![]() |
miRBase |
![]() |
![]() |
![]() 43 publications mentioning dre-let-7a-2Open access articles that are associated with the species Danio rerio and mention the gene name let-7a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary. |
|
1 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-let-7g, hsa-let-7i, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-let-7j
To determine whether any correlation existed between the expression of let-7a and its target proteins in breast cancer cell lines, the expression levels of the predicted let-7a target proteins were examined, such as CCR7, IGF-1R, c- Myc, and CDK4 (Figure 2c).
[score:9]
The results from the present study suggest that targeting of CCL21-CCR7 signaling is a valid approach for breast cancer therapy and that let-7a directly binds to the 3'UTR of CCR7 and blocks its protein expression, thereby suppressing migration and invasion of human breast cancer cells.
[score:8]
Downregulation of let-7a expression was reported in breast cancer [19], and in the present study, the expression was determined with Northern blotting and quantitative RT-PCR analysis (Figure 2a, b).
[score:8]
After siRNA of CCL21 and synthetic anti-let-7a transfections, downregulation of CCL21 and overexpression of CCR7 expression was demonstrated by using RT-PCR and (Figure 5b).
[score:8]
In the present study, we determined that let-7a suppressed breast cancer cell migration and invasion by downregulating CCR7 expression.
[score:8]
In the present study, among the metastasis-related genes as potential targets of let-7a, a reverse correlation between CCR7 and let-7a expression was observed in breast cancer patient tissues and breast cancer cell lines, and let-7a specifically influenced CCR7 downexpression.
[score:7]
In the present study, the authors demonstrated that microRNA (miRNA) let-7a downregulates CCR7 expression and directly influences the migration and invasion of breast cancer cells.
[score:7]
Next, the inhibitory effect of let-7a was determined by using synthetic anti-let-7a oligo-nucleotides in MCF-7 breast cancer cells, which express a high level of let-7a and a low level of CCR7, with a high level of CCL21 expression.
[score:7]
The results provided confirmation that CCR7 expression and the consequent breast cancer cell proliferation and motility are downregulated by let-7a.
[score:6]
Collectively, the results from the present study demonstrate let-7a suppresses metastasis through CCR7 target regulation and may be potentially useful as an antimetastatic agent in breast cancer.
[score:6]
Therefore, we suggest that let-7a reduces breast cancer cell migration and invasion through the downregulation of CCR7 expression.
[score:6]
Based on our data, we can infer that let-7a regulates the translation of CCR7, which is believed to be the most common mechanism of miRNA targeting [27].
[score:6]
The expression of CCR7 and CDK4 was downregulated by let-7a more than that of IGF-1R and c- Myc.
[score:6]
Let-7a was also found to target CCR7 3'UTR directly, thereby downregulating breast cancer cell migration and invasion.
[score:6]
Among the target proteins, CCR7 showed a significant reverse correlation with let-7a expression, suggesting that CCR7 could be regulated by let-7a in breast cancer cells.
[score:6]
In seven of 15 breast cancer patients, let-7a expression was more downregulated in malignant tissues than in normal counterpart tissues (Figure 8a).
[score:6]
After CCL21 siRNA and synthetic let-7a transfections, downregulation of both CCL21 and CCR7 expression was shown via RT-PCR and (Figure 5a).
[score:6]
To clarify the role of let-7a in metastasis, potential let-7a target genes were searched, specifically metastasis-related genes, and their protein expression was examined after synthetic let-7a treatment.
[score:5]
Next, the anti-let-7a effect was also confirmed through the transfection of CCL21 siRNA and synthetic anti-let-7a in MCF-7 cell lines with a high expression of CCL21 and low expression of CCR7 (Figure 5b and 5d).
[score:5]
Figure 3 Detection of changes in the expression of let-7a predicted target proteins and cell proliferation, cell migration, and invasion of MDA-MB-231 breast cancer cells after transfection with synthetic let-7a.
[score:5]
The results suggest that CCR7 silencing has an inhibitory effect on breast cancer cell proliferation, migration, and invasion, and overexpression of let-7a has the same effect as CCR7 silencing.
[score:5]
The 3'UTR of CCR7 was confirmed as a direct target of let-7a by using the luciferase assay for the reporter gene expressing let-7a CCR7 3'UTR binding sites.
[score:5]
To confirm the fact that 3'UTR of CCR7 is a direct target of let-7a, a luciferase assay for the reporter gene expressing the let-7a binding sites of CCR7 3'UTR was used.
[score:5]
The result suggests that let-7a directly regulates CCR7 protein expression through interaction with the 3'UTR of CCR7.
[score:5]
Overexpression of let-7a decreases CCR7 expression as well as cell proliferation, invasion, and migration in MDA-MB-231 breast cancer cells.
[score:5]
Synthetic let-7a was transfected into MDA-MB-231 cells, which express low levels of let-7a, and the change in the expression level of predicted CCR7 target proteins (Figure 3a) was evaluated.
[score:5]
In contrast, silencing (inhibition) of let-7a resulted in increases in CCR7 expression, cell migration, and cell invasion in MCF-7 breast cancer cells, consistent with the results of CCR7 silencing by its specific siRNA.
[score:5]
We observed decreasing MDA-MB-231 cell migration and invasion when CCR7 expression was inhibited by synthetic let-7a.
[score:5]
Therefore, we suggest that targeting of CCL21-CCR7 signaling is a convincing approach for improving breast cancer therapy and the usefulness of let-7a as a direct regulator of this signaling.
[score:5]
Through the previously mentioned studies, we focused on the interrelation of the two agents, let-7a and CCR7, in search of promising molecular targets to inhibit metastasis and for potential antimetastatic agents for possible use in breast cancer therapy.
[score:5]
Let-7a directly regulates CCR7 expression by binding with the 3'UTR of CCR7.
[score:4]
The data showed the 3'UTR of CCR7 was a direct target of let-7a.
[score:4]
These experiments showed that let-7a regulates CCR7 and cell motility, dependent on CCL21 expressions.
[score:4]
Downregulation of let-7a increases cell invasion, migration, and proliferation in MCF-7 breast cancer cells.
[score:4]
Downregulation of let-7a was found in highly metastatic human breast cancer patient tissues [19], and in human breast cancer cells, such as MDA-MB-231 cells.
[score:4]
Let-7a was found to act as a tumor suppressor directly regulating RAS and HMGA2 oncogenes by interacting with the 3'UTR [11- 13].
[score:4]
Reverse correlation between the expression of let-7a and CCR7 in breast cancer cell lines.
[score:3]
First, the let-7a binding site on CCR7 3'UTR was predicted by using the TargetScan microRNA -binding prediction program (Figure 6a).
[score:3]
Within the let-7 family, let-7a expression increases after differentiation and in mature tissue, but is barely detectable in the embryonic stage [10].
[score:3]
Synthetic let-7a decreased breast cancer cell proliferation, migration, and invasion, as well as CCR7 protein expression in MDA-MB-231 cells.
[score:3]
Let-7a targeting of CCR7 3'UTR was confirmed by using a luciferase reporter gene carrying the 3'UTR of CCR7 wild-type or a mutant type of the let-7a binding site.
[score:3]
In addition, the strong association between the loss of let-7a expression and metastatic relapse suggests the potential of let-7a in prognostic stratification of breast cancer patients in addition to conventional clinical and pathologic staging markers.
[score:3]
Notably, a reverse correlation between levels of let-7a and CCR7 expression was found in both human breast cancer patient tissues and in cancer cell lines.
[score:3]
Figure 2Detection of basal expression levels of CCR7, IGF-1R, c- Myc, CDK-4, and let-7a in seven breast cancer cell lines.
[score:3]
Figure 8 Analysis of let-7a and CCR7 expression in tissues from 15 breast cancer patients (five infiltrating ductal cancers (P1, P3, P11-13), one metaplastic cancer matrix-producing type (P2), seven invasive ductal cancers (P4-10), one infiltrating cribriform cancer (P14), and one atypical medullary cancer (P15)] (Table 1).
[score:3]
Reverse correlation between the expression of CCR7 and let-7a in breast cancer patients.
[score:3]
Collectively, the data suggest that the zebrafish embryo mo del can be used to monitor the migration of breast cancer cells in a living animal, and let-7a overexpression or CCR7 silencing could cause a significant reduction in breast cancer cell migration in vivo.
[score:3]
Comparatively, high and low let-7a expression was detected in MCF-7 and JIMT-1 cells and in MDA-MB-231 cells, respectively.
[score:3]
The expression of CCR7, its ligand CCL21, and let-7a was detected in breast cancer cell lines and in breast cancer patient tissues.
[score:3]
In addition, a reverse correlation in the expression of CCR7 and let-7a in breast cancer cell lines and breast cancer patient tissues was detected.
[score:3]
Reduced levels of let-7a correlate with elevated RAS expression in lung squamous carcinoma [11].
[score:3]
First, CCL21-specific siRNA and synthetic let-7a were transfected into MDA-MB-231 cell lines expressing high levels of both CCL21 and CCR7 (Figure 5a and 5c).
[score:3]
After transfection with synthetic anti-let-7a, the level of CCR7 expression increased (Figure 4a).
[score:3]
The let-7a inhibitor reversed the let-7a effects on the MCF-7 cells.
[score:3]
In addition, the effect of cell migration and invasion activity was confirmed through the cell migration and invasion assay, indicating that let-7a decreased MDA-MB-231 cell migration and invasion activity, dependent on CCR7 and CCL21 expression (Figure 5c).
[score:2]
Synthetic let-7a and an inhibitor of let-7a were transfected into MDA-MB-231 and MCF-7 breast cancer cells, respectively, and cell proliferation, cell migration, and invasion assays were performed.
[score:2]
Additionally, the effect of cell migration and invasion activity was confirmed by the cell migration and invasion assays, showing anti-let-7a increased MCF-7 cell migration and invasion activity, dependent on CCR7 and CCL21 expression (Figure 5d).
[score:2]
Figure 6 Direct interaction between let-7a and 3'UTR of CCR7.
[score:2]
The cell lines were transfected with synthetic let-7a, CCR7 siRNA, anti-let-7a, and scRNA for 1 day and then transferred to the upper chamber of the Transwell coated with 0.5 mg/ml collagen type I (BD Bioscience) and a 1:15 dilution of Matrigel (BD Bioscience).
[score:1]
The studies showed that synthetic let-7a- or CCR7 siRNA -transfected cells exhibit reduced cell migration.
[score:1]
An in vivo invasion animal mo del system using transparent zebrafish embryos was also established to determine the let-7a effect on breast cancer cell invasion.
[score:1]
The luciferase reporter constructs were generated by introducing the CCR7 3'UTR carrying a let-7a binding site into the pGL3 control vector (Promega).
[score:1]
Notably, when analyzing in vivo invasion, MDA-MB 231 cells after synthetic let-7a transfection were unable to invade the vessels in zebrafish embryos.
[score:1]
Recent studies have shown that both let-7a and CCR7 influence cell proliferation, as well as cancer cell invasion and migration [5, 14, 20].
[score:1]
Let-7a regulation of cell migration and invasion is dependent on CCR7 and its ligand CCL21.
[score:1]
Transfection of synthetic let-7a decreases in vivo breast cancer cell invasion in zebrafish embryo animal mo delsTo analyze the in vivo effect of let-7a on cancer cell migration, zebrafish embryos having green fluorescent protein (GFP)-labeled blood vessels were prepared as an animal mo del.
[score:1]
The results showed that only the let-7 family binds CCR7 3'UTR.
[score:1]
Last, by using zebrafish embryo mo dels, confirmation of the let-7a effects observed in vitro was obtained in vivo.
[score:1]
Synthetic let-7a transfection had greater luciferase activity in the CCR7 3'UTR WT construct than in the CCR7 3'UTR MUT construct.
[score:1]
HEK-293 cells were transfected with each of the plasmids (empty vector (EV), CCR7 3'UTR WT and CCR7 3'UTR MUT, as a let-7a binding site) together with synthetic let-7a oligonucleotides and negative control RNA in six-well plates.
[score:1]
To elucidate the role of let-7a in CCR7 protein expression, the CCR7 3'UTR was prepared in the pGL3 control luciferase vector, and luciferase activity was evaluated after transfecting with synthetic let-7a (Figure 6).
[score:1]
The let-7 family has multiple functions.
[score:1]
Let-7 was the first identified miRNA originally isolated from Caenorhabditis elegans.
[score:1]
Red fluorescent protein (RFP)-labeled MDA-MB-231 cells were transfected with synthetic let-7a or CCR7 siRNA and injected into the abdomens of the zebrafish embryos.
[score:1]
The dsRNA used in transfection experiments as a scrambled siRNA (scRNA) was 5'-UCACAACCUCCUAGAAAGAGUAGA-3', synthetic let-7a: 5'-UGAGGUAGUAGGUUGUAUAGUU-3', CCL21 siRNA: 5'- GUACAGCCAAAGGAAGAUUUU-3', and CCR7 siRNA: 5'- GCTGGTCGTGTTGA CCTAT-3'.
[score:1]
The oligonucleotide probes used were 5'-AACTATACAA CCTACTACCTCA-3' with a sequence complementary to the mature let-7a RNA.
[score:1]
According to the results, a small reduction in cell proliferation was detected by silencing CCR7 with both synthetic let-7a and CCR7 siRNA in transfected MDA-MB-231 cells.
[score:1]
Approximately 30% of control breast cancer cells were able to migrate out from the embryo abdomen, but none of the synthetic let-7a or CCR7 siRNA -transfected cells could do so.
[score:1]
Additionally, the relation between let-7a and the CCL21-CCR7 signaling pathway was confirmed.
[score:1]
Moreover, both synthetic let-7a and CCR7 siRNA reduced cell invasion and migration by less than half of the reduction resulting from transfection with scRNA (Figure 3d, e).
[score:1]
Furthermore, the present study underscores the therapeutic potential of let-7a as an antitumor and antimetastatic manager in breast cancer patients.
[score:1]
After transfection with scRNA or synthetic let-7a, the luciferase activity was analyzed (Figure 6b).
[score:1]
Normal MDA-MB-231 cells have the ability to migrate out into the vessel and move toward the tail, whereas cells in which CCR7 is silenced with synthetic let-7a or CCR7 siRNA lose this ability.
[score:1]
As expected, transfection with anti-let-7a increased cell proliferation, invasion, and migration (Figure 4b-d).
[score:1]
To analyze the in vivo effect of let-7a on cancer cell migration, zebrafish embryos having green fluorescent protein (GFP)-labeled blood vessels were prepared as an animal mo del.
[score:1]
Next, the wild-type (WT) constructs containing let-7a binding CCR7 3'UTR and mutant type (MUT) constructs were prepared, in which the binding site was deleted.
[score:1]
When using scRNA -transfected cells, breast cancer cell migration was observed in nine of 21 zebrafish embryos, and no cell migration was observed in embryos by using synthetic let-7a or CCR7 siRNA -transfected cells.
[score:1]
However, the mechanism of let-7a action on metastasis-related genes is poorly understood.
[score:1]
Transfection of synthetic let-7a decreases in vivo breast cancer cell invasion in zebrafish embryo animal mo dels.
[score:1]
In addition, commercial anti-let-7a oligonucleotide was purchased from Panagene in Korea.
[score:1]
To confirm the results, MDA-MB-231 cells were transfected with synthetic let-7a or CCR7 siRNA as a CCR7-silencing positive control (Figure 3b).
[score:1]
Figure 5 Let-7a regulates cell migration and invasion of MDA-MB-231 and MCF-7 cell lines, dependent on CCR-7-CCL21 signaling.
[score:1]
The effects of let-7a and CCR7 siRNA silencing on breast cancer cell migration in vivo were also confirmed by using a zebrafish embryo mo del.
[score:1]
MDA-MB-231 and MCF-7 cells were plated in 96-well culture plates (3 × 10 [3 ]per well), followed by transfection of synthetic let-7a, CCR7 siRNA, anti-let-7a, and scRNA.
[score:1]
However, synthetic let-7a or CCR7 siRNA -transfected cells were not detected in the trunk or tail vessels of the zebrafish embryos.
[score:1]
[1 to 20 of 95 sentences]
|
2 |
![]()
Other miRNAs from this paper: cel-let-7, cel-lin-4, dre-mir-203a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j
Surprisingly, the expression level of let-7 miRNA in lin-28a and lin-28b morphant embryos was very low, and we did not detect significant upregulation in these morphants, suggesting that the downregulation of Lin-28a or Lin-28b is itself insufficient to induce the expression of the let-7 family, at least at 5 hpf (Figure 5B).
[score:11]
In a reciprocal fashion, Lin-4 and let-7 expressions were first detected at L1 and L3 stage, respectively and became stronger as development proceeded, thereby down-regulated the expression of their target gene.
[score:11]
Since zebrafish lin-28b and lin-41 have a lin-4/miR-125b and let-7 target sites in their 3′UTRs (using Targetscan and PITA) [33], the downregulation of lin-28b and lin-41 might be directly regulated by these miRNAs.
[score:10]
As development proceeded, let-7 and miR-125a/b expression levels were increased, and expression levels of Lin28 and Lin41 were prominently downregulated in a reciprocal pattern.
[score:9]
However, while the expression of let-7a and let-7b was significantly upregulated in these morphants at 24 hpf, we did not find any significant upregulation of these let-7 miRNAs in these morphants at the early blastula stage (Figure 5B).
[score:9]
Reciprocal expression of lin-4 and let-7 expression were detected at 24 hpf and 48 hpf, respectively, and the expression level increased as development proceeds.
[score:8]
The expression of LIN28 was highly restricted in ES cells, which negatively regulated let-7 expression, and the let-7 target gene, mouse lin-41, was reported to play an important role as a stem cell specific E3 ubiquitin ligase for the miRNA pathway protein Ago2.
[score:8]
Indeed, we observed significant upregulation of let-7 family miRNA expression in both lin-28a and lin-28b morphants, implying their conserved function as a let-7 regulator.
[score:7]
On the other hand, the expression of let-7 and lin-4/miR-125b miRNA, a downstream heterochronic gene of lin-28, was expressed subsequent to lin-28b expression.
[score:7]
Furthermore, since lin-41 is a direct target of let-7 in C. elegans and mice, we performed RT-PCR and in situ hybridization to investigate whether the expression of lin-41 was downregulated in lin-28a or lin-28b morphant embryos.
[score:7]
In the C. elegans heterochronic pathway, let-7 and lin-4/miR-125 miRNA play an essential regulatory role in the timing of stage-specific cell lineage development in nematodes, in part by directly regulating their target genes [5], [6], [13], [14].
[score:7]
Since LIN-28 prevents the premature accumulation of let-7 miRNA in L2, let-7 miRNA expression occurs during the third larval stage (L3) and controls the fourth larval stage (L4)-to-adult transition by repressing multiple target genes, including the TRIM protein Lin-41 [6], [18], [19].
[score:5]
Interestingly, consistent with decreased lin-28a and lin-28b expression, let-7a, let-7b, and lin-4/miR125b miRNA expression was dramatically increased at 72 hpf (Figure 2B).
[score:5]
We also observed the expression of lin-41, a down-stream target of let-7 in the presumptive anterior neural plate.
[score:5]
Consistent with a prominent increase in let-7 miRNA, RT-PCR analysis of lin-41 expression showed that lin-41 mRNA was downregulated in both lin-28a and lin-28b morphants as compared to the control sample at 24 hpf (Figure 5D).
[score:5]
Concomitant with the increased expression of let-7 and lin-4/miR-125b, the expression of lin-28b and lin-41 began to decrease from 24 and 48 hpf, respectively (Figure 6B).
[score:5]
They did not find any significant changes in the overall level of let-7 in lin-28 morphant embryos at the early gastrula stage (10.5), proposing a let-7-independent function for Lin-28 (e. g., translational regulation of maternally-deposited mRNAs).
[score:4]
The knockdown of Lin-28a or Lin-28b function by morpholino (MO) microinjection resulted in severe cell proliferation defects during early morphogenesis, and the expression of both let-7 and lin-41 was modulated.
[score:4]
On the other hand, let-7 and miR-125 are reportedly expressed in a reciprocal fashion to Lin28a and Lin41 during mouse development [36], [39] (Figure 6C).
[score:4]
Lin-28a and Lin-28b Regulate the Expression of Downstream Heterochronic Genes, as well as the miR-430 miRNA familyIn the C. elegans heterochronic pathway, miRNAs, including let-7 and lin-4/miR-125, play a critical role as downstream genes of lin28.
[score:4]
Among others, mammalian homologs of Lin-28 significantly contribute to cancer progression, the pluripotency of embryonic stem (ES) cells, early zygote development and the reprogramming of human and mouse fibroblasts to induced pluripotent stem (iPS) cells [23]– [26], mostly by preventing the anti-proliferative function of let-7; thus, the role of Lin-28 in vertebrate development has attracted considerable interest.
[score:3]
C. Real-time PCR analysis of let-7a and let-7b expression in control MO-, lin-28a MO- and lin-28b MO -injected embryos.
[score:3]
To characterize the expression pattern of zebrafish homologs of heterochronic genes (including lin-28, let-7, lin-41/TRIM71, and lin-4/miR-125b) in zebrafish development, reverse transcription-PCR (RT-PCR), TaqMan quantitative RT-PCR (qRT-PCR), and whole-mount in situ hybridization were performed on embryos at various developmental stages.
[score:3]
For example, let-7 and lin-4/miR-125 are highly conserved and expressed in various species, including Drosophila and humans [20], [34], [35].
[score:3]
B. Real-time PCR analysis of let-7a, let-7b, miR-430a and miR-430b expression in control MO-, lin-28a MO- and lin-28b MO -injected embryos.
[score:3]
B. Real-time PCR analysis of let-7a, let-7b and lin-4/miR-125b miRNA expression.
[score:3]
As expected, the miRNA expression of both let-7a and let-7b was increased two- to four-fold in lin-28a and lin-28b morphant embryos (Figure 5C).
[score:3]
Next, lin-4 and let-7 miRNA expression begins at L2 and L3, respectively [5], [6], [13], [14].
[score:3]
In mouse ES cells, Lin41 regulates let-7 activity in cooperation with Lin28 and acts as a stem cell-specific E3 ubiquitin ligase [38].
[score:2]
For example, in neural stem cells, Lin28 regulates the timing of cell fate competency in neural stem cells during neurogliogenesis by a let-7-independent mechanism [37].
[score:2]
Expression levels of let-7a, let-7b, miR-430a and miR-430b were analyzed at 5 hpf using TaqMan miRNA assay.
[score:2]
Moreover, lin-41 and lin-28 are highly conserved in mammals and are regulated by let-7 and miR-125 like C. elegans [22], [36].
[score:2]
Expression levels of let-7a, let-7b and lin-4/miR-125b was analyzed using TaqMan miRNA assay.
[score:2]
Expression levels of let-7a and let-7b were analyzed using TaqMan miRNA assay at 28 hpf.
[score:2]
The expression level of let-7a and let-7b was increased in both lin-28a MO- and lin-28b MO -injected embryos embryos compared with control MO -injected embryos (*p<0.05, **p<0.01, control MO vs.
[score:2]
Two domains containing RNA -binding motifs, an N-terminal cold-shock domain and a pair of retroviral-type CCHC zinc fingers near the C-terminus, presumably play an important role in let-7 miRNA binding [32].
[score:1]
In the C. elegans heterochronic pathway, miRNAs, including let-7 and lin-4/miR-125, play a critical role as downstream genes of lin28.
[score:1]
Although it has recently been suggested that the Lin28 -mediated repression of let-7 -induced differentiation may play a major role in the maintenance of most undifferentiated cells, increasing evidence strongly suggests the existence of a let-7-independent function for Lin28.
[score:1]
Thus, it is possible that the let-7 independent function of Lin-28 might play a critical role in these lin-28a and lin-28b morphant phenotypes.
[score:1]
In particular, two functional domains for pri- and pre-let-7 miRNA binding, a cold-shock domain and a pair of CCHC zinc finger domains, were highly conserved.
[score:1]
For example, in has been suggested that Lin28, let-7 and miR125 play important roles in cell fate determination in ES cells [24].
[score:1]
[1 to 20 of 41 sentences]
|
3 |
![]()
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-196a-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3, dre-mir-26b, dre-mir-99-1, dre-mir-99-2, dre-mir-122, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-mir-196a-2, dre-mir-196b, dre-let-7j, dre-mir-196c, dre-mir-196d
Because both Zcchc11 and Zcchc6 function with Lin28 to regulate pre-let-7 in many cell types, we performed the following experiments in Hela cells, as they do not express either Lin28A or Lin28B, but express both TUTases (30).
[score:6]
Considering this, we next examined the expression of Zcchc6 and Zcchc11 proteins in a panel of different adult mouse tissues where let-7 miRNAs are abundantly expressed.
[score:5]
Target hox transcript Forward Reverse a1a TGGATGAAGGTTAAACGCAAC CGAAAAATTGGTGCGTACAG a9a AATTCCTGCGGAGACGAAG CACCGCTTTTTCCTAGTGGA b3a AACAGCTCCCCTAGTGCAAG GGAGGGCTTTTCTCACCAC b5a CCCAAATATTCCCTTGGATG ATAGCGGGTATATGCAGTTCG c6a AGATCTACCCGTGGATGCAG TTCCAAGGTTTGGTATCTGGA d3a AGCAGAAAAGCACCAACTGC CAGGCGGACTCTTGTCATC d10a AACTGAGGCGTCTGTTTCCA CGGTTAACCAGTTGCTCGTC b8b CCCATGGATGAGACCACAA CGGGTCAGGTAAGGATTGAA Zcchc11 is known to be an important regulator of let-7 maturation in undifferentiated cells, yet its catalytic activity is not restricted to pre-miRNAs.
[score:4]
They are expressed either in clusters containing let-7 family members or from within Hox gene clusters themselves, and are known to regulate numerous Hox genes—in many cases those located in a nearby genomic locus.
[score:4]
Thornton J. E. Gregory R. I. How does Lin28 let-7 control development and diseaseTrends Cell Biol.
[score:4]
In the last several years, a number of activities have been credited to Zcchc11 and Zcchc6 including positive and negative regulation of pre-let-7 miRNAs, mediating toll-like receptor (TLR) signaling, uridylation of a small subset of mature miRNAs, and regulating the cell cycle independent of its catalytic activity (6, 8, 15– 18, 30, 33– 36).
[score:3]
Although a Zcchc11 knockout mouse has been described and survives to birth at Men delian ratios, the redundancy between the two TUTases in mature miRNA uridylation and pre-let-7 turnover suggests a double knockout animal is required before robust phenotypes are observed (8).
[score:3]
To explore if Zcchc11 has preferential uridylation activity toward specific miRNA substrates, we asked whether mature let-7 miRNAs can be targeted by immunopurified Zcchc11 in vitro.
[score:3]
Hagan J. P. Piskounova E. Gregory R. I. Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cellsNat.
[score:3]
Zcchc11 and Zcchc6 were initially identified as regulators of let-7 miRNA biogenesis in embryonic stem cells where they recognize the let-7 precursor RNA (pre-let-7) when it is bound by the small RNA -binding protein Lin28 (16– 18).
[score:2]
Zcchc11 is known to be an important regulator of let-7 maturation in undifferentiated cells, yet its catalytic activity is not restricted to pre-miRNAs.
[score:2]
Zcchc6 is a TUTase that shares significant homology and redundant activity with Zcchc11 in regulating pre-let-7 levels in embryonic stem cells (18) (Figure 4a).
[score:2]
We also tested the intrinsic preference of Zcchc11 toward miR-26a, a miRNA with reported Zcchc11 -dependent uridylation in cells, but found that it did not support strong uridylation similar to let-7 or miR-10 (6).
[score:1]
RNA oligo Sequence let-7g guide UGAGGUAGUAGUUUGUACAGUU let-7g passenger CUGUACAGGCCACUGCCUUGC GL2 guide UCGAAGUAUUCCGCGUACGUU GL2 passenger CGUACGCGGAAUACUUCGAUU let-7i guide UGAGGUAGUAGUUUGUGCUGUU let-7i passenger CUGCGCAAGCUACUGCCUUGCU let-7i domains 1/2 mut UAGUCGCUGCAUUUGUGCUGUU let-7i domains 2/3 mut UGAGGUAUGCAGCCUAGCUGUU let-7i guide 1/2/3 mut UAGUCGCUGCAGCCUAGCUGUU let-7i delG UUACAUACUAAUUUCUACUCUU GL2 with let-7 motif UCGAAGUGUAGUUUGUACGUU miR-10a guide UACCCUGUAGAUCCGAAUUUGUG miR-26a guide UUCAAGUAAUCCAGGAUAGGC miR-10a double mut UACCCUUGCAAUCCGAAGCCUAG let-7g+A guide UGAGGUAGUAGUUUGUACAGUUA let-7g+U guide UGAGGUAGUAGUUUGUACAGUUU Human Zcchc11 cDNA region encoding amino acids 225–1384 was subcloned into a modified pET-24 plasmid (Novagen) containing an N-terminal His6-Trx (thioredoxin) tag with a cleavage sequence for TEV (tobacco etch virus) protease.
[score:1]
Rybak A. Fuchs H. Smirnova L. Brandt C. Pohl E. E. Nitsch R. Wulczyn F. G. A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitmentNat.
[score:1]
The first nucleotide in this sequence (shaded dark) is poorly conserved relative to the remaining sequences shared by let-7 miRNAs.
[score:1]
In addition, several mature let-7 miRNAs are subjected to 3′ mono- and oligo-uridylation but the mechanism underlying this activity is poorly understood (4– 7, 9, 15– 18).
[score:1]
Loughlin F. E. Gebert L. F. Towbin H. Brunschweiger A. Hall J. Allain F. H. Structural basis of pre-let-7 miRNA recognition by the zinc knuckles of pluripotency factor Lin28Nat.
[score:1]
While uridylation is detected above background for let-7i, this is complicated by adjacent genomic thymidine residues for most let-7 species including let-7a/b/c/d/f/g.
[score:1]
To determine the sequences that convey this substrate specificity, we performed mutagenesis on let-7i guide, another member of the let-7 family.
[score:1]
Indeed isolated r. Zccch11 displayed the same preference for uridylating let-7 guide miRNAs with an overall activity comparable to that of the Flag-Zcchc11 purified from mammalian cells (Figure 4e), thereby demonstrating the sufficiency of Zcchc11 for this selective miRNA uridylation activity.
[score:1]
Heo I. Joo C. Cho J. Ha M. Han J. Kim V. N. Lin28 mediates the terminal uridylation of let-7 precursor MicroRNAMol.
[score:1]
To gain insight into the mechanism of substrate selectivity and to identify other miRNAs that contain a similar uridylation signal, we performed an alignment of all members of the human let-7 miRNA family.
[score:1]
Consistent with previous work showing similar activity between the two proteins, we found Zcchc6 to have a similarly strong preference for let-7 guide and miR-10a guide over let-7 passenger and miR-26 as for Zcchc11 (Figure 4b).
[score:1]
This miRNA turnover pathway serves to keep let-7 miRNAs low in undifferentiated cells and, upon the transition to differentiation, is relieved to ultimately permit the accumulation of mature let-7 miRNAs in differentiated cells (16– 18, 21– 23).
[score:1]
The Lin28/pre-let-7/TUTase ternary complex is sufficient to oligo-uridylate the 3′ end of pre-let-7 and facilitates its degradation by the exonuclease Dis3l2 (19, 20).
[score:1]
Zcchc11 and Zcchc6 along with GLD2/PAPD4, a TUTase previously shown to have mono- and oligo(A)-adding activity, together can add single uridine residues to the 3′ end of certain precursor let-7 miRNAs to create a 3′ end structure that facilitates efficient Dicer processing (15).
[score:1]
These data suggest that specific sequences found in several let-7 miRNAs are both necessary and sufficient to drive preferential uridylation activity of Zcchc11.
[score:1]
Extract from P19 embryonal carcinoma (EC) cells was used as positive control since we have previously reported an overlapping function for Zcchc6/11 in the Lin28 -mediated control of let-7 biogenesis in these cells (18).
[score:1]
Furthermore, non-templated U addition is enriched for 3p-miRs and widespread pre-miRNA uridylation has been reported for several distinct miRNA families beyond let-7, complicating the analysis of 3p-miR uridylation (4, 31).
[score:1]
Figure 2. A sequence motif in mature let-7 miRNAs defines Zcchc11 substrates.
[score:1]
As shown in Figure 2a, all let-7 members contain at least one GUAG sequence, while all except let-7e and miR-98 contain two overlapping GUAG motifs.
[score:1]
Interestingly, a subset of miRNAs that are responsive to GLD2 -mediated adenylation are specified by sequences in their 3′ ends and include some but not all let-7 family members (e. g. let-7i, identified as TUTase -dependent in our study).
[score:1]
Roughly half of this group, the let-7 miRNA family, is the best-characterized heterochronic miRNA family, known to regulate developmental timing in organisms as diverse as C. elegans and humans (27, 28).
[score:1]
Our in vitro analysis is largely supported by our deep sequencing results but there are notable exceptions including the general absence of many uridylated mature let-7 family members.
[score:1]
The predicted miRNAs found in our search comprise four families, specifically: let-7, miR-99/100, miR-196a/b and miR-10a/b family members.
[score:1]
Also worth noting is the similarity in the seed sequence between let-7 family miRNAs and miR-196a/b.
[score:1]
[1 to 20 of 37 sentences]
|
4 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, mmu-let-7g, mmu-let-7i, mmu-let-7d, hsa-let-7g, hsa-let-7i, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-let-7j, mmu-let-7j, mmu-let-7k
We propose that Shh -dependent induction of Ascl1a and Lin28a contributes to Müller glia dedifferentiation through let-7 microRNA -mediated translational downregulation of shha, shhb, smo, ptch1, and zic2b from respective mRNAs.
[score:6]
Shh Signaling/ lin28a/ let-7 Regulatory Loop Is Essential for MGPC InductionWe then explored whether the RNA -binding protein and pluripotency-inducing factor Lin28a, a necessary and well-known target of Ascl1a during retina regeneration, is regulated directly through Shh signaling (Ramachandran et al., 2010a).
[score:6]
These findings suggest that lin28a -mediated suppression of let-7 is required for the translational regulation of Shh signaling components in MGPCs as a part of positive feedback loop mediated through the Ascl1a- lin28a axis.
[score:6]
As zic2b mRNA shows a translational regulation through let-7 microRNA, one could speculate that the role of Zic2b protein is restricted to Ascl1a- or Lin28a -expressing MGPCs.
[score:6]
We report on stringent translational regulation of sonic hedgehog, smoothened, and patched1 by let-7 microRNA, which is regulated by Lin28a, in Müller glia (MG)-derived progenitor cells (MGPCs).
[score:5]
This let-7 downregulation in MGPCs is opposite to the IF pattern of Shh (Figures 3H and 3I), which suggested possible regulation of shha mRNA by let-7 microRNA.
[score:5]
We cloned these four genes in-frame with GFP reporter regulated by the cytomegalovirus (CMV) promoter and transfected these constructs with increasing concentrations of let-7a and let-7f microRNA expression plasmid (Ramachandran et al., 2010a) in HEK293T cells (Figure S5F).
[score:4]
• Shh signaling is essential for MG dedifferentiation during retina regeneration •Shh signaling components are regulated by let-7 microRNA in the zebrafish retina • A regulatory feedback loop between Mmp9 and Shh signaling is active in the retina •Shh signaling induced a gene-regulatory network involving mmp9, ascl1a, zic2b, and foxn4 zebrafish retina regeneration Shh Ascl1a Mmp9 Zic2b Foxn4 let-7 Lin28 In contrast to mammals, zebrafish retina possesses remarkable regenerative capacity after an acute injury, leading to functional restoration of vision (Sherpa et al., 2008).
[score:4]
Furthermore, let-7 microRNA, which is downregulated by Lin28a (Ramachandran et al., 2010a), was abundant in the uninjured inner nuclear layer (INL) in BrdU [+] MGPCs at 4 dpi (Figure 3H).
[score:4]
Arrowheads mark expression of let-7a in BrdU [−] cells and arrows mark co-exclusion of let-7a from BrdU [+] cells in (H).
[score:3]
We anticipate a much wider role for the Shha-Mmp9-Ascl1a-Lin28a- let-7 regulatory loop during retinal regeneration.
[score:2]
Shh Signaling/ lin28a/ let-7 Regulatory Loop Is Essential for MGPC Induction.
[score:2]
Figure 3Lin28a- let-7 Axis Regulates Shh Signaling Component Genes in the Injured Retina(A) FISH and IF microscopy images of a 0.5-μm-thick optical section of retina showed co-localization of lin28a with ptch1 in BrdU [+] MGPCs at 4 dpi.
[score:2]
These results suggest that zic2b is an essential regeneration -associated gene in zebrafish retina that is regulated through the mmp9-shha-ascl1a-lin28a-let-7 pathway.
[score:2]
This speculation is mainly because of the presence of bona fide let-7 microRNA -binding sites in the zic2b coding region (Figure S5F).
[score:1]
In silico analysis predicted several let-7 microRNA -binding sites present in shha, shhb, smo, and ptch1 genes (Table S4).
[score:1]
These include the interplay of Shh/Notch signaling components, transcription factors (namely, Ascl1a, Zic2b, Foxn4, and Insm1a), the matrix metalloproteinase Mmp9, the RNA -binding protein Lin28a, and microRNA let-7. Complete retina regeneration in zebrafish has provided valuable clues as to why their mammalian counterparts often fail (Goldman, 2014, Wan and Goldman, 2016).
[score:1]
[1 to 20 of 17 sentences]
|
5 |
![]()
Other miRNAs from this paper: cel-let-7, cel-mir-1, cel-mir-35, cel-mir-52, cel-mir-58a, dme-mir-1, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, dme-bantam, mmu-let-7d, dme-let-7, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-1a-2, cel-lsy-6, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-1b, cel-mir-58b, mmu-let-7j, mmu-let-7k, cel-mir-58c
pab-1 and pab-2 genetically cooperate with miRNAs let-7 was previously implicated in the translation repression of its targets during the larval developmental stages of C. elegans (32).
[score:6]
let-7 was previously implicated in the translation repression of its targets during the larval developmental stages of C. elegans (32).
[score:6]
Ecsedi M. Rausch M. Grosshans H. The let-7 microRNA directs vulval development through a single target Dev.
[score:5]
Bursting was recently attributed to the mis-regulation of a single target, lin-41, as mutating a single let-7 binding site in lin-41 3′UTR recapitulates the phenotype (36).
[score:4]
let-7(n2853) animals (L1) were fed with bacterially-expressed dsRNA against the indicated gene, or L4 animals injected with dsRNA (B) and F1 animals were scored for bursting vulva phenotype at the permissive temperature (16°C).
[score:3]
Nolde M. J. Saka N. Reinert K. L. Slack F. J. The Caenorhabditis elegans pumilio homolog, puf-9, is required for the 3′ UTR -mediated repression of the let-7 microRNA target gene, hbl-1 Dev.
[score:3]
These results demonstrate that pab-1 and pab-2 are required for the full function of let-7 in larval development.
[score:2]
To examine the role of PAB-1 and PAB-2 and other proteins identified in our proteomic survey in miRNA -mediated translation repression, we tested their genetic interaction with let-7. As previously noted, complete genetic depletion of pab-1 and pab-2 leads to sterility, due to germline proliferation defects and pleiotropic effects (33, 34); we thus employed a sensitized genetic assay based on the temperature-sensitive let-7(n2853) hypomorphic allele.
[score:2]
Figure 2. pab-1 and pab-2 genetically cooperate with let-7 and lsy-6 miRNAs.
[score:1]
All strains were grown at 22°C except let-7(n2853), which was maintained at 16°C.
[score:1]
Akay A. Craig A. Lehrbach N. Larance M. Pourkarimi E. Wright J. E. Lamond A. Miska E. Gartner A. RNA -binding protein GLD-1/quaking genetically interacts with the mir-35 and the let-7 miRNA pathways in Caenorhabditis elegans Open Biol.
[score:1]
Worm strains used: N2 Bristol (WT), pab-2 (ok1851), let-7 (n2853), MH2636 (otIs114(Plim-6::GFP, rol-6(d)), lsy-6(ot150)), FD01(pab-2(ok1851), otIs114(Plim-6::GFP, rol-6(d)), lsy-6(ot150)), FD02(pab-2(ok1851), otIs114(Plim-6::GFP, rol-6(d))).
[score:1]
Accordingly, deadenylation of a 6×-let-7 reporter reached half-completion at ∼3 h in mouse ascites and was fully impaired by PABP depletion (5), whereas a 8x-let-7 reporter was deadenylated much faster in Drosophila lysates (T [1/2] <30 min), and did not require PABP (20).
[score:1]
[1 to 20 of 13 sentences]
|
6 |
![]()
Other miRNAs from this paper: dre-mir-181a-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-23b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-150, dre-mir-190a, dre-let-7j, dre-mir-212, dre-mir-181a-2, dre-mir-31, dre-mir-190b, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5
Opioid Receptor Knockdown Affects the Expression of dre-let-7d and its Precursors (qPCR studies)Since opioid receptors (MOR) are considered putative targets of the let-7 miRNA family [21], [23], we speculated that silencing the opioid receptors would affect the expression of dre-let-7d and its precursors.
[score:7]
Since opioid receptors (MOR) are considered putative targets of the let-7 miRNA family [21], [23], we speculated that silencing the opioid receptors would affect the expression of dre-let-7d and its precursors.
[score:4]
Since Let-7 family is highly conserved across species in both sequence and function [23], we suggest that in zebrafish the down regulation of the dre-let-7d target genes (opioid receptors: ZfMOR, ZfDOR1 and ZfDOR2), also decrease its modulator, the miRNA dre-let-7d.
[score:4]
Let-7 miRNA is a putative regulator of µ opioid receptor binding in the CDS [21] and within 3′UTR elements of mRNA [23], which can affect the expression of opioid receptors.
[score:4]
Cocaine Modulates the Expression of dre-let-7d and its Precursors (RT-qPCR study)The human miRNA let-7d showed high homology with zebrafish dre-let-7d (72%), and dre-let-7d displayed high homology (from 63 to 81%) with the other family members of human let-7 (let-7a, let-7b, let-7c, let-7e, let-7f, let-7g and let-7i) (Fig. 2D).
[score:3]
Opioid Receptor DNA-microinjection Modulates the Expression of dre-let-7d and its Precursors (qPCR studies)The human let-7 miRNA family has a putative binding site at the µ-opioid receptor (let-7d in the CDC) [21] and within the 3′UTR elements of mRNA MOR [23].
[score:3]
The human let-7 miRNA family has a putative binding site at the µ-opioid receptor (let-7d in the CDC) [21] and within the 3′UTR elements of mRNA MOR [23].
[score:1]
D) DNA sequences of mature let-7 family members in vertebrates, humans and zebrafish.
[score:1]
The accession numbers (according to miRBase) of the several mature let-7 members were: hsa-let-7a (MI0000060), hsa-le-7b (MI0000063, hsa-let-7c(MI0000064, hsa-let-7d (MI0000065), hsa-let-7e (MI0000066), hsa-let-7f (MI0000067, hsa-let-7g (MI0000433), hsa-let-7i (MI0000434), dre-let-7d (MI0001868).
[score:1]
The human miRNA let-7d showed high homology with zebrafish dre-let-7d (72%), and dre-let-7d displayed high homology (from 63 to 81%) with the other family members of human let-7 (let-7a, let-7b, let-7c, let-7e, let-7f, let-7g and let-7i) (Fig. 2D).
[score:1]
Likewise, let-7 family members have been reported to be present in embryonic tissues, in neural precursors, and also in the developing nervous system of the zebrafish [60], [61].
[score:1]
Likewise, the lethal 7 (Let-7) family, the first miRNA identified in humans, is highly conserved across species in both sequence and function [23] and has been shown to be a modulator of many genes, among them MOR; binding in the CDS [21] and within 3′UTR elements of mRNA [23].
[score:1]
[1 to 20 of 12 sentences]
|
7 |
![]()
Other miRNAs from this paper: dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-let-7j
Lin28 and Let7 maintain a balance in molecular expression, as overexpression of Let-7 blocks Lin28 gene expression, and Lin28 expression degrades Let-7. Throughout embryonic development, we see a steady decline in levels of Lin28 expression and a simultaneous increase in Let-7 miRNAs, responsible for the suppression of cellular self-renewal of undifferentiated cells and the stimulation of cell differentiation.
[score:14]
In turn, elevated expression of Let-7 in Muse cells could claim responsibility for the suppression of Lin28 expression, preventing tumor formation and promoting tissue regeneration (Figure 2(f)) (unpublished data).
[score:6]
In contrast, Let-7, a microRNA that regulates embryonic development, cell differentiation, and tumor suppression, opposes the action of Lin28 [21].
[score:4]
These results strongly suggest that overexpression of Let-7 in Muse cells is a putative target for further exploration.
[score:4]
MicroRNA Let-7 seems to be a critical upstream regulator decreasing genes involved in cell cycle division (CDCA3 and CDC16) cell differentiation (DZIP1), cellular growth and proliferation (SSR1), DNA replication factor and cancer (RFC3, RFC5, and MCM6), and cell death and survival (NUF2, BRCA1, BUB1B, and CDK6) which potentially balance cell development and oncogenesis preventing Muse-AT cells forming teratomas (Figure 2(h)).
[score:2]
[1 to 20 of 5 sentences]
|
8 |
![]()
Other miRNAs from this paper: dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-30c, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-let-7j, dre-mir-24b
Intrigued by our results on the analysis of miR-24 and let-7 mutations, we reasoned that a comprehensive analysis of our mutagenized miRNA sequences would establish the most successful mutations to functionally perturb miRNA expression in vivo (Fig. 4A).
[score:5]
We detected ubstantial off-target effects only in the let-7 multiplex experiment, in which one out of the eleven off-target sequences was mutated at a frequency higher than 10% (Fig. 2).
[score:5]
For the let-7 family, 24-multiplexed sgRNAs were sufficient to target 36 loci since multiple let-7 members share an identical pre-miRNA genome sequence.
[score:3]
The co-injection of GFP-let-7-MRE and mCherry mRNAs, and the M24 let-7 sgRNA pool with Cas9 induced derepression of GFP protein expression (Fig. 3B, arrows).
[score:3]
We tested our approach in zebrafish by targeting three miRNA families consisting of 2 miRNA members, three families consisting of 4 to 5 miRNA members, and the let-7 family consisting of 18 known members.
[score:3]
In the somatic tissue of individual F0 adults, we found 90% of the injected sgRNA pairs induced mutations across multiplexed conditions including 15 out of the 18 let-7 members (Fig. 1C).
[score:2]
We also generated a GFP-let-7-MRE sensor by cloning three different let-7 MREs recognized by let-7 a, b and c miRNAs in the 3′UTR of the GFP reporter construct.
[score:1]
Indeed, the injection of our CRISPR/Cas9 against the let-7 superfamily or miR-24 was sufficient to disrupt mature miRNA activity leading to derepression of a GFP sensor containing miRNA -binding sites.
[score:1]
[1 to 20 of 8 sentences]
|
9 |
![]()
Other miRNAs from this paper: dre-mir-181b-1, dre-mir-181b-2, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15b, dre-mir-23b, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-145, dre-mir-155, dre-mir-190a, dre-mir-206-1, dre-mir-206-2, dre-let-7j, dre-mir-190b, dre-mir-181b-3
They also found that morphine significantly upregulates let-7 expression in SH-SY5Y cells and in a mouse mo del of opioid tolerance.
[score:6]
Regulation of opioid tolerance by let-7 family microRNA targeting the mu opioid receptor.
[score:4]
Inhibition of let-7 decreased brain let-7 levels and partially attenuated opioid antinociceptive tolerance in mice.
[score:3]
The miRNA let-7 works as a mediator moving MOR mRNA to P-bodies, leading to translation repression.
[score:3]
He et al. (2010) identified a let-7 binding site in the 3′-UTR of the MOR mRNA and found that let-7 thereby represses MOR expression.
[score:3]
These results suggest that let-7 plays an integral role in opioid tolerance.
[score:1]
Substrate requirements for let-7 function in the developing zebrafish embryo.
[score:1]
miR-let-7. miR-23b.
[score:1]
Although chronic morphine treatment did not change overall MOR transcript levels, association of polysomes with MOR mRNA declined in a let-7 -dependent manner.
[score:1]
[1 to 20 of 9 sentences]
|
10 |
![]()
Other miRNAs from this paper: dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-mir-219-1, dre-mir-219-2, dre-mir-221, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-92b, dre-mir-96, dre-mir-100-1, dre-mir-100-2, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-135c-1, dre-mir-135c-2, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-153a, dre-mir-181c, dre-mir-200a, dre-mir-218a-1, dre-mir-218a-2, dre-mir-219-3, dre-mir-375-1, dre-mir-375-2, dre-mir-454a, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-181a-2, dre-mir-34b, dre-mir-34c, dre-mir-222b, dre-mir-138-2, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-128-3
In addition to miRNAs with expression restricted to either proliferating or differentiating cells, miR-9, miR-135c, miR-153a, miR-219 and members of the let-7 family (let-7a, let-7b and let-7c) show expression in both proliferating and differentiating cells of the larval brain (Figures 1c,f; 2, 3, 9, 12, 18, and 22-24, and Tables A, B and C in7).
[score:5]
let-7a and let-7c, which differ in their sequence from let-7b by two and one nucleotide, respectively, located outside the seed region, appear to lack this retinal expression, although we cannot exclude that these LNA probes cross-hybridize to various let-7 family members in different brain areas (Additional data files 22-24 and 27-29).
[score:3]
let-7a expression in the zebrafish brain.
[score:3]
Additional data file 22 is a figure showing let-7a expression in the zebrafish brain.
[score:3]
Click here for file 2 let-7a expression in the zebrafish brain.
[score:3]
We observe that in the case of let-7a, miR-92b and miR-153a, one mismatch strongly reduces the hybridization signal.
[score:1]
Mismatch test for let-7a, miR-92b, miR-153a and miR-181a.
[score:1]
Click here for file 9Mismatch test for let-7a, miR-92b, miR-153a and miR-181a.
[score:1]
Additional data file 29 is a figure showing a mismatch test for let-7a, miR-92b, miR-153a and miR-181a.
[score:1]
[1 to 20 of 9 sentences]
|
11 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Since the let-7 family is known to regulate terminal differentiation, their down-regulation suggests a potential role in dedifferentiation, thus regulating targets involved in regeneration (Tsonis et al, 2007).
[score:8]
Microarray analysis revealed that the let-7 family, particularly let-7a, -7b, -7c, -7d, -7e, -7f and -7g, expression was reduced, both in hair cells and lens differentiation.
[score:3]
Despite the relatively moderate differences (15–40%), miRNAs that had the highest differential expression were let-7a, -7b, miR-220, -423, -190, -204,-24, -195 and miR-125b.
[score:3]
[1 to 20 of 3 sentences]
|
12 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-125a, mmu-mir-126a, mmu-mir-145a, hsa-mir-30c-2, mmu-mir-143, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-126, mmu-mir-30c-1, mmu-mir-30c-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-27a, mmu-mir-107, mmu-mir-26a-2, hsa-mir-30c-1, hsa-mir-26a-2, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3, dre-mir-26b, dre-mir-27a, dre-mir-30c, dre-mir-107a, dre-mir-125a-1, dre-mir-125a-2, dre-mir-126a, dre-mir-143, dre-mir-145, dre-let-7j, dre-mir-107b, dre-mir-126b, mmu-mir-145b, mmu-let-7j, mmu-let-7k, mmu-mir-126b
Wang X. Cao L. Wang Y. Wang X. Liu N. You Y. Regulation of let-7 and its target oncogenesOncol.
[score:4]
He X. Y. Chen J. X. Zhang Z. Li C. L. Peng Q. L. Peng H. M. The let-7a microRNA protects from growth of lung carcinoma by suppression of k-Ras and c-Myc in nude miceJ.
[score:3]
For example, miRNAs of the let-7 family repress the expression of known oncogenes, including k-Ras and c-Myc [28, 29].
[score:3]
Nicastro G. García-Mayoral M. F. Hollingworth D. Kelly G. Martin S. R. Briata P. Gherzi R. Ramos A. Noncanonical G recognition mediates KSRP regulation of let-7 biogenesisNat.
[score:2]
Furthermore, eight of the E2-repressed miRNAs also contained the AGGGU motif in their terminal loop (let-7 family members, miR-26a and miR-125a), whereas this motif does not exist in any of the control miRNA terminal loop sequences (Table S2).
[score:1]
[1 to 20 of 5 sentences]
|
13 |
![]()
Other miRNAs from this paper: dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-7a-3, dre-mir-30c, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-206-1, dre-mir-206-2, dre-mir-375-1, dre-mir-375-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j
WT, wild type To further prove the specificity of the pancreatic islet phenotype, we injected two control morpholinos against let-7 and miR-124 and analyzed these for miR-375 and insulin expression.
[score:3]
WT, wild typeTo further prove the specificity of the pancreatic islet phenotype, we injected two control morpholinos against let-7 and miR-124 and analyzed these for miR-375 and insulin expression.
[score:3]
Figure 6 (A) In situ analysis of miR-375 and insulin expression in 72-hpf embryos injected with morpholinos against the miR-375 precursor and negative control morpholinos for let-7 and miR-124.
[score:3]
In addition, many miRNAs reside in families of related sequence (e. g., let-7 and miR-182), and these should possibly be targeted simultaneously by different morpholinos to obtain a biological effect.
[score:3]
[1 to 20 of 4 sentences]
|
14 |
![]()
Other miRNAs from this paper: dre-mir-181b-1, dre-mir-181b-2, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-16b, dre-mir-16c, dre-mir-29a, dre-mir-101a, dre-mir-144, dre-mir-153b, dre-mir-181c, dre-mir-462, dre-mir-457b, dre-let-7j, dre-mir-181a-2, dre-mir-1388, dre-mir-7147, ipu-let-7a-7, ipu-let-7a-1, ipu-let-7a-3, ipu-let-7a-5, ipu-let-7a-6, ipu-let-7a-4, ipu-let-7a-2, ipu-let-7b-2, ipu-let-7b-1, ipu-let-7c-1, ipu-let-7c-2, ipu-let-7d-2, ipu-let-7d-1, ipu-let-7e-2, ipu-let-7e-1, ipu-let-7f, ipu-let-7g-1, ipu-let-7g-2, ipu-let-7h, ipu-let-7i, ipu-let-7j-1, ipu-let-7j-2, ipu-mir-101a, ipu-mir-1388, ipu-mir-144, ipu-mir-153b, ipu-mir-16b, ipu-mir-181a-1, ipu-mir-181a-2, ipu-mir-181a-3, ipu-mir-181a-4, ipu-mir-181a-5, ipu-mir-181b-2, ipu-mir-181b-1, ipu-mir-181c, ipu-mir-462, ipu-mir-9-4, ipu-mir-9-2, ipu-mir-9-6, ipu-mir-9-1, ipu-mir-9-3, ipu-mir-9-7, ipu-mir-9-5, ipu-mir-7147, ipu-mir-29a, ipu-mir-16c, ipu-mir-203c, ipu-mir-129b, ipu-mir-7553, ipu-mir-7556, ipu-mir-7562, ipu-mir-7568, ipu-mir-7569, ipu-mir-7570, ipu-mir-7571, ipu-mir-7572, ipu-mir-7573, ipu-mir-7574, ipu-mir-7575, ipu-mir-7576, ipu-mir-7577, ipu-mir-457b, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d
The C. elegans let-7 family plays a key role in regulating late developmental events by down -regulating multiple genes that contain 3′ UTR sequences complementary to the seed region.
[score:4]
Previous studies in mammals have also indicated that the let-7 gene family can regulate the expression of major cytokine-inducible proteins in response to microbial challenge [31]– [32].
[score:4]
Possibly because of vital roles in channel catfish, ipu-let-7 was identified as the second most abundant miRNA family (1,471,153 reads).
[score:1]
Let-7 is a highly significant miRNA family that was first discovered in C. elegans [30].
[score:1]
The comparison of let-7a precursors among Homo sapiens, Mus musculus, Ciona intestinalis, Branchiostoma floridae and Schmidtea mediterranea showed that the seed sequences of the mature miRNAs are highly conserved among the five species.
[score:1]
We selected let-7 in several typical animals to analyze the conservation of the miRNA*s identified in channel catfish across vertebrates and invertebrates.
[score:1]
[1 to 20 of 6 sentences]
|
15 |
![]()
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-204-1, dre-mir-181a-1, dre-mir-214, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-25, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3, dre-mir-30d, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-100-1, dre-mir-100-2, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-mir-126a, dre-mir-143, dre-mir-146a, dre-mir-462, dre-mir-202, dre-mir-204-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-181a-2, dre-mir-1388, dre-mir-222b, dre-mir-126b, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-204-3
However, in fruit fly (Drosophila melanogaster), let-7 promotes germline differentiation through regulating gonadal-somatic cell behaviour 48.
[score:2]
Relative abundance of let-7a-5p, miR-181a-5p, and miR-202-5p varied between different species as well as the two zebrafish studies.
[score:1]
We detected high abundance of let-7a-5p in testis at 6 wpf (Fig. 4), but not in sexually mature gonads, in contrast to the other four fish species, and the other zebrafish study 27. miR-202-5p had high abundance in rainbow trout, marine medaka, and the other zebrafish study, but we detected comparatively lower abundance (Fig. 4), similar to Nile tilapia.
[score:1]
In mouse, Trim71 is present within the male germline, and let-7a promotes spermatogonia differentiation 47.
[score:1]
Among the most frequently abundant miRNAs between species were let-7a-5p, miR-143-3p, miR-181a-5p, miR-202-5p, and miR-21-5p (Supplementary Fig. S2B).
[score:1]
Lin28 interacts with pre-let-7 to prevent its maturation, which results in cells maintaining an undifferentiated state.
[score:1]
Notably, all miRNAs from the miR-10 family showed a significant increase in abundance in ovaries at 24 wpf, while miRNAs from the let-7 family showed a significant increase at 6 wpf only.
[score:1]
The specific timing of let-7 abundance observed in zebrafish testis suggests a conserved function in promoting testis differentiation, although future studies will be needed to determine whether teleost let-7 functions primarily through the germline or gonadal somatic cells.
[score:1]
Of the testis-enriched miRNAs, the let-7 family was well represented at 6 wpf (Fig. 6a), while the miR-125 family was abundant at 6, 9, and 24 wpf (Fig. 6a,b,d).
[score:1]
We found significantly increased abundance of let-7 miRNAs in testis at 6 wpf (Fig. 5).
[score:1]
The let-7 miRNA family is highly conserved and typically associated with promoting progenitor cell differentiation and proliferation, often through interactions with lin41/trim71 and lin28 44.
[score:1]
[1 to 20 of 11 sentences]
|
16 |
![]()
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
Not surprisingly, miR-124 and let-7 variants, known to be highly expressed in the brain (Lagos-Quintana et al., 2002), were among the most abundant miRNAs identified by direct cloning.
[score:4]
From the over 100 distinct miRNAs identified in olfactory tissues, the most abundant miRNAs isolated from our study include species that are wi dely expressed in many neural tissues (miR-124a and let-7 variants), as well as a highly restricted family of miRNAs (miR-200).
[score:3]
Forty-one miRNAs (30%), including many of the let-7 variants, show expression in all tissues examined, whether olfactory derived or not (Table S1).
[score:3]
[1 to 20 of 3 sentences]
|
17 |
![]()
Other miRNAs from this paper: dre-mir-7a-1, dre-mir-7a-2, dre-mir-181b-1, dre-mir-181b-2, dre-mir-192, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30a, dre-mir-30b, dre-mir-30c, dre-mir-30d, dre-mir-30e-2, dre-mir-107a, dre-mir-122, dre-mir-137-1, dre-mir-137-2, dre-mir-181c, dre-mir-196b, dre-let-7j, dre-mir-181a-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-733, dre-mir-734, dre-mir-736, dre-mir-1388, dre-mir-107b, ccr-let-7a, ccr-let-7b, ccr-let-7g, ccr-let-7i, ccr-let-7j, ccr-mir-107, ccr-mir-122, ccr-mir-137, ccr-mir-181a, ccr-mir-181b, ccr-mir-181c, ccr-mir-192, ccr-mir-196b, ccr-mir-27a, ccr-mir-27c, ccr-mir-27d, ccr-mir-30b, ccr-mir-30d, ccr-mir-499, ccr-mir-724, ccr-mir-725, ccr-mir-734, ccr-mir-7a, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d
This miRNA family plays a role in regulating late developmental events by down regulating lin-41 [30] and possibly other genes which also contain sequences complementary to the seed region in their 3′ UTRs, possibly as a result of its vital role in developmental timing, let-7 was identified as a highly expressed miRNA in bighead and silver carp (602885 and 687481 sequences, respectively).
[score:7]
Table S5 Comparison of ten let-7 family members in bighead carp and silver carp.
[score:1]
The comparison of let-7 precursors among silver carp (Hypophthalmichthys molitrix), zebrafish (Danio rerio), human (Homo sapiens), fruit fly (Drosophila melanogaster) and nematode (Caenorhabditis elegans) showed the conservation of let-7 mature sequence between vertebrates (above the horizontal line) and invertebrates (below the horizontal line); while the star sequence, though conserved in vertebrates, was less conserved between vertebrates and invertebrates.
[score:1]
Another highly-expressed miRNA family is let-7, a highly significant miRNA family that was first discovered and characterized in Caenorhabditis elegans.
[score:1]
[1 to 20 of 4 sentences]
|
18 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-29a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-147a, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-132, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-146a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, dre-mir-222a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-21-1, dre-mir-21-2, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-122, dre-mir-132-1, dre-mir-132-2, dre-mir-146a, dre-mir-146b, dre-mir-155, dre-mir-194a, dre-mir-194b, hsa-mir-146b, dre-let-7j, hsa-mir-147b, dre-mir-222b, dre-mir-29b3
In another study, Salmonella typhimurium infection was found to induce rapid down-regulation of let-7 miRNA family members in macrophages, thereby leading to an upregulation of let-7 targets, the IL-6 and IL-10 cytokines [15].
[score:9]
[1 to 20 of 1 sentences]
|
19 |
![]()
Other miRNAs from this paper: dme-mir-34, dme-let-7, dre-mir-34a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-34b, dre-mir-34c
In mouse, the LIN28/let-7/BLIMP1 axis, in which RNA binding protein LIN28 negatively regulated let-7 to protect the expression of BLIMP1, was essential for PGC induction in vitro 35, 36.
[score:4]
In human, the miR-372/let-7 axis regulated germ cell formation from embryonic stem cells [18].
[score:2]
In human, it had been found that a miR-372/let-7 axis regulated germ cell maintenance and differentiation [22].
[score:2]
[1 to 20 of 3 sentences]
|
20 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
The level of expression of let-7 miRNAs were found to be significantly reduced.
[score:3]
MicroRNAs and regeneration: let-7 members as potential regulators of dedifferentiation in lens and inner ear hair cell regeneration of the adult newt.
[score:2]
The first recognized miRNAs were lin-7 and let-7 in Caenorhabditis elegans (Lagos-Quintana et al., 2001), but since then the number of these regulatory RNAs has grown to 30,424 mature miRNA sequences in 206 species (Kozomara and Griffiths-Jones, 2011) [2].
[score:2]
[1 to 20 of 3 sentences]
|
21 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
a induces neuronal lineage commitment of cultured mouse NSCs by targeting lin-28 which inhibits pre-let-7 processing by Dicer in ESCs and thus, contribute to the maintenance of the NSCs self-renewal capacity (Rybak et al., 2008).
[score:5]
A feedback loop comprising lin-28 and controls pre-let-7 maturation during neural stem-cell commitment.
[score:1]
let-7. miR-124.
[score:1]
[1 to 20 of 3 sentences]
|
22 |
![]()
Other miRNAs from this paper: dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-210, dre-mir-214, dre-mir-219-1, dre-mir-219-2, dre-mir-221, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-21-1, dre-mir-21-2, dre-mir-25, dre-mir-30e-2, dre-mir-101a, dre-mir-103, dre-mir-107a, dre-mir-122, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-126a, dre-mir-129-2, dre-mir-129-1, dre-mir-130b, dre-mir-130c-1, dre-mir-130c-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-135c-1, dre-mir-135c-2, dre-mir-140, dre-mir-142a, dre-mir-142b, dre-mir-150, dre-mir-152, dre-mir-462, dre-mir-196a-2, dre-mir-196b, dre-mir-202, dre-mir-203b, dre-mir-219-3, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-mir-455-1, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-135b, dre-mir-135a, dre-mir-499, dre-mir-738, dre-mir-429b, dre-mir-1788, dre-mir-196c, dre-mir-107b, dre-mir-455-2, dre-mir-222b, dre-mir-126b, dre-mir-196d, dre-mir-129-3, dre-mir-129-4
Conversely, dre-miR-124, dre-let-7a and dre-mir-21 were ubiquitously expressed.
[score:3]
Members of the let-7 family and dre-miR-21 showed high levels of expression in the majority of tissues, e. g., dre-miR-21 yielded 21% of muscle miRNAs.
[score:3]
[1 to 20 of 2 sentences]
|
23 |
![]()
Other miRNAs from this paper: dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-let-7j
Inhibition of three miRNAs, let-7, miR-125, and miR-9, caused similar defects in retinal development shown in Dicer1 conditional knock-out mice, further confirming that miRNAs are essential for early retinal development [23].
[score:6]
[1 to 20 of 1 sentences]
|
24 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-let-7g, hsa-let-7i, hsa-mir-125b-1, hsa-mir-125a, hsa-mir-125b-2, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-let-7j
In the nematode Caenorhabditis elegans, the let-7 microRNA (miRNA) controls the timing of key developmental events and terminal differentiation in part by directly regulating lin-41 (CLIN41/TRIM71).
[score:4]
As was similarly noted for lin-41 in C. elegans, Mlin41 also appears to be regulated by the let-7 and mir-125 miRNAs.
[score:2]
[1 to 20 of 2 sentences]
|
25 |
![]()
Other miRNAs from this paper: dre-mir-219-1, dre-mir-219-2, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-130a, dre-mir-130b, dre-mir-130c-1, dre-mir-130c-2, dre-mir-142a, dre-mir-142b, dre-mir-144, dre-mir-146a, dre-mir-153c, dre-mir-190a, dre-mir-219-3, dre-mir-301a, dre-mir-301b, dre-mir-301c, dre-mir-459, dre-let-7j, dre-mir-735
Distinct microRNA expression profiles in prostate cancer stem/progenitor cells and tumor-suppressive functions of let-7. Cancer Res.
[score:5]
[1 to 20 of 1 sentences]
|
26 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
They demonstrated that there is a relationship between the expression profiles and the staged embryo temporal regulation of a large class of miRNAs, such as members of the let-7 family.
[score:4]
[1 to 20 of 1 sentences]
|
27 |
![]()
Other miRNAs from this paper: dre-mir-210, dre-mir-429a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-mir-150, dre-mir-200a, dre-let-7j, dre-mir-429b
A number of these hypoxia-regulated miRNAs are demonstrated to contribute to cellular responses to hypoxia by modulating critical downstream targets, including let-7 [29], miR-429 [30], miR-195 [31], miR-210 [32, 33], miR-322 [34], miR-200a [35], miR-199a [36, 37] and miR-150 [38].
[score:4]
[1 to 20 of 1 sentences]
|
28 |
![]()
Other miRNAs from this paper: dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-34a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-26a-1, dre-mir-26a-2, dre-mir-26a-3, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30e-2, dre-mir-122, dre-mir-126a, dre-mir-143, dre-let-7j, dre-mir-126b
Recent research has demonstrated that miRs are able to regulate the expression of key genes involved in lipid homeostasis, including miR-122, miR-33, miR-106, miR-758, miR-26, miR-370, miR-378, let-7, miR-27, miR-143, miR-34a, and miR-335 [7, 8, 9, 10, 11, 12, 13].
[score:4]
[1 to 20 of 1 sentences]
|
29 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-148a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-34c, hsa-mir-148b, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-10c, dre-mir-21-1, dre-mir-21-2, dre-mir-122, dre-mir-135c-1, dre-mir-135c-2, dre-mir-148, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-459, hsa-mir-499a, dre-let-7j, dre-mir-499, dre-mir-34c, dre-mir-734, hsa-mir-499b, dre-mir-7146, dre-mir-7147, dre-mir-7148
Slide1: dre-miR-21 is found to be abundant and ubiquitously expressed as compared to some let-7 family members.
[score:2]
The data was analysed with comparative Ct method (2–[delta][delta]Ct) using two miRNA housekeeping genes (dre-let-7a and dre-miR-10c).
[score:1]
[1 to 20 of 2 sentences]
|
30 |
![]()
Other miRNAs from this paper: dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-10b-2, dre-mir-15a-1, dre-mir-15a-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-30b, dre-mir-140, dre-mir-143, dre-mir-146a, dre-mir-146b, dre-mir-193a-1, dre-mir-193a-2, dre-mir-196b, dre-mir-338-1, dre-mir-338-2, dre-let-7j, dre-mir-31, dre-mir-222b, dre-mir-181b-3, dre-mir-338-3
Compared with their results, which were performed by microarray screening, we also identified similar miRNAs up- or down-regulated in early EPC (up: let-7 g-5p, miR-16-5p, miR-26b-5p, miR-30b-3p, miR-140-5p, miR-146a-5p, miR-146a-3p and miR-338-3p) or in late EPC (miR-27a-3p, miR-27b-5p, miR-27b-3p, miR-151a-5p and miR-193a-5p).
[score:3]
[1 to 20 of 1 sentences]
|
31 |
![]()
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-30a, dre-mir-30b, dre-mir-30c, dre-mir-30d, dre-mir-30e-2, dre-mir-101a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-148, dre-mir-206-1, dre-mir-206-2, dre-let-7j
A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence.
[score:3]
[1 to 20 of 1 sentences]
|
32 |
![]()
Other miRNAs from this paper: dre-mir-10a, dre-mir-192, dre-mir-181a-1, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-mir-1-2, dre-mir-1-1, dre-mir-22a, dre-mir-22b, dre-mir-25, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-184-1, dre-mir-206-1, dre-mir-206-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-456, dre-mir-184-2, dre-mir-181a-2, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5
Furthermore, the top 5 most abundant miRNA families expressed at each stage were selected, including dre-let-7a, dre-miR-1, dre-miR-10a-5p, dre-miR-124, dre-miR-181a-5p, dre-miR-184, dre-miR-192, dre-miR-22a, dre-miR-25, dre-miR-430a and dre-miR-456 families (Figure 5C).
[score:3]
[1 to 20 of 1 sentences]
|
33 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
Since the discovery of the first two miRNA genes, lin-4 [1, 2] and let-7 [3, 4], much has been learned about the structure, biogenesis and function of miRNAs [5- 7].
[score:1]
Some, the let-7 family for example, maintain almost identical mature forms in evolution.
[score:1]
[1 to 20 of 2 sentences]
|
34 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-let-7g, hsa-let-7i, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-let-7j
Ascl1a regulates Müller glia dedifferentiation and retinal regeneration through a Lin-28 -dependent, let-7 microRNA signalling pathway.
[score:2]
[1 to 20 of 1 sentences]
|
35 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-let-7g, hsa-let-7i, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-let-7j
Ascl1a regulates Müller glia dedifferentiation and retinal regeneration through a Lin-28 -dependent, let-7 microRNA signalling pathway.
[score:2]
[1 to 20 of 1 sentences]
|
36 |
![]()
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-183, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-mir-1-2, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-20a, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-101a, dre-mir-101b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-145, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-499, ola-mir-430a-1, ola-mir-430c-1, ola-mir-430b-1, ola-mir-430c-2, ola-mir-430c-3, ola-mir-430d-1, ola-mir-430a-2, ola-mir-430c-4, ola-mir-430d-2, ola-mir-430a-3, ola-mir-430a-4, ola-mir-430c-5, ola-mir-430d-3, ola-mir-430b-2, ola-mir-430c-6, ola-mir-430c-7, ola-mir-20a-1, ola-mir-92a-2, ola-mir-9a-2, ola-mir-101a, ola-mir-9b-1, ola-mir-499, ola-let-7a-1, ola-mir-9a-3, ola-mir-183-1, ola-let-7a-2, ola-mir-29b-1, ola-mir-29a, ola-mir-124-1, ola-mir-124-2, ola-mir-9a-4, ola-mir-101b, ola-let-7a-4, ola-mir-10d, ola-mir-9a-1, ola-mir-92b, ola-mir-9b-2, ola-mir-1-2, ola-mir-124-3, ola-mir-15a, ola-mir-10b, ola-mir-92a-1, ola-mir-20a-2, ola-mir-17, ola-mir-29b-2, ola-mir-29c, ola-mir-183-2, ola-let-7a-3, ola-mir-9a-5, ola-mir-145, dre-mir-29b3
For detailed lists of miRNA family assignments, see Supplement Table 4 The age -dependent expression of the following miRNAs was previously demonstrated by qPCR: tni-miR-15a, tni-miR-101a, tni-miR-101b, dre-miR-145, hsa-miR 29c-1 (100% identical to dre-miR-29a), hsa-let-7a-5p, hsa-miR-124a-1, hsa-miR-1-2, olamiR-21, ola-miR-183-5p and, from cluster dre-miR-17a/18a/19a, and dre-miR-20a (the used primers were Qiagen miScript primer).
[score:1]
For detailed lists of miRNA family assignments, see Supplement Table 4 The age -dependent expression of the following miRNAs was previously demonstrated by qPCR: tni-miR-15a, tni-miR-101a, tni-miR-101b, dre-miR-145, hsa-miR 29c-1 (100% identical to dre-miR-29a), hsa-let-7a-5p, hsa-miR-124a-1, hsa-miR-1-2, olamiR-21, ola-miR-183-5p and, from cluster dre-miR-17a/18a/19a, and dre-miR-20a (the used primers were Qiagen miScript primer).
[score:1]
[1 to 20 of 2 sentences]
|
37 |
![]()
Other miRNAs from this paper: dre-mir-10a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-126a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-138-1, dre-mir-181c, dre-mir-206-1, dre-mir-206-2, dre-let-7j, dre-mir-181a-2, dre-mir-499, dre-mir-15c, dre-mir-126b, dre-mir-138-2, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-29b3
Roush S. Slack F. J. The let-7 family of microRNAs Trends Cell Biol.
[score:1]
Examples include the let-7 family, which contains the first miRNA to ever be described [59] or the miR-1/133 and miR-15 families.
[score:1]
[1 to 20 of 2 sentences]
|
38 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Finally, the lin28/ let-7 miR system has been implicated in the maturation of the post-natal hypothalamus and induction of puberty, in a mouse mo del of CHH (Gaytan et al., 2013; Sangiao-Alvarellos et al., 2013).
[score:1]
[1 to 20 of 1 sentences]
|
39 |
![]()
Other miRNAs from this paper: dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-181a-1, dre-mir-214, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7c-1, dre-let-7c-2, dre-mir-10b-2, dre-mir-21-1, dre-mir-21-2, dre-mir-27c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-100-1, dre-mir-100-2, dre-mir-122, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-130a, dre-mir-130b, dre-mir-130c-1, dre-mir-130c-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-137-1, dre-mir-137-2, dre-mir-146a, dre-mir-146b, dre-mir-153a, dre-mir-181c, dre-mir-216b, dre-mir-135b, dre-mir-181a-2, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d
miRNAs let-7a, miR-100-5p, miR-10b-5p, miR-125b-5p, miR-146a, miR-181a-5p, miR-21, miR-27c-3p and miR-92a-3p were the most abundant miRNAs (>100,000 reads) in the four samples (Excel S1).
[score:1]
[1 to 20 of 1 sentences]
|
40 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
These filtering criteria revealed 4 isomiRs: 2 variants of let-7a and 1 variant of miR-203a-1-3p and miR-143 each (Fig 4A).
[score:1]
[1 to 20 of 1 sentences]
|
41 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, mmu-let-7g, mmu-let-7i, mmu-mir-185, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-185, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-let-7j, hsa-mir-649, hsa-mir-1286, hsa-mir-1306, mmu-mir-1306, hsa-mir-3618, hsa-mir-4761, mmu-let-7j, mmu-let-7k, hsa-mir-6816, dre-mir-1306, mmu-mir-3618
Inactivation of a temperature sensitive allele of DGCR8 in C. elegans lead to the accumulation of protein products of other genes elsewhere in the genome, particularly let-7, and a reduction in life span [101].
[score:1]
[1 to 20 of 1 sentences]
|
42 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA.
[score:1]
[1 to 20 of 1 sentences]
|
43 |
![]()
Other miRNAs from this paper: dre-mir-34a, dre-mir-182, dre-mir-183, dre-let-7a-1, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-24-4, dre-mir-30d, dre-mir-133a-2, dre-mir-146a, dre-mir-152, dre-mir-458, dre-let-7j, dre-mir-34b, dre-mir-34c
Like let-7 [5, 6], some miRNAs are highly conserved throughout evolution and participate in pivotal biological processes [7].
[score:1]
[1 to 20 of 1 sentences]
|