sort by

15 publications mentioning hsa-mir-496

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-496. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 296
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
Down regulated mRNAs with MBD2 overexpression identify networks of putative targets of hsa-mir-496 Expression analysis of mRNA in MCF-10A stably overexpressing MBD2 identified 5129 genes that were significantly (p<0.005) repressed (<0.9 ratio fold change) in comparison with control MCF-10A cells (Table S1). [score:10]
Following hsa-mir-496 knockdown, CTSH, POU2F3 were induced in all three cell lines as expected if these genes are downregulated by hsa-mir-496 (Fig. 4C,E) while PTGS1 was induced in MCF-10A cells overexpressing MBD2 and MDA-MB-231 cells expressing high level of MBD2 but not in MCF-7 cells (Fig. 4G). [score:9]
In addition to experimentally validating several targets of hsa-mir-496, by cross-referencing of hsa-mir-496 in silico targets with down regulated mRNAs in MBD2 overexpressing MCF-10A cells we derived a list of 141 genes whose repression is potentially downstream to the MBD2- hsa-mir-496 pathway. [score:8]
Repressed targets of MBD2 in MBD2 overexpressing cells are putative targets of hsa-mir-496. [score:7]
By comparing the list of repressed genes in response to MBD2 in MCF-10A cells from an expression array and in silico predicted hsa-mir-496 targets we derived possible gene targets for MBD2 -hsa-mir-496 pathway. [score:7]
It is unclear whether these partial changes in DNA methylation are involved in the inhibition of MBD2 expression or whether MBD2 has an impact on hsa-mir-496 expression that is independent of DNA methylation. [score:7]
0074009.g004 Figure 4Repressed targets of MBD2 in MBD2 overexpressing cells are putative targets of hsa-mir-496. [score:7]
We depleted hsa-mir-496 with a locked nucleotide antisense oligonucleotide targeting hsa-mir-496 (using a scrambled LNA as a control) in MCF-10A that overexpress ectopic MBD2 as well as MCF-7 and MDA-MB-231 cells which express endogenous MBD2 (Fig. 4D). [score:7]
Three of these 20 genes that are in silico targets of hsa-mir-496 that were found to be silenced in response to MBD2 overexpression were also regulated by MBD2 in other cell lines: Cathespin H (CTSH), POU domain class 2 transcription factor 3(POU2F3) and prostaglandin-endoperoxide synthase 1(PTGS1). [score:6]
Down regulated mRNAs with MBD2 overexpression identify networks of putative targets of hsa-mir-496. [score:6]
We show first that ectopic MBD2 expression in untransformed epithelial cells results in upregulation of a microRNA hsa-mir-496 (Fig. 1D). [score:6]
In contrast to over expression of MBD2 in MCF-10A cells which results in a dramatic hypomethylation, depletion of MBD2 in MCF-7 and MDA-MB-231 cells results in very limited hypermethylation in spite of a significant decrease in expression of hsa-mir-496. [score:5]
Second, expression of hsa-mir-496 is partially dependent on endogenous MBD2 in two breast cancer cell lines; partial depletion of MBD2 results in reduction in hsa-mir-496 expression (Fig. 1D). [score:5]
Over expression of MBD2 triggers demethylation and activation of hsa-mir-496 MCF-10A, MCF-7 and MDA-MB-231 mammary cell lines were used in our study since they express varying levels of endogenous MBD2 (Fig. 1A Fig. 1C) ranging from low (MCF-10A) to high, (MDA-MB-231). [score:5]
Our data derived from forced expression of MBD2 in MCF10A cells suggested that MBD2 expression could activate and lead to demethylation of hsa-mir-496 (Fig. 1 and 2). [score:5]
We also show in two breast cancer cell lines that endogenous MBD2 is required for expression of hsa-mir-496 since depletion of MBD2 results in reduction of hsa-mir-496 expression (Fig. 1D). [score:5]
Although some reports have indicated a role of hsa- mir-496 in alcohol exposure [44], and aging [45] its expression has not yet been functionally linked to any repressed targets. [score:5]
Genes silenced in response to MBD2 overexpression are targets of hsa-mir-496 We tested the hypothesis that MBD2 would repress specific genes through activation of microRNA. [score:5]
MBD2 overexpression in MCF-10A cells induces hsa-mir-496 expression and demethylation through binding to the TSS. [score:5]
Table S2 Repressed transcripts following MBD2 overexpression in MCF-10A that overlap with putative targets of hsa-mir-496. [score:5]
0074009.g002 Figure 2MBD2 overexpression in MCF-10A cells induces hsa-mir-496 expression and demethylation through binding to the TSS. [score:5]
Ingenuity pathway analysis of putative targets of the MBD2 -hsa-mir-496 pathway in MCF-10A cells overexpressing MBD2. [score:5]
Nevertheless, endogenous MBD2 is required for expression of hsa-mir-496 cells in both MCF-7 and MDA-MB-231 cells since depletion of MBD2 results in concomitant reduction of hsa-mir-496 expression (Fig. 1D ). [score:5]
Cross-referencing this list with a computed list of putative hsa-mir-496 targets (using miRANDA) identified a dataset of 141 (Table S2) genes repressed by MBD2 that are putative targets of hsa-mir-496. [score:5]
0074009.g005 Figure 5Ingenuity pathway analysis of putative targets of the MBD2 -hsa-mir-496 pathway in MCF-10A cells overexpressing MBD2. [score:5]
Genes silenced in response to MBD2 overexpression are targets of hsa-mir-496. [score:5]
Within this subset we looked directly at the pathways of down regulated mRNAs and putative targets of hsa-mir-496 to identify a possible role in migration and haptotaxis. [score:5]
−550 rev AAGCTCCACTTCTTCCCCAAA mir-496-pcpgl ChIP forward GGAAGCGAGCACCCAAGT mir-496-pcpgl ChIP reverse TGCCATCTTCCAGAGGGTAG luc-pcpgl ChIP forward TCCCTGAAGTTGGTGGAGAC luc-pcpgl ChIP reverse GCAGGTGTGGTCAGAGATGA qPCR MBD2 forward CAAAGTCACAAATCTCCTAGTAAAGT qPCR MBD2 reverse TATAATTTGTTCTGTTACATCTGATACACT qPCR CTSH forward TACTGGCTGTTGGGTATGGAG qPCR CTSH reverse CGATGAGGAAGTACCCGTTC qPCR POU2F3 forward ACTCCAAAGCAGCAGTGAAC qPCR POU2F3 reverse CGGTACCAAGATCCTGAAGAG qPCR PTGS1 forward CGTAGGAGAGAAGGAGATGG qPCR PTGS1 reverse AGAAGCAGTCCAGGGTAGAAC Expression of targets and MBD2. [score:5]
Down regulated mRNA and putative hsa-mir-496 targets are highlighted in bold and light blue outline. [score:4]
We then determined whether the effect of up or down regulation of MBD2 on expression of these genes was mediated by hsa-mir-496. [score:4]
MBD2 activates methylated hsa-mir-496 promoter activity in a luciferase reporter transient transfection assayOur data derived from forced expression of MBD2 in MCF10A cells suggested that MBD2 expression could activate and lead to demethylation of hsa-mir-496 (Fig. 1 and 2). [score:4]
These data are consistent with the hypothesis that CTSH and POU2F3 suppression by MBD2 is mediated by hsa-mir-496 while PTGS1 regulation by MBD2 seems to involve other factors in MCF-7 cells. [score:4]
Further experiments are required to unravel these additional events regulating hsa-mir-496 expression in different cell types. [score:4]
in silico scanning using mirANDA identified a set of predicted targets of hsa-mir-496. [score:3]
Sixth, MBD2 targets and binds an ectopic hsa-mir-496 promoter (Fig. 3D). [score:3]
Hsa-mir-496 is required for MBD2 repression of these genes since depletion of hsa-mir-496 (Fig. 4D) in MBD2 overexpressing MCF-10A cells results in relief of repression (Fig. 4E, F,G). [score:3]
However, in both cases MBD2 depletion resulted in concomitant partial reduction in hsa-mir-496 expression (Fig. 1D; 1.76-fold and 3-fold decrease in MCF-7 cells and MDA-MB-231 respectively). [score:3]
However, not surprisingly the expression of hsa-mir-496 in these cells is not determined exclusively by the levels of MBD2. [score:3]
Ectopic expression of MBD2 increased demethylation at −108, −98, −40, −17,−15, and −6 and +16 suggesting that increasing levels of MBD2 over endogenous levels enhanced the extent of demethylation of transiently transfected hsa-mir-496 promoter bound to MBD2 (Fig. 3E dark box). [score:3]
The genes that were validated here as targets of hsa-mir-496 are known to be involved in different aspects of cancer progression. [score:3]
MCF10A cells express higher levels of hsa-mir-496 than MCF-7, which have higher steady-state levels of MBD2 (Fig. 1 A, C, D). [score:3]
We focused our study in this paper on hsa-mir-496 which showed robust demethylation by ectopic expression of MBD2 (Fig. 1 B,D). [score:3]
The microRNA hsa-mir-496 5′ region upstream to the transcription start site (TSS) (Fig. 2A) is highly methylated in control MCF-10A and MCF-7 cells and is hypomethylated in MDA-MB-231 which express higher levels of hsa-mir-496 (Fig. 2B) as determined by DNA methylation mapping analysis using bisulfite converted DNA. [score:3]
0074009.g001 Figure 1Depletion of MBD2 in mammary breast cancer cell lines leads to induction of hsa-mir-496 expression. [score:3]
It is clear however that levels of MBD2 per se are not exclusively determining the steady state levels of hsa-mir-496 since MCF-7 cells express lower levels of hsa- mir-496 (Fig. 1D) than MCF-10A cells despite their higher levels of endogenous MBD2 (Fig. 1C). [score:3]
Third, overexpression of MBD2 in MCF-10A cells triggers demethylation of the promoter of hsa-mir-496 (Fig. 2D). [score:3]
Depletion of MBD2 in mammary breast cancer cell lines leads to induction of hsa-mir-496 expression. [score:3]
In MCF-7 cells, which express lower levels of MBD2 than MDA-MB-231 cells the hsa-mir-496 promoter is heavily methylated except at site −103 which is completely hypomethylated. [score:3]
We show that expression of ectopic MBD2 in MCF-10A cells results in almost complete demethylation of the hsa-mir-496 promoter (results of bisulfite analysis in Fig. 2D). [score:3]
Its silencing by overexpression of MBD2 through hsa-mir-496 is consistent with a role in cancer. [score:3]
Over expression of MBD2 triggers demethylation and activation of hsa-mir-496. [score:3]
Although our data shows that interaction of ectopic MBD2 with the hsa-mir-496 promoter results in demethylation, our data does not directly demonstrate that MBD2 is demethylating hsa-mir-496 promoters in cells nor does it claim that MBD2 is involved in its demethylation. [score:2]
Following MBD2 knockdown in MDA-231 cells methylation at the hsa-mir-496 promoter is significantly increased at −40 while remaining sites are relatively hypomethylated following depletion of MBD2 (Fig. 2F). [score:2]
Although we have no evidence for these indirect mechanism in the case of hsa-mir-496 promoter, further experiments are required to test this hypothesis that are beyond the scope of this paper. [score:2]
This provides further evidence for direct action of MBD2 on the hsa-mir-496 promoter as an MBD2 antibody pulls down the hsa-mir-496 DNA region and not other regions on the vector. [score:2]
Plasmid Promoter Constructs and in vitro methylation of mir-496 A PCR amplified fragment (Using primers in Table 1) containing the mir-496 promoter 5′ regulatory region (−315→+161 relative to the TSS) was cloned into PCR2.1 and sub-cloned using HindIII and BamHI restriction sites into the CpG-free pCpGl luciferase reporter [30] in sense and antisense directions. [score:2]
PTGS1 is induced in MDA-MB-231 cells by hsa-mir-496 depletion (Fig. 4G) but not in MCF-7 cells suggesting that other factors regulate this gene in MCF-7 cells (Fig. 4G). [score:2]
Fifth, a luciferase reporter assay demonstrates that the hsa-mir-496 promoter region per se is silenced by DNA methylation and that it is activated with ectopic expression of MBD2 (Fig. 3 B and C). [score:2]
Taken together these results are consistent with the hypothesis that MBD2 could regulate hsa-mir-496 promoter activity and its DNA methylation state. [score:2]
Our assay demonstrates binding of MBD2 within the (TSS) (−11–+246) of hsa-mir-496 that correlates with MBD2 expression in the different cell lines (Fig. 2C). [score:2]
SiRNA knock down achieved significant MBD2 depletion of 80% in MCF-7 and 60% in MDA-MB-231) (Fig. 1C for QPCR) and depletion of MBD2 binding to the TSS of hsa-mir-496 in both cell lines (Fig. 2C). [score:2]
of the transiently transfected hsa-mir-496-pCpGl Luciferase expression plasmid was carried out using pyrosequencing with a first round of outer PCR primers located within the pCpGl construct (to differentiate between the exogenous transfected promoter and the endogenous promoter) and a second round of inner PCR within the cloned mir-496 sequence with biotinylated primers in Table 1. Pyrosequencing was carried out directly on the PCR product using a Biotage Q24 Pyrosequencer according to the manufacturer's gui delines. [score:2]
The transcriptional activity of methylated hsa-mir-496-pCpGl increases when the methylated reporter is co -transfected with MBD2 expression vector as compared with an empty backbone (pEF6) (1.8 fold) and does not increase with an MBD2 methylated DNA binding domain (MBD) deletion mutant (mtMBD2) (Fig. 3C). [score:2]
It is surprising therefore that this gene is down regulated by MBD2 and hsa-mir-496 in highly invasive breast cancer cells MDA-MB-231. [score:2]
A PCR amplified fragment (Using primers in Table 1) containing the mir-496 promoter 5′ regulatory region (−315→+161 relative to the TSS) was cloned into PCR2.1 and sub-cloned using HindIII and BamHI restriction sites into the CpG-free pCpGl luciferase reporter [30] in sense and antisense directions. [score:2]
In vitro methylation of all CGs in this region with Sss1 DNA methyltransferase which recapitulates the situation in MCF-10A cells reduced luciferase activity 59-fold relative to the unmethylated control supporting the conclusion that methylation of CG sites in the hsa-mir-496 promoter region silenced its activity (Fig. 3B). [score:1]
This could be explained by insensitivity of PTGS1 to the extent of reduction of hsa-mir-496 that is brought about by partial MBD2 depletion in MDA-MB-231 cells using siMBD2 treatment (Fig. 1D). [score:1]
Hsa-mir-496 is highly methylated in MCF-10A cells and we reasoned that depletion of MBD2 in these cells would have very little further impact on DNA methylation. [score:1]
Hsa-mir-496 depletion in MCF-7 and MDA-MB-231 results in induction of CTSH and POU2F3 (Fig. 4E,F). [score:1]
A limitation of our studies is that we only used mir-496 antagonists in the current study. [score:1]
Conversely, although PTGS1 is responsive to hsa-mir-496 depletion in MDA-MB-231 cells (Fig. 4G) it is not affected by MBD2 depletion in these cells (Fig. 4C). [score:1]
We captured the ectopic hsa-mir-496 promoter DNA molecules that were interacting with MBD2 (in both empty vector transfection where the transfected hsa-mir-496 was interacting with endogenous MBD2 and ectopic MBD2 transfectants which had an excess of ectopically transfected MBD2) by ChIP using anti MBD2 antibody and treated the captured DNA with sodium bisulfite. [score:1]
Bottom panel is a Western blot analysis with an anti MBD2 antibody (D) qPCR quantification of hsa-mir-496 in MBD2 transfected (black) MCF-10A and controls (empty), and siRNA-MBD2 treated MCF-7 and MDA-231 cells (empty) and controls (black). [score:1]
Plasmid Promoter Constructs and in vitro methylation of mir-496. [score:1]
This construct has CG DNA methylation target sequences only in the hsa-mir-496 promoter region and the assay is therefore not confounded by vector DNA methylation and measures directly the effects of DNA methylation and MBD2 on the transcriptional activity of this region as well its state of methylation. [score:1]
MBD2 binding to the hypomethylated hsa-mir-496 promoter in MDA-MB-231 (Fig. 2C) is higher than its binding to the methylated promoter in MCF-10A and MCF-7 cells, consistent with a role for MBD2 in interacting with an active and demethylated hsa-mir-496 (Fig. 2C). [score:1]
Seventh, the physically MBD2 bound ectopic hsa-mir-496 promoter molecules are partially demethylated delineating a tight relationship between MBD2 binding and DNA demethylation of the hsa-mir-496 promoter (Fig. 3E). [score:1]
+389 CCACACAACCAAAATAATTTCA Outer pcpgl bisulfite mir-496-pcpgl forward TTAAAAGGAATTttTGtAGGAtTAG Outer pcpgl bisulfite mir-496-pcpgl reverse TTTCTTAATATTCTTaaCATCCTCCA Nested bisulfite mir-496-pcpgl forward TTTTTTGAATGGTTTTTTGTAAGAG Nested bisulfite mir-496-pcpgl reverse AAAAAAAATTAACCATATAATACTCATCAT Pyrosequencing mir-496-pcpgl S1 AGTAAGGGATGGAGT Pyrosequencing mir-496-pcpgl S2 TGTTGTTATTTTTTTGATTTTTAGT ChIP mir-496 −11. [score:1]
In summary, endogenous MBD2 depletion results in alteration of the DNA methylation state of hsa-mir-496 with increased methylation of specific sites as well as demethylation of other sites. [score:1]
To determine whether endogenous MBD2 plays a role in hsa-mir-496 DNA methylation we measured the effects of depletion of MBD2 mRNA in two breast cancer cell lines MCF-7 and MDA-MB-231 that express significant levels of MBD2 (Fig. 1C). [score:1]
−61 TGGAGGTTGTttATGGTGTGTT Nested bisulfite mir-496 reverse +368. [score:1]
The position of CG dinucleotide sequences are indicated as balloons which are all located in the hsa-mir-496 5′ region. [score:1]
−550 for GGGTCTGCGCTAGCGTGT ChIP mir-496 −834. [score:1]
Fourth, MBD2 interacts with chromatin at the hsa-mir-496 promoter as determined by a ChIP assay, which is consistent with the hypothesis that MBD2 activates hsa-mir-496 directly in cis rather than the alternative hypothesis that MBD2 activation of hsa-mir-496 is mediated through MBD2 repressive activity on a putative trans acting repressor gene (Fig. 2B). [score:1]
The hsa-mir-496 region overlapping the predicted TSS, whose state of methylation was examined by bisulfite mapping in Fig. 2B–F, was cloned into CpG-free pCpGl –luciferase reporter (hsa-mir-496-pCpGl) (Fig. 3A). [score:1]
+264 rev CATGTCAACTAAAACGTCAGCA ChIP mir-496 −834. [score:1]
−423 TCCATTCAaCCAaaAaTTCCTT Nested bisulfite mir-496 forward −83. [score:1]
Both Anti-mir-496 (Exiqon, Cat. [score:1]
This is consistent with the conclusion that MBD2 is required for hsa-mir-496 activity independently of the state of methylation. [score:1]
To directly test the hypothesis that MBD2 could bind and activate the hsa-mir-496 promoter and alter its state of methylation we used a transient transfection reporter assay. [score:1]
We then tested whether the binding of MBD2 to ectopic hsa-mir-496 promoter results in a change in its state of methylation. [score:1]
To determine whether MBD2 directly interacts with hsa-mir-496 promoter in the human breast cancer cell line examined, we performed a chromatin immunoprecipitation with an MBD2 antibody as previously described and amplification with primers covering the transcriptional start site (TSS) [15]. [score:1]
−162 TGGGTGGTGTGTTGttAttTTt Outer bisulfite mir-496 reverse −402. [score:1]
+264 for GGAAGCGAGCACCCAAGT ChIP mir-496 −11. [score:1]
[1 to 20 of 94 sentences]
2
[+] score: 37
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 MiRNAs are small, 19–23 nucleotide non-coding RNAs that function as post-transcriptional repressors of gene expression, either through messenger RNA (mRNA) degradation or translational repression (Bartel, 2009). [score:14]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 Using microarray analysis, the expression profile of murine miRNAs in the developing lip and PS were analyzed from E10 to E14 (Mukhopadhyay et al., 2010; Warner et al., 2014). [score:12]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 CS, CC, JV: Conception of the work, drafting of the manuscipt, revision of the manuscript, final approval of the manuscript. [score:10]
Similarly, altered miR-496-FGF2, miR-145-FGF5, and miR-187-FGF9 interactions were associated with clefting in 289 nsCLP and 49 nsCPO patients (Li D. et al., 2016). [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 29
After normalization to 1 in the control group (U937/GFP), the relative expressions of selected downregulated miRNAs (miR-27a-3p, miR-424-5p, and miR-496-5p) in the test group are shown in A; the relative expressions of upregulated miRNAs (miR-296-5p, miR-377-5p, and miR-3680-5p), and unchanged miR-191-5p in the test group are shown in B. Figure 3 qPCR validation of miRNA expression levels in samples from the latent tuberculosis infection (LTBI) group versus the healthy control group. [score:13]
After normalization to 1 in the control group (U937/GFP), the relative expressions of selected downregulated miRNAs (miR-27a-3p, miR-424-5p, and miR-496-5p) in the test group are shown in A; the relative expressions of upregulated miRNAs (miR-296-5p, miR-377-5p, and miR-3680-5p), and unchanged miR-191-5p in the test group are shown in B. Figure 3 qPCR validation of miRNA expression levels in samples from the latent tuberculosis infection (LTBI) group versus the healthy control group. [score:13]
Relative expressions of miR-424-5p, miR-496-5p, miR-27a-3p, miR-377-5p, and miR-3680-5p in LTBI and healthy samples. [score:3]
[1 to 20 of 3 sentences]
4
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
In this scenario, in vivo overexpression of miR-369-3p, miR-496 and miR-543 in radial glial cells (RGCs) which can differentiate into neurons, negatively regulate N-cadherin (Ncad) and lower levels of Ncad conduce to their premature neuronal differentiation which is prevented by expressing a miRNA-resistant Ncad version (Rago et al., 2014). [score:6]
On the other hand, when miR-369-3p, miR-496 and miR-543 are suppressed, an increase in cell proliferation is observed, which correlates with a decrease in neuronal differentiation (Rago et al., 2014). [score:3]
[1 to 20 of 2 sentences]
5
[+] score: 8
Other miRNAs from this paper: hsa-mir-127, hsa-mir-154, hsa-mir-376c, hsa-mir-494, hsa-mir-495
Based on the qRT-PCR results, the hESCs with higher MEG3 and MEG8 expression were classified as MEG3-ON hESCs, in which several miRNAs from this locus, miR-127-3p, miR-154, miR-376c, miR-494, miR-495, and miR-496, were also abundantly expressed (Figure  1B). [score:5]
The UPL probe system (Roche) was used to detect the expression of miRNAs, including miR-127-3p, miR-376c, miR-494, miR-495, miR-496, and miR-154. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 7
However, two miRNAs (miR-496, miR-1538) were found to be upregulated in the old participants by miRNome analysis and in the validation experiments, but when examined among the larger cohort these miRNAs were found to be downregulated in older participants (Fig. 3A, Table S1, S3). [score:7]
[1 to 20 of 1 sentences]
7
[+] score: 7
org, we choose miR-186, miR-384, miR-410, miR-448, miR-496 and miR-544 to further study which miRNA might regulate matrilin-3 expression. [score:4]
a The mRNA and protein levels of matrilin-3 in normal and osteoarthritis cartilages were determined using quantitative real-time PCR and western blot, n = 10. b The levels of miR-186, miR-384, miR-410, miR-448, miR-496 and miR-544 in osteoarthritis cartilages were determined using quantitative real-time PCR, n = 10. c Pearson’s correlation analysis of the relative expression levels of miR-448 and the relative matrilin-3 mRNA levels in osteoarthritis cartilage. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 4
According to the study conducted by Mo and colleagues, human ESCs with low MEG3 expression level (designated as MEG3-OFF) also showed significantly low expressions of DLK1-DIO3 locus-derived noncoding RNAs, including MEG8, miR-127, miR-376, miR-494, miR-495, miR-496, and miR-154, compared to its counterpart MEG3-ON [68]. [score:4]
[1 to 20 of 1 sentences]
9
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
In contrast, deregulation of the expression of miR-9, miR-33, miR-92a, miR-142-3p, miR-146a, miR-181a/c, miR-210, miR-215, miR-369-5p, miR-335, miR-454, miR-496, miR-518d, and miR-599 was associated with an unfavorable long-term clinical outcome in ALL patients [65, 67– 73]. [score:4]
[1 to 20 of 1 sentences]
10
[+] score: 3
Reduced expression of miR-103, miR-107, miR-128, miR-130a, miR-155, miR-24, miR-221, miR-496, and miR-1538 in older individuals was also recently reported [19]. [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 2
Other miRNAs from this paper: hsa-mir-377
Genomic pairwise sequence alignments which correspond to the region that spans 1500bp upstream of the human transcription start site of ACAN and ADAMTS5, or the intergenic region (1375bp) between hsa-mir-377 and its 5’ adjacent hsa-mir-496 were used to identify potential AP1 (red) and CREB1 (green) transcription binding sites. [score:1]
0082045.g007 Figure 7 Genomic pairwise sequence alignments which correspond to the region that spans 1500bp upstream of the human transcription start site of ACAN and ADAMTS5, or the intergenic region (1375bp) between hsa-mir-377 and its 5’ adjacent hsa-mir-496 were used to identify potential AP1 (red) and CREB1 (green) transcription binding sites. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 1
Clustal W alignment shows that bma-miR-5838 shares 8 nt at its 5′ end which includes the seed sequence, GAGTAT, with Aedes aegypti miR-12 and human miR-496 (Figure 3C). [score:1]
[1 to 20 of 1 sentences]
13
[+] score: 1
In addition, miR-495, miR-134, miR-409-3p, miR-496, miR-379, miR-369-3p in the cluster are linked to the tumor invasion depth in gastric cancer [104, 106]. [score:1]
[1 to 20 of 1 sentences]
14
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
In the early developing bovine conceptus, the levels of some miRNAs including miR-496 and miR-125a vary greatly suggesting a role in the maternal-to-zygotic transcriptional transition [11]. [score:1]
[1 to 20 of 1 sentences]
15
[+] score: 1
MNPT) miR-449a# 3.92 miR-32 3.49 miR-548c-5p 2.71 miR-562 2.56 miR-103-as 2.53 miR-512-3p 2.41 miR-200c* 2.33 miR-147b 2.24 miR-770-5p 2.09 miR-518c* 2.00 miR-517b 1.88 miR-182 1.79 miR-615-3p 1.70 miR-496 1.59 miR-1200 1.58 miR-375 1.54 miR-551a 1.53 *Passanger strand. [score:1]
[1 to 20 of 1 sentences]