1 |
[+]
score:
53
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1510a, gma-MIR1511, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR4998, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5368, gma-MIR5371, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR4413b, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
In the present study, the expression of miR159a-3p and miR159e-3p was significantly decreased under SDs at 0, 8 and 16 h. In total, four differentially expressed targets of miR159, belonging to the R2R3-MYB family, were confirmed to respond to day length change through qRT-PCR.
[score:7]
The miR159 regulates the expression of MYB gene family members, many of which are expressed in the shoot apices and are essential for plant development [26].
[score:7]
Plants overexpressing miR159a also showed decreased MYB33 expression and were male sterile, with delayed flowering time [26], indicating that miR159 functions as a negative regulator of the flowering time through the GA signal pathway.
[score:6]
This negative correlation in expression patterns provided evidence for miR159-directed GAMYB regulation.
[score:5]
Four targets of miR159 at 0 h were increased under SDs as the positive regulator of flowering time in soybean (Fig 5B).
[score:4]
Among the three target genes of miR159, Glyma07g14480.
[score:3]
Four miRNA159 target genes (Glyma07g14480.
[score:3]
Further study is needed to determine the function of miR159 and its targets in the response to the day length changes.
[score:3]
In cereals and Arabidopsis, GAMYB genes were predominantly expressed in the anthers and seeds, where less miR159 accumulation was observed [26].
[score:3]
At 16 h, the targets of miR159, miR1508, miR396, and miR4413 showed increased transcription under SDs and responded to the day-length treatment.
[score:3]
These results suggested that miR159 and its target genes are not only involved in the GA signal pathway but also in the photoperiod pathway.
[score:3]
The expression pattern of miR156, miR159 and miR172.
[score:3]
Plant flowering time is also regulated by miR159 through the gibberellins (GAs) response pathways [21, 26].
[score:2]
Among the conserved miRNAs, the most abundant reads in the six libraries encoded miR159a-3p (with 698, 12,935, 6,559, 284, 1,854, and 19,034 reads) and miR159e-3p (with 702, 12,962, 6,611, 286, 1,864, and 19,093 reads) (S5 Table).
[score:1]
[1 to 20 of 14 sentences]
|
2 |
[+]
score:
33
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR482a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR530a, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR2111a, gma-MIR530b, gma-MIR828a, gma-MIR156p, gma-MIR530c, gma-MIR828b, gma-MIR530d, gma-MIR156q, gma-MIR169o, gma-MIR319n, gma-MIR530e, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR169t, gma-MIR2111e, gma-MIR2111f, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
Two targets are commonly regulated by miR319 and miR395 while seven targets are commonly regulated by miR319 and miR159.
[score:7]
For example, miR319 shared two targets with miR395 and seven targets with miR159 (Figure 7).
[score:5]
However, thirty-eight genes with a variety of functions were specifically targeted by miR319 while 18 genes were only targeted by miR159.
[score:5]
It has been shown in Arabidopsis that the interaction of miR159 and its target MYB genes is involved in the regulation of vegetative growth, flowering time, seed shape and germination [54]– [56].
[score:4]
Expression patterns of miR159 and miR319 are significantly different in Arabidopsis.
[score:3]
In contrast to miR159, miR319 regulates embryonic patterning, jasmonate synthesis, leaf morphogenesis and senescence in Arabidopsis and tomatoes [57]– [59].
[score:2]
Accumulation of miR159 is abundant and widespread over the whole plants, while accumulation of miR319 is mainly confined to specific tissues and developmental stages [53], [57].
[score:2]
For example, we detected reads for only 2 out of 5 miR159 loci in soybean cotyledons (Table S1 in File S1 and Table S2 in File S1).
[score:1]
Seven miRNA families (miR159, miR162, miR164, miR169, miR395, miR396, and miR397) most likely evolved in the common ancestor of spermatophytes, as they were present in both gymnosperm and angiosperm lineages.
[score:1]
It is likely that these interactions predated the divergence of miR159 and miR319 and were conserved through their long evolutionary history.
[score:1]
miR159-specific or miR319-specific interactions contributed to their distinct biological functions in soybean cotyledons and are possible outcomes from neo-functionalization or sub-functionalization after the gene duplication event.
[score:1]
miR319 and miR159 shared significant sequence similarity and had been shown to evolve from a common ancestral miRNA gene [53].
[score:1]
[1 to 20 of 12 sentences]
|
3 |
[+]
score:
27
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1520d, gma-MIR167d, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR4348a, gma-MIR4361, gma-MIR4368b, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR4414a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171e, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR862a, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR5372, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR1512b, gma-MIR167j, gma-MIR1512c, gma-MIR5559, gma-MIR5774b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR5786, gma-MIR156t, gma-MIR2606a, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR4348b, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR4348c, gma-MIR319q, gma-MIR4348d, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR4414b, gma-MIR399n, gma-MIR399o
84-70 variety, 56 known miRNAs belonging to 15 miRNA families as well as one novel miRNA (novel-soy0043-5p) were found significantly differentially expressed, and among them 12 known miRNAs belonging to 6 miRNA families (i. e. gma-miR159a/e-3p-1, gma-miR2119-3p, gma-miR482b/d-3p) were up-regulated while the other known miRNAs (i. e. gma-miR156b/f-5p, gma-miR171b/e/h-5p, gma-miR390a/b/c/d-5p) and the novel miRNA were down-regulated.
[score:9]
For example, Glyma13g04030.1 was predicted to be the target of both gma-miR159a/e-3p-1 and gma-miR319g/l-3p, and Glyma16g05900.1 was regulated by both gma-miR156b/f-5p and gma-miR169o/r-5p.
[score:4]
Among these significantly differentially expressed miRNAs responsive to long-term N limitation from both genotypes, 16 known miRNAs in 7 miRNA families (i. e. gma-miR1512c-5p, gma-miR159a-3p-1, gma-miR159b/f-5p-2, gma-miR169c/e/h/p/s-5p, and gma-miR862a/b-5p) were common.
[score:3]
116 variety roots, 3 significantly differentially expressed known miRNAs belonging to 2 miRNA families(gma-miR159a/e-3p-1, gma-miR2109-3p) were common under short-term and long-term low N stress conditions, while in No.
[score:3]
Under long-term low N stress condition, 5 known miRNAs belonging to 4 miRNA families(gma-miR159a/e-3p-1, gma-miR2109-3p, gma-miR397b-3p, gma-miR408d-5p) were significantly differentially expressed in both shoots and roots of 116 variety.
[score:3]
116 variety, 9 known miRNAs belonging to 3 miRNA families (gma-miR159a/e-3p-1, gma-miR160/b/c/d/e-5p, gma-miR2109-3p, gma-miR2109-5p) were significantly differentially expressed in response to short-term low N stress in both shoots and roots of No.
[score:3]
In this study, we also found that some pre-miRNAs, such as pre-miR159a, pre-miR319a, pre-miR394a, and pre-miR2118a could generate distinct abundant sequences on their 5′ arm or 3′ arms, the positions of which didn’t overlap and the sequence frequencies were high enough.
[score:1]
The results showed that 3 known miRNAs in 2 miRNA families (gma-miR159a/e-3p-1, gma-miR2109-3p,) were common.
[score:1]
[1 to 20 of 8 sentences]
|
4 |
[+]
score:
19
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1512a, gma-MIR1518, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR5037c, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR171l, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR171m, gma-MIR171n, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR398d, gma-MIR9727, gma-MIR9750, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
a miR159 family and their targets responsive to SCN infection; b miR399 family and their targets responsive to SCN infection To understand the role of soybean miRNAs in response to SCN infection, an experiment was conducted with soybean grown in sterilized soil and soil infested with SCN HG type 7. Two Kansas soybean cultivars were used: KS4607, a SCN susceptible cultivar [31], and KS4313N, a cultivar resistant to HG type 7 [32].
[score:5]
a miR159 family and their targets responsive to SCN infection; b miR399 family and their targets responsive to SCN infection In the present study, we sequenced small RNA libraries from the roots of two soybean genotypes at different time points in the presence and absence of SCN infection and acquired 0.3 billion reads.
[score:5]
The regulatory network revealed that miR159 and miR399 likely had a function in response to SCN infection by targeting a number of different genes in roots.
[score:4]
Another conserved miRNA, miR159, was revealed to be induced by Pseudomonas syringae infection to regulate the ABA and/or gibberellin signaling pathway [47].
[score:2]
The most abundant miRNAs in all libraries were conserved miRNAs such as miR482, miR159, and miR396, while several legume specific miRNAs, such as miR1510, miR2109, miR2118, miR4996, and miR1509, were also highly abundant.
[score:1]
Among the DE miRNAs, several members in conserved miR159 and miR399 families were significantly changed in both cultivars.
[score:1]
According to the functional analysis and previous reports, several conserved miRNAs (for example, gma-miR159, gma-miR171, gma-miR398, gma-miR399, and gma-miR408) and legume specific miRNAs (for example, gma-miR1512, gma-miR2119, and gma-miR9750) could be potential candidates for manipulating the SCN infection.
[score:1]
[1 to 20 of 7 sentences]
|
5 |
[+]
score:
15
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1514a, gma-MIR1514b, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4345, gma-MIR396d, gma-MIR4369, gma-MIR482b, gma-MIR167g, gma-MIR4397, gma-MIR156f, gma-MIR4409, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5373, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR1513c, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR1512c, gma-MIR5767, gma-MIR5770a, gma-MIR393b, gma-MIR5781, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR5770c, gma-MIR1446, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Under Pi deficiency downregulation of miR169 and miR159 whereas upregulation of miR482 and miR397 was reported [32] and similar responses were found during water deficit (Table 2 and Additional file 2).
[score:7]
Another study [33] reported upregulation of miR159 under Pi deficiency in soybean roots, which contradicts with the results from Xu et al. [32] as well as our analysis under water deficit stress (Additional file 2 and Table 2).
[score:4]
Among the highly conserved 23 miRNA families [23], two (miR156 and miR166) were classified as high, three (miR168, miR396 and miR172) as moderate and seven (miR169, miR171, miR164, miR390, miR159, miR160 and miR167) as low and two (miR395 and miR399) as extremely low abundantly expressed miRNA families in primary root tips of soybean.
[score:3]
Nineteen miRNA families (miR5767, miR4345, miR169, miR2109, miR482, miR2119, miR2118, miR171, miR164, miR4413, miR390, miR1514, miR159, miR160, miR5781, miR167, miR5373 and miR4409) displayed lower abundances (1000 to 10,000 RPTM) (Additional file 2).
[score:1]
[1 to 20 of 4 sentences]
|
6 |
[+]
score:
11
Other miRNAs from this paper: gma-MIR319a, gma-MIR319b, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR159b, gma-MIR159c, gma-MIR396c, gma-MIR396d, gma-MIR159d, gma-MIR396e, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR1535b, gma-MIR396f, gma-MIR396g, gma-MIR403a, gma-MIR403b, gma-MIR159e, gma-MIR159f, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR319n, gma-MIR396j, gma-MIR396k, gma-MIR319o, gma-MIR319p, gma-MIR319q
Among the most highly reduced miRNAs were the closely related miRNAs miR319f and miR159a, miRNAs that target a subset of genes encoding the developmentally important TCP and GAMYB-like transcription factors, respectively.
[score:4]
Coincidentally, the two most differentially expressed miRNAs in our data set are miR159 and miR319, a finding that suggests that the noncanonical pri-miRNA processing pathway may be more severely affected in the dcl1a/ dcl1b double mutant background.
[score:3]
Allen R. S. Li J. Stahle M. I. Dubroué A. Gubler F., 2007 Genetic analysis reveals functional redundancy and the major target genes of the Arabidopsis miR159 family.
[score:3]
Currently, only two Arabidopsis miRNAs have been demonstrated to be processed by this more complex pathway, including miR159 and mR319 (Bologna et al. 2009).
[score:1]
[1 to 20 of 4 sentences]
|
7 |
[+]
score:
11
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR156a, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR1508a, gma-MIR1510a, gma-MIR1515a, gma-MIR167d, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR390c, gma-MIR2118a, gma-MIR2118b, gma-MIR1508c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR4413b, gma-MIR167j, gma-MIR393b, gma-MIR4416b, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR156q, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR167k, gma-MIR167l, gma-MIR169w
On the other hand, miR159a and b single mutants do not have obvious developmental phenotypes but the double mutant exhibits severe developmental defects, suggesting functional redundancy among family members [7].
[score:3]
For example, like in soybean, clusters of MIR159 genes have been identified in maize and sorghum as well [57], whereas miR159 family is encoded by three unclustered genes in Arabidopsis [58].
[score:1]
Tandem duplication of MIR159 and MIR395 genes.
[score:1]
We identified four families of miRNAs (miR159, miR169, miR395 and gma-miR-Seq14) that had at least one locus with tandemly duplicated genes.
[score:1]
Similar observations were made for miR395 and miR159 gene families, suggesting continuous evolution of these families as well.
[score:1]
We identified four miRNA families that have tandemly duplicated members: MIR159, MIR169, MIR395, three conserved families, and MIR-Seq14 that is soybean-specific.
[score:1]
However, unlike MIR169 genes, head to head (MIR159) and tail to tail (MIR395) duplications in addition to tandem duplications were observed in these families (Additional file 2: Figure S2).
[score:1]
It should be noted that MIR159, MIR169 and MIR395 genes are tandemly duplicated in other plant species as well (e. g. M. truncatula Arabidopsis).
[score:1]
For example, among the conserved families, miR159, miR390 and miR395 had a preference for A at the 5’ end of mature miRNAs (Additional file 1: Table S1, sheet1).
[score:1]
[1 to 20 of 9 sentences]
|
8 |
[+]
score:
10
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR1520h, gma-MIR1520i, gma-MIR1520j, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR4406, gma-MIR169d, gma-MIR1520q, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR167k, gma-MIR167l, gma-MIR169w
MYB family members in rice, which are targeted by miR159, appear to play an important role in response to the presence of abscisic acid (ABA) during plant embryonic development, suggesting their roles in seed development [37, 38].
[score:5]
In this study, we detected a number of MYB family transcription factors regulated by gma-miR159 (Additional file 1. The gma-miRNA156 family members target sites in numerous proteins containing the Squamosa Promoter Binding (SBP) domain.
[score:4]
In each of the four Glyma mo dels, a clear peak for the absolute number of tags is found at the predicted cleavage site for gma-miR159, gma-miR4406, gma-miR167, or gma-miR164.
[score:1]
[1 to 20 of 3 sentences]
|
9 |
[+]
score:
8
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, gma-MIR1508a, gma-MIR1509a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR1517, gma-MIR167d, gma-MIR396c, gma-MIR1508b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4357, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR482c, gma-MIR1508c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR1512c, gma-MIR5559, gma-MIR393b, gma-MIR4416c, gma-MIR4416b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR1515b, gma-MIR399i, gma-MIR167k, gma-MIR167l, gma-MIR4405b, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
High levels of miR159a expression may restrict activation of MYB transcription factor in active growing vegetative tissues.
[score:3]
It has been shown that miR159 acts as a molecular switch only permitting the expression of GAMYB-like genes which participate in GA -induced pathways in anthers and seeds [46].
[score:3]
All miRNAs identified in our previous study [35] and some miRNAs such as miR156, miR159, miR1508, miR1509, miR1511-15, miR1518-23 etc.
[score:1]
However, there were 5 miRNAs (gma-miR159a, gma-miR482, gma-miR168, gma-miR1511 and gma-miR2109), 50% of the top 10 miRNAs, identical in shoot apical meristem and young leaves of soybean (Table S5), which are functionally closely related in aboveground.
[score:1]
[1 to 20 of 4 sentences]
|
10 |
[+]
score:
6
Other miRNAs from this paper: gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
Significant up-regulation at 3 h post inoculation and sustained induction was observed for another set of miRNAs (e. g. miR159, miR393).
[score:4]
UUUGGAUUGAAGGGAGCUA 19 H gma-MIR159?
[score:1]
UGACAGAAGAGAGAGAGCACA 21 H 159 gma-MIR159 UUUGGAUUGAAGGGAGCUCUA 21 H gma-MIR159?
[score:1]
[1 to 20 of 3 sentences]
|
11 |
[+]
score:
5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ahy-MIR156a, ahy-MIR156b, ahy-MIR156c, ahy-MIR159, ahy-MIR167, ahy-MIR394, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR394e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
Expression levels of two members of the ahy-miR159 family (ahy-miR159a and ahy-miR159b) were similar and were detected 66 and 41 times, respectively (Table 1).
[score:3]
In addition to miRS1 and miR2118, we also found the third small RNA with 137 reads in our dataset that had only one mismatch with Phaseolus vugaris miR159.2.
[score:1]
For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40, and 40 plant species, respectively [34, 38, 41].
[score:1]
[1 to 20 of 3 sentences]
|
12 |
[+]
score:
5
More recently, improved plant resistance was achieved by targeting the nucleoprotein (N) but not silencing suppressor genes (NSs) in tomato spotted wilt virus (TSWV) using a shortened miR159a precursor backbone [24].
[score:5]
[1 to 20 of 1 sentences]
|
13 |
[+]
score:
4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, miRNA156, miRNA159 and miR172 targeted more than one gene family.
[score:3]
These thirteen conserved pre-miRNAs belonged to the miR156 (6), miR159 (4), miR160 (2) and miR170 (1) families.
[score:1]
[1 to 20 of 2 sentences]
|
14 |
[+]
score:
4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
It was reported that five conserved miRNAs (miR159, miR162, miR166, miR390, and miR399) presented similar expression levels in root apexes and nodules, but miR169, miR171, miR393, and miR396 enriched in root tips [41].
[score:3]
MicroRNA chip experiments showed that eight miRNAs (miR156/157, miR167, miR168, miR319, miR159, miR894, miR1507, and miR1509) were induced by Pi starvation in soybean leaves, and seven miRNAs (miR159, miR894, miR1507, miR1509, miR396, miR474, and miR482) were induced in soybean roots by low P [31].
[score:1]
[1 to 20 of 2 sentences]
|
15 |
[+]
score:
4
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, ath-MIR172c, ath-MIR172d, ath-MIR390a, ath-MIR390b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR319c, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR390a, gma-MIR390b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR156f, gma-MIR172f, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR399b, gma-MIR156s, gma-MIR156t, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR399f, gma-MIR399g, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR319q, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
When miR159 was overexpressed, plants flowering time was delayed in SD condition with decreased levels of MYB33 and LFY in Arabidopsis [15].
[score:3]
The main players are the miR156, miR159 and miR172 families.
[score:1]
[1 to 20 of 2 sentences]
|
16 |
[+]
score:
4
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR391, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
We also found five families (miR159, miR160, miR164, miR166 and miR168) conserved in gymnosperms and two (miR396 and miR408) in Selaginella.
[score:1]
This includes one new member for each of the families, miR158, miR159, miR160, miR172, miR390, miR395 and miR408.
[score:1]
We found six families (miR159, miR160, miR167, miR170/171, miR396 and miR399) in 30–39 species; seven (miR164, miR168, miR172, miR393, miR395, miR398 and miR408) in 20–29 species; and five (miR162, miR390, miR397, miR403 and miR437) in 10–19 species (Table 1).
[score:1]
Six families (miR159, miR160, miR167, miR170/171, miR396 and miR399) were found in 30–39 diverse plant species (Table 1).
[score:1]
[1 to 20 of 4 sentences]
|
17 |
[+]
score:
3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1514a, gma-MIR1514b, gma-MIR1536, gma-MIR1530, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR398d, gma-MIR167k, gma-MIR167l, gma-MIR169w
A series of targets for known miRNAs, including gma-miR156, gma-miR159, gma-miR160, gma-miR164, gma-miR167, gma-miR169, gma-miR396, gma-miR398 and gma-miR1514, belong to this class (Tables 3, 4).
[score:3]
[1 to 20 of 1 sentences]
|
18 |
[+]
score:
3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR319a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR393a, gma-MIR1518, gma-MIR1520d, gma-MIR1521a, gma-MIR396c, gma-MIR2119, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR4380a, gma-MIR396d, gma-MIR4378a, gma-MIR4380b, gma-MIR156f, gma-MIR4407, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR396f, gma-MIR396g, gma-MIR397a, gma-MIR397b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR396h, gma-MIR396i, gma-MIR1512b, gma-MIR4413b, gma-MIR5674a, gma-MIR5770a, gma-MIR4416c, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR5674b, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR9747, gma-MIR399i, gma-MIR9763, gma-MIR5770c, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Alonso-Peral MM Li JY Li YJ Allen RS Schnippenkoetter W Ohms S The microRNA159-regulated GAMYB-like genes inhibit growth and promote programmed cell death in ArabidopsisPlant Physiol.
[score:3]
[1 to 20 of 1 sentences]
|
19 |
[+]
score:
3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR169a, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR169a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR391, ath-MIR156g, ath-MIR156h, ath-MIR159c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR535, ath-MIR781a, ath-MIR782, ath-MIR847, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, osa-MIR1846d, osa-MIR1857, osa-MIR1846a, osa-MIR1846b, osa-MIR1846c, osa-MIR1846e, ath-MIR2112, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, gma-MIR391, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR169f, gma-MIR169g, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR169i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, ath-MIR781b, ath-MIR156i, ath-MIR156j, gma-MIR156p, gma-MIR156q, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR156t, gma-MIR169t, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR169w
Although only a few cleavage targets of the highly accumulated RC-miRNAs were detected, several RC-miRNAs were shown to possess great potential to guide DNA methylation in both Arabidopsis (RC_ath-miR2112, RC_ath-miR391, RC_ath-miR781, RC_ath-miR782, and RC_ath-miR847) and rice (RC_osa-miR156, RC_osa-miR159, RC_osa-miR169, RC_osa-miR1846, RC_osa-miR2118, and RC_osa-miR535) (Figure 4 and Table S6).
[score:3]
[1 to 20 of 1 sentences]
|
20 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1515a, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR1509b, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR862a, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, gma-MIR2111a, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR398d, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The highest read abundance (31,416 RPM and 20,776 RPM) was detected for gma-miR159, and was 2–25-fold greater than other relatively abundant miRNA families, including gma-miR396, gma-156, miR168, and miR166, whose total abundance ranged from 1,000 to 15,000 RPM (Table S2).
[score:1]
[1 to 20 of 1 sentences]
|
21 |
[+]
score:
1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR156a, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR156f, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR156s, gma-MIR156t, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab
For example, XLOC_015015 was annotated as miR159, suggesting that some of the novel nTUs are functional as non-coding RNAs.
[score:1]
[1 to 20 of 1 sentences]
|
22 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1513a, gma-MIR1520d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1513b, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1513c, gma-MIR4415b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR169t, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR319q, gma-MIR169w
Also, in MIR159, two new genes with sequences originated from both the 3'and 5'arms were identified.
[score:1]
[1 to 20 of 1 sentences]
|
23 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1523a, gma-MIR1528, gma-MIR1535a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR1509b, gma-MIR396d, gma-MIR4366, gma-MIR4382, gma-MIR4389, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR4411, gma-MIR171c, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, gma-MIR1507c, gma-MIR1508c, gma-MIR1535b, gma-MIR4996, gma-MIR1523b, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5374, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5667, gma-MIR5761a, gma-MIR4416c, gma-MIR5761b, gma-MIR4416b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR167k, gma-MIR167l, gma-MIR169w
The third category included miR5761, miR159, miR5667, miR1535, miR511, miR4382 and miR4416.
[score:1]
[1 to 20 of 1 sentences]
|
24 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR159b, gma-MIR159c, gma-MIR159d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u
Kitazumi A Kawahara Y Onda TS De Koeyer D de los Reyes BG Implications of miR166 and miR159 induction to the basal response mechanisms of an andigena potato (Solanum tuberosum subsp.
[score:1]
[1 to 20 of 1 sentences]
|
25 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR1520d, gma-MIR396c, gma-MIR396d, gma-MIR159d, gma-MIR396e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR396f, gma-MIR396g, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR396h, gma-MIR396i, gma-MIR396j, gma-MIR396k, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u
Implications of miR166 and miR159 induction to the basal response mechanisms of an andigena potato (Solanum tuberosum subsp.
[score:1]
[1 to 20 of 1 sentences]
|