodium/calcium exchanger 1 (NCX), and microRNA-214, which targets sarcoplasmic reticulum calcium ATPase-2a (Serca2a), are involved in cardiac function regulation.

Different letters indicate statistically different groups (P < 0.05) Next, we looked to the expression of cardiac miRNA-1 and −214 expressions.

A study by Kumarswamy [35] validated NCX mRNA as a target to miRNA-1. Using gene therapy to restore miRNA-1 levels in a heart failure mo del, the authors showed that NCX expression was recovered to basal levels, while cardiac function was improved to a healthy condition.

Here, we also showed that MI decreased miRNA-1 expression, while ET prevented its decrease at least partially, suggesting its close association to cardiac NCX protein expression that was also normalized in the T-INF group.

These results suggest that exercise training restores microRNA-1 and −214 expression levels and prevents change in both NCX and Serca-2a protein and gene expressions.

MI induced a decrease in miRNA-1 expression and an increase in miRNA-214 expression.

Among the proteins related to Ca2+ handling, NCX is a validated target of miRNA-1, while Serca-2a is a predicted target of miRNA-214.

MiRNA-1 is one of the most abundant miRNAs in the heart and regulates several gene expressions [34].

However, ET after MI partially restored miRNA-1 and returned miRNA-214 expression to basal levels.

MicroRNA-1 and −214 expressions were, respectively, decreased (52 %) and increased (54 %) in the S-INF compared to the S-SHAM, while exercise training normalized the expression of these microRNAs.

In conclusion, we have demonstrated that MI is associated with altered expression of cardiac miRNA-1 and −214.

Different letters indicate statistically different groups (P < 0.05) NCX and SERCA-2a are two important molecules involved in Ca2+ handling and targets to miRNA-1 and −214.

ET protocol after MI restored both miRNA-1 (23 %) and miRNA-214 expression to basal levels (Fig.   2a and b).

Thus, the purpose of this study was to investigate the effects of ET post-MI on the expression of cardiac miRNA-1 and −214 and their target genes NCX and Serca-2a in the remote region myocardium (RM).

Furthermore, moderate ET restored miRNA-1 and −214 expressions in the RM post-MI.

Thus, the aim of this study was to evaluate the effect of exercise training on cardiac microRNA-1 and −214 expression after myocardial infarction.

However, it was unexpected the decrease of miRNA-1 in the T-SHAM group.

It can be observed in Fig.   2a and b that miRNA-1 decreased 52 % and miRNA-214 increased 54 % after MI.

14

MiR-1 targets both DnaJ-B1& Nucleolin; miR-23a target nucleolin & SMAD4 and miR-29a targets DnaJ-B1 & SMAD4 3′UTR.

Although LNA based-miRCURY microarray produced results reproducible in further analyzing differences in in vitro confirmation of the over -expression of let7a, miR1, miR-29a and miR-23a in SMSP samples, the approach taken here was focused on the identification of target protein genes for the respective microRNAs that affect the glucose transport pathways in SKM.

The miR-1 and miR-29a target DnaJ-B1 whereas nucleolin is targeted by miR-23 and miR-1 with a statistical significance (Fig. 12, I&II).

This target protein SMAD4, whose 3′UTR contains the binding sites for miR-29a, let7a and miR-1 that are over-expressed in the IPGR male sk.

The protein factors SMAD4, DnaJ-B1, and nucleolin, are possible targets of miR-29a, miR-23a and miR-1. Cellular fractionation of possible target proteins: Nuclear fraction.

I asked the question directly in an established rat cell-line whether miR-1, miR-23a or miR-29a play a role in regulating glucose transport activity (GTA) in vitro, delineating the possible functional correlation of these microRNA(s) over-expressed in SMSP muscle tissues.

MiR-29a significantly up-regulates GTA (p<0.01), whereas both miR-1 and miR-23 tend to increase the transport activity (for miR-1 p = 0.06 and 0.08; for miR-23a p = 0.08 and no difference; Fig. 9A, B) compare to the mock treatment.

Whereas, miR-1 and miR-23a transfections results in inconclusively because of the effect of microRNA on the pMIR-Reporter expression alone.

Distinctively, miR-1, let7a and miR-29a expressions were much higher in SMSP experimental samples (n = 6) than in control CMCP rat muscles.

According to the alignment scores and energy levels, let7a>miR-29a>miR-1 towards SMAD4 target sites (Fig. 8).

The 3′UTR of these mRNAs harbor the miRNA target sites (DnaJ1 contains miR-29a and Nucleolin (C23) contains miR-1 sites) and this data is supported by the transfections of Pre-miR(s) in L6 myoblast cells (Fig. 12).

Ncl mRNA have a miR-1 binding site (Alignment score 168.2 and energy for binding mRNA target sequence, −15.17; Fig. 8).

muscle [32], [65], [66] and found to be targeted by miR-1 and miR-23a in bioinformatics analysis.

Groups of tissue-specific (e. g., miR-1, miR-206, miR-208) and non-tissue-specific (e. g., miR-29a, miR-23a) microRNAs have been found to control skeletal muscle development in growth and differentiation [13]– [19].

The 3′UTR of SMAD4 harbor the recognition sites for miR-1, miR-29a and let-7a according to the bioinformatics analysis (Sloan-Kettering Institute micro -RNA site, http://www.

Denaturing Urea-Acrylamide gel electrophoresis of total RNA (10 µg) have been run and subjected to Northern Blot analysis using P [32] -labelled LNA -based microRNA probes (Exiqon) either as mixed samples of 6 SKM RNA (I) or separately for 6 samples for miR-1 (II).

Figure 3 shows the 22 cycles (mid log of exponential phase, data not shown) of end products in RT-PCR reactions for let7a, miR-23a, miR-23b, miR-1 along with GAPDH as an internal control.

In order to see the effective mature microRNA molecules, denaturing polyacrylamide gel electrophoresis was conducted followed by Northern Blotting using [32]P-labeled miR-23a, miR-129*, miR-1 and let7a specific LNA Probes.

The microRNA miR-1 did not show any effect in vitro by changing the GTA either in presence or absence of insulin.

Central co-SMAD, Mothers Against Decapentaplegic Homolog 4, bears putative binding sites for three different microRNAs miR-1, miR-29a and let7a (Fig. 8).

miR-1, miR-29a and miR-23a for SMAD4, DnaJ-B1 and nucleolin 3′UTRs.

This may suggest an unidentified mechanism becomes activated in order to generate the mature miR-1 molecules in the experimental starved adult rat male SKM.

Precursor microRNA mimics- Mimics of endogenous precursor micro -RNA synthetic molecule for rat, namely, Pre-miR-1, Pre-miR-23a, Pre-miR-23b and Pre-miR-29a were purchased from Ambion Inc.

0034596.g008 Figure 8 miR-1, miR-29a and miR-23a for SMAD4, DnaJ-B1 and nucleolin 3′UTRs.

DnaJ B1 and nucleolin 3′UTR recognizes miR-29a and miR-1 respectively with very strong affinities (Fig. 8) according to miRANDA alignment score and energy of stabilizations.

Surprisingly, in miR-1 Northern Blot, almost no detectable mature miR-1 was found in control CMCP compare to SMSP, whereas the level of precursor forms remained unaltered (Fig. 4, panel II).

15

The NCX1 protein, which is the direct target of microRNA-1, was downregulated in OZR compared with the other groups (LZR, LZR + TR, and OZR + TR); this data indicates a possible antagonism between NCX1 and microRNA-1 expressions [34].

These findings and the results concerning the upregulation of microRNA-1 can be associated with the downregulation of NCX1 in OZR which suggest that cardiac contractile dysfunction was prevented in OZR + TR improving these mechanisms, thus improving the cardiac function [4].

In addition, obesity upregulated microRNA-1, which targets NCX1.

Conversely, microRNA-1 levels were upregulated, and their target gene NCX1 was decreased in OZR, maybe causing diastolic dysfunction in these animals as we showed before [4].

These results show that NCX1 expression in obesity -induced pathological CR could be possibly reduced via increasing microRNA-1 expression by exercise training.

Interestingly, AET caused downregulation of microRNA-1 expression in OZR + TR compared with OZR, showing that it could be an important tool against the pathological phenotype caused by obesity.

In contrast, AET restored the pathological expression of microRNA-1 and microRNA-29c and their target genes, which likely counteracted the pathological cardiac remo deling and cardiac dysfunction in obesity.

In parallel with the microRNA-1 expression, NCX1 expression was significantly reduced in the OZR group compared with LZR, LZR + TR, and OZR + TR.

Interestingly, studies have shown the involvement of microRNAs in the regulation of calcium signaling pathways in the heart, indicating NCX1 as a target of microRNA-1 [26– 28].

Our study demonstrates for the first time that AET was efficient in restoring the microRNA-1 and microRNA-29c to nonpathological levels in obesity, as well as its targets NCX1 and collagen, respectively.

MicroRNA-1 targets the NCX1 protein and is an important regulator of calcium mechanisms in the heart [26].

The relative expression of COLIAI, COLIIIAI, ANF, α-MHC, α-actin skeletal, β-MHC, microRNA-1, microRNA-29a, microRNA-29b, and microRNA-29c was analyzed using real-time polymerase chain reactions (real-time PCR) as described previously [24].

In addition, AET reduced microRNA-1 expression in LZR + TR compared with the LZR and OZR groups (Figure 5(a)).

MicroRNA-1 targets the NCX1 gene that is one of the most important cellular mechanisms for Ca [2+] removal.

AET was also able to reduce the expression of microRNA-1 in LZR + TR compared with LZR, data that reinforces the profile observed in the previous AET studies [24].

Interestingly, AET was able to normalize microRNA-1 levels in the OZR + TR group.

MicroRNA-1 expression was increased in the OZR group compared with LZR, LZR + TR, and OZR + TR.

Thus, further studies are needed to assess whether modulation of the microRNA-1 and microRNA-29c in vivo in the obesity phenotype would play a key role in preventing pathologic cardiac remo deling.

16

The miRNA array data have been deposited in the Gene Expression Omnibus (accession number [GEO: GSE22181]) miRNA expression was quantified using real-time RT-PCR on the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems) to verify the upregulated miRNA targets detected by the miRNA array from the spinal segments (miR-384-3p, miR-325-5p, miR-342-5p, and miR-340-5p) and DRGs (miR-21) in the denervation and sham control groups, and the muscle-specific miRNAs (miR-1, miR-133a, and miR-206) in the soleus muscles of the sham control, entrapment, and decompression groups.

In contrast, 3 miRNAs (miR-499, miR-1, miR-133a, and miR-466b) were upregulated in the denervated muscle and 3 miRNAs (miR-329, miR-204, and miR-139-3p) were downregulated after 6 months.

We previously demonstrated that the expression of miR-1 and miR-133 in the soleus muscle of rats increased by ~2-fold at 4 months after sciatic nerve denervation and after reinnervation with microanastomosis [22]; however, the expression of miR-206 was significantly increased by 3-fold at 1 month later and lasted for at least 4 months after reinnervation, but not after denervation [22].

The decreased expression of miR-1 and miR-133a was suggested to compensate for the overload by removing the posttranscriptional repression of the necessary target genes [34].

In addition, muscle-specific miRNAs (miR-1, -133a, and -206) and selectively upregulated miRNAs were subsequently quantified using real-time reverse transcription-polymerase chain reaction (real-time RT-PCR).

After nerve entrapment using a silastic tube, we observed the downregulation of miR-1 and miR-133a in the soleus muscle at 3 months after its insertion that lasted until at least the 6-months time point (Figure 3).

In this study, there was an ~50% decrease in the expression levels of miR-1 and miR-133a at 3 and 6 months after entrapment as well as after 1 and 3 months of decompression.

Previously, in a rat mo del of sciatic nerve denervation, in the absence or presence of nerve microanastomosis [22], we demonstrated that the expression patterns of miR-1 and miR-133a were similar in the soleus muscle after denervation and reinnervation.

Regarding the muscle-specific miRNAs, real-time RT-PCR analysis revealed an ~50% decrease in miR-1 and miR-133a expression levels at 3 and 6 months after entrapment, whereas miR-1 and miR-133a levels were unchanged and were decreased after decompression at 1 and 3 months.

In contrast, the expression pattern of miR-206 was found to be independent from those of miR-1 and miR-133a.

Thus, it is not surprising to discover that the expression patterns of miR-1 and miR-133a were similar.

The expression patterns of miR-1 and miR-133a were similar after entrapment and decompression.

Real-time RT-PCR analysis revealed an ~50% decrease in the expression levels of miR-1 and miR-133a at 3 and 6 months after entrapment, whereas the levels of miR-1 and miR-133a were unchanged and then decreased after decompression for 1 and 3 months, respectively.

The expression of miR-1 and miR-133a increased in the muscle after 4 months of denervation and reinnervation.

After entrapment, the expression of miR-1 and miR-133 was significantly decreased to ~50% of those observed in the sham control group at 3 and 6 months after entrapment.

It has been reported that the expression of miR-1 and miR-133a decreased during skeletal muscle hypertrophy after 7 days of functional overload in rats.

After decompression, miR-1 and miR-133a levels were unchanged and sustained a significant decrease at 1 and 3 months later, respectively.

miR-1 and miR-133a are transcribed from a common pre-miRNA precursor in the miR-1/miR-133a locus that generates different primary transcripts [33].

Three muscle-specific miRNAs (miR-1, miR-133, and miR-206), with multiple key roles in the control of muscle growth and differentiation, have been the focus of intense research.

17

In summary, the data analysis supports the view that the down-regulation of four miRs (miR-133b, miR-143, miR-335-5p, miR-1) appears to orchestrate the development of chronic neuropathic pain in Sural-SNI while the up-regulation of seven miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1) appear to orchestrate the recovery from post-nerve injury induced pain in Tibial-SNI.

On the other hand, the translation of these ion channels would be predicted to decrease in the Tibial-SNI primary sensory neurons due to the increase in expression of all seven identified miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1).

In a bone cancer mo del, intrathetal injections of miR-1 -inhibitor or miR-34c-5p -inhibitor, respectively produce a mild or a strong decrease in mechanical hypersentitivity (Bali et al., 2013).

This analysis indicated that the translation of various ion channels, including some that have already been found to contribute to neuronal hyperexcitability and neuropathic pain (see), would be expected to increase in Sural-SNI primary sensory neurons due to the decreased expression of at least four miRs (miR-133b-3p, miR143, miR-335-5p, miR-1).

By using the rationale from our dual SNI variants we interpret that the decrease in expression of four miRs (miR-133b-3p, miR-145, miR-143, and miR-1) contributes to pain while the increase in expression of two miRs (miR-193b-3p and miR-191-5p) limits the level of pain that develops following a sciatic nerve crush.

Except for miR-1, the regulation in the contralateral DRG was comparable in the two SNI variants, and more closely resembles the expression pattern in the ipsilateral DRG of Tibial-SNI.

The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2.

Differential expression of microRNA-1 in dorsal root ganglion neurons.

Consistent with this view the overexpression of miR-1 in cardiac myocytes slows conduction and depolarizes these cells partly through post-transcriptional repression of GJA1 (which encodes for connexin-43) (Yang et al., 2007).

The decrease in miR-1 would accelerate protein translation compensating for the decrease in mRNA.

In both the microarrays (Figure 3A) and qPCR (Figures 3B,C) seven miRs (miR-133b, miR-145, miR-193b, miR-143, miR-335-5p, miR-191, miR-1) had a significantly higher level of expression in Tibial-SNI than in Sural-SNI.

However, except for miR-1, the regulation in the contralateral DRG was comparable in the two SNI variants.

Based on our findings we propose that the observed decrease of miR-1 in partial nerve ligation (Kusuda et al., 2011) and Sural-SNI (this study) might contribute to the development of chronic pain by enhancing excitability and by promoting aberrant sprouting of nerve branches.

In rats miR-1 differs in one nucleotide, and miR-193b is 3 nucleotides shorter (Supplement 2).

In contrast, the increase in miR-1 following axotomy (Kusuda et al., 2011) and Tibial-SNI (this study) could actually be a compensatory response to limit the level of neuronal hyperexcitability and the level of aberrant sprouting, at least during the first weeks following axotomy.

These apparent contradictory results could be explained by our observation that miR-1 is decreased.

These changes were comparable in the two SNI variants, only being significantly different for miR-1. Significant difference between Sural-SNI L vs.

Another miR that has been studied in reference to neuropathic pain is miR-1. In DRG, the level of miR-1 was increased following axotomy while it was decreased following partial sciatic nerve ligation (Kusuda et al., 2011).

The two exceptions, miR-1 and miR-193b are identical between mice and humans.

Enhancement of miR-1 reduces neurite outgrowth of cultured DRG sensory neurons (Bastian et al., 2011).

Ct values were <30.60 for miR-133b, <27.78 for miR-145, <27.66 for miR-193b, <30.19 for miR-143, <33.69 for miR-335, <23.42 for miR-191, <37.89 for miR-130a, <36.00 for miR-325, <32.04 for miR-1. Reference miRs were: MammU6-4395470 (Ct values < 19.30), snoRNA135-4380912 (Ct values < 33.98), and U87-4386735 (Ct values < 28.32).

18

In fact, the ovarian hormone estrogen has been shown to increase Let7f expression but suppresses miR1 [65], raising the possibility that in intact animals in this study, Let7f antagomir treatment may counteract estrogen -induced Let7f expression and complement estrogen suppression of miR1.

org) indicates that miR1 and the Let7 family are both functional antagonists of IGFs, and Let7 potentially targets multiple components of the IGF signaling pathway including IGF1 and 2, IGF1R, the IGF mRNA binding and translation regulatory proteins, IGF2BP1, 2 and 3 and the IRS2, a signaling intermediary that couples IGF receptors to intracellular signaling pathways.

Both in silico analyses using a variety of prediction algorithms, as well a large body of experimental literature [35]– [42] indicated that Let-7 and miR1 target multiple components of the IGF signaling cascade, ranging from mRNA binding proteins that coordinate the translation of IGFs to members of the IGF family, their receptors and downstream signaling pathways.

In the following experiments, we therefore compared the effects of suppressing miR1 and Let7f (as a prototype member of the Let7 family, conserved throughout vertebrate evolution, [43]), with the effects of suppressing miR124 on functional recovery from stroke.

Both anti-Let7f and anti-miR1 were neuroprotective when administered post stroke, but to differing extents, indicating that other clusters of target genes regulated by these miRNA may critically determine outcomes.

Expression of miR1 and Let7f is elevated in middle-aged (10–12 month) females as compared to adults females (5–7 month), while age does not affect the expression of miR124, a brain-specific miRNA not associated with IGF-1. *: p<0.05.

These analyses indicate that suppressing miR1 and Let7 is both predicted and demonstrated to promote IGF function in a variety of biological systems.

org; [34]) for vertebrate-conserved target sites for miR1 and Let7f binding in the 3′ UTR of the rat IGF1 gene.

We therefore hypothesized that the suppression of either Let7 or miR1 would recruit the activation of an evolutionarily conserved network of genes to mimic IGF neuroprotection.

We first identified by literature search and in silico analysis, two microRNAs, miR1 and the Let7 family as candidate regulators of IGF-1 signaling.

PCR analysis of adult and middle-aged cortical tissue indicated that expression of both miR1 and Let7f was elevated in middle-aged females (10–12 m old) where IGF-1 levels are reduced, as compared to adult females (5–7 m old) where IGF-1 levels are higher (Fig. 1B).

Moreover, anti-Let7f was overall more effective in inducing neuroprotection following stroke compared to anti-miR1 suggesting that the Let7 family is likely to constitute a stronger therapeutic target for interventional strategies following stroke.

0032662.g001 Figure 1 A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene.

Our data indicate that anti-Let7f (a prototypic vertebrate-conserved member of the Let7 family [43] or anti-miR1, administered four hours following a stroke episode, is indeed neuroprotective to mature female rats.

Four hours after ET-1 injection, animals received an intracerebroventricular (ICV) injection of either scrambled oligonucleotides, anti-miR1, anti-Let7f, or anti-miR124 oligonucleotides (LNA -modified, Exiqon, Vedbaek, Denmark).

Here we report that antagomirs to two miRNAs, miR1 and Let7f, with consensus binding sites in the 3′ UTRs of multiple IGF signaling pathway components confer neuroprotection, while antagomir to a brain-specific miRNA not associated with IGF signaling, was not neuroprotective.

Our two presumptive IGF pathway interacting miRNAs, Let-7 and miR1 as well as our control, miR124, represent three members of a small family of five miRNAs that have been conserved throughout bilaterian evolution (from invertebrates to mammals) [47], and the functions of the Let7 family, in particular, exhibit strong evolutionary conservation [43].

Furthermore, both Let7f and miR1 were elevated in middle-aged animals, where IGF-1 levels are low.

Like miR1, IGF1's neuroprotection is limited to the cortex.

Four hours post-stroke, animals were administered intracerebroventricular (ICV) injections (ICV; coordinates −1.0 mm anterior posterior, +1.4 mm medial lateral, −3.5 mm relative to the dural surface [75] of either scrambled miR (control), anti-Let 7f, anti-miR1 or an unrelated, anti-miR124 antisense LNA-oligonucleotide sequences, (termed “antagomirs”, Exiqon, Vedbaek, Denmark).

The present study provides novel in vivo evidence for a therapeutic role for antagonists to Let7f and miR1 following cerebral ischemia.

Striatal infarct volume was not significantly altered by miR1 antagomir treatment.

A. Schematic depiction of the 3′UTR of the IGF-1 gene: miR1 and Let7 have preferentially conserved, 7–8 mer and 8 mer binding sites respectively on the 3′UTR region of IGF-1 gene.

Interestingly, while anti-miR1 reduced infarct volume in the cortex, anti-Let7f reduced infarct volume in both cortex and striatum.

19

Next, the normalized Negr1 expression on the side with AAV‐miR1 or AAV‐mir2 was expressed as percentage of expression of Negr1 on the side with AAV‐miRLuc.

To determine whether altered expression of Negr1 affects energy balance, AAV‐NEGR1 and AAV‐miR1 were infused bilaterally into the ARC/VMH of rats to increase or decrease Negr1 expression, respectively.

Both pAAV‐miR1 (one sample t‐test, t = −151.062, P < 0.001) and pAAV‐miR2 (one sample t‐test, t = −21.578, P < 0.001) successfully decreased Negr1 expression in vitro (Fig. 1A).

Both AAV‐miRs did show effective knockdown in vitro, but only AAV‐miR1 achieved significant knockdown in vivo.

Infusion of AAV‐miR1 (one sample t‐test, t ≤ 3.289, P ≤ 0.030), but not AAV‐miR2 (t ≥ 2.521, P ≥ 0.086) led to a significant decrease in ARC/VMH expression (Fig. 1B).

To determine knockdown efficiency of AAV‐miR1 and AAV‐miR2 different primer sets were used, because care was take to span the target sites of the different miRs (for AAV‐miR1: FW: TCTCCCCATCAGCAAAACCA, RV: CGCAAAGTTCACGACCACTC and for AAV‐miR2: FW: GTGACACAGGAGCACTTCGG, RV: GTGCTTGGAGGGTTGAGGGG).

As AAV‐miR2 did not induce sufficient knockdown of Negr1 to influence the regulation of energy balance further discussion will be limited to the results of AAV‐miR1.

com/rnaiexpress/) from Invitrogen (miR1: GTGCAGAGAACGATGTATCAT; miR2: GAGCACTTCGGCAACTATACT; miR‐luc: AAAGCAATTGTTCAGGAACC).

These animals were used to determine the in vivo knockdown efficiency of AAV‐miR1 and AAV‐miR2 (as described below).

AAV‐miR2 did reach borderline significance for knockdown in vivo and showed comparable percentages of knockdown when compared to AAV‐miR1.

To examine in vivo knockdown efficiency, rats were bilaterally injected in the ARC/VMH with AAV‐miR1 or AAV‐miR2 on one side and AAV‐CTRL on the other side.

Knockdown efficiency of pAAV‐miR1 and pAAV‐miR2.

Depicted are the mean (±SEM) body weight (C) and weekly chow intake (D) of AAV‐miR1, AAV‐miR2 and AAV‐CTRL animals under exposure to food restriction (RFS).

Effect of AAV‐miR1 and AAV‐miR2 infusions in the ARC/VMH on body weight and food intake under exposure to restricted feeding, refeeding, and high‐energy diets.

*A significant difference between pAAV‐CTRL and pAAV‐miR1 or pAAV‐miR2 (P ≤ 0.05).

To generate the pAAV‐ESYN‐miR1‐EGFP (pAAV‐miR1), pAAV‐ESYN‐miR2‐EGFP (pAAV‐miR2), and pAAV‐ESYN‐miRLuc‐EGFP (pAAV‐miRLuc), pENTR‐L1‐ESYN‐L4 and pENTR‐L3‐oPRE‐L2 were recombined with pAAV‐R1‐R2 and with either pENTR‐R4‐miR1‐EGFP‐R3, pENTR‐R4‐miR2‐EGFP‐R3, or pENTR‐R4‐miRluc‐EGFP‐R3.

*A significant difference between AAV‐miR1 and AAV‐CTRL (P ≤ 0.05).

Depicted are the mean (±SEM) body weight (E) and weekly chow intake (F) of AAV‐miR1, AAV‐miR2, and AAV‐CTRL animals under exposure to the refeeding diet (REF).

Effect of AAV‐miR1 and AAV‐NEGR1 infusion in the ARC/VMH on body weight, food intake, locomotor activity, and body temperature under CHOW exposure.

Depicted are the mean (±SEM) body weight (A) and daily chow intake (B) of AAV‐miR1, AAV‐miR2, and AAV‐CTRL animals under chow exposure (CHOW).

AAV treatment showed an interaction with light/dark phase (f = 32.583, P < 0.001) and subsequent analyses showed that both AAV‐miR1 and AAV‐NEGR1 animals were less active than AAV‐CTRL animals during the dark phase (one way ANOVA, f = 103.416, P < 0.001, LSD post hoc, P ≤ 0.001), but that only AAV‐NEGR1 animals showed decreased activity during the light phase (LSD post hoc, P < 0.001) (Fig. 3C).

Both cotransfection of pAAV‐miR1 or pAAV‐miR2 with the NEGR‐renilla fusion plasmid led to significant knockdown, when compared to cotransfection with pAAV‐miRLuc.

Depicted are the mean (±SEM) body weight (A) and weekly chow intake (B) in the weeks after surgery of AAV‐miR1, AAV‐NEGR1, and AAV‐CTRL animals.

As with locomotor activity, AAV treatment showed an interaction with light/dark phase (f = 46.504, P < 0.001) and subsequent analyses indicated that both AAV‐miR1 and AAV‐NEGR1 animals showed decreased body temperature during the dark phase (ANOVA, f = 231.000, P < 0.001, LSD post hoc P < 0.001), but that AAV‐miR1, AAV‐NEGR1, and AAV‐CTRL animals showed comparable body temperatures during the light phase (Fig. 3D).

*A significant difference between AAV‐CTRL and AAV‐miR1 or AAV‐miR2 (P ≤ 0.05).

AAV‐miR1 animals showed increased body weight (LSD post hoc, P = 0.043) and increased food intake (LSD post hoc, P = 0.001), while AAV‐NEGR1 animals did not significantly differ from AAV‐CTRL in body weight (LSD post hoc, P = 0.311) or food intake (LSD post hoc, P = 0.698) (Fig. 3A and B).

*A significant difference between AAV‐CTRL and AAV‐miR1 animals (P ≤ 0.05).

*A significant difference between AAV‐CTRL and AAV‐miR1 or AAV‐NEGR1 animals (P ≤ 0.05).

In experiment 1, rats (n = 24) were injected with AAV‐miR1, AAV‐NEGR1, AAV‐GFP, or AAV‐miRLuc; in experiment 2, rats (n = 24) were bilaterally injected with 1.0 μL of 1.0 × 10 [9] genomic copies/ μL of either AAV‐miR1, AAV‐miR2, or AAV‐miRLuc; and in experiment 3, rats (n = 8) were unilaterally injected with AAV‐miRLuc and received contralateral infusions of either AAV‐miR1 or AAV‐miR2 in the ARC/VMH.

Figure 3. Effect of AAV‐miR1 and AAV‐NEGR1 infusion in the ARC/VMH on body weight, food intake, locomotor activity, and body temperature during CHOW exposure.

20

From the epigenetic point of view, the expression of the KCN- potassium channels macromolecular complex is targeted and down-regulated by abnormal expression of miR-1, caused by hyperglycemia stimulation [13].

MiR-1 expression levels were significantly up-regulated in H9c2 cells grown in high glucose medium (P < 0.01) and dose -dependently down-regulated by BF-5m pretreatment (Figure 7A).

Moreover, the expression levels of mir-1, that has been proved to suppress KCNQ1 and KCNE1 because up-regulated by hyperglycemia [15], was also evaluated.

In conclusion, these results suggest that the new aldose reductase inhibitor benzofuroxane derivative BF-5m may supply cardioprotection from the high glucose induced instability of QT interval components by reducing the cytotoxic effects induced by hyperglycemia on cell viability, by down -regulating miR-1 expression and consequently restoring plasma membrane KCNE1 and KCNQ1 levels in rat heart ventricle H9c2 cells exposed to high glucose.

H9c2 cultured in glucose 33 mM (High glu) and pretreated with BF-5m 0.01–0.025–0.05 µM showed a significant down-regulation of miR-1 expression levels compared to High glu.

BF-5m pretreatment increases KCNE1 and KCNQ1 protein levels in H9c2 exposed to high glucose through a down regulation of mir-1 expression.

Effectively, in the present study immunocytochemistry and western blot analysis showed that H9c2 cells exposed to high glucose have low levels of KCNQ1/KCNE1 and high levels of miR-1. BF-5m dose -dependently increased plasmatic KCNE1 and KCNQ1 levels, significantly reduced by high glucose medium, paralleled by a significant down-regulation of miR-1 levels.

Figure 7(A) qRT-PCR assay of miR-1 expression levels expressed as arbitrary units (A. U. ) in H9c2 cultured in normal medium (Normal glu) or high glucose medium (High glu) and exposed to DMSO 0.05 µM and BF-5m 0.01–0.025–0.05 µM.

H9c2 grown in high glucose medium showed an up-regulation of miR-1 levels compared to normal glu.

RNA extraction and mir-1 expression.

This latter evidence being a further novelty of this study since no one have previously linked ALR2 to miR-1 or KCN- potassium channels.

21

Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs.

These two miRNA genes – miR-1 and miR-133 – exist as a cluster and thus are always expressed together in mouse [42].

In agreement with this observation, miR-1 is the most abundantly expressed miRNA in the heart but not in the liver or thymus (Figure 3), two other tissues used for miRNA library generation.

Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns.

The expression patterns of miR-1 and miR-133 largely overlapped in many tissues examined in this study (Figure 2).

Thus, the high abundance of miR-1 as indicated by the number of sequence reads is associated with its high expression in the heart.

Our small RNA blot analysis indicated that miR-1 was highly expressed in the heart but moderately in the stomach, testes, bladder and spleen (Figure 2).

For instance, the miR-1 family has the highest frequency (411 times) in our sequences (Table 2) and the highest level of expression in the heart, but was barely detected in thymus and liver (Figure 2).

Like miR-1, miR-133 is a muscle-specific miRNA (Figure 2) because of its abundant expression in many other muscular tissues such as heart and skeletal muscle [45, 46].

miR-1 is one of the highly conserved miRNAs and found to be abundantly and specifically expressed in the heart and other muscular tissues [41, 42].

Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression.

For instance, miR-133 is represented only by 4 clones (two reads each for 133a and 133b) in our sequences, which indicates a 100-fold lower expression level compared with that of miR-1 family, if cloning frequency taken as a measure of expression.

The miR-1 family is represented by three members (miR-1a, miR-1b and miR-1c) in diverse animals (miRBase).

miR-1 was barely detected in the liver, with only trace amounts in the thymus (Figure 2).

Therefore the total miR-1 count in our sequences could be derived largely from heart tissue.

Our sequence analysis in this study indicated that miR-1 family (miR-1a, miR-1b and miR-1c) has the highest abundance (411 sequence reads).

The discrepancies between the cloning frequency and small RNA blot results for miRNA-1 and miR-133 could not be attributed to the RNA source because the same RNA samples were used for both experiments (cloning and small RNA blot analysis).

The high level of miR-1 in the pig heart is in agreement with previous reports [43, 44].

However, our small RNA blot analysis indicated a different picture as miR-133 was detected as abundantly as miR-1 in the heart (Figure 2).

We cannot ascertain whether the miR-1 family is also represented by three members in pig because of the lack of complete genome information, but is possible because we found miR-1a, miR-1b and miR-1c homologs in our library (Table 2).

We also used approximately a similar amount (activity) of [32]P -labelled probe for detection of miR-1 and miR-133.

22

In the mo del group, 17 miRNAs were downregulated, including miR-1, miR-133, miR-29, miR-126, miR-212, miR-499, miR-322, miR-378, and miR-30 family members, whereas the other 18 miRNAs were upregulated, including miR-21, miR-195, miR-155, miR-320, miR-125, miR-199, miR-214, miR-324, and miR-140 family members.

Among these differentially expressed miRNAs, miR-1, miR-133, miR-29, miR-126, miR-499, miR-30, miR-21, miR-195, miR-155, miR-199, miR-214, and miR-140 have been reported to be related to MI [25– 36], while the other miRNAs have not been reported directly in MI.

MiR-1 and miR-133 have been regarded as key factors involved in cardiac development and cardiovascular disease.

It has been reported that Cx43 is a miR-1 and miR-133 target [48, 49], but Cx45 has not been reported yet.

The relative expressions of miR-1 and miR-133 were validated by quantitative real-time PCR, and the possible effects of WXKL were observed at the same time.

Relative Expressions of miR-1 and miR-133.

And WXKL increased the expressions of miR-1 and miR-133 significantly.

The results showed that the expressions of miR-1 and miR-133 were consistent with the microarray data.

As shown in Figure 6, the 14 pathways were predicted to be related to the 3 differentially expressed miR-1 and miR-133 family members.

Further pathway analysis indicated that gap junction pathway was the predicted closely correlation pathway to be targeted by miR-1 and miR-133.

As shown in Figure 5, the relative expression of miR-1 decreased in the mo del group compared with the control group (P < 0.01).

Regulatory effects on miR-1, miR-133, Cx43, and Cx45 might be a possible pharmacological mechanism of WXKL in the treatment of MI at the gene level.

Compared with the mo del group, the relative expressions of miR-1 and miR-133 increased in the WXKL and the captopril groups (P < 0.01 and P < 0.05, resp.

Complex changes of miRNAs and related pathways, including miR-1, miR-133, and gap junction pathway, are involved in the pathogenesis of MI.

The present study is interested in miR-1 and miR-133, two muscle-enriched miRNAs, and they were chosen for further validation by the quantitative real-time PCR, and the possible effects of WXKL were observed at the same time.

MiR-1 and miR-133 are muscle-enriched miRNAs, and they are abundant in the heart.

23

[23] A previous study also suggested that attenuation of miR-1/miR-133 transcription leads to the up-regulation of their direct downstream target cyclin D1,[24] and the abundance of cyclin D1 and expression of miR-17 were inversely correlated.

Yu and colleagues revealed that phosphorylated Akt, a downstream target of the phosphatidylinositol-3-kinase (PI3K)/Akt signalling pathway, is up-regulated by decreased miR-1. [21] Similarly, Huang and colleagues found that miR-133 represses the insulin-like growth factor 1 receptor, which is upstream of PI3K/Akt signalling at the post-transcriptional level, and negatively regulates the PI3K/Akt signalling pathway.

All miRNAs except miR-17 repress Akt activation, and miR-1 and miR-133 indirectly suppress cyclin D1 expression.

miR-1, miR-17, and miR-133 suppress cyclin D expression.

A previous study has shown that, of the various miRNAs, the down-regulation of miR-1, miR-133, and miR-17 causes activation of Akt and cyclin D1.

Collectively, we conclude that APC and IPC are related to miR-1, miR-17, miR-133, and miR-205, which suppress the Akt–GSK–cyclin D1 pathway.

Four miRNAs (miR-1, miR-17, miR-133, and miR-205) related to the Akt–GSK–cyclin D1 pathway were significantly down regulated by both APC and IPC treatment (p < 0.05, Table 2).

24

It is known that miR-1 promotes myogenesis by targeting histone deacetylase 4 (HDAC4), a transcriptional repressor of muscle gene expression, while miR-206 promotes muscle differentiation as well as improves skeletal muscle hypertrophy and regeneration by repressing the expression of connexin 43 (Cx43), follistatin-like 1 (Fstl1) and utrophin (Utrn) [41]– [45].

To understand if the presence of PRP was potentially able to modulate the expression of miRNAs, we analyzed the expression of miR1, miR206 and miR-133a during the early stages of skeletal muscle regeneration.

Since myoblast proliferation following myotrauma is orchestrated by multiple factors including growth factors, transcription factors, and miRNAs relating to myogenesis in vivo, in this study we analyzed at 2- and 5-day post-injury the multi-directionally effects of PRP on the expression of several cytokines (TNFα, IL-6, IL-10, IL-1β, and TGF-1β), myogenic response factors (MRFs) (MyoD1, Myf5, Pax7, Myogenin, and Mrf4), GFs (VEGF-A and IGF-1Eb), as well as myo-miRNAs (miR-1, miR-133a, and miR-206), stress-response proteins (Hsp70, Hsp27 and αB-crystallin) and apoptotic markers (NF-κB-p65, Bcl-2, Bax, and caspase 3).

In agreement with those data, our results showed that the level of miR-1, miR-206 and miR-133a decreased at day 2 after muscle injury in all experimental groups, returning to pre-injury levels at day 5, with the exception of miR133a, which still remained down-regulated in the presence of PRP.

At day 2 after injury, the expression level of miR-1, miR-133a and miR-206 was significantly decreased, more than 0.5-fold with respect to the pre-injured level (p<0.05), independently from the presence or not of PRP (Figure 4A).

Real time-PCR analysis of miR-1, miR-133a and miR-206 expression using total RNA isolated from Ctrl-, PRP- and NO-PRP- group at 2 (A) and 5 (B) day post-injury.

At day 5, the expression level of each miRNA in the NO-PRP group was increased, returning to approximately the same level as that of pre-injury (p>0.05), whereas in the PRP group only the miR-1 and miR-206 levels were back to the Ctrl group magnitude (p>0.05).

Of these, the most wi dely studied are members of miR1, miR206 and miR-133 families [39], [40].

Quantitative analysis of miR-1, 133 and 206 was performed by RNA retro-transcription and subsequent TaqMan real-time PCR, using a 7500 Real-Time PCR System as recommended by the supplier (Applied Biosystems, Life Technologies).

25

In addition, given the recent findings that altered microRNA (miR) expression profiles are involved in cardiovascular disease including ischemic heart disease,[20– 23] and that studies have shown the implication of dysregulation of miR-1, -15a-5p, -15b, -21, -24, -92a, 133a, -133b, -210, -214, -320, and -499 in the development of cardiopathology including arrhythmia, cardiac remo deling, angiogenesis, and regulation of cardiomyocyte survival [24– 26].

Up-regulation of miR-1, -15b, -92a, -133a, and -133b have been shown to be involved in the regulations of multitude of genes in the heart, contributing to the development of arrhythmia, hypertrophy, fibrosis, and suppression of angiogenesis, and cell death and survival [41– 48].

Both miR-1 and miR-15b target Bcl-2 down-regulation [47, 48] and thus, increase the cardiomyocyte susceptibility to apoptosis in the setting of ischemia and reperfusion injury.

In addition, miR-1, miR-15 and miR-21 can directly influence the survival of cardiomyocytes.

Thus, the finding that chronic losartan treatment significantly increased miR-1 and, particularly miR-15b of 9-fold, as well as decreased miR-21 by 50% in the left ventricle, suggests a novel mechanism of miRs in angiotensin receptor-modulated vulnerability of the heart in response to acute onset of ischemic injury.

26

0065809.g007 Figure 7 A: Ten most frequently detected isomiR sequences of miR-1 (rat mature miRNA highlighted in yellow) with expression values in brackets aligned to the published pre-miR sequence (boxed in green; miRBase v18).

Our discovery of the second gene is therefore critical for miR-1 expression studies in the rat.

Expression of miRNAs relative to rno-miR-1 according to 2 [−ΔCt] where ΔCt = Ct – Ct [miR-1] (mean ± SEM).

0065809.g006 Figure 6Expression of miRNAs relative to rno-miR-1 according to 2 [−ΔCt] where ΔCt = Ct – Ct [miR-1] (mean ± SEM).

A: Ten most frequently detected isomiR sequences of miR-1 (rat mature miRNA highlighted in yellow) with expression values in brackets aligned to the published pre-miR sequence (boxed in green; miRBase v18).

The existence of two rat miR-1 genes has implications for understanding how this important miRNA is regulated.

It was surprising that miR-1 was only the 28 [th] most abundant miRNA in the sequencing data (Fig. 2) because it is generally considered to be one of the most highly expressed in the heart [84].

Of the Top 20 miRNAs detected in each mouse study 6 were detected in all 3 (mmu-miR-1, 126, 378, 26a, 125b & 133a).

The G to A substitution gives a sequence equivalent to hsa-miR-1 (and mmu-miR-1) which has not been reported before in rat (Fig. 7B).

The importance of miR-1 in the heart is by now well recognised [132].

Manipulation of miR-1 expression in the rat heart may be a useful strategy for further investigating the physiological role of miR-1. However, such studies could have been confounded by the unknown existence of a second miR-1 gene.

A Novel Rat miR-1 Analog.

Novel rno-miR-1 sequence as detected by deep sequencing.

The possibility that miR-1 is under-represented in our libraries is supported by the RT-qPCR data shown in Fig. 6 which suggests that, based on relative Ct values, miR-1 is more abundant than miR-22 and miR-486 which are the two most common miRNAs in the deep sequencing data (Fig. 2).

B: miR-1 sequences as published in miRBase v18 showing the novel rat miR-1 sequence aligned with the previously reported rat miR-1 and the human sequence (with which it is identical).

27

rno-miR-675-5p 4.143757751 Premature senescence of cardiac progenitor cells, G1 arrest, reduced cell proliferation, colony formation, migration and invasion rno-miR-183-3p 3.74730108 Regulates claudin-1 expression rno-miR-299a-5p 3.626723224 Anti-apoptotic role rno-miR-200c-3p 3.593610443 Targets the VEGF-VEGFR2 pathway and angiogenesis rno-miR-665 3.511737089 Negatively targets anti-apoptotic BCL2L1 rno-miR-291a-5p 3.457928187 VSMC migration rno-miR-490-5p 2.373358 Tumour suppressor rno-miR-1 2.505729 Suppresses cell growth rno-miR-133b 2.192279 Inhibits cell proliferation and invasion rno-miR-30c-1-3p 2.70761 Suppresses PXR expression rno-miR-294 2.010496 Promotes proliferation and differentiation rno-miR-127-5p 2.780488 A regulator of MMP-13 and suppresses cell growth rno-miR-503 2.327383 Inhibits cell proliferation and invasion Table 2 Twenty down-regulated miRNAs.

28

Lu et al. confirmed that the administration of propranolol could reverse the expression of miR-1 in ischemic rat heart and inhibition of miR-1 could provide ischemic cardioprotection [30].

The result demonstrated that miR-1 stressed upon regulation of myocyte growth, yet miR-29b and miR-98 put their regulatory emphases upon fibrosis and inflammation, respectively.

C. Quantification of miR-1 expression.

Further finding revealed that miR-1 focused on regulation of myocyte growth, yet miR-29b and miR-98 stressed on fibrosis and inflammation, respectively.

A-C. Largest functional modules regulated by miR-1, miR-29b and miR-98, respectively.

They were miR-1 emphasizing on cell growth regulation, miR-29b stressing on fibrosis and miR-98 focusing on inflammation.

The modules regulated by miR-1, miR-29b and miR-98 contained more proteins encoded by ischemia related genes (Figure 3).

There are increasing lines of evidences to suggest that miR-1 might be a vital regulator of MI [28], [29].

Relative level of miR-1 normalized to control; *** p<0.0001 vs.

They were miR-1, miR-21, miR-195 and miR-200c.

Taken together, these studies provide functional links between miR-1 and MI, which is consistent with its higher static score in our network analysis.

Our network analysis identified that, among these miRNAs, the prime players in MI were miR-1, miR-29b and miR-98.

29

The most highly expressed miR was miR-1; its expression was ~4-fold greater than that of miR-206, the next most highly expressed miR (Table 1).

Among the myomiRs, miR-206 was significantly downregulated after SCI whereas no change in expression was observed for miR-1 or miR-133b (Fig 2B).

A similar pattern of dysregulation of miR-1, 133a, 133b and 206 has been reported in inflammatory myopathies and in a cell culture system in which TNF-α reduced expression of these myomiRs [20].

By far the most abundant miR was miR-1. If one takes an abundance of 10% of that for miR-1 as a cut-off for being highly expressed, only miR-206 and miR 29c would be included.

Comparison of the qPCR and Nanostrings data revealed agreement for miR-1, miR-126, and miR-17, which were unchanged after SCI by both methods (Fig 2, Tables 1 and S1).

Using a cutoff of 1% of the abundance of that of miR-1, a total of 22 miRs would be present at concentrations above the cutoff; these miRs include miRs 23a, and 145.

After 11 days and 19 hours in space, rat gastrocnemius muscle revealed reductions in miR-206 and trends toward decreases in miR-1 [14].

The canonical myomirRs are miR-1, miR-133a/b, and miR-206.

30

Our results demonstrated that GS-Rb1 suppressed the expression of mir-1 and mir-29a in the mo del group, which might be the microRNA targets of GS-Rb1 to protect cardiomyocytes from H/I injuries.

Overexpression of mir-1 could exacerbate cardiac injury; on the contrary, knockdown of mir-1 significantly attenuated cardiac ischemia/reperfusion injury [26].

MicroRNAs have been proved to be potential biomarkers for ischemic heart disease, such as mir-1, mir-133, mir-208, and mir-499 [4– 6].

The expression level of mir-1, mir-29a, and mir-208 was increased in the H/I group (5.9-, 3.4-, and 9.3-fold versus control, relatively), while that of mir-21 and mir-320 was significantly decreased (0.35- and 0.41-fold versus control, relatively).

Compared with that of the control group, expressions of mir-1, mir-29a, and mir-208 obviously increased in the experimental mo del groups.

Tanshinone IIA, a lipid-soluble pharmacologically active compound extracted from the rhizome of traditional Chinese herb Salvia miltiorrhiza, has been reported to improve hypoxic cardiac myocytes and postinfarction rat cardiomyocytes by regulating mir-133 and mir-1 and MAPK pathways [21, 22].

Specifically, mir-1 is skeletal and cardiac muscle specific microRNA necessary for postmitotic muscle proliferation and differentiation [23].

Many researchers have proved that mir-1 plays an important part during cardiac apoptosis [24, 25].

31

In terms of expression patterns within each individual ZT06 group, the 24-hour acute group had a tandem cluster that was differentially expressed, with downregulation of the tumour suppressor miRNAs, miR-1 and miR-133a (Tables 1 and 2).

The miR-1/133a cluster has been shown to be downregulated in a variety of cancers, whereas miRNA-133a has also been shown to act as a tumour suppressor in breast cancer cells by causing S/G [2] phase cell-cycle arrest through activity on phosphorylated Akt [28, 29].

This indicates that CD -induced down regulation of the miR-1/133a cluster may have oncogenic effects through previously identified mechanisms, as well as through potential circadian relevant targets.

In the 24-hour acute ZT06 group, two miRNAs that are part of the same cluster, miR-133a and miR-1, were both underexpressed (Table 2).

32

More interestingly, the downregulation of the BCL-2-inhibiting microRNAs miR-1, miR-138, and miR-148b is broadly consistent with the increase in the number of BCL-2 -positive cells present 3 days after injury ([76]; however, see [77]), although microRNA downregulation extends throughout the 7-day period after injury, which is typically a time when the number of BCL-2 -positive cells is progressively reduced.

Similarly, HSP70 has been shown to demonstrate a strong increase in expression peaking at 7 days after injury [69], which directly matches the reduced expression of its regulator miR-1 [72].

On the contrary, other microRNAs identified by these authors, such as miR-152, miR-214, miR-206, and miR-221, either did not show significant expression changes or showed opposite behaviors in our analyses (such as the downregulation of miR-1).

Interestingly, in network 2, we detected signaling components involved in extracellular matrix organization, such as PLAU (miR-331) and CHSY1 (miR-1*, miR-330).

33

By comparing the venous plasma microRNA expression profiles from patients with Takotsubo cardiomyopathy or acute myocardial infarction, miR-16 and miR-26a were found to be highly expressed in Takotsubo cardiomyopathy patients, while miR-1 and miR-133a were highly expressed in acute myocardial infarction patients.

Five differentially expressed microRNAs were randomly selected for validation, including three arterial highly expressed microRNAs (rno-miR-139-3p, rno-miR-423-5p, rno-miR-125b-5p) and two venous highly expressed microRNAs (rno-miR-1-3p, rno-miR-340-3p).

MiR-1 and miR-206 contributed the association with this term and related diseases like distal myopathies (P-value = 4.77e-3), musculoskeletal abnormalities (P-value = 1.34e-3) and rhabdomyosarcoma (P-value = 4.35e-3).

And circulating miR-1 was demonstrated as a biomarker for cardiovascular diseases [17].

For example, miR-1 was a microRNA enriched in muscle and heart.

For example, seven microRNAs, including miR-1, miR-200c, miR-340, miR-342, miR-325, miR-139 and miR-500 contributed to the association with heart failure (P-value = 2.74e-3).

34

As depicted in Fig 8, miR-1, miR-29a, miR-106b and miR-200a was selectively inhibited by H [2]0 [2] treated Pitx2 -overexpressing cells but up-regulated in H [2]0 [2] treated Pitx2 silenced cells at both time points (12h and 24h).

qPCR of left atrial chambers demonstrated that miR-1, miR-26b, miR-29a, miR-30e, miR-106b, miR-133 and miR-200 are up-regulated in HTD rats as compared to controls (Fig 1), demonstrating a similar microRNA expression profile as in atrial-specific Pitx2 deficient mice [14, 16].

Whereas it is wi dely documented that redox signaling can compromise ion channel functioning and calcium homeostasis in cardiomyocytes [67], in our system we observed no influence of H [2]O [2] administration on the regulatory impact of Pitx2 in distinct ion channels such as Scn5a, Kcnj2 and Cacna1c as well as multiple Pitx2-regulated microRNAs such as miR-1, miR-26, miR-29 and miR-200, in which redox impairment impact is less documented [68].

0188473.g008 Fig 8Analyses of Scn5a, Kcnj2 and Cacna1c (A), miR-1, miR-29a, miR-106b and miR-200b (B) expression in Pitx2 gain and loss-of-function experiments after H [2]0 [2] administration for 12h and 24h, respectively.

Several lines of evidence have already reported the key regulatory role of miR-1 [60– 62], miR-26 [63], miR-106b [64], miR-133 [65– 66] and miR-200 [64] in arrhythmogenesis.

35

Further, miR-1 enhances cardiomyoblast apoptosis by targeting the expression of Hsp60 and Hsp70, while miR-133 targets and represses caspase-9 expression to decrease cardiomyoblast apoptosis [33].

The expression of these four miRNAs (miR-125b, miR-30d, miR-34a and miR-1) did not change during UPR, with exception of miR-125b whose expression was increased after Tg treatment (Figure 3).

The muscle specific miR-1 and −206 are closely related in terms of expression and function.

The four miRNAs (miR-125b, miR-30d, miR-34a and miR-1) were included as control miRNAs whose expression did not show significant change during conditions of UPR.

Both miR-1 and miR-206 are shown to promote myoblast-to-myotube differentiation [30, 32].

36

Three miRNAs profiles were found with (A) rno-miR-133b-3p, rno-miR-378a-3p, and rno-miR-434-3p equally expressed in both muscle types, (B) rno-miR-1-3p and rno-miR-133a-3p with higher expression in EDL and (C) rno-miR-206-3p, mmu-miR-208b-3p, and rno-miR-499-5p with higher expression in SOL.

First, miRNAs such as miR-1-3p and -133a-3p expression was higher in the fast EDL than slow soleus.

MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy.

In healthy organisms, our group demonstrated that exercise -induced muscle damage (EIMD) in human, as well as toxic muscle injury in rats, induced an early elevation of a subset of muscle specific (miR-1, -133a, 133b, -206, -208b, -499) and non-muscle specific miRNAs (miR-378a, -434) (Banzet et al., 2013; Siracusa et al., 2016).

Three miRNAs profiles were found with (A) rno-miR-1-3p and rno-miR-133a-3p rising in response to both SOL and EDL muscle damage, (B) rno-miR-133b-3p, rno-miR-378a-3p, and rno-miR-434-3p with higher levels following EDL muscle damage and (C) rno-miR-206-3p with higher levels following SOL muscle damage.

The other damage-responsive myomiRs, miR-1-3p, -133a-3p and -206-3p, were robustly detectable in the plasma following traumatic muscle damage.

This is further supported by the study of Muroya et al. (2013), where the sequencing read count of bta-miR-1, -133a and -206 are among the most frequently detected miRNAs in bovine skeletal muscles (mean read count of both semitendinous and masseter muscles ranging from ∼1260528 for bta-miR-1 to ∼80481 for bta-miR-206), while bta-miR-208b was detectable but with lower read count (∼1687) (Muroya et al., 2013).

MyomiRs (namely miR-1, -133a, -133b, -206, -208a, -208b, -486, -499) are a class of muscle and/or cardiac specific miRNAs.

37

rno-miR-3559-3p was significantly up-regulated at P3 and rno-miR-1-3p was significantly down-regulated at P14 in intrauterine infection group compared to control.

qRT-PCR analyses of the fetal and neonatal rat lung tissue samples showed that rno-miR-3559-3p was significantly up-regulated at P3 in intrauterine infection group compared to control, and rno-miR-1-3p was significantly down-regulated at P14 in intrauterine infection group compared to control (Fig. 19).

Number for conjoint (and non-conjoint) differentially expressed miRNAs are also indicated To validate the differential expression of the miRNAs identified by array profiling, the 10 neonatal rat lung tissue samples in intrauterine infection group (every 5 samples at P3, P14 respectively) and 10 normal controls were analyzed by qRT-PCR for rno-miR-3559-3p and rno-miR-1-3p which were selected randomly from the results of miRNA microarray analysis.

Fig. 19 The mRNA quantitation for rno-miR-3559-3p and rno-miR-1-3p.

38

Shan, et al [19] reported that expression of miR-1/miR-206 was up-regulated in a rat mo del of myocardial infarction.

Therefore, it is possible that miR-1 or miR-206 or both are up-regulated during I/R, and this result in the tight regulation of ZFP580 mRNA.

Based on a bioinformatic analysis, we found that the 3′ untranslated region of ZFP580 mRNA may be regulated by miR-1 and miR-206.

39

MIR-1, a microRNA which is expressed in human neuroblastoma cells [54], targets CREB1 and regulates cell growth [55], and differentiation of embryonic stem cells [56].

Interesting MIR-1 was also shown to inhibit apoptosis via modulating PTEN/Akt signalling, a canonical pathway we identified as LTP-regulated at 24 h post-LTP induction.

Within 24 h-Network 1 (Figure 9A; all interactions; Score = 41), the microRNA MIR-1 and MIR-124 form central hubs, with the majority of the genes in this network downregulated.

40

miRNAs such as miR-1 [40, 41] and miR-214 [42], display anti-hypertrophic or cardioprotective effects by directly targeting 3′-UTR of Ncx1.

Ncx1 has been validated as a target of miR-1 [40] and miR-214 [42].

For example, it has been reported that Igf1r is a target of miR-1 [55], miR-139 [56], miR-378 [57], miR-99a [58], and miR-497 [59].

For example, it has been reported that miR-221 [15], miR-199a/b [16][17], miR-27b [18], miR-195 [11] and miR-34a/b/c [19] positively regulate cardiac hypertrophy, while miR-378 [9], miR-29 [20], miR-150 [11], miR-223 [21] and miR-1 [22] negatively regulate cardiac hypertrophy.

41

MiR-499 and miR-21 were downregulated in LPS -induced cells in a dose- and time -dependent manner, while there was no significant change to miR-1, miR-133, and miR-208 expression.

In the myocardium of rats with acute myocardial infarction, the expression of some miRNAs was altered, including cardiac-abundant miRNAs such as miR-1, miR-133, miR-208, and miR-499 [15– 17].

Cardiac-abundant miRNAs such as miR-1, miR-133, miR-208, and miR-499 regulate diverse aspects of cardiac function, including cardiomyocyte proliferation, differentiation, contractility, and stress responsiveness.

Several reports demonstrated that transient transfection of miR-1 and miR-499 reduced proliferation and enhanced differentiation into cardiomyocytes in human cardiac progenitor cells and embryonic stem cells [6].

42

One homologous to mir-1, tsp-miR-1, was observed to express in three developmental stages of T. spiralis and may have similar functions.

The following forward primers were designed to confirm the sequencing results of miRNAs that showed differential expression patterns: tsp-miR-100 5′-AAC CCG TAG ATC CGA ACT TGT GT-3′; tsp-let-7 5′-TGA GGT AGT AGG TTG TAT AGT T-3′; tsp-miR-228 5′-AAT GGC ACT GGA TGA ATT CAC GG-3′; tsp-miR-1 5′-TGG AAT GTA AAG AAG TAT GTA G-3′; tsp-miR-31 5′-AGG CAA GAT GTT GGC ATA GCT GA-3′; tsp-novel-108 5′-CTT GGC ACT GTA AGA ATT CAC AGA-3′; tsp-novel-83 5′-TTG AGC AAT TTT GAT CGT AGC-3′; tsp-novel-46 5′-TGG ACG GCG AAT TAG TGG AAG-3′; tsp-novel-86 5′-TGA GAT CAC CGT GAA AGC CTT T-3′; tsp-novel-21 5′-TCA CCG GGT AAT AAT TCA CAG C-3′.

The mature miRNA of tsp-mir-1 and the complementary miR* are represented in red and blue respectively.

For instance, tsp-miR-1-3p was detected at 1,515 TPM (transcripts per million) in the Ad stage, 9,759 in the NBL stage and 3,351 in the ML stage, respectively, whereas its counterpart tsp-miR-1-5p was much less abundant (Fig. 4, Table S5).

Sequences and the number of sequencing reads matching the tsp-mir-1 hairpin were listed.

Figure 4Sequence and predicted secondary stem-loop structure of tsp-mir-1 identified in T. spiralis.

Five conserved miRNAs (tsp-miR-228, tsp-miR-100, tsp-let-7, tsp-miR-1 and tsp-miR-31) and five novel miRNAs (tsp-novel-108, tsp-novel-83, tsp-novel-46, tsp-novel-86 and tsp-novel-21) with relatively higher TPM values identified by sequencing were validated by qRT-PCR and Northern blot.

Sequence and predicted secondary stem-loop structure of tsp-mir-1 identified in T. spiralis.

43

On day 7, miR-31, miR-214, miR-199a-5p, and miR-199a-3p were up-regulated, whereas miR-181c, miR-29b, miR-26b, miR-181d, mir-126, mir-499-5p, and miR-1 were down-regulated.

Some of the deregulated miRNAs (miR-181, miR-26, miR-1, mir-29, miR-214, miR-126, and miR-499) are reported to be related to hypoxia, cell development, and cell growth [1, 5, 7, 25].

Recently, some miRNAs for example miR-21, miR-1, miR-216[10], and miR-29 family[11], were reported to be deregulated in myocardial infarction.

44

Four myocardial-enriched miRNAs, miR-1, miR-133, miR-499 and miR-208, were confirmed to be highly expressed in ovine heart tissue.

For the first time we report that not only are the four cardiac-enriched miR-1, miR-133, miR-499 and miR-208 highly expressed in sheep LV, but also provide information on their isomiRs.

MiR-1, miR-133, miR-499 and miR-208 are highly enriched myocardial miRNAs 27, 28 and are highly conserved across multiple species including human [29], mouse [30] rat [31] and porcine [32].

MiRNA-1, -133a, -208a/b and -499 are reported as cardiac-specific or cardiac-enriched miRNAs in many species including the mouse, rat and human [20].

Similarly, two miRNA-1 encoded loci are found in the sheep.

Cardiac-enriched miR-1-3p, miR-133a-3p, miR-133b-3p, miR-208b-3p and miR-499-3p were screened.

Human miRNA-1 has two isoforms, miR-1-1 and miR-1-2, which are encoded by two different genomic loci [33].

45

Expression of several hypertrophy -associated genes, such as calmodulin and myocyte enhancer factor 2a, sarco/endoplasmic reticulum calcium -dependent ATPase 2a and insulin growth factor 1, were negatively regulated by microRNA-1 [16, 17, 18].

Ikeda S. He A. Kong S. W. Lu J. Bejar R. Bodyak N. Lee K. -H. Ma Q. Kang P. M. Golub T. R. MicroRNA-1 negatively regulates expression of the hypertrophy -associated calmodulin and MEF2A genes Mol.

Kumarswamy R. Lyon A. R. Volkmann I. Mills A. M. Bretthauer J. Pahuja A. Geers-Knoerr C. Kraft T. Hajjar R. J. Macleod K. T. SERCA2A gene therapy restores microRNA-1 expression in heart failure via an Akt/FOXO3A -dependent pathway Eur.

Studies have shown that microRNAs are involved in many kinds of pathophysiologic process and both microRNA-133a and microRNA-1 are involved in cardiac hypertrophy and fibrosis [15].

46

To selectively disrupt rabbit Nox5 expression, we designed 4 miRNAs that specifically recognize rabbit Nox5 mRNA and identified one sequence, miRNA-1 that was most effective at reducing the expression of rabbit Nox5 and attendant superoxide production.

We found all 4 miRNAs decreased superoxide production as well as the protein expression of rabbit Nox5 with miRNA-1 exhibiting the best efficiency (Figure 3C).

We then tested the dose effect relationship of miRNA-1, and found that it could dose -dependently decrease rabbit Nox5 protein expression (Figure 3D).

47

We also measured miR-1 expression in the tissue with the same treatments and found no difference in miR-1 expression among the groups, indicating that the observed changes of let-7e expression were specifically elicited by the lentivirus vector carrying the pre-let-7e or AMO-let-7e (Fig. 4A).

MiR-1 overexpression contributed to slow conduction, membrane depolarization [22], atrio ventricular block [23] and afterdepolarizations [24]; while miR-1 inhibition was involved in atrial fibrillation (AF) [25].

Levels of let-7a/c/d/e/i, miR-1 and β [1]-AR mRNA were determined using SYBR Green I incorporation methods on ABI 7500 fast Real Time PCR system (Applied Biosystems), with U6 as an internal control of miRNA or GAPDH as an internal control of β [1]-AR mRNA.

48

For example, rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p are most highly expressed in both HF and control group in our study, which was consistent with the previous studies that rno-miR-133, rno-miR-1 and rno-miR-499 are highly expressed in the heart[26], and miR-1, let-7 and miR-133 are highly expressed in the murine heart[27].

The most highly expressed miRNAs were rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p in both HF and control group.

49

Though miR-133 and miR-1 are bicistronic and reported to be jointly regulated during pathological hypertrophy, the expression of miR-1 was downregulated while miR-133 was upregulated in our case (Figs. 2, 4).

50

Similarly, other miRNAs (e. g., miR-1, -29a/b/c, -210 and -133a/b) were also predicted to target several down-regulated genes encompassing Ets1, Hoxa2, Igf2, Tp53, Foxa2, Gata2, Cbx1 and Mtf2.

Among them, only 28 miRNAs changed in the same direction during postnatal development in both types of arteries, one miRNA changed in the opposite direction (miR-1).

51

Bish et al. [14] reported that strong cardiac shPLB expression in canines altered the expression of several miRs and induced toxic side effects such as transiently increased serum levels of troponin I. To investigate whether scAAV6-shPLBr and scAAV6-amiR155-PLBr treatment might affect the expression levels of selected cardiac miRs that had been analyzed in the in vivo study of Bish et al. [14], the levels of miR-1, miR-21, miR-124, miR-195 and miR-199a were determined in CM at day 14 after transduction with 25×10 [3] vg/c of scAAV6-shPLBr, scAAV6-amiR155-PLBr, scAAV6-shCon or scAAV6-amiR155-Con.

To analyse the expression of miR-1, miR-21, miR-124, miR-195, and miR-199a, 10 ng of total RNA, isolated from CM, were reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Life Technologies, Applied Biosystems Inc.

Expression levels were determined by real-time PCR using the TaqMan MicroRNA Assays rno-miR1, hsa-miR21, hsa-miR124, hsa-miR195 and hsa-miR199a (Life Technologies, Applied Biosystems Inc.

52

Both mir-1 and mir-145, whose expression is downregulated in prostate cancer, have been implicated as pro-differentiation factors by silencing the stem cell self-renewal and pluripotency program or inhibiting epithelial-mesenchymal transition (EMT), respectively [61], [62].

For example, many target genes of miRNAs let-7, mir-1, and mir-145 were hypermethylated in cells cultured under AR-inducing conditions for 3 days compared to 1 day (Table S6), suggesting a promoting role of these microRNAs in secretory differentiation of prostatic epithelial cells.

53

Recent studies demonstrated the increase of miR-1 in coronary artery diseases (CAD) and miR-1 is downregulated by beta-blocker propranolol in rat mo del of myocardial infarction [29].

Aging (Albany NY) 29 Lu Y Zhang Y Shan H Pan Z Li X 2009 MicroRNA-1 downregulation by propranolol in a rat mo del of myocardial infarction: a new mechanism for ischaemic cardioprotection.

54

Recent data have shown numerous miRNA dysregulations during MI, for example, MiR-210 and miR-1 were proven to improve cardiac function following MI by enhancing angiogenesis and inhibiting cardiomyocyte apoptosis [10, 11]; MiR-150 was shown to be downregulated in patients with acute myocardial infarction (AMI), atrial fibrillation, dilated cardiomyopathy and ischemic cardiomyopathy [12– 14]; and overexpression of microRNA-99a attenuates heart remo deling and improves cardiac performance following myocardial infarction [15].

55

The family of ‘myomiRs’ (miR-1, -133a, -133b, and -208) is known to be expressed in both cardiac and muscle tissues [39, 40], and was enriched in the myocardium of rats, dogs, and monkeys [41].

Serum was also analyzed by Q-RT-PCR for a panel of 20 tissue enriched and potential miRNA biomarkers, including those identified for liver (cfa-miR-122 and -885), heart/muscle (cfa-miR-1, -133, and -206), testis (miR-34b/c), pancreas (cfa-miR-216), brain (cfa-miR-212), and ubiquitously expressed cfa-miR-193b.

A single HTE miRNA was identified in the dog heart (cfa-miR-499) and in skeletal muscle (cfa-miR-206), and both tissues had the same 5 TE miRNAs (cfa-miR-1, -133a-5p, -133a-3p, -133b, and -208) (Fig.   3).

A total of 22 miRNAs (Additional file 6: Figure S5) were selected for qPCR validation including the following 14 biomarker candidates of organ toxicity: liver (cfa-miR-122 and -885), pancreas (cfa-miR-216a/b); heart (cfa-miR-499); muscle (cfa-miR-206); heart/muscle (cfa-miR-1, -133a/b, and -208); testis (cfa-miR-34b/c); and brain and sciatic nervous tissues (cfa-miR-212, -432, and -885), and 5 miRNAs reported in the literature (cfa-miR-21, -192, -193a/b, and -200).

The transient serum elevations of heart/muscle TE miRNAs (cfa-miR-1 and -133) and muscle HTE miRNA (cfa-miR-206) were not correlated with microscopic findings (data not shown) and may be due to injury during animal handling.

56

When looking at the expression of microRNA-1 we found no effect of pulmonary stenosis per se, but there was a significant reduction with exercise (Figure 5A).

Figure 5 Exercise training decreases microRNA-1 (A) and normalizes microRNA-21 (B) myocardial expression in PAS animals (SHAM, n = 4; SS, n = 6; TS, n = 6).

However, microRNA-1 was reduced only in trained animals, showing that the physiological exercise stimulus persists even with pathological PAS insult.

Myocardial MicroRNA-1 and -21 levels are regulated by exercise.

These findings are surprising because it was presumed that the microRNA-1 levels could be reduced with PAS, as previously reported in rodents subjected to aortic binding (Wang et al., 2009).

57

miR-1 promotes myogenesis by targeting histone deacetylase 4 (HDAC4), while miR-133 promotes myoblast proliferation by inhibiting serum response factor (SRF) [57].

Two well-known miRNAs, miR-1 and miR-133, have highly specific expression in cardiac and skeletal muscle tissue [55].

58

To our knowledge, we are the first to identify a canonical Hypoxia Response Element (HRE) at the miR-1/133a bicistronic promoter and its function in the regulation of the promoter activity in response to hypoxia.

We cloned the rat miR-1/133a bicistronic promoter (2043 base pair) from rat genomic DNA and identified a canonical hypoxia response element (HRE) with a bipartite HAS and a unique HBS motif and a classical TATAAA box [34] located at −37 bp upstream the transcription initiation site (Figure 6).

Figure 7(A) The schematic representation of rat miR1/133a bicistronic promoter region proximal to the transcription start site (+1) shows the presence of two HIF-1a binding sites: HAS and HBS.

MiR-1 and miR-133a are coded by a bicistronic promoter [29].

Sequences of rat miR1/133a gene bicistronic promoter.

Analysis of rat miR-1/133a bicistronic promoter.

This bicistronic promoter drives the transcription of two heart specific microRNAs, namely miR-1 and miR-133a.

59

The expression of miR-101, miR-30b, miR-30c, miR-30d and miR-27b was detected (Figure 1D) but miR-1 and miR-30e expression was not (data not shown).

Six miRNAs (miR-1, miR-101, miR-30b, miR-30c, miR-30d, and miR-30e) were selected to potentially target Sox9 (Figure 1A).

60

Picking out 7 miRNAs associated with heart failure and taking statistical analysis, we found that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p, rno-miR-146a-5p, and rno-miR-1-3p (Figure 5(b)).

Picking out 7 miRNAs associated with heart failure and taking statistical analysis, our data reveal that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p,rno-miR-146a-5p, and rno-miR-1-3p.

61

For example, miR-1 enhances cardiomyocyte apoptosis by regulating the target genes Hsp60 and Hsp70, whereas miR-133 targets and represses caspase-9 expression to decrease cardiomyocyte apoptosis [35].

62

Comparison of miRNA expression profiles among tissues revealed that very few miRNAs expression was tissue specific (e. g., miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle).

Our comparison of miRNA expression across 11 tissues from bovine revealed a few tissue specific miRNAs: miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle, which had been previously reported in mouse and human [13, 27].

63

For example, previous published studies showed that inhibition of miR-1 [29], miR-23a [30], or miR-133 [31] expression accelerated cardiaomyocyte hypertrophy, while other studies demonstrated that myocardial hypertrophy was regulated by miR-22 and miR-30a in vivo and in vitro [32], [33].

64

Xu C Lu Y Pan Z The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytesJ Cell Sci.

Bostjancic E Zidar N Stajer D MicroRNAs miR-1, miR-133a, miR-133b and miR-208 are dysregulated in human myocardial infarctionCardiology.

Chen JF Man del EM Thomson JM The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiationNat Genet.

65

For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9].

66

The role of miRNAs in IPostC was further demonstrated in a study by He et al. [11], which showed the upregulation of miR-1 and miR-133 by IPostC during reperfusion in a rat mo del.

Additionally, IPostC -mediated regulation of miR-1 and miR-21 have been found to attenuate apoptosis in patients undergoing valvular heart surgery [12].

67

Taniguchi K PTBP1 -associated microRNA-1 and -133b suppress the Warburg effect in colorectal tumorsOncotarget.

68

Notably, cardiac-specific miR-1, miR-133, miR-208 and miR-499 were all suppressed by two or more orders of magnitude [34], [35], as were the stemness and cell cycle repressors miR-141 and miR-137 [36]; in contrast, the proliferative miRNAs, miR-222 [37], increased dramatically in MDCs, and miR-221 was undetectable in myocytes but highly expressed in MDCs (Figure 5D).

69

Many miRNAs are expressed in a tissue-specific manner, such as cardiac and skeletal-specific miRNAs (miR-1, miR-133, miR-206), which have been shown to regulate muscle development and function 34 35.

70

For instance, TPPP/p25 is a potential target for several miRNAs, including miR-1. Thus, an increase in one miRNA such as miR-206 may not be sufficient to significantly repress the expression of this protein.

71

As an example, miR-1 expressed in skeletal muscle and heart and miR-206 expressed specifically in skeletal muscle differ by only 3 bases.

72

Sun Y. Ge Y. Drnevich J. Zhao Y. Band M. Chen J. Mammalian target of rapamycin regulates miRNA-1 and follistatin in skeletal myogenesis J. Cell Biol.

73

More importantly, our previous study revealed that miR-1 was a negative regulator of connexin 43 and Kir2.1 expression in rats with MI [18].

74

They also showed the up-regulation of miR-1, miR-449a and a 60-fold induction of miR-135b.

75

Kuwabara Y. Ono K. Horie T. Nishi H. Nagao K. Kinoshita M. Watanabe S. Baba O. Kojima Y. Shizuta S. Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damage Circ.

Shan H. Li X. Pan Z. Zhang L. Cai B. Zhang Y. Xu C. Chu W. Qiao G. Li B. Tanshinone IIA protects against sudden cardiac death induced by lethal arrhythmias via repression of microRNA-1 Br.

76

Recent studies have identified that many miRs [11], such as miR-1, miR-21, miR-29, miR-31, miR-143/145, and miR-221/222, play important roles in neointimal hyperplasia by regulating the functions of VSMCs.

A number of miRs, such as, miR-1, miR-21, miR-29, miR-31, miR-143/145 and miR-221/222, were verified to be involved in neointimal hyperplasia by regulating the functions of VSMCs [11].

77

MiR-1 and miR-133 were down-regulated in exercised trained rats and cardiac-specific Akt transgenic mice 11, 12.

78

Moreover, miR-1, involved in the regulation of brain development and neuronal function, is induced in neuro-2a cells after oxygen/glucose deprivation (OGD; Chang et al., 2016).

Roles of microRNA-1 in hypoxia -induced apoptotic insults to neuronal cells.

79

Moreover, KCNQ1 and KCNQ5 are down-regulated by other miRs, namely, miR1/133 and miR190, respectively.

80

Probes, and negative controls showing no lens expression of muscle-specific miR-1, are described elsewhere [39].

In a previous study, we demonstrated miR-124 is produced in rat and mouse lenses along with other brain-enriched miRNAs, and by contrast, muscle-specific miR-1 is not present in lenses [37].

81

P38 MAPK/miR-1 are involved in the protective effect of EGCG in high glucose -induced Cx43 downregulation in neonatal rat cardiomyocytes.

82

According to previous studies, miR-1 is highly expressed in the heart, but not in the brain or liver in human adults and mice [28, 29].

In 2014, miR-1, miR-133a, miR-133b, and miR-206 were validated as muscle-specific miRNAs in rat [30].

83

Microarray analysis identified a panel of miRNAs, which are either highly expressed in the heart (miR-1, miR-133a and miR-16) or in the liver (miR-122, miR-192 and miR-194) or invariant (miR-21; Supplementary Figure 1a).

Total RNA from heart or liver were reverse transcribed according to the miQPCR and TaqMan protocols and the expression of 7 miRNAs (miR-1, miR-133b, miR-16, miR-122, miR-194 and miR-21) and a small nuclear RNA (RNU6) was measured by qPCR with respectively SYBR-Green (top panel) or TaqMan probes (lower panel).

84

For example, miR-1 and miR-133 are specifically expressed in muscles.

85

MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy.

86

Brandenburger T, Grievink H, Heinen N, Barthel F, Huhn R, Stachuletz F, Kohns M, Pannen B, Bauer I: Effects of remote ischemic preconditioning and myocardial ischemia on microRNA-1 expression in the rat heart in vivo.

87

For instance, overexpression of miR-1 deleteriously affects cardiac conduction and membrane depolarization in myocardial infarction [14].

88

MiR-1 (not shown), miR-29b, and miR-29c returned significant associations with target mRNA levels.

89

FOXP1 is one of the targets of miR-1 micro RNA.

90

Located on chromosome 6p12.2, miR-206 is similar in expression and function to miR-1, but its sequence differs by four nucleotides [32].

91

MiR-1, a muscle specific miRNA, has been shown to inhibit HDAC4 which in turn de-represses Mef2C, allowing myocyte differentiation to proceed [62].

92

Interestingly, the miR-133 family, together with miR-1, miR-206 and miR-208, is specifically expressed in muscle; thus, these miRNAs are called myomiRs 42.

93

Our group demonstrated in a previous report that muscle specific miRNAs (miR-1, 133a and 206) increased in plasma immediately after a half marathon in five trained young male runners (Da Sol Kim et al., 2015).

Circulating miR-1, miR-133a, and miR-206 levels are increased after a half-marathon run.

Cycling acute or chronic exercise did not change the serum levels of muscle-enriched miRNAs (miR-1, miR-133a, miR-133b, miR-206, miR-208b, miR-486, and miR-499) with an exception for miR-486, which showed a significant negative correlation with VO [2max] (Pedersen et al., 2007).

94

It has been observed that many miRNAs regulate cell apoptosis, such as miR-1, miR-133, miR-199, miR-208, miR-320, miR-21, and miR-204, etc [18- 23].

95

A further example is the regulation of the liver receptor homolog 1 (NR5A2) by miR-1 and this nuclear receptor functions as a transcription factor and phospholipid binding protein and plays an essential role in hepatic metabolism.

96

Recent studies have successfully established a functional link between cell survival and a discrete group of survival -regulating miRNAs, including miRNA-1 [14], miRNA-125 [15], miRNA-206 [14], miRNA-210 [16, 17] and miRNA-708 [18].

97

miR-1, 133, and 872 also precipitate changes in cardiac oxidative stress.

Specifically, miRNAs miR-1, 21, 23, 133, and 350 play important roles in this scenario [35].

98

miR-1, -26, -29, -21, -24, -103, -133, and -210 have been reported to be regulators of I-R injury either in the early or in the late stage after myocardial infarction, though the underlying mechanisms are largely unclarified [12, 13].

99

The miRNAs miR-1, miR-155, and miR-208 have significant effects on the RAAS [14].

Some miRNAs, including miR-1, miR-145, miR-122, miR-221, and miR-222, have been linked to vascular endothelial dysfunction [12].

100

Pan Z miR-1 exacerbates cardiac ischemia-reperfusion injury in mouse mo delsPLoS One.

Recent studies elucidate that miR-21, -24, -133, -210, -494 and -499 prevent myocytes against ischemia/reperfusion -induced apoptosis, while miR-1, -29, -195, -199a, -497 and -320 promote apoptosis 8– 10.