sort by

106 publications mentioning hsa-mir-18b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-18b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 265
In this study we showed that a) over -expression of miR-18b was associated with poor prognosis of HCC; b) miR-18b has the ability to control the expression of TNRC6B gene as a target; and c) over -expression of miR-18b and down-regulation of TNRC6B showed malignant potential for hepatocarcinogenesis. [score:12]
Based on miRanda and Targetscan target search algorithms and Argonaute 2 immunoprecipitation study, we noted that miR-18b can control the expression of trinucleotide repeat containing 6B (TNRC6B) as a target gene. [score:9]
The expression pattern of TNRC6B when miR-22 was over-expressed or suppressed was similar to the expression pattern using miR-18b (Figure  1B). [score:9]
To clarify the biological links between miRNAs and TNRC6B, we examined the expression pattern of TNRC6B in Huh7 cells by real-time qPCR when expression levels of miR-18a, miR-18b miR-122, miR-221, miR-423-5p, and miR-22 were either over-expressed or suppressed. [score:9]
The result was that low expression of TNRC6B was reflected by over -expression of miR-18b treated with mature miR-18b and vise versa when miR-18b was suppressed with antisense oligonucleotide. [score:7]
We found high miR-18b and low TNRC6B expression levels in poorly differentiated HCC (case 261), low miR-18b and high TNRC6B expression levels in highly differentiated HCC (case 64), and moderate expression miR-18b and TNRC6B in moderately differentiated HCC (case 248) (Figure  3A, B). [score:7]
5.0 and reported that miR-92, miR-20, miR-18 and precursor miR-18 had significantly high expression in poorly differentiated HCC samples, moderate expression in moderately differentiated HCC and low expression in well-differentiated HCC. [score:7]
TNRC6B down-regulation in HCC is inversely related to miR-18b expression. [score:6]
In addition, we also established that over -expression of miR-18b and down-regulation of TNRC6B was closely associated with the proliferation of HCC. [score:6]
Taken together, we concluded that miR-18b can regulate the expression of TNRC6B as a target gene. [score:6]
Since down regulation of miR-18b and/or over -expression of TNRC6B inhibited cell proliferation and promoted cell adhesion, we propose miR-18b as a new diagnostic and prognostic miRNA marker for HCC progression. [score:6]
Additionally, in two hepatoma cell lines, we found that over -expression of miR-18b or down-regulation of TNRC6B accelerated cell proliferation and loss of cell adhesion ability. [score:6]
B) Cell adhesion index in Huh7 and Li7 cells respectively after over -expression of miR-18b or TNRC6B, or suppression of miR-18b or TNRC6B for 24 or 72 hr. [score:5]
TNRC6B on the other hand, was a common target gene in miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 using Targetscan. [score:5]
Blue indicates the expression of miR-18b (arrows) and brown indicates the expression of TNRC6B (arrowheads). [score:5]
Finally, we observed that after surgical resection, HCC patients with high miR-18b expression had a significantly shorter relapse-free period than those with low expression. [score:5]
In both cell lines, over -expression or inhibition of miR-18b showed deceleration or acceleration of cell adhesion respectively (p < 0.05). [score:5]
Each column represents the relative amount of TNRC6B normalized to the expression level of β-actin or the relative amount of miR-18b normalized to the expression level of U18. [score:5]
Specifically, patients with high expression of miR-18b had significantly lower survival rate than patients with low miR-18b expression. [score:5]
14.0 and showed that the expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC were expressed significantly lower than in well differentiated HCC. [score:5]
The expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC had significantly lower expression levels than in well differentiated HCC (p < 0.05) (Table  2). [score:5]
Over -expression of miR-18b and inhibition of TNRC6B by siRNA in human hepatoma cell lines Huh7, showed the progression of cell proliferation. [score:5]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
Well differentiated HCC showed low expression of miR-18b; poorly differentiated HCC showed strong expression of miR-18b. [score:5]
A) Cell proliferation index in Huh7 and Li7 cells respectively, after over -expression of miR-18b or TNRC6B, or suppression of miR-18b or TNRC6B for 24 or 72 hr. [score:5]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
In this paper we presented the results of our miRNA expression profiling in HCC and highlighted the clinical and functional implications of miR-18b expression. [score:5]
These results indicated that over -expression of miR-18b and inhibition of TNRC6B, have the advantage of accelerating cell proliferation and decelerating cell adhesion. [score:5]
Using our findings, we will show that miR-18b repression in HCC correlates with clinically relevant parameters such as histological differentiation status, and that the loss of miR-18b expression correlates with distinct gene expression profiles characteristic of tumor progression (that is, suppression of hepatic differentiation phenotype and gain of metastatic properties). [score:5]
Then, we speculated that miR-18b and miR-22 could regulate the expression level of TNRC6B, and to clarify this physiological association, we performed an Ago2-coimmunoprecipitation (Ago2-IP) analysis. [score:4]
However, we found no significant correlation between the expression pattern of miR-18b and tumor size, age, gender, and background of HCC. [score:3]
Determining miR-18b target genes. [score:3]
Complementary of the sequence between miR-18b and TNRC6B gene by miRanda algorithm (upper side) and Targetscan algorithm (lower side). [score:3]
Particularly, miR-18b expression in poorly differentiated HCC was significantly higher than in well differentiated HCC. [score:3]
Kaplan–Meier curves showing the percentage of relapse-free HCC patients after surgical resection grouped on the basis of their median miR-18b expression level. [score:3]
miR-18b expression is an important marker of cell proliferation and cell adhesion, and is predictive of clinical outcome. [score:3]
However, there was no significant correlation between the contra-relation of miR-18b and TNRC6B expression. [score:3]
While miR-18b expression was associated with the relapse-free rate after surgical resection, we found that it did not significantly affect the overall survival rate (Figure  5 and Additional file 1: Table S2). [score:3]
Figure 5 miR-18b expression and relapse-free rate after surgical resection in 73HCC. [score:3]
Aberrant expression of miR-18b and TNRC6B can modify cell proliferation and unusual fashion of cell adhesion in hepatoma cell lines. [score:3]
Considering our miRNA profiling in HCC based on a variety of clinical information (grade of histological differentiation, recurrence of HCC after resection, size of tumor, the background of liver disease, age, and gender) and our analysis of the efficiencies of miRNAs in relation to cancer cell proliferation or adhesion, we strongly believe that miR-18b may be the gene with the most potential as a biomarker for diagnosing, prognosing or elucidating molecular pathogenesis. [score:3]
Kaplan-Meier survival analysis and log-rank test demonstrated a significant difference in the outcomes of patients who were divided into two groups based on their median miR-18b expression level (p < 0.05). [score:3]
Homo sapiens trinucleotide repeat containing 6B (TNRC6B) was a common hypothetical target gene in miR-221, miR-18a, miR-18b, miR-423-5p, miR-455-3p, miR-1914*, miR-215, miR-122*, let-7b, and miR-22 using miRanda algorithm. [score:3]
Figure 3 A) Expression of miR-18b and TNRC6B according to the degree of histological differentiation in HCC. [score:3]
This suggests that when miR-18b and TNRC6B are aberrantly expressed it is easy for oncogenesis to occur. [score:3]
miR-18b and TNRC6B expression correspond to the degree of histological differentiation. [score:3]
The expression pattern of miR-18, 22, 99, 221 in HCC observed in this study are similar to that noted in our previous reports [9]. [score:3]
Over -expression of miR-18b in HCC is associated with poor prognosis. [score:3]
Figure 4 The association between miR-18b and TNRC6B expression pattern and the cell proliferation and adhesion in hepatoma cell lines. [score:3]
Figure 2 Expression pattern of TNRC6B and miR-18b according to the histological differentiation. [score:3]
Expression pattern of TNRC6B and miR-18b according to the degree of histological differentiation by real-time qPCR. [score:3]
Since our study revealed that TNRC6B did not correlate with recurrence, or survival rate of HCC, we speculate that TNRC6B may be regulated by a gene other than miR-18b. [score:2]
HE stain (a, d, g), in situ hybridization of miR-18b (b, e, h) and immunohistochemistry of TNRC6B (c, f, i) are shown, respectively. [score:1]
One reason for this difference could be that the base sequences of probe which recognizes miR-18b differ. [score:1]
We generated both a locked nucleic acid (LNA) − modified probe for miR-18b (5′- taaggtgcatctagtgcagttag-3′) and a scrambled negative control sequence (5′-gtgtaacacgtctatacgccca-3′: miRCURY-LNA detection probe, Exiqon, Vedbaek, Denmark). [score:1]
miR-18b confirmed the microarray results using real-time qPCR, while the real-time qPCR result corresponded to the microarray analysis result (Figure  2B). [score:1]
12.5 pmol/l of double stranded mature miR-18b, 2′-O-methylated antisense oligonucleotide (ASO) of miR-18b (Hokkaido System Science), siRNA for TNRC6B (Hokkaido System Science) and Silencer® negative control siRNA (Ambion), were transfected with lipofectamine RNAiMAX (Invitrogen). [score:1]
Wild and mutant type reporter vectors with miR-18b complementary sites were confirmed by sequencing. [score:1]
From a clinical point of view, our study emphasizes miR-18b as a diagnostic and prognostic marker for HCC progression. [score:1]
Inserter sequence of the miR-18b binding sequence of the TNRC6B 3′-UTR for reporter vector. [score:1]
The concentration of TNRC6B IP -RNA treated with miR-18b was higher than those treated with the control RNA or double strand of miR-22, miR-455-3p, and let-7b (Figure  1D). [score:1]
C) Transfection of reporter vectors with either the wild (left part) or mutated (right part) TNRC6B 3 [′]UTR and miR-18b. [score:1]
Ago2-IP fractionated cell lysates were prepared by transfecting 293FT cells with mature double strand of miR-18b, miR-22, miR-455-3p, let-7b, or a non-specific siRNA which was used as a control RNA. [score:1]
B) Positive cells for miR-18b in situ hybridization and TNRC6B immunostain was quantified by each miR-18b in situ hybridization and TNRC6B immunostain score system, respectively. [score:1]
Huh7.5 cells (5×10 [4] cell/well) were transfected into 24-well dishes with DMRIE-C (Invitrogen), 10pmol of double stranded mature miR-18b, Antisense oligonucleotide of miR-18b, or negative control of RNA and 0.25 μg wild or mutant type reporter vector. [score:1]
Among others, miR-18 which is intimately associated with the occurrence and progression of different types of cancer have also been implicated [16]. [score:1]
Estimating positive staining for miR-18b using in situ hybridization and immunostaining of TNRC6BPositive in situ hybridization staining and immunostaining were interpreted semi-quantitatively by assessing the intensity and extent of staining on the entire tissue sections observed on the slides, as described previously [18]. [score:1]
To detect miRNA level by real-time qPCR, TaqMan® microRNA assay (Applied Biosystems) was used to quantify the relative expression level of miR-18b (assay ID. [score:1]
Estimating positive staining for miR-18b using in situ hybridization and immunostaining of TNRC6B. [score:1]
We then performed in situ hybridization using locked nucleic acid (LNA) -modified probes labeled with digoxigenin (DIG) in miR-18b and also immunohistochemistry of TNRC6B in 8 samples (well differentiated: case 64, 108; moderately differentiated: 248, 277, 310, 333; poorly differentiated: case 261, 274). [score:1]
In situ hybridization for miR-18b and immunohistochemistry for TNRC6B. [score:1]
In situ hybridization for miR-18b and immunohistochemistry for TNRC6BEight paraffin-embedded tissue samples (case 64, 108, 248, 261, 274, 277, 310 and 333) were used (Additional file 1: Table S1). [score:1]
Cells were transfected with 12.5 pmol/l of Silencer® negative control siRNA (Ambion), siTNRC6B s; 5′-gggacaaggaggaaagaaatt-3′, as; 5′-uuucuuuccuccuuguccctt-3′ (Hokkaido System Science, Sapporo, Japan) or double-stranded mature miR-18b (Hokkaido System Science) using lipofectamine RNAiMAX (Invitrogen). [score:1]
[1 to 20 of 73 sentences]
2
[+] score: 29
Elevated miR-18b expression in human nasopharyngeal carcinoma accelerates cell growth, and knockdown of C-Jun causes a dramatic decrease of miR-18b expression [36]; AP-1 binds to miR-101 promoter and activates its expression where miR-101 can further suppress the c-Fos and subsequently attenuate the AP-1 signaling [37]; miR-187 is expressed at high level in ovarian cancer, and it inhibits the expression of disabled-2 tumor suppressor who can suppress tumorigenicity by reducing c-Fos expression [38, 39]. [score:22]
Using the same criteria, we found that luciferase activity was up-regulated by four dTuDs (dTuD-miR-18b-5p, -148b-3p, -101-3p and -1324) under PMA stimulated but not un-stimulated condition, and three dTuDs (dTuD-miR-130b-3p, -186-3p and -187-3p) under both conditions. [score:4]
Although substantial downstream validations are required to validate their involvements in AP-1 signaling, miR-18b, -101 and -187 have been previously demonstrated to have functional roles in AP-1 regulatory network. [score:2]
Collectively, these findings revealed the important roles of miR-18b, -101 and -187 in AP-1 signaling. [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 28
Moreover, we tested the target specificity of the 6C-miR-18–11bp probe against a non-specific miRNA background, by incubating the 6C-miR-18–11bp probe with several non-target miRNAs, miR-200c, miR-125c, miR-221, miR-27b, miR-451 and miR-21 (Figure 6C). [score:5]
As shown in Figure 6C, the 6C-miR-18–11bp probe shows I [0]/ I value of 14 when it encounters its target, implying a high sensitivity of this probe. [score:3]
Thus, with 6C-miR-18–11bp is it feasible to detect the presence of target miR-18 at least above 50 nM (Figure 6B). [score:3]
Indeed, the 6C-miR-18–11bp probe selectively recognized only its specific target, miR-18a, from a mixture of other miRNAs. [score:3]
The target recognition ability of 6C-miR-18–11bp was tested by adding miR-18a in a concentration dependent manner. [score:3]
As expected, addition of increasing amounts of miR-18a, led to a gradual drop of the orange fluorescence of 6C-miR-18–11bp, revealing a linear dependence of the I [0]/ I intensity versus miR-18a target concentrations (inset shows that the Stern–Volmer plot of the data in Figure 6B). [score:3]
A recent study (35, 42) reported that HEK-293T cell lines maintain a substantial expression level of miR-18a whereas miR-21 and miR-27b are almost untraceable, hence we used total RNA from HEK-293T to validate the 6C-miR-18–11bp probe. [score:3]
Similarly, we tested 6C-miR-18–11bp and 6C-miR-27b-4bp probes with total RNAs from specific cell lines. [score:1]
As shown Figure 7B, the orange fluorescence of 6C-miR-18–11bp notably decreased when it was mixed with total RNA from HEK-293T cell lines. [score:1]
As shown in Figure 6A, in the probe 6C-miR-18–11bp the length of the fold-back anchor was adjusted to give a similar T [m] value to that of 6C-miR-21–10bp. [score:1]
Indeed, miR-18a was only detected in HEK-293T cell lines when we cross-validated with northern blot analysis, confirming the accuracy of 6C-miR-18–11bp probe (Figure 7D-2). [score:1]
Interestingly, 6C-miR-18–11bp generated very strong orange fluorescence when it was excited at 510 nm. [score:1]
[1 to 20 of 12 sentences]
4
[+] score: 22
All members of miR-17-92 cluster, except miR-18, are also known to downregulate expression of the tumor suppressor PTEN [52]. [score:8]
It is suggested that SMAD2/4 is regulated by miR-18 in neuroblastoma cells [66] and that SMAD4 is targeted by miR-19a/b in thyroid follicular cells [68]. [score:4]
One possible relevant difference between these two clusters is that miR-17-92, but not miR-106b-25, expresses members of the miR-19 and miR-18 families. [score:3]
Furthermore, the antiangiogenic proteins TSP11 and CTGF are both negatively regulated by miR-18 and miR-19 [58]. [score:2]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
It is tempting to speculate that loss of miR-19a, miR-19b, and miR-18 is significantly responsible for the phenotype caused by deletion of miR-17-92. [score:1]
In addition, it has been demonstrated that miR-18 and miR-19 repress the antiangiogenic factors TSP-1 and CTGF [51]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
This cluster encodes six miRNAs: miR-106a, miR-18b, miR-19b-2, miR-20b, miR-92a-2, and miR-363 [42]. [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 21
Statistical significance enrichment analysis identified nine miRNAs as frequently targeted at detected spliced transcripts: hsa-miR-769-3p (predicted to target four transcripts), hsa-miR-378 (with six targets) as well as hsa-mir-320, hsa-miR-92b-5p, hsa-miR-16, hsa-miR-150, hsa-miR-671, hsa-miR-20a, and hsa-miR-18b (The full list and adjusted p-values are given under Table S10). [score:7]
For example, hsa-mir-20a and hsa-miR-378 increased in PD patients and decreased post-DBS, whereas the inflammatory -regulating hsa-miR-424 (Spinelli et al., 2013) showed no change in PD but it's passenger 3′ form (hsa-miR-18b-3p, previously called star form) exhibited down-regulation following DBS. [score:5]
The network showed a remarkable asymmetry containing the highest number of spliced junctions (68) in predicted targets for miR-16 and the lowest (1) for hsa-miR-18b-3p (previously called hsa-miR-18b [*]). [score:3]
Enrichment analysis for miRNA binding sited in the detected genes detected 3 of the DBS -modified miRNAs: hsa-miR-20, hsa-mir-18, and hsa-miR-143 as highly predicted to bind AS targets detected by the exon level analysis (Table S19). [score:3]
Enrichment analysis detected 6 of the DBS -modified miRNAs as modified (having adjusted p-value < 0.05): hsa-miR-320 (a, b, and c) as predicted to bind 4 spliced transcripts including hnRNPA2B1, hsa-miR-378 (predicted to bind 6 spliced transcripts), hsa-miR-92b (predicted to bind 4 spliced transcripts), hsa-mir-150, hsa-miR-20a, and hsa-miR-18b (where hsa-miR-18b-3′ changed). [score:1]
Inversely, the tumorigenic miR-18b was elevated in PD (Guo et al., 2008). [score:1]
The oncogenic hsa-mir-16 (Diniz et al., 2012), which was also observed in other PD blood cohort through RT-PCR as changed (Margis and Rieder, 2011) and the tumorigenic miR-18b (Guo et al., 2009). [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 18
While most miRNAs (e. g. miR-18b up-regulation and miR-145 down-regulation) showed an ER status independent differential expression, miR-199 and miR-214 were down-regulated in proliferating samples only in the 38 ER -negative samples (both with TNoM p<0.01, see Table S6). [score:12]
In addition we have recently observed that the miR-18 cluster is over-expressed in a panel of samples from various cancers types [20]. [score:3]
The miRNAs selected for this validation were miR-17-5p, miR-18a, miR-18b, miR-19a, miR-29c, miR-34c-5p, miR-142-3p, miR-150 and miR-449a, and the endogenous control used was RNU6B. [score:1]
Specifically, we observed an enrichment of cell-cycle genes when considering positive correlation to members of the miR-17-92 cluster, with miR-93 and miR-18b yielding the strongest enrichment (minimum-hypergeometric (mHG) p [score:1]
Specifically, miR-574-3p and miR-18b ranked high in both comparisons. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 18
Moreover, the expression level of the miR-18 family (sharing seed with BART5-5p) was up-regulated in NPC, and expression levels of the miR-29 family (sharing seed with BART1-3p) and miR-200 family (sharing seed with BART9-3p) were down-regulated in NPC tissues (Figure 7) [19], [30]. [score:11]
Our previous study using real-time PCR also found that the expression levels of miR-18a and miR-18b were significantly up-modulated in NPC tissues [19]. [score:3]
In particular, the miR-200 family (shares seeds with BART9-3p), the miR-29 family (shares seeds with BART1-3p) and miR-18 (shares seeds with BART5-5p) are expressed at high levels in major types of human tissues and cell lines [44] and are highly conserved during evolution [43]. [score:3]
The seed sequence of BART5-5p is identical to the seed sequence of two human miRNAs, hsa-miR-18a and miR-18b, which are members of the oncogenic miR-17-92 cluster. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 17
Hsa-miR-18 and hsa-miR-125 were upregulated whereas hsa-miR-29c was downregulated in basal cell carcinoma [35]. [score:7]
To validate our microassay findings above, we then selected four miRNAs including one downregulated (miR-29c) and three upregulated (miR-186, miR-15a and miR-18b) for qRT-PCR analysis. [score:6]
Murakam et al. systematically analyzed miRNA expression profiles in biopsies from patients with HBV, HCV, cirrhosis, and HCC using the adjacent normal tissues as control, and demonstrated that levels of miR-18, pre-miR-18 and miR-224 are elevated in HCC, whereas levels of miR-199a*, miR-195, miR-199, miR-200a and miR-125a are decreased. [score:3]
0.007 ± 0.001 (p-value < 0.05), and miR-18b were 0.07 ± 0.01 vs. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 17
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
Comparison of hsa-miR-18a, hsa-miR-18b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-556-3p, hsa-miR-424, hsa-miR-136, hsa-miR-340, hsa-miR-302b expression obtained by miRNA expression profile and qRT-PCR on tumors collected from human IGROV-1 ovarian tumor-bearing mice treated daily i. p. with CpG-ODN or saline (control group). [score:5]
Of the 9 miRNAs, hsa-miR-18a and hsa-miR-18b were selected based on their reported role in the pathogenesis of ovarian cancer [25]; [26], and hsa-miR-101 and hsa-miR-302b for their described involvement in DNA repair processes and sensitivity to chemotherapy [20]; the remaining 5 miRNAs were randomly selected. [score:1]
RT-qPCR using the RNA profiled in microarray analysis validated all 9 miRNAs (Fig. S1), whereas RT-qPCR using the RNA of the replica confirmed 6 of 9 miRNAs (p<0.05), with a trend observed for hsa-miR-18b and hsa-miR-101 but not for hsa-miR-136 (Fig. 2). [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 17
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
This, together with miR-18 and miR-19 targeting CTGF and TSP-1 and the fact that ECM proteins are crucial for healthy cardiac aging, has led us to hypothesize that these miRNAs play a role in age-related cardiac remo deling. [score:3]
The miR-18/19 – CTGF/TSP-1 axis is regulated in aged cardiomyocytes in vitroTo gain further insight into the role of the miR-17–92 cluster in aging of cardiomyocytes, neonatal rat cardiomyocytes (NRCMs) were aged in vitro, and miRNA levels were determined. [score:2]
The miR-18/19 – CTGF/TSP-1 axis is regulated in aged cardiomyocytes in vitro. [score:2]
Cardiomyocyte CTGF and TSP-1 and collagen production are regulated by miR-18/19. [score:2]
The miR-18/19 – CTGF/TSP-1 axis is regulated in human age -associated heart failure. [score:2]
[1 to 20 of 6 sentences]
11
[+] score: 16
These events may lead to the activition of other ER isoforms which induce the expression of some miRNAs, such as miR-206, miR-18a, miR-18b, miR-221 and miR-222, leading to further inhibition of ERα expression (49)and the activation of other pathways controlling cell growth and proliferation. [score:7]
Similar to miR-206, miR-18a, miR-18b and miR-221/222 are also up-regulated in ERα -negative cell lines, suggesting an important role of these miRNAs in the development of ERα -negative breast cancers (48, 49). [score:5]
In addition to miR-206, ERα mRNA is also a direct target of miR-18a, miR-18b, miR-193b, miR-302c and miR-221/222 in breast cancer cells. [score:4]
[1 to 20 of 3 sentences]
12
[+] score: 15
MiR-17, miR-18 and miR-106a showed up to 19, 28 and 21 fold change differences in expression in F50 versus adult tissue, with the highest level of expression observed at F50, independent of the brain tissue type (Figure 4). [score:5]
A number of miRNAs including the entire miR-17/92 cluster (with miR-17 and miR-18a being particularly significant), as well as the miR-106a/363 cluster, excluding miR-19b-2 and miR-92a-2 (with miR-106a and miR-18b having the lowest p-values), exhibited decreasing expression throughout development. [score:4]
Co -expression of miR-17 and miR-18 has also been previously shown in rat and monkey brain, by Miska et al. [22]. [score:3]
It could be considered that miRNAs which were highly expressed in fetal tissue might be involved in the development and growth of a particular region of the brain, such as the frontal cortex or cerebellum (e. g. miR-17, miR-18 or miR-106a). [score:3]
[1 to 20 of 4 sentences]
13
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
14
[+] score: 12
The upregulation of miR-18a and miR-18b were verified in clinical samples. [score:4]
miR-18a of the miR-17-92 cluster and miR-18b of the miR-106a-92 cluster showed almost identical expression patterns in clinical samples, while some divergence was observed for miR-19b being encoded by both clusters (Figure 3). [score:3]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
The level of change was significant for nine of these miRNAs; miR-1, miR-9, miR-18a, miR-18b, miR-126, miR-133b, miR-144, miR-195 and miR-223. [score:1]
These 13 miRNAs include all the above seven miRNAs (omitting miR-31*) previously described in osteoblasts [8] as well as miR-1, miR-18a, miR-18b, miR-19b, miR-133b and miR-144. [score:1]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 10
The importance of these functions have been demonstrated by showing that retroviral overexpression of a cassette containing miR-17, miR-18 and miR-19 in mice results in c-Myc -induced lymphoma [29]. [score:3]
MiRNA microarray profiling reveals that Toxoplasma infection increases the levels of miR-17-, miR-18- and miR-19 -family members. [score:1]
Red boxes are miR-17 family members; blue boxes are miR-18 family members. [score:1]
Colors of each miRNA indicate the miRNA family to which each belongs; miR-17 = yellow; miR-18 = green; miR-19 = blue; miR-25 = red. [score:1]
These results suggest that the mature miR-18 and miR-19 family members that increase upon infection with Toxoplasma are derived from miR-17∼92; although pri-miR-106b∼25 is also increased in Toxoplasma-infected cells, miR-106b∼25 does not encode miR-18 and miR-19 family members and, consistent with previous reports [32], [37], no pri-miR-106a∼363 was detectable. [score:1]
MiR-18, miR-19 and miR-25 family members also showed an increase in abundance in RNA samples derived form Toxoplasma-infected HFFs (Figures 2C). [score:1]
As miR-17 family members are co-transcribed with members of the miR-18 (Figure S1, blue box), miR-19 and miR-25 families, and are encoded in three separate paralogous loci (miR-17∼92, miR-106a∼363 and miR-106b∼25; Figure 1B), we assembled a heat-map from our microarray data that contains the averaged fold-change values for all probes that hybridized to members of the miR-17, miR-18, miR-19 or miR-25 families (18, 4, 4, and 4 probes, respectively; Figure 1C). [score:1]
Examples relevant to the present work are four families of miRNAs (miR-17, miR-18, miR-19 and miR-25) that are encoded by three paralogous loci; these related loci, which are miR-17∼92, miR-106b∼25 and miR-106a∼363 (see Figure 1B), produce primary transcripts that are post-transcriptionally processed to yield mature miR-17, miR-18, miR-19 and miR-25 family members. [score:1]
[1 to 20 of 8 sentences]
16
[+] score: 10
The target genes of miRNA-32, miRNA-34c, miRNA-135a, miRNA-18b, and miRNA-9, which were up-regulated in the follicular fluid of women with PCOS, were involved in insulin regulation and inflammation [28]. [score:7]
The expression of miRNA-32, miRNA-34c, miRNA-135a, miRNA-18b, and miRNA-9 was significantly increased in the follicular fluid of women with PCOS [28]. [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 9
org) suspects that ERBB2 is the target gene of the miR-18-5p, miR-125-5p, miR-133a-3p or miR-3622b-5p. [score:3]
To explore whether ERBB2 is the target gene of those miRNAs, we transfected miR-18-5p, miR-125-5p, miR-133a-3p or miR-3622b-5p mimic and miRNA mimic control into SK-BR-3 or SNU-216 cells. [score:3]
Consequently, the expression of ERBB2 in miR-3622b-5p -transfected cells, not in cells transfected with miR-18-5p, miR-125-5p or miR-133a-3p, was more significantly depressed than that in control cells (Figure 1A and Supplementary Figure 1). [score:3]
[1 to 20 of 3 sentences]
18
[+] score: 9
For example, miR-18-a antisense (AS), upregulated by STAT3-shRNA has a complementary sequence in STAT3 mRNA, consistent with the “sponge regulation” hypothesis. [score:5]
Conversely, the miR-18-a sense form, downregulated by STAT3-shRNA, does not have a complementary sequence in STAT3 or the 3’UTR-STAT3. [score:4]
[1 to 20 of 2 sentences]
19
[+] score: 8
For instance, the paralog miRNA clusters miR-106a/363 (integrated by miR-106a, miR-363, miR-92-2, miR-19b-2, miR-20 and miR-18b), miR-106b/25 (compound of miR-106b, miR-25 and miR-93) and miR-17/92 (comprising miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) are down-regulated upon differentiation, while clusters miR-29a/29b and miR221/222 are strongly up-regulated, suggesting an important role for coordinate regulatory miRNA networks during GIC differentiation. [score:8]
[1 to 20 of 1 sentences]
20
[+] score: 8
Interestingly, downregulation of HDAC9 by si-HDAC9 in P-PDLSCs restored the expression of pri-miR-17-92a as well as the mature miR17-92a, though, miR-18 was not affected, suggesting that HDAC9 inhibited miR17-92a (Fig.   3a, b). [score:8]
[1 to 20 of 1 sentences]
21
[+] score: 8
For H1N1 infected cells, at 18 and 24-hour post-infection, miR-188-5p, miR-1260, miR-1274a, miR-1274b, miR141, miR183*, miR-18b, miR-19a, miR21*, miR-301a, miR-572, miR-720, and miR-939 were found to be up-regulated (>1.5-fold, p<0.05) (Table 1). [score:4]
Furthermore, at 18, and 24-hour post-infection, miR-1260, miR-1274a, miR-1274b, miR-141, miR-18b, miR-21*, miR-720, miR-100*, miR-1260, miR1280, and miR21* were found to be down-regulated (>3-fold, p<0.05) in H5N1 infected cells. [score:4]
[1 to 20 of 2 sentences]
22
[+] score: 7
A recent study has shown that FOXN1 is a target of miR-18b and miR-518b, and their silencing leads to FOXN1 up-regulation and epithelial lineage development in NT2/D1 and H9 human embryonic stem (hES) cells [164]. [score:7]
[1 to 20 of 1 sentences]
23
[+] score: 7
microRNAs downregulated in quiescent cells included miR-18, miR-20, miR-29, and miR-7, and microRNAs upregulated with quiescence included let-7b, miR-125a, miR-30, miR-181, miR-26, and miR-199. [score:7]
[1 to 20 of 1 sentences]
24
[+] score: 7
For example, gga-miR-18, gga-miR-193a, gga-miR-193b, gga-miR-30b, gga-miR-146a, gga-miR-24, gga-miR-92, gga-miR-7b, gga-miR-7-1, and gga-miR-7-2 are up-regulated after avian influenza virus infection in previous studies whereas in our results these miRNAs are down-regulated on PID 4 33. [score:7]
[1 to 20 of 1 sentences]
25
[+] score: 6
The down-regulated miRNAs include, miR-17-5p/3p, miR-18, miR-19a, miR-2a, miR196-1 and miR-92-1. Significantly, host proteins targeted by the miR-17/92 cluster include histone acetylase, PCAF; PCAF has been shown to be an important co-factor in Tat-transactivation and HIV-1 replication. [score:6]
[1 to 20 of 1 sentences]
26
[+] score: 6
b The down-regulated cellular miRNAs at different times Comparing the relationship between cellular miRNAs and EBV-miRNAs, we determined that hsa-miR-18b-5p of CD8+ T cells exhibited positive correlation with BHRF1-2-5P, BART2-5P, 4-3p, 4-5p, 16–1, 6-3p, 22, 12–1, 19-3P, 19-5P, 13–1, and 13*-1 (0.96 ≤ r ≤ 0.99, P < 0.05). [score:4]
Additionally, our study showed that hsa-miR-18b-5p of CD8+ T cells had positive correlation with BHRF1-2-5P and BART2-5P. [score:1]
Additionally, hsa-miR-155-5p of B cells and hsa-miR-18b-5p of CD8+ T cells exhibited a positive correlation with miR-BHRF1-2-5P and miR-BART2-5P (0.96 ≤ r ≤ 0.99, P < 0.05). [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 6
48) 28 hsa-mir-30b dbDEMC, miR2Disease 4 hsa-let-7i dbDEMC 29 hsa-mir-125a dbDEMC, miR2Disease 5 hsa-mir-155 dbDEMC 30 hsa-mir-18b higher RWRMDA (No. [score:5]
Hsa-mir-18a, hsa-mir-18b, hsa-mir-499, and hsa-mir-542 are ranked No. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 6
The human miR-17/92 cluster composed of 5 miRNAs (miR-17, 18, 19, 20, 92) was found to be related to tumorigenesis and promoted tumor angiogenesis through targeting the anti-angiogenic thrombospondin-1 (Tsp1) by miR-19 or connective tissue growth factor (CTGF) by miR-18 to down-regulate their functions [19, 20]. [score:6]
[1 to 20 of 1 sentences]
29
[+] score: 6
Bcl-6 promotes Tfh cell differentiation through the repression of a set of miRNAs which normally prevent effector T cells from expressing Tfh cell signature molecules such as CXCR5, CXCR4, and PD-1. miR-17, miR-18, and miR-20a are involved in CXCR5 upregulation through “repression of the repressor”. [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 6
MiR-224, miR-18, and pre-mir-18 were upregulated and miR-199a*, miR-200a, miR-199a, miR-125a, and miR-195 were downregulated in HCC samples compared to normal liver samples. [score:6]
[1 to 20 of 1 sentences]
31
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 6
Other miRNAs from this paper: hsa-mir-18a
Both miR-18 and -124a down-regulated the GR, establishing their critical role in the regulation of glucocorticoid responsiveness of the brain [67]. [score:5]
Further studies have supported the implication of microRNAs, specifically miR-18 and -124a, in brain responsiveness to glucocorticoids. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 5
The expression of four novel miRNAs (miR-1, miR-12, miR-18, and miR-110) was markedly altered in the decidua, but these miRNAs were expressed at low levels (data not shown). [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
In S. mansoni, 112 miRNAs (including 84 novel miRNA families) have been reported in adult worms of S. mansoni (Marco et al., 2013); miR-4, miR-6, miR-9, miR-32, miR-125, miR-3, and miR-5 are expressed in adult worms only, and miR-20, miR-18, miR-22, miR-26 and bantam are expressed in schistosomula only (Simões et al., 2011). [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
Sprague-Dawley rats treated with 2-AAF for 12 or 24 weeks exhibited disrupted regulation of the miR-34a-p53 feed-back loop and substantial deregulation of expression of miR-18, miR-21, miR-182, and miR-200 family miRNAs [11]. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
Additionally, miR-20b* was higher expressed in pediatric PreBII large cells (up 14.1 fold, p = 0.0106), and miR-18b*/miR-19a*/miR-19b-1*/miR-20b*/miR-25* were higher expressed in adult Immature B cells (up 4.6–17.3 fold, p = 0.0465–0.0093). [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 5
Of significant interest are miRNAs with pro-fibrotic effect (miR-32, miR-155 and miR-15b*) exhibiting an increased expression, and miRNAs with an anti-fibrotic effect (miR-18a, miR-18*, miR-19a*, miR-19b-1*, miR-200a* and miR-335*) showing lower expression in cirrhotic livers (data not shown) [42- 44]. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 5
2013.125 24212931 42. van Almen GC Verhesen W van Leeuwen RE van de Vrie M Eurlings C Schellings MW MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failureAging Cell. [score:4]
Our findings do not add value to its involvement in aging process (not present in consensus modules) and its synergy impact was not substantial (miR-18b/-22 pair appeared on the 552 [th] rank). [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 5
Although multiple miRNAs, such as miR-122 [30], miR-18b [31], miR-515-5p [32], miR-148a and miR-152 10, 14, are involved in IGF-1 regulation pathway by directly targeting IGF-1, IGF-1R, IRS-1 or FOXO3a in breast cancer, the effects of IGF-1 induced signaling cascades on miRNA expression in breast cancer has yet to be evaluated. [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
We predicted there are no miR-18b (a tumour suppressor in melanoma) binding site in MALAT1 transcripts. [score:3]
Quantitative RT-PCR was used to detect the levels of MALAT1, MMP14, Snail, miR-18b, miR-1, miR-145 and miR-22. [score:1]
D. and E. MS2-RIP followed by miRNA RT-PCR to detect endogenous miR-22, miR-1, miR-18b or miR-145 associated with the MS2-tagged MALAT1 transcript. [score:1]
[1 to 20 of 3 sentences]
41
[+] score: 5
Changes in serum miRNA concentration between each infected child and corresponding control is expressed as the difference in RT-qPCR Ct-values for miR-124 (b) and miR-17, miR-19a and miR-18b (c). [score:3]
Circulating biomarkers detected in the T. gondii infected brain are clusterin (CLU), oxytocin/neurophysin I prepropeptide (OXT), peptidoglycan recognition protein 2 (PGLYRP2), and microRNAs (miR214, miR-17, miR-18b, miR-19a) (Fig.   4B, Supplement B: Table  S7). [score:1]
In considering these biomarkers in serum, three of those miRNAs, mir-17, mir-18b and mir-19a, are all encoded by the miR-17-92 family of miRNA clusters that modulate a number of protein-coding genes implicated in apoptosis, cell proliferation and angiogenesis [87] (Fig.   6d). [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 5
Most of the changed microRNAs are involved in development (especially in the embryonic development) and some examples of them are miRNA-222, miRNA-383, miRNA-126, miRNA-133, miRNA-30, miRNA-10a, miRNA-196 and miRNA-18b. [score:3]
Four microRNAs (miRNA-18b-5p, 193b-3p, 133a-3p and 133c-3p) related to embryonic development were analyzed by q-RT-PCR (Table 1). [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 5
MiR-675 regulates type II collagen in articular chondrocytes [20], miR-18 regulates chodnrocytic phenotype by targeting Ccn2/Ctgf [21]. [score:5]
[1 to 20 of 1 sentences]
44
[+] score: 4
The expression level of miR-18b in hepatocellular carcinoma is associated with the grade of malignancy and prognosis. [score:3]
The miR-17-92 cluster, located on human chromosome 13, encodes six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1. The miR-106a-363 cluster, located on human chromosome X, encodes six miRNAs: miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 4
Recently, it has also been shown that miR-18, a member of the mir-1 cluster of miRNAs, directly targets heat shock factor 2 (hsf2), a transcription factor involved in spermatogenesis [16]. [score:4]
[1 to 20 of 1 sentences]
46
[+] score: 4
We further confirmed this by a complementary approach using lentiviral overexpression of antagomirs against miR-17, miR-18 and miR-20a in the human BCR-ABL -positive BV173 cell line. [score:3]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 4
The miR-17-92 cluster consists of five members, miR-17-5p, miR-17-3p, miR-18, miR-19b and miR-20, of which only miR-20 was previously reported to be upregulated in mature differentiated adipocytes [60]. [score:4]
[1 to 20 of 1 sentences]
48
[+] score: 4
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-129-2, hsa-mir-423, hsa-mir-452, hsa-mir-622
Aliquots of sera were pooled from patients with Ross scores <3, 3–5, and >5 for expression analysis of miR129-5p, miR18b, miR423-5p, miR622, and miR452. [score:3]
Following linear pre-amplification of miRNA sequences using the Applied Biosystems Preamplification system, relative expression was determined using singleplex TaqMan Assays (ABI) with primer sets for miR-129 (ABI; 000590), miR-18b (ABI; 002310), miR-423-5p (ABI; 002340), miR-622 (ABI; 001553), and miR-452 (ABI; 002330). [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 4
2 −2.03(52) hsa-miR-134 14q32.2 −2.03(12, 29) hsa-miR-346 10q23.2 −2.01(12, 13) hsa-miR-324-5p 17p13.1 −2.00(12, 50) UPREGULATED hsa-miR-199b-3p 9q33.3 4.56(12) hsa-miR-199a-3p 19p13.2/1q24.1 4.49 hsa-miR-199a-5p 19p13.2/1q24.1 4.14(28) hsa-miR-21 17q22 3.70(12– 14, 29, 31) hsa-miR-214 1q24.2 3.59 hsa-miR-19a 13q31.3 3.11(12– 14) hsa-miR-92a-1* 13q31.3/Xq26.2 3.06 hsa-miR-214* 1q24.2 2.93 hsa-miR-34a 1p36.23 2.78(13, 30, 53) hsa-miR-18b Xq26.2 2.74 hsa-miR-422a 15q22.2 2.72(14) hsa-miR-34a* 1p36. [score:4]
[1 to 20 of 1 sentences]
50
[+] score: 4
MiR-503 and five other miRNAs (miR-4417, miR-18a, miR-431, miR-1246, and miR-18b) were the only short RNAs, which showed significant upregulation through the normal to  adenoma (dysplasia) transition in our analysis. [score:4]
[1 to 20 of 1 sentences]
51
[+] score: 4
In conclusion, chronic exposure to a mixture of five EDCs induces changes in the expression profiles of specific miRNAs (such as miR-34b-5p, miR-7686-5p and miR-1291), along with alterations in the miRNAs/isomiRs association (in particular for miR-15b-5p, miR-18b-5p, miR-20b-5p, and miR-1981-5p) regulating mRNAs implicated in key biological process in the testes (Table  3). [score:4]
[1 to 20 of 1 sentences]
52
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
miR- Effects over miR-9/9 [*]/-2 Promote HCC migration and invasion through regulation of KLF17Budhu et al., 2008; Wang et al., 2008; Sun et al., 2013; Xu et al., 2013 miR-10b Promoted cell migration and invasionLadeiro et al., 2008; Li et al., 2010 miR-15b Molecular mechanisms and roles in HCC remain largely unknownLiu et al., 2012; Wong et al., 2013 miR-17/-5p Proliferation and migrationKutay et al., 2006; Huang et al., 2009; Yang et al., 2010; Chen et al., 2012a; Zheng et al., 2013 miR-17-92 Induce proliferation and anchorage-independent growthPogribny et al., 2007; Wang et al., 2012a miR-18/a/p-18 High expression in HCC tumors. [score:4]
[1 to 20 of 1 sentences]
53
[+] score: 4
Leivonen et al previously reported that five ERα -regulating miRNAs, miR-18a, miR-18b, miR-193b, miR-302c and miR-206, directly targeted ERα in 3’UTR reporter assays (11). [score:4]
[1 to 20 of 1 sentences]
54
[+] score: 3
The following miRNA inhibitors (LNA) were obtained from Exiqon: hsa-miR-143 (138515-00), hsa-miR-455-3p (138667-00), hsa-miR-30a (138468-00), hsa-miR-17 (138461-00), hsa-miR-20b (138221-00), hsa-miR-106a (138477-00), and hsa-miR-18 (138462-00), and scramble miR (199002-04) was used as a negative control. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 3
miR-128 and miR-18b negatively explain the expression profile of the ActivityScore of genes which will have negative effect of activity centers. [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 3
The miR-17-92 cluster (miR17-5p, miR-18, miR-19a, miR-19b, miR-20a and miR-92a), located in an intron of MIR17HG [miR-17-92 cluster host gene (non-protein coding)] on chromosome 13 (13q31.3), is overexpressed in lung cancers, especially with the most aggressive SCLC [31]. [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
Mir-21, mir-34c and mir-221/222 control self-renewal of undifferentiated spermatogonia [19], Mirc1, Mirc3 and Mirlet7 regulate spermatogonial differentiation [9], [20], mir-15a and mir-184 mediate differentiation of spermatocytes [18], [19], miR-18, miR-34b, miR-34c, miR-184, miR-383, miR-449 and miR-469 mediate meiotic division of spermatocytes to spermatids [21], [23]– [25] and miR-469, miR-34c regulate differentiation of spermatid to form spermatozoa [24], [25]. [score:3]
[1 to 20 of 1 sentences]
58
[+] score: 3
These authors showed that miRNAs 20-b, miR-20a, miR-17, miR-21, miR-106a, miR-18a, mir-21, miR106b, mir-18b, miR-421, miR-340, miR-19a and miR-658 were highly expressed in GC. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 3
MiRNAs belonging to the cluster mir-17/92 and the paralogous clusters mir-25/106b and mir-106a/363 showed a similar trend of expression, i. e. mir-17-5p, mir-20a, mir-106a, mir-20b, mir-18a, mir-106a, mir-18b, mir-20b, mir-106b, mir-93 and mir-25 (Cluster 1, Figure 1). [score:3]
[1 to 20 of 1 sentences]
60
[+] score: 3
While miR-BART5 and hsa-miR-18-5p share the same seed sequence, hsa-miR-18-5p is unable to target LMP1 [101]. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Interestingly, miR-92a is transcribed from miR-17-92 locus that encode the polycistronic precursor containing seven microRNAs: miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b and miR-92a, and the human microRNA cluster miR-17-92 is amplified and/or overexpressed in several cancers such as acute myeloid leukemia [15], [18], malignant lymphoma [19], lung cancer [20], thyroid cancer [21] and hepatocellular carcinoma [22]. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Among this group, miR-18 has been reported to control ctgf/ccn2 gene expression in chondrocytic cells [64]. [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 3
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
Ten miRNAs (let-7e, miR-128, miR-323-3p, miR-133b, miR-18b, miR-144, miR-451, miR-150, miR-486-3p, and miR-196b-5p) reflected a fourfold differential expression, and three miRNAs (miR-130b-5p, miR-452, and miR-579) were only identified in plasma from RA patients. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
For example, rs4559 is a common variant associated with STAT6 expression (Fig. 4f) in both cell types and is within the binding region of miR-18b. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
Murakami et al. [48] showed a correlation between miR-222, miR-106a, miR-92, miR-17-5p, miR-20 and miR-18 and the degree of differentiation suggesting an involvement of specific miRNAs in the progression of the disease. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Several miRNAs from the MYCN -induced miR-17–92 cluster (miR-17-5p, miR-18-5p, miR-20a-5p and miR-92a-3p) were significantly upregulated in LSL- MYCN;Dbh-iCre tumors compared with normal adrenals from wild-type mice (Supplementary Figure 8b). [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
Other miRNAs from this paper: hsa-mir-18a
For example, TCGA data showed that expression of high levels of miR-18 and low levels of TGF-β genes in the proneural glioblastoma subtype correlates with prolonged patient survival [73]. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 2
The gene cluster is located on the sense strand of chromosome 11 and the coordinate information is: mir-17: 36,340,189–36,340,268; mir-18: 60,972,593–60,972,684; mir-19a: 60,972,741–60,972,822; mir-20: 60,972,911–60,972,981; PN(a)46-1: 60,973,037–60,973,123; PN(a)119-1 : 60,973,159–60,973,236. [score:1]
This representation also shows the ratio of counts of the most abundant isomiR and the miRBase entry which ranges from infinitely large (miRBase entry was “not detected”) (such as miR-18-5p, Figure S2A. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 2
The microRNAs encoded by this cluster were grouped based on seed sequences into four families: miR-92, miR-17, miR-18 and miR-19 [37, 38] There are some examples of microRNAs with an essential impact on angiogenesis and ECM remo deling. [score:1]
The microRNAs encoded by this cluster were grouped based on seed sequences into four families: miR-92, miR-17, miR-18 and miR-19 [37, 38]There are some examples of microRNAs with an essential impact on angiogenesis and ECM remo deling. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 2
MiR-127, miR-9, miR-148, miR-203, miR-340, miR-18, and miR-34b/c are several examples of miRNAs regulated by CpG island hypermethylation [11, 15, 19, 20]. [score:2]
[1 to 20 of 1 sentences]
72
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
In the miR-17-92 cluster, ssc-miR-17 and ssc- miR-18 had higher expression in mpiPSCs compared with the pEFs. [score:2]
[1 to 20 of 1 sentences]
73
[+] score: 2
In this work, the SVM method selected hsa-miR-146a-5p, hsa-miR-18b-5p, hsa-miR-21-3p, hsa-miR-22-3p, hsa-miR-29a-3p, hsa-miR-432-5p, hsa-miR-511-5p, and hsa-miR-596 as an EVD classifier. [score:1]
Six of the miRNAs increased in abundance with higher viral load (>1000 PFU), while miR-18b-5p and miR-432-5p declined (Fig. 4A). [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 2
Chr2.326 1851 Pkinase  csa-mir18 evm. [score:1]
Chr1.775 1845 Aldedh  csa-mir18 evm. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 2
Protein levels and function of p53 have been shown to be regulated by miRNAs including miR-125 [43], miR-18 [23], and miR-504 [28]. [score:2]
[1 to 20 of 1 sentences]
76
[+] score: 2
Based on the high predicted frequency, we chose 10 candidates (has-miR-144-3p, hsa-miR-18b-5p, hsa-miR-222-5p, hsa-miR-221-3p, hsa-miR-24-3p, hsa-miR-27a-5p, hsa-miR-27b-3p, hsa-miR-9-5p, hsa-miR-210-3p, hsa-miR-661) that promote BC development (confirmed from previous studies) [21– 30] for verification (Supplementary Figure S1). [score:2]
[1 to 20 of 1 sentences]
77
[+] score: 2
Furthermore, miR-17, and miR-18b have been postulated to directly reduce EPAS1 in human macrophages [140]. [score:2]
[1 to 20 of 1 sentences]
78
[+] score: 2
The miRNA miR-18b-5p is also involved in breast cancer, regulating genes involved in cell migration and metastasis [30]. [score:2]
[1 to 20 of 1 sentences]
79
[+] score: 2
Limiting the analysis to the three natural hosts (humans, chicken, and pig) revealed an additional three consistently regulated miRNAs (miR-18b-3p, miR-22-5p and miR-30a-3p). [score:2]
[1 to 20 of 1 sentences]
80
[+] score: 2
Considering that (a) the deletion affected the secondary structure and stability of the pre-miR-17–pre-miR-18 region and the entire cluster, (b) the deletion was not present in any of the 480 controls, and (c) rs770419845 is a rare variant in BRCA1/2 -negative BC, this in del is likely pathogenic. [score:1]
The hairpin structure most strongly affected by the variant was pre-miR-18. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 1
hsa-miR-2355-3p2.000.001622hsa-miR-133b4.300.009926hsa-miR-451a2.200.0108517hsa-miR-4664-3p4.310.000228hsa-miR-130b-3p2.300.0462722hsa-miR-44314.350.003682hsa-miR-486-5p2.320.002088hsa-miR-4804-3p4.360.000235hsa-miR-361-5p2.330.04722Xhsa-miR-18b-3p4.620.00191Xhsa-miR-3156-3p2.500.0072910hsa-miR-675-3p4.680.0002811hsa-miR-4728-3p2.670.0002917hsa-miR-550b-3p4.720.013827hsa-miR-3191-5p2.670.0002019hsa-miR-551a4.750. [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
Note, however, that one out of eighteen hits, miR-18b, was not detected by RT-QPCR in our cells and might be a false positive. [score:1]
[1 to 20 of 1 sentences]
83
[+] score: 1
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-155, hsa-mir-26a-2, hsa-mir-326, hsa-mir-599
We were able to identify 6 mature miRNA species, miR-326, miR-155, miR-3676, miR-18b, miR-599 and miR-26a-5p deriving from known human stem-loop sequences (miRBase 12.0). [score:1]
[1 to 20 of 1 sentences]
84
[+] score: 1
These miRNAs are encoded by three paralogous clusters located at chromosome 13q31.3 (the mir-17 cluster, containing miR-18a*, miR-19a, miR-19b-1* and miR-92-1), chromosome Xq26.2 (the mir-106a cluster, containing miR-18b*, miR-20b and miR-92-2) and chromosome 7q22.1 (the mir-106b cluster, containing miR-93 and miR-93*) (Fig. 4B) [23]. [score:1]
[1 to 20 of 1 sentences]
85
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
One example of miRNAs that can be actively involved in cell proliferation is the miR-17-92 cluster, which comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b, and miR-92-1). [score:1]
[1 to 20 of 1 sentences]
86
[+] score: 1
To identify the miRNAs present in adult C. sinensis, deep sequencing and bioinformatics extrapolations combined with stem-loop real-time PCR analysis approach was applied (Xu et al., 2010), they identified a total of 62,512 conserved miRNAs which belonged to 284 families along with six novel miRNA (cis-miR-001, cis-miR-2, cis-miR-6, cis-miR-10, cis-miR-18, and cis-miR-19). [score:1]
[1 to 20 of 1 sentences]
87
[+] score: 1
In an in silico analyses, miR-BART-5 was found to be an ortholog of cellular miR-18 [79]. [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
Within mast cell lines, 121 microRNAs, including miR-1, miR-15, miR-16, miR-17, miR-18, miR-181, miR-375, lin-4 and let7, were demonstrated within their released extracellular vesicles (Valadi et al., 2007). [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
In total, eight circulating miRNAs (hsa-miR-146a-5p, hsa-miR-18b-5p, hsa-miR-21-3p, hsa-miR-22-3p, hsa-miR-29a-3p, hsa-miR-432-5p, hsa-miR-511-5p, and hsa-miR-596) were selected as an EBOV classifier. [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
Additionally, two miR-17-92 paralogs have been identified: (i) the miR-106a-363 cluster, which is located on the X chromosome and houses miR-106a, miR-18b, miR-20b, miR-19b-2,2a-2, and miR-363, and (i) the miR106b-25 cluster, which is located on chromosome 7 and houses miR-106b,3, and miR-25 [35]. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
This cluster encodes six miRNAs belonging to four different seed families: (i) the miR-17 family with miR-17 and miR-20a, (ii) the miR-18 family with miR-18a, (iii) the miR-19 family with miR-19a and miR-19b-1 and (iv) the miR-92 family [8– 11]. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
Similarly, a recent study on the lncRNA microarray in gastric cancer has revealed that linc00152 and other six other lncRNAs form a cancer -associated ceRNA network with 9 miRNAs, including miR-18a-5p, miR-18b-5p, miR-19a-3p, miR-20b-5p, miR-106a-5p, miR-106b-5p, miR-31-5p, miR-139-5p, and miR-195-5p [32]. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
We found three correlations of the creatine kinase (CK) at day 5 with miR-18-3p, miR-33b-3p or miR-650. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Other miRNAs from this paper: hsa-mir-18a, hsa-mir-4735
Interestingly, miR-18a and miR-18b belong to the miR-18 miRNA family and possess similar seed regions. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
was performed by transfecting PTEN-WT vector into A549 cells together with miR-18 mimics or miR-18a mimics + pcDNA-TP53TG1 (c), and anti-miR-18a or anti-miR-18a + si-TP53TG1#1 (d). [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
Based on the bioinformatics tools and the reference [11], 4 potential microRNAs binding sites scattered the CTNNAP1 transcript as well as the sequence of CTNNA1 3′-UTR (microRNA-141, microRNA-18b, microRNA-33a and microRNA-9). [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
MiRNA-20b clusters with miR-18b, miR-92a-2, miR-19b, miR-363, and miR-106a. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
MiR-19b belongs to the miR-17-92 cluster which includes miR-17, miR-18, miR-19a, miR-19b, miR-20 and miR-92 30. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
mir-106a∼mir-363 designates mir-106a/mir-18b/mir-20b/mir-19b-2/mir-92a-2/mir-363 cluster and mir-941-1∼3 designates mir-941-1/mir-941-2/mir-941-3 cluster. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
Similarly, Mir92a which is in the Mirc1 cluster on mouse chromosome 14 containing Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, and Mir92a-1, is required to promote proliferation of orofacial development (Ning et al., 2013). [score:1]
[1 to 20 of 1 sentences]