sort by

18 publications mentioning gga-mir-126

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-126. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 134
Comparing the inhibition of luciferase activity by the lentiviral expressed and endogenously expressed miRNAs, these results show that 1) the lentiviral expressed miR126 (both sense and antisense strands) and miR140 antisense strand exhibit potent RNAi activity; 2) the lentiviral expressed miR451 antisense strand does not have any RNAi activity; 3) the observed RNAi activity of lentiviral expressed miR21 (both sense and antisense strands) and miR140 sense strand could be due to endogenous miRNAs. [score:13]
In addition, the chicken miR126 -based expression system effectively inhibits reporter gene expression in human, monkey, dog and mouse cells. [score:7]
Although the expression cassette is based on chicken miR126, the resulting lentiviral vectors also effectively inhibit reporter gene expression in human, dog, mouse and monkey cells. [score:7]
In our development of lentiviral vectors capable of expressing multiple anti-influenza miRNAs, we have developed a novel chicken miR126 -based miRNA expression cassette. [score:6]
By testing different mouse and chicken miRNAs, different hairpins, and different numbers of miRNAs in the same lentiviral vector, we showed that the chicken miR126 -based design supports robust expression of artificial miRNAs and efficient knockdown of target genes both in transiently transfected cells and stably transduced cells (Figure 3c,d). [score:6]
Inhibition of luciferase activity by multiple anti-influenza miRNAs expressed from chicken miR126 -based lentiviral vectors. [score:5]
Inhibition of luciferase activity in non-chicken cells by miRNAs expressed from the miR126 -based lentiviral vector. [score:5]
The results showed that miR126-NP inhibited luciferase activity by 95% (Figure 3c); miR21-NP-shRNA by 70%; whereas miR21-NP and miR126-NP-shRNA exhibited only minor or no inhibition. [score:5]
Luciferase activity was inhibited by NP, PB1 and PA miRNAs by 70 to 95% (Figure 6a), suggesting that the chicken miR126 -based lentiviral vector is a general platform for expressing artificial miRNAs. [score:5]
Expression of both the sense and antisense strands of gga-miR21, gga-miR126 and gga-miR140 led to the inhibition of Renilla luciferase activity (Figure 2a). [score:5]
We have developed a novel chicken miR126 -based artificial miRNA expression system that can express one, two or three miRNAs from a single cassette in a lentiviral vector. [score:5]
These results demonstrate the versatility of the miR126 -based miRNA expression cassette for potent and effective silencing of target genes. [score:5]
Here, we show that in the miR126 -based lentiviral vector, miRNA stem-loop expression cassettes can be placed on both ends of the flanking sequences of pre-miRNA and still maintain efficient processing to produce RNAi activity. [score:3]
Based on the miR126-NP stem-loop design, we constructed miR126-PB1 and miR126-PA, encoding miRNAs targeting influenza polymerase components PB1 and PA, respectively. [score:3]
These results show that three artificial miRNAs can be expressed from a single cassette of the chicken miR126 -based lentiviral vector. [score:3]
Together, these results suggest that the miR126 -based design is novel and efficient for expression and processing of artificial miRNAs for RNAi activity. [score:3]
Based on these results, we selected gga-miR21 and gga-miR126 to construct lentiviral vectors to express NP miRNA. [score:3]
Because gga-miR21, gga-miR126, gga-miR140 and gga-miR451 are generally expressed, we assayed their activity in DF-1 cells by directly transfecting the reporter plasmids into DF-1 cells. [score:3]
All three vectors (pLB2-NP, pLB2-ScrA-NP and pLB2-ScrA-NP-ScrB) inhibited NP reporter activities to the same extent (Figure S2c), suggesting that inclusion of additional flanking sequences does not improve processing of miR126-NP. [score:3]
In addition, miR126 -based design are also efficiently expressed and processed in mammalian cells. [score:3]
The miR126 -based cassette can express one, two or three miRNAs from a single cassette in the context of a lentiviral vector. [score:3]
Based on literature reports and the miRNA database (miRBase), we chose four endogenous chicken miRNAs gga-miR21, gga-miR126, gga-miR140 and gga-miR451 that are expressed in many different tissues of adult chicken and chicken embryo [22]. [score:3]
The other design replaces the entire pre-miRNA stem-loop with one that is commonly used to express shRNA driven by Pol III promoters (miR21-NP-shRNA and miR126-NP-shRNA) (Figure 3b) [24]. [score:3]
We show that endogenous gga-miR21 is highly active in the DF-1 cells while gga-miR126 is not (Figure 2b). [score:1]
In a reverse correlation, artificial miRNA transcribed from miR126 -based design produced potent RNAi activity while that from miR21 -based design did not. [score:1]
0022437.g003 Figure 3(a) Structures and sequences of the miR21-NP and miR126-NP. [score:1]
The miR21-NP-shRNA was able to generate functional RNAi but miR126-NP-shRNA was not (Figure 3c). [score:1]
To test the RNAi activity of miR126-NP in stably integrated DF-1 cells, we transduced DF-1 cells with the miR126-NP lentivirus at an MOI of 0.1. [score:1]
Mature miR21 or miR126 sequences were replaced with anti-influenza NP sequences (blue). [score:1]
According to the miRBase, both sense and antisense strands of gga-miR21 and gga-miR126 can produce mature miRNAs. [score:1]
The miR126-PB1 cassette was cloned into Not I and Swa I sites at the 5′ end of flanking sequence of pLB2-NP lentiviral vector. [score:1]
Because the length of miR21 and miR126 sequences are different, slightly different anti-influenza NP sequences, both containing a 20 nucleotide core sequence of UUGUCUCCGAAGAAAUAAGA, were used to replace them (Figure 3a). [score:1]
Therefore, we constructed miR21-NP and miR126-NP lentiviral vectors (Figure 3a) where the anti-influenza NP sequences replaced the miR21 sense or miR126 antisense strand, respectively. [score:1]
The miR126-PB1 stem-loop was inserted at the 5′ end of the miR126 flanking sequence in pLB2-NP, producing lentiviral vector pLB2-PB1-NP (Figure 4a). [score:1]
Sequences of these anti-influenza artificial miRNA cassettes are listed in Table 2. To construct pLL3.7-NP, the termination signal (TTTTTT) was added to the 3′ end of miR126-NP and one T was added to the 5′ end of miR126-NP in order to reconstitute the U6 promoter. [score:1]
Thus, the chicken miR126 -based stem-loop hairpin can also be transcribed and processed from a Pol III promoter. [score:1]
The miR126-PA cassette was cloned into the Pme I site at the 3′ end of the flanking sequences (Figure 4a). [score:1]
Figure S2 Flanking sequences do not improve processing of miR126-NP. [score:1]
The miR126-PA stem-loop was inserted at the 3′ end of the miR126 flanking sequence in pLB2-PB1-NP, producing lentiviral vector pLB2-PB1-NP-PA. [score:1]
These results demonstrate that inclusion of flanking sequences does not enhance anti-NP activity by improving processing of miR126-NP. [score:1]
Figure S3 Complete sequences of miR21-NP, miR126-NP, miR-NP-shRNA and miR126-NP-shRNA. [score:1]
For gga-miR21, the more abundant one is the sense strand and for gga-miR126, the antisense strand. [score:1]
Thus, miR126-NP was cloned into the pLL3.7 lentiviral vector under the transcriptional control of the U6 promoter. [score:1]
The gga-miR126 based lentiviral vector design also works in other cell types. [score:1]
Furthermore, our results show that the miR126 -based design can be transcribed by either RNA Pol II or Pol III and the resulting miRNAs can be processed to exert RNAi activity. [score:1]
To exclude the possibility that the anti-viral activity is due to a non-specific effect of flanking sequences that improve processing of miR126-NP, we constructed pLB2-ScrA-NP lentiviral vector where a scrambled sequence replaced PB1, and pLB2-ScrA-NP-ScrB lentiviral vector where two scrambled sequences replaced PB1 and PA (Figure S2a and S2b). [score:1]
We also tested whether the miR126-NP stem-loop can be properly processed when transcribed from a RNA polymerase III promoter. [score:1]
DF-1 cells were infected with miR126-NP lentivirus (MOI = 0.1) and were selected with puromycin until GFP -positive cells reached >95%. [score:1]
miR126-PB and miR126-PA cassettes were replaced with miR126-ScrA and miR126-ScrB (b), respectively. [score:1]
Since RNAi processing machinery is highly conserved among different species, we tested whether the chicken miR126 -based lentiviral vector also works in other cell types including human epithelial cell 293T, Madin-Darby Canine Kidney (MDCK) cells, mouse embryonic fibroblast (MEF) cells, and African green monkey kidney (Vero) cells. [score:1]
[1 to 20 of 50 sentences]
2
[+] score: 55
Figure 10(A– B) Over expression of miR-222a and miR-126–5p causes decreases CPEB3 and FGFR3 target gene expression levels respectively. [score:7]
Figure 9(A) CPEB3 target regulated by gga-miR-222a (B) FGFR3 target down regulated by gga-miR-126–5P. [score:7]
In vitro analyzed of the over expression of miR-222a and miR-126-5p was significantly reducing the expression level target gene CBEB3 and FGFR3 in DF-1 cells, respectively. [score:7]
We then measured target gene expression after 48 h. Both miR-222a and miR-126-5p down regulated their respective targets (Figure 10A and 10B). [score:6]
CPEB3 expression was significantly and negatively correlated with miR-222a levels and FGFR3 was negatively correlated with miR-126-5p indicating that these genes are targets for these miRNAs. [score:5]
We constructed dual luciferase reporters to test whether miR-126-5p and miR-222a bind directly to the 3′-untranslated regions (3′-UTR) of CPEB3 and FGFR3 mRNAs, respectively. [score:4]
The luciferase activity of the transfected with the PGLO vector containing the CPEB3 and FGFR3 3’UTR fragment with the binding sequence of miR-222a and miR-126–5p was inhibited by transfection of miR-222a and miR-126–5p mimic into DF-1 cells line respectively. [score:3]
These included miRNAs (miR-222a, miR-499-5p, miR-126-5p, miR-10b-5p, miR-22-3p, let-7f-5p, miR-181a-5p and miR-215-5p) (Figure 6) and differentially expressed genes (CPEB3, SUCLA2, MUSTN1, FGFR3 and ABHD3) (Figure 7). [score:3]
The CPEB3 and FGFR3 3′-UTR sequences around the miRNA-222a and miR-126-5p target sites and the seed sequence of mature miRNA-222a and miR-126-5p are well conserved in chickens. [score:3]
When miR-222a and miR-126-5p inhibitors were transfected, CPEB3 and FGFR3 increased respectively (Figure 10C and 10D). [score:3]
Validation of the miR-222a and miR-126–5p predicted targets using luciferase reporters containing CPEB3 and FGFR3 3′UTRs in DF-1 cells. [score:3]
The 20 most abundant miRNAs in the three groups were ordered by the average proportion of each miRNA and included miR-148a-3p, miR-22-3p, miR-10b-5p, miR-181a-5p, miR-133a-3p, miR-126-5p, let-7f-5p, miR-10a-5p, miR-30c-5p, miR-146c-5p (Supplementary Table 1). [score:1]
We also evaluated the effects of miR-222a and miR-126-5p by transfecting miR-222a and miR-126-5p mimics or inhibitors separately in DF-1 cells. [score:1]
MicroRNA mimics for miR-126-5p and miR-222a and negative controls were synthesized by Ribobio (Guangzhou). [score:1]
The mutant CPEB3 3′-UTR and FGFR33′-UTR plasmids were generated by changing the miR-222a and miR-126-5p binding sites from ATGTAGCA to GACGTAGT, and TAATAAT to ATCACGA, respectively. [score:1]
[1 to 20 of 15 sentences]
3
[+] score: 26
Among them miR-202-3p was predicted to target 34 genes, miR-202-5p targeted 18 genes, miR-147 targeted 17 genes, and miR-126-3p targeted 9 genes. [score:9]
The expression patterns of the 4 common differentially expressed miRNAs (miR-202-3p, miR-202-5p, miR-147 and miR-126-3p) were shown in Fig 6e. [score:5]
Our analysis of the differently expressed miRNAs revealed four miRNA (miR-202-5p/3p, miR-126-3p, miR-147) that were differentially expressed in all three comparisons (SSC vs. [score:5]
Conversely, miR-126-3p was down-regulated in SSC vs. [score:4]
Venn analysis of these miRNA identified 4 miRNAs expressed in all samples analyzed: miR-202-3p, miR-202-5p, miR-147 and miR-126-3p (Fig 6b). [score:3]
[1 to 20 of 5 sentences]
4
[+] score: 21
Several examples are: miR-17-92 which is upregulated in colonocytes coexpressing K-Ras and c-Myc, represses the expression of anti-angiogenic thrombospondin-1 (Tsp1) and connective tissue growth factor (CTGF), thus induces angiogenesis [17]; miR-378 promotes angiogenesis induced by human glioblastoma cell line U87 by targeting Fus-1 expression [18]; miR-126 regulates vascular integrity and angiogenesis, and miR-126 restoration decreases VEGF level in lung cancer cells [19], [20]; miR-130a mediates angiogenesis through downregulating antiangiogenic homeobox genes GAX and HOXA5 [21]; miR-296 level is elevated in primary brain tumor endothelial cells and regulates angiogenesis by directly targeting the hepatocyte growth factor-regulated tyrosine kinase substrate mRNA, leading to the reduction of HGS -mediated degradation of the growth factor receptors VEGFR2 and PDGFRbeta [22]. [score:21]
[1 to 20 of 1 sentences]
5
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Out of the 26 miRNA/host gene pairs with coordinated expression, 11 have been found to be coordinately expressed in both, human and mouse [19], [27], [59], [61]– [64], [67]– [69], [71], [73]– [79]: mir-103/ PANK3, mir-107/ PANK1, mir-126/ EGFL7, mir-128-1/ R3HDM1, mir-140/ WWP2, mir-211/ TRPM1, mir-218-1/ SLIT2, mir-218-2/ SLIT3, mir-27b/ C9orf3, mir-33/ SREBF2, and mir-499/ MYH7B. [score:5]
Previous studies revealed that five miRNA genes as well as their host genes (hsa-mir-10a/ HOXB4, hsa-mir-126/ EGFL7, hsa-mir-152/ COPZ2, hsa-mir-191/ DALRD3, and hsa-mir-342/ EVL) were found to be epigenetically downregulated, either by histone modification and/or CpG island hypermethylation in the promoter region in cancer cells [27], [86]– [89] (Table 2 ). [score:4]
Significantly for this discussion, inadvertent deletion of mmu-mir-126 has led to the misattribution of phenotype - angiogenesis defects previously reported in a knockout of the Egfl7 locus were subsequently shown to have arisen due to deletion of the mmu-mir-126 [99]. [score:2]
[1 to 20 of 3 sentences]
6
[+] score: 7
Comparing the 19 most highly expressed miRNAs with the total miRNA expression during the period of feather regeneration in ducks [9], only miR-30a, miR-126, and miR-181a were also highly expressed during feather regeneration in ducks [40]. [score:7]
[1 to 20 of 1 sentences]
7
[+] score: 6
Other miRNAs from this paper: gga-mir-26a, gga-mir-223, gga-mir-146a, gga-mir-451
Comparative miRNA expression profiles of 7 MDV-transformed T-cell lines showed that host-encoded miRNAs such as miR-26a, miR-223, miR-150, miR-451 and miR-126 were consistently downregulated [3]. [score:6]
[1 to 20 of 1 sentences]
8
[+] score: 5
For example, miR-126, -30d and -10a are relevant to porcine muscle development 33, and miR-148a mediates myogenic differentiation through targeting ROCK1 34. [score:4]
In addition, some other miRNAs, such as miR-148a, miR-122, miR-21-5p, Let-7f-5p, miR-26a-5p, miR-126-5p, miR-30d, and miR-10a-5p, were also highly abundant in chicken liver. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 4
The following 15 miRNAs were dominantly expressed in the two libraries: gga-miR-10a, gga-miR-146c, gga-miR-101, gga-miR-21, gga-let-7a, gga-let-7b, gga-let-7c, gga-let-7j, gga-let-7f, gga-let-7 k, gga-miR-30a-5p, gga-miR-30e, gga-miR-148a, gga-miR-100 and gga-miR-126. [score:3]
Furthermore, gga-miR-101, gga-miR-1a, gga-miR-146c, gga-miR-148a, gga-miR-126, gga-miR-26a and gga-miR-30d were abundant in our sequencing libraries, as has been shown in other animal gonads [25, 27, 28]. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 4
Except for gga-miR-92-5p with a slight difference in the R group, the expression patterns of gga-miR-101-3p, gga-miR-126-3p, gga-miR-155, gga-miR-103-5p, and gga-miR-455 were comparable by both methods. [score:3]
Several miRNAs previously reported to be involved in immune responses such as miR-155, miR-9, miR-30, miR-126, and miR-29 families were identified. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 3
Most of the changed microRNAs are involved in development (especially in the embryonic development) and some examples of them are miRNA-222, miRNA-383, miRNA-126, miRNA-133, miRNA-30, miRNA-10a, miRNA-196 and miRNA-18b. [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 3
miRNAs Normalized Reads Total Reads WRRh WRRl XHh XHl gga-miR-133a 3,558,683 3,069,071 1,997,286 2,607,787 11,232,827 gga-miR-133c 3,350,936 2,885,440 1,878,925 2,449,209 10,564,510 gga-miR-133b 3,326,848 2,864,578 1,864,721 2,431,274 10,487,421 gga-let-7a 1,699,621 1,513,865 857,210 1,133,532 5,204,228 gga-miR-22-3p 1,333,233 1,145,421 712,464 988,186 4,179,304 gga-miR-30a-5p 1,213,468 1,148,128 790,893 930,507 4,082,996 gga-miR-26a 1,212,635 1,054,689 691,456 1,006,522 3,965,302 gga-miR-30d 851,887 813,262 583,932 667,002 2,916,083 gga-miR-181a-6p 918,452 836,452 485,661 650,836 2,891,401 gga-miR-10a-5p 943,686 782,180 420,809 663,401 2,810,076 gga-miR-10b 911,725 757,564 398,852 633,567 2,701,708 gga-miR-30e 799,679 730,832 501,718 596,218 2,628,447 gga-let-7j 848,972 756,205 428,182 566,165 2,599,524 gga-let-7f 398,292 363,598 206,995 274,333 1,243,218 gga-miR-148a 288,585 300,432 144,015 180,973 914,005 gga-miR-146c-5p 224,147 207,782 171,443 132,712 736,084 gga-let-7k 211,853 206,518 118,297 155,412 692,080 gga-let-7c 242,661 189,820 111,118 139,257 682,856 gga-miR-199-3p 168,417 152,158 75,346 121,460 517,381 gga-miR-126-5p 139,914 109,805 89,607 86,681 426,007 Differentially expressed miRNAs were identified by DEGseq analysis (fold change > 1.5 or < 0.66; p-value < 0.05; q-value < 0.01), as a result, 200, 279, 257 and 297 miRNAs were detected in four comparisons of WRRh vs. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
Other miRNAs from this paper: gga-mir-148a, gga-mir-106
Our previous studies have confirmed that miR-126-5p played a role in osteoclastogenesis through targeting MMP13 and PTHrP in GCT [22, 23]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 2
For example, the predicted novel chicken miRNA gga-m0015-3p is complementary to the known chicken miRNA gga-miR-126-5p, the 3′ portion of gga-m0016-5p overlaps with the 5′ portion of gga-miR-219b, and the 5′ portion of gga-m0028-3p overlaps with the 3′ portion of gga-miR-3525 (Figure S2). [score:1]
Note: The sequence of gga-m0015-3p is complementary to gga-miR-126-5p. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 2
In addition, qPCR confirmed other transcripts showing cardiac enrichment like the miR30a/b/d, miR126 and miRNA ENSGALT0000042439-3p, a transcript which has not yet been included in the miRbase [2]. [score:1]
Cross referencing our cardiac enriched miRNA transcripts with previously published mouse and human sequencing data generated by Landgraf et al [22] showed overlap for miR144-3p, miR126-5p and 146a-5p. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 1
Furthermore, gga-miR-7, gga-miR-148a-3p, gga-miR-146c-5p, gga-miR-125b-5p, gga-miR-30d, gga-miR-153-3p and gga-miR-126-3p were abundant in our sequencing libraries and have been shown to occur in other animals [15, 69, 73, 74]. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Four precursor miRNAs (gga-mir-126, gga-mir-1728, gga-mir-301b, and gga-mir-455) showed a reversal in the ratios of the 5p- and 3p- derived sequences across the four RNA libraries. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
gga-miR-126* is another case in which only miRNA* was detected (Table 2). [score:1]
[1 to 20 of 1 sentences]