sort by

51 publications mentioning gga-let-7b

Open access articles that are associated with the species Gallus gallus and mention the gene name let-7b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 341
In normal myoblast, let-7b overexpression significantly reduced IGF2BP3 expression by about 30%, and the expression of GHR gene, which is another let-7b target gene, is also down-regulated (Figure 3C). [score:12]
Our previous results have showed that the expression of let-7b was up-regulated in the skeletal muscle of dwarf chicken, and its expression showed opposite expression trends to the mRNA expression of IGF2BP3 (Lin et al., 2012). [score:12]
On the other hand, let-7b inhibition significantly increased IGF2BP3, GHR and Suppressor of Cytokine Signaling 3 (SOCS3) mRNA expression in normal myoblast (Figure 3G), whereas its inhibition in dwarf myoblast can only increase IGF2BP3 mRNA expression (Figure 3H). [score:11]
Furthermore, from let-7b overexpressed analysis, we observed that let-7b significantly reduced mRNA and protein levels of IGF2BP3 without affecting IGF2 mRNA levels, but the IGF2 protein was significantly reduced in both normal and dwarf myoblasts, suggesting that let-7b -mediated down-regulation of IGF2BP3 could further reduce IGF2 expression at the post-transcriptional level. [score:8]
Additionally, IGF2 protein expression was down-regulated both in dwarf and in normal myoblast after let-7b overexpression (Figure 3F), and the IGF2 protein level was lower in dwarf myoblast than in normal myoblast after let-7b transfection (Figure 3F). [score:8]
Therefore, these results indicated that the increased expression of let-7b in dwarf chicken results in IGF2BP3 repression, which further inhibits IGF2 translation and cell proliferation through let-7b-IGF2BP3-IGF2 pathway. [score:7]
IGF2BP3, an IGF2 mRNA binding protein that can regulate IGF2 expression and function (Liao et al., 2005), is also a direct target gene of let-7b. [score:7]
IGF2BP3 is a target gene of let-7bTo verify whether IGF2BP3 is a target gene of let-7b, we used TargetScan (http://www. [score:7]
Here, we validated that IGF2BP3 is a conserve and direct target gene of let-7b, and the inhibition of IGF2BP3 by let-7b would result in cell cycle arrest of chicken primary myoblast, demonstrating that let-7b can regulate myoblast proliferation. [score:7]
Therefore, the up-regulation of let-7b in dwarf chicken might be due to the loss-of-function of GHR and down-regulation of IGF1. [score:7]
In dwarf myoblast, let-7b overexpression significantly reduced the relative expression of IGF2BP3 by more than 60%, and the expression of GHR, IGF1 and IGF2 have no change (Figure 3D). [score:7]
Let-7b inhibits chicken primary myoblast proliferation through represses its target gene IGF2BP3To test whether let-7b can regulate chicken myoblast proliferation or not, we next detect the effect of let-7b on the regulation of myoblast cell cycle. [score:7]
Let-7b up-regulation balance the inhibiting effect of let-7b on cell proliferation through enhancing its binding to IGF2BP3. [score:6]
In our previous work, we found let-7b is able to regulate the GH/GHR/IGFs somatotropic axis through inhibiting GHR gene expression (Lin et al., 2012). [score:6]
Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblastTo further study the regulation of let-7b on IGF2BP3 in dwarf and normal chicken skeletal muscle, we transfected let-7b mimic to the primary myoblast (Figure 3A) of dwarf and normal chickens, respectively (Figure 3B). [score:6]
showed that the overexpression of let-7b significantly repressed the relative luciferase activity of the cells transfected with wild-type IGF2BP3-3′UTR reporter, and mutation of the predicted binding site would abolish the inhibition effect of let-7b to the reporter (Figure 2C). [score:6]
Therefore, these results indicated that let-7b inhibits chicken primary myoblast proliferation at least in part through represses its target gene IGF2BP3. [score:5]
On the other hand, the loss of target binding site of let-7b in dwarf GHR mRNA might result in increasing binding of let-7b to IGF2BP3, because the same amount of let-7b expression in dwarf and normal myoblast leads to different IGF2BP3 repression. [score:5]
Additionally, growth factors can also suppress let-7 expression through MAPK signaling pathway (Dangi-Garimella et al., 2009), which is inactivated in dwarf chicken (Luo et al., 2016). [score:5]
On the one hand, the higher expression of let-7b in dwarf chicken results in the more significant decrease of IGF2BP3 in dwarf chicken skeletal muscle and leads to decrease of IGF2 expression, which finally repressed skeletal muscle growth through let-7b-IGF2BP3-IGF2 signaling pathway. [score:5]
Our previous microarray data showed that let-7b expression is significantly higher in the skeletal muscle of 7 week (w) dwarf chickens than in 7 w normal chickens (Figure 1A), and IGF2BP3 mRNA expression is significantly lower in the skeletal muscle of 7 week (w) dwarf chickens than in 7 w normal chickens (Figure 2A). [score:5]
Immunoblotting results also showed that let-7b overexpression reduced the relative IGF2BP3 protein expression by about 35% in normal chicken, whereas this reduction was more than 50% in dwarf chicken (Figure 3E). [score:5]
In this case, let-7b would enhance its inhibition on IGF2BP3 expression. [score:5]
In both dwarf and normal myoblasts, let-7b overexpression significantly inhibited luciferase activity of the reporters (Figure 3J). [score:5]
Therefore, the inhibition of GHR and IGF2BP3 by let-7b in chicken myoblast will not only result in cell cycle arrest, but also may regulate the other developmental processes of myoblast. [score:5]
Therefore, these results suggested that let-7b inhibits IGF2BP3 expression in chicken myoblast, and the binding activity of let-7b to the 3′UTR of IGF2BP3 mRNA is significantly higher in dwarf myoblast than in normal myoblast. [score:5]
Let-7b, a member of the let-7 miRNA family, has been found to inhibit chicken growth by repressing growth hormone receptor (GHR) gene expression (Lin et al., 2012). [score:5]
In our previous microarray analysis, we found that let-7b is differentially expressed between the skeletal muscles of dwarf and normal chicken, suggesting that it is potentially involved in the regulation of chicken muscle development (Lin et al., 2012; Luo et al., 2016). [score:5]
To verify whether IGF2BP3 is a target gene of let-7b, we used TargetScan (http://www. [score:5]
Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J. 28, 347– 358. [score:5]
Let-7b has an enhanced inhibitory effect on IGF2BP3 expression in dwarf myoblast than in normal myoblast. [score:4]
let-7b can inhibit skeletal muscle development through let-7b-IGF2BP3-IGF2 signaling pathway and let-7b-GHR-GHR downstream genes pathway in normal chicken. [score:4]
Let-7b inhibits chicken primary myoblast proliferation through represses its target gene IGF2BP3. [score:4]
Collectively, these results indicate that IGF2BP3 is a direct target gene of let-7b in chicken. [score:4]
Therefore, let-7b inhibits skeletal muscle development only through let-7b-IGF2BP3-IGF2 signaling pathway with enhancing effect in dwarf chicken. [score:4]
To further understand the relationship between let-7b and IGF2BP3, and investigate the regulatory roles of let-7b in skeletal muscle development of dwarf and normal chickens, we use primary myoblast from dwarf and normal chickens to analysis let-7b mediated regulation of IGF2BP3 expression and muscle cell proliferation in vitro. [score:4]
Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. [score:4]
The let-7 family is one of the first identified miRNAs and known to be differentially expressed between embryo and mature tissues (Yanaihara et al., 2006). [score:3]
html) to predict the target relationship between let-7b and IGF2BP3. [score:3]
Additionally, our previous study indicated that let-7b might be involved in the regulation of skeletal muscle development (Luo et al., 2016). [score:3]
To test whether let-7b can regulate chicken myoblast proliferation or not, we next detect the effect of let-7b on the regulation of myoblast cell cycle. [score:3]
Combined previous studies with our present results, we can establish gene regulatory network for let-7b mediated skeletal muscle development (Figure 5). [score:3]
IGF-1R, a target of let-7b, mediates crosstalk between IRS-2/Akt and MAPK pathways to promote proliferation of oral squamous cell carcinoma. [score:3]
However, the co-transfection of let-7b and IGF2BP3 cannot fully rescue the inhibition effect of let-7b in cell cycle of normal myoblast. [score:3]
GHR gene defection would lead to the decrease of IGF1, which is able to negatively alter let-7 family expression (Martin et al., 2012). [score:3]
Opposite expression trends between let-7b and IGF2BP3 in the skeletal muscle of dwarf and normal chickens. [score:3]
For normal chicken, let-7b not only can promote skeletal muscle growth through let-7b-GHR-GHR downstream genes signaling pathway, but also can inhibit muscle growth via let-7b-IGF2BP3-IGF2 signaling pathway. [score:3]
To further understand whether there is any difference in the binding of let-7b to IGF2BP3 between dwarf and normal myoblasts, we overexpressed let-7b and NC mimics, respectively, to the myoblasts transfected with pmirGLO-IGF2BP3-3′UTR reporter. [score:3]
Additionally, GHR is another target gene of let-7b in chicken. [score:3]
Figure 1Opposite expression trends between let-7b and IGF2BP3 in the skeletal muscle of dwarf and normal chickens. [score:3]
IGF2BP3 is a target gene of let-7b. [score:3]
Figure 2 IGF2BP3 is a target gene of let-7b. [score:3]
Without let-7b overexpression, the relative luciferase activity was also lower in dwarf myoblast than in normal myoblast (0.88 vs. [score:3]
Both of these two miRNA target prediction software showed that the 3′UTR of chicken IGF2BP3 mRNA has a potential binding site of let-7b (Figure 2A), and this binding site is conserved among vertebrates (Figure 2B). [score:3]
The inhibition of let-7b also increased IGF2BP3 protein level in both normal and dwarf myoblast (Figure 3I). [score:3]
Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens. [score:3]
Therefore, let-7b and IGF2BP3 showed opposite expression trends in the skeletal muscle of dwarf and normal chickens. [score:3]
Both the relative expression levels of IGF2BP3 mRNA and protein were reduced more in dwarf myoblast than in normal myoblast, and the binding activity of let-7b in dwarf myoblast is significantly higher than that in normal myoblast. [score:3]
In this study, we found that let-7b mediated pathway is one of the reasons that can lead to inhibition of skeletal muscle growth in dwarf chickens. [score:3]
The findings of this study would be beneficial to understand the function and regulation of let-7b in skeletal muscle development of the dwarf and normal chickens. [score:3]
For the dwarf chicken, as the deletion mutation not only results in dysfunction of GHR and dwarf phenotype of chicken, but also leads to the loss of the ability of let-7b to pair with sequences in GHR mRNA 3′UTR (Lin et al., 2012), the regulation of GHR gene was affected (Figure 5). [score:3]
The plasmid pmirGLO-IGF2BP3-3′UTR was prepared for verification of target relationship between let-7b and IGF2BP3 mRNA. [score:3]
In both normal and dwarf myoblasts, let-7b overexpression significantly reduce the number of cells that progressed to S phase, and the number of cells that progressed to G0/1 phase was significantly increased (Figures 4A,B). [score:3]
With let-7b overexpression, the relative luciferase activity was significantly lower in dwarf myoblast than in normal myoblast (0.41 vs. [score:3]
Interestingly, when we co -transfected let-7b and IGF2BP3 overexpression vector into dwarf myoblast, the significant changes of the number of S, G0/1, and G2 phase cells induced by let-7b were rescued (Figures 4A,B). [score:3]
The higher expression of let-7b might be a feedback result of the loss function of GHR gene in dwarf chicken. [score:3]
To further study the regulation of let-7b on IGF2BP3 in dwarf and normal chicken skeletal muscle, we transfected let-7b mimic to the primary myoblast (Figure 3A) of dwarf and normal chickens, respectively (Figure 3B). [score:2]
In this network, we concluded that the let-7b mediated regulatory pathway is different between dwarf chicken and normal chicken. [score:2]
However, the role of let-7b in skeletal muscle development still remains unknown. [score:2]
However, the large deletion mutation at the exon 10 and 3′UTR of GHR gene in dwarf chicken lead to disruption of let-7b binding site in GHR 3′UTR. [score:2]
H19/let-7/LIN28 reciprocal negative regulatory circuit promotes breast cancer stem cell maintenance. [score:2]
Here, with a further study of let-7b, we found another role of let-7b in the regulation of this somatotropic axis. [score:2]
The temporal patterning microRNA let-7 regulates several transcription factors at the larval to adult transition in C. elegans. [score:2]
Therefore, these works suggesting an important regulatory role of let-7b in the GH/GHR/IGFs somatotropic axis. [score:2]
Post-transcriptional regulation of the let-7 microRNA during neural cell specification. [score:2]
Ezh2 regulates the Lin28/let-7 pathway to restrict activation of fetal gene signature in adult hematopoietic stem cells. [score:2]
The let-7 miRNA family is conserved across diverse animals, functions to control late temporal transitions during development (Grosshans et al., 2005). [score:2]
Figure 5Schematic illustration for signaling pathways of skeletal muscle growth regulated by let-7b. [score:2]
During the last decade, the involvement of let-7 in regulating cell differentiation has been analyzed in various contexts, including neural cell specification, stem cell maintenance and hematopoietic progenitor differentiation (Wulczyn et al., 2007; Oshima et al., 2016; Peng et al., 2017). [score:2]
Collectively, let-7b regulates skeletal muscle growth through two signaling pathways in normal chicken, but only one signaling pathway with enhancing effect in dwarf chicken. [score:2]
Let-7b mimic (50 nM) and pmirGLO-IGF2BP3-3′UTR (200 ng) were co -transfected into DF-1 cells (3 × 10 [4] cells) by using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's instructions. [score:1]
Integrative analyses of miRNA-mRNA interactions reveal let-7b, miR-128 and MAPK pathway involvement in muscle mass loss in sex-linked dwarf chickens. [score:1]
Two types of plasmids, the wild-type, and a mutant with let-7b potential binding site deleted were prepared. [score:1]
Let-7b, a member of the let-7 family, is characterized to be highly conserve, tissue specific, and has important roles in regulating cell development (Pasquinelli et al., 2000; Gao et al., 2014). [score:1]
[1 to 20 of 84 sentences]
2
[+] score: 218
GHR expression was up-regulated in dwarf chickens and down-regulated in normal chickens, suggesting that let-7b could play a significant role in inhibiting GHR expression, further promoting the growth and development of skeletal muscle. [score:14]
Only let-7b was found to be complementary to its target in the 3′ untranslated region of GHR, and was able to inhibit its expression. [score:9]
Expression of let-7b and miR-128 in 7-week-old chickens was significantly up-regulated and down-regulated, respectively. [score:9]
Of the differentially expressed miRNAs, expression of let-7b, miR-30a-5p, miR-30b, miR-99a, and miR-133b was commonly up-regulated in both dwarf and normal chickens. [score:8]
Data from the microarray and qPCR analyses supported that the above pathway, indicating that the expression of GHR is inhibited by let-7b, and the expression of SOCS3 gene is regulated and stimulated by GHR. [score:8]
In 7-week-old chickens, as compared with 14-day-old embryos, the expression of let-7b, miR-30a-5p, miR-30b, miR-99a and miR-133b was significantly up-regulated, but miR-16c, miR-92, miR-106, miR-203, miR-451 and miR-454 were significantly down-regulated in both dwarf and normal chickens. [score:8]
By combining target gene prediction for differential miRNAs, joint analysis of mRNA expression profiles, and BLAST analysis, the critical role of let-7b in regulating the GHR expression was identified. [score:8]
Comparing the different developmental stages (Table  2), expression levels of let-7b were significantly up-regulated in both dwarf and normal chickens. [score:7]
This confirms that the expression of GHR is regulated by let-7b, and that the let-7b target is located in the region of the GHR 3′ UTR mutation. [score:7]
miRNA let-7b inhibits the expression of GHR and regulates SOCS3. [score:6]
This allows for the gene to be up-regulated as let-7b is unable to pair with GHR gene as its target site is deleted. [score:6]
When comparing dwarf and normal chickens, the expression levels of let-7b were significantly up-regulated. [score:6]
As the deletion mutation in dwarf chickens results in the loss of the ability of let-7b to pair with sequences in its target gene, the regulation of growth and development is affected. [score:6]
In dwarf chickens, let-7b could not inhibit the expression of GHR. [score:5]
Let-7b -mediated regulation of GHR expressionThe miRNAs involved in the regulation of GHR were let-7b, miR-15c (miR-16, miR-16c), and miR-181b (Additional file 3: Table S3). [score:5]
Through signaling pathway analysis, we found that let-7b regulates the expression of GHR, and further regulates SOCS3 through the JAK-STAT signaling pathway. [score:5]
Expression levels of let-7b were significantly up-regulated in both dwarf and normal chickens at both stages of development investigated (Table  2). [score:5]
SOCS3 plays a critical role in regulating skeletal muscle growth and fat deposition via let-7b -mediated GHR expression. [score:4]
Methylation, post-translation modifications, and Lin28 genes regulate the let-7 family. [score:4]
In the overexpression assay for let-7b, we observed it was up-regulated 6.41-fold as compared with the control. [score:4]
Validation of the 3′ UTR of GHR as the target site of let-7bLuciferase activity was decreased in DF-1 cell lines transfected with pmirGLO-let-7b- GHR 3′ UTR (Figure  3A), but increased in DF-1 cells transfected with pmirGLO-let-7b- GHR 3′ UTR mutation, and in the control DF-1 cell line (Figure  3 B and C). [score:4]
At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). [score:4]
We concluded that the regulation of let-7b could be critical to GHR expression. [score:4]
Our data showed that the retarded growth of dwarf chickens was caused by a deletion in the GHR 3′ UTR inducing loss of the let-7b target site. [score:3]
BLAST analysis indicated that the last 29 bp of the GHR 3' UTR exactly coincided with the target site of let-7b. [score:3]
BLAST analysis confirmed that the target location of let-7b was in the deleted region of GHR 3' UTR. [score:3]
The plasmid pmirGLO-let-7b- GHR 3′ UTR was prepared for verification of GHR mRNA expression. [score:3]
Figure 4 Functional validation of let-7b inhibiting GHR in an in vitro cell system. [score:3]
Validation of the 3′ UTR of GHR as the target site of let-7b. [score:3]
of let-7b-regulated GHRAssuming that the dwarf chicken phenotype in this experiment was caused by a deletion mutation in GHR, we used the Kyoto Encyclopedia of Genes and Genomes (KEGG) software (http://www. [score:3]
The signaling pathway related to the regulation of the growth and development of skeletal muscle by let-7b -mediated GHR has not been previously reported. [score:3]
Let-7b -mediated regulation of GHR expression. [score:3]
Quantitative polymerase chain reaction (qPCR) analysis of the GHR signaling pathway regulation by let-7bBased on the previously mentioned analyses, a schematic illustration of the GHR signaling pathway, as regulated by let-7b, was developed (Figure  1). [score:3]
Two plasmids, pcDNA3.1-EGFP (Invitrogen) and pEASY-T1-pre-let-7b, were used for constructing the let-7b expression plasmid pcDNA3.1-EGFP-pre-let-7b. [score:3]
In the present study, little change in expression of let-7b between dwarf and normal chickens was observed; however, growth was retarded in dwarf chickens. [score:3]
With the aid of KEGG signaling pathway and qPCR analyses, the network through which let-7b -mediated GHR regulates growth and development of skeletal muscle as well as fat deposition was established. [score:3]
of let-7b-regulated GHR. [score:2]
Luciferase activity was decreased in DF-1 cell lines transfected with pmirGLO-let-7b- GHR 3′ UTR (Figure  3A), but increased in DF-1 cells transfected with pmirGLO-let-7b- GHR 3′ UTR mutation, and in the control DF-1 cell line (Figure  3 B and C). [score:2]
Validation of GHR as the target of let-7b, and luciferase reporter assays for functional validation in vitro were conducted. [score:2]
Previous studies of the let-7 family have largely focused on tumor suppression mechanisms [46], and studies investigating the family’s role in growth and development are rare. [score:2]
There is a critical miRNA, let-7b, involved in the regulation of GHR. [score:2]
The miRNAs involved in the regulation of GHR were let-7b, miR-15c (miR-16, miR-16c), and miR-181b (Additional file 3: Table S3). [score:2]
Figure 1 Schematic illustration of the signaling pathway of GHR regulated by let-7b. [score:2]
Quantitative polymerase chain reaction (qPCR) analysis of the GHR signaling pathway regulation by let-7b. [score:2]
DF-1 cells were transfected with pmirGLO-let-7b- GHR 3′ UTR, pmirGLO-let-7b- GHR 3′ UTR mutation plasmid, or the control plasmid. [score:2]
Four miRNAs, let-7b, miR-16, miR-16c, and miR-181b, are involved in the regulation of GHR. [score:2]
Figure 3 Dual-luciferase reporter assay for validation of the 3′ UTR of GHR as the target site of the let-7b in vitro cell system. [score:2]
Based on the previously mentioned analyses, a schematic illustration of the GHR signaling pathway, as regulated by let-7b, was developed (Figure  1). [score:2]
These were influenced by let-7b-regulated GHR. [score:2]
Deletion, or mutation of the function of let-7, may lead to defects in the transformation of nematodes from their larval to adult stage [44]. [score:2]
The let-7b miRNA is a member of the let-7 family. [score:1]
GHR was affected by let-7b, miR-15c, miR-16, and miR-16c. [score:1]
Plasmids pcDNA-EGFP-pre-let-7b and pmirGLO-let-7b- GHR 3′ UTR were co -transfected into DF-1 cells (3 × 10 [4] cells). [score:1]
PCR products including pre-let-7b were ligated and transformed using the pEASY-T1 Simple Clone Kit (Trans Gen Biotech, Beijing, China). [score:1]
There are 13 homologs in the let-7 family in the human genome, clustered into eight sites [45]. [score:1]
[1 to 20 of 55 sentences]
3
[+] score: 139
In late larval up to the young adult stages, this suppression is removed and let-7 is processed to the mature microRNA, which effectively downregulates lin-41. [score:6]
Since Lin-28 is also a known target of let-7, the fish retina exemplifies the autoregulatory mechanism of the microRNA and its target in a regeneration inducing process (Ramachandran et al., 2010). [score:6]
Let-7 is upregulated in the last larval stage (L4), and by downregulating lin-41 mRNA, allows the animal to fully mature. [score:6]
In this context, loss of SOX2 as well as overexpression of let-7 (specifically of let-7i) led to the inhibition of neuronal differentiation (Cimadamore et al., 2013). [score:5]
In order to generate different levels of Chinmo throughout MB development, let-7 and miR-125 co-transcribed from the let-7-C locus, contribute to the progressive downregulation of chinmo in vivo. [score:5]
Neurons degrading due to e. g., the consequences of Alzheimer’s disease release the microRNA let-7. Extracellular elevated let-7 molecules are sensed by the Toll-like receptor 7 (TLR 7) which is expressed in cortical neurons. [score:5]
Thus, let-7-C mediated downregulation of Abrupt regulates the transition between different subsets of MB neurons. [score:5]
Let-7 and miR-125 regulate chinmo expression directly via binding sites in the 3′UTR of the transcription factor. [score:5]
Notably, the expression of let-7-C appears to be dependent on Ecdysone signaling, a key regulator for morphological transitions during insect development (Robbins et al., 1968). [score:5]
Expression and activation of Lin-28 inhibits let-7 and leads to the maturation of the NPCs, which are derived from human ES cells (Cimadamore et al., 2013). [score:5]
To ensure precise timing of activity for instance during neuronal differentiation, let-7 interacts with one of its classical targets in an autoregulatory cycle. [score:4]
microRNA Mo del organism Function Citation Development let-7 Drosophila Maturation of neuromuscular junction (NMJ) Caygill and Johnston (2008), Sokol et al. (2008) Mushroom body (MB) differentiation Kucherenko et al. (2012), Wu et al. (2012) Human neural precursor cells embryonic stem cells Pluripotency Rybak et al. (2008), Cimadamore et al. (2013) bantam Drosophila Glia cell growth in the brain and optic lobe Reddy and Irvine (2011) Differentiation and number of glia cells in the opticlobe Li and Padgett (2012) miR-279 DrosophilaCO [2] neuron development Cayirlioglu et al. (2008), Hartl et al. (2011) Regeneration let-7 C. elegans AVM neuron axon regeneration Zou et al. (2013) Zebrafish De-differentiation of Mueller glia cells Ramachandran et al. (2010) bantam Drosophila Dendritic aborisation (da) neuron regeneration Song et al. (2012) Degeneration let-7 MouseLoss of cortical neurons through extracellular let-7 Lehmann et al. (2012) Behavior miR-279 Drosophila Regulation of circadian rhythm Luo and Sehgal (2012) While aging, the nervous system progressively loses the ability to rapidly regenerate new cells. [score:4]
All let-7-C microRNAs are strongly upregulated in the transition from the late pupal to early adult stage. [score:4]
Two other recent studies in Drosophila show that the let-7 complex (let-7-C) is a key regulator of the development of the MB (Kucherenko et al., 2012; Wu et al., 2012). [score:3]
Whether depletion of let-7b could decrease the extent of neurodegeneration in Alzheimer disease patients appears to be an interesting hypothesis to be tested in future studies. [score:3]
In embryonic stem (ES) and embryonic carcinoma (EC) cells, the pluripotency factor Lin-28 binds pre-let-7 and inhibits the last step during let-7 processing and thereby prevents the formation of a mature microRNA (Rybak et al., 2008). [score:3]
In vivo, precocious expression of let-7 and miR-125 in larval stage 1 leads to a sharp decrease of Chinmo levels already in larval stage 3. As a consequence, the adult MB shows strong morphological defects and mis-differentiation of its cell types. [score:3]
In C. elegans let-7 participates in the so-called heterochronic pathway, which regulates the transition between different developmental stages in the worm by timing the division and differentiation of stem cells. [score:3]
As exemplified in the fish retina and fly da neurons blocking the expression of let-7 or bantam enables the cell to increase the levels of pluripotency factors to allow cell growth and thereby regeneration of cells and tissues. [score:3]
Mice injected with let-7b into the spinal canal lose 18% of neurons after 3days in the cortical area where TLR 7 is endogenously expressed. [score:3]
The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. [score:3]
Nevertheless, the results of the two publications show that let-7-C is used to sharpen the expression of two potent transcription factors in order to produce different neuronal subtypes. [score:3]
The experiments suggest that in early stages of development a Lin-41/Alg-1 complex is formed and represses the synthesis of let-7 permitting axonal regeneration and extension. [score:2]
Ascl1a regulates Muller glia dedifferentiation and retinal regeneration through a Lin-28 -dependent, let-7 microRNA signalling pathway. [score:2]
The third microRNA of the let-7-C, mir-100, seems not to be involved in the post-transcriptional regulation (Wu et al., 2012). [score:2]
Temporal regulation of metamorphic processes in Drosophila by the let-7 and miR-125 heterochronic microRNAs. [score:2]
Three microRNAs, let-7, bantam, and miR-279 were discovered in forward genetic screens, because their mutants showed substantial developmental phenotypes. [score:2]
Similar to let-7, miR-279 appears to regulate neuronal commitment and differentiation of progenitor cells (Cayirlioglu et al., 2008; Hartl et al., 2011; Table 1). [score:2]
Here, we review recent advances in the understanding of the function of let-7, bantam, and miR-279 in neural development, regeneration and degeneration, and behavior. [score:2]
SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors. [score:2]
Let-7-C gives rise to three different microRNAs, namely (let-7, miR-100, and miR-125), which can act individually but also synergistically on mRNA regulation. [score:2]
While both studies describe effects on MB morphology, the effect of the let-7-C mutation on MB morphology differs in the two studies. [score:2]
FIGURE 2 let-7 regulates neuronal degeneration. [score:2]
The authors could show that the phenotype is accompanied by increased levels of the broad-complex, tramtrack, and bric-a-brac (BTB) transcription factor Abrupt in let-7 mutants (Caygill and Johnston, 2008) corroborating a previous finding that Abrupt ensures the remo deling of the larval NMJ to achieve its adult shape and function (Hu et al., 1995). [score:1]
Injection of let-7b was in turn also sufficient to activate downstream TLR 7 signaling which was shown by the increased phosphorylation state of IRAK4 (Takeuchi and Akira, 2010). [score:1]
In contrast, let-7 uses a new and different mechanism in the context of neuronal degeneration. [score:1]
The second study revealed that let-7-C also influences the timing of α′/β′ to α/β transition via the Chinmo related BTB transcription factor Abrupt (Kucherenko et al., 2012). [score:1]
Strong alleles of let-7 mutants cause a severe phenotype of a blasting vulva (Reinhart et al., 2000). [score:1]
An unconventional role for miRNA: let-7 activates Toll-like receptor 7 and causes neurodegeneration. [score:1]
INITIAL DISCOVERY OF Let-7, Bantam, AND miR-279. [score:1]
An unexpected role of let-7 was revealed in a study on signaling mechanisms leading to neuronal degeneration (Lehmann et al., 2012). [score:1]
A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
In neural stem cells, lin-28 is repressed by let-7 and miR-125. [score:1]
Drosophila let-7 microRNA is required for remo deling of the neuromusculature during metamorphosis. [score:1]
In this context, the microRNA involved and responsible for increased axonal length and regeneration is let-7 (Figure 1). [score:1]
MECHANISMS OF Let-7 REGULATION. [score:1]
Although no anatomical phenotype was detected, let-7 mutant flies show defects in locomotion, flight, and also fertility (Sokol et al., 2008). [score:1]
In a recent study, the RNA sensing receptor Toll-like 7 (TLR 7) in cortical neurons of mice was shown to bind extracellular enriched let-7 released by degenerating neurons (Figure 2). [score:1]
Let-7 REGULATES CELLULAR DIFFERENTIATION OF THE NMJ AND OTHER BRAIN STRUCTURES. [score:1]
Interestingly, Lin-41 co-immunoprecipitates with Alg-1, which constitutes a key factor for let-7 biogenesis. [score:1]
In this case, let-7 acts as an extracellular signaling molecule. [score:1]
Steroid -induced microRNA let-7 acts as a spatio-temporal code for neuronal cell fate in the developing Drosophila brain. [score:1]
In silico analysis predicted a strong interaction of let-7 with the transcription factor Abrupt. [score:1]
Mutants of let-7 exhibited the same phenotype in AVM neurons as alg-1 mutants. [score:1]
Let-7-complex microRNAs regulate the temporal identity of Drosophila mushroom body neurons via chinmo. [score:1]
Weak mutant alleles of let-7 lead to a reiteration of larval patterns of cell division, and the animal fails to differentiate. [score:1]
The study showed that in order to stop AVM axons from extending, Lin-41 is strongly repressed by let-7 in late adult stages. [score:1]
Here, an increase in let-7 levels in degenerating neurons induces cell death of cortical neurons. [score:1]
[1 to 20 of 58 sentences]
4
[+] score: 102
From the expression profiles and validation assays we found that let-7b may be involved in higher GHR mRNA expression levels in the SLD chickens than in normal chickens, and that let-7b may function in the regulation of many signaling pathways through its direct target gene GHR [31]. [score:8]
Up-regulation of let-7b in the SLD chicken might inhibit the normal development of skeletal muscle. [score:7]
Functional analysis indicated that many DEGs were targeted by let-7b at 7w, and the potential target pathways of let-7b are mainly involved in muscle development, such as the MAPK pathway and the PI3K-Akt pathway. [score:6]
In our previous study, we found that let-7b inhibits GHR expression by directly binding to the 3′ UTR of the GHR mRNA [31]. [score:6]
On the other hand, the expression of let-7b is also up-regulated from E14 to 7w in both SLD and normal chickens. [score:6]
Finally, we confirmed that the expressions of let-7b, miR-128 and miR-187 are differentially expressed between the SLD chickens and normal chickens at 7w by using qPCR assays (Figure 3d), and the Western Blotting results also showed that the expression of phospho-ERK1/2 is reduced in the SLD chicken compared to that in normal chickens at 7w (Figure 3e). [score:5]
Let-7b is able to repress cell proliferation and cell cycle progression [36, 37], and our results of functional analysis indicated that many genes in the MAPK or PI3K-Akt pathways might have repressed expression since they are the potential target genes of let-7b. [score:5]
These analyses identified that let-7b, miR-128 and the MAPK pathway are important for chicken muscle development, and their different expressions or activities during muscle development might lead to differences in muscle performance between the SLD and normal chickens. [score:5]
Additionally, the qPCR results showed that the expressions of let-7b, miR-128 and miR-187 have no significant difference between the SLD chickens and normal chickens at E14 (Figure 3f), but the expression of phospho-ERK1/2 is also reduced in the SLD chickens compared to that of in normal chickens at E14 (Figure 3g). [score:4]
Additionally, let-7b can also regulate some signaling pathways, which are implicated in cell growth and fat synthesis, by targeting the GHR gene [31]. [score:4]
Among these pathways, the PI3K-Akt and MAPK signaling pathways implicated in muscle development were found to be involved in the target pathways of let-7b and miR-128 (Figure 3b and Table S1). [score:4]
Thus, based on the integrative analysis of miRNA-mRNA interactions, we conclude that abnormal expressions of let-7b, miR-128, the MAPK pathway and the negative regulation of cell proliferation may be critical for the muscle mass loss in the SLD chicken. [score:4]
Let-7b is a key regulator of development [35], while miR-17-5p, miR-20a and miR-20b are members of miR-17 family, which play important roles during embryo development [63]. [score:4]
Approximately 15.34% of the DEGs are targeted by at least two DEMs, and the LASP1 gene is regulated by seven DEMs (miR-24, miR-133a, miR-133b, let-7b, miR-20a, miR-20b and miR-130b). [score:4]
Period-specific DEGs potentially targeted by let-7b are involved in the MAPK, PI3K-Akt and Wnt signaling pathways. [score:3]
Both our qPCR and microarray results have shown that let-7b is differentially expressed between the normal and SLD chickens at 7w. [score:3]
Altogether, these results suggested that let-7b, miR-128 and the MAPK signaling pathway are the most important potential targets that are related to the difference of muscle performance between SLD and normal chickens at 7w of age. [score:3]
Notably, the binding site of the let-7b in the GHR 3′ UTR is located on the deleted region in SLD chickens, therefore, the GHR gene expression would not be influenced by the let-7b in the SLD chickens. [score:3]
Therefore, let-7b may be a key regulator in chicken skeletal muscle development. [score:3]
Lin S. Li H. Mu H. Luo W. Li Y. Jia X. Wang S. Jia X. Nie Q. Li Y. Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens BMC Genom. [score:3]
Schultz J. Lorenz P. Gross G. Ibrahim S. Kunz M. MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth Cell Res. [score:3]
Let-7b, which belongs to the highly conserved let-7 family, plays a crucial role in development and cell maturation [35]. [score:2]
In conclusion, our study revealed that let-7b, miR-128 and the MAPK pathway are potential key molecules and the pathway implicated in GHR -deficient induced muscle mass loss, and that the reduced cell division, growth and developmental process in the SLD chicken skeletal muscle may be the molecular reasons that result in the muscle mass loss. [score:2]
This network showed that let-7b and miR-128 are involved in the regulation of many DEMs (Figure 3c). [score:2]
The core nodes for this network are let-7b, miR-128 and miR-187. [score:1]
Finally, by analyzing the functions of these DEGs and DEMs, we also found that several molecules and pathways, such as let-7b, miR-128, and the MAPK signaling pathways, may be the key nodes or pathways that play critical roles in the GHR -deficient induced muscle mass loss. [score:1]
Johnson C. D. Esquela-Kerscher A. Stefani G. Byrom M. Kelnar K. Ovcharenko D. Wilson M. Wang X. Shelton J. Shingara J. The let-7 microRNA represses cell proliferation pathways in human cells Cancer Res. [score:1]
[1 to 20 of 27 sentences]
5
[+] score: 47
As a lung tumor suppressor in humans, overexpression of let-7 results in inverse expression of RAS, a potential oncogene, and inhibits lung tumor cell growth [79]. [score:9]
Overexpression of let-7b elevates mouse neural stem cell differentiation but reduces proliferation by targeting the stem cell regulator nuclear receptor subfamily 2, group E, member 1 (Nr2e1) and the cell cycle regulator cyclin D1[82]. [score:7]
As expected, the complementary sequence of let-7b to normal GHR matched the deleted region of mutant GHR, indicating that let-7b suppresses expression of GHR in normal chickens but not in SLD chickens. [score:5]
Comparison of differential expression profiles of miRNA and mRNA in SLD and normal chickens showed that, in addition to let-7b, mRNA expression of GHR genes increased SLD compared to in normal chicken. [score:4]
It was reported to exert a negative effect on cell number and positive effect on the fraction of cells in the G2/M cell cycle phase following peripheral introduction of let-7 in primary fibroblasts by targeting and down -regulating the cell division cycle 34 (Cdc34) gene, indicating its crucial influence on cell cycle control [80]. [score:4]
A significant difference in expression of let-7b in skeletal muscle was observed between SLD chickens due to the identical mutant type of GHR with Connecticut SLD [88] and normal chickens at 7 w of age. [score:3]
Moreover, inhibition of let-7b boosts de-differentiation of somatic cells into induced pluripotent stem (iPS) cells [81]. [score:3]
Introduction of let-7 family members in mouse embryonic stem cells (ESCs) can suppress continuous self-renewal resulting from a lack of DiGeorge syndrome critical region gene 8 (Dgcr8), which enables silencing of this program. [score:3]
Thus, tight control of let-7b may block expression of SOCS3 in a non-mutant GHR -dependent manner. [score:3]
The relationship between let-7b and GHR has been confirmed through a dual reporter assay and overexpression experiment in vitro. [score:2]
Because aberrant GHR elicits the dwarfism phenotype, it is important in the functional mechanism that how GHR acts on skeletal muscle in SLD in response to let-7b. [score:1]
Additionally, Glazov et al. found that the total number of let-7 family reads increased significantly during embryonic stages on days 5, 7, and 9, particularly let-7b, with maximum reads on day 9 [47]. [score:1]
After identification in C. elegans, let-7 miRNAs have been shown to play vital roles in mediating cell proliferation and differentiation. [score:1]
Many growth-related miRNAs have been discovered, including miR-1, miR-133, miR-206, miR-101, and let-7b, the biochemical roles of which have been demonstrated through experimental validation. [score:1]
[1 to 20 of 14 sentences]
6
[+] score: 43
The major function of the let-7 family is to target genes, which promote the terminal differentiation in development, and to suppress tumor growth by targeting oncogenes such as Myc and Ras [6]. [score:8]
Top amongst them were miRs reported to decrease tumor metastasis and invasion (miR-194, miR-103, miR-29) [21, 22], inhibit cell proliferation (let-7 family, miR-215) [23], induce apoptosis (miR-125) [24], and tumor suppressors (let-7 family, miR-125, miR-106) [25, 26] to mention but a few. [score:5]
The expression of let-7 family members is down-regulated in many types of cancer when compared to normal tissue and during tumor progression, it is associated with poor prognosis [23, 27]. [score:5]
It is still unknown if quercetin may also lead to Notch downregulation in PDA and if it is mediated by let-7 signaling. [score:4]
In the present study, we demonstrate by miR profiling that members of the let-7 family are in the top upregulated miRs after quercetin treatment of PDA cells. [score:4]
Let-7 miRs have also been identified to regulate Notch signaling pathways [8], known to regulate many cellular processes, including cell proliferation, apoptosis, migration, invasion, angiogenesis and normal development [9]. [score:4]
The miR-let-7 (from “lethal”) is one of the first identified miRs [7] and the expression levels of let-7 members are significantly low in human cancers. [score:3]
Inhibition of tumor growth in human non-small cell lung cancer xenografts and the KRAS-G12D transgenic mouse mo del have resulted from therapeutic delivery of let-7 in either the form of a let-7 mimic or a virus [34]. [score:3]
Let-7 is a tumor suppressor miR and one of the earliest identified miRs per se. [score:3]
Among the top 24 differentially regulated candidates were several miRs, which were known to be deregulated in pancreatic cancer, among them the miR-29 and let-7 families (Figure 1A). [score:3]
miR-34 is the first miR replacement therapy in clinical trials by the company Mirna Therapeutics, with let-7 in the pipeline [35]. [score:1]
[1 to 20 of 11 sentences]
7
[+] score: 39
Our study, however, revealed a novel role and mechanism of AGO2 as an enhancer of myeloma angiogenesis through miRNA dysregulation, including the upregulation of pro-angiogenic miRNAs such as the let-7 family members and the miR-17/92 cluster and downregulation of the anti-angiogenic miRNA miR-145. [score:8]
In ECs, the downregulation of both enzymes decreased the capillary-sprouting and tubule-forming activities induced by regulatory miRNAs, including the let-7 family members and miR-27b [17]. [score:5]
let-7 family member miRNAs have been shown to be pro-angiogenic and to promote tumour angiogenesis by inhibiting the anti-angiogenic factors thrombospondin-1 (TSP-1) and tissue inhibitor of metalloproteinase-1 (TIMP-1) [16, 17]. [score:5]
However, the targets of the other let-7 family members are unclear. [score:3]
The pro-angiogenic miRNAs of the let-7 family and the miR-17/92 cluster, along with the anti-angiogenic miRNA miR-145, play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
The pro-angiogenic let-7 family miRNAs, the miR-17/92 cluster and the anti-angiogenic miRNA miR-145 play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
Most let-7 family members and 2 miR-17/92 cluster members (miR-17a and miR-92-1), all known pro-angiogenic miRNAs, were positively regulated by AGO2 whereas anti-angiogenic miRNAs such as miR-145 and miR-361 were negatively regulated by AGO2. [score:3]
Otsuka et al. [16] reported that TIMP-1 was a target of let-7b. [score:3]
In particular, many of these commonly dysregulated miRNAs are well-known angiogenic miRNAs, including the let-7 family members (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7f-2, let-7 g and let-7i), 2 miR-17/92 cluster members (miR-17a and miR-92-1), miR-145 and miR-361. [score:2]
Of interest, the miRNAs regulated positively by AGO2 included most let-7 family members (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7f-2, let-7 g and let-7i) and 2 miR-17/92 cluster members (miR-17a and miR-92-1), which are known pro-angiogenic miRNAs. [score:2]
Previous studies have identified the miR-17/92 cluster, let-7 family and miR-145 as the modulators of angiogenesis [41]. [score:1]
let-7 family members are known as pro-angiogenic miRNAs. [score:1]
[1 to 20 of 12 sentences]
8
[+] score: 38
Our results show that miRNAs display a wide variety of expression profiles over the whole life of the silkworm, including continuous expression from embryo to adult (miR-184), up-regulation over the entire life cycle (let-7 and miR-100), down-regulation over the entire life cycle (miR-124), expression associated with embryogenesis (miR-29 and miR-92), up-regulation from early 3 [rd ]instar to pupa (miR-275), and complementary pulses in expression between miR-34b and miR-275. [score:18]
miR-100 and let-7 were up-regulated from 1 [st ]instar to 3 [rd ]molt, maintained over the 4 [th ]and 5 [th ]larval stages (Additional file 7), and highly expressed from early to late 4 [th ]instar larvae and fifth-instar day 2 and day 7 larvae (Figure 3C). [score:6]
Simultaneous expression of miR-125 and let-7 during Drosophila development is synchronized with the high- titer ecdysone pulses that initiate metamorphosis [62]. [score:4]
In contrast, both microarray and analyses confirmed that let-7 and miR-100 were coordinately up-regulated, gradually accumulating from late 1 [st ]molt until the 3 [rd ]molt stage (Figure 1A, C, Additional file 4). [score:4]
In contrast, miR-100 and let-7 were initially expressed in late 2 [nd ]instar larvae, and accumulated to high levels in late 3 [rd ]molt larvae, with obvious fluctuations during the early larval stages. [score:3]
Therefore, some miRNAs were not probed in this microarray (such as let-7b). [score:1]
Small and large miRNA transcripts were detected in pre-laid eggs and embryos, and were identified as miR-8, miR-252 and let-7 (indicated with a red arrow in Figure 2B). [score:1]
A number of miRNAs were also confirmed in females by (let-7a, let-7b, miR-8, and miR-2a) (Figure 5B). [score:1]
[1 to 20 of 8 sentences]
9
[+] score: 37
Relation of S. japonicum miRNA expression to life cycle stageUsing the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:5]
Analysis of sja-let-7, sja-miR-71 and sja-bantam expression by stem-loop RT-real time PCR revealed highly stage-specific expression patterns. [score:5]
Sja-let-7 expression was lowest in the miracidium stage, increased during the sporocyst stage, peaked during the cercaria stage, and then proceeded to decrease for the remainder of the organism's lifespan within the mammalian host. [score:3]
Expression of sja-let-7, sja-miR-71 and sja-bantam were analyzed in six stages of the life cycle, i. e. egg, miracidium, sporocyst, cercaria, schistosomulum, and adult worm, by a modified stem-loop reverse transcribed polymerase chain reaction (RT-PCR) method developed in our laboratory. [score:3]
The let-7 miRNA is active during the last larval stage in C. elegans, promoting the transformation from larva to adult, and is also highly expressed in the late third instar larval stage of D. melanogaster when a pulse of the ecdysone triggers puparium formation and onset of metamorphosis [26]. [score:3]
The expression pattern during the life cycle of S. japonicum indicates that sja-let-7 might take part in the transformation from miracidium to sporocyst in the snail intermediate host. [score:3]
Using the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:3]
The role of let-7 during metamorphosis in Drosophila and in C. elegans development is well documented for C. elegans and D. melanogaster [4]. [score:2]
miRNA egg miracidium sporocyst cercaria schistosomulum male adult worm female adult worm sja-let-7 1.15±0.96 0.02±0.02 0.24±0.22 5.92±4.02 0.60±0.41 0.75±0.35 0.59±0.13 sja-mir-71 8.68±5.06 3.21±2.17 4.57±0.79 1257.92±565.47 0.91±0.34 1.93±1.41 1.65±0.36 sja-bantam 4.50±2.67 1.69±0. [score:1]
5, 6, 7 and 8 were the amplification plot of sja-let-7, sja-mir-71, alpha tubulin and sja-bantam, respectively, using the no-RT control. [score:1]
In this study, we firstly identified five authentic miRNAs in S. japonicum by constructing and screening parasite cDNA library of size-fractionated RNAs: sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1. [score:1]
miRNA Sequence Size (nt) S. japonicum contig (LSBI, Shanghai) a S. mansoni shortgun reads (Sanger) b Clones c Δ G° [folding] (kcal/mol e) sja-let-7 GGAGGUAGUUCGUUGUGUGGU 21 CNUS0000067197: 5856–5876 shisto12670f07: 651–671 5 −30.8 sja-miR-71 UGAAAGACGAUGGUAGUGAGA 21CNUS0000007682(-) d: 3100–3120 shisto8708d10: 353–372 1 −34.5 sja-bantam UGAGAUCGCGAUUAAAGCUGGU 22 CNUS0000021739: 2223–2244shisto5226g02(-) d: 325–346 6 −22.9 sja-miR-125 UCCCUGAGACCCUUUGAUUGUC 22 CNUS0000024724:7691–7712 Smp_contig001766:3162–3183 2 −25.6 sja-miR-new1 UCCCUGAGACUGAUAAUUGCUC 22CCON0000000380 (-) d:353325–353346:15–36 shisto8125f02.p1k 4 −29.2 alocation of the miRNA sequence within the published chromosomal sequence of S. japonicum. [score:1]
Hence, herein we have tentatively designated the five novel miRNAs from S. japonicum as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Figure S8 The amplification plot of sja-let-7, sja-mir-71, sja-bantam and alpha tubulin. [score:1]
Alignments of the miRNAs with corresponding family members indicated that four of them belong to a metazoan miRNA family: let-7, miR-71, bantam and miR-125. [score:1]
Membranes were incubated with five different biotin-labeled probes (1: sja-let-7, 2: sja-miR-71, 3: sja-bantam, 4: sja-miR-125 and 5: sja-miR-new1). [score:1]
The novel miRNAs were designated as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Alignments with known miRNA sequences indicated that four of the five novel S. japonicum miRNAs belong to four different metazoan miRNA families, i. e. let-7, miR-71, bantam, and miR-125 (Figure 3, S3 and S4). [score:1]
[1 to 20 of 18 sentences]
10
[+] score: 35
In fact, lin-4 and let-7 family miRNAs are originally discovered as regulators of developmental timing in C. elegans [17, 18], which precisely control the transition of four larval stages by down -regulating particular targets [19]. [score:6]
Three members, let-7a, let-7b and let-7g expression levels increased, conversely, the other five members, let-7c, let-7f, let-7i, let-7j and let-7k expression levels decreased from BO to AO. [score:5]
Very recently, Alvarellos et al (2013) [22] report that the developmental changes of Lin28/ let-7 expression in hypothalamus may lead to puberty onset of rats. [score:4]
LIN28A and LIN28B are the homologs of heterochronic gene LIN28 in Caenorhabditis elegans, which encode RNA -binding proteins that inhibit the maturation of the let-7 family microRNAs (miRNAs) [14]. [score:3]
The increased expression trends for let-7a and let-7b have also been observed in hypothalamus of rat during puberty onset [22] and in whole brains of aging mice [38]. [score:3]
Conversely, let-7a, let-7b, miR-132 and miR-145 show opposite expression profiles. [score:3]
However, let-7a, let-7b and let-7g expression levels are showed to decrease in the hypothalamus of 1-day-old and 36-week-old chicken [33]. [score:3]
Except for the let-7 family, totally 15 miRNAs were found to have more than four times expression changes (|log2fold-change| > 2.0) between BO and AO. [score:3]
The results suggest that multiple miRNAs, not just restricted to the sole let-7 family, may be involved in timing the rapid development of chicken gonads. [score:2]
It revealed the diverse functions of the let-7 family members. [score:1]
As expected, the let-7 family was contained in the list. [score:1]
Changes in the c-Myc/ Lin28b/let-7 pathway are also detected in mo dels of delayed puberty by manipulation. [score:1]
[1 to 20 of 12 sentences]
11
[+] score: 34
It has also been reported that miR-30c, let-7a, let-7b and let-7c were up-regulated, while miR-30d, miR-29a and miR-26a were down-regulated in rat granulosa cells treated with FSH for 12 h, which suggests that these miRNAs participate in FSH -mediated progesterone biosynthesis of granulosa cells [45]. [score:7]
In this study, gga-let-7b is up-regulated while gga-let-7 g, gga-miR-17-3p gga-miR-30d, gga-miR-29a, gga-miR-26a and gga-miR-181a are all down-regulated in the mature ovary compared with the immature ovary. [score:6]
A recent study showed that the activated estrogen receptor can suppress the expression of BAX by up -regulating a group of miRNAs including hsa-let-7 family members in endometrial adenocarcinoma and precancerous lesions [47]. [score:6]
The let-7 miRNA family was also expressed abundantly in ovary and oocyte of bovines [28, 29, 38, 39], as well as in murine ovaries and testis [40]. [score:3]
In addition, we found that two members of the let-7 miRNA family, gga-let-7b and gga-let-7 g, exhibited significantly differential expression, although the fold-changes were lower at 1.292- and 1.366-fold, respectively. [score:3]
The following 15 miRNAs were dominantly expressed in the two libraries: gga-miR-10a, gga-miR-146c, gga-miR-101, gga-miR-21, gga-let-7a, gga-let-7b, gga-let-7c, gga-let-7j, gga-let-7f, gga-let-7 k, gga-miR-30a-5p, gga-miR-30e, gga-miR-148a, gga-miR-100 and gga-miR-126. [score:3]
In the sexually mature chicken ovary library, gga-miR-10a and gga-miR-21 were the two most frequently sequenced miRNAs, and the let-7 miRNA family was another abundant cluster with let-7a being the most abundantly expressed miRNA. [score:3]
For example, in the immature ovary, gga-let-7 family abundance varied from 855 reads (gga-let-7d) to 415,122 reads (gga-let-7a). [score:1]
Another study showed that a lack of miR17-5p and let-7b resulted in corpus luteum insufficiency and infertility in mice and that exogenous administration of the two miRNAs could prevent this phenotype [46]. [score:1]
The three most abundant miRNAs in the chicken ovary are gga-miR-10a, gga-let-7 and gga-miR-21. [score:1]
[1 to 20 of 10 sentences]
12
[+] score: 33
At the same time as the miR-302 family and miR-222 are down-regulated, eleven miRNAs related to the let-7 family are up-regulated, as well as 2 additional miRNAs associated with cellular differentiation (Table S7) [54]. [score:7]
Duck NC cells at HH25 have down-regulated the miR-302 family and up-regulated some of the miRNAs associated with cellular differentiation (i. e. the let-7 family), though not as many as chicken NC (Table S7). [score:7]
Taken together, these miRNA changes, including differential expression of let-7, miR-302, and miR-30 families (Table S7), indicate that the HH20 to HH25 developmental window may be a critical transition phase in which multipotent NC cells begin to differentiate to form the various tissues of the face. [score:4]
These include miR-30c-2*, miR-129-5p which targets the stem cell regulator SOX4 [55], [56], the differentiation-promoting miR-137 [57], and the let-7-related miR-100* and miR-125b-2* [58]. [score:4]
In addition, given that a number of miRNAs related to let-7 and cellular differentiation are only up-regulated in the chicken and quail at HH25 (Table S7), the timing of this transition may be slightly delayed in the morphologically different duck, perhaps allowing a more prolonged period of proliferation. [score:4]
In all, 9 of 10 detectable members of the let-7 family are up-regulated in chicken and quail NC by HH25 (Table S7). [score:4]
These miRNAs belong to the 19 member let-7 family of miRNAs, the expression of which has been associated with cellular differentiation [54]. [score:3]
[1 to 20 of 7 sentences]
13
[+] score: 17
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
Similar miRNA profiles were observed in 18SSI and 18DSI, with the presence of identically expressed high-abundance miRNA, such as miRNA-1, miRNA-71b-5p and let-7. By contrast, in 23DSI and 23SSI, most of these high-abundance miRNAs were down-regulated. [score:6]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
For example, their levels of miR-1c, miR-1a, miR-1, miRNA-71b-5p, and let-7 were far lower than those in 18 DSI or 18SSI. [score:1]
We found the level of high-abundance miRNAs such as miR-1, miR-1a, miR-1c, miR-71b-5p, and let-7 to be higher in 18DSI and 18SSI than in 23DSI and 23SSI. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 17
A total of 42 TF–miRNA–mRNA interactions involving 1 TF (CTCF), 3 differentially expressed miRNAs (gga-let-7 g, gga-miR-196-2, and gga-miR-1635) regulated by CTCF and 42 differentially expressed mRNAs (also predicted miRNA targets) are summarised for the IBDV-stimulated group. [score:8]
Of these miRNAs, gga-let-7 g, gga-miR-196-2, gga-miR-1635, gga-miR-1603 and gga-miR-21 were significantly upregulated in IBDV-infected DCs. [score:4]
Gga-let-7 regulates TGFBR1 and LIN28B during the differentiation process in early chick development [31]. [score:3]
Our study recognised three TF–miRNA networks in IBDV-stimulated DCs (CTCF-Let-7 g, CTCF-miR196-2, and CTCF-miR1635). [score:1]
Three TF–miRNA networks were also identified in IBDV-stimulated DCs (CTCF-Let-7 g, CTCF-miR196-2 and CTCF-miR1635). [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 13
For instance, few proteins (IRAK1, IRAK2, and TRAF6) within TLR signaling have been confirmed as direct targets of miR-146 (O'Neill et al., 2011); signal molecules MyD88, TAB2, SHIP1, and SOCS1 were targets of miR-155 (Eulalio et al., 2012); and cytokines IL-6 and IL-10 are targeted by Let-7 (Stae del and Darfeuille, 2013). [score:8]
Previous studies have shown that miRNAs, such as miR-146a, miR-155, and Let-7 and their targets are involved in the regulation of immune response to Salmonella or lipopolysaccharide infection in mice (O'Neill et al., 2011; Schulte et al., 2011; Eulalio et al., 2012) and swine (Bao et al., 2014, 2015; Yao et al., 2016a, b). [score:4]
Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 12
The other abundantly expressed miRNAs family in our libraries was gga-let-7, which also was reported to have abundant expression in chicken skeletal muscle [40]. [score:5]
The family of let-7 miRNAs has been shown to play vital roles in mediating cell proliferation and differentiation, in particular, gga-let-7b has demonstrated a role in growth regulation through targeting GHR [26]. [score:4]
The let-7 family was also expressed abundantly in the breast muscle libraries, five of them (gga-let-7a, gga-let-7c, gga-let-7f, gga-let-7j and gga-let-7k) are in the list of the top 20 abundant miRNAs. [score:3]
[1 to 20 of 3 sentences]
17
[+] score: 12
In zebrafish, upon retinal injury, Müller glia cells express the proneural gene ascl1a along with lin-28, generating a regulatory loop in which ascl1a regulates lin-28, which in turn negatively regulates the miRNA Let-7[29]. [score:6]
During in vitro differentiation of mouse embryonic carcinoma cells to neural and glial fates, Lin-28 can alter the cell fate independently of let-7; in addition, overexpression of Lin-28 increases neurogenesis in the same cell types [33]. [score:3]
Lin-28 is an important regulator of let-7 miRNAs, and it has a functional role in organismal growth and metabolism, tissue development, somatic reprogramming and cancer (reviewed in [32]). [score:3]
[1 to 20 of 3 sentences]
18
[+] score: 11
One study revealed that the let-7 family of miRNA is downregulated in the regenerating newt auditory epithelium [32]. [score:4]
One study revealed that the let-7 family of miRNA are downregulated in the newt inner ear after hair cell injury [32]. [score:4]
An interesting translational correlate to this finding is that let-7 reduces tumor growth in a rodent mo del of lung cancer, providing additional evidence for the antiproliferative effects of this particular family of miRNA [93]. [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 9
For example, the three members of the let-7 family (let-7a, let-7f, let-7k) are broadly expressed across tissues [36] and tissue enrichment has been found for miR-499-5p and −3p in heart [37], miR-122-5p in liver [38], miR-202-5p in testis [39] and gga-miR-107-3p in brain tissues [40] (Table 2). [score:3]
Given that in mice the overexpression of the let-7 family leads to decreased fat mass and body weight [50], our data suggest a fundamental role of the let-7 family in response to intense selection for metabolic traits in these lines. [score:3]
Together with other members of the let-7 family, miR-let-7f regulates the glucose metabolism in multiple organs [50] and has an important role in the control of fasting glucose concentration [51]. [score:2]
It is remarkable that the three other mature miRNAs encoded by the let-7 family (gga-miR-let-7a-5p and-3p, and gga-miR-let-7k-5p) were found to be more abundant in the R+ than in the R− line (Figure 4, Table S1). [score:1]
[1 to 20 of 4 sentences]
20
[+] score: 9
Similarly, some other highly expressed differential miRNAs (FDR < 0.05), such as miR-107-3p, let-7b, and miR-181b, have all been proved to take part in the regulation of postnatal liver development or metergasis process 22, 24, 25. [score:5]
Moreover, we also found that miRNA-30 family and let-7 family were significantly differentially expressed between the postnatal and matured livers and were abundant in the liver, whose important roles in the liver development have been proved 14, 22. [score:4]
[1 to 20 of 2 sentences]
21
[+] score: 8
During the same developmental stage, miR-1623, miR-181b, let-7b, and miR-128 were differentially expressed in the skeletal muscle of dwarf and normal chickens [10]. [score:4]
Lin S Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickensBMC Genom. [score:3]
Since the first microRNA (miRNA) Lin-4 was discovered in nematode in 1993 [1], and the function of miRNA let-7 was subsequently demonstrated [2], miRNAs began to attract the attention of researchers and subsequently they have become an intense and focused area of biological research. [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 8
Increased expression of Wnt genes and let-7 miRNAs in the Harderian gland may increase the efficiency of this lymphoid tissue, by serving as a home to progenitor or naïve lymphocytes that can quickly be differentiated or activated in response to a stimulus. [score:3]
Post-transcriptional regulation of the let-7 microRNA during neural cell specification. [score:2]
The Harderian gland may utilize Wnt genes and let-7 miRNAs to control or stall cell differentiation. [score:1]
Previously, increased levels of let-7 pri-miRNA were found in undifferentiated embryonic stem cells (Wulczyn et al., 2007). [score:1]
The let-7 family of microRNAs. [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 7
In mammals, a number of miRNAs have been demonstrated to target genes involved in adipogenesis and lipid metabolism, such as the regulation on the proliferation of adipose tissue-derived mesenchymal stem cells by miR-21 and miR-196a [4– 6]; the enhancement of adipogenesis by miR-103, miR-224 and the miR-17–92 cluster [7– 9]; the impairment of adipogenesis by the let-7 family, miR-448, miR-15a and miR-27 [10– 13]; the regulation of adipocyte lipid metabolism by miR-27a and miR-143 [13– 15]; and the important role of miR-33 on the repression of sterol transporters reported in numerous studies [16– 24]. [score:5]
The top 10 abundant miRNAs included the let-7 miRNA family (let-7a, j, b, f, c, and k), gga-miR-148a, gga-miR-146c, gga-miR-10a, and gga-miR-21. [score:1]
The let-7 miRNA family was the most abundant, representing 83.3% and 79.46% of the total reads in lean and fat broilers, respectively. [score:1]
[1 to 20 of 3 sentences]
24
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
a induces neuronal lineage commitment of cultured mouse NSCs by targeting lin-28 which inhibits pre-let-7 processing by Dicer in ESCs and thus, contribute to the maintenance of the NSCs self-renewal capacity (Rybak et al., 2008). [score:5]
A feedback loop comprising lin-28 and controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
let-7. miR-124. [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
In addition the miRNAs clusters that were significantly down-regulated miR-15/16 and let-7 are typically down-regulated in stem cells and cancer [62- 64]. [score:7]
[1 to 20 of 1 sentences]
26
[+] score: 7
Mice fed a HFD and overexpression of let-7 had impaired glucose tolerance and IR, despite having normal insulin production and secretion levels [254]. [score:3]
The let-7 family of miRNAs also participates in the regulation of IR. [score:2]
A nutritional intervention study found that in healthy young women, reducing the dietary glycemic load increased plasma levels of let-7b by up to eight times [274]. [score:1]
Moreover, the administration of anti-miRNA let-7 partially diminished the effects of HFD on IR in experimental studies on mice and humans [255]. [score:1]
[1 to 20 of 4 sentences]
27
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Interestingly, Xue et al. (2008) showed that three of the miRNAs that we find in serum (sja-bantam, sja-miR-71 and sja-let-7) are expressed during all the stages of parasite development but are enriched in the cercariae, suggesting that they may be important during the initial stages of schistosome infection [65]. [score:4]
The other 2 miRNAs, sma-miR-10-5p and sma-let-7-3p, were excluded from analysis because they are highly similar to homologous mouse miRNAs that are present at >100 fold higher read frequencies (Table S3). [score:1]
22875816:+ 3sma-let-7-3p 3 CAUACAACCGACUGGCUUUCC S_mansoni. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 6
We used Northern blots to independently demonstrate the expression of four (let-7b, miR-1b, let-7s, and miR-750) of these newly identified S. japonicum miRNAs (Fig 1B and S3 Table). [score:3]
Name SequencesReads * Hairpin locus sja-let-7b AGAGGUAGUGAUUCAUAUGACU 655,165 SJC_S000353: 80195–80367 sja-let-7s GAGGUAGUUAGAUGUACGACU 111,993 SJC_S000383:436660–436832 sja-miR-750 CCAGAUCUGUCGCUUCCAACU 281,357 SJC_S000460:180604–180776sja-miR-1175 # UGAGAUUCAAUUACUUCAACUG 20,657 SJC_S000460:180879–181001 sja-miR-1989 UCAGCUGUGUUCAUGUCUUCGA 2,812 SJC_S000128:160744–160623sja-miR-new1 # GAGAGAGCACUUUUAUGACGGA 1,192 SJC_S004484:20079–20188 sja-miR-new2 AGCUAAAUAGGUUAGUUUGACUGUC 15,436 SJC_S016196:787–876sja-lin-4 # UCCCUGAGACCUUAGAGUUGU 23,558 N/Asja-miR-1b # UGGAAUGUUGUGAAGUAUGUGC 1,412,190 N/A sja-mir-277b AAAAUGCAUCAUCUACCCUAGA 207,027 N/A * The number is the sum of miRNA reads in all of the 8 libraries. [score:1]
Of these, 10 miRNAs were new to S. japonicum (lin-4, miR-1b, let-7b, let-7s, miR-277b, miR-750, miR-1175, miR-1989, miR-new1 and miR-new2) and 6 are new to schistosomes (let-7b, let-7s, miR-750, miR-1989, miR-new2, miR-277b) (Table 1). [score:1]
Among the 10 novel miRNAs, three of the miRNAs (let-7b, let-7s, and miR-750) have long hairpin structures (>200 nt), suggesting that schistosomes miRNA biogenesis has adapted to process these long hairpin precursor miRNAs. [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 6
Among other miRNAs, we found that the let-7 miRNA family was another abundant cluster with let-7f-5p being the most abundantly expressed miRNA. [score:3]
The let-7 miRNA family is abundantly expressed in bovines [69– 71] and in murine ovaries and testis [72]. [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 5
Another recent study has shown that the two RNAse III endonucleases dicer and drosha inhibit the expression of thrombospondin-1 by controlling the levels of let-7 and miR-27b, thus modulating angiogenesis [23]. [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence. [score:3]
For example, the members of the let-7 microRNA family [10] and miR-105 can regulate mRNA level of TLR4 and TLR2 respectively [11]. [score:2]
[1 to 20 of 2 sentences]
32
[+] score: 5
Moreover, lncRNA H19, which is highly expressed in the developing embryo and in adult muscle, functions as a molecular sponge for the let-7 family of miRNAs, and thereby regulates muscle differentiation (Kallen et al., 2013). [score:4]
The imprinted H19 lncRNA antagonizes let-7 microRNAs. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 4
Other miRNAs from this paper: hsa-let-7b
In addition to the exon, the 5′UTR of GHR-AS was complemented with the 3′UTR of GHR-S. Our group has proved that chicken GHR-S 3′UTR was the target of Let-7b [33]. [score:2]
Consequently, the 3′UTR of GHR-S may be the competitive binding site for GHR-AS and Let-7b if the double strand GHR-S/AS RNAs can be formed in 3′UTR of GHR-S. Further, many long noncoding RNAs have been confirmed regulating gene mRNA stability via competing for binding to miRNA [34]. [score:2]
[1 to 20 of 2 sentences]
34
[+] score: 4
Let-7 was down-regulated to induce the release of cytokine IL6 (interleukin 6) and IL10 to participate in the regulation of immune response to Salmonella infection in macrophages [14]. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 4
These genes also localize in 7 genomic clusters, together with mir-100 and mir-125 miRNA families (see previous study on the evolution of the let-7 miRNA cluster in [73]). [score:1]
Evolution of the let-7 microRNA Family. [score:1]
Another obvious loss in birds is cluster F, containing two let-7 microRNA paralogs. [score:1]
In addition, the microRNA family let-7 is the most diverse microRNA family with 14 paralogs in human. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 4
The miRNA let-7c, a member of the let-7 miRNA family, was downregulated in the liver upon hatching (Fig. 3e). [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
Additionally, an increasing number of reports indicate that microRNAs (miRNAs), such as let-7b, miR-1, miR-133 and miR-206 [13, 14], function in animal growth by regulating their target genes. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
In translational reporter assays, the addition of numb 3´-UTR made the translation of the luciferase reporter specifically sensitive to the presence of ban but not let-7 miRNA (Fig 4A). [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 3
The first two miRNAs, lin-4 and let-7, were discovered as important post-transcriptional regulators for the development of Caenorhabditis elegans in the early larval stage [11]. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
Some host miRNAs, including gga-miR-let-7, gga-miR-199a-1, gga-miR-26a, gga-miR-181a, and gga-miR-16, were expressed at lower levels in MDV -induced tumors than non-infected spleens, indicating their potential importance in tumorigenesis. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
Lin S. Li H. Mu H. Luo W. Li Y., 2012  Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
A number of microRNAs (e. g., let-7, miR-199a-1, 26a) are expressed at lower levels in MDV -induced tumors, highlighting the potential importance of this class of molecules in tumorigenesis. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
To date, several miRNAs, including gga-miR-221, gga-miR-222, gga-miR-23b, gga-miR-375, gga-miR-125b, gga-miR-1650, gga-miR-193a, gga-miR-193b, gga-let-7b, gga-let-7i, gga-miR-458, gga-miR-1456, gga-miR-1704, gga-miR-1777, gga-miR-1790, and gga-miR-2127, have been reported to be associated with tumorigenesis and the aberrant expression of the retrovirus, ALV-J (Li et al., 2012; Wang et al., 2013a, b; Li H. et al., 2014; Dai et al., 2015; Li et al., 2015). [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 2
Six of these miRNAs (miR-31, miR-10a, miR-10b, miR-16C and two let-7 members) have been implicated in skeletal muscle regeneration or development [39- 42]. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 2
The discovery of the regulatory miRNA let-7 in C. elegans in 2000 [10], with homologs in other species including humans, caused researchers to reconsider the idea that miRNAs may have a more widespread function within cells. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
Since the discovery of the first two miRNA genes, lin-4 [1, 2] and let-7 [3, 4], much has been learned about the structure, biogenesis and function of miRNAs [5- 7]. [score:1]
Some, the let-7 family for example, maintain almost identical mature forms in evolution. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 1
Further, deep sequencing detected let-7, miR-21, and miR-30 in rainbow trout eggs, which indicated that these miRNAs may play roles in controlling egg quality [21]. [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
The imprinted H19 lncRNA antagonizes let-7 microRNAs. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
Seven conserved families all were DE with P ≤ 0.05, including let-7 (let-7a, -7b, -7c,-7f, -7g, -7i, -7j, and -7k), miR-130 (miR-130a, and -130b), miR-146 (miR-146a, -146b, and -146c), miR-15 (miR-15a, -15b, and -15c), miR-181 (miR-181a and -181b), miR-29 (miR-29a, -29b and -29c), and miR-30 (miR-30a, -30b, -30c, -30d, and -30e). [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
Edge R. E. Falls T. J. Brown C. W. Lichty B. D. Atkins H. Bell J. C. A let-7 microRNA-sensitive vesicular stomatitis virus demonstrates tumor-specific replicationMol. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
The other seven miRNAs (miR-460B-5P, miR-383-5p, miR-181b-5p, gga-let-7b, miR-301b-3p, miR-10a-3p and miR-217-5p) created the other half of the network, interacting with 13 other protein-coding genes that are related to the immune system, hemarthrosis, arteriosclerosis obliterans, apoptosis, survival caspase cascade and muscular dystrophy. [score:1]
[1 to 20 of 1 sentences]