sort by

21 publications mentioning hsa-mir-519b

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-519b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 106
In addition, the PLC inhibitor (U73122) and the PKC inhibitors (GF109203x and Gö6976) or PLCγ and PKCα siRNA reversed TGF-β1 -inhibited miRNA-519b expression (Fig 6D). [score:9]
We demonstrate that TGF-β1 enhanced the expression of HO-1 via the stimulation of PLCγ/PKCα phosphorylation and suppression of the downstream expression of miRNA-519b, an miRNA that disrupts the transcription of the HO-1 gene. [score:7]
We used open-source software (TargetScan, miRDB, and miRWalk) to compare the miRNA expression profiles of OASFs before and after TGF-β1 administration and found that miRNA-519b was apparently suppressed by TGF-β1. [score:7]
These findings suggest that TGF-β1 promotes HO-1 expression by suppressing miRNA-519b expression in OASFs. [score:7]
TGF-β1 stimulated the expression of HO-1 via activating the PLCγ/PKCα pathway and suppressing the downstream expression of miRNA-519b. [score:7]
These data suggest that miRNA-519b directly suppresses HO-1 gene transcription via binding to the 3’UTR region of the human HO-1 gene promoter, and that miRNA-519b expression is negatively regulated by PLCγ/PKCα phosphorylation induced by upstream TGF-β1 signaling. [score:7]
We also showed that the expression of miRNA-519b, which blocks HO-1 transcription, is inhibited by TGF-β1, and the suppression of miRNA 519b could be reversed via blockade of the PLCγ/PKCα pathway. [score:7]
Open-source software (TargetScan, miRDB, and miRWalk) was utilized in this study to identify the miRNAs that could possibly interfere with the transcription of HO-1. The findings showed that the 3’UTR region of the HO-1 promoter harbors potential binding sites for 20 candidate miRNAs, and miRNA-519b is downregulated to the greatest extent after TGF-β1 stimulation (data not shown). [score:6]
TGF-β1 enhanced HO-1 expression by inhibiting miRNA-519b synthesis. [score:5]
To further determine if TGF-β1 stimulates HO-1 expression by inhibiting miRNA-519b synthesis, OASFs were transfected with the miRNA-519b mimic, which subsequently diminished TGF-β1-enhanced HO-1 mRNA and protein synthesis (Fig 5B and 5C). [score:5]
We found that TGF-β1 (1 to 30 ng/ml) inhibited miRNA-519b expression in a concentration -dependent manner (Fig 5A). [score:5]
To confirm these findings, we directly compared the expression levels of miRNA-519b in OASFs with and without TGF-β1 administration. [score:3]
The subsequent decrease in miRNA-519b expression enhances HO-1 promoter activity and HO-1 protein synthesis. [score:3]
Our study shows that the binding of TGF-β1 in OASFs triggers the phosphorylation of PLCγ and PKCα, contributing to the suppression of miRNA-519b synthesis. [score:3]
The 3′-UTR-luciferase reporter constructs including the 3′-UTR regions of HO-1 with wild-type and mutant binding sites for miRNA-519b were utilized to validate that miRNA-519b inhibits the transcription of HO-1. After amplifying the cDNAs with PCR reaction, the yielded PCR products were cloned into a pmirGLO reporter vector (Promega) between the NheI and XhoI restriction sites, immediately downstream of the luciferase reporter gene. [score:3]
The binding of miRNA-519b to HO-1 3’ UTR mitigates TGF-β1 -induced increases in HO-1 expression. [score:3]
TGF-β1 suppression of miRNA-519b enhances HO-1 production. [score:3]
This decrease in miRNA-519b expression was confirmed by qPCR assay. [score:2]
miRNA-519b expression levels were examined by qPCR assay (n = 4 per group). [score:2]
We also used the luciferase reporter vector including the wild-type 3′UTR of HO-1 mRNA (wt-HO-1-3′UTR) as well as the vector harboring mismatches in predicted miRNA-519b binding site (mt-HO-1-3′UTR) to determine whether miRNA-519b regulates the 3’UTR of HO-1 mRNA (Fig 6A). [score:2]
MiR-519b expression was examined by qPCR (n = 4 per group). [score:2]
We have shown that transfection of OASFs with miRNA-519b mimic attenuates TGF-β1-stimulated HO-1 expression, while the luciferase assay showed that mutant HO-1 promoter activity was enhanced by TGF-β1 administration. [score:2]
The “full mutant” lost all apparent binding of miRNA-519b. [score:1]
The reagent Trizol, Lipofectamine 2000 transfection reagent, miR-519b mimic, and control miRNA were purchased from Life Technologies (Carlsbad, CA). [score:1]
These findings underscore the importance of miRNA-519b in the process of TGF-β1 stimulation of HO-1 synthesis. [score:1]
0176052.g006 Fig 6 (A) Diagram of the miRNA-519b binding site in the wild-type and mutant HO-1 3′UTRs. [score:1]
Fig 6B shows that miRNA-519b mimic reduced TGF-β1-enhanced luciferase activity in the wt-HO-1-3′UTR plasmid but not in the mt-HO-1-3′UTR plasmid (Fig 6B and 6C). [score:1]
In addition, treatment of OASFs with the miRNA-519b mimic attenuated TGF-β1 -induced HO-1 promoter activity (Fig 5D). [score:1]
[1 to 20 of 28 sentences]
2
[+] score: 56
miR-519, a microRNA that suppresses tumorigenesis and lowers expression of RNA -binding protein HuR, was upregulated in senescent cells. [score:8]
In conjunction with the finding that miR-519 reduced tumorigenesis in a xenograft mo del [32], we propose that the coordinated action of senescence -upregulated microRNAs can suppress tumor growth by reducing the levels of oncogenes or tumor promoters. [score:6]
Among the microRNAs showing increasing abundance with senescence, miR-519 was of particular interest because it was shown to inhibit translation of HuR and to diminish tumor growth [31, 32]. [score:5]
miR-519 was recently found to inhibit translation of the RNA -binding protein HuR through its interaction with the HuR coding region [31]. [score:5]
As indicated above, miR-519 was found to suppress tumor growth [32]. [score:3]
Overexpression of miR-519 induced senescence in WI-38 and HeLa cells. [score:3]
As shown here for miR-519, we postulate that these changes help to meet the needs of senescent cells in eliciting tumor suppression and growth arrest. [score:3]
Since HuR potently enhances the expression of cancer-promoting proteins, and reducing HuR levels promotes HDF senescence [11, 38], we propose that miR-519 represses tumor growth at least in part, by lowering HuR and thereby promoting senescence (Figs. 4 and 5). [score:3]
Additionally, miR-519 could further repress tumor growth by lowering the expression of other genes, such as ABCG2 or HIF-1α [46, 47]. [score:3]
In a separate study, miR-519 suppressed the growth of tumor xenografts in an HuR -dependent manner [32]. [score:3]
Accordingly, we postulate that one of the mechanisms by which miR-519 suppress tumor growth is by inducing senescence, and further propose that miR-519 triggers senescence -at least in part- by reducing HuR levels. [score:3]
Given that HuR promotes cell proliferation and decreases senescence [33, 34], we hypothesized that the elevated miR-519 in senescent cells (Figure 4A) might lower HuR expression in WI-38 HDFs, and hence promote senescence. [score:3]
We were particularly interested in the miR-519 family. [score:1]
Together, these data indicate that miR-519 reduced HeLa cell proliferation and promoted HeLa cell senescence. [score:1]
miR-519 -induced senescence in HDFs. [score:1]
miR-519 -induced senescence in HeLa cells. [score:1]
We previously reported that miR-519 represses the production of HuR, an RNA -binding protein which is highly abundant in cancer cells and is low in untransformed cells [11, 38]. [score:1]
Moreover, while HuR levels are high in tumors and low in normal tissues, miR-519 levels are high in normal tissues and low in cancer tissues [32]. [score:1]
Influence of miR-519 on the senescent phenotype of HeLa cells. [score:1]
Influence of miR-519 on WI-38 senescence. [score:1]
[1 to 20 of 20 sentences]
3
[+] score: 49
As shown on Fig 7D, miR-519b-3p overexpression lead a modest but significant down-regulation of Smyd2 mRNA, compared with random miRNAs overexpression and a down-regulation of SMYD2 at the protein level (Fig 7E and 7F). [score:10]
Indeed, it has been demonstrated that the decrease of target expression by individual miRNAs is usually quite modest [71, 72] and is confirmed here with the study of the interaction between Smyd2 and miR-519b-3p. [score:5]
The 3’-UTR regions of the 2 Smyd2 human transcripts were predicted to be bind by miR-519a-3p and miR-519b-3p, 2 highly down-regulated miRNAs in LA (S3 Table). [score:4]
In order to validate the down-regulation of Smyd2 at the mRNA level, pre-miR-519b-3p was transfected in HEK293T. [score:4]
MiR-519a-3p or miR-519b-3p precursors were cloned in pEZX-MR04 vector also expressing GFP (#Hmi R0453; #Hmi R0320, GeneCopoeia [™], Inc. [score:3]
0196666.g007 Fig 7A) HEK293T cells were transfected with reporter plasmid containing the 3’-UTR region of Smyd2 associated with luciferase/renilla and with either a plasmid expressing random miRNAs, or pre-miR-519a-3p or pre-miR-519b-3p. [score:3]
C) Validation of miR-519b-3p overexpression in HEK293T. [score:3]
A) HEK293T cells were transfected with reporter plasmid containing the 3’-UTR region of Smyd2 associated with luciferase/renilla and with either a plasmid expressing random miRNAs, or pre-miR-519a-3p or pre-miR-519b-3p. [score:3]
GFP detection in HEK293T was used to confirm the transfection efficiency (Fig 7B), and quantification of miR-519b-3p in HEK293T recipient cells confirmed its strong over -expression (Fig 7C). [score:3]
MiR-519b-3p overexpression. [score:2]
E) Quantification of SMYD2 protein level in HEK293T transfected with either pre-miR-519-3p or random miRNA sequences. [score:1]
D) Quantification of Smyd2 mRNA level in HEK293T transfected a plasmid containing either pre-miR-519-3p or random miRNA sequences. [score:1]
F) Western-blot of HEK293T protein extract, transfected either with pre-miR-519-3p or random miRNA sequences. [score:1]
80% confluent HEK293T cells were transfected with pre-miR-519b-3p using a 1:5 ratio (μg DNA/μl ExGen500 reagent). [score:1]
B) Transfection efficiency with miR-519b-3p was validated by visualizing GFP in HEK293T and was found similar to the efficiency with random miRNAs. [score:1]
As shown on Fig 7A, only miR-519b-3p could bind the 3’-UTR region of Smyd2 and reduce significantly the luciferase/renilla activity. [score:1]
Two days later, cells were transfected in quadruplicate with Smyd2 3'-UTR sequence concomitantly with either miR-519a-3p or miR-519b-3p precursors or an empty pEZX vector used as control, by using ExGen500 transfection reagent (EUROMEDEX). [score:1]
Validation of Smyd2 mRNA interaction with miR-519. [score:1]
In order to validate these predictions, a reporter plasmid containing the 3’-UTR region of Smyd2 associated with luciferase/renilla was co -transfected with either pre-miR-519a-3p or pre-miR-519b-3p. [score:1]
[1 to 20 of 19 sentences]
4
[+] score: 19
However, construction of a Venn diagram showed that only 262 putative target genes are common between the miR-519 and miR-520 subfamilies in group I, indicating that the miR-519 and -520 subfamilies target different sets of genes. [score:5]
Genes targeted by either or both the miR-519 or -520 subfamilies are shown in different color boxes. [score:3]
Furthermore, one of the characteristics of target prediction, the sequence context surrounding the seed binding site of the target transcript [1], between the miR-519 and -520 subfamilies are also dissimilar (Fig.   2a). [score:3]
The group I miR-519 subfamily also shares 262 putative target genes with the miR-302/-372 families, far fewer than the miR-520 subfamily (Fig.   3a, red box). [score:3]
In this study, the putative target sets of the miR-519 and -520 subfamilies are overlapping gene sets predicted by two different prediction algorithms. [score:3]
The group I miRNAs are composed of the miR-519 and -520 subfamilies. [score:1]
Furthermore, it is noted that the AAGUGC seed position at 5’ end is variable among the C19MC-AAGUGC-miRNAs: subgroup I miRNAs, which includes eight miR-519 and -520 subfamilies, have the seed sequence located at the canonical and optimal 5’-nucleotide positions (nts) 2-7, as in the miR-302/-372 families; the seed sequence of the four subgroup IIa miRNAs is at location nts 1-6, and that of the remaining subgroup IIb miRNAs is at nts 3-8 and 4-9 (Fig.   2a). [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 17
The mechanism underlying selective upregulation of the ORAI1 subunit is not known, but the post-transcriptional expression of the ORAI1 gene has been shown to be regulated by miR-519 using TargetScan/complementarity studies in HELA cells (Ab delmohsen et al., 2012). [score:9]
Whether similar regulation by MIR-519 occurs in hVF-HF is not known, but in our studies we were unable to detect MIR-519 expression in fibroblasts from non-failing or failing hearts, which is suggestive that other possible regulatory mechanisms are involved (Sauc et al., 2015). [score:5]
Growth inhibition by miR-519 via multiple p21-inducing pathways. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 17
In addition, we identified 12 other hES upregulated miRNAs in this cluster: miR-302a, miR-302b, miR-302c, miR-302d, miR-519b, miR-519c, miR-520a, miR-520b, miR-520c, miR-520d, miR-520e which share a consensus seed sequence: AAGUGC [24]. [score:4]
In particular, the expression of miR-519b was 8-fold greater in hES cells than in EB cells and it was not even detected in adult cells. [score:3]
Expression of levels of miR-200c, miR-302b, miR-302c, miR-367, miR-519b, and miR-520b were the greatest in hES cells (panel A). [score:3]
Using qRT-PCR we found that the expression levels of miR-302b, miR-302c, miR-367, miR-200c, miR-519b, and miR-520b were much higher in hES cells than in either EB or adult cells (Figure 6, panel A). [score:3]
Among these miRNAs, miR-518b, miR-518c, miR-519b, miR-519c, miR-520a, miR-520c, miR-520e, miR-520g, and miR-524* are over-expressed in undifferentiated hES cells [24, 26, 29]. [score:3]
In particular, miR-302a, miR-302b, miR-302c, miR-302d, miR-519b, miR-519c, miR-520a, miR-520b, miR-520c, miR-520d, and miR-520e had a consensus seed sequence: AAGUGC (Figure 8, panel A). [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 7
Mir-519 and -519E were also upregulated in cKit+ ILCs; these microRNAs have been shown to inhibit cell growth and thus promote cell survival [25]whereas mir-423 promotes cell growth by regulating the G(1)/S transition in the cell cycle in hepatocellular carcinoma cell lines [26]. [score:7]
[1 to 20 of 1 sentences]
8
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Small RNA regulation of some of the splicing control proteins has previously been reported; for example, the ELAV transcript, which encodes the HuR protein, a major modulator of mRNA stability and translation in addition to mRNA splicing [58], is subject to regulation by miRNAs miR-519, miR-16 and miR-125a in a variety of cell types including cervical, ovarian and colon cancer cell lines [59, 60, 61]. [score:5]
Ab delmohsen K. Srikantan S. Kuwano Y. Gorospe M. miR-519 reduces cell proliferation by lowering RNA -binding protein HuR levels Proc. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 4
Recently identified miRNAs, such as miR-9, miR-34a, miR-16, miR-125a, miR-29a, miR-200c, and miR-519, play crucial roles in regulating HuR expression through interaction of miRNAs with specific sites in the 3′UTR and 5′UTR of the HuR mRNA. [score:4]
[1 to 20 of 1 sentences]
10
[+] score: 4
Of interest, in a recent study identifying the association of miR-519b with human obesity, Martinelli and co-workers [31] also detected that miR-642a was up-regulated in 19 out of 20 fat depots of obese subjects. [score:4]
[1 to 20 of 1 sentences]
11
[+] score: 4
MiR-519 represses the production of HuR, an RNA -binding protein very abundantly found in tumor cells and less expressed in untransformed cells, while the overexpression of HuR delays the senescent phenotype (83). [score:4]
[1 to 20 of 1 sentences]
12
[+] score: 3
Other previously identified miRNAs are a chromosome 19 microRNA cluster (C19MC) including miR-517a, miR-519b, miR-520b, miR-520b, and miR-521, which were found to be highly expressed in human stem cells [10]; the miR-290 cluster was only detected at high levels in mouse stem cells [11]. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
The miR-518b, miR-518c, miR-519b and miR-519c have been consistently reported to be overexpressed in undifferentiated hESCs [156, 166, 171, 172]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
For example, miR-144, miR-937, miR-376, miR-519, and miR-548A-3P are shown to regulate a number of mRNAs, and HCK, NFKBIE, IL6, SHMT2, and MCM4 are regulated by several miRNAs. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
Following that, miR-19b, miR-19a, miR-520d-5p, miR-524-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-495, miR-944 and miR-664 regulate 121, 119, 130, 130, 109, 109, 109, 102, 138, 123 genes, respectively. [score:2]
, miR-19b, miR-19a, miR-520d-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-944 and miR-664) are partially known (i. e., known to only human, but still unknown to rhesus). [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 3
Our analysis shows a possible involvement of several members of the miR-515 family (such as miR-515-5p, miR-519 and miR-520a-3p/b/c-3p/d-3p/e/g/h), located at 19q13.4, in POF, since they are predicted to target FMR1 and FOXL2, two genes which are associated to POF [47], [48]. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 2
'STAT2’, 'hsa-miR-519b-3p’ and 'JAK1’ (Janus kinase 1) also forms another co-regulation motif. [score:2]
[1 to 20 of 1 sentences]
18
[+] score: 1
Figure 5 shows one such alignment between an unannotated read profile from chr17:20841720-20841781(+) and a read profile of hsa-mir-519b. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
1* TTTGGATTGAAGGGAGCTCTA 6,587 miR519b + miR159b. [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
2010.00683. x 20649821 8. Ab delmohsen K. Srikantan S. Kuwano Y. Gorospe M. miR-519 reduces cell proliferation by lowering RNA -binding protein HuR levels Proc. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
The miR-659-3p cluster also included miR-219-3p and miR-519-5p (Fig.   1b), which had less significant or no association with PFS (p = 0.036 and p = 0.12, respectively). [score:1]
[1 to 20 of 1 sentences]