sort by

25 publications mentioning ath-MIR395c

Open access articles that are associated with the species Arabidopsis thaliana and mention the gene name MIR395c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 71
Identification of miR395 target gene in tobaccoTo understand how the excess miR395 impacts tobacco sulfate homeostasis at the molecular level, we sought to identify putative new target genes of miR395 using two approaches 29. [score:5]
Sulfate regulates tobacco NtamiR395 and NtaSULTR2To confirm that NtaSULTR2 is the target of miR395 in tobacco, we investigated the expression level of both NtaSULTR2 and mature NtamiR395 under different sulfate concentrations. [score:4]
There are four mismatches and three mismatches between NtaSULTR2 target sequence and mature OsamiR395 and NtamiR395, separately (Fig. 7b), indicating that NtaSUTLR2 should be efficiently regulated by miR395 because of their near perfect complementary sequence. [score:4]
We speculate that the two sulfate transporter genes and miR395 may be differentially expressed in different leaf tissues and thus, OsaSULTR2;1 and OsaSULTR2 may not be subjected to miR395 regulation. [score:4]
Identification of miR395 target gene in tobacco. [score:3]
To understand how the excess miR395 impacts tobacco sulfate homeostasis at the molecular level, we sought to identify putative new target genes of miR395 using two approaches 29. [score:3]
Based on the results of real-time PCR and RML-RACE, we verified that NtaSULTR2 is the target gene of miR395 (Figs 8 and 9). [score:3]
To further confirm that NtaSULTR2 is the true target of miR395, we conducted RLM-RACE (T4 RNA Ligase Mediated Rapid Amplification of cDNA Ends) to verify that NtaSULTR2 transcripts are cleaved by miR395. [score:3]
By performing small molecule northern blotting, we observed high transcript level of miR395 in transgenic tobacco under normal condition, indicating that rice pri -OsamiR395h could be successfully expressed and processed into mature miR395h in tobacco (Fig. 4). [score:3]
MiR395 mediates the cleavage of NtaSULTR2 mRNATo further confirm that NtaSULTR2 is the true target of miR395, we conducted RLM-RACE (T4 RNA Ligase Mediated Rapid Amplification of cDNA Ends) to verify that NtaSULTR2 transcripts are cleaved by miR395. [score:3]
The RNA adapter has a length of 44 bp, and the reverse GSP is localized 545 bp downstream of the predicted miR395 target site in the NtaSULTR2 mRNA, so the product of the first round PCR should have a length of about 589 bp. [score:3]
We cloned the full-length cDNA sequence of NtaSULTR2 using RACE (Rapid Amplification of cDNA Ends) method, and identified the target site of miR395 that is located between 135 bp and 156 bp of its coding region. [score:3]
How to cite this article: Yuan, N. et al. Heterologous expression of a rice miR395 gene in Nicotiana tabacum impairs sulfate homeostasis. [score:3]
We used RNA from the miR395 -overexpressing transgenic tobacco plants to facilitate the detection of cleaved NtaSULTR2 mRNA. [score:3]
To confirm that NtaSULTR2 is the target of miR395 in tobacco, we investigated the expression level of both NtaSULTR2 and mature NtamiR395 under different sulfate concentrations. [score:3]
Previous studies on Arabidopsis miR395 have indicated its involvement in sulfate starvation response by repressing the expression of genes in sulfate transportation and assimilation pathways. [score:3]
NtaSULTR2 with a length of 1335 bp contains a sulfate transporter domain between 724 bp to 1332 bp, and a miR395 target site between 135 bp to 156 bp. [score:3]
Identification of a sulfate transporter gene, NtaSULTR2, the target of miR395 in tobacco. [score:3]
To reveal the molecular mechanism underlying miR395 -mediated plant sulfate metabolism, we studied genes impacted by excessive dose of miR395 in transgenic tobacco, and identified a novel sulfate transporter gene NtaSULTR2 belonging to the second group of sulfate transporter genes (Fig. 7). [score:1]
To investigate the expression levels of pri -OsamiR395h, mature miR395 and NtaSULTR2 in tobacco, tobacco seeds were surface sterilized and grown in MS medium under 16h light/8h dark at 22 °C 39. [score:1]
More specifically, Zhang et al. found that 9 miRNA families are highly conserved 33, 10 miRNA families are moderately conserved and 16 miRNA families including miR395 are lowly conserved across plant species. [score:1]
To prepare radiolabeled probe for detecting mature miR395, DNA oligonucleotide GAGTTCCCCCAAACACTTCAC was synthesized (http://www. [score:1]
Cloning and sequencing of the PCR product further confirmed the predicted miR395 cleavage site in the NtaSULTR2 mRNA. [score:1]
To verify miR395 cleavage site within NtaSULTR2, was conducted following a previously described method 45. [score:1]
At the same time, we also observed low level of endogenous mature miR395 in WT tobacco, confirming that tobacco mature miR395 is highly conserved with its rice homolog. [score:1]
This result indicated that the high-level of miR395 accumulation in transgenic plants impacts the uptake and transportation of sulfur and sulfate. [score:1]
MiR395 is highly conserved across species, which strongly suggests that its function in regulating plant response to nutrition, particularly sulfate supply could also be conserved during evolution. [score:1]
In a later work, miR395 family was identified in the common ancestor of all embryophytes 25. [score:1]
Confirmation of miR395 -mediated cleavage of NtSULTR2 mRNA. [score:1]
Red lines indicate miR395 cutting site. [score:1]
[1 to 20 of 30 sentences]
2
[+] score: 48
An induced expression of the miR395 targets APS1 and APS4, and the miR857 target laccase 7 (LAC7) was found in Cd-exposed leaves, but these altered target expressions were not in accordance with the expression profiles of the miRNAs. [score:13]
Similarly, the gene expression levels of the miR395 target SULTR2;1 and the miR398 targets CSD1 and CSD2 decreased in the leaves after 72 h Cd exposure (Table  2), while the expression of their regulating miRNAs increased (Table  1). [score:10]
Three miRNAs had an altered expression at the earliest time-point of 2 h: in roots and leaves an upregulation of pri-miR395c after Cu exposure and of pri-miR398a after Cd and Cu exposure was observed, while a downregulation of pri-miR826 in Cu- and Cd-exposed roots was noticed. [score:9]
2004.05.027 15200956 9. Kawashima CG, Yoshimoto N, Maruyama-Nakashita A, Tsuchiya YN, Saito K, Takahashi H, et al. Sulphur starvation induces the expression of microRNA-395 and one of its target genes but in different cell types. [score:5]
However, Cd exposure resulted in the leaves in induced expression levels of miR395, miR397 and miR398 and this led to reduced transcript levels of their targets SULTR2;1, LAC2, LAC4 and LAC17, and CSD1 and CSD2 (Tables  1 and 2). [score:5]
Also in the roots of 5 μM Cd-exposed plants the only transcript level induced after 24 h exposure was from sulphate transporter 2;1 (SULTR2;1), a target of miR395 (Table  2). [score:3]
Kawashima CG, Matthewman CA, Huang S, Lee B-R, Yoshimoto N, Koprivova A, et al. Interplay of SLIM1 and miR395 in the regulation of sulfate assimilation in Arabidopsis. [score:2]
MiR395, negatively regulating ATP sulfurylases and a sulphate transporter, was strongly induced upon sulphate starvation [8– 10]. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 46
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157d, ath-MIR158a, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR161, ath-MIR162a, ath-MIR162b, ath-MIR163, ath-MIR164a, ath-MIR164b, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR170, ath-MIR172a, ath-MIR172b, ath-MIR173, ath-MIR159b, ath-MIR319a, ath-MIR319b, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR172c, ath-MIR172d, ath-MIR391, ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR397a, ath-MIR397b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, ath-MIR400, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR158b, ath-MIR159c, ath-MIR319c, ath-MIR164c, ath-MIR167c, ath-MIR172e, ath-MIR447a, ath-MIR447b, ath-MIR447c, ath-MIR773a, ath-MIR775, ath-MIR822, ath-MIR823, ath-MIR826a, ath-MIR827, ath-MIR829, ath-MIR833a, ath-MIR837, ath-MIR841a, ath-MIR842, ath-MIR843, ath-MIR845a, ath-MIR848, ath-MIR852, ath-MIR824, ath-MIR854a, ath-MIR854b, ath-MIR854c, ath-MIR854d, ath-MIR857, ath-MIR864, ath-MIR2111a, ath-MIR2111b, ath-MIR773b, ath-MIR841b, ath-MIR854e, ath-MIR833b, ath-MIR156i, ath-MIR156j, ath-MIR826b
In contrast, fewer differentially expressed miRNAs were identified under –S conditions: miR164c and miR395 were upregulated specifically, and miR391 and miR845a were downregulated. [score:9]
Similarly, –S upregulated miR395, which was downregulated by –C, –N, and –P. [score:7]
Both downregulation of miR169 by –N and upregulation of miR395 by –S were consistent with previous reports, confirming the reliability of the sequencing data. [score:7]
Although the miR826 sequence was not found because of low expression abundance in –P, we found that –C -induced miR169b/c, –S -induced miR395, and –Cu -induced miRNAs (miR397, miR398, miR408, and miR857) were significantly suppressed in roots grown in –P conditions (Supplemental Table 5). [score:5]
In contrast to the miRNAs that were regulated similarly by –C, –N, and –S, miR169b/c, miR395, miR822, and miR837-3p were regulated differentially by –C, –N, and –S. [score:3]
miR395 plays key roles in modulating sulfate uptake and allocation by targeting genes encoding sulfate assimilation and transport proteins respectively 21. [score:3]
In addition, some miRNAs were positively correlated with their targets, such as miR395- APS3 in –S, miR397- LAC2 in –C, and miR160- ARF17 in –C and –S. [score:3]
Our previous studies confirmed that miR826 regulates the N starvation adaptation of Arabidopsis by reducing glucosinolate synthesis 26, and miR395 mediates S homeostasis by regulating sulfate assimilation and transport 21. [score:3]
miR395 was positively regulated by –S, but negatively by –C and –N. [score:2]
Under –S conditions, elevation of miR395 resulted in advantageous root growth. [score:1]
miR395 was induced sharply by –S. [score:1]
miR169b/c, miR826, and miR395 showed the largest changes in response to –C, –N, and –S, respectively. [score:1]
Although there have been no reports about –C-responsive miRNAs, previous studies on –N and –S-responsive miRNAs showed that miR169 and miR395 are negatively and positively responsive to –N and –S, respectively 21 25. [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 38
Other miRNAs from this paper: ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f
The repression of SULTR2;1 in shoots is consistent with the upregulation of miR395 under S deficiency, which targets to SULTR2;1 mRNA and suppresses its expression [8]. [score:10]
This is due to their cell-type-specific expressions in roots, in which miR395 only expresses in the phloem companion cells and is unable to target the SULTR2;1 mRNA in xylem parenchyma and pericycle cells [8]. [score:7]
miR395 targets to ATPS1, ATPS4 and the low-affinity sulphate transporter gene SULTR2;1 and regulates their expression [8, 9]. [score:6]
Such cell-type-specific induction by S-deficiency has been observed for miR395 and SULTR2;1. The induction of miR395 by S-deficiency is restricted to the phloem companion cells in roots, which fails to digest the miRNA target SULTR2;1 expressed in xylem parenchyma and pericycle cells leaving the SULTR2;1 mRNA intact [8]. [score:5]
However, both SULTR2;1 and miR395 are upregulated in roots under S deficiency. [score:4]
Another regulator involved in S starvation response is miR395. [score:2]
miR395 is strongly induced by S deficiency and regulates the translocation of sulphate from old to young leaves as well as from roots to shoots under sulphate limited conditions [10, 11]. [score:2]
The induction of miR395 by S deficiency is controlled by SLIM1 and thus SLIM1 and miR395 are two important components of the regulatory circuit controlling plant sulphate assimilation in S deficient conditions [8, 11]. [score:2]
[1 to 20 of 8 sentences]
5
[+] score: 31
For example, miR395 is induced by sulfate starvation and regulates sulfate accumulation and allocation by targeting APSs (ATP Sulfurylase) and SULTR2;1 (SULFATE TRANSPORTER 2;1), respectively [10]; miR399 is up-regulated by phosphate limitation and controls phosphate transport and redistribution by repressing PHO2 (PHOSPHATE 2) [11]. [score:7]
Under N-starvation conditions, miR399, miR395, miR850, miR857, miR863, and miR827 were significantly down-regulated, whereas miR160, miR826, miR839, and miR846 were dramatically up-regulated. [score:7]
In the present study, the abundance of miR395 decreased dramatically under N-starvation conditions, with moderate increases of its targets, APS1 and APS4 (Figure 3). [score:3]
Deep sequencing analyses also suggested that miR169, miR395, and miR398 were expressed at low levels under P -deficient conditions [12]. [score:3]
The over -expression of miR395 led to over-accumulation of sulfate in Arabidopsis leaves. [score:3]
For miR156, miR160, miR169, miR171, miR172, miR395, miR397, miR398, miR399, miR408, miR775, miR780.1, miR827, miR842, miR846, miR857, and miR2111, their targets have been predicted and most of them were validated previously (Table 2). [score:3]
miR395, a sulfate starvation-inducible miRNA, regulates sulfate accumulation and allocation in Arabidopsis leaves [10]. [score:2]
Recent sequence analysis of miRNAs from Brassica napus [31] revealed that miR395 and miR399 are abundant in the phloem under low-sulfate and low-phosphate conditions, respectively. [score:1]
In B. napus, miR395 is translocated through graft unions from scions to rootstocks under S-starvation conditions [33]. [score:1]
Therefore, N starvation can reduce the accumulation of sulfate in leaves by repressing miR395. [score:1]
[1 to 20 of 10 sentences]
6
[+] score: 24
In this context, it was recently shown that miR395, a microRNA up-regulated under sulfate deficiency and that targets SULTR2;1, was down-regulated under Pi deficiency, thus potentially contributing to SULTR2;1 overexpression under Pi deficiency [59]. [score:11]
For sulfate deficiency, this pattern could be explained by the action of miR395 on SULTR2;1 expression in shoots but not in roots because of the non-overlapping tissue-specific expression of miR395 and SULTR2;1 in roots [23]. [score:5]
However, the physiological impact of the down-regulation of miR395 on sulfate metabolism in Pi -deficient plants is not known. [score:4]
Sulfate limitation also induces the expression of microRNA miR395 in a SLIM1 -dependent manner [22, 23]. [score:3]
It is possible that SULTR2;1 mRNA abundance is actually more tightly controlled by a different signaling pathway, notably by the action of the transcription factor SLIM1 and miR395, in order to control sulfate transfer in shoots upon Pi starvation [21- 23]. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 19
Hsieh et al. (2009) reported that the increased accumulation of miR395, known to be up-regulated by SO [4] starvation, is suppressed in Pi -deficient plants. [score:6]
Sulphur starvation induces the expression of microRNA-395 and one of its target genes but in different cell types. [score:5]
Some key regulatory molecular mechanisms and components involved in the regulation of SO [4] transport have been discovered, among which a regulatory pathway requiring miRNAs, including miR395 (Kawashima et al., 2009). [score:4]
It can be explained by the increased level of miR395 under such conditions (Kawashima et al., 2009), leading to a strictly restricted expression of the SULTR2;1 gene in the xylem (Kawashima et al., 2009). [score:3]
miR395 acts downstream of the TF SULFUR LIMITATION 1 (SLIM1), also known as ETHYLENE- INSENSITIVE3- LIKE 3 (EIL3; Maruyama-Nakashita et al., 2006; Kawashima et al., 2009). [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 15
Other miRNAs from this paper: ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f
This translational mechanism specifically allows plastid-cytosol dual localization of ATPS2, a unique non-miR395 target among the ATPS gene family members. [score:5]
Sulphur starvation induces the expression of microRNA-395 and one of its target genes but in different cell types. [score:5]
Control of chloroplastic ATPS (ATPS1, –3, and –4) thus seems important for regulation of PAPS biosynthesis in response to sulfate supply, although the potential of the miR395 -mediated post-transcriptional regulation may be limited for fine-tuning the ATPS1, –3, and −4 transcript levels (Kawashima et al., 2011). [score:3]
Interplay of SLIM1 and miR395 in the regulation of sulfate assimilation in Arabidopsis. [score:2]
[1 to 20 of 4 sentences]
9
[+] score: 11
miRNA downregulation showed in this work also agrees with the general mo del, since three repressed families (miR535, miR395 and miR482) were predicted to target NB-LRR and LRR resistance-like genes in cassava. [score:6]
These repressed families included miR535, miR395 and miR482 which were predicted to target various candidate NB-LRR and LRR disease resistance proteins. [score:5]
[1 to 20 of 2 sentences]
10
[+] score: 10
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Other conserved miRNA targets includes F-box protein (miRNA393, miRNA394), ATP sulfurylase (miRNA395), CCHC type zinc finger protein (miRNA482), NAD(P) -binding protein (miRNA827), and Poly(ADP-ribose) polymerase (miRNA1432), all of them are known to play roles in the expression control of genes involved in regulation of metabolic processes. [score:6]
Four known miRNA families, miR395, miR482, miR2118 and miR2275 were not successfully detected in our datasets suggesting that miRNAs expression maybe developmental and/or tissue-specific. [score:4]
[1 to 20 of 2 sentences]
11
[+] score: 6
In three cases—miR402 targeting of the transcription factor DML3 (UniProt: O49498) (Fig 5A), miR398 regulation of free radical metabolism (Fig 5B), and miR395 regulation of sulfur metabolism (Fig 5C), there was no evidence of co-regulation by kinases. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 6
For example, miR395 was induced after virus infection in WT, the expression of its targets: adenosyl phosphatosulfate kinase (APS) 1, 2 and 4 and sulfate transporter 3;5 (SULTR3;5) were subsequently reduced. [score:5]
The abundance of miR160, miR168, miR170, miR393, miR395, miR408 and miR850 were specifically increased. [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 5
Interestingly, Mir395 is up-regulated in response to drought stress in rice (Zhou et al., 2010) and under high salinity conditions in maize (Zea mays L. ; Ding et al., 2009), suggesting it participates in abiotic stress responses, presumably by maintaining the flux of sulfur toward aerial parts. [score:3]
Interplay of SLIM1 and miR395 in the regulation of sulfate assimilation in Arabidopsis. [score:2]
[1 to 20 of 2 sentences]
14
[+] score: 5
For miRNAs that have been shown to target multiple gene families, such as miR395, two targets from both gene families were analyzed. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 4
For instance, in Arabidopsis thaliana and Brassica napus, miR395 is over-expressed under sulfate-starvation conditions [18, 19]. [score:3]
miR395 is involved in detoxification of cadmium in Brassica napus. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 4
However, in mutual exclusion modes of regulation such as miR395: SULTR2, both miRNA and target are transcriptionally induced upon sulfur starvation in roots [56, 57]. [score:4]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR408, ath-MIR156g, ath-MIR156h, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, ath-MIR848, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1527, gma-MIR1533, gma-MIR396c, pvu-MIR166a, pvu-MIR399a, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, ath-MIR5021, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR169w
ATP sulfyrylase responsible for sulphur (S) uptake and assimilation is the target for miR395 family in Arabidopsis [69], rice [70] and soybean [67]. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Experimental studies in Arabidopsis and other plants have shown that abiotic and biotic stresses induce differential expression of a set of miRNAs such as: miR156, miR159, miR165, miR167, miR168, miR169, miR319, miR393, miR395, miR396, miR398, miR399, and miR402 [7, 18- 23]. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
There were extremely low frequencies of miR395, miR399, miR2275, miRs12, and miRs19, possibly because these families are expressed in a tissue-specific manner. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 2
mir395 [91] APS and AST family members. [score:1]
mir395 [97] APS and AST family members. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 2
miR399 and miR395 have been identified as being involved in sulfate- and phosphate-starvation responses [16, 17]. [score:1]
miR395 and miR397 play roles in sulfate metabolism and copper homeostasis, respectively [43– 45]. [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 2
Other miRNAs from this paper: ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f
Interplay of SLIM1 and miR395 in the regulation of sulfate assimilation in Arabidopsis. [score:2]
[1 to 20 of 1 sentences]
23
[+] score: 1
For miRNAs that are induced by nutritional stresses, such as phosphate deficiency (miR399) copper deficiency (miR398), and sulfate deficiency (miR395), their abundance were low in all lines and were not significantly changed in our OE lines [22, 30- 32]. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Oryza and Populus, we find no new miSquare families, but three new members of known miRBase families (oza-MIR399, ptc-MIR166, and ptc-MIR395; see Table 2). [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
This was observed in a previous study on tandem duplicated paralogs of miR395 in rice and miR168 in Brassicaceae [34], [35]. [score:1]
[1 to 20 of 1 sentences]