11 publications mentioning dre-mir-23a-3

Open access articles that are associated with the species Danio rerio and mention the gene name mir-23a-3. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

To further confirm that miR-23a could directly target the zebrafish tsga10-3′-UTR, we performed in vivo fluorescence sensor assay, indicating that the overexpression of miR-23a inhibited the tsga10-3′-UTR expression (Fig. 8d).

Since miRNAs exerted their biological function by triggering the degradation of mRNA and/or inhibiting translation [47], we sought to further identify TSGA10 as a direct target of miR-23a.

To test whether the increase or reduction of exosomal miR-23a, frequently as a result of regulated expression of miR-23a in CNE2 cells, contributed to angiogenesis, we first modulated miR-23a expression via miR-23a mimic and inhibitor.

Our study indicates that a combination of miR-23a inhibitor with currently available VEGF inhibitors would better clarify the disease traits at the individual level; this leads, in turn, to enhance our ability to take preventive treatment for NPC patients with a high risk of metastasis.

Our study identifies that proangiogenic functions of miR-23a have been ascribed to direct suppression of the secreted, antiangiogenic factor TSGA10 within ECs, suggesting one mechanism of miR-23a upregulation associated with NPC metastasis.

Analogously, the migration enhanced by miR-23a upregulation could be abolished by Flag-TSGA10 treatment (Fig. 7l–o), indicating that miR-23a exerted its function by directly targeting TSGA10.

Among a series of cellular analyses, we found that upregulation of miR-23a enhanced cell growth, migration, and tube formation of ECs, while silencing miR-23a expression attenuated these functions (Fig. 3b–i).

In addition, downregulation of miR-23a in ECs contributed to angiogenesis inhibition by altering cell proliferation, migration, and tube formation (Fig. 3).

As a first step to identify the direct targets of miR-23a, two programs (i. e., MicroCosm Targets Version 5 [35], and RNAhybrid [36]) were applied; and there were hundreds of potential genes predicted.

They showed that miR-23a–27a–24-2 cluster members were enriched in ECs and highly vascularized tissues, and inhibition of miR-23/27 repressed sprouting angiogenesis by targeting Sprouty2 and Sema6A proteins [15].

First, CNE2 cells with high or low miR-23a expression were obtained after transfection with miR-23a mimic or an inhibitor (Fig. S4A).

b Pearson correlation between miR-24-2 expression and miR-23a/27a expression in nasopharyngeal samples.

Candidate targets of miR-23a were predicted using MicroCosm Targets and RNAhybrid.

In addition, the association of miR-23a expression and the prognosis of NPC patients was analyzed, showing that the overall survival time of NPC patients was shorter in the groups exhibiting high miR-23a expression (Fig. 1i).

One-way ANOVA Consistent with the results from the reporter assay, ectopic expression of miR-23a, or treatment with miR-23a -mimic-exo, decreased the protein expression of TSGA10 in HUVECs (Fig. 7d–g).

Collectively, we suggest that miR-23a modulates angiogenesis through directly targeting TSGA10.

To quantify the relative levels of miR-23a in collected exosomes, we performed, showing that the levels of circulating exosomal miR-23a were tumor-specifically upregulated, and thus, were higher in NPC patients than healthy volunteers (Fig. 4f).

In addition, western blot analysis showed that elevated expression of miR-23a positively regulates ERK signaling (Fig. 3j, k).

One-way ANOVAConsistent with the results from the reporter assay, ectopic expression of miR-23a, or treatment with miR-23a -mimic-exo, decreased the protein expression of TSGA10 in HUVECs (Fig. 7d–g).

Considering that vascular development may depend on various factors at different times [40], we explore the likelihood of miR-23a as a novel antiangiogenic target.

The human miR-23a–27a–24-2 clusters are intergenic on chromosome 19 (Fig. 1a), and Pearson correlation revealed that there was relevant upregulation of miR-23a/27a when miR-24-2 was increased (Fig. 1b).

We believe that exosomes serve as a paracrine mechanism for miR-23a transported from NPC cells to ECs, thereby accelerating angiogenesis in the adjacent tumor endothelium by directly targeting TSGA10.

In agreement with these publications, we showed that upregulated miR-23a induced increased proliferation and motility of NPC cells (Fig. S4).

Significantly, in this study, we found that reduced expression of TSGA10 enhanced the migration of ECs, suggesting negatively regulating tumor angiogenesis to miR-23a (Figs. 7 and 8).

We demonstrated for the first time that miR-23a could directly repress TSGA10 expression through its binding to the specific site in the 3′-UTR of the human TSGA10 gene/zebrafish tsga10 gene.

In the mutant sensor, mcherry levels were not reduced The human miR-23a–27a–24-2 clusters are intergenic on chromosome 19 (Fig. 1a), and Pearson correlation revealed that there was relevant upregulation of miR-23a/27a when miR-24-2 was increased (Fig. 1b).

In analogy, mimic-exo -mediated miR-23a upregulation resulted in the increase of NPC angiogenesis in vitro and in vivo Matrigel plug mo del (Figs. 5 and 6 and Fig. S8).

In addition, Yang et al. demonstrated that miR-23a was upregulated and facilitated the progress of cell cycle and epithelial–mesenchymal transition (EMT) in epithelial ovarian cancer cells [46].

Overexpression of miR-23a in human NPC is associated with metastatic progression in NPC patients.

non-metastatic NPC patients [11], we examined the association of miR-23a and MVD, showing that elevated expression of miR-23a was accompanied by high MVD (Fig. 2).

Then, exosomes in CM were extracted; confirmed that the exosomal miR-23a expression predominantly changed with respect to transfection (Fig. 4h and Fig. S5).

c Overexpression of miR-23a (miR-23a-pre) reduced tsga10-3′-UTR luciferase activity in HUVECs.

h of miRNA expression in exosomes isolated from miR-23a -treated CM.

Hatzl et al. revealed that enforced expression of miR-23a causes reduction of RKIP, thereby inducing a dramatical increase of proliferation in hematopoietic cells [45].

Briefly, the psiCheck2 -TSGA10-3′-UTR or psiCheck2- TSGA10-3′-MUTR vector was transfected into HUVECs with miR-23a mimic/nc/inhibitor, or miR-23a-pre/precursor control.

Thus, a relatively high exosomal miR-23a expression was observed for mimic -treated CNE2 cells vs.

c Overexpression of miR-23a reduced TSGA10-3′-UTR luciferase activity in vitro but not mutated TSGA10-3′-UTR luciferase activity.

Transient transfection with siRNA, plasmid, and miR-23a mimic/nc/inhibitor.

Hence, therapies targeting miR-23a, combined with existing conventional antitumor therapies, may serve as an effective treatment approach for NPC patients with high metastatic risk.

Small-interfering RNA (siRNA) for TSGA10 and its negative controls, as well as miR-23a mimic/nc/inhibitor were supplied by Biomics Biotechnologies (Nantong, China).

Our study further identifies that miR-23a, a tumorigenic as well as an angiogenic factor, may be a potential treatment target for metastatic NPC patients.

In order to verify our hypothesis, ISH and IHC analyses were carried out on the same two independent sets of 51 human NPC specimens, showing a marked correlation between high miR-23a expression score with increased MVD (Fig. 2a, b), which prompted us to further assess the function of miR-23a in angiogenesis.

f Statistical comparison of differences in expression of miR-23a in the three groups.

To further verify the positive effects of miR-23a on angiogenesis, miR-23a mimic, negative control (nc), and an inhibitor were subsequently transfected to obtain HUVECs with different levels of miR-23a (Fig. 3a).

To exclude the effect due to other angiogenic genes, we attempted to establish a mo del system to alter exosomal miR-23a expression.

i Statistical analyses of the association of miR-23a expression with survival time of the patients.

To explore whether short metastasis time in premetastatic patients exhibits higher miR-23a expression, Pearson correlation analysis was performed, showing no significant difference (Fig. 1h).

HUVECs cocultured with miR-23a -overexpressing exosomes derived from both media dramatically increased angiogenesis (Figs. 5 and 6 and Fig. S8).

A final score obtained from the intensity score multiplied by the extent score was used to identify miR-23a expression level.

Moreover, elevated miR-23a expression in premetastatic tissues was found to be a tissue -based marker for the prediction or early diagnosis of NPC metastasis (Fig. 1).

A total of 2 × 10 [4] HUVEC cells pretreated with miR-23a mimic/nc/inhibitor were seeded on BD Matrigel according to the manufacturer’s recommendations.

The sequences used in transfection are hsa-miR-23a mimic Sense: AUCACAUUGCCAGGGAUUUCC Antisense: GGAAAUCCCUGGCAAUGUGAU hsa-miR-23a nc Sense: UCACAACCUCCUAGAAAGAGUAGA Antisense: UCUACUCUUUCUAGGAGGUUGUGA hsa-miR-23a inhibitor GGAAAUCCCUGGCAAUGUGAU TSGA10_siR1 Sense: GCUGGUUGCUAAAGAUCAAdTdT, Antisense: UUGAUCUUUAGCAACCAGCdTdT; TSGA10_siR2 Sense: GCGACACCUUGCUAAGAAAdTdT, Antisense: UUUCUUAGCAAGGUGUCGCdTdT; TSGA10_siR3 Sense: GCUAAAGCUAAACAAGAAAdTdT, Antisense: UUUCUUGUUUAGCUUUAGCdTdT; TSGA10_siR4 Sense: CACAGAACGAGAUAGUCUAdTdT, Antisense: UAGACUAUCUCGUUCUGUGdTdT.

A recent study from Ruan et al. described that overexpression of miR-23a attenuated TNF-α -induced EC apoptosis [16].

The sequences used in transfection are hsa-miR-23a mimic Sense: AUCACAUUGCCAGGGAUUUCC Antisense: GGAAAUCCCUGGCAAUGUGAU hsa-miR-23a nc Sense: UCACAACCUCCUAGAAAGAGUAGA Antisense: UCUACUCUUUCUAGGAGGUUGUGA hsa-miR-23a inhibitor GGAAAUCCCUGGCAAUGUGAU TSGA10_siR1 Sense: GCUGGUUGCUAAAGAUCAAdTdT, Antisense: UUGAUCUUUAGCAACCAGCdTdT; TSGA10_siR2 Sense: GCGACACCUUGCUAAGAAAdTdT, Antisense: UUUCUUAGCAAGGUGUCGCdTdT; TSGA10_siR3 Sense: GCUAAAGCUAAACAAGAAAdTdT, Antisense: UUUCUUGUUUAGCUUUAGCdTdT; TSGA10_siR4 Sense: CACAGAACGAGAUAGUCUAdTdT, Antisense: UAGACUAUCUCGUUCUGUGdTdT.

Analogously, higher relative values of exosomal miR-23a derived from NPC cells than NP69 cells were observed, which was consistent with cellular miR-23a expression (Fig. 4g and Fig. S1D).

b Pearson correlation between miR-23a expression and MVD.

Our study identifies miR-23a -mediated angiogenesis as one mechanism of miR-23a overexpression associated with NPC metastasis.

h Pearson correlation between miR-23a expression and metastasis time (time for patients who later developed distant metastasis).

One-way ANOVA In order to characterize exosomal pathways as a means of miR-23a -mediated angiogenesis, we divided circulating exosomes of NPC patients into two groups: high miR-23a expression group and low miR-23a expression group (Fig. 4f).

Notably, miR-23a level was higher in the presence of HUVECs cocultured with a high -expression group, indicating that circulating exosomal miR-23a might transfer to HUVECs (Fig. S2A).

MiR-23a directly targets TSGA10 in HUVECs and zebrafish.

The expression levels of miR-23a were further validated by, showing that miR-23a was enriched in NPC cell lines (Fig. 1j).

These results collectively suggest that exosomes expressing different levels of miR-23a accompanied by angiogenic potential changes; in turn, supports our conjecture that exosomes mediate the transfer of miR-23a.

Given that MVD was significantly higher in metastatic NPC patients than that in non-metastatic ones, there might be a potential relationship between miR-23a expression and MVD.

In this study, we have demonstrated the high expression of miR-23a in metastatic NPC specimens in contrast to non-progression NPC or non-cancerous nasopharyngeal tissues.

In addition, we undertook to determine whether inhibition of ERK signaling would alleviate the proangiogenic ability of miR-23a.

Of note, CNE2 with higher miR-23a expression enhanced cell proliferation and migration, whereas it failed to influence cell apoptosis (Fig. S4B–L).

It was shown that miR-23a expression level was elevated in NPC specimens and was even higher in metastatic specimens (Fig. 1d–f).

ISH was performed on deparaffinized NPC tissues using LNA™ microRNA ISH miR-23a optimization kit (Exiqon; Woburn, MA) following the manufacturer’s directions.

These evidences suggest that miR-23a depends directly on zebrafish tsga10 as well.

Exosomal miR-23a regulates angiogenesis both in vitro and in vivo.

Moreover, TSGA10-si1 was selected (Fig. 7h, i) for transwell assays, revealing that the migration blocked by miR-23a inhibition in HUVECs could be restored by siTSGA10 treatment (Fig. 7j, k).

To examine whether miR-23a targeted the 3′-UTR of zebrafish tsga10 as well, luciferase assays were carried out, showing that miR-23a precursor reduced the luciferase activity of tsga10-3′-UTR (Fig. 8c).

Next, luciferase assays were carried out to test the biologically effective interaction of miR-23a and TSGA10-3′-UTR in HUVECs, showing that miR-23a mimic significantly decreased the expression of luciferase -TSGA10-3′-UTR (Fig. 7c).

In accordance, exosomes of 100,000 ×  g -associated miR-23a were extracted from CM, and cocultured with CNE2, leading to dysregulated cell proliferation and migration (Fig. S6).

Advances in cancer research have highlighted the mediation of miR-23a–27a–24-2 clusters in angiogenesis.

Student’s t-testTo investigate the role of miR-23a in NPC progression, in situ hybridization (ISH) was performed to verify miR-23a expression.

Additional analyses revealed that high exosomal miR-23a markedly accelerated cell viability and migration in CNE2, whereas low exosomal miR-23a attenuated them (Fig. S6), which was similar to the biological role of circulating exosomes (Fig. S7).

Importantly, among a panel of NPC cell lines, CNE2 cells were chosen in subsequent experiments for the highest miR-23a level.

Of note, only miR-23a and miR-24-2 level were significantly altered in freshly obtained NPC tissues by quantitative real-time PCR (qRT-PCR), and miR-23a function was subsequently explored for detecting higher fold change (8.24 vs.

Student’s t-test To investigate the role of miR-23a in NPC progression, in situ hybridization (ISH) was performed to verify miR-23a expression.

a The sequences of hsa-miR-23a and dre-miR-23a.

a Structure of human miR-23a–27a–24-2 clusters.

To determine whether exosomes mediated the transfer of miR-23a, exosomes were first isolated from serum of NPC patients (serum-exo) or conditioned media (CM) of NPC cells (CM-exo) by differential centrifugation (Fig. 4a).

Bioinformatics analysis of a region upstream to the miR-23a locus indicated multiple putative binding sites for TSGA10.

It seems to lack a reasonable explanation as to why miR-23a, a proangiogenic factor, is shown to be significantly elevated in NPC cells, rather than blood vessels by ISH.

To test the angiogenic activity of miR-23a may be, in part, mediated by exosomes, we quantified the transport of NPC-derived miR-23a to HUVECs, proving that exogenous miR-23a could function like endogenous miR-23a in ECs via exosomal transport (Fig. 4 and Fig. S1).

Circulating exosomes containing miR-23a affect angiogenesis.

d– e Representative images of miR-23a in situ hybridization (ISH) in tissues collected from graph-depicted groups.

Our data offer interests to detect the noncancer source of exosomal miR-23a.

b Schematic of the predicted miR-23a binding sequence in tsga10-3′-UTR.

Interestingly, after injecting miR-23a precursor and control miRNA, respectively, into single-cell-stage zebrafish, we demonstrated that miR-23a promoted the outgrowth of subintestinal vessels (SIVs) and EC proliferation in intersegmental vessels (ISVs) of zebrafish (Fig. 2c–f).

Fig. 5High exosomal miR-23a promoted HUVEC proliferation, migration, and tube formation.

Understanding the underlying mechanisms responsible for miR-23a-related metastasis may reveal additional strategies for miR-23a intervention.

Collectively, our clinical data suggest that miR-23a could serve as a tissue -based marker for predicting NPC metastasis rather than metastasis time.

a Representative images of immunohistochemical staining for CD34 with high or low levels of miR-23a.

d miR-23a-precursor injection reduced the mCherry levels in mCherry- tsga10-3′-UTR sensor, whereas no change in EGFP was observed.

Among a series of in vitro and in vivo analyses, we noted that serum-derived high level of miR-23a transferred to HUVECs via exosomes might further extend their proangiogenic effect to HUVECs with low exosomal miR-23a uptake (Figs. S2– 3).

Overall, our observations suggest that tumor-derived miR-23a may be useful not only to early-diagnosing metastasis, but also to predict future metastasis.

One-way ANOVA Fig. 6High exosomal miR-23a promoted in vivo angiogenesis.

a Schematic of predicted miR-23a binding sequence in TSGA10-3′-UTR.

To validate miR-23a level in exosomes, qEV size- exclusion columns, another recognized method for exosome isolation and purification [34], were also applied.

Of particular interest, miR-23a had been related to tumorigenic activity by facilitating cell growth and migration previously.

c Quantitative PCR shows that the precursor enhanced miR-23a efficiently.

The loci of miR-23a, miR-27a, and miR-24-2 are shown as colored boxes.

On the basis of these results, we found that exosomes containing miR-23a modulated angiogenesis.

confirmed elevated exosomal miR-23a level in NPC patients by analyzing exosome-enriched fractions (Fig. S1A–C).

Our description is the first to establish that exosomal miR-23a mediated NPC angiogenesis and strengthens that exosome -dependent mechanisms may mediate the communication of miR-23a between NPC cells and HUVECs.

Interestingly, in silico analysis also depicted that the 3′-UTR of zebrafish tsga10 contained the conserved binding sites of miR-23a (Fig. 8a, b).

2

In the current study, we established that a reduction in RUNX2 downregulates VEGF-A expression, while miR-23a reduced RUNX2 expression.

Consistent with our hypothesis, overexpression of miR-23a decreased the translational activity of target gene (RUNX2) transcripts.

To confirm this effect of miR-23a on angiogenesis, we designed anti-miRTM miRNA Inhibitor (ASO-miR-23a) to knockdown expression of miR-23a.

However, in the dre-mir-23a group, only 30% of the embryos were normal, about 35% of embryos showed mild inhibition, and more than 20% of embryos were categorized as severe inhibition (Figure 10A).

In order to determine whether Rg1 suppresses miR-23a expression in HUVECs, we employed qRT-PCR, using GAPDH as an internal control.

RUNX2 is directly targeted and regulated by miR-23a.

Furthermore, qRT-PCR and western blot results demonstrated that miR-23a reduced RUNX2 expression through targeting of its 3’-UTR region (Figure 5C and 5D).

The interaction between miR-23a and its binding site in the 3’-UTR of the target RUNX2 gene transcript is important for activating target repression.

Moreover, 8 hours after Rg1 treatment, miR-23a expression level decreased more than 90%, and this suppression was sustained throughout 24 hours (Figure 6).

Taken together, miR-23a targets RUNX2 and suppresses angiogenesis in Rg1-stimulated endothelial cells.

Therefore, we believe that Rg1 -induced angiogenesis may be simulated through an increase in RUNX2 via the downregulation of miR-23a.

Potential target of miR-23a is partially complementary to the RNA sequence extending from nucleotide 1061-1067 within RUNX2 3’-UTR.

Thus, we speculated that RUNX2 might be a target of miR-23a in Rg1 -induced angiogenesis.

As shown in Figure 6, Rg1 reduces miR-23a expression in HUVECs.

HUVECs were seeded onto 3.5 cm dish for 24 hours and subsequently transfected with anti-miRTM miRNA Inhibitor (ASO-miR-23a) (50 nM) (RIBOBIO, Guangzhou) using Lipofectamine [TM] 2000 in Opti-MEM I Reduced Serum Medium (Invitrogen).

When the ASO-miR-23a was administered, the expression of VEGF-A increased.

Thus, we identify RUNX2 as a promising potential target and present miR-23a as an effective strategy in anti-angiogenesis.

Conversely, the addition of ASO-miR-23a increased VEGF-A expression (Figure 7).

MiR-23a regulates ginsenoside Rg1 -induced VEGF-A expression.

The target region of miR-23a was confirmed as the binding site of RUNX2 transcript that extends from nucleotides 1061 to 1067 located within the RUNX2 3’-UTR.

There was a significant decrease in endothelial tube formation following miR-23a overexpression.

Both qRT-PCR and western blot analysis revealed that miR-23a reduces the expression of VEGF-A in HUVECs.

These data are consistent with our proposal that RUNX2 expression is mediated by miR-23a.

Since Rg1 reduced endogenous miR-23a levels in HUVECs, anti-miRTM miRNA Inhibitor (ASO-miR-23a) was designed to mimic the Rg1 -induced decrease in miR-23a.

When HUVECs were treated with miR-23a, VEGF-A expression was decreased.

Figure 7 (A) Quantitative analysis of miR-23a expression following treatment of HUVECs with 50nM miR-23a or ASO-miR-23a.

Ginsenoside Rg1 reduces miR-23a expression.

In our study, RUNX2 was identified as the target of miR-23a during Rg1 -induced angiogenesis.

Overexpression of miR-23a under Rg1 treatment caused a significant decrease in endothelial tube formation and cell motility.

As shown in Figure 6, the expression level of miR-23a decreased ~80% as early as 4 hours following Rg1 treatment.

Moreover, the group treated with ASO-miR-23a expressed increased viability when compared with the control group.

The inhibitory effect of miR-23a on RUNX2 3’-UTR was further confirmed in luciferase reporter gene assay.

Additionally, our zebrafish mo del confirmed a regulatory role of miR-23a by detecting the formation of basket-like SIV in zebrafish embryos.

Overexpression of miR-23a resulted in a robust reduction of cell growth, and wound recovery decreased ~30%, as compared to the control group (Figure 8A and 8C).

MiR-23a regulates cell viability and migration.

However, the relationship between VEGF-A and miR-23a remains unclear.

These data further confirm an anti-angiogenic function of miR-23a in vivo.

Figure 6 (A) Quantitative analysis of miR-23a in HUVECs after treatment with 250nM Rg1 for varying hours.

For the miR-23a group, 297 zebrafish were observed, and for the control group, and 280 zebrafish were observed.

MiR-23a regulates ginsenoside Rg1 -induced angiogenesis in vitro.

These in vivo results further supported our conclusion and also confirmed that the function of miR-23a and RUNX2 won't lose efficacy under in vivo conditions.

In order to identify an anti-angiogenic mechanism of miR-23a in vivo, zebrafish were utilized to perform an angiogenesis experiment [30].

Figure 10 (A) Fertilized, one to four cell stage zebrafish embryos were injected with 10μM dre-mir-23a agomir or NC agomir.

Figure 8 (A and B) Cell proliferation analysis following a 72 hour treatment with miR-23a or ASO-miR-23a.

MiR-23a regulates angiogenesis in zebrafish.

Furthermore, zebrafish embryos injected with miR-23a showed significant impediments in angiogenesis in vivo.

Expectedly, we observed a decreased when transfected with si-RUNX2/miR-23a.

MiR-23a regulates ginsenoside Rg1 -induced angiogenesis in zebrafish.

Embryos were collected from the fish tank, and zebrafish at one to four cell stage were injected with 10μM dre-mir-23a agomir (AUCACAUUGCCAGGGAUUUCCA) or NC agomir (UUCUCCGAACGUGUCACGUTT) (Sangon Biotech, Shanghai).

These data indicate that the response of miR-23a to Rg1 treatment is quick but stable.

The formation of basket-like subintestinal vessels (SIV) was used to indicate the anti-angiogenic ability of miR-23a.

In this test, the dre-miR-23a agomir and its random sequence, NC agomir, were injected in zebrafish embryos.

This suggests that miR-23a acts as a repressor of HEK-293 cell motility.

Our search results found that miR-23a was partially complementary to the RNA sequence of RUNX2 extending from nucleotide 1061–1067 (Figure 5A).

MiR-23a regulates ginsenoside Rg1 -induced angiogenesis in vitroThe angiogenesic effect of miR-23a was examined using tube formation assay in HUVECs.

However, transfection with ASO-miR-23a improved tube formation from less than 20% to about 55% (Figure 9).

We found that viability, migration, and tubulogenesis were significantly increased when treated with ASO-miR-23a.

3

Our findings were in consistent with studies using the hemin -treated K562s or EPO -induced CD34+ HPCs to differentiate into mature erythrocytes, revealing the upregulation of miR-23a, miR-27a or miR-24 during erythropoiesis, whereas an activin A -mediated erythroid mo dels reported the inhibitory role of miR-24 in haemaglobin accumulation.

Based on the aforementioned observations, we propose that the GATA1/2 switch at the miR-23a∼27a∼24-2 promoter is responsible for their upregulation during erythropoiesis.

Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cellsThe miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24.

Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cells.

These results suggest the occurrence of GATA-1-directed positive regulation of the miR-23a∼27a∼24-2 cluster (Figure 1K).

Figure 1. GATA-1 was located on the upstream of miR-23a∼27a∼24-2 cluster and activated its expression during erythropoiesis.

The miR-23a∼27a∼24-2 cluster was regulated by GATA1/2 switch during erythroid differentiationGiven the aforementioned observations that GATA-1 could reside on the −557 promoter site of miR-23a∼27a∼24-2 cluster and activate transcription, we attempted to determine whether GATA-2 and GATA-1 share the same −557 binding site but yield different biological outputs.

Despite the fact that miR-451, miR-23a and mir-223 were shown to suffer from GATA-1 regulation in some species (6, 7, 11), there are virtually no data about GATA-1/2 switch dynamically operating on their genes during erythropoiesis.

Recently, we reported that miR-23a was a positive erythroid regulator and activated by GATA-1 along erythroid differentiation (7).

The activity of GATA-1 on the miR-23a∼27a∼24-2 promoter was examined by using a luciferase reporter assay following co-transfection with a GATA-1 overexpressing-vector and either a wild-type pGL-3-promoter construct (WT) or a mutant promoter (MUT) in 293T cells.

So far, a number of non-coding regulators such as miR-451 (5, 6), miR-23a (7), miR-221/222 (8), miR-376a (9) and miR-223 (10) were reported to play positive or negative roles in controlling erythropoiesis.

The miR-23a∼27a∼24-2 cluster was regulated by GATA1/2 switch during erythroid differentiation.

Thus, the miR-23a∼27a∼24-2 cluster could coordinate with different TFs to determine or maintain such cell fates.

Given the significant associations of miR-23a in erythropoiesis demonstrated in our previous studies (7), we decided to examine the primary and mature products from miR-23a∼27a∼24-2 cluster.

Here, we demonstrate that the GATA-1/2 switch occurs at the common gene locus encoding miR-23a, miR-27a and miR-24.

Given the aforementioned observations that GATA-1 could reside on the −557 promoter site of miR-23a∼27a∼24-2 cluster and activate transcription, we attempted to determine whether GATA-2 and GATA-1 share the same −557 binding site but yield different biological outputs.

edu/cgi-bin/tess) sequence analysis was performed and revealed two putative GATA sites scattered within the promoter region of human miR-23a∼27a∼24-2 loci (Figure 1E; detailed information is shown in Supplementary Figure S1).

Furthermore, q-PCR using specific Taqman probes revealed that pri-miR-23a∼27a∼24-2 and mature miR-27a, miR-24 and miR-23a were increased in EPO -driven erythroid differentiation of primary cultured human CD34+ HPCs (Figure 1D).

The miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24.

To confirm this mo del, we analysed the association of GATA-2 and GATA-1 with the −557 site of the miR-23a∼27a∼24-2 cluster following miRNA treatment.

This cluster is composed of three members, miR-23a, miR-27a and miR-24, and has been linked to osteoblast differentiation, angiogenesis, cardiac remo delling, skeletal muscle atrophy and tumorigenesis (27–29).

These results suggest that GATA-2 -dependent miR-23a∼27a∼24-2 cluster repression occurs.

To further establish the connection between GATA-2 and miR-27a/24, the levels of both the primary and mature miR-23a∼27a∼24-2 clusters were evaluated in K562s transfected with either siRNAs specific to GATA-2 or constructs over -expressing GATA-2 (Figure 5D).

GATA-1 was located on the miR-23a∼27a∼24-2 cluster promoter and activated its transcription.

Therefore, changes in miR-23a∼27a∼24-2 cluster transcription would be able to be predicted by disruption of this feedback loop.

4

Together with qRT-PCR results confirming that miR-23a and miR-21 were indeed overexpressed in zebrafish via vector -based miRNA expression assay (Figure 1C), we found out that miR-23a, a miRNA that has not been reported to be associated with axon regeneration, had no obvious effect on M-cell axon regeneration; while miR-21, which has been shown to promote regeneration in different organs (Strickland et al., 2011; Han et al., 2014; Hoppe et al., 2015), remarkably promoted M-cell axon regeneration (control: 243.7 ± 32.9 μm, n = 33 fish vs.

With another two miRNAs (miR-23a and miR-21) having different effects on axon regeneration, we reported that overexpression of miR-133b specifically reduced the regenerative length in M-cell (Figure 7).

To overexpress miRNAs, a construct containing pri-miR-133b/pri-miR-23a/pri-miR-21 was made by amplifying a genomic region containing the miR-133b/miR-23a/miR-21 precursor.

To further verify the specific role of miR-133b in regulating axon regeneration, we overexpressed another two miRNAs, miR-23a and miR-21, with the same assay as mentioned above.

miR-23a OE: 229.0 ± 62.4 μm, n = 10 fish vs.

miR-23a OE, P = 0.8312.

5

Specifically, tumor suppressor miRNAs, such as miR-23a, miR-26a/b, miR-29a/b and miR-101a, were found upregulated, whereas oncogenic miRNAs, like miR-7a and members of the miR cluster 17∼92, were downregulated [34].

6

Interestingly, several VTGs are targets of miRNAs for silencing [119]: VTG-3 is targeted by miR-122, the most abundant miRNA in the liver, as well as miR-107, VTG-7 by miR-107, VTG-2 by miR-214 and VTG-6 by miR-23a, highlighting the importance that miRNAs have on vitellogenesis, oocyte maturation and reproduction.

Another endocrine disruptor, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), has been shown to change the expression of several miRNAs in zebrafish embryos (miR-23a, 23b, 24, 27e and 451) that are critical for hematopoiesis and cardiovascular development [133].

7

Since miR-23 (JX994633), miR-218 (JX994383) and miR-338 (JX994406) are present in the elephant shark, these conserved miRNAs are likely to be involved in the regulation of Runx2 expression in elephant shark, possibly during chondrogenic differentiation through mechanisms similar to that in other jawed vertebrates.

Of these, binding sites for miR-23, miR-218 and miR-338 were found conserved in the 3′UTR of elephant shark Runx2, while only that for miR-28 is present in zebrafish and fugu Runx2 (Fig. 8B).

8

MicroRNA-23 restricts cardiac valve formation by inhibiting Has2 and extracellular hyaluronic acid production.

In a zebrafish dicer mutant lacking mature miRNAs, endocardial cushion formation was excessive, prompting the observation that miRNA-23 is necessary to restrict the number of cells that differentiate into endocardial cushion cells (Lagendijk et al., 2011).

9

26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10.

26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10.

10

Several other miRNA clusters including miR-126, miR-218, miR-23/27 clusters are documented in the regulation of angiogenesis [39, 42– 44], whether, all these families of miRNAs function independently or in concert are unclear.

11

The resulting strain named MIR23 carrying the integrated construct risIs[Pbcat-1::bcat-1::gfp+unc119] has been used for experiments.