sort by

160 publications mentioning hsa-mir-193b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-193b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 102
Other miRNAs from this paper: hsa-mir-30c-2, hsa-mir-200c, hsa-mir-30c-1, hsa-mir-363
3.3. miR-193b Directly Targets MCL-1 and Suppresses Its Expression in MCF-7/DOXR Cells. [score:8]
These data indicate that the downregulation of miR-193b and upregulation of MCL-1 may be related to doxorubicin resistance. [score:7]
Downregulation of miR-193b and Upregulation of MCL-1 in Breast Doxorubicin-Resistant Cells. [score:7]
These results indicate that MCL-1 is negatively regulated by miR-193b as its direct target gene in MCF-7/DOXR cells. [score:5]
We conclude that the miR-193b modulates resistance to doxorubicin in human breast cancer cells by downregulating MCL-1. Aberrant regulation of apoptosis commonly plays a key role in acquired chemotherapy resistance for cancer cells, which is largely mediated by the Bcl-2 family proteins [25]. [score:5]
More importantly, we found doxorubicin -induced apoptosis was inhibited in MCF-7/DOXR cells cotransfected with MCL-1 expression vector and miR-193b mimic, indicating that MCL-1 plays a pivotal role in mediating miR-193b-modulated doxorubicin resistance in human breast cancer. [score:5]
3.4. miR-193b Sensitized MCF-7/DOXR Cells to Doxorubicin through the Downregulation of MCL-1. 4. Discussion. [score:4]
We observed that the transfection of pcDNA3.1-MCL-1 totally reversed the downregulation of MCL-1 by miR-193b (Figure 4(a)). [score:4]
As shown in Figure 3(b), miR-193b significantly suppressed the luciferase activity of the pMIR reporter with wild-type 3′-UTR of MCL-1, whereas the mutant MCL-1 3′UTR or empty pMIR-luciferase activity remained unchanged in cells transfected with miR-193b. [score:3]
Interestingly there was a negative correlation between the expression levels of miR-193b and MCL-1 in MCF-7/DOXR cells. [score:3]
Furthermore, we also examined the effect of MCL-1 overexpression on apoptotic cell death in MCF-7/DOXR cells treated with doxorubicin and miR-193b. [score:3]
Taken together, MCL-1 is a potential target through which miR-193b modulates doxorubicin resistance in human breast cancer. [score:3]
Furthermore, our study provided new insight into the molecular basis of doxorubicin resistance; that is, miR-193b sensitizes breast cancer cells to doxorubicin by targeting myeloid cell leukemia-1 (MCL-1). [score:3]
More importantly, the overexpression of MCL-1 significantly reversed the viability of the MCF-7/DOXR cells treated with miR-193b and doxorubicin (Figure 4(b)). [score:3]
MCL-1 has been reported as a potential target gene of miR-193b [13]. [score:3]
Similar to the aforementioned findings, in the present study, we found that the expression of miR-193b was lower in MCF-7/DOXR cells comparing with its parental MCF-7 cells. [score:3]
Further results showed that MCL-1 was directly regulated by miR-193b, which is in accordance with the prior finding in melanoma [13]. [score:3]
After 24 h incubation, a significant decrease in both mRNA and protein expression levels of MCL-1 was observed in MCF-7/DOXR cells transfected with miR-193b (Figure 3(a)). [score:3]
We therefore compared the expression levels of miR-193b in the drug-resistant human breast cancer cell line MCF-7/DOXR, which was established by continuous exposure to doxorubicin, with its parental MCF-7 cell line. [score:2]
The expression of miR-193b was assayed using stem-loop reverse transcription (RT) (Chen et al. [11]) followed by real-time PCR analysis. [score:2]
The mutant plasmid was created by mutating the seed regions of the miR-193b binding sites using site-directed mutagenesis kit (Takara, Japan). [score:2]
To investigate the role of MCL-1 in miR-193b regulated doxorubicin resistance, we rescued the doxorubicin- and miR-193b -treated MCF-7/DOXR cells with MCL-1 expression vector. [score:2]
Furthermore, we investigated whether overexpression of miR-193b could increase the DOX sensitivity and determined the potential role of MCL-1 in miR-193b -mediated regulation of DOX resistance in human breast cancer cells. [score:2]
These results suggest that miR-193b increases the sensitivity of breast cancer cells to doxorubicin. [score:1]
More importantly, transfection of MCF-7/DOXR cells with the exogenous miR-193b significantly decreased doxorubicin resistance. [score:1]
The 3′-UTR sequences of MCL-1 (GenBank accession number: NM_001197320) containing the putative miR-193b binding site were amplified by PCR using the cDNA from MCF-7/DOXR cells as a template. [score:1]
So the present study may provide a novel individualized treatment strategy for chemotherapy-resistant tumors by miR-193b-MCL-1-apoptosis pathway. [score:1]
To investigate the relationship between miR-193b expression and doxorubicin resistance, we established a doxorubicin-resistant MCF-7 cell line (MCF-7/DOXR) by continuous exposure of MCF-7 cells to doxorubicin. [score:1]
Figure 2(b) showed that miR-193b levels were effectively elevated by transfection with the mimics in the MCF-7/DOXR cells. [score:1]
Transfection of miR-193b Sensitized MCF-7/DOXR Cells to Doxorubicin. [score:1]
To further explore the downstream mechanism through which miR-193b modulates doxorubicin resistance, we transfected the MCF-7/DOXR cells with miR-193b mimic or NCO. [score:1]
Furthermore, we cotransfected miR-193b mimic or NCO together with the pMIR-reporter luciferase plasmid containing 3′UTR of MCL-1 into the MCF-7/DOXR cells. [score:1]
As shown in Figure 2(d), miR-193b enhanced apoptosis in MCF-7/DOXR cells during the doxorubicin treatment. [score:1]
As shown in Figure 1(a), the levels of miR-193b were significantly lower in MCF-7/DOXR cell line than in its parental MCF-7 cell line. [score:1]
The sequences were as follows: miR-193b mimic, AACUGGCCCUCAAAGUCCCG CU; NCO, GCUCCCAACCCUUGGCCCAAGU. [score:1]
MCF-7/DOXR cells were transfected with the MCL-1 3′UTR pMIR firefly luciferase reporter vector, control Renilla luciferase pRL-TK vector, and miR-193b mimic or NCO using Lipofectamine 2000 reagent. [score:1]
The recombinant plasmid was named pcDNA3.1-MCL-1. Human miR-193b (50 nM), NCO (50 nM), pcDNA3.1 (2  μg/mL), pMIR reporter plasmid (2  μg/mL), and control Renilla luciferase pRL-TK vector (100 ng/mL, Promega, USA) were transfected into MCF-7/DOXR cells using Lipofectamine 2000 (Invitrogen, USA) when the cells were covered at approximately 80% confluence of the plate. [score:1]
However, the role of miR-193b in drug resistance of breast cancer cells remains unknown. [score:1]
miR-193b mimic and negative control oligonucleotide (NCO) were purchased from Genepharma Company (China). [score:1]
We observed that the MCF-7/DOXR cells transfected with miR-193b exhibited significantly enhanced sensitivity to doxorubicin comparing with those transfected with NCO, with IC [50] values of 2.180 ± 0.602 and 7.840 ± 0.901  μg/mL, respectively (Figure 2(c)). [score:1]
[1 to 20 of 40 sentences]
2
[+] score: 82
By target prediction and GO analysis, we found low levels of these miRNAs may ease post-transcriptional suppression of their up-regulated mRNA targets related to several neurodegenerative signaling pathway, including PI3K-Akt signaling pathway (hsa-miR-183 andhsa-miR-193b), mTOR signaling pathway (hsa-miR-193b and hsa-miR-3935), regulation of actin cytoskeleton (hsa-miR-193b and hsa-miR-3935), axon guidance (hsa-miR-193b and hsa-miR-3935), MAPK signaling pathway (hsa-miR-183 andhsa-miR-3935) and so on. [score:11]
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
Similarly, the miR-193b was also reported to modulate cell proliferation (Chen et al., 2010; Gao et al., 2011), migration, and invasion (Hu et al., 2012), and downregulation of miR-193b contributes to enhanced tumor progression and invasion through its target gene-neurofibromin 1(NF1) (Li et al., 2009; Lenarduzzi et al., 2013). [score:6]
Downregulation of miR-193b contributes to enhance urokinase-type plasminogen activator (uPA) expression and tumor progression and invasion in human breast cancer. [score:6]
A functional network (Figure 4 and Supplementary Table 1 [miRNAs-pathways]), based on Gene Ontology and KEGG database, was constructed to visualize the connections of hsa-miR-183, hsa-miR-193b, hsa-miR-3935, and their predicted targets (hsa-miR-451, which target genes were less and failed to construct the pathway net, was rule out). [score:5]
MicroRNA-193b is a regulator of amyloid precursor protein in the blood and cerebrospinal fluid derived exosomal microRNA-193b is a biomarker of Alzheimer's disease. [score:4]
It is noteworthy that the hsa-miR-193b showed opposite direction of relative expression with microarray analysis in the validation stage. [score:4]
There was no significant difference in the expression of hsa-miR-193b between PD patients and HCs, and between SALS patients and PD patients (Table 4). [score:3]
The significant differences in the expression levels of four miRNAs (hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935) were confirmed between the SALS patients and HCs (Figure 2). [score:3]
These miRNAs, including hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935, were down regulated in SALS patients relative to healthy controls, with AUC values of 0.69, 0.62, 0.81, and 0.57, respectively. [score:2]
Four miRNAs, including hsa-miR-34a, hsa-miR-100, hsa-miR-193b, hsa-miR-4485, with significantly higher expression levels were identified in the SALS group compared with those in the healthy control group (mean ratio = 2.11−3.12, p < 0.05, Table 2, Figure 1). [score:2]
In the present study, we observed significantly lower expression of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 in SALS patients compared with controls. [score:2]
In summary, our pilot study showed that peripheral blood leukocytes miR-183, miR-193b, miR-451, and miR-3935 are down regulated in SALS, which raises the potential clinical utility of leukocytes miRNA profiling in SALS diagnosis. [score:2]
Moreover, previous study found the miR-193b may take part in the development of AD and is a potential blood -based biomarker of mild cognitive impairment and AD (Liu et al., 2014). [score:2]
MicroRNA-193b regulates c-Kit proto-oncogene and represses cell proliferation in acute myeloid leukemia. [score:1]
The ROC curve analyses revealed that the levels of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 were useful biomarkers for the diagnosis of ALS, with AUC values of 0.763 [95%CI: 0.677–0.835], 0.713 [95%CI: 0.624–0.792], 0.820 [95%CI: 0.740–0.884], and 0.590 [95%CI: 0.497–0.679], respectively. [score:1]
ROC curve analyses revealed that the plasma levels of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 were useful biomarkers for differentiating SALS and HCs, with AUC values of 0.763, 0.713, 0.820, and 0.590, respectively. [score:1]
The four miRNAs were combined as a panel of miRNAs by the logit mo del, which was used to construct the ROC curve as follow, logit (p = SALS) = 3.152 − 0.708 × hsa-miR-193b − 1.517 × hsa-miR-183 − 0.147 × has-miR-3935 − 3.331 × hsa-miR-451. [score:1]
However, the accurate mechanisms of the miR-193b causing neurodegeneration remained unknown. [score:1]
MicroRNA-193b enhances tumor progression via down regulation of neurofibromin 1. PLoS ONE 8: e53765. [score:1]
Among the four miRNAs, hsa-miR-193b had the highest specificity with the cut-off value of 0.7675, and hsa-miR-3935 had the highest sensitivity when its cut-off value is 4.2734 (Table 3). [score:1]
MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. [score:1]
[1 to 20 of 23 sentences]
3
[+] score: 58
Together, these findings indicate that a similar approach might be applied in the context of Cutaneous Leishmaniasis, where the altered expression of miR-193b and miR-671 could be reverted in order to downregulate TNFR expression. [score:8]
We found only STAT3 as a potential target for miR-671 and 11 target genes for miR-193b considering both data sets (Figure 4A). [score:5]
Figure 4The expression of miR-193b and -671 and their target genes as key in localized cutaneous leishmaniasis (LCL) outcome. [score:5]
It is tempting to speculate that the axis of miR-193b, miR-671, and TREM-1 is a potential candidate to the development of new tools to manage this disease and other inflammatory skin disorders. [score:4]
The involvement of miR-193b in the regulation of relevant target genes has already been described for different types of cancers (71– 73) and for hepatitis B infection in humans (74). [score:4]
The statistical significance (p-value) of the correlations between miR-193b (Figure 4C) and miR-671 (Figure 4D) with their target genes reinforced the relevance of miRNAs in the regulation of inflammation. [score:4]
Furthermore, no reports in the literature have described altered expression of miR-193b and miR-671 in the same context. [score:3]
In addition, manipulation of the miR-193b and TREM-1 axis could also be useful for other inflammatory diseases, since the mechanism by which TREM-1 promotes inflammation seems to be common for distinct mo dels of immune -mediated illness. [score:3]
From this analysis, only miR-193b and miR-671 had significant mRNA targets that matched these criteria. [score:3]
The expression levels of hsa-miR-155, hsa-miR-503, hsa-miR-193b, hsa-miR-99a, and hsa-miR-221 were normalized with SNORD8, SNORA70, and SNORD46 used as endogenous controls. [score:3]
Interestingly, only miR-193b had a negative correlation with its target genes (Figure 4B), suggesting that miR-193b could play a significant role in the amplification of the inflammatory response observed in LCL. [score:3]
The present study identifies miR-193b as a candidate to antagonize TREM-1 expression under inflammatory conditions in an endogenous manner. [score:3]
MicroRNA-193b and -671 and Their Targets Genes Correlate With LCL Outcome. [score:2]
In this study, we identified both miR-193b and miR-671 as relevant regulators of the inflammatory response observed in human LCL patients. [score:2]
As expected, there was a negative correlation between miR-193b and CD40, meaning that increased levels of CD40 are frequently related with reduced miR-193b (Figure 4E), which contributes to the inflammatory response. [score:1]
We observed that the axis of miR-193b, miR-671, and TREM-1 could be used as a predictive marker of prognosis for human LCL. [score:1]
The most significant genes (CD40 and TNFR) were selected for detailed correlation analysis with miR-193b (Figure 4E) and miR-671 (Figure 4F). [score:1]
Only patients with a good response to treatment (0–59 days) presented negative correlations (red lines) among miR-193b, TREM-1, miR-671, and LFA-1. On the other hand, patients who needed more than 60 days to be cured presented only positive correlations (blue lines) between different molecules, such as GRB2 and STAT5. [score:1]
In addition, there was no correlation among miR-193b, miR-671, and TREM-1 in patients who required more than 90 days of treatment (Figure 4G), suggesting a role for miR-193b, miR-671, and TREM1 in better prognosis for LCL. [score:1]
Spearman correlations between (E) miR-193b/CD40 and (F) miR-671/TNFR. [score:1]
[1 to 20 of 20 sentences]
4
[+] score: 57
a Over -expression of miR-31 restores chemo-response by reducing stathmin expression; miR-101/stathmin pathway contributes to radioresistance in human NPC; down-regulation of miR-193b promotes migration and proliferation of tumor cells by targets stathmin; miR-223 regulates stathmin by JNK signaling pathway to regulate MPM cell motility; b up-regulation of miR193b reduces proliferation and migration by inhibiting stathmin and uPA; silencing of miR-210 promotes proliferation of cancerous cells; transfection of miR-142 and miR-223 decreases expression of stathmin and IGF-1R to inhibit proliferation of cancerous cells; c microrna-9 inhibits cell proliferation, vasculogenic mimicry and tumor growth through controlling stathmin expression; miR-101 suppresses autophagy via targets stathmin and down-regulation of miR-101 is linked to the increase of cellular proliferation and invasiveness. [score:32]
Interestingly, overexpression of miR-193b suppresses the proliferation, migration and invasion of pancreatic cancer Panc-1 cells by inhibiting the expression of stathmin and urokinase-type plasminogen activator (uPA) [26]. [score:9]
Down-regulation of miR-193b is closely associated with overexpression of stathmin in melanoma, which is identified to be conducive to promote the migration and proliferation of tumor cells [71]. [score:6]
miRNAs small non-coding regulatory RNAs, JNK c-JunN-terminalkinase, uPA urokinase-type plasminogen activator, IGF-1R insulin-like growth factor-1 receptor, MPM malignant pleural mesothelioma Elevation of miR-193b impedes the ability of esophageal cancer cells to recover following 5-fluorouracil (5-FU) treatment through the regulation of autophagy, which suggests that it may mediate some of its effects through stathmin regulation (potential autophagy regulator) [72]. [score:5]
miRNAs small non-coding regulatory RNAs, JNK c-JunN-terminalkinase, uPA urokinase-type plasminogen activator, IGF-1R insulin-like growth factor-1 receptor, MPM malignant pleural mesothelioma Elevation of miR-193b impedes the ability of esophageal cancer cells to recover following 5-fluorouracil (5-FU) treatment through the regulation of autophagy, which suggests that it may mediate some of its effects through stathmin regulation (potential autophagy regulator) [72]. [score:5]
[1 to 20 of 5 sentences]
5
[+] score: 54
The downregulation of mR-193 is quantitatively comparable with the upregulation achieved in panel A. (D) HepG2 cells were transfected with GAPMER control or GAP1 alone or in association with anti-miR-193b, and cell viability assessed by CellTiter-Blue at 48 hours. [score:7]
Among these nine miRNAs, miR-615, miR-193b and miR-346 were upregulated after inhibition of uc. [score:6]
We have previously shown that miR-193b mediates apoptosis through targeting of mcl-1, 12 and the overexpression of uc. [score:5]
158− in Huh-7 cells induced downregulation of miR-193b (figure 7C). [score:4]
Indeed, miR-193b was shown to be downregulated in human HCC. [score:4]
158− in HCC nicely fits with these data as well as with the previous work that found downregulation of miR-193b in a subgroup of HCCs. [score:4]
miR-193b was found to be overexpressed in Huh-7 versus HepG2 cells (in line with uc. [score:3]
158− changed miR-193b expression in human malignant hepatocytes. [score:3]
158− in HepG2 cells, with miR-193b showing the most significant increase and having higher values of expression (figure 7A). [score:3]
158− inhibitor and anti-miR-193b rescued the effect of uc. [score:3]
In three independent experiments, miR-193b expression was higher in Huh-7 in comparison with HepG2. [score:3]
Bars represent logarithmic expression of miR-193b in Huh-7 versus HepG2. [score:3]
We then looked at the level of miR-193b in the sera of patients with HCC (n:10) who were naive for any treatment. [score:1]
Patients with low circulating miR-193b had mainly alpha-fetoprotein (AFP) negative tumours, in line with previous reports of observed lower levels of AFP in CTNNB1-mutated HCC 41 (figure 7E). [score:1]
Co-transfection of GAP1 and anti-miR-193b could rescue the biological effect of uc. [score:1]
miR-193b was predicted to have binding sites within the uc. [score:1]
χ [2] test was used to assess the correlation between miR-193b and alpha-fetoprotein (AFP) groups. [score:1]
158− and miR-193b was assessed by real-time PCR. [score:1]
[1 to 20 of 18 sentences]
6
[+] score: 46
In particular, previous studies showed that miR-26a sensitized gastric cancer to cisplatin targeting NRAS and E [2]F [2] [22], miR-149 increased chemosensitivity of glioblastoma to Temozolomide treatment through a RAP1B -mediated remo deling of cellular cytoskeleton [23], miR-181a enhanced Adryamicin -induced apoptosis targeting Bcl-2 [24], miR-193b sensitized cancer cells to Doxorubicin targeting myeloid cell leukemia-1 (MCL-1) [25], miR-195 increased Adriamycin sensibility by downregulating RAF [26], and, finally, miR-324-3p induced drug sensitivity reducing its SMAD7 target mRNA that is associated with lung, pancreas and skin cancer [27]. [score:12]
Since miR-26a, miR-149, miR-181a, miR-193b, miR-195 and miR-324-3p are resulted to be upregulated (Figure 5) and data in literature showed their involvement in increasing drug sensitivity, we assessed also the expression levels of miR-26a and its potential target E2F2 (Hs00918090_m1) (Supplementary Figure 5). [score:8]
Conversely, miR-23a, miR-149, miR-193b, and miR-324-3p were upregulated, whereas miR-15b, miR-29a, miR-181a, miR-195, and miR-494 were downregulated (Figure 6). [score:7]
Figure 6MiRNAs deregulation was confirmed by TaqMan miRNA expression assays that specifically allowed to detect the expression levels of following miRNAs: miR-23a (Hs03659093_s1), miR-149 (Hs04231523_s1), miR-193b (Hs04231607_s1), miR-324-3p (Hs04273262_s1), miR-15b (Hs04231486_s1), miR-29a (Hs03849009_s1), miR-181a (Hs04231460_s1), and miR-195 (Hs03656088_s1) (Supplementary Figure 6). [score:5]
The upregulation of other miRNAs, such as miR-149 (Hs04231523_s1), miR-181a (Hs04231460_s1), miR-193b (Hs04231607_s1), miR-195 (Hs03656088_s1) and miR-324-3p (Hs04273262_s1), was confirmed by TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
Figure 6 MiRNAs deregulation was confirmed by TaqMan miRNA expression assays that specifically allowed to detect the expression levels of following miRNAs: miR-23a (Hs03659093_s1), miR-149 (Hs04231523_s1), miR-193b (Hs04231607_s1), miR-324-3p (Hs04273262_s1), miR-15b (Hs04231486_s1), miR-29a (Hs03849009_s1), miR-181a (Hs04231460_s1), and miR-195 (Hs03656088_s1) (Supplementary Figure 6). [score:5]
In MDA-MB-231 cells, among upregulated miRNAs there are miR-26a, miR-149, miR-181a, miR-193b, miR-195 and miR-324-3p that increase drug responsiveness. [score:4]
[1 to 20 of 7 sentences]
7
[+] score: 42
In order to confirm the results of the microarray analysis, we conducted a northern blot analysis to detect the expression levels of 8 representative differentially expressed miRNAs identified using the microarray, including 4 upregulated miRNAs (miR-196a, miR-193b, miR-383 and miR-143) and 4 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b and miR-590). [score:11]
A northern blot analysis was conducted to confirm that miR-196a and miR-490-5p were indeed differentially expressed in all 3 samples, which is consistent with the microarray results, whereas miR-193b and miR-383 were found to be upregulated in only 2 samples, and miR-1307 was downregulated in only 1 sample. [score:9]
The miRNAs that exhibited at least a 2-fold change in expression in the hADSCs before and after the induction of chondrogenic differentiation are listed in Table I, and these include 12 upregulated miRNAs (miR-196a, miR-143, miR-383, miR-193b, let-7i, miR-26a, miR-539, miR-199a-3p, miR-337-5p, miR-146a-5p, miR-646, and miR-381) and 8 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b, miR-96-3p, miR-302-3p, miR-23a-3p, miR-590, and miR-510). [score:9]
However, only 5 miRNAs [miR-196a, miR-193b, miR-383 (upregulated), miR-490-5p and miR-1307 (downregulated)] produced northern blot analysis signals. [score:7]
The results from northern blot analysis also revealed that miR-196a was overexpressed in all the 3 samples, whereas miR-193b and miR-383 were overexpressed in only samples 1 and 3 between the undifferentiated hADSCs and the hADSCs which were subjected to chondrogenic differentiation. [score:5]
The probe sequences were as follows: miR-196a antisense, 5′-CCCAACAACATGAAACTACCTA-3′; miR-193b antisense, 5′-AGCGGGACTTTGAGGGCCAGTT-3′; miR-383 antisense, 5′-AGCCACAATCACCTTCTGATCT-3′; miR-490-5p antisense, 5′-ACCCACCTGGAGATCCATGG-3′; miR-1307 antisense, 5′-AGCCGGTCGAGGTCCGGTCGA-3′; and U6 antisense, 5′-GCCATGCTAATCTTCTCTGTATC-3′. [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 35
For example, the up-regulation of miR-34a and miR-195 was associated with a down-regulation of BCL2 and SGK1 protein levels, respectively; whereas the down-regulation of miR-193b, miR-221, miR-222 and miR-7 was associated with an up-regulation of MCL1, BCL2L11 (Bim), CDN1B (p 27) and VDAC1 protein levels, respectively (Figure 9A). [score:13]
Finally, the Par-4-down-regulated microRNA miR-193b was predicted to target the pro-survival gene MCL1. [score:6]
Our qRT-PCR results showed that miR-18a, miR-193, miR-221, miR-222 and miR-7 were down-regulated, whereas miR-195, miR-30d and miR-34a were up-regulated in Par-4 -transfected cells when compared with empty vector -transfected cells (Figure 8C). [score:6]
To the best of our knowledge, the predicted target mRNAs of miR-193b, miR-195 and miR-7 have yet to be functionally validated; whereas BCL2, BCL2L11 (Bim) and CDN1B (p 27) have been functionally validated (by Western blot or qRT-PCR analysis) as target mRNAs of miR-34a, miR-221 and miR-222 in human neuroblastoma, prostate cancer and rat PC12 cell lines [40- 42]. [score:5]
Eleven (miR-30d, miR-10b, miR-34a, miR-195, miR-222, miR-221, miR-31, miR-7, miR-663, miR-193b and miR-18a) out of 22 deregulated microRNAs accounted for the 283 predicted target mRNAs linked to cell death (e. g. pro- or anti-apoptotic genes) (see Additional file 8). [score:4]
Fold changes for miR-18a, miR-193b, mi-195, miR-221, miR-222, miR-30d, miR-30d, miR-34a and miR-7 are indicated. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 27
miR-193b (−6/−4 fold, SOLiD/RT-qPCR) down-regulation has been observed in cancer [52, 53] suggesting that its pro-proliferation mRNA targets are not inhibited in cancers as well as in meningiomas. [score:8]
Li J. Kong F. Wu K. Song K. He J. Sun W. miR-193b directly targets STMN1 and uPA genes and suppresses tumor growth and metastasis in pancreatic cancer Mol. [score:6]
miR-193b presumably targets RUNX1T1 mRNA, however in this study miR-193b was also downregulated (Table 3). [score:6]
After verification of the top 18 miRNAs by RT-qPCR with fold change values over ±5.17 in any of these comparisons, only six miRNAs (miR-21, miR-34a, miR-143, miR-193b, miR-218, and miR-451) were clearly differentially expressed (tumors vs. [score:3]
Our results indicate that meningioma tumor formation and proliferation in part could be attributed to the lower expression of miR-143, miR-193b and miR-451, a feature similar to that of several malignant tumors. [score:3]
Chen J. Feilotter H. E. Paré G. C. Zhang X. Pemberton J. G. Garady C. Lai D. Yang X. Tron V. A. MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma Am. [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 23
0037395.g003 Figure 3(A) Serum miR-122 expression levels; (B) Serum miR-192 expression levels; (C) Serum miR-193 expression levels; (D) Biochemical parameter: serum ALT levels; (E) Biochemical parameter: serum AST levels. [score:7]
0037395.g004 Figure 4(A) Serum miR-122 expression levels; (B) Serum miR-192 expression levels; (C) Serum miR-193 expression levels; (D) Biochemical parameter: serum ALT levels; (E) Biochemical parameter: serum AST levels; The absolute concentrations of target miRNAs were calculated by referring to calibration curves developed with corresponding synthetic miRNA oligonucleotides. [score:7]
By individual TaqMan qRT-PCR analysis of dysregulated serum miRNAs uncovered by serum TLDA and dysregulated liver tissue miRNAs uncovered by microarray hybridization in primary screening, 6 serum miRNAs, including miR-122, miR-192, miR-193, miR-200a, miR-21 and miR-29c, exhibited a high correlation with primary screening results. [score:3]
In the dose -dependent analysis of the serum miRNAs miR-122, miR-192 and miR-193, miR-122 showed extremely high sensitivity in both 2 DILI mo del groups (fold change >50.0), while serum biochemical parameters (e. g., ALT and AST) displayed only mild sensitivity (fold change <20.0) in the high-dose group. [score:1]
Our results demonstrate that a new panel of serum miRNAs (miR-122, miR-192 and miR-193) could have the potential to serve as sensitive, specific and noninvasive biomarkers for the diagnosis of DILI. [score:1]
In summary, serum miR-122, miR-192 and miR-193 constitute a new panel for compound- and herb -induced liver injury diagnosis. [score:1]
Among this set of serum miRNAs, miR-122, miR-192 and miR-193 presented a significant change in both DILI mo del groups within the threshold of a fold change >10 and P-value<0.05 (Table 1). [score:1]
The panel of aberrantly expressed serum miRNAs (miR-122, miR-192 and miR-193) all exhibited time- and dose -dependent characteristics. [score:1]
In the time -dependent analysis of the serum miRNAs miR-122, miR-192 and miR-193, all of these serum miRNAs exhibited an ascending trend 3 h after administration in both DILI mo del groups (fold change >2.0); while serum biochemical parameters (e. g., ALT and AST) remained at baseline levels (fold change <1.5). [score:1]
[1 to 20 of 9 sentences]
11
[+] score: 20
Consistent with our results, CCND1, KRAS and MCL1 are identified as miR-193 target genes (26, 32, 33, 37). [score:3]
We showed that miR-193a and miR-193b inhibited BrdU incorporation and induced caspase 3/7 activation in A2780 cells, indicating that these miRNAs could affect cell cycle and apoptotic gene pathways. [score:3]
We examined whether miR-124a, miR-192, miR-193a and miR-193b affected DNA synthesis to inhibit cell proliferation in A2780 cells. [score:3]
As shown in Fig. 2A, miR-124a, miR-192, miR-193a and miR-193b decreased an incorporation of BrdU compared with the negative control, indicating that these miRNAs induced the inhibition of DNA synthesis in A2780 cells. [score:2]
The result indicated that miR-193a and miR-193b could induce the apoptotic cell death in A2780 cells. [score:1]
We discovered pro-proliferative miRNAs (miR-9 [*], miR-93, miR-130a, miR-130b, miR-301, miR-302b, miR-302d, miR-363, miR-372, miR-373), and anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506, miR-517c) in A2780 cells. [score:1]
To further evaluate miRNA mimics on the inhibition of cell proliferation in A2780, we selected top 10 anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506 and miR-517c) from the first screen, and examined the cell viability in A2780 cells transfected with different concentrations of miRNAs (5, 25, 50 nM). [score:1]
Anti-proliferative and pro-apoptotic functions of miR-193 are reported in several cancer cell lines including MDA-MB-453 (breast cancer), Malme-3M, SKMEL-28, SKMEL-5 (melanoma), HO-1-N-1, HSC-2 (oral squamous cell carcinoma), 22Rv1 (prostate cancer), SK-Hep-1 (hepato-cellular carcinoma) and Kasumi-1 (acute myeloid leukemia) (26, 31– 36). [score:1]
We found several anti-proliferative miRNAs including miR-124, miR-192 and miR-193 in A2780, suggesting that the potential of miRNA screens for discovering miRNAs as therapeutic tools to treat ovarian cancer. [score:1]
We found that miR-193a and miR-193b but not miR-124a and miR-192 induced more than twofold increase in an activity of caspase 3/7, the effector of apoptotic pathway, in A2780 cells (Fig. 2B). [score:1]
pro-proliferative miR-93, miR-302b, miR-302d, miR-372, miR-373 and anti-proliferative miR-193a, miR-193b), supporting the importance of the seed region of miRNA on its function. [score:1]
For example, miR-93/miR-302/miR-372/mir-373 seed family miRNAs (miR-93, miR-302b, miR-302d, miR-372, miR-373) were pro-proliferative, while miR-193 seed family miRNAs (miR-193a, miR-193b) were anti-proliferative (Table I). [score:1]
We confirmed results of our first screening at 50 nM, and found that the transfection of miR-124a, miR-192, miR-193a and miR-193b induced a large decrease in the cell viability of A2780 even at 5 nM (Fig. 1B), indicating that these miRNAs had a profound anti-proliferative effect in A2780 cells. [score:1]
[1 to 20 of 13 sentences]
12
[+] score: 20
Both miR-193b and miR-365a could acted as a tumor suppressor in the epidermis by directly targeting KRAS oncogene [79]. [score:6]
Interestingly, activation of the RAS-MAPK pathway mediated by miR-193b up-regulation correlated with a lower disease-free survival and could serve as a novel prognostic biomarker in HNSCC [121]. [score:6]
MiR-193b was overexpressed in HNSCC, and directly targeted the NF1 mRNA. [score:5]
In a mo del of chemically induced mouse skin tumorigenesis, the miR-193b/365a cluster expression was significantly reduced during tumor progression. [score:3]
[1 to 20 of 4 sentences]
13
[+] score: 19
A significant number of genes associated with metastasis were overexpressed in tumors classified into the serum miRNA cluster 1. (A) Box plots representing microarray expression results for miR-141, miR-200b, miR-193b and miR-301 from two different studies performed in lung primary tumors. [score:5]
A supervised diagnostic miRNA signature composed of 4 miRNAs (miR-141, miR-200b, miR-193b and miR-301) which were up-regulated in NSCLC tumors and serum was selected to validate its diagnostic value in an independent cohort of age and sex-matched serum samples. [score:4]
We identified 4 miRNAs that fulfilled these criteria: miR-141, miR-200b, miR-193b and miR-301, since they were significantly overexpressed in lung AC and/or SCC versus normal lung samples (Fig. 3A) as well as in the serum of NSCLC patients versus NC (Fig. 3B). [score:3]
Validation results showed that all 4 miRNAs were significantly overexpressed in the NSCLC sera (p < 0.001) and the log [2] fold-change for miR-141, miR-200b, miR-193b and miR-301 were 2.67, 2.98, 2.52 and 2.01 respectively. [score:3]
Only 5 miRNAs were found overexpressed in both lung AC and lung SCC primary tumors (miR-141, miR-200b, miR-193b, miR-200c and miR-106b) as well as in the NSCLC serum. [score:3]
To validate these findings, we measured by RT-PCR the expression level of miR-141, miR-200b, miR-193b and miR-301 in the serum of an independent cohort of 84 NSCLC and 23 age and sex-matched NC subjects. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 19
The expression of miR-342-3p was unchanged while miR-193b expression was slightly induced during the monocyte-to-macrophage transition, while both increased significantly in response to IL-4. In contrast, miR-99b and miR-125a-5p showed a significant induction during monocyte–macrophage differentiation. [score:5]
We examined miR-193b and miR-342-3p as two of the highly expressed IL-4 -induced miRNAs. [score:3]
The IL-4 -dependent induction of mir-193b expression is known, hence we used it as an adequate control of our differentiation method [24]. [score:3]
In contrast, miR-193b expression did not change upon IL-4 treatment. [score:3]
We found IL-4 -dependent induction of miR-342-3p and miR-193b and repression of miR-99b and miR-125a-5p. [score:1]
Some miRNAs from our study, including miR-342-3p and miR-193b, may be promising candidates as potential biomarkers in combination with other well characterized alternative macrophage activation-specific genes and proteins in human diseases. [score:1]
a Stem-loop RT-qPCR -based measurement of miR-342-3p, miR-193b, miR-99b, and miR-125a-5p expression in IL-4-stimulated and unstimulated mouse bone marrow-derived macrophages. [score:1]
Finally, miR-193b has been found to be induced by IL-4 in human macrophages, although its function remains unknown [24]. [score:1]
c Stem-loop RT-qPCR -based measurement of miR-342-3p, miR-193b, miR-99b, and miR-125a-5p expression in human monocytes, 72-h nontreated, and IL-4-stimulated macrophages. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
In contrast, upregulation of miRNA-193b-3p activated mTORC1 signaling leading to the inhibition of autophagy and promoted cell death (Li et al., 2017). [score:6]
Downregulation of miRNA-193b-3p promoted autophagy and cell survival by targeting TSC1/mTOR signaling pathway in NSC-34 cell mo del of ALS. [score:6]
Downregulation of MicroRNA-193b-3p promotes autophagy and cell survival by targeting TSC1/mTOR signaling in NSC-34 cells. [score:5]
Li et al. (2017) demonstrated that miRNA-193b-3p plays a vital role in the pathogenesis of ALS. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 18
Specifically, miRNA-seq analysis identified 5 up-regulated cardiac specific miRNAs (miR-29a, miR-29b, miR-133, miR-193 and miR-223) previously identified for being regulators of cardiac development and homeostasis (Fig.   2). [score:6]
Targetscan software [50] predicted about 51 common targets for miR-29a, miR-29b, miR-133, miR-193 and miR-223 (Fig.   2C, middle panel). [score:5]
Table  2, miR-29a, miR-29b, miR-133, miR-193 and miR-223 were selected among the 10 most up-regulated miRNAs associated to the aging heart 43, 47– 49. [score:4]
Venn diagrams depicting the distribution of miR-133, miR-193, miR-29a/b, miR-223 predicted targets (middle panel). [score:3]
[1 to 20 of 4 sentences]
17
[+] score: 18
Conversely, CREBRF and PTEN were up-regulated and observed jointly with down-regulation of their predicted miRNA regulators, miR-193 and miR-486, respectively. [score:8]
Other up-regulated genes that are also targets of miR-193 included mediators of obesity, related inflammatory cytokine and leptin signaling (JAK2) [78, 79] as well as atherosclerosis (SCARF2/SREC-I) [80]. [score:6]
After HGHF diet, miR-193 was significantly down-regulated. [score:4]
[1 to 20 of 3 sentences]
18
[+] score: 18
miRNA-31 downregulation conferred resistance to radiotherapy and chemotherapy in several types of cancers [37], [38], and downregulation of miRNA-30a [39], miRNA-203 [40], miRNA-183 [41], miRNA-130a [42], miRNA-24 [43] and miRNA-23a [43], and upregulation of miRNA-193b [44] increased tumor cells resistant to chemotherapy. [score:10]
Our results showed that miRNA-23a, miRNA-203, miRNA-31, miRNA-30a, miRNA-183, miRNA-130a, and miRNA-24 were downregulated, and miRNA-193b upregulated in the radioresistant NPC cells, suggesting that deregulation of these miRNAs might be involved in the NPC radioresistance. [score:8]
[1 to 20 of 2 sentences]
19
[+] score: 17
The boxplots show significant downregulation of miR-130a-3p a, miR-149-5p b, miR-423-5p c, miR-487b-3p d and miR-193b-3p e in the FET placentae. [score:4]
The decreased expression of miR-193b-3p might be due to procedures common to FET and ET, including ovulation-induction methods, insemination, culture system, and embryo transfer. [score:3]
There were weak inverse correlations between miR-193b-3p expression and not only placental weight (R = −0.29, p = 0.0047) but also adjusted birthweight (R = −0.29, p = 0.0050). [score:3]
miR-193b-3p was significantly downregulated in FET and ET placentae compared with SP placentae. [score:3]
Correlation between miR-193b-3p expression and adjusted birthweight or placental weight. [score:3]
The lack of a significant difference in birthweight and placental weight between ET and SP might be due to factors that compensate for the influence of miR-193b-3p and complement the increases of fetal and placental growth in ET. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 17
Bao et al. [37] studied a set of miRNAs related to kidney development and diseases (miR-193a, miR-21, miR-15a, miR-16, and let-7e) in a mo del of high-glucose EMT in HPMCs and found miR-193 upregulation, miR-15a and let-7e downregulation, and no significant changes for miR-16 and miR-21 [37]. [score:10]
When the same mo del was analyzed by Zhou et al. [19], peritoneal fibrotic tissues displayed upregulation in 8 miRNAs (miR-205, miR-664, miR-352, miR-146b-5p, predicted miR-160, miR-132, miR-15b, and let-7d) while 15 were downregulated (miR-335, miR-923, miR-801, miR-200a, miR-801, miR-30a, miR-193a-3p, miR-193b, miR-29b, miR-203, miR-148a, miR-709, miR-192, miR-15a, and miR-26b) [19]. [score:7]
[1 to 20 of 2 sentences]
21
[+] score: 16
However, a solid relationship between miR methylation and expression has not been thoroughly established as only weak supporting evidence has been provided in many of the previous studies, as we have summarized for 9 tested miR genes/clusters (extragenic miR-9-3, miR-137, miR-200b/200a/429, miR-203, miR-375; intragenic miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210) in this present study (Additional file 1: Table S2) [19- 27]. [score:3]
Thus, CpG islands of 9 disease-related miR genes, including 5 extragenic miR genes or gene clusters (miR-9-3, miR-137, miR-200b/200a/429, miR-203, and miR-375) and 4 intragenic genes or gene clusters (miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210), were selected as the representative genes in the present study (Additional file 1: Table S1). [score:3]
We also observed methylation changes in miR-200b, miR-193b, miR-203, and miR-210 CpG islands in the development of GCs that has not been previously reported. [score:2]
Therefore, we hypothesize that miR-203 and miR-193b methylation may also be a host adaptation to the development of gastritis or GCs. [score:2]
miR-375, miR-203, and miR-193b methylation might be host adaptation to the development of GCs. [score:2]
However, correlation between H. pylori infection and miR-203 and miR-193b methylation was not found in any of the gastric tissue samples that were studied. [score:1]
We observed that the positive rate of miR-203 and miR-193b methylation increased in normal, gastritis, and SM tissues, but decreased in GCs as did miR-375 methylation pattern. [score:1]
DHPLC chromatogram of methylated and unmethylated miR-193b in various cell lines Fluorescence-detector; the partial denaturing temperature, 56.5 °C; U, peak for the unmethylated PCR products; M, peak for the methylated PCR products; B, peripheral blood DNA; MB, M. sssI-methylated blood DNA. [score:1]
miR-203 and miR-193b methylation has also been reported in hepatomas and prostate cancer, respectively [12, 37]. [score:1]
[1 to 20 of 9 sentences]
22
[+] score: 15
miR-193b is also down-regulated in breast cancer cell lines, where it is thought to repress oncogenic expression of urokinase-type plasminogen activator (uPA) [34- 36]. [score:6]
Conformational studies revealed, however, that only miR-365, miR-193b,, and were expressed in the lymphoblast cell line; and only showed a significant change in expression in response to NRF2 activation. [score:5]
miRNA Location Targets References miR 193b/365Chr16,14397824-14397906 (miR193b)14403142-14403228 (miR-365)TTf1 - oncogenicBCL2 – TSGCyclin D- TSG, uPa(Qi et al., 2012)(Nie et al., 2012)(Li et al., 2009) Chr7, 130562218-130562298Sp-1MCL-1 - oncogenicTCL1 – oncogenic(Amodio et al., 2012)(Mott et al., 2007)(Pekarsky et al., 2006) Chr19, 13985513-13985622SIRT1- oncogenic and TSGKRAS - oncogenicTGFβ - TSGTNF - TSGNOTCH - oncogenic and TSG(Zhang et al., 2012)(Schonrock et al., 2012)(Hashimoto et al., 2010) miR-617 Chr12, 81226312-81226408 N/A miR-592 Chr7, 126698142-126698238 N/A miR-1207 Chr8 129061398-129061484. [score:3]
Interestingly, both miR-365 and miR-193b can be tumor associated without the other member of the cluster. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 15
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
The second group that had a low expression level on day 1 and a high expression level on day 7 included miR-148, miR-494, miR-124, miR-193, and miR-300. [score:5]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 14
Downregulation of NF1 by microRNA-193b, which is overexpressed in sporadic head and neck squamous cell carcinomas (HNSCC), led to activation of ERK and resulted in tumour progression. [score:6]
Knockdown of miR-193b in HNSCC cells increased NF1 transcript and protein expression levels, decreased ERK phosphorylation with reduction in cell viability, migration, invasion and tumour formation [151]. [score:4]
Survival outcomes in HNSCC patients whose tumours expressed high levels of miR-193b were inferior compared to patients with low miR-193b expression. [score:4]
[1 to 20 of 3 sentences]
25
[+] score: 14
While the cluster miR-193–365 is up-regulated by Prdm16, partially through Pparγ [14], they are not required for brown fat development and function [24]. [score:5]
Of these miRNAs, 145 were expressed in both human and mouse BAT (Additional file 4), including 23 miRNAs that had the same name but their sequences differed by few nucleotides between the species (i. e. miR-155, miR-193b, miR-455). [score:3]
Homeobox C9 (HOXC9) is predicted to be targeted by miR-193, 150 and -26b. [score:3]
However, miR-193b null mice, that are also deficient in miR-365, have normal BAT development, differentiation and function [24]. [score:2]
miR-193b null mice have elevated levels of miR-455 suggesting a compensatory effect in the absence of the miR-193b-365 cluster. [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 13
The miR-126 reduces the production of CCL [2] by targeting directly the 3’-UTR of CCL [2], while miR-193b inhibited indirectly the CCL [2] production through down regulating the transcription factors of CCL [2] (RELB, STAT6, and ETS1) [2]. [score:8]
MiRNA-193b may be of particular importance since its expression was associated with TNF-α mRNA expression. [score:4]
In particular, we demonstrated a signal circuit from has-miR-193b to TNF-α either via ETS1 as a single TF step. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 13
We used miScript Primer Assays for 9 miRNAs (miR-744-5p, miR-648, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-222-3p, miR-423-3p and miR-766-3p) and QuantiTect Primer assays for 9 target genes (CDKN1A, MYC, PTEN, ESR1, ETS1, SOD2, MGMT, KRAS and HNF4A) (Qiagen, Hilden, Germany) to validate the different expression levels of the miRNA and their target genes, which are determined by miRTargetLink prediction software. [score:5]
Out of the eight miRNAs, miR-648 was up-regulated and the seven remaining miRNAs were down regulated (miR-744-5p, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-423-3p and miR-766-3p). [score:5]
Similarly, miR-423-5p, miR-193b-3p, and miR-550a-5p showed an altered expression level in patients with heart failure [56, 57]. [score:3]
[1 to 20 of 3 sentences]
28
[+] score: 12
Smoothened is a direct target of, miR-193b, miR-324-5p, miR-326, and miR-338-3p. [score:4]
Downregulation of, miR-193b, miR-324-5p, miR-326, and miR-338-3p in human cancers de-repress Smoothened and promotes tumor proliferation and invasion through aberrant Hedgehog signaling activation. [score:4]
Smoothened is a direct target of (Ferretti et al., 2008), miR-193b (González-Gugel et al., 2013), miR-324-5p (Ferretti et al., 2008), miR-326 (Ferretti et al., 2008), and miR-338-3p (Huang et al., 2011b). [score:4]
[1 to 20 of 3 sentences]
29
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Mu Y. P. Tang S. Sun W. J. Gao W. M. Wang M. Su X. L. Association of miR-193b down-regulation and miR-196a up-regulation with clinicopathological features and prognosis in gastric cancer Asian Pac. [score:7]
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
[1 to 20 of 2 sentences]
30
[+] score: 12
Iliopoulos et al. reported that the expression of miR-193a is inversely correlated with K-RAS and plasminogen activator urokinase (PLAU) expression in human colon adenocarcinomas, and that miR-193 expression inhibits tumorigenicity and invasiveness by directly targeting K-RAS and PLAU, respectively (Iliopoulos et al., 2011). [score:12]
[1 to 20 of 1 sentences]
31
[+] score: 12
The expression profile of the miRNAs that were strongly up-regulated during adipogenesis (miR-642a-3p, miR-378, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, and miR-193b) was validated by quantitative PCR (qPCR; Additional file 4). [score:6]
The expression patterns of miRNAs that were previously reported in adipocytes or their precursors are in agreement with published data, as summarized in Additional file 3. However, the adipogenesis -dependent regulation of many of the differentially expressed miRNAs we identified has never been described before; these include miR-642a-3p, miR-345, miR-193b, miR-29c, miR-664, miR-10b, miR-136, miR-22*, miR-181a, miR-154*, let-7a, let-7b and let-7c. [score:6]
[1 to 20 of 2 sentences]
32
[+] score: 12
The differential expression of six miRNAs (miR-106b#, miR-9, miR-16, miR-34a, miR-155, and miR-126) (P<0.05; FC>1.33) was confirmed in a larger set of 64 tumor samples, the fold change of miR-193b was equal to 1.23, but the trend of expression was also maintained. [score:5]
The fold change of miR-193b was equal to 1.23, and the trend of expression of four additional selected miRNAs was opposite to that revealed by arrays. [score:3]
The last miRNA selected for confirmation from the group of HPV -negative tumors was miR-193b whose high expression in tissue was identified as an independent prognostic risk factor in patients with ovarian cancer [64]. [score:3]
MiR-106b# and miR-9 were selected as specific for HPV -positive tonsillar tumors, miR-16, miR-34a, miR-193b, miR-31, miR-221, and miR-21 as specific for HPV -negative tumors, and miR-155, miR-126, and miR-205 as specific for tonsillar tumors of any etiology. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 12
Interestingly, Ikeda et al. found that miR-193b inhibits pancreatic cancer cell proliferation concomitantly with its ability to target and downregulate StarD7 transcript expression in pancreatic cells, effect associated with an inhibition in cellular proliferation [46]. [score:12]
[1 to 20 of 1 sentences]
34
[+] score: 12
In detail, the expression of miR-186, miR-215 and miR-223 resulted upregulated in ATRA differentiated cells, while the expression of miR-17-5p, miR-25, miR-193, miR-195, and let-7a resulted downregulated (the miRNAs bolded were already reported as deregulated by ATRA in differentiated NB4 cells in refs. [score:12]
[1 to 20 of 1 sentences]
35
[+] score: 11
Similarly, miR-193b-3p is downregulated in HPV16 E6/E7 -expressing HFKs, as well as in HFKs expressing HPV16 E6 or E7 alone. [score:8]
FIG 2  Validation of selected miRs identified by (A to D) Validation of miR-15b-5p (A), miR-16-5p (B), miR-193b-3p (C), and miR-203a-3p (D) levels in HPV16 E6/E7 -expressing (red) and control vector-transduced (blue) HFKs. [score:3]
[1 to 20 of 2 sentences]
36
[+] score: 11
LogFC indicates the log fold change relative to uninfected cells miR-193a-5p and miR-193b-3p are also both up-regulated at 24 hpi, and form part of the core network (Fig.   6). [score:4]
LogFC indicates the log fold change relative to uninfected cellsmiR-193a-5p and miR-193b-3p are also both up-regulated at 24 hpi, and form part of the core network (Fig.   6). [score:4]
miR-193b-3p expression during mycobacterial infection has not been reported, however a previous study identified miR-193b-3p as one of the top circulating miRNA in mice exposed to gram -positive bacterial infection, with the potential to differentiate gram -positive from gram -negative infections [50]. [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 11
Among the genes with mildly decreased expression, four (GPR146, EIF2S1, PLA2G4D and MAPK10) were possible targets of one up regulated miRNA (miRNA-193b). [score:6]
miR-199a-3p, miR-193b and miR-126 have all been implicated in the suppression of cell proliferation [41], [42], [43], [44], [45], [46], [47], [48], [49], [50], [51]. [score:3]
Of the 14 miRNAs, miR-193b and miR-338 were increased in patients, the others were decreased. [score:1]
miR-193b, however was the only reproducibly increased miRNA, which does not fit with this hypothesis. [score:1]
[1 to 20 of 4 sentences]
38
[+] score: 10
Remarkably, downregulation of miR-193b-3p by antagomiR in the NOTCH1 -induced mouse mo del significantly accelerated leukemia onset in vivo, suggesting the inhibition of tumor-suppressor miR-193b-3p can cooperate with NOTCH1 in T-ALL pathogenesis. [score:8]
Followed by in vitro luciferase reporter assay, miR-193b-3p was detected as a direct negative regulator of MYB. [score:2]
[1 to 20 of 2 sentences]
39
[+] score: 10
Other miRNAs from this paper: hsa-mir-181b-1, hsa-mir-181b-2, hsa-mir-676
To further explore the sensitivity and specificity of cmiRNAs in discriminating between acclimatized and un-acclimatized individuals, we measured the expression levels of has-miR-676-3p (MIMAT0018204), has-miR-3591-3p (MIMAT0019877), has-miR-181b-5p (MIMAT0000257) and has-miR-193b-5p (MIMAT0004767), the most differentially up-regulated cmiRNAs, by qRT-PCR. [score:4]
Indeed, has-miR-676-3p, has-miR-3591-3p, has-miR-181b-5p, and has-miR-193b-5p were differentially expressed between acclimatized and un-acclimatized individuals. [score:3]
microRNA name Forward primer Reverse primer miR-181b-5p CACGACACCAACATTCATTGC TATGGTTGTTCTCGTCTCCTTCTC miR-676-3p ACGCCGTCCTGAGGTTGT TATGGTTTTGACGACTGTGTGAT miR-193b-5p AGGCCGGGGTTTTGAGG TATGGTTGTTCACGACTCCTTCAC miR-3591-3p GCCGCTTAAACACCATTGTC TATGCTTGTTCTCGTCTCTGTGTC cel-miR-39 ATATCATCTCACCGGGTGTAAATC TATGGTTTTGACGACTGTGTGAT After microRNA profiling, we searched three well-known target prediction databases, including TargetScan (http://www. [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 10
miR-146a is abundant in immune cells in addition to its expression in the heart [42] and miR-193 is also expressed on mononuclear cells [43]. [score:5]
The remaining 14 (miR-18a-5p, miR-146a-5p, miR-30d-5p, miR-17-5p, miR-200a-3p, miR-19b-3p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-192-5p, miR-296-5p, miR-29a-3p, and miR-133a-3p) were upregulated in HCM patients with T [1] < 470 ms compared with those with T [1] ≥ 470 ms, and 11 (except miR-192-5p, miR-296-5p and miR-133a-3p) were significantly inversely correlated with postcontrast T [1] values. [score:3]
8 miRNAs (miR-18a-5p, miR-30d-5p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-296-5p, and miR-29a-3p) were selected by the mo del and the AUC for the combination of these 8 miRNAs remained 0.87 (Fig.   4). [score:1]
However, the role of miR-193 in fibrosis is unclear. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 10
down-regulated cell lines[63] CELL CYCLE miR-193b cyclin D1 down-regulated tumors[161] miR 17-92 cluster c-MYC up-regulated cell lines[62, 63] miR 106-363 cluster Rbp1-like (?) [score:10]
[1 to 20 of 1 sentences]
42
[+] score: 9
T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematological malignancy that is classified into different genetic subtypes based upon the aberrant expression of specific transcription factor oncogenes (TAL, TLX1, TLX3 or HOXA) or the arrest at a specific stage of T-cell differentiation (immature T-ALL) 1– 4. Notably, these molecular subgroups are characterized by unique mRNA and long non-coding RNA expression signatures, which partially reflect their putative cell of origin 1, 2, 5. MicroRNAs (miRNAs) are short non-coding RNAs that function as post-transcriptional repressors of specific target genes 6, 7. Several studies have previously described a role for miRNAs in malignant T-cell transformation, including the identification of both an oncogenic (miR-19b, mir-20a, miR-26a, miR-92 and miR-223) [8] as well as a tumor suppressor (miR-150, miR-155, miR-200 and miR-193b-3p) 9, 10 miRNA network involved in T-ALL disease biology. [score:9]
[1 to 20 of 1 sentences]
43
[+] score: 9
Compared with seasonal IAV strain A/Texas/36/91 (H1N1), r1918 causes strong downregulation of miR-193, miR-29a and miR-29b, while Texas/91 causes massive up-regulation of miR-193, and modest downregulation of both miR-29a and miR-29b. [score:9]
[1 to 20 of 1 sentences]
44
[+] score: 9
Li and coworkers reported that down-regulation of miR-193b contributes to enhance urokinase-type plasminogen activator expression and tumor progression and invasion in human breast cancer [63]. [score:6]
Using microarray expression profile to analyze 96 cancer-related miRNAs, Hu and coworkers were able to identify ten miRNAs (miR-200a, miR-9, miR-10b, miR-183, miR-204, miR-24, miR-181a, miR-193b, miR-146b and miR-10a) related to cervical cancer survival. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 9
Serum was also analyzed by Q-RT-PCR for a panel of 20 tissue enriched and potential miRNA biomarkers, including those identified for liver (cfa-miR-122 and -885), heart/muscle (cfa-miR-1, -133, and -206), testis (miR-34b/c), pancreas (cfa-miR-216), brain (cfa-miR-212), and ubiquitously expressed cfa-miR-193b. [score:3]
Elevation of serum cfa-miR-193b in the two dogs with liver injury (Dogs 1 and 3) was likely due to the ubiquitous expression of the miRNA in the dog, including the liver. [score:3]
Q-RT-PCR ΔCt values (y-axis) line plot per animal for duration of Day 1, 7, and 14 treatment samples tested highlights the elevation of both liver enriched miRNAs (miR-122 and miR-885) and ubiquitously expressed miR-193 in the 2 dogs with elevated ALT and AST. [score:3]
[1 to 20 of 3 sentences]
46
[+] score: 8
Downregulation of miR-193b contributes to enhance urokinase-type plasminogen activator (uPA) expression and tumor progression and invasion in human breast. [score:6]
For instance, miR-193b is characterized to have a defined role in breast cancer as its down-regulation contributes to tumor progression and invasion (Li et al., 2009). [score:2]
[1 to 20 of 2 sentences]
47
[+] score: 8
Expression of let-7i and miR-193b positively correlated with SF2, SF5 and SF8, indicating radiation resistant cell-lines had higher levels of the two microRNAs. [score:3]
All three microRNAs, let-7i, miR-142-5p and miR-193b, are known to have growth-suppressive effects [53], [54], [55]. [score:3]
Such similarity between the multiple NCI-60 microRNA datasets was also observed in correlation analysis of microRNA levels and radiation sensitivity of the cell-lines, in which microRNAs let-7i, miR-142-5p and miR-193b were identified as associated with at least one of the SF2, SF5 and SF8 radiation sensitivity parameters in datasets of this (table S3) as well as the Liu and Sokilde studies [23], [24]. [score:1]
MicroRNAs let-7i, miR-142–5p and miR-193b were common to the results with the three datasets. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 8
Other miRNAs from this paper: hsa-mir-181c, hsa-mir-210
In this study, we found a negative correlation between promoter DNA methylation and gene expression for some genes (e. g., CHCHD2, SLC16A8, hsa-mir-193b and hsa-mir-210), which is consistent with the hypothesis that promoter methylation represses gene expression. [score:5]
In mature RPE, we found a negative correlation between DNA methylation and miRNA expression for hsa-mir-193b and hsa-mir-210 clusters in the four different cell stages (Figure 3), indicating that DNA methylation is associated with the silencing of these two miRNAs. [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 8
Moreover, a further and deeper comparison among pre-miR-214-3p-EV, antago-miR-24-3p-EV and anti-IL-3R-EV miR content led us to hypothesize that their overlapping anti-angiogenic effects might also depend on the combined action of a pattern of shared miRs (miR-222-3p, miR-16-5p, miR-484 for all EV samples; miR-19b-3p miR-17-5p, miR-196b-5p, miR-365b-5p for pre-miR-214-3p-EVs and anti-IL-3R-EVs; miR-106a-5p, miR-197-3p, miR-193b-3p for antago-miR-24-3p-EVs and anti-IL-3R-EVs) which may be involved in the regulation of a network of genes related to cancer development/progression. [score:3]
a Meta-analysis algorithm of the most significant pathways targeted by miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, miR-193b-3p, miR-518d-5p and miR-191-5p. [score:3]
Such significant correlation was also found for miR-17-5p (in pre-miR-214-3p-EVs) and miR-193b-3p (in antago-miR-24-3p-EVs). [score:1]
As shown in Fig.   8a and resumed in Fig.   8b, miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, and miR-193b-3p significantly correlated with at least 2 of the following pathways: pathway in cancer, adherens junction, p53 signaling pathway, cell cycle and ECM receptor interaction; whereas, miR-518d-5p and miR-191-5p did not. [score:1]
[1 to 20 of 4 sentences]
50
[+] score: 7
For example, miR-193b, frequently down-regulated in HCC [40], melanoma [51], breast [52] and prostate cancers [53], was shown to promote apoptosis and inhibit growth of cancer cells [39], [40], [51]– [53]. [score:6]
miR-193 which shows no promoter binding in microarray serves as negative control. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 7
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-203a, hsa-mir-373, hsa-mir-203b
also reported that miR-193b as a novel tumor suppressor plays an important role in breast cancer progression by inhibiting RAB22A expression. [score:7]
[1 to 20 of 1 sentences]
52
[+] score: 7
On the other hand, HDAC inhibition also determined coherent up- or down-modulation of several miRNAs directly involved in positive (e. g. mir-129-3p, mir-193b, mir-370) or negative (e. g. mir-196b, mir-335, mir-370) control of cell cycle [44], [45], [46], [47], [48], [49], thus suggesting the existence of an epigenetically regulated negative loop protecting CD34 [+] cells from unrepressed cellular growth, and reinforcing the anti proliferative effect exerted by small cyclin/CDK inhibitors such as p14 [ARF], p16 [INK4] and p21 [Cip1/Waf1] gene products (Figure 2E). [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 7
For example, gga-miR-18, gga-miR-193a, gga-miR-193b, gga-miR-30b, gga-miR-146a, gga-miR-24, gga-miR-92, gga-miR-7b, gga-miR-7-1, and gga-miR-7-2 are up-regulated after avian influenza virus infection in previous studies whereas in our results these miRNAs are down-regulated on PID 4 33. [score:7]
[1 to 20 of 1 sentences]
54
[+] score: 7
Since many miRNAs were identified as targets of methylation regulation, such as miR-9, miR-34b/c and miR-148a in metastatic carcinomas [16], and miR-137 and miR-193a in oral cancer [17], miR-193b and miR-145 in prostate cancer [18], [19], we decided to analyze the regulatory mechanism of miR-219-2-3p expression from its genomic methylation. [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 7
For example, miR-106b, miR-107, miR-130a, miR-34 [9], miR-93, miR-155, miR-181a, miR-21, miR-23a, miR-320a [8], miR-193b, miR-320b [13] are significantly up-regulated and miR-148a [11, 14], miR-330-5p [15], miR-373 [16] significantly down-regulated. [score:7]
[1 to 20 of 1 sentences]
56
[+] score: 7
MIR31HG and miR-193b respectively regulates each expression in a RISC manner (Yang et al., 2016). [score:4]
Long noncoding RNA MIR31HG exhibits oncogenic property in pancreatic ductal adenocarcinoma and is negatively regulated by miR-193b. [score:2]
Similarly, lncRNA MIR31HG harbors two miR-193b binding sites. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 7
Similar independent studies revealed that miR-155 was overexpressed and miR-193b was downregulated in dedifferentiated liposarcoma as compared to their differentiated counterpart (Taylor et al., 2011b; Zhang et al., 2012). [score:5]
They performed supervised hierarchical clustering and found five miRNAs, miR-92a, miR-99b, miR-132, miR-193-5p, and miR-422 that could significantly differentiate between good and poor responders to IFO. [score:1]
The other study performed sequencing of genome, exome and transcriptome and found that miR-193b helps in distinguishing differentiated vs. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
MiR-96 was reported to be distinctively upregulated in HBV -associated HCC (Ladeiro et al., 2008), whereas miR-193b upregulation has been found upon transfection of HCV genome (Braconi et al., 2010). [score:7]
[1 to 20 of 1 sentences]
59
[+] score: 7
In cSCC most of the altered miRNAs are downregulated (miR-125b, miR-34a, miR-214, miR-124, miR-361, miR-193b, miR-365a, miR-20a, miR-199a) [19– 25] whereas only a small number of miRNAs have been found to be upregulated and act as onco-miRNAs, being involved in angiogenesis, colony formation, migration and invasion, and metastatic spread (miR-365, miR-9, miR-184, miR-21, miR-31, miR-135b, miR-205, let-7a) [25– 34]. [score:7]
[1 to 20 of 1 sentences]
60
[+] score: 6
In addition, miR-101, miR-193b, miR-125b, and let-7c, which are downregulated in HCC cells, might exert anti-apoptotic action via targeting Mcl-1 [9]. [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
Clustered miRNAs and homologous miRNAs had various expression levels (even involved in larger expression divergence), but they always showed consistent dysregulation patterns (For example, mir-15b cluster and mir-193b cluster; mir-15 family) although the fold change may differ. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
miR-193, -30b, -30c, -26a, and -26b are highly expressed during early development, gestation and late involution; miR-141, -200a, -148a, and -146b are highly expressed during gestation, lactation, and early and late involution. [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
Other miRNAs from this paper: hsa-mir-193a
Furthermore, TCs express c-kit in certain circumstances and the expression of micro -RNA (e. g. miR-193), which regulates c-kit, differentiates TCs from other stromal cells 35. [score:6]
[1 to 20 of 1 sentences]
64
[+] score: 6
The miRNA miR-193b-3p was shown to be an important marker in clinical metastasis of human breast cancer cells, which potentially up-regulates the expression of uPA [56]. [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
The dsyregulation of miRNAs in HCC have been reported using miRNA expression profiling studies with several miRNAs reported as enhancers (miR-30d, miR-151, miR-210) or suppressors (miR-122, let-7g, miR-29b, miR-193b, miR-194, miR-139 and miR-124) of the metastatic process [8]. [score:6]
[1 to 20 of 1 sentences]
66
[+] score: 6
Wang L MicroRNA-193b inhibits the proliferation, migration and invasion of gastric cancer cells via targeting cyclin D1Acta Histochem. [score:4]
Pathways MicroRNAs Conditions (Cancer/Stage) KIRC LIHC UCEC Stage 1 Stage 2 Stage 1 Glycolysis / Gluconeogenesis Pathway miR-18a-3p PGK1, PKM2 PKM2 PKM2 miR-320a PKM2 PKM2 PKM2 miR-193b-3p GPI, PGAM1 GPI, ALDH3A2, ALDH7A1 GPI, ALDH3A2, TPI1 miR-92b-3p PGAM1 ALDOA PGAM1 Pathways MicroRNAs KIRC LUSC UCEC Stage 1 Stage 1 Stage 1 Focal Adhesion miR-18a-3p PAK4, PIK3R3 COL4A1 COL4A1 miR-320a ACTB, CCND2 PAK1, CCND2 LAMA5, MET miR-193b-3p LAMB1 FLNA, RAPGEF1, VAV2 CCND1, PTEN, PAK2, PIP5K1C, COL4A1 miR-92b-3p ACTN4, PARVG, PPP1CB FLNB, MAPK1 ACTN4, FLNA, MAPK1, PARVG, TLN1 Figure 6Illustration of the cooperative regulation of a miRNA module that contains four miRNAs: miR-18a-3p, -320a, -193b-3p, and -92b-3p (pink diamonds). [score:2]
[1 to 20 of 2 sentences]
67
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
Further, miR-193b and miR-365, also present in milk, were shown to control lipid synthesis, upregulating brown fat differentiation via enhancing expression of Runt-related transcription factor 1 translocated to 1 (Runx1t1) [166]. [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 6
The study reported six up-regulated miRNAs in the cells cultivated on ZO [2] ceramics compared to the one cultivated on Ti layer (miR-214, miR-337, miR-423, miR-339, miR-377, and miR-193b), and four down-regulated miRNAs (miR-143, miR-17-5p, miR-24, and miR-22) [29]. [score:6]
[1 to 20 of 1 sentences]
69
[+] score: 6
OS upregulates a group of miRNAs (miR-329, miR-193b, miR-20a, miR-296, and miR-130b), which is associated with affecting 83 target genes. [score:6]
[1 to 20 of 1 sentences]
70
[+] score: 6
Increased miRNA expression of miR-124-3p, miR-145-3p, miR-193b-3p, and miR-934 in carcinomas was associated with worse survival while increased expression of other miRNAs (i. e. miR-17-5p, miR-19b-3p, miR-20a-5p, miR-20b-5p, miR-425-5p, miR-92a-3p, and miR-93-5p) in carcinoma tissue improved survival. [score:5]
Four miRNAs were associated with survival after being diagnosed with colon cancer, miR-124-3p, miR-145-5p, miR-193b-3p, and miR-934, although none of these associations remained significant after adjustment for multiple comparisons. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Among them are two polycistronic transcripts (miR-15a~16-1 and miR-193b~365-1), and two expressing single miRNAs (miR-148a and miR-155). [score:3]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 5
Mir-193b decreases in breast cancer cells, which allows the expression of its target genes DNAJC13 and RAB22A, and promotes breast cancer progression 77. [score:4]
Both mir-193b and mir-221 has been ranked in the top 10 prediction list for breast cancer and confirmed by literatures. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 5
Likewise, hypoxic stress enables the epidermal growth factor receptor (EGFR) to phosphorylate Ago2 and prevent its binding to Dicer, thereby inhibiting the processing and maturation of tumor suppressive pre-miRNAs (e. g.,, miR-192, and mir-193-5p; [29]). [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
The ISH probes used for nucleolar miRNAs were: hsa-miR-191 with a sequence 5′DigN-cag ctg ctt ttg gga ttc cgt tg-3′; hsa-miR-193b with a sequence 5′DigN-agc ggg act ttg agg gcc agt t-3′; hsa-miR-484 with a sequence 5′DigN-atc ggg agg gga ctg agc ctg a-3′; and hsa-miR-574-3p with a sequence 5′DigN-tgt ggg tgt gtg cat gag cgt g-3′. [score:1]
0070869.g003 Figure 3(A) Localisation of miR-193b, miR-484 and miR-574-3p is examined in lung cancer cells H1299, liver cancer cells Huh7, RPE cells, human adult fibroblast AG06858 and primary mouse adult fibroblast. [score:1]
Nucleolar location of mature miR-191, miR-193b, miR-484 and miR-574-3p in HeLa cells. [score:1]
Four nucleolar miRNAs; miR191, miR-484, miR-574-3p and miR-193b, were tested in our ISH experiments, and all four miRNAs exhibit strong nucleolar localisation (Figure 2A). [score:1]
Four nucleolar microRNAs; miR-191, miR-193, miR-484, miR-574-3p, are examined for their nucleolar location. [score:1]
[1 to 20 of 5 sentences]
75
[+] score: 5
In claudin-low TNBC cell lines, metformin induces apoptosis and inhibits mammosphere formation through the induction of miR-193b [24] and inhibits TGF-β -induced proliferation, motility and invasion [25]. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
The nine miRNAs includes four miRs (miR-16-5p, miR-21-3p, miR-462-5p, miR-731-3p) relatively high expressed in XX and five miRs (let-7g-5p, miR-26a-5p, miR-135c-5p, miR-193b-3p, miR-200b-3p) relatively high expressed in XY. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
14-3-3ζ expression can be modulated by miR-193b and miR-375, which target 3′ UTR of 14-3-3ζ mRNA, in cancer cells (33, 34). [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
One study found an age-related increase in miR-199a-3p and miR-193b contributing to a downregulation in collagen type II, aggrecan and SOX9, along with reduced proliferation and a reduction in miR-320c [17]. [score:4]
Finally, a number of miRNAs, which have roles in cartilage homeostasis, including miR-337 [43], miR-302 [44], miR-181 [45], mir-193 [17], miR-135 [46], and miR-24 [20] were in this group. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 5
There are to our knowledge, no reports in circulating miRNA-193b but in breast cancer, cellular miRNA-193b has been shown to be down-regulated [27]. [score:4]
miRNA-193b did not differ in breast cancers but was decreased in postmenopausal women and increased in the luteal phase of the menstrual cycle whereas tamoxifen therapy did not change the levels. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 5
Still, statistical analysis detected only 11 miRNAs with altered expression in HeLa cells, of which only four miRNAs (hsa-miR-146b, hsa-miR-577, hsa-miR-877 and hsa-miR-193b*) had FC > 2 expression change between cell cycle phases. [score:5]
[1 to 20 of 1 sentences]
81
[+] score: 4
miR-365 is clustered with miR-193b which shows similar expression patterns to miR-365 in our system (Tables 2 and 3 ), thus suggesting that these miRNAs may be co-regulated. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
Zhou X The aberrantly expressed miR-193b-3p contributes to preeclampsia through regulating transforming growth factor-beta signalingSci. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In another study, it has been found that two miRNAs, miR-132 and miR-320, were expressed at significantly lower levels in the follicular fluid of women with PCOS than in a group of healthy women, as can be seen in Figure 3. In addition, it has been evidenced that miR-132, miR-320, miR-520c-3p, miR-24, and miR-222 that are present in the follicular fluid regulate estradiol concentrations and miR-24, miR-193b, and miR-483-5p progesterone concentrations [52]. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
14 hsa-miR-127-5p 1708.96 hsa-miR-139-5p 1096.97 hsa-miR-146b-5p 1662.59 hsa-miR-23b-3p 1281.21 hsa-miR-193b-3p 1275.18 hsa-miR-320b 1148.60 hsa-miR-146a-5p 1135.37 hsa-miR-210 1055.20 hsa-miR-708-3p 1027.45 hsa-miR-769-5p 1004.10 hsa-miR-378d 1000.99 To determine if adjacent fascia exhibits a disease-like molecular phenotype, we compared the adjacent fascia biopsies with patient matched diseased Dupuytren’s fascia. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
For instance, miR140 and miR-193b, both associated with chondrogenic development can also target Wnt and TGF-β signalling 34 35, pathways that interact with the SOX transcription factor family in chondrogenesis. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
For this analysis, we decided to use the eight miRNAs having more than 80 dysregulated targets (miR-23b [50], miR-223, miR-193b [51], miR-424, miR-20a [52], miR-98, miR-891a, and miR-566), see Figure 2. We left the custom degree constraint at the default of 1 for the subsequent ORA. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
Leivonen et al previously reported that five ERα -regulating miRNAs, miR-18a, miR-18b, miR-193b, miR-302c and miR-206, directly targeted ERα in 3’UTR reporter assays (11). [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
Other miRNAs from this paper: hsa-mir-29a
Hence, MYB expression is precisely regulated during hematopoiesis, which is accomplished by various upstream transcription factors as well as microRNAs, for example microRNA(miR)-15a or miR193b-3p [15– 17]. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
In addition to miR-206, ERα mRNA is also a direct target of miR-18a, miR-18b, miR-193b, miR-302c and miR-221/222 in breast cancer cells. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
Of particular interest was that co-culture of PBMC with CD14 [-] non-monocytic cells from the same donor induced accumulation of miR-155 and miR193b and increased expression of NF-κB, STAT1 and of the interferon-responsive genes ITGB7 and ISG20. [score:3]
IL-4, an inducer of tissue remo deling/profibrotic monocyte/macrophage (M2) differentiation increased miR-193b and miR-222 but decreased miR125-5p. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 4
All the results in qRT-PCR were consistent with those obtained from the sequencing except for gga-miR-193b-3p which had reverse regulatory direction (Table  4). [score:3]
The highest fold change (71.24) was observed for gga-miR-490- 5p and the lowest fold change (2.06) for gga-miR-193b-3p. [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 4
Similar to the microarray results, 5 of the 10 miRNAs (miR-196b-5p, let-7i-5p, miR-22-3p, miR-193b-3p, and miR-365a-5p) were significantly downregulated in the cancer cell lines compared to early passage MSCs. [score:3]
Out of the 13 miRNAs being evaluated for new consensus miRNAs in MSCs, 8 miRNAs had detectable expression in both the microarray and experiments (miR-22-3p, miR-27a-3p, miR-34a-5p, miR-193b-3p, miR-320b, miR-324-3p, miR-494, and miR-1260a). [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 4
Thirteen of the miRNAs:mRNA seed region matches (MEF2C with miR-203a; TGFBR1 with miR-2117 and miR-6071; DUSP4 with miR-193b-3p; PDGFRA with miR-17-5p, miR-19b-3p, miR-203a, miR-20a-5p, miR-20b-5p, miR-29b-3p, miR-501-3p; RASGRP3 with miR-429; and PRKCB and miR-203a) were inversely associated suggesting a greater likelihood of a direct effect between the miRNA and mRNA. [score:2]
Other direct biological associations were observed between MEF2C and miR-193b-3p and miR-203a, downstream of p38. [score:2]
[1 to 20 of 2 sentences]
94
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
In contrast, only one miRNA, hsa-miR-193, was down-regulated in DMD. [score:4]
[1 to 20 of 1 sentences]
95
[+] score: 3
For instance, microRNA-193b enhances the cytotoxicity of cisplatin to hepatocellular carcinoma cells by targeting Mcl-1 [13]. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Overexpression of miR-193b promotes autophagy and non-apoptotic cell death and thereby significantly impedes the ability of esophageal cancer cells to recover following 5-fluorouracil (5-FU) treatment (Nyhan et al., 2016). [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Moreover, miR-141, miR-143, and miR-193 are differently expressed in the mouse uteri before and after embryo implantation [33- 35]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Experimental data have shown that miR-193b experienced attenuation in cutaneous T-cell lymphoma [46]; by repressing miR-125b-5p (the 5p arm of the pre-miRNA for miR-125b), the Lymphoma cells would be sensitized to anticancer agents such as bortezomib [47]; the overexpression of miR-146b-5p (the 5p arm of the pre-miRNA for miR-146b) would prevent the cells of diffuse large B-cell lymphoma from growing [48]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
[8] In the mouse, only three miRNAs (mmu-miR-193, mmu-miR-434-5p and mmu-miR-22) showed altered expression following treatment with haloperidol, olanzapine and clozapine for 7 days. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
The herein presented exposure signature of 93 miRNAs showed an overlap of 28 (30%) miRNAs with the diagnostic lymphoma signature (including the tumor suppressor miRNAs mir-193, miR-152 and miR-34a). [score:3]
[1 to 20 of 1 sentences]