sort by

25 publications mentioning ath-MIR171c

Open access articles that are associated with the species Arabidopsis thaliana and mention the gene name MIR171c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 152
Because up-regulation of LOMs (35S::LUC-rLOM1) and down-regulation of SPLs (35S::MIR156F) both reduced TCL1 and TRY expression and triggered ectopic trichomes, we wondered if miR171-LOMs induced trichome formation through affecting the miR156 -targeted SPLs. [score:11]
The miR156 -targeted SPLs up-regulate trichome negative factors TRY and TCL1 to repress trichome production on stem and inflorescence, whereas miR171 -targeted LOMs counteract the SPLs through protein-protein interaction. [score:8]
By dissecting molecular mechanisms that control Arabidopsis trichome distribution, we found that the miR171 -targeted LOMs directly interact with the miR156 -targeted SPL9 and SPL2, leading to inhibition of the SPL activities. [score:8]
The miR156 and its targets, such as SPL9, show reverse expression patterns [2]– [4], whereas miR171 and LOMs have a congruous temporal expression pattern (Figure S7). [score:7]
Taken together, these results demonstrate that the miR171 -targeted LOMs physically interact with the miR156 -targeted SPL9 and SPL2 and may result in attenuation of the SPL function such as regulating trichome patterning. [score:6]
Together, these data reveal a regulatory feedback loop between LOMs and MIR171 genes, particularly MIR171A (Figure 8), which explains the seemingly contradictory phenomenon that miR171 and its target LOMs show similar expression patterns and both are mounting to a high level in inflorescence (Figure S7). [score:6]
A recent report showed that overexpression of miR171 (Hvu-pri-miR171a) in barley up-regulated miR156 and repressed vegetative phase transitions [49], which is in contrast with the opposite effects of the two miRNAs in Arabidopsis described herein and reported by others [26], [29], [50]. [score:6]
By dissecting the regulatory network controlling trichome formation on stem, we show that a group of GRAS family members, LOST MERISTEMS 1 (LOM1), LOM2 and LOM3, targeted by timing miR171, function in modulating the SPL activity through direct protein-protein interaction. [score:5]
To investigate if MIR171 genes were directly regulated by their targets, we used an inducible system to test the activity of LOM1 in activating MIR171 expression. [score:5]
Although 35S::MIR171B repressed trichome formation on stem in wild-type plants, it did not change the ectopic trichome distribution induced by 35S::MIR156F (Figure 3A–3D), suggesting a requirement of miR156 -targeted SPLs in miR171 -mediated trichome suppression. [score:5]
This regulatory feedback loop ensures the homeostasis of miR171 and its targets. [score:4]
Based on the facts that miR156 and miR171 are conserved in plant kingdom and excessive miRNAs cause opposite phenotypes, the interaction between the two miRNA targets coordinate many developmental and morphogenesis events beyond trichome formation. [score:4]
LOMs regulate MIR171 expression. [score:4]
1004266.g006 Figure 6LOMs regulate MIR171 expression. [score:4]
Because both miR156 and miR171 are timing regulators, the interaction between their targets shed a new light on the endogenous network of plant aging. [score:4]
There are three LOM genes in Arabidopsis, LOM1/ 2/ 3 (also known as AtHAM1/2/3 [25] or SCL6-2/ 3/ 4 [26]), which are targets of miR171 [27], [28]. [score:3]
Overexpression of MIR171 resulted in dark-green and narrower leaves. [score:3]
1004266.g001 Figure 1(A) Trichome distribution on main stem of wild-type (Col-0) and MIR171OE (35S::MIR171A/ B/ C) plants; MIR171 overexpression decreased trichome density. [score:3]
Here, we report that miR171 -targeted LOMs functionally interfere with selected SPLs through protein-protein interaction. [score:3]
Figure S7 SPL9, LOMs and MIR171 show similar temporal expression pattern. [score:3]
In addition, miR171 overexpression resulted in phenotypic changes similar to those of lom1 lom2 lom3 triple mutant (termed lomt hereinafter) as reported [26]: the narrower rosette leaves and the higher chlorophyll content (Figure 1E–1I). [score:3]
1 was set to 1. (C) MIR171 expression in main stem and inflorescence. [score:3]
LOM2 and LOM3 expression was slightly reduced in 35S::LUC-rLOM1 plants (Figure 6E), possibly due to the elevated miR171 levels. [score:3]
Interestingly, the miR171 level was clearly increased in 35S::LUC-rLOM1 but decreased in lomt mutant plants (Figure 6A), and overexpression of LOM2 or LOM3 also promoted miR171 accumulation (Figure 6C). [score:3]
Remarkably, miR156 and miR171 function antagonistically in regulating many aspects of plant growth and development, including but far beyond the age -dependent trichome formation. [score:3]
Indeed, miR171 was over-accumulated (Figure 1C) and LOM expression declined drastically (Figure 1D). [score:3]
LOMs positively regulate MIR171, forming a feedback loop to maintain their homeostasis, which influences the SPL output. [score:2]
miR171-LOM regulates trichome distribution. [score:2]
Clearly, the three miR171-regulated LOMs have the ability to promote trichome initiation at flowering stage. [score:2]
Furthermore, in transient assays using N. benthamiana leaves, the level of luciferase activity controlled by the MIR171A promoter was elevated significantly when LOM1 was co-expressed, while the MIR171B and MIR171C promoters exhibited a weak or marginal response (Figure 7B). [score:2]
LOM1 weakly bound to promoters of MIR171B and MIR171C directly (Figure 7H and 7I). [score:2]
A mo del for miR171-LOM and miR156-SPL interaction in regulating trichome formation and other biological events. [score:2]
These data indicate that miR171-LOMs act upstream of TRY and TCL1 in promoting trichome formation. [score:1]
MiR171-LOMs regulate trichome initiation. [score:1]
MiR171 is not only regulated by endogenous cues, but also responds to environmental stress, such as cold, high salt and hydration [40]– [43]. [score:1]
However, the response of MIR171B and MIR171C promoters to LOM1 was negligible in N. benthamiana leaves (Figure 7E, 7F and Figure S6). [score:1]
Figure S6 Identification of promoter regions of MIR171 genes responsible for LOM1 induction. [score:1]
LOM1 (At2G45160), LOM2 (At3G60630), LOM3 (At4G00150), MIR171A (At3G51375), MIR171B (At1G11735), MIR171C (At1G62035), SPL9 (At2g42200), SPL2 (At5G43270), MIR156F (At5G26147), SOC1 (At2g45660), GL1 (At3G27920), GL3 (At5G41315), EGL3 (At1G63650), TCL1 (At2g30432), TRY (At5G53200), GIS (At3g58070), GIS2 (At5g06650 ), ZFP8 (At2g41940), β-TUBULIN-2 (At5g62690) and Ph-HAM (AY112704). [score:1]
Stem trichome repressors act at downstream of miR171-LOMs. [score:1]
1 was set to 1. (D) The mature miR171 level was increasing with age, and the miR156 showed an opposite accumulation pattern. [score:1]
Mining of genome data revealed that both miR156 and miR171 are highly conserved in land plants from moss (Physcomitrella patens) to flowering plants of both monocots and dicots [45], and in crop plants they control important agronomic traits [46], [47]. [score:1]
However, the miR171-LOM module is different from the miR156-SPL. [score:1]
The Agrobacterium strain containing the MIR171::LUC reporter combined with the effector strain containing the 35S::rLOM1 or the empty vector were infiltrated into N. benthamiana leaves. [score:1]
Briefly, the effector plasmid is 35S::rLOM1 or empty vector, and the reporter plasmid, pGreen-0800-LUC, harbors two luciferases: the firefly luciferase (LUC) controlled by the MIR171 promoter, and the Renilla (REN) luciferase controlled by the constitutive 35S promoter. [score:1]
LOMs induce miR171 accumulation. [score:1]
In the diploid cotton species of Gossypium raimondii there are 15 MIR171 and seven putative LOM genes, of which five LOMs contain the miR171 recognition sites (see [48] and Figure S9). [score:1]
LOM2 and LOM3 were slightly reduced in LUC-rLOM1OE plants probably due to elevated miR171 accumulation. [score:1]
The level of LOMs elevates with age, leading to progressively activation of MIR171 genes, which in turn keep the LOM transcripts under the fine control. [score:1]
To see if the reduction of trichomes was caused by decreased level of LOMs due to miR171 accumulation, we first checked the abundance of mature miR171 and the transcript levels of LOMs in these transgenic plants. [score:1]
To identify the LOM1 binding regions, we dissected the truncated promoters of the three MIR171 genes (Figure 7C). [score:1]
In Arabidopsis genome, there are four miR171 coding genes, MIR171A, B, C and MIR170. [score:1]
An obvious transcript increase of MIR171A and, to a less extent, of MIR171B was observed after 4 hours, whereas MIR171C was not induced during this period (Figure 7A). [score:1]
[1 to 20 of 52 sentences]
2
[+] score: 37
It is very likely that induction of miR171 results in decreased expression of its targets (SCL6-II, SCL6-III, and SCL6-IV) (Figure 5B), which then suppresses the elongation of primary roots during N starvation in Arabidopsis. [score:7]
Quantitative RT-PCR analyses showed that the expression of miR171c was clearly up-regulated in the root under N starvation (Figure 5B). [score:6]
Correspondingly, the three targets of miR171 were down-regulated significantly by N starvation. [score:6]
Differential expression was also observed among members of the miR167, miR171, miR172, and miR319 families (Table S2). [score:3]
From these results, a conclusion was drawn that in response to N deficiency, plants may enhance their root systems by inducing expression of miR160 and decreasing those of miR167 and miR171 (Figure 5C). [score:3]
For miR156, miR160, miR169, miR171, miR172, miR395, miR397, miR398, miR399, miR408, miR775, miR780.1, miR827, miR842, miR846, miR857, and miR2111, their targets have been predicted and most of them were validated previously (Table 2). [score:3]
Our results suggested that changes in the expression levels of miR160, miR167, and miR171 may be important for the enhancement of plant root system under nitrogen deficiency. [score:3]
miR160, miR167, and miR171 are involved in the signaling pathways triggering root system development. [score:2]
miR160, miR167, and miR171 are involved in development of root system under N starvation coditions. [score:2]
Recent research showed that miR171 decreased primary root elongation by cleaving three SCL6 genes [45], [46]. [score:1]
Under N -deficient conditions, the abundance of miR171 was three-fold higher than that under N-sufficient conditions. [score:1]
[1 to 20 of 11 sentences]
3
[+] score: 18
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
Pde-MIR171 family had two conserved targets, while pde-MIR162 and pde-MIR166 families each had only one conserved target. [score:5]
For example, HD-ZIP and GRAS family transcription factors, which are important to root and nodule development in Medicago truncatula and nutrient homeostasis in maize, were predicted to be targets of pde-MIR166 and pde-MIR171, respectively [50, 51]. [score:4]
It includes DCL1 targeted by pde-miR162, GRAS family transcription factor cleaved by pde-miR171, Class III HD-Zip protein HDZ33 regulated by pde-miR166 and CC-NBS-LRR resistance-like protein sliced by pde-miR2118. [score:4]
Our results demonstrated that 9 of them had higher expression levels in needles than in stems except pde-miR171. [score:3]
For example, the pde-MIR482 family has 4 members, whereas only one exists in 19 miRNA families (pde-MIR159, pde-MIR162, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR783, pde-MIR946, pde-MIR947, pde-MIR950, pde-MIR951, pde-MIR1310, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR1448, pde-MIR3701 and pde-MIR3712). [score:1]
It includes pde-MIR159, pde-MIR162, pde-MIR166, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396 and pde-MIR399. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 15
It was possible to confirm predicted target downregulation for other induced conserved miRNA families, including miR394, miR165 and miR171 which target an F-box family protein, an ATHB transcription factor and a scarecrow-like transcription factor, respectively (Figure 3). [score:8]
In some of these cases (miR171, miRE, miR394, miR197b) target expression decreased at 4 days post-inoculation (dpi) and then increased at 8 dpi, but never reached higher expression values than those without inoculation. [score:7]
[1 to 20 of 2 sentences]
5
[+] score: 11
Expression of target mimics against the b and c members of the miR171 family did not confer any phenotype, suggesting less important roles for these two miRNAs. [score:5]
MiR170 and miR171 target a group of SCARECROW-like transcription factor genes [9], and both MIM170 and MIM171A plants had round, pale leaves (Figure 2), as well as defective flowers, with sepals that did not separate properly, resulting in reduced fertility (Figure 3H and 3I). [score:3]
The mature miRNAs produced by members of the miR169 and miR171 families differ slightly, and different target mimics were designed for these subfamilies. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 10
While the expressions of 14 families (miR156/miR157, miR158, miR160, miR162, miR165/miR166, miR168, miR169, miR171, miR390, miR393, miR394, miR396, miR398, and miR399) were dramatically reduced, 3 families (miR159, miR167, and miR172) were up-regulated in CsCl -treated seedlings. [score:6]
As shown in the radial chart in Fig 4C, expression of the miR157, miR160, miR165, miR168, miR171, miR319, and miR403 families was decreased by around 80% to 140% in CsCl -treated seedlings. [score:3]
Several miRNA families were significantly lower in both CsCl -treated and KCl -treated seedlings (miR156, miR169, miR170/miR171, and miR399). [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 8
Other miRNAs from this paper: ath-MIR159a, ath-MIR171a, ath-MIR159b, ath-MIR171b, ath-MIR159c
To determine whether other DCL or RDR proteins are required for miRNA formation in Arabidopsis, miR-171 and miR-159 were analyzed in four new mutants. [score:1]
Similarly, accumulation of miR-171 and miR-159 was unaffected in rdr1 and rdr2 mutants. [score:1]
Probes for miR-171 and AtSN1-siRNA analysis were described previously (Llave et al. 2002b; Zilberman et al. 2003). [score:1]
This was in contrast to the low level or shifted mobility of miR-171 and miR-159 in dcl1-7 and hen1-1, respectively (see Figure 1B). [score:1]
As shown for miR-171, miR-159 (Figure 1A), and several other miRNAs (Park et al. 2002; Reinhart et al. 2002), mutants with dcl1 loss-of-function alleles lose most of their miRNA populations (Figure 1B). [score:1]
Accumulation of miR-171 and miR-159 was unaffected in the dcl2 and dcl3 mutants (see Figure 1B). [score:1]
From top to bottom: miR-171 and miR-159a loci; siRNA02 loci, with each siRNA02 sequence indicated by an asterisk and the inverted duplication shown by the gray arrows; cluster2 siRNA locus; a segment of chromosome III showing 10 5S rDNA repeats (blue indicates 5S rRNA, gray indicates spacer) containing the siRNA1003 sequence. [score:1]
This was in strict contrast to miR-171, miR-159 (see Figure 1B), and several other miRNAs tested (data not shown), which depended specifically on DCL1. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 8
The genes HAM1, HAM2, and HAM3 are targets for ath-miR171b, ath-miR171c, and ath-miR170. [score:3]
We grouped these miRNAs into the ath-miR171 family because ath-miR171a has full complementarity with all of the sites in the mRNAs of HAM1, HAM2, and HAM3 paralogs. [score:1]
The amino acid sequences of miR171 -binding sites in HAM orthologous proteins are conserved and encode the same ILARLN motif. [score:1]
Supplemental table S1: Nucleotide variability of miR171 binding sites in mRNA of HAM orthologous genes. [score:1]
The nucleotide sequences of miR171 binding sites are highly conserved in the mRNAs of 37 HAM orthologous genes and encode GAUAUUGGCGCGGCUCAAUCA sequence. [score:1]
The maximal interaction energy (Δ G [m]) for miR156, miR157, miR170, miR171, and their families was equal to the binding energy of perfectly complementary sequences. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 7
Reduced miR171 accumulation coincided with increased accumulation of its target SCL6-III RNA (Figure 5A), suggesting that SB1 RNA could compete with miRNA precursors for HYL1 binding and thus reduce miRNA processing efficiency and miRNA -mediated regulation in planta. [score:4]
The correlative increase of the miR171 -targeted SCL6-III mRNA is shown. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 5
Other miRNAs from this paper: ath-MIR171a, ath-MIR171b, ath-MIR822, ath-MIR839
Gene-specific RACE products for SCL6-III, a known target for miR171, as well as those for CPSF30 and TRAP α-like were resolved on 1.5% agarose gel. [score:3]
While the miR171-directed cleavage of SCL6-III (At3g60630) mRNA [27] was detected in both mock- and TMV-Cg-infected wild type Arabidopsis (Fig 5B, lanes 1 and 2), cleavage of the CPSF30 and the TRAP α -like mRNAs appeared to be specific to TMV-Cg-infection (Fig 5B, lanes 3–6). [score:2]
[1 to 20 of 2 sentences]
11
[+] score: 5
miR171 and its targets SCL6-III and SCL6-IV are highly expressed in inflorescences [17]. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 3
The involvement of miRNAs as key regulators of flowering time (miR159, miR172, miR156, and miR171), hormone signaling (miR159, miR160, miR167, miR164, and miR393), or shoot and root development (miR164), was reviewed by (Wang and Li, 2007). [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR408, ath-MIR156g, ath-MIR156h, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, ath-MIR848, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1527, gma-MIR1533, gma-MIR396c, pvu-MIR166a, pvu-MIR399a, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, ath-MIR5021, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR169w
Scarecrow-like transcription factor is already an established target for miR171 family in Arabidopsis [69] and Oryza sativa [70]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
The seed regions of the newly identified maize miRNAs t0002967, t0511822, t0207061, t0448353 and t0053880 were identical to those of ctr-miR171 and ctr-miR166, respectively, indicating that they may share the same targets. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
Among the 30 miRNA families detected at 2dpi, 10 (miR160, miR161, miR167, miR171, miR172, miR390, miR394, miR396, miR398 and miR408) displayed contrasting expression levels between viruses. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
The function of miR319 seems to be conserved also in maize where, in addition, this specific miRNA together with miR171 target genes that participate in secondary pathways of auxin and GA signaling transduction, thus affecting embryo differentiation (Zhang et al., 2009a; Kang et al., 2012; Shen et al., 2013). [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 2
Other miRNAs from this paper: ath-MIR171a, ath-MIR171b
As a control, neither tasiRNA255 nor miRNA171 was affected by the rdm18 or nrpe1 mutation (Additional file 1: Figure S4B). [score:2]
[1 to 20 of 1 sentences]
18
[+] score: 2
Diurnal oscillation in the accumulation of Arabidopsis, miR167 miR168 miR171 and miR398. [score:1]
miR171, miR398, miR168, and miR167 oscillate diurnally but are not under clock-control (Sire et al., 2009). [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 2
Other miRNAs from this paper: ath-MIR171a, ath-MIR171b
24-nt siRNAs, 21-nt ta-siRNA255, and miRNA171 were detected. [score:1]
The accumulation level of ta-siRNA255 and miRNA171 was not affected by idp1 and nrpd1. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 1
Diurnal oscillation in the accumulation of Arabidopsis microRNAs, miR167, miR168, miR171 and miR398. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
Other miRNAs from this paper: ath-MIR171a, ath-MIR171b
Indeed in vivo evidence for smRNA elongation was provided in the study of the RDR6 -dependent silencing of a miR171(21nt)-sensor transgene in Arabidopsis [20]. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Arabidopsis, only the miR171 family is divided in two families, and the following miRBase families are pairwise grouped together: MIR319–MIR159, MIR156–MIR157, MIR165–MIR166, and MIR170–MIR171. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Eight cis-NATs were coincidently the precursors of miR162, miR167, miR171, miR172, miR398 and miR408 (Table  3). [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
In Arabidopsis, miR156, miR158, miR159, miR165, miR167, miR168, miR169, miR171, miR319, miR393, miR394 and miR396 are drought-responsive. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
Liu et al [7] identified 14 miRNAs induced by high-salinity, drought and low temperature in Arabidopsis thaliana on a microarray -based analysis, among which miR168, miR171 and miR396 responded to all three stresses. [score:1]
[1 to 20 of 1 sentences]