sort by

28 publications mentioning mmu-mir-466a

Open access articles that are associated with the species Mus musculus and mention the gene name mir-466a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 121
The developmental regulation of C2MC is especially germane to this work, because the member of C2MC that was most highly upregulated after alloantigen exposure, miR-466a, was found to target TGF-β2, a protein that is also under considerable governance due to its extensive involvement in proper development (41, 42). [score:9]
Among the upregulated miRs, the specific miRNA from C2MC with the highest validated mean expression in CD4 [+] T cells draining from the allograft was miR-466a-3p (Figure 2A), henceforth referred to as miR-466a. [score:6]
In the same experiment, LNA-466 failed to induce significant changes in the size and cellularity of the spleens (Figures S2A,B in), thereby demonstrating that LNA-466 was targeting the dLNs, the primary site of immune response against alloantigen, and the site of mir-466a upregulation. [score:6]
Predicted miRNA target Predicted consequential pairing of miRNA (top) and mRNA target region (bottom) mirSVR score TGFβ2 −0.5786 TGFβRIII −0.0256 Smad2 −0.0256 Smad3 −0.3307 To directly test the role of miR-466a on Treg differentiation, we used an in vitro Treg polarization mo del. [score:6]
Together, the current study demonstrates for the first time that allografts induce miR-466a in CD4 [+] T cells which inhibits Treg differentiation through the suppression of TGF-β2. [score:5]
To further corroborate the role of miR-466a in T cell differentiation, we used LNA in a coculture mo del to inhibit miR-466a expression and found that LNA-466 caused an increase in CD4 [+] CD25 [HI] FoxP3 [+] Tregs and a decrease in pro-inflammatory Th1 cells, CD8 [+] IFNγ [+] cells (Tc1), and CD4 [+] IL-17A [+] (Th17) cells. [score:5]
Validation of miR-466a Expression and Predicted mRNA Targeting. [score:5]
To that end, naïve CD4 [+] cells were purified and stimulated in vitro with anti-CD3/CD28 Ab in the presence of an LNA, designed specifically to inhibit miR-466a/b/c/d/e/p-3p (will be referred to as LNA-466), or a control that was designed not to target any known miRs (LNA-ctrl). [score:5]
Thus, the data presented in this study paint a picture of a complex inflammatory environment wherein the modulation of TGF-β2, specifically, via miR-466a downregulation can modify most greatly the inflammatory environment in circulation and within the allograft. [score:4]
We next quantified the mRNA and protein levels of the predicted targets of miR-466a after transfection and found that the mRNA expressions of Smad2, Smad3, TGF-β1, TGF-β2, and TGF-βR3 were all reduced after mimic transfection compared to the other conditions (Figure S1B in). [score:4]
Upregulation of miR-466a after allotransplantation was specific to dLN CD4 [+] cells, as it was not significantly altered in splenic CD4 [+] cells or other peripheral LN CD4 [+] cells (Figure 2C). [score:4]
This miRNA was chosen as the main miRNA of interest, both because of its noteworthy upregulation (Figure 2A) and because the seed sequence of miR-466a is identical to miR-297(a/b/c)-3p, miR-446d-3p, miR-467g, and miR-669d-3p, other members of C2MC. [score:4]
In both experiments, cells were transfected with either 25 nM miR-466a-3p mimic (UAUACAUACACGCACACAUAAGA), 100 nM miR-466a-3p inhibitor (UAUACAUACACGCACACAUAAGA), or 25 nM scramble control, using HiPerfect Transfection Reagent from Qiagen (Valencia, CA, USA). [score:3]
miR-466a Targets Treg Polarization Through TGF-β2. [score:3]
Our data suggest that in vivo modulation of miR-466a may constitute a novel approach to induce Tregs and thereby inhibit inflammation that is seen in a variety of clinical disorders. [score:3]
We found that purified CD4 [+] T cells draining the allograft expressed heightened miR-466a; it is quite possible that these cells could be secreting their miRNAs in exosomes as a form of cell–cell communication in the dLN microenvironment to dendritic cells. [score:3]
Considering that clinical transplantation involves lesser HLA incompatibilities than used in our murine mo del, and due to the salutary effects that in vivo manipulation of miR-466a has on allograft rejection, we suggest that the miRNA management of TGF-β2 may constitute a therapeutic modality for allograft rejection or other inflammatory diseases—clearly additional studies are necessary to reinforce this point. [score:3]
Next, we examined the effect of miR-466a inhibition in a mo del wherein there was no exogenously administered TGF-β1. [score:3]
This was demonstrated conclusively in our study by altering TGF-β2 levels via transfection of CD4 [+] cells under Treg-polarizing conditions with miR-466a mimics, which led to a decreased generation of Tregs, while mimic inhibition reversed this effect. [score:3]
miR-466a Inhibitor Decreases Pro-Inflammatory and Increases Anti-Inflammatory Cells After Coculture With Alloantigen. [score:3]
Fresh medium was added on day 5, and LNA -based miRNA inhibitor (anti-miR-466a-3p, Exiqon, Denmark) and control LNA were added every 3 days at 50 ng/mL. [score:3]
In addition, there was a decrease in the amount of free-active TGF-β1 in the cells transfected with miR-466a mimic, and this alteration was reversed with the addition of the inhibitor (Figure S1C in). [score:3]
Through pathway analyses, these miRNAs, and specifically miR-466a-3p, were predicted to target several members of the TGF-β-signaling family. [score:3]
Relevant targets for miR-466a-3p and other miRNAs were investigated by cross-referencing predictions from TargetScan Mouse 6.2 software using a context + score threshold greater than −0.02 and microRNA. [score:3]
In studies using LNA -based miRNA inhibitor (anti-miR-466a-3p, Exiqon), the LNA (10 mg/kg) was injected i. p. to graft-recipient mice 1 day before skin transplant and then every third day after that until termination of the study. [score:3]
Coculture of lymph node (LN) cells with alloantigen increases miR-466a-3p expression compared to LN cells cultured with syngeneic antigen at the indicated time points as determined by quantitative real-time-PCR (A). [score:2]
Coculture with alloantigen provoked a robust increase in the expression of miR-466a at several time points compared to cells cultured with syngeneic antigen (Figure 4A). [score:2]
Mice receiving LNA-466 exhibited no significant changes in the amounts of circulating TGF-β1; however, consistent with the ability of miR-466a to target TGF-β2, the LNA-466 group demonstrated increases in circulating TGF-β2 when compared to syn or allograft + LNA-Ctrl groups (Figures 5F,G). [score:2]
Thus, our findings that miR-466a regulates TGF-β2, which in turn plays a key role in the generation of Tregs, are novel. [score:2]
Contrary to our hypothesis that in vivo inhibition of miR-466a using LNA-466 would result in delayed allograft rejection, our data showed that LNA administration failed to delay allograft rejection compared to controls. [score:2]
Predicted target, binding, and miRSVR score of miR-466a–mRNA interactions are displayed in Table 2. We cloned the 3′ UTR of several mRNAs of interest (Smad2, Smad3, TGF-β2, and TGF-βR3) as well as a mutated 3′ UTR, immediately downstream of luciferase in a luciferase reporter assay. [score:2]
We found that in the presence of miR-466a mimic, the luciferase activity of the reporter with the TGF-β2 3′ UTR cloned into its sequence was significantly lower, while such a decrease was not seen in the presence of the scramble control, any of the other cloned 3′ UTRs, or in the mutated control group (Figure 2E). [score:1]
We showed that miR-466a directly binds to the 3′ UTR of TGF-β2 through reporter luciferase assays. [score:1]
This finding was consistent with the predicted 7mer-m8 seed match shared between miR-466a and TGF-β2. [score:1]
miR-466a-3p is a member of C2MC, one of the largest clusters of miRNAs, containing 71 miRNA genes (32– 34). [score:1]
It should be noted that while miR-466a and its target were validated in this study, there were still several miRNAs picked up by the array that were not investigated further, and it is possible that such miRNAs may contribute to the complex inflammatory cascade perpetuating graft rejection. [score:1]
EL-4 cells were transfected with the luciferase reporters or a control vector lacking any 3′ UTR inserts in the presence of either a miR-466a mimic or a scramble control. [score:1]
We next investigated the mRNA specifically targeted by miR-466a. [score:1]
[1 to 20 of 38 sentences]
2
[+] score: 74
of databases predicting interaction Names of databases Dcx mmu-miR-200a 6 DIANAmT, miRanda, miRDB, miRWalk, PITA, Targetscan mmu-miR-200b 6 DIANAmT, miRanda, miRWalk, PITA, Targetscan, PICTAR 4 mmu-miR-466a-3p 4 miRanda, miRWalk, PITA, Targetscan mmu-miR-466d-3p 4 miRanda, miRWalk, PITA, Targetscan Pafah1b1 mmu-miR-200a 4 DIANAmT, miRanda, PITA, Targetscan mmu-miR-200b 5. [score:11]
In NSCs from diabetic pregnancy, the significant increase in protein expression of Dcx and Pafah1b1 correlates well with the reduced expression of miRNAs (mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p) (Figs. 2B and 3C) which have been predicted to target Dcx and Pafah1b1 suggesting possible role for miRNA in regulating gene expression. [score:10]
We report novel role of miRNAs mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p in regulating neurogenesis and gliogenesis in vitro by targeting and upregulating Gfap, Map2 and Ng2 proteins either through direct target or through an indirect regulation which needs detailed evaluation. [score:10]
In NSCs, hyperglycemia increased the expression of Dcx (Doublecortin) and Pafah1b1 (Platelet activating factor acetyl hydrolase, isoform 1b, subunit 1) proteins concomitant with decreased expression of four microRNAs (mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p) predicted to target these genes. [score:7]
DIANAmT, miRanda, miRWalk, PITA, Targetscan mmu-miR-466a-3p 4 miRanda, miRWalk, PITA, Targetscan mmu-miR-466d-3p 4 miRanda, miRWalk, PITA, Targetscan NSCs from normal pregnancy were transferred into 24 well plates with poly lysine coated coverslips and the cells were allowed to adhere for 48 h. 5′ Fluorescein labelled miRCURY LNA ™ probes were purchased for mouse U6, mmu-miR-200b and mmu-miR-466d-3p from Exiqon (Vedbaek, Denmark)(Table S2 in Tables S1). [score:7]
Knockdown of miRNAs, mmu-miR-200a, or mmu-miR-200b, or mmu-miR-466a-3p or mmu-miR-466d-3p resulted in increased expression of Dcx (1.78±0.57-folds, p<0.05; 1.42±0.34-folds, p<0.05; 2.12±0.40-folds, p<0.05; 2.98±1.05-folds, p<0.05 respectively) (Fig. 4B) and Pafah1b1 (1.93±0.43-folds, p<0.05; 1.69±0.57-folds, p<0.05; 1.64±0.45-folds, p<0.05; 1.68±0.34-folds, p<0.01 respectively) (Fig. 4C) proteins in NSCs. [score:4]
miR-200 family has been reported to regulate olfactory neurogenesis in mouse and zebrafish mo dels [47] and the expression of few members of miR-466 family have been shown in mouse ocular tissue [48]. [score:4]
Further, we confirmed that Dcx and Pafah1b1 were targets of miRNAs mmu-miR-200a, mmu-miR-200b, and mmu-miR-466a-3p and mmu-miR-466d-3p by using knockdown approach. [score:4]
Confocal images showing the expression of Gfap positive cells (A–E), Ng2 positive cells (F–J) and Map2 positive cells (K–O) (red) in differentiated cells following knockdown of miRNAs mmu-miR-200a or mmu-miR-200b or mmu-miR-466a-3p or mmu-miR-466d-3p in NSCs. [score:4]
This study is the first to report the expression of miRNAs mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p in NSCs obtained from mouse embryonic forebrain. [score:3]
5′flourescently labelled miRCURY LNA ™ miRNA inhibitors mmu-miR-200b, mmu-miR-466d-3p, and non labeled miRCURY LNA ™ mmu-miR-200a, mmu-miR-466a-3p and were purchased from Exiqon (Vedbaek, Denmark) (Table S3 in Tables S1). [score:3]
miRNAs, mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p were knocked down individually in NSCs in culture. [score:2]
The expression levels of miRNA mmu-miR-200a (0.009±0.009 vs 1.06±0.45-folds, p<0.05), mmu-miR-200b (0.021±0.02 vs 1.04±0.37-folds, p<0.05), mmu-miR-466a-3p (0.054±0.01 vs1.01±0.21-folds, p<0.05) and mmu-miR-466d-3p (0.028±0.02 vs 1.01±0.21-folds, p<0.01) were significantly decreased in NSCs from diabetic pregnancy when compared to the control (Fig. 3C). [score:2]
Knockdown of only mmu-miR-200a (135.25±19.34%, p<0.05) or mmu-miR-466a-3p (121.54±17.29%, p<0.05) significantly increased the number of Map2 positive cells compared to scrambled transfected cells (Fig. 5K–O, iii), signifying increased neurogenesis. [score:1]
There was significantly increased astrogenesis as indicated by increased Gfap positive cells following knockdown of miRNAs, mmu-miR-200a (120.52±6.54%, p<0.01) or mmu-miR-200b (115±2.24%, p<0.01) or mmu-miR-466a-3p (126.53±18.87%, p<0.05) compared to scrambled (Scr) transfected cells (Fig. 5 A–E, i). [score:1]
We performed in situ hybridization of two representative miRNAs (mmu-miR-200b and mmu-miR-466d-3p) selected from each family of miRNA that are investigated in this study (mmu-miR-200 and mmu-miR-466 family) in unbiased manner to detect whether these miRNAs were expressed by NSCs. [score:1]
[1 to 20 of 16 sentences]
3
[+] score: 32
miR-466 in turn impacts lymph-angiogenesis by targeting Prox1 3′UTR sequence and suppressing the expression of the gene and therefore reducing lymphangiogenesis [95]. [score:7]
miR-466 and miR-1187, in particular, emerge as significant and regulators, sharing common target genes with Nr2e3, Rora, Ezh2 that are also differentially expressed in AMD. [score:6]
Seo M Choi J-S Rho CR Joo C-K Lee SK MicroRNA miR-466 inhibits Lymphangiogenesis by targeting prospero-related homeobox 1 in the alkali burn corneal injury mo delJ. [score:5]
In addition, the miRNAs mir466 and mir1186 have 5 potential target genes that are differentially expressed in AMD patients compared to unaffected individuals: lymphocyte cytosolic protein1 (Lcp1), NADPH oxidase 4 (Nox 4) regulator of G-protein signaling (Rgs5), Dystonin (Dst), and Cpm. [score:5]
miR-466 was discovered in a recent study to identify miRNAs that target the Prospero homeobox 1 (Prox1) gene, a known regulator of retinal neurogenesis. [score:4]
Additionally, prior studies from various mo dels of retinal degeneration identified over 300 differentially expressed miRNAs 63– 90, a total of 16 common miRNAs were identified (miR-1187, miR-125b-5p, miR-331-3p, miR466d-3p, miR-467f, miR-542-3p, miR-574-5p, miR654-3p, miR669h-3p, miR-882, miR-342-3p, miR-466a-5p, miR-466d-5p, miR-706, miR-345-3p, miR532-5p). [score:3]
This filtering strategy allowed us to identify 2 genes (Ell2 and Entpd1) as well as 3 miRNAs (mir466, miR1187 and miR710) that are regulated by epigenetic factors and nuclear hormone receptors and are associated with AMD pathogenesis. [score:2]
[1 to 20 of 7 sentences]
4
[+] score: 29
In the nucleus accumbens, miR-342-5p was found to be upregulated (∼115 fold) and miR-466 was downregulated (∼4 fold) in the high-active mice. [score:7]
Target gene analysis of miR-466 showed some similarity in gene families to Ferguson, et al. ’s previous protein work (Ferguson et al. 2014). [score:3]
In this study, we observed miR-466 in the nucleus accumbens and soleus to be differentially expressed between the strains. [score:3]
Figure 1Relative expression determined by qRT-PCR of (A) miR-342-5p (P < 0.0001) and (B) miR-466 (P < 0.0004) in nucleus accumbens and (C) miR-466 (P < 0.0001) and (D) miR-1960 (P = 0.06) in the soleus between high- (C57L/J) and low- (C3H/HeJ) active mice. [score:3]
Furthermore, miR-342-5p and miR-466 in the nucleus accumbens, and miR-466 in soleus were validated by qRT-PCR to be differentially expressed between the high- and low-active mice. [score:3]
Expression of miR-466 in the soleus was ∼5 fold lower in high-active mice. [score:3]
Specifically, these authors showed that glucose deprivation caused oxidative stress, leading to histone acetylation of the miRNA promoter region, and activating expression of miR-466 h-5p and Sfmbt2. [score:3]
In the nucleus accumbens, miR-342-5p and miR-466 were validated as differentially expressed between strains by qRT-PCR, as was miR-466 in the soleus. [score:3]
Finally, as miR-466d-3p and miR-466b-3p are 100% matching, they are noted under the same miRNA family and referred to as simply miR-466 regardless of tissue of reference. [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 24
Other miRNAs from this paper: mmu-mir-467a-1, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, hsa-mir-548q, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, mmu-mir-466c-3, hsa-mir-548bc
The expressions of mmu-miR-466 and mmu-miR-467 markedly waved during the hair follicle cycling in mouse [50] and were downregulated in melanoma of mouse by curcumin diet [51]. [score:6]
hsa-miR-548, mmu-miR-466, and mmu-miR-467 have an enormous number of targets on IGs, which both have the role of inhibition of host immunity response. [score:5]
The mmu-miR-466 family and mmu-miR-467 family have predicted 1,704 target sites and 956 target sites, respectively, distributed on 375 and 310 IGs of the mouse. [score:5]
We found that the hsa-miR-548 family has the highest amount of target sites among the identified miRNAs in human and the mmu-miR-466 and mmu-miR-467 families are top two in the miRNAs list predicted in the mouse. [score:3]
Both of hsa-miRNA-548 and mmu-miR-466 and mmu-miR-467 can inhibit the host immunity response [54]. [score:3]
In this study, mmu-miR-466, mmu-miR-467, and mmu-miR-669 clusters have one core promoter region and transcriptional start site shared with the Sfmbt2 gene. [score:1]
And histone deacetylation and metabolic oxidative stress can induce the activity of mmu-miR-466 [52]. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 24
In contrast, when miRNA expression in LAT Y136F CD4 [+] T cells was compared to miRNA expression in the other two proliferative settings, miR-669f, miR-155 and miR-466a/b were preferentially upregulated when using wild type naïve CD4 [+] T cells as a basis for comparison. [score:7]
The most highly expressed miRNAs that are regulated in LAT Y136F lymphoproliferative disease compared to the other proliferative settings are miR-669f, miR-155 and miR-466a/b. [score:5]
In hyper-proliferating LAT Y136F T cells, one miRNA (miR-181a) was underexpressed more than 10-fold compared to C57BL/6 memory CD4 [+] T cells and another was underexpressed more than 5-fold (miR-466a/b). [score:4]
Four miRNAs (miR-21, miR-181a, miR-146a and miR-148a) have a greater than 10-fold difference in expression between LAT Y136F and naïve C57BL/6 CD4 [+] T cells and five additional miRNAs have greater than 5-fold differences (Table 1; miR-669f, miR-155, miR-466a/b, miR-125a and miR-96). [score:3]
In addition we can compose a list of other miRNAs that are differentially regulated more than 5-fold among various combinations of the three proliferative states: miR-96, miR-125a, miR-139, miR-148a, miR-155, miR-181a, miR-361, miR-466a/b and miR669f. [score:2]
These miRNAs differentially regulated in LAT Y136F CD4 [+] T cells were miR-669f, miR-155, miR466a/b and miR-125a. [score:2]
H poly mmu-miR-150 mmu-miR-181a ↓↓ ↓↓ mmu-miR-669f ↓ ↓ mmu-miR-29c ↑ mmu-miR-155 ↑ ↑ mmu-miR-467f ↓ mmu-miR-466a/b-3p ↓ ↓ mmu-miR-361 ↑↑ ↓ mmu-miR-547 mmu-miR-1949 mmu-miR-345-3p ↓ ↑ mmu-miR-101b mmu-miR-340-5p mmu-miR-148a ↑ ↑ mmu-miR-139-5p ↓↓ ↓ mmu-miR-132 ↑ ↑ mmu-miR-539 ↓ mmu-miR-125a-5p ↑↑ ↑ ↓ mmu-miR-130b *miRNAs with Nanostring counts that passed the minimum intensity filter and have >2-fold differences among any two-way comparison. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 16
mir-466a, activating k Ras expression, was downregulated by ECS more strikingly in males than females, and naproxen was effective in counteracting ECS-related downregulation in females but not in males. [score:9]
70 Synapse development and plasticity miR-350-5p 0.22/0.35 0.33/3.59 0.47/0.47 0.30/0.29 0.12/0.53 0.76/0.28 Inflammation (Increase in unphosphorylated NFATc3 and its nuclear translocation) miR-421-3p 1.65/2.83 6.67/1.72 7.57/2.35 2.86/0.30 2.13/1.57 1.24/2.25 Post-transcriptional regulation of ACE2 miR-466a-5p 4.36/3.17 0.53/5.42 2.96/1.55 3.63/1. [score:3]
Most of the other miRNAs distinguishing the mice according to the yield of microadenomas (miR-30, miR-181b, miR-183, miR-301a, miR-350, miR-466a, and miR-466i) were also able to distinguish the mice according to the yield of adenomas. [score:1]
In these mice, 5 miRNAs were altered in blood but not in lung (miR-34b, miR-106a, miR-449, miR-466, miR-493). [score:1]
In aspirin -treated mice exposed to MCS, modulation of 9 miRNAs in both lung and blood serum (miR-30c, miR-181b, miR-183, miR-301a, miR-350, miR-466a/i, miR-500, and miR-709) correlated with protection against pulmonary microadenomas, while no miRNA related to protection against pulmonary adenomas was modulated at the same time in both body compartments. [score:1]
One miRNA only (miR-466) was altered in both blood serum and lung of mice with a high yield of microadenomas. [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
MiR-466 was the only miRNA that was upregulated both in lung and blood of mice bearing >10 microadenomas. [score:4]
The identity, fold-change variation, direction of alteration, and biological function of these miRNAs are reported in Table 2. In mice bearing adenomas, 5 miRNAs (miR-34b, miR-106a, miR-499, miR-466, and miR-493) were altered in the blood serum but not in lung. [score:2]
One miRNA only (miR-466) was altered in both body compartments of mice bearing >10 microadenomas in the lung fragment. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 11
Exosomes contain circulating microRNAs which can modify the expression of genes 15, 16 and we screened mir466, 455, 323 and 29b that can bind to the 3′ UTR region of MMP9 and downregulate its expression. [score:8]
Figure 6Expression of mir29b, mir455, mir323-5p and mir466. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 9
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
miR-669 is involved in c-Myc expression through p53 [95], miR-500 regulates MET protooncogenes and affects NF-kB [96], miR-466 is involved in mammary tumor development, miR-466c is involved in tumor growth [95], miR-449a regulates breast cancer development and inhibits cell proliferation [71], [97], [98] and miR-Let7b plays a role in myeloid leukemia [99]. [score:9]
[1 to 20 of 1 sentences]
11
[+] score: 8
Only three miRNAs were consistently regulated in both mo del systems with miR-155 being upregulated both in differentiating adipocytes and in obese mice and miR-466a-3p as well as miR-467 that were downregulated in both adipocytes and obese mice. [score:8]
[1 to 20 of 1 sentences]
12
[+] score: 8
In this study, we also predicted targets of miRNAs, and found the targets of miR-10a miR-10b miR-414 and miR-466 in the HOX clusters (Additional file 9). [score:5]
Regarding targets of miRNAs in the tammar HOX clusters, valid miRNA hits to miR-10a, miR-10b, miR-414 and miR-466 were confirmed (details referred to Additional file 9). [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 8
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-130a, mmu-mir-186, mmu-mir-200b, mmu-mir-202, mmu-mir-30e, mmu-let-7d, mmu-mir-130b, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-mir-200a, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-19a, mmu-mir-200c, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-709, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-574, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-21b, mmu-mir-130c, mmu-mir-21c, mmu-mir-30f, mmu-mir-466c-3
In particular, BMP5 mRNA is upregulated while the miR-466/467 cluster is downregulated. [score:7]
For example, miR-466, miR-669, and miR-467 were derived from a single microRNA cluster Chromosome 2 microRNA cluster (C2MC) which might play important roles in immune response [32]. [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 8
The miR-466 family affects apoptosis regulation in mammalian cells and is a master regulator of several pathways associated with regulatory T cell development and function [61, 62]. [score:5]
Two miRNAs, miR-222-3p and miR-466 k, were differentially expressed. [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 6
We verified by real-time quantitative PCR the expression levels of miR-466e-3p, miR-185-3p and miR-21-3p; both miR-466-e-3p and miR-21-3p were upregulated after high-fat diet and irradiation, respectively (Table S1). [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 4
The 10 most upregulated miRNAs at any of the four time points are miR-9, miR-466a/e/f/p, miR-3105, miR-5128, miR-6539, miR-6909, and miR-7648. [score:4]
[1 to 20 of 1 sentences]
17
[+] score: 3
In the present study, we found that the miR-379∼329∼667∼410 cluster has 38 mir genes, while the miR-466∼467∼669 cluster, being one of the largest miRNA clusters in mouse genome, has 71 miRNA genes. [score:1]
The miR-466∼467∼669 cluster is one of the largest miRNA clusters in the mouse genome, containing 71 miRNA genes. [score:1]
Each clusters had at least 2 genes, with mir-466∼467∼669 cluster (cluster # 2) having 71 genes and mir-379∼410 cluster (cluster #7) having 38 genes. [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 3
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
Furthermore, such DEX alteration of adrenal miRNA levels demonstrates that DEX suppression of endogenous ACTH secretion modulates a set of adrenal miRNAs, with the exception of miRNA-96, miRNA-466, and miRNA-27a, that are distinct from those modulated by treatment with exogenous ACTH. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-93, mmu-let-7g, mmu-let-7i, mmu-mir-126a, mmu-mir-302a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-126, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-93, hsa-mir-302a, hsa-mir-551b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-626, hsa-mir-548d-1, hsa-mir-548d-2, mmu-mir-551b, mmu-mir-763, mmu-mir-680-2, mmu-mir-692-1, mmu-mir-327, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-467g, hsa-mir-1233-1, hsa-mir-1234, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-103b-2, hsa-mir-320d-2, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3176, hsa-mir-548w, hsa-mir-548x, mmu-mir-3471-1, hsa-mir-4281, hsa-mir-1302-11, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-3689c, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, mmu-let-7j, hsa-mir-548ay, hsa-mir-548az, mmu-let-7k, mmu-mir-126b, hsa-mir-548ba, hsa-mir-548bb, mmu-mir-466c-3, hsa-mir-548bc
We observed five categories: • The primary sequences of pre-miRNAs HSA-MIR-466, HSA-MIR-1233-1, HSA-MIR-3669, MMU-MIR-297A-6 and MMU-MIR-467g are similar to microsatellites (microsatellites are similar to tandem repeats of short sequence motifs (less than 10 nt)) [39]): HSA-MIR-466 contains microsatellites GU [n ]and AC [n]; HSA-MIR-1233-1 contains microsatellites AGGGC [n]; and MMU-MIR-467g is composed by microsatellite AU [n]. [score:1]
We observed five categories: • The primary sequences of pre-miRNAs HSA-MIR-466, HSA-MIR-1233-1, HSA-MIR-3669, MMU-MIR-297A-6 and MMU-MIR-467g are similar to microsatellites (microsatellites are similar to tandem repeats of short sequence motifs (less than 10 nt)) [39]): HSA-MIR-466 contains microsatellites GU [n ]and AC [n]; HSA-MIR-1233-1 contains microsatellites AGGGC [n]; and MMU-MIR-467g is composed by microsatellite AU [n]. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 2
Similarly, miR-466-3c was regulated by two nearby loci on chromosome 10 (14–24 Mb, rs3712394 and 24–38 Mb, rs13480563). [score:2]
[1 to 20 of 1 sentences]
21
[+] score: 2
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
Examples of this are the mir-297, mir-466, mir-467, mir-548 [16], mir-1302 [20], mir-1972, mir-3118 and mir-3179 families (which are all RrmiR families listed here) (Table S5). [score:1]
Three miRNA families that are the results of lineage-specific expansion were found in the mouse genome: the mir-466 and mir-467 families derived from simple repeats and the mir-297 family derived from SINE and LTR repetitive elements (Table S1 and Table S2). [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 1
An exception might be the sequence containing has-mir-466 with (TATG)n and (CA)n microsatellites (Additional File 2 Table S4A). [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-30b, mmu-mir-141, mmu-mir-151, mmu-mir-10b, mmu-mir-191, mmu-mir-143, mmu-mir-30e, mmu-mir-34c, mmu-mir-34b, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-21a, mmu-mir-10a, mmu-mir-139, mmu-mir-375, mmu-mir-196b, mmu-mir-465a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-208b, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-6240, mmu-mir-30f, mmu-mir-465d, mmu-mir-466c-3
Prominent among these were members of the let7, miR-30, miR-465, miR-466, miR-467, and miR-669 clusters. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
miR-466 and miR-184 are reported to be closely related with corneal lymphangiogenesis. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
From the following groups of miRNAs with identical sequence, only the first member is annotated in the heat-map: mmu-let-7a*/mmu-let-7c-2*; mmu-miR-466a-3p/mmu-miR-466b-3p/mmu-miR-466c-3p/mmu-miR-466e-3p; mmu-miR-467a*/mmu-miR-467d*; mmu-miR-297a*/mmu-miR-297c*/mmu-miR-297b-3p and mmu-miR-199a-3p/mmu-miR-199b. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Functions of the other three miRNAs, miR149, miR193 and miR466a-3p, have not been previously examined in the intestinal epithelium in vitro or in vivo. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
The well-studied miRNAs within this group included let-7 family (let-7c/d/f/k), miR-212 cluster (miR-212-3p and miR-132-3p/5p), miR-23a/b, miR-9-3p/5p, miR-411 clusters (miR-299a and miR-329) and miR-466 clusters (miR-466m-5p and miR-669f-5p) (Figure 2 and Table 1). [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
The mouse host gene Sfmbt2 (Scm-like with four mbt domains 2), located on MMU2, was found to comprise the largest number of resident miRNA genes (n = 70) belonging to the mir-297, mir-466, and mir-467 gene families. [score:1]
[1 to 20 of 1 sentences]