sort by

62 publications mentioning hsa-mir-520c

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-520c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 457
Noticeably, GO analysis revealed mainly translation and translation related categories with greatest representations of genes which had decreased protein synthesis (lowest values in the most actively translating fractions [fractions 10–11], and highest values in the non-translating and low-translating fractions of the gradient [fractions 1–7]) in miR-520c-3p overexpressed versus control cells (Figure 3A, Figure S4). [score:13]
Given that mRNA translation is primarily regulated at the level of initiation and that eIF4G is a key scaffolding protein that forms a critical link between the mRNA cap structure and poly(A) tail during this process, we further postulated that the repression of the eIF4GII by miR-520c-3p might elicit a global mRNA translation inhibition upon miR-520c-3p overexpression. [score:10]
Our findings demonstrate the ability of miR-520c-3p to repress the development of cancer malignancies through coordinated control of several significant mechanisms: (1) inhibition of eIF4GII and consequent repression of global translational machinery and induction of senescence in tumor cells, and (2) corresponding regulation of other target genes involved in cancer development. [score:10]
Based on above data, we hypothesized that overexpression of miR-520c-3p can suppress tumor growth by decreasing protein translation, inhibiting proliferation, and promoting cell senescence. [score:9]
In summary, our findings provide strong evidence that miR-520c-3p overexpression contributes to the observed inhibition of tumor formation in the human xenograft mouse mo del by maintaining a translationally repressed state, inhibiting proliferation and initiating cellular senescence in cancer cells. [score:9]
Identified in this study, tumor suppressor function of miR-520c-3p is mediated through the inhibition of translational factor eIF4GII, resulting in the repression of global translational machinery and induction of senescence in tumor cells. [score:9]
Hence, by decreasing eIF4GII protein expression, miR-520c-3p indirectly controls expression of many eIF4GII target genes and collaboratively promotes changes in the proteome of malignant cells. [score:8]
The above data confirm that miR-520c-3p targets and decreases expression of many important genes involved in translational control, cell proliferation and cancer development. [score:8]
To better understand the molecular mechanisms whereby miR-520c-3p elicits global translational repression and to identify miR-520c-3p targets and pathways involved in this regulation, we performed microarray analysis of total mRNA and mRNA isolated from polysomal fractions (translational profiling). [score:8]
Importantly, among the validated genes in which translation and protein levels were strongly decreased by miR-520c-3p was eukaryotic translation initiation factor 4 gamma, 3 (eIF4GII), one of the crucial components of the cap -dependent translation regulation complex eIF4F (Figure 3D and E). [score:8]
We have identified the miR-520c-3p as a negative regulator of tumor growth via specific downregulation of translational factor, eIF4GII. [score:7]
We propose that the observed decreased protein translation and premature senescence is mediated, at least in part, through a miR-520c-3p -mediated decrease in expression of translational factor, eIF4GII. [score:7]
We also tested whether silencing of eIF4GII could affect the translation of specific mRNAs validated in Figure 3 as miR-520c-3p targets by monitoring the fraction of those mRNAs associated with the translational apparatus. [score:7]
As shown in Figure 3E, corresponding with protein levels, we found decreased levels of all the validated transcripts in the actively translating fractions of the gradient (fractions 8–11), and elevated levels in the non-translating and low-translating fractions of the gradient (fractions 1–7) in groups transfected with miR-520c-3p. [score:7]
Altogether, these data indicate that overexpression of miR-520c-3p inhibited global translation and cell proliferation, and induced cellular senescence in cancer cells. [score:7]
miR-520c-3p is downregulated in DLBCL cells and affects global gene translation and cell proliferation. [score:6]
Based on the data gathered from our studies, we postulate that the main tumor-suppressive mechanisms of miR-520c-3p can be attributed through the repression of translation and induction of premature senescence, which is a direct function of reduced eIF4GII protein levels. [score:6]
Corresponding to the overexpression of miR-520c-3p, knockdown of eIF4GII decreased protein levels of the miR-520c-3p target genes (Figure 5C). [score:6]
By comparing miR-520c-3p upregulated to control transfected cells by RT-qPCR analysis, we observed no influence of miR-520c-3p on total mRNA levels of most of the validated miR-520c-3p target transcripts (Figure 3C). [score:6]
Microarray analysis revealed that miR-520c-3p regulates the expression of many translation, cell proliferation and cancer related genes. [score:6]
The effect of miR-520c-3p overexpression was furthermore verified for several mRNAs (Figure 3B) chosen from the most significantly altered in microarray data genes (Table S2), which were computationally predicted as direct targets of miR-520c-3p (by miRanda and Microcosm database) and, functionally represented above ranked pathways found by GO and IPA analysis. [score:6]
Strikingly, overexpression of pCDH-eIF4GII(CR) also changed the levels of senescence markers and abolished miR-520c-3p triggered differences in their expression. [score:5]
1004105.g004 Figure 4 (A) Schematics of eIF4GII mRNA depicting the miR-520c-3p predicted target sites in 3′-untranslated region (3′UTR) and luciferase reporter construct bearing either no eIF4GII mRNA sequences or eIF4GII 3′UTR. [score:5]
These data suggest that miR-520c-3p inhibits eIF4GII expression through two sites in eIF4GII 3′UTR but one site, seed region 1, may not be the true binding site for miR520c-3p. [score:5]
Our findings presented here provide a previously unknown tumor suppressor function for miR-520c-3p elicited by decreasing eIF4GII expression, resulting in repressed global protein synthesis and induction of premature cellular senescence. [score:5]
Finally, we tested if miR-520c-3p overexpression affects the availability of eIF4GII for translation initiation and observed miR-520c-3p mediated reduction in the abundance of eIF4GII associated with the 5′ 7-methyl-GTP cap structure analog (Figure 4G). [score:5]
The specific influence of miR-520c-3p on eIF4GII was initially confirmed by heterologous reporter constructs, which revealed diminished luciferase activity in the construct bearing the 3′ untranslated region (3′UTR) of eIF4GII mRNA suggesting that miR-520c-3p indeed repressed eIF4GII translation through its 3′UTR sequence (Figure 4B). [score:5]
Given that miR-520c was found to have decreased expression in the series of DLBCL cases used for miRNA profiling [32] and deregulation of protein synthesis has been recognized as a critical part of cancer development [33]– [35] we focused on miR-520c-3p function in human cancers with a particular interest in DLBCL. [score:5]
Herein, we discovered that elevated expression of miR-520c-3p results in decreased global translation and cell proliferation, and induced premature senescence in HeLa and diffuse large B-cell lymphoma (DLBCL). [score:5]
In addition, the overexpression of miR-520c-3p reduced eIF4GII translation and consequently decreased its protein levels through the miR-520c-3p seed sequence on the eIF4GII 3′UTR. [score:5]
As we observed, overexpression of pCDH-eIF4GII(CR) construct affected the expression of senescence markers (Figure 4E), therefore we wished to determine if eIF4GII repression might also participate in the process of miR-520c-3p triggered formation of the senescent phenotype. [score:5]
Mutation of the seed region 1 (mut1) only slightly increased GFP expression in miR-520c-3p overexpressing cells compared to the wild type. [score:5]
Instead, we found that increased miR-520c-3p levels lowered protein expression of studied target genes (Figure 3D). [score:5]
Six weeks old male mice were injected with 1.5×10 [6] SUDHL4 cells, either expressing empty vector or overexpressing miR-520c-3p into the left and right dorsal flanks, resuspended in 100 µL PBS and mixed with an equal volume of Matrigel. [score:5]
Collectively, these findings indicate that the miR-520c-3p-elicited repression in global translation is facilitated through the influence of miR-520c-3p on eIF4GII expression, and further eIF4GII actively contributes to the miR-520c-3p triggered decrease in cell proliferation and the induction of senescence. [score:5]
Genes differentially expressed in studied groups were analyzed for representation of Gene Ontology (GO) terms to identify key biologically functional categories that were significantly changed (p<0.05) in miR-520c-3p overexpressed versus control transfected cells as described before [60]. [score:5]
Given that epigenetics has a profound effect on the regulation of miRNA expression and DNA hypermethylation has been shown to be involved in the decrease of miRNA in lymphomas, we examined if the decreased expression of miR-520c in DLBCLs as compared to normal B cells could be due to hypermethylation of the genomic locus (Text S1, Figure S8, Table S4). [score:5]
Consistent with our in vitro results, we demonstrated in a human xenograft mouse mo del that overexpression of miR-520c-3p significantly inhibits tumor formation in vivo. [score:5]
Overexpression of miR-520c-3p Decreased Global Translation and Proliferation and Induced Senescence in HeLa and DLBCL Cells. [score:5]
In the present study, we explored the expression of both miR-520c-3p levels and eIF4GII protein expression in a DLBCL mo del. [score:5]
Finally, we examined whether overexpression of miR-520c-3p inhibits tumor formation in vivo. [score:5]
Elevated Levels of miR-520c-3p Decreased Translation of Its Target Genes. [score:5]
The data presented herein not only illustrates the complexity of the miR-520c-3p triggered post-transcriptional regulation network that regulates translation and cell growth, but also provides information about the cooperation between the functionally related mechanisms that results in tumor growth repression. [score:5]
Additionally, genes affected by miR-520c-3p overexpression in the most translationally active polysomal fraction 10 were put in the context of the known molecular interactions by using Ingenuity Pathways Analysis (IPA). [score:5]
Indeed, such profiles were consistent with our in vitro cell culture data (Figure 1B and D) showing a global translational decrease in miR-520c-3p overexpressing tumors. [score:5]
Herein, we demonstrated that elevated levels of miR-520c-3p resulted in inhibition of global gene translation, cell proliferation and promoted senescence in HeLa and DLBCL cells. [score:5]
Furthermore, miR-520c-3p negatively regulates the protein synthesis of eIF4G3/eIF4GII (known from here out as eIF4GII) through the direct targeting of its mRNA. [score:5]
Among those identified by microarray analysis and validated miR-520c-3p target genes, we found, eIF4GII, a pivotal scaffold member of eIF4F, and a central organizing protein in the recruitment of mRNA during translational initiation. [score:5]
On the contrary, knocking down miR-520c-3p with miRZip-520c-3p increased the expression of eIF4GII, was able to restore eIF4GII levels silenced by siRNA and modulated levels of studied senescence phenotype proteins (Figure 4F). [score:4]
com/; Ingenuity Systems; Redwood City, CA) was performed to identify the top network functions amongst the genes translationally regulated by miR-520c-3p. [score:4]
Figure S2Downregulation of miR-520c-3p. [score:4]
Altogether, this data support the role of miR-520c-3p and eIF4GII in the deregulation of protein synthesis in DLBCL and support the potential role of these molecules as specific therapeutic targets. [score:4]
Both miR-520c-3p Overexpression and eIF4GII Knockdown Diminished the Clonogenic Capacity of Lymphoma Cells. [score:4]
Upregulation of miR-520c-3p resulted in a significant repression of lymphoma tumors growth (Figure 6C and D, Figure S7A). [score:4]
Table S1 The top five functional networks derived by Ingenuity Pathways Analysis (IPA) from the genes translationally regulated by miR-520c-3p. [score:4]
In a recent survey identifying the microRNAs associated with elevated levels of the oncoprotein MCT-1 (data not shown), we found that overexpression of miR-520c-3p greatly repressed global protein synthesis, suggesting that miR-520c-3p could contribute broadly to regulating protein abundance. [score:4]
However, these observed differences were not as dramatic as the reduction after overexpression of mir-520c-3p (Figure S2A–D). [score:3]
Inversely, reduction of miR-520c-3p expression by miRZip-520c-3p transduction increased global protein synthesis levels. [score:3]
eIF4GII is a specific target of miR-520c-3p. [score:3]
The induction of a senescent phenotype triggered by increased levels of miR-520c-3p was further supported by the enhanced activity of the senescence marker ß-galactosidase (Figure 2C) and was confirmed by other hallmarks of senescence such as elevated p16 and p53 protein levels and decreased HuR expression [36] in HeLa and DLBCL cells (Figure 2D). [score:3]
eIF4GII Is a Specific Target of miR-520c-3p. [score:3]
Figure S7 Xenograft tumors in SCID mice using cells overexpressing miR-520c-3p. [score:3]
DLBCL cells express high levels of eIF4GII protein and low levels of miR-520c-3p. [score:3]
Cloning of the eIF4GII 3′UTR fragments containing seed regions (wild-type or mutants) of miR-520c-3p in plasmid pcDNA3.1/NT-GFP-TOPO were performed using NT-GFP Fusion TOPO TA Expression Kit (Invitrogen). [score:3]
However, mutating the seed region 2 (mut2) in the eIF4GII 3′UTR strongly increased GFP levels in miR-520c-3p overexpressing populations. [score:3]
Lending further clinical significance to our findings, we were able to demonstrate that primary DLBCL samples had elevated levels of eIF4GII while having reciprocally low miR-520c-3p expression. [score:3]
eIF4GII was predicted to have two miR-520c-3p binding sites in its 3′ untranslated region (3′UTR) (Figure 4A). [score:3]
Consistent with the repressed translation, the cell proliferation was reduced in all studied cell lines as fewer cells were observed in the miR-520c-3p upregulated populations compared to the control miRNA groups when examined by cell counting (Figure 1F and G) and measured in real-time by the xCELLigence System in HeLa cells (Figure 1H). [score:3]
We found only one message (Vil2 mRNA) to be affected on both the stability and translational level by miR-520c-3p. [score:3]
Figure S1Overexpression of miR-520c-3p. [score:3]
To this end, we established a preclinical xenograft mouse mo del with SUDHL4 cells transduced with either an empty vector (pCDH-Vector) or a vector overexpressing miR-520c-3p (pCDH-520c-3p). [score:3]
All together, these results strongly support the contention that the miR-520c-3p-elicited changes in protein translation and cell phenotype are indeed a consequence of modulated eIF4GII levels, via miR-520c-3p interaction with binding sites in the eIF4GII 3′UTR. [score:3]
Further, to corroborate that miR-520c-3p repressed eIF4GII translation specifically through the seed sites on its 3′UTR, heterologous GFP reporters were transfected in the conditions of either elevated miR-520c-3p or miR-Ctrl. [score:3]
Although, one cannot exclude the role of multiple target genes contributing to the observed miR-520c-3p triggered phenotype, signaling pathways (kinases or phosphatases) or other miRNAs actions that may also be involved, our data strongly support a major role of eIF4GII in this control. [score:3]
Overexpression of miR-520c-3p resulted in diminished clonogenic capacity of DLBCL cells and reduced tumor growth in a human lymphoma xenograft mouse mo del. [score:3]
Reciprocal Expression of miR-520c-3p and eIF4GII in DLBCLs. [score:3]
These in vitro and in vivo results were confirmed in DLBCL patient samples, where miR-520c-3p levels were inversely correlated to eIF4GII protein expression. [score:3]
Therefore, we hypothesized that the influence of miR-520c-3p overexpression on global protein synthesis and cell phenotype might be mediated by eIF4GII. [score:3]
Increase in miR-520c-3p Expression Resulted in Repressed Tumor Formation in a Human Xenograft Mo del. [score:3]
Furthermore we observed that, comparable to miR-520c-3p elevation, silencing of eIF4GII by siRNA repressed translation, cell proliferation, promoted senescence and diminished the clonogenic ability of cancer cells. [score:3]
As demonstrated in Figure 4D, increased miR-520c-3p levels efficiently reduced GFP wild type expression in both eIF4GII fragments, confirming miR-520c-3p's repressive ability on both studied sites. [score:3]
Transfection with miR-520c-3p efficiently repressed eIF4GII levels in vector transfected populations but did not affected the levels of overexpressed eIF4GII with deleted 3′UTR sequence, pCDH-eIF4GII(CR) (Figure 4E). [score:3]
HeLa cells were transfected by using Oligofectamine (Invitrogen) with 50 nM small RNAs Pre-miR-520c-3p (AAAGUGCUUCCUUUUAGAGGGU), control Pre-miR-Ctrl (Ambion), or 20 nM siRNA targeting eIF4GII and control siRNA (Qiagen). [score:3]
In summary, we revealed a tumor-suppressive function of miR-520c-3p and identified eIF4GII as a major effector of this action. [score:3]
We found that reduced miR-520c-3p was correlated with elevated eIF4GII expression in DLBCL. [score:3]
Forty-eight and seventy-two hours after transfection to elevate the levels of miR-520c-3p, significant reduction in the global protein synthesis in miR-520c-3p overexpressing cells relative to the control cultures was demonstrated by polysome distribution profiles and incorporation of [35]S-labeled amino acids into nascent protein in HeLa (Figure 1B and C, Figure S1A–C) and DLBCL (Figure 1D and E, Figure S1D–F) cell populations. [score:3]
We established that miR-520c-3p represses tumor growth through the repression of eIF4GII, a major structural component of the translation initiation complex. [score:3]
For real-time qPCR quantification of selected miR-520c-3p targets following gene-specific primer pairs were used: CCCTTCAAGATGCACCTCAT and GTGGTCCACAGCATTTCCTT for eIF4GII mRNA, GATGCATTGCAGAGGCACTA and CCCTAATGCTGGAAGCACTC for FOXO3 mRNA, TGCAATCCAGCCAAATACAA and TTATCCAGCTTCAGCCAGGT for VIL2 mRNA, GGACCTTGGCCTCAGTGTTA and GAAAGTTGCAGGCACCAAAT for HNRPDL mRNA, TCCCCTTTCCCTGATCTTTT and TGGGATTCTGTGGGAGAAAG for HuR mRNA, TGCTATCATGGCAGAAGGAA and ATATGCCACAGCCCATCATT for MCT-1 mRNA and, CGGAGTCAACGGATTTGGTCGTAT and AGCCTTCTCCATGGTGGTGAAGAC for GAPDH mRNA. [score:2]
Significantly altered genes were further analyzed for representation of Gene Ontology (GO) terms to identify key biologically functional categories that were significantly changed in miR-520c-3p overexpressed compared to control transfected cells. [score:2]
Overexpression of miR-520c-3p in DLBCL diminished colony formation in clonogenic assay and decreased tumor growth in xenograft mo del. [score:2]
Importantly, we found that DLBCL cell lines and patient samples expressed reduced levels of miR-520c-3p and elevated levels of eIF4GII as compared to normal donor B-cell lymphocytes. [score:2]
Furthermore, flow cytometry analysis showed that seventy-two hours after transfection cells with increased miR-520c-3p expression delayed passage through G [1] phase as compared to control -transfected populations (Figure 2B, Figure S3A and B). [score:2]
To address our hypothesis, we transfected Farage cells with either Pre-miRNA-Ctrl, Pre-miR-520c-3p (Figure 6A), siRNA targeting eIF4GII or control siRNA (Figure 6B) and carried out soft agar colony formation assays. [score:2]
Influence of miR-520c-3p on the senescent phenotype. [score:1]
The repeated measure ANOVA showed a significant effect of time on tumors growth F(13,78) = 10.05, p<0.001, and significant inhibition of growth by miR-520c-3p as revealed by significant effect of treatment F(1,7) = 40.60, p<0.001 and significant treatment x time interaction F(13,78) = 2.04, p<0.05. [score:1]
Comparable to the cells with increased miR-520c-3p, silencing of eIF4GII by siRNA caused a significant decline in the cell proliferation (Figure 5E) but no significant increase in cellular apoptosis (Figure 5F). [score:1]
Simultaneously, RNA from the same TMA samples was purified and expression of miR-520c-3p was measured by RT-qPCR (Table S3, Figure 7C). [score:1]
Consistently, similar results were obtained in a xenograft mo del performed with Pre-miR-520c-3p transfected HeLa cells (Figure S7B). [score:1]
These reporters were bearing segments with the predicted miR-520c-3p sites that were either wild type (wt) or with mutated (mut) seed region on eIF4GII 3′UTR (Figure 4C). [score:1]
We observed focal areas of hypomethylation of miR-520 and 5′ from the coding sequence in lymphomas, which may represent a permissive state for the binding of putative transcriptional repressors. [score:1]
Although miR-520c has previously been linked to cancer [43]– [45], to date its role in tumor progression remains controversial and the molecular mechanism of miR-520c's function still awaits further clarification. [score:1]
Upon miR-520c-3p overexpression, all studied cell lines showed only slight or no increase in cell apoptosis, as measured by Annexin V staining (Figure 2A). [score:1]
Interestingly, we discovered that HeLa cells overexpressing miR-520c-3p were enlarged, displayed a distinctive flat morphology, and had numerous vacuoles, which is characteristic of senescent cells. [score:1]
Figure S6 (A) (Upper) Schematic of GFP reporter constructs bearing segments with predicted miR-520c-3p sites with either wild type (wt) or with mutated (mut) seed sequences on eIF4GII 3′UTR. [score:1]
Since specific miRNA can be deregulated by multiple mechanisms, examining the regulation of miR-520c repression in DLBCL by alternative means is an opportunity for future investigation. [score:1]
Farage cells were transfected with Pre-miR-Ctrl, Pre-miR-520c-3p, eIF4GII siRNA or Ctrl siRNA and cultured in agarose/medium. [score:1]
Table S3 eIF4GII (IHC staining) and miR-520c-3p (measured by RT-qPCR) expression in TMA of primary DLBCL samples. [score:1]
This attenuated impact was likely due to the already low levels of miR-520c-3p present in the cells. [score:1]
For transduction of SUDHL4 cells plasmids pCDH-Vector or pCDH-miR520c-3p (System Biosciences, CA) were transfected with PureFection (System Biosciences, CA) in HEK-293TN packaging cells. [score:1]
Contribution of eIF4GII in the Phenotype Triggered by miR-520c-3p. [score:1]
1004105.g006 Figure 6 (A) Farage cells after transfection with either Pre-miR-Ctrl or Pre-miR-520c-3p were cultured in agarose/medium for two weeks. [score:1]
These results provided further evidence that eIF4GII is implicated in miR-520c-3p mediated cells growth control. [score:1]
Despite the internal variability characteristic for primary samples derived from different patients we observed significant inverse relationship between eIF4GII protein expression and miR-520c-3p levels (Pearson correlation coefficient r = −0.38, p<0.02) in studied DLBCL cases. [score:1]
Encoded on chromosome 19q13.42, miR-520c was identified as being associated with t(4;14) and t(11;14) translocations in multiple myeloma. [score:1]
First, we explored the abundance of miR-520c-3p in several primary normal B-cells, primary DLBCL cells, cultured DLBCL and Burkitt Lymphoma (BL) cell lines by RT-qPCR analysis. [score:1]
[1 to 20 of 115 sentences]
2
[+] score: 103
In conclusion, we found that highly expressed HOXA-AS2 down-regulates miR-520c-3p, then release its targets, TGFBR2 and RELA, and promotes proliferation, migration and invasion of breast cancer cells (Figure 7F). [score:8]
Meanwhile, miR-520c-3p also inhibited the expression of HOXA-AS2 in MCF-7 and MDA-MB-453 cells (P < 0.05, Figure 5D). [score:5]
HOXA-AS2 controls the expression of the targets of miR-520c-3p. [score:5]
As shown in Figure 6A, we identified TGFBR2 and RELA as direct targets of miR-520c-3p in breast cancer. [score:4]
To explore the regulatory relationship between HOXA-AS2 and miR-520c-3p, MCF-7 and MDA-MB-453 cells were transfected with HOXA-AS2 siRNAs and controls, and qRT-PCR was used to detect the expression level of miR-520c-3p. [score:4]
The OncomiRDB database was used to identify direct targets of miR-520c-3p (http://bioinfo. [score:4]
d) HOXA-AS2 acts as a molecular sponge for miR-520c-3p and regulates its targets. [score:4]
Figure 6 (A) The OncomiRDB database supplied the direct targets (TGFBR2 and RELA) of miR-520c-3p. [score:4]
The results showed that silencing of HOXA-AS2 increased the expression level of miR-520c-3p in MCF-7 and MDA-MB-453 cells (P < 0.05, Figure 5C). [score:3]
HOXA-AS2 controls the targets of miR-520c-3p in breast cancer. [score:3]
Then, we artificially altered the expression level of miR-520-3p by HOXA-AS2, si-HOXA-AS2, miR-520c-3p or antisense miR-520c-3p (Anti-520-3p) in breast cancer cells, and qRT-PCR was used to validate the transfection efficiency (P < 0.05, Figure 6C, 6D). [score:3]
These results indicate that HOXA-AS2 and miR-520c-3p inhibit each other in breast cancer. [score:3]
As shown in Figure 5E, there was a putative miR-520c-3p target site in the HOXA-AS2 sequence. [score:3]
In the present study, we also explored the mechanism of the HOXA-AS2/miR-520c-3p axis in breast cancer and detected the influences of HOXA-AS2 on the targets (TGFBR2 and RELA) of miR-520c-3p. [score:3]
The HOXA-AS2/miR-520c-3p regulatory network may shed light on tumorigenesis in breast cancer and may contribute to the development of novel diagnostic and treatment approaches for breast cancer. [score:3]
The results revealed that HOXA-AS2 siRNAs significantly increased the miR-520c-3p expression in breast cancer cells, which was rescued by anti-520c-3p (P < 0.05, Figure 7A). [score:3]
In our study, we found that miR-520c-3p showed low expression and plays important roles in human breast cancer, which indicates it may be a potential biomarker in the diagnosis and treatment of breast cancer. [score:3]
Our results demonstrated that the HOXA-AS2/miR-520c-3p axis controls the expression of RELA, suggesting a role for the HOXA-AS2/miR-520c-3p in breast cancer through the NF-κB signaling pathway. [score:3]
The analysis of HOXA-AS2-predicted miR-520c-3p targets was performed using starBase v2.0 (http://starbase. [score:3]
Another target of miR-520c-3p, RELA (p65, NF-κB3), is a member of the transcription factor nuclear factor kappa B (NF-κB) family. [score:3]
To further investigate the regulatory effect of HOXA-AS2 on miR-520c-3p, the OncomiRDB Database was used to search for direct targets of miR-520c-3p in breast cancer. [score:3]
We found that HOXA-AS2 controls the expression of TGFBR2 and RELA by acting as a miR-520c-3p sponge. [score:3]
Mir-520c-3p was directly regulated by HOXA-AS2 in breast cancer. [score:2]
MiR-520c-3p rescued the si-HOXA-AS2 -induced tumorigenesis inhibition of breast cancer. [score:2]
Functional studies demonstrated that HOXA-AS2 alters proliferation and invasion of breast cancer by regulating miR-520c-3p. [score:2]
Then, dual-luciferase reporter assays confirmed that miR-520c-3p, screened by microarray and bioinformatics analyses, was a HOXA-AS2-regulated miRNA in breast cancer cells. [score:1]
In addition, the relationships between miR-520c-3p expression and clinical characteristics of 38 patients with breast cancer were analyzed, and we found that miR-520c-3p was significantly associated with invasion (P = 0.018), lymphatic metastasis (P = 0.0003), distant metastasis (P = 0.0016), and TNM stage (P = 0.0003), which has a negative relationship with HOXA-AS2 (Table 2). [score:1]
The miR-520c-3p and anti-miR-520c-3p oligonucleotides were purchased from GenePharma (Shanghai, China). [score:1]
Figure 7MCF-7 and MDA-MB-453 cells were transfected with control plus scramble, HOXA-AS2 siRNAs plus scramble or HOXA-AS2 siRNAs plus anti-miR-520c-3p. [score:1]
MCF-7 and MDA-MB-453 cells (5 × 10 [4] cells/well) were seeded in 24-well plates and co -transfected with miR-520c-3p and wild type or mutant HOXA-AS2, along with a Renilla plasmid (RL-SV40) using Lipofectamine 3000 (Invitrogen). [score:1]
MCF-7 and MDA-MB-453 cells were co -transfected with the reporter plasmid (or the corresponding mutant reporter) and miR-520c-3p. [score:1]
The arrow indicates miR-520c-3p, which was included in these miRNAs. [score:1]
MiR-520c-3p was regulated by HOXA-AS2 in breast cancer. [score:1]
Our research showed that HOXA-AS2/miR-520c-3p may participate in breast cancer tumorigenesis through the TGF-β signaling pathway. [score:1]
The network from OncomiRDB shows the relationships among miR-520c-3p, TGFBR2 and RELA (Figure 6B). [score:1]
Correlation analysis between miR-520c-3p expression and clinic pathological characteristics of patients with breast cancer. [score:1]
MCF-7 and MDA-MB-453 cells were transfected with control plus scramble sequences, HOXA-AS2 siRNAs plus scramble sequences or HOXA-AS2 siRNAs plus anti-miR-520c-3p. [score:1]
Then, we performed a functional analysis of the HOXA-AS2/miR-520c-3p axis in breast cancer cell carcinogenesis. [score:1]
MCF-7 and MDA-MB-453 cells were transfected with control plus scramble, HOXA-AS2 siRNAs plus scramble or HOXA-AS2 siRNAs plus anti-miR-520c-3p. [score:1]
In this study, we aimed to explore the ceRNA mechanism of HOXA-AS2 though miR-520c-3p and revealed the functional relevance of miR-520c-3p and HOXA-AS2 in breast cancer. [score:1]
HOXA-AS2 promotes proliferation and invasion of breast cancer by miR-520c-3p. [score:1]
MCF-7 and MDA-MB-453 cells were treated with HOXA-AS2 siRNAs at a final concentration of 50 nM, plasmid vectors, and 50 nM of miR-520c-3p or anti-miR-520c-3p oligonucleotides using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. [score:1]
[1 to 20 of 42 sentences]
3
[+] score: 71
As miR-520c [32] was upregulated on PAA (Fig. 12C), however, CD44 expression was downregulated on PAA (Fig. 12D). [score:9]
Mechanistically, both miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1 -mediated Ras/Raf/MEK/Erk signaling pathway and NF-κB factor. [score:8]
Keklikoglou and colleagues show that overexpression of miR-520/373 members reveals a strong downregulation of transforming growth factor-β (TGF- [β]) signaling and a negative correlation between miR-520c and TGFBR2 expression was observed in estrogen receptor negative (ER(-)) breast cancer patients[20]. [score:8]
This suggests that these same microRNAs were upregulated on PAA and we choose to confirm this by performing on reported and predicted miR-520c and miR-373 targets that are involved in MMP regulation and TNFα and TGFβ signaling. [score:7]
We also examined CD44, a well-established biomarker for PNET in children[28] and with prognostic value[29], which is involved in the activation of MMP9 [30], and is targeted by miR-520c and miR-373 by suppressing CD44 translation [26, 31]. [score:7]
A previous study on fibrosarcoma cells showed an increase in MMP9 activity could be explained by miR-520c and miR-373 that acts by targeting the 3’UTR of mTOR and SIRT1 and its downstream effectors and kinases to inactivating signaling pathways that negatively regulate MMP9 expression [21]. [score:6]
Liu and Wilson made a direct connection that miR-520c and miR-373 increased the expression and activity of MMP9 in 3D type I collagen gels [21]. [score:4]
Both miR-520c and miR-373 confer robustness to biological processes by upregulation of activity of MMP9 in human fibrosarcoma cells [21]. [score:4]
Nevertheless, the expression of miR-520c and miR373 involved in the up regulation of MMP9 could nicely explain the experiments described on the modulation of cytokines activity by the substrate stiffness on MMP activities. [score:4]
This involvement of miRNA expression will be further directly measured by managing miR-520c and miR373 expression in the brain-like microenvironment. [score:4]
This is a component of NF-κB, a transcription factor for MMP9 [20, 27] and the receptor for TGFβ2, TGFβR2, which are both targeted by miR-520c and miR-373 [20]. [score:3]
Our study predicted that both mir-520c and miR-373 binding sites were common among the 3’ UTRs of genes downregulated on PAA compared to PS (S1 Dataset). [score:3]
Huang and colleagues found that human miR-373 and miR-520c stimulated cancer cell migration and invasion in vitro and in vivo, and that certain cancer cell lines depend on endogenous miR-373 activity to migrate efficiently [26]. [score:1]
MicroRNA 520c and 373 (miR-520c and miR-373) have been characterized as oncogenes in prostate cancer [31]), cancer cell metastasis-promoting factors in breast cancer [26], and tumor suppressors in estrogen receptor negative breast cancer [20]. [score:1]
These implicate that miR-373 and miR-520c promote tumor invasion and metastasis [26]. [score:1]
The identification of stem cell specific miRNAs(miR-520, miR-302, miR-372, and miR-373) [40, 41], which was predicted to be increased on PAA is an indication that the PAA tissue environment may allow the PNET cells to return to a less differentiated state (S1 Dataset). [score:1]
[1 to 20 of 16 sentences]
4
[+] score: 68
We also found that the expression level of members of the two clusters, miR-520b and miR-302c, were negatively correlated with their targeted genes based on gene expression analysis We identified the expression patterns of miRNAs and gene transcripts in the undifferentiation of human embryonic stem cells; among the miRNAs that are highly expressed in undifferentiated embryonic stem cells, the miR-520 cluster may be closely involved in hES cell function and its relevance to chromatin structure warrants further study. [score:11]
To infer the function of these miRNAs, we predicted 2,436 targets for the miR-302 cluster and 4,691 targets for the miR-520 cluster by querying the public database miRNAMap 2.0, and 2,284 target genes were shared by both clusters suggesting functional similarity. [score:7]
Our results confirmed the recent report that majority of miRNA genes in hES cells were expressed from Chromosomes 19 and X [55] and demonstrated the significant upregulation of miR-520 cluster in hES cells. [score:6]
Among the hES signature miRNAs, the miR-520 cluster shared a similar expression pattern and seed sequence as the well known miR-302 family and targeted the same genes as the miR-302 family. [score:5]
In addition, we identified 12 other hES upregulated miRNAs in this cluster: miR-302a, miR-302b, miR-302c, miR-302d, miR-519b, miR-519c, miR-520a, miR-520b, miR-520c, miR-520d, miR-520e which share a consensus seed sequence: AAGUGC [24]. [score:4]
Among the miRNAs upregulated in hES cells, we observed 7 miRNAs were located in the miR-302 cluster and 21 miRNAs were located in miR-520 cluster. [score:4]
The upregulation of miR-302 cluster and miR-520 cluster in hES cells suggests their ability to modulate local chromatin states which is necessary for stem cell pluripotency [58, 59]. [score:4]
In addition, we identified 21 hES upregulated miRNAs that were co-localized in a cluster on chromosome 19, the miR-520 cluster, many of which shared consensus seed sequence with miR-302 family and which can be used as candidate biomarkers for pluripotency (Additional file 1). [score:4]
Along with the reports of miR-302 family on chromosome 4 [16, 17, 19, 25, 26], several groups have reported the expression of members of miR-520 cluster on chromosome 19 in hES cells [24, 26, 29]. [score:3]
The miR-302 cluster and miR-520 cluster target large groups of genes which share overlapping functions based on Gene Ontology (GO) analysis. [score:3]
Gene Ontology (GO) enrichment analysis confirmed that the inferred functions of miRNAs within the miR-302 and miR-520 clusters were overlapping based on their involvement in cell growth, negative regulation of cellular metabolic process, negative regulation of transcription, and small GTPase mediated signal transduction. [score:3]
Among these miRNAs, miR-518b, miR-518c, miR-519b, miR-519c, miR-520a, miR-520c, miR-520e, miR-520g, and miR-524* are over-expressed in undifferentiated hES cells [24, 26, 29]. [score:3]
Especially, members of the miR-302 cluster on chromosome 4 and miR-520 cluster on chromosome 19 were highly expressed in undifferentiated hES cells. [score:3]
To visualize the functions of these miRNA targeted genes, a binary (red indicate participate in the functional category and green indicate not) heatmap was used to indicate functional commonality among all miRNAs in miR-302 and miR-520 clusters. [score:3]
Figure 8 Sequence and GO analysis of the miR-302 cluster and miR-520 cluster. [score:1]
The members of the miR-302 and miR-520 clusters had similar sequences; they shared a consensus seed sequence: AAGUGC (panel A, seed sequence is highlighted by the purple rectangle). [score:1]
In particular, miR-302a, miR-302b, miR-302c, miR-302d, miR-519b, miR-519c, miR-520a, miR-520b, miR-520c, miR-520d, and miR-520e had a consensus seed sequence: AAGUGC (Figure 8, panel A). [score:1]
Less is known about the function of the miR-520 cluster. [score:1]
Functional comparison of miR-302 cluster and miR-520 cluster. [score:1]
[1 to 20 of 19 sentences]
5
[+] score: 46
Columns A and B contain the number of target genes of miR-29b-3p and miR-520c-3p Since these results based mainly on target genes of miR-29b-3p, we repeated the analysis considering also target genes with lower supporting evidence and thus increased the number of target genes from the other two miRNAs in the analysis (Additional file 2: Table S4). [score:9]
Columns A and B contain the number of target genes of miR-29b-3p and miR-520c-3pSince these results based mainly on target genes of miR-29b-3p, we repeated the analysis considering also target genes with lower supporting evidence and thus increased the number of target genes from the other two miRNAs in the analysis (Additional file 2: Table S4). [score:9]
We defined target genes using miRTarBase [20] and, by restricting to only high confidence target genes, identified 84 genes (77 target genes for miR-29b-3p and 7 for miR-520c-3p, no target gene was reported for miR-1183). [score:9]
n. a. : test not performed Differential expression was confirmed for miR-29b-3p but failed for miR-520c-3p, whose expression was below the detection levels in all tested samples (Table 2). [score:5]
n. a. : test not performedDifferential expression was confirmed for miR-29b-3p but failed for miR-520c-3p, whose expression was below the detection levels in all tested samples (Table 2). [score:5]
We identified the 3 miRNAs miR-520c-3p, miR-29b-3p and miR-1183 to be significantly differentially expressed at a 5% FDR (i. e. with a p [adj] < 0.05; Fig.   1b), all of them being more than 4-fold higher expressed in ACM than in control samples (Table  2; the complete results are provided in Additional file 1). [score:5]
Summarizing, we identified 3 miRNAs (miR-520c-3p, miR-29b-3p and miR-1183) to be differentially expressed between ACM patient-derived and control CStCs and confirmed the de-regulation of miR-29b-3p in an extended data set including samples from in total 8 ACM patients and 5 controls. [score:4]
[1 to 20 of 7 sentences]
6
[+] score: 45
Therefore we tested mir-520c, we observed that mir-520c over -expression significantly decreased luciferase activity when the putative mir-106a target site was included in the reporter compared to either a reporter lacking the putative target site or a reporter carrying a seed-region mutant of the putative mir-106a target site (Figure 1B). [score:8]
Having demonstrated that over -expression of mir-106a or mir-520c was capable of repressing reporter gene expression via interaction with its putative target site, we investigated whether over -expression of these miRNAs could decrease endogenous APP levels in human cell lines. [score:7]
Mir-106a and mir-520c, therefore, appear to inhibit translation of the APP transcript. [score:5]
APP [770 ]and APP [751 ]levels are reduced in cells over -expressing (A) mir-106a compared to cells expressing either mir-125b or the empty vector and (B) mir-520c compared to cells expressing the empty vector. [score:5]
Another miRNA, mir-520c, shares the same seed region target sequence as mir-106a but is not expressed in human brain (Figure 1A) [13]. [score:5]
We do not expect mir-520c mediated APP regulation to occur in neurons since this miRNA is not expressed in brain. [score:4]
Over -expression of mir-520c had a similar effect on APP levels as mir-106a (Figure 2B and 2D). [score:3]
Over -expression of mir-106a or mir-520c had no effect on APP mRNA levels (Figure 2E). [score:3]
To confirm that the miRNAs were being over-expressed, we utilized RT-QPCR to quantify miRNA levels and observed significant increases in both mir106a and mir-520c (Table 1) levels (p < 0.0001). [score:3]
Figure 2 mir-106a and mir-520c can regulate APP levels post-transcriptionally. [score:2]
[1 to 20 of 10 sentences]
7
[+] score: 34
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
However, construction of a Venn diagram showed that only 262 putative target genes are common between the miR-519 and miR-520 subfamilies in group I, indicating that the miR-519 and -520 subfamilies target different sets of genes. [score:5]
NIK and RelA, have been experimentally validated as direct targets miR-520e and miR-520c-3p [10, 12]. [score:4]
The group I miR-519 subfamily also shares 262 putative target genes with the miR-302/-372 families, far fewer than the miR-520 subfamily (Fig.   3a, red box). [score:3]
However, the miR-520 and miR-302/372 families share a significant number of target genes (Fig.   3a) suggesting common biological functions. [score:3]
To obtain further supporting evidences on selective activation, expression of eight miRNAs spanning the C19MC cluster (Fig.   1a), but with different genomic structures, was selected for further experimentally verification; amongst the selected miRNAs, miR-512-3p is transcribed by the two miR-512-1 and-512-2 genes located at the 5’-end of the C19MC miRNA gene cluster; miR-520c-3p, -519b-3p and -520f-3p are single miRNA genes located between previously proposed exons; miR-524-5p and -517a-3p are two of three miRNA genes mapped on intron 18 and miR520d-5p and -520g-3p are two of four miRNAs mapped on intron 20 (Fig.   1a) [24]. [score:3]
The results showed that 1185 putative shared genes were obtained between the miR-520 and -302/372 families (Fig.   3a, blue box and Additional file 1: Table S1), suggesting that the miR-520 subfamily might share similar biological functions with the miR-302/372 family. [score:1]
Hence, it is highly likely that the group I miR-520 miRNAs may also contribute to reprogramming, as supported by the predicted involvement of miR-520 miRNAs in the reprogramming-related apoptosis and cell proliferation pathways (see Fig.   4 and below). [score:1]
[1 to 20 of 9 sentences]
8
[+] score: 27
By targeting mTOR and SIRT1 directly, which are negative regulators of MMP9 expression, miR-373 and miR-520c up-regulates the expression level of MMP9, resulting in increased cell migration [18]. [score:12]
CD44 was determined as a functional target of miR-373 and miR-520c, down-regulation of CD44 by miR-373 was responsible for the migration phenotype. [score:6]
However, in MDA-MB-231, which is an aggressively invasive ER [−] breast cancer cell line, overexpression of miR-520c/373 blunted the invasive capacity of cancer cells [22]. [score:3]
Using a forward genetic screen, Huang et al. [8] transduced MCF-7 cells with a miRNA -expression library and performed transwell cell migration assay to assess their migration ability, identified miR-373 and miR-520c as metastasis-promoting miRNAs. [score:2]
Therefore, when we discuss the functions of miR-373 here, we should bear in mind that other members of miR-520/373 family may possess the same functions. [score:1]
On one side, miR-373 was demonstrated to be positively correlated with higher metastatic phenotype [8], on the other, miR-520c/373 was shown to be negatively correlated with lymph node metastasis [22]. [score:1]
In human fibrosaroma HT1080 cells, miR-373 and miR-520c can also promote migration. [score:1]
miR-373 is one member of miR520/373 family, which consists of three different miRNA clusters possessing identical seed region, miR-302/367, miR-371/372/373 and miR-520 [8, 18, 22]. [score:1]
[1 to 20 of 8 sentences]
9
[+] score: 26
Akin to the cell lines semi-quantitative revealed an upregulation of 3 miRNAs and again, as further example of that cluster, results were supplemented with qRT-PCR analyses for miR-520. [score:4]
In prostate cancer both miR-373 and miR-520c although found to be downregulated stimulated migration and invasion in vitro [9]. [score:4]
Values of miRNA were normalized to RNU6B (RNA, U6 small nuclear 2) (A) miR-520c expression in thyroid cell lines, five cell lines derived from adenomas with 19q13.4 rearrangements (S141.2, S290.1, S121, S211, S40.2) (red bars) and three cell lines derived from thyroid adenomas with other structural rearrangements (S533, S325, S270.2) (light red bars). [score:3]
Recently, Huang et al. [10] were able to demonstrate that miR-373 and miR-520c promote tumor invasion and metastasis in vivo and in vitro by the suppression of CD44. [score:3]
Expression of miR-520c, miR-371-3p, miR-372 and miR-373 in cell lines and primary tumors. [score:3]
In breast cancer, miR-373 and miR-520c promote tumor invasion and metastasis in vivo and in vitro by the suppression of CD44 [10]. [score:3]
We have shown that all thyroid adenomas with 19q13 rearrangements express significantly higher levels (p≤0.003133) of miR-520 than samples without 19q13 rearrangements (adenomas and surrounding thyroid tissue; for details see Table 1) (Figure 3b). [score:3]
We have then used these cell lines to quantify the expression of another member of the C19MC cluster i. e. miR-520c by real-time PCR (qRT-PCR). [score:3]
[1 to 20 of 8 sentences]
10
[+] score: 24
of a one-sided K-S test for seed -dependent off-target effects are as follows: transcripts with seed-complementary sequences of dsEcad640, P≤10 [−59]; those of miR-302a, P≤10 [−45]; those of miR-372, P≤10 [−20]; those of miR-373, P≤10 [−39]; those of miR-520c, P≤10 [−40]; those of miR-520f using common seed sequence, P≤10 [−14]; miR-520f using own seed sequence, P≤10 [−57]. [score:3]
of a one-sided K-S test for seed -dependent off-target effects is as follows: transcripts with complementary seed sequences of the opposite strand of dsEcad640, P = 0.999; those of miR-302a, P = 0.266; those of miR-372, P = 0.449; those of miR-373, P = 0.953; those of miR-520c, P = 0.031; those of miR-520f, P = 0.998. [score:3]
The mean expression levels of the transcripts that have common seed-complementary sequences, AGCACUU, to dsEcad640 and miR-302/372/373/520 miRNA family members in their 3′UTR were apparently reduced by the transfection with dsEcad640, miR-302a, miR-372, miR-373, and miR-520c duplexes (Figure S1). [score:3]
In the promoter analyses, miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes showed the effects to increase the expression of proE-cad178-Luc and proE-cad670-Luc (Figure 6B, and D). [score:3]
To assess the parallel genome-wide regulation by dsEcad640 and the members of miR-302/372/373/520 family, microarray analyses were performed using PC-3 cells transfected with each of the miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes, as well as with dsEcad640 at 24 hour. [score:2]
Chemically synthesized dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes were transfected into PC-3 cells. [score:1]
Microarray profiles of transcripts containing common seed-complementary sequences of dsEcad640 and members of miR-302/372/373/520 family by the transfection of (A) dsEcad640, (B) miR-302a duplex, (C) miR-372 duplex, (D) miR-373 duplex, (E) miR-520c duplex, and (F) miR-520f duplex. [score:1]
The miR-302a duplex is composed of miR-302a and miR-302*; the miR-373 duplex, miR-373 and miR-373*; and the miR-520c duplex, miR-520c-5p and miR-520c-3p. [score:1]
The seed sequences of dsEcad640 sense strand, miR-302*, the opposite strand of miR-372, miR-373*, miR-520c-5p, and the opposite strand of miR-520f, are different (Figure 1B). [score:1]
The effects of dsEcad215, dsEcad302, dsEcad640, miR-302a, miR-372, miR-373, miR-520c, miR-520f, and siZEB1_CDS were determined using stably transfected cells with each luciferase reporter, and shown as Renilla/firefly. [score:1]
The transcripts of ZEB1, MED8, MTPN, LATS2, and RAB31 possess seed-complementarities to either of dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f. [score:1]
Microarray profiles of transcripts containing variable seed-complementary sequences of the opposite strands in their 3′UTRs by the transfection of (A) dsEcad640, (B) miR-302a duplex, (C) miR-372 duplex, (D) miR-373 duplex, (E) miR-520c duplex, and (F) miR-520f duplex. [score:1]
MiR-302a, miR-372, miR-373, miR-520c, miR-520f miRNA duplexes were synthesized to form the same sequences and structures described in miRBase [51]. [score:1]
The silencing activities by dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f on wild-type pLuc-CDS (WT), pLuc-CDS-m640-1, -2, and -1+2 are shown as Renilla/firefly. [score:1]
Then, the effects on ZEB1 CDS were determined by the transfection of miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes along with pLuc-CDS and pGL3-Control into PC-3 cells (Figure 1). [score:1]
[1 to 20 of 15 sentences]
11
[+] score: 16
The hsa-miR-371-373 cluster (counteracting cellular senescence and linked with differentiation potency), as well as hsa-miR-520c/-520h (inhibiting the tumor suppressor p21) were 3.9-16.3 fold up-regulated in two of the three cisplatin resistant cell lines. [score:8]
In our analysis, hsa-miR520c as well as hsa-miR520h were up-regulated (3.9-7.1-fold) in NTERA-2-R/NTERA-2 and NCCIT-R/NCCIT cell line pairs, which could point towards another mechanism counteracting senescence. [score:4]
The tumor suppressor p21, regulating transition through the cell cycle and acting downstream of p53, has already been associated with hsa-miR520 belonging to the miR-106/302 family [14]. [score:4]
[1 to 20 of 3 sentences]
12
[+] score: 14
Moreover, enhanced expression of a CD44 gene that was unresponsive to miR-373/miR-520c inhibited the migratory activity of MCF7 cells overexpressing miR-373 and miR-520c. [score:7]
Interestingly, Huang and coworkers found that miR-373 and miR-520c “seed” sequences were similar and both target CD44 messenger RNA. [score:3]
The second hallmark report [48] established that miR-373 and miR-520c can also promote tumor invasion and metastasis by regulating the cell-surface glycoprotein encoding gene CD44 (cell surface receptor for hyaluronan). [score:2]
In order to identify new potential metastasis-promoting miRNAs, Huang, et al. from Agami’s group set up a genetic screen using the non-metastatic MCF7 cell line, and found that miR-373 and miR-520c stimulated cell migration and invasion in vitro and in vivo. [score:1]
Similarly to miR-10b, miR-373 and miR-520c did not affect cell proliferation. [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 13
miR-520c and miR-373 upregulate MMP-9 expression and enhance human fibrosarcoma cell migration and growth not by direct binding to the MMP-9 promoter, but by directly targeting the 3′-UTR of the mRNAs of mTOR and SIRT1, which are negative regulators of MMP-9 expression [58]. [score:13]
[1 to 20 of 1 sentences]
14
[+] score: 12
Ectopic overexpression of CD44 reduced migration of MCF-7 cells that express miR-373 and miR-520c, which indicates that the downregulation of CD44 is essential to the migration of these cells [114]. [score:8]
In a genetic screen that overexpressed approximately 450 miRNAs in the nonmetastatic MCF-7 breast cancer cell line, authors found that miR-373 and miR-520c promoted migration and invasion in vivo and in vitro. [score:3]
The miR-373 and miR-520c are prometastatic miRNAs [79, 112]. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 11
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In patients with asthenozoospermia, two studies found that hsa-miR-27a [47, 56, 57], hsa-miR-548b-5p, hsa-miR-548c-5p and hsa-miR-548d-5p are up-regulated [47], while hsa-miR-34b-3p [47, 51], hsa-miR-520 h and hsa-miR-520d-3p are downregulated [47]. [score:7]
These miRNAs are expressed in spermatozoa and are involved in spermatogenesis (hsa-miR-34b-3p, hsa-miR-27a), embryonic development (hsa-miR-520 family) or in signaling pathways and human tumorigenesis (hsa-miR-548 family). [score:4]
[1 to 20 of 2 sentences]
16
[+] score: 11
OncomiRs Breast cancer-related proteins encoded by mRNAs that are oncomiRs targets Reference miR-21 Bcl-2, PDCD4, TPM1, TIMP3(18– 22) miR-155 Caspase 3, SOCS1(5, 66) miR-27a ZBTB10, FOXO1(67, 68) miR-96 FOXO1(68) miR-182 FOXO1(68) miR-128a TGF-βR1(69) miR-10b Tiam1, TWIST, HOXD10, E-cadherin(5, 70) miR-9 E-cadherin(5, 71) miR-373 CD44(7) miR-520c CD44(7)Bcl-2, B cell lymphoma2 (antiapoptotic protein); PDCD4, programed cell death 4 (neoplastic transformation inhibitor); TPM1, tropomyosin 1 (alpha); PTEN, phosphatase and tensin homolog; TIMP3, TIMP metallopeptidase inhibitor 3; SOCS1, tumor suppressor gene suppressor of cytokine signaling; ZBTB10, zinc finger and BTB domain containing 10; FOXO1, Forkhead box protein O1; TGF- βR1, transforming growth factor- β type 1 receptor; Tiam1, T lymphoma invasion and metastasis; TWIST, twist-related protein; HOXD10, homeobox D10. [score:11]
[1 to 20 of 1 sentences]
17
[+] score: 9
miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-kappaB factor in human fibrosarcoma cells. [score:8]
miR-520c and miR-373 have been shown to activate Ras/MAPK pathway via activation of MMP9 in fibrosarcoma cell lines (Liu and Wilson, 2012). [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 9
Liu P. Wilson M. J. miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-kappaB factor in human fibrosarcoma cellsJ. [score:8]
miR-520c and miR-373 are two miRNAs which are also involved in the modulation of the extracellular matrix of fibrosarcomas [86]. [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 9
Conversely, mature miR-371, miR-520 and miR-302b (Figure 2B, C) appeared to be expressed in the stem cell populations only (hES and lt-NES), while their corresponding precursors were present both in stem cells and neuronal differentiating cultures. [score:3]
Intriguingly, the maintenance of precursor expression in neuronal cultures for the pluripotency -associated miR-371 and miR-520, as well as for miR-302 might indicate that these miRNAs have further functional roles beyond the switch from self-renewal to differentiation. [score:3]
Among the miRNAs expressed only in hES cells (Group 3), we found miR-371 and miR-520 (Figure 2C), which are known to be associated with pluripotency [29]– [31]. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 9
The elucidation of the coordinated activity of miR-17-92 and miR-520 miRNAs, as well as of the regulatory networks that they are able to establish with their target genes, can largely contribute to i) the understanding of the physiology of hES cells development and differentiation and to ii) the exploitation of their potential as best candidate resources for both cell replacement therapy and development research. [score:6]
What is of more interest is that these biclusters group together miR-17-92 gene cluster members with those belonging to another important miRNA gene cluster, i. e. miR-520. [score:1]
The association of miR-17-92 with miR-520 was not detected either in mirDIP-A or in biclusters extracted from miRTarBase. [score:1]
Above all, HOCCLUS2 was able to group together, at high levels of the hierarchy, members of the miR-17-92 gene cluster with those belonging to the miR-520 gene cluster. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 8
While we have not explored this possibility in the current manuscript, we note that even if such transcripts prevail in T-ALL cases, the most upstream canonical poly-adenylation site would only protect the MRE corresponding to miR-520-3p, miR-140-3p (both of which we showed to have no effect on reporter expression recovery upon mutagenesis assays) and the 4th MRE for miR-520-5p, which we showed that, together other two MREs for miR-520-5p, is not sufficient to recover the reporter expression. [score:4]
Interestingly, miR-101 [20, 43- 52], miR-140-5p [53- 56], miR-520-5p [57], and miR-485-5p [58- 60], are all reported as putative tumor suppressors in different cancers. [score:3]
The miRNAs miR-520-3p C. and miR-140-3p E. are not predicted to bind to TAL1 3′UTR, nevertheless the putative MRE were mutated as depicted. [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 7
miR-522, miR-139-3p, miR-520c-5p, miR-518d-5p, miR-146b-5p, miR-34a, miR-526a, miR-193a-3p, miR-221, miR-4674 were significantly upregulated and miR-760 was downregulated in ECSCs (Figure 2A). [score:7]
[1 to 20 of 1 sentences]
23
[+] score: 6
For examples, miR-373 and miR-520c promote invasion and metastasis of breast cancer cells by suppression of CD44 [16], while the miR-200 family members repress cell migration and invasiveness by targeting ZEB1 and ZEB2, known regulators of EMT [17, 18]. [score:6]
[1 to 20 of 1 sentences]
24
[+] score: 6
The existing literature implicated hsa-miR-520 h as an important target of ABCG2. [score:3]
Wang and colleagues observed that it resulted in inhibition of cell migration and invasion and decreasing rate of side population cells through transfection of hsa-miR-520 h into Panc-1 cells [30]. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
26
[+] score: 6
miR-520 in hepatocellular carcinoma (HCC) cellsThe expression levels of miR-520e were decreased dramatically in HCC cells and clinical HCC tissues resulting from DNA hypermethylation in the upstream region of miR-520e locus, whereas silencing of the expression of miR-520e promoted cell proliferation [50]. [score:5]
miR-520 in hepatocellular carcinoma (HCC) cells. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 6
Additionally, it was reported that hsa-miR-520 h downregulates ABCG2 in pancreatic cancer cells leading to inhibition of migration, invasion, and side population cells [19]. [score:6]
[1 to 20 of 1 sentences]
28
[+] score: 5
In abdominal tissue, hsa-miR-520c-3p/520f, hsa-miR-519d and hsa-miR-183 were found to be associated with their target mRNAs, as well as being tissue differentially expressed. [score:5]
[1 to 20 of 1 sentences]
29
[+] score: 5
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a, hsa-mir-373
A previous study found that both miR-520c and miR-373 suppressed SIRT1 mRNA translation, leading to activation of the Ras/Raf/MEK/Erk pathway. [score:5]
[1 to 20 of 1 sentences]
30
[+] score: 5
miR-520c, miR-373, and miR-211 were described as miRNAs targeting TGFBR2 and contributing to the induction of MET [25], [49] although these three miRNAs were not identified as prime candidates of EMT-suppressive miRNA in our screening. [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
Altered miRNA signatures in primary breast cancers and their metastasis have been observed, including the loss of tumor suppressor miRNAs (miR-206, miR-17-5p, miR-125a, miR-125b, miR-200, let-7, miR-34 and miR-31) and the overexpression of oncogenic miRNAs (miR-21, miR-155, miR-10b, miR-373 and miR-520c) [138]. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 5
In addition, recent studies have reported that the miR-520 cluster, which is overexpressed in human ES cells, also acts as a tumor suppressor, and that introduction of miR-520h mimics into pancreatic cancer cells results in reduction of side population cells. [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 5
The authors used a siRNA against the EphA2 oncogene in a preclinical mo del of ovarian cancer and boosted the antitumour effects by addition of miR-520-3d, which synergistically inhibited the EphA2 expression in cancer cells. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
Surprisingly, while we confirmed the inhibition of GPC3 by miR-219-5p (Figure 2A), this miRNA and miR-520c-3p [21, 22] were not retained in our screen using GPC3 5’- and 3’-UTRs as baits (Supplementary Table 1). [score:3]
Contrarily to miRNA paralogs miR-96-5p and miR-1271-5p [11, 13], the previously described GPC3 -regulating miRNAs, miR-219-5p and miR-520c-3p [21, 22] were below the cut-off (Supplementary Table 1) and thus not selected in our screening. [score:2]
[1 to 20 of 2 sentences]
35
[+] score: 5
In our previous study, we identified miR-520c-3p, miR-211 and miR-148a being aberrantly expressed in the lead-sensitive group involved in the present studies (unpublished data), and we hence hypothesized that the XPO5 miR-SNP would be an influencing factor of occupational internal exposure to lead by altering miRNA expression. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
Importantly, miR-520-5p has previously been reported to inhibit expression of the EMT-related gene TWIST1 [38]. [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 4
Earlier evidence suggests that miR-373 and miR-520c can stimulate migration and invasion of MCF-7 and MDA-MB-435 cells, at least in part through direct suppression of CD44 (53), which functions as a cell surface receptor for several ECM components and mediates cell-cell or cell-substrate interactions through recognition of elements of the ECM (75, 76). [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
Indicated are select oncomiRs from the miR-17-92 and miR-106b-25 clusters and miR-520/373 family, which all have enriched putative target sites in Ago1-bound sequences. [score:3]
Interestingly, approximately one third of the 49 miRNAs are known oncomiRs including those from the miR-17-92 and miR-106b-25 clusters, as well as the miR-520/373 family (Figure 6B, Table S9). [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 4
The mir-520 group suppresses NFκB and TGF-β signaling, again in the context of cancerous cells [27], but given the roles of both signaling molecules in cytokine signaling and regulation, it is likely that this microRNA has alternative functions in these ILCs. [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In another study, it has been found that two miRNAs, miR-132 and miR-320, were expressed at significantly lower levels in the follicular fluid of women with PCOS than in a group of healthy women, as can be seen in Figure 3. In addition, it has been evidenced that miR-132, miR-320, miR-520c-3p, miR-24, and miR-222 that are present in the follicular fluid regulate estradiol concentrations and miR-24, miR-193b, and miR-483-5p progesterone concentrations [52]. [score:4]
[1 to 20 of 1 sentences]
41
[+] score: 3
The miRNA-520 cluster on chromosome 19 was highly expressed in undifferentiated hESCs, and might be closely involved in hESC function [156, 166]. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
CD44 is mediated by some miRs via binding to its 3′-UTR region in diverse human diseases; for instance, miR-34a in prostate cancer 13, miR-328 in gastrointestinal cancer 14, and miR-373 and miR-520c in breast cancer 31. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Two miRNAs from this location, miR-373 and miR-520c, have previously been shown to stimulate cancer cell migration and invasion in both in vitro and in vivo mo dels and to be expressed at increased levels in metastatic breast cancer [43]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Other miRNAs from this paper: hsa-mir-373
In breast cancer CD44 can be suppressed by miR-373 and miR-520c [37]. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
In human breast cancer it has been shown that they can act either as tumor suppressors (i. e., miR-206, miR-17-5p, miR-125a, miR-125b, miR-200, let-7, miR-34 and miR-31) or as oncogenes (i. e., miR-21, miR-155, miR-10b, miR-373 and miR-520c) [20]. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In HepG2 cells, EGCG differentially represses the expression of five miRNAs (miR-30b*, miR-453, miR-520-e, miR-629, and miR-608) involved in inflammatory pathways, the peroxisome proliferators-activated receptors (PPAR) signaling pathway, the insulin signaling pathway, glycolysis and gluconeogenesis, oxidative phosphorylation, and glutathione metabolism [127]. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
Several miRNA families, including the human (hsa)-miR-302, hsa-miR-106, hsa-miR-372, hsa-miR-17, hsa-miR-520, hsa-miR-195 and hsa-miR-200 families [155] were up-regulated specifically in hPSCs compared to mature differentiated cell types. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
BRMS1 was shown to act as a repressor for metastasis-promoting miRs such as miR-10b, miR-373 and miR-520c and an activator for metastasis-suppressing miRs miR-146a/b, miR-335 and miR-21 [109] (Figure  4). [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 2
Two other miRNAs (miR-373 and miR-520c) can also promote tumor invasion and metastasis, at least in part by regulating the CD44 gene [32]. [score:2]
[1 to 20 of 1 sentences]
51
[+] score: 1
A series of microRNAs have been identified as metastasis promoters, including let-7, miR-9, miR-10b, miR-21, miR-373, miR-520c, and miR-103/107 [12], [14], [15], [16], [17], [18], [19], [20]. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
MiR-373 and miR-520c have also been reported to promote tumor invasion and metastasis in prostate cancer [12]. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
miR-373 belongs to the miR-520/-373 family, which consists of three different miRNA clusters (miR-302/-367, miR-371/-372/-373, and miR-520) [27]. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
miR-372, miR-373, miR-302, miR-520 and some other miRNAs are members of miR-93 family. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
For example, microRNA-10b [28], miR-373 and miR-520c [29], [30] stimulated cancer cell migration and invasion in breast cancer. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
Other miRNAs from this paper: hsa-mir-21, hsa-mir-106b, hsa-mir-373
miR-373 and miR-520c have been reported to be associated with tumor invasion and metastasis in breast cancer cell lines [5]. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
Several miRNAs - miR-10b, miR-373, miR-520c, miR-335 and miR-206 - appear to promote late stages of mammary tumor progression by impacting critical steps in the metastatic cascade such as epithelial-to-mesenchymal transition (EMT), apoptosis, and angiogenesis [6]. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
By comparison, miRNA transcripts of the C19MC cluster (miR-512, miR-516b, miR-520, and miR-525) were unchanged (Fig. 5). [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
Huang Q. Gumireddy K. Schrier M. le Sage C. Nagel R. Nair S. Egan D. A. Li A. Huang G. Klein-Szanto A. J. The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis Nat. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
We can see that, while bicluster Z' associates MUC17 with miR-17, miR-20a and miR-20b (Figure 9(a)), biclusters at levels 3 and 4 (Figures 9(b) and 9(c)) also include other miRNAs, some belonging to the miR-17-92 gene cluster and others to the miR-520 gene cluster. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Interestingly, except for isomiR of hsa-miR-520 g, other isomiRs with 3′ additions had the same 5′ ends and “seed sequences” with their canonical miRNA sequences in the miRBase database. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Thus, in breast cancer, which represents the most common malignancy among women in the world, miRNAs such as miR-9, miR-10b, miR-21, miR-103/107, miR-132, miR-373, and miR-520 stimulate metastasis, while miR-7, miR-30, miR-31, miR-126, miR-145, miR-146, miR-200, miR-205, miR-335, miR-661, and miRNAs of the let-7 families in contrast impair the different steps of metastatic process, from epithelial-to-mesenchymal transition to local invasion to colonisation and angiogenesis [61]. [score:1]
[1 to 20 of 1 sentences]