130 publications mentioning rno-mir-34a (showing top 100)

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-34a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

In the current study, we showed in MSCs that FOXO3a was downregulated in response to a miR-34a inhibitor, and could be abolished by silencing SIRT1 expression, suggesting that the restorative function of the miR-34a inhibitor in MSCs was mediated through the SIRT1–FOXO3a signaling pathway.

Among the known miRNAs, expression of miR-34a was found to be elevated in mouse hearts after myocardial infarction (MI) [12] and in cardiac tissue from patients with heart disease [13], while inhibition of the expression of miR-34a alleviated apoptosis and senescence in myocardial cells [14, 15] and other cell lines [16– 18].

Frequently downregulated and functioning as an independent prognostic indicator in multiple types of cancers [18, 43], miR-34a expression levels were significantly upregulated in the animal mo del of acute MI and in the aged hearts [15] and were strongly correlated with left ventricular end-diastolic dimension 1 year after acute MI [44].

Our work revealed that downregulation of miR-34a decreased total FOXO3a and Bim protein expression, whereas SIRT1 knockdown increased the expression of these two proteins (Fig.   3e, f).

The results showed miR-34a inhibitor reduced CASP3 activity and expression of cleaved PARP1 (Fig.   3e, f), while siRNA-SIRT1 partly abolished the effects of the miR-34a inhibitor, verified both by flow cytometric analysis of the percentage of Annexin V [+]/PI [–] cells (Fig.   3a, b) and by western blot analysis of cleaved CASP3 and cleaved PARP1 (Fig.   3e, f).

b qRT-PCR analysis was applied to detect mRNA expression of SIRT1 in MSCs after transfection with miR-34a mimic, NC mimic, miR-34a inhibitor, or NC inhibitor for 48 hours, respectively.

e, f Western blot analysis of SIRT1, FOXO3a, Bim, CASP3, and PARP1 protein expression in cultures of siRNA-NT, siRNA-SIRT1, miR-34a inhibitor, or siRNA-SIRT1 cotransfected with miR-34a inhibitor -treated MSCs, under normal and H/SD conditions (MSCs were transfected for 72 hours and exposure to H/SD and maintained as such for 6 hours).

However, when ROS was removed by NAC or when miR-34a was inhibited by a miR-34a inhibitor, the expression of γ-H2A.

Intracoronary infusion or intramyocardial delivery of MSCs modified with current developing therapeutics to inhibit the expression of miR-34a might thus have great advantage in application for vascular diseases.

Overexpression of miR-34a aggravated MSC apoptosis, while inhibition of miR-34a expression conferred resistance to H/SD -induced apoptosis.

For overexpression or inhibition of miR-34a, cells were transfected with different concentrations of miR-34a mimic or miR-34a inhibitor (both from Invitrogen, Carlsbad, CA, USA).

The results of the current study showed that miR-34a was significantly up-regulated under H/SD conditions in MSCs, while overexpression of miR-34a was significantly associated with increased apoptosis, impaired cell vitality and aggravated senescence.

c, d Western blot analysis showed dose -dependent regulation of SIRT1 by miR-34a after transfection with miR-34a mimic, NC mimic, miR-34a inhibitor, or NC inhibitor for 72 hours, respectively.

miRNA microRNA, NC negative control, ORF open reading frame, SIRT1 silent information regulator 1, UTR untranslated region After identifying SIRT1 as a direct target of miR-34a, we investigated whether knockdown of SIRT1 by siRNA (siRNA-SIRT1) induces apoptosis in MSCs.

Silent information regulator 1 (SIRT1), one of the potential targets of miR-34a [19], is an NAD -dependent deacetylase that regulates apoptosis in response to oxidative and genotoxic stress and plays a critical role in regulating cell cycle, senescence, and metabolism [19– 21].

Our results show that miR-34a is significantly upregulated under H/SD conditions in MSCs, and overexpression of miR-34a is strongly associated with increased apoptosis, lower viability, and increased senescence.

To test the hypothesis that miR-34a regulates SIRT1 expression in MSCs from rats, we transfected MSCs with a miR-34a mimic or miR-34a inhibitor.

Western blot analysis revealed an inhibition of cytochrome c release in the miR-34a inhibitor group, while siRNA-SIRT1 reversed its effect (Fig.   4b, c).

Badi I, Burba I, Ruggeri C, Zeni F, Bertolotti M, Scopece A et al. MicroRNA-34a induces vascular smooth muscle cells senescence by SIRT1 downregulation and promotes the expression of age -associated pro-inflammatory secretory factors.

Similar to miR-34a mimic treatment, suppression of SIRT1 expression promoted apoptosis, revealed by flow cytometric analysis of the percentage of cells that were Annexin V [+]/PI [–] (Fig.   3a, b).

SIRT1, one of the potential targets of miR-34a, has been identified as an apoptosis inhibitor and has been found to act as a longevity gene in many studies reported previously [48].

miR-34a was expressed in almost every tissue but was scarcely expressed in lung tissue [42].

MSCs were transfected with siRNA-NT, siRNA-SIRT1, miR-34a inhibitor, or siRNA-SIRT1 cotransfected with miR-34a inhibitor under normal and H/SD conditions (MSCs were transfected for 72 hours and exposure to H/SD and maintained as such for 6 hours).

qRT-PCR results showed that miR-34a was expressed in normal MSCs and that expression increased significantly when exposed to atmospheric conditions representing H/SD for 6 hours (Fig.   1a).

To identify the potential targets of miR-34a that mediated its pro-apoptotic role in MSCs, bioinformatics algorithms including miRBase (University of Manchester, Manchester, UK), TargetScan (David Bartel Lab, Whitehead Institute for Biomedical Research, MA, USA), PicTar (Rajewsky lab, NY, USA and Max Delbruck Centrum, Berlin, DE), and miRanda (Computational Biology Center at MSKCC, NY, USA) were applied.

We then used CCK-8 to evaluate the role of miR-34a in MSC survival, and found that overexpression of miR-34a reduced cell survival, while inhibition of miR-34a expression showed the opposite effect (Fig.   1b, c).

d, e Flow cytometric analysis of apoptotic cells in normal and H/SD conditions, in cultures of miR-34a mimic, NC mimic, miR-34a inhibitor, or NC inhibitor treated (MSCs were transfected for 48 hours and exposure to H/SD and maintained as such for 6 hours).

Notably, the inhibition of miR-34a in MSCs was concurrent with the increased expression of SIRT1 (Fig.   2d).

a Rat MSCs were cultured in normal condition or exposed to H/SD for 6 hours and were transiently transfected with miR-34a mimic, NC mimic, miR-34a inhibitor, or NC inhibitor for 48 hours, respectively.

MicroRNA-34a (miR-34a) is originally identified as a TP53 -targeted miRNA that modulates cell functions, including apoptosis, proliferation, and senescence via several signaling pathways, and hence is an appealing target for MSC -based therapy for myocardial infarction.

As expected, we found that inhibition of miR-34a increased the ΔΨm of MSCs during H/SD, and decreased cleaved CASP3 expression.

In conclusion, our study reveals that miR-34a is greatly elevated in MSCs during H/SD, and overexpression of miR-34a leads to robust apoptosis, while inhibition of miR-34a significantly increases pressure resistance of MSCs to H/SD.

Our data demonstrate that miR-34a is involved in the process of H/SD in MSCs, while inhibition of miR-34a leads to an increase in SIRT1 and a decrease in FOXO3a protein expression, fewer apoptotic cells, and better viability.

However, when miR-34a was inhibited, MSCs showed better resistance to H/SD than the NC inhibitor group (Fig.   1d, e).

Moreover, our results show that miR-34a overexpression increases cellular senescence, which may be regulated by ROS production.

However, neither miR-34a inhibitor nor siRNA-SIRT1 altered the mRNA level of FOXO3a (data not shown), indicating that miR-34a and SIRT1 could regulate FOXO3a posttranscriptional activity under H/SD conditions.

In this study, increased activities of the cleaved CASP3 and cleaved PARP1 were observed when SIRT1 was knocked down or miR-34a was overexpressed (Fig.   3b, d).

CASP3 caspase 3, FOXO3a forkhead box O transcription factor 3a, H/SD hypoxia and serum deprivation, miRNA microRNA, NC negative control, PARP1 polyADP-ribose polymerase 1, PI propidium iodide, SIRT1 silent information regulator 1, siRNA small interfering RNA, siRNA-NT scrambled siRNA To further elaborate the relationship between miR-34a and SIRT1, MSCs were transfected with miR-34a inhibitor or siRNA-SIRT1, or a combination, before exposure to H/SD.

Fig. 2SIRT1 is a direct target of posttranscriptional repression by miR-34a.

Among the known miRNAs, miR-34a has been demonstrated to be involved in apoptosis [40] and senescence [17] and to inhibit various key regulators of cell cycle progression [41].

CASP3 caspase 3, FOXO3a forkhead box O transcription factor 3a, H/SD hypoxia and serum deprivation, miRNA microRNA, NC negative control, PARP1 polyADP-ribose polymerase 1, PI propidium iodide, SIRT1 silent information regulator 1, siRNA small interfering RNA, siRNA-NT scrambled siRNATo further elaborate the relationship between miR-34a and SIRT1, MSCs were transfected with miR-34a inhibitor or siRNA-SIRT1, or a combination, before exposure to H/SD.

SIRT1 is a direct target of posttranscriptional repression by miR-34a.

SIRT1, identified as a direct and functional target of miR-34a, protects MSCs from H/SD -induced apoptosis through its downstream effector FOXO3a.

Expression levels of miR-34a were determined by qRT-PCR.

Cells were left untreated or pretreated with miR-34a mimic, siRNA-SIRT1, ROS scavenger NAC (10 mM), and miR-34a inhibitor separately or in combination for 72 hours, and then cellular senescence was analyzed by SA-β-gal staining (a, b).

Taken together, these data support the hypothesis that miR-34a may be involved in the apoptotic process of MSCs induced by H/SD through activation of the mitochondrial apoptosis pathway by targeting SIRT1.

Inhibition of miR-34a in MSCs would thus be beneficial and could demonstrate great therapeutic potential in clinical transplantation for vascular disorders.

Furthermore, overexpression of miR-34a was demonstrated to promote the apoptosis of myocardial cell during MI [45], aggravate senescence, and impede angiogenesis ability of EPCs [17] and endothelial cells [46], as well as induce senescence and inflammation in vascular smooth muscle cells [47], leading to myocardial and vascular dysfunctions.

showed that overexpression of miR-34a increased β-galactosidase -positive cells as well as ROS production.

Thus, inhibition of miR-34a might have important therapeutic implications in MSC -based therapy for myocardial infarction.

In this study, we explored whether ROS was the main mediator of MSC senescence induced by miR-34a overexpression.

To further ascertain the effect of miR-34a, cellular fractionation was performed and cell lysates from cytosolic and mitochondrial fractions were subjected to western blotting to detect the expression of cytochrome c, which was released from mitochondria and functioned as a key mediator of apoptosis [30].

These results imply that ROS has an important role in MSC senescence induced by miR-34a overexpression and thus may partly explain the poor survival rate of engrafted MSCs in the infarcted area.

Inhibition of miR-34a might therefore be a promising therapeutic strategy for enhancing the biological functions of MSCs, thus demonstrating great therapeutic potential in clinical transplantation.

H/SD hypoxia and serum deprivation, miRNA microRNA, NC negative control, PI propidium iodide Bioinformatics results suggested that SIRT1, identified as an apoptosis -associated gene, was the potential target of miR-34a.

These data suggest that SIRT1 is likely to be targeted by miR-34a posttranscriptionally.

In contrast to the scramble cells, cells treated with the miR-34a inhibitor displayed significant changes in ΔΨm (Fig.   4a).

miR-34a induces apoptosis by modifying SIRT1 and FOXO3a expression.

With rapid development of anti-miRNA chemistries, even ahead of miRNA mimicry [56], the miR-34a knockdown by antagomirs or LNA -based anti-miRNAs has been shown to protect against the deterioration of cardiac systolic function in mice after acute MI [15].

miR-34a expression increases under H/SD, and correlates with decreased cell survival and increased apoptosis.

For analysis of miR-34a expression, total RNA was extracted from the MSCs using TRizol reagent (Invitrogen, Shanghai, China) and reverse-transcribed into cDNA according to the manufacturer’s instructions.

Our study demonstrates for the first time that miR-34a plays pro-apoptotic and pro-senescence roles in MSCs by targeting SIRT1.

The expression of miR-34a was determined by qRT-PCR.

miR-34a inhibitor, ▲ P <0.05 vs.

miR-34a belongs to one of several evolutionarily-conserved families of miRNAs, namely miR-34, and was originally identified as a TP53 -targeted mRNA [40].

This study strongly suggests that miR-34a is a promising candidate for a more optimized and appealing target for MSC -based therapy in MI.

Fig. 5Overexpression of miR-34a induces senescence in MSCs.

a The predicted targeting sites with miR-34a of SIRT1 3′-UTR (Hsa, human; Mmu, mouse) are highlighted in red.

As controls, cells were transfected with negative control (NC) mimic, NC inhibitor of miR-34a (both from Invitrogen,Carlsbad, CA, USA), or scrambled siRNA (siRNA-NT) of SIRT1 (GenePharma Co.

These findings suggest that knockdown of SIRT1 or treatment with miR-34a mimic acts similarly in the regulation of apoptosis.

In the present study, we showed that miR-34a was expressed in normal MSCs and was elevated greatly during H/SD, designed to mimic the in vivo conditions of ischemia and hypoxia.

This supports our hypothesis that the decreased cell survival and increased apoptosis in MSCs are associated with overexpression of miR-34a.

Overexpression of miR-34a induces senescence in MSCs.

Moreover, we found that overexpression of miR-34a induced senescence of MSCs, which may partly be abolished by the ROS scavenger NAC.

Cells were left untreated or pretreated with NAC, miR-34a mimic, siRNA-SIRT1, and miR-34a inhibitor separately or in combination and then stimulated with the diluted fluoroprobe 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA; Beyotime Institute of Biotechnology, Beijing, China) for 20 minutes at 37 °C with slight shaking every 5 minutes.

H/SD hypoxia and serum deprivation, miRNA microRNA, SIRT1 silent information regulator 1, siRNA small interfering RNA Considering that the regenerative capacity of MSCs contributed greatly to their function, we further examined cellular senescence in miR-34a mimic -transfected MSCs.

These data suggests that miR-34a not only regulates resident myocardial cell apoptosis but also plays an important role in engrafted MSCs survival in the infarcted area.

In the miR-34a mimic and siRNA-SIRT1 group, the expression of p16, p53, and p21 was obviously increased compared with that in the control group (Fig.   5e, f).

revealed that overexpression of miR-34a significantly increased the percentage of SA-β-gal -positive cells compared with that of scramble (Fig.   5a, b).

Western blot analysis demonstrated a dose -dependent decrease in SIRT1 protein expression in miR-34a mimic -transfected cells compared with the NC mimic group (Fig.   2c).

The results showed that miR-34a played a crucial role in a plethora of biological processes via regulation of SIRT1/FOXO3a and the reactive oxygen species (ROS) pathway in MSCs.

Further study showed that miR-34a can also aggravate MSC senescence, an effect which was partly abolished by the reactive oxygen species (ROS) scavenger, N-acetylcysteine (NAC).

Thus, we presumed that miR-34a may play a crucial role in the MI microenvironment and contribute to the poor survival rate of MSCs in the infarcted area.

transfection with 10 nM miR-34a mimic.

miR-34a exerts pro-apoptotic effects via activation of the mitochondrial apoptosis pathway.

We further examined the role of ΔΨm and the intrinsic apoptosis pathway of the CASP3–PARP1 axis in the pro-apoptotic activity of miR-34a in MSCs.

As expected, the miR-34a mimic increased ROS production, which was alleviated by addition of the ROS scavenger N-acetylcysteine (NAC) (Fig.   5c, d).

miR-34a mimic, ▲ P <0.05 vs.

Therefore, to understand the intrinsic apoptotic pathway that is activated by miR-34a, we performed JC-1 staining.

Moreover, we found that the mechanism underlying the proapoptotic function of miR-34a involves activation of the SIRT1/FOXO3a pathway, mitochondrial dysfunction and finally, activation of the intrinsic apoptosis pathway.

In the current study, we tested the hypothesis that overexpression of miR-34a increases cellular susceptibility to hypoxia and serum deprivation (H/SD) -induced apoptosis and aggravates cell senescence, and investigated the underlying mechanisms.

To further determine the role of miR-34a in MSCs under conditions of H/SD, Annexin V–FITC/PI staining was performed.

However, the precise role of miR-34a in MSCs has not been unraveled to date.

Moreover, miR-34a was also found to aggravate the senescence of MSCs in a ROS -dependent manner.

The results showed that miR-34a mimic -treated MSCs were significantly more apoptotic than the NC mimic group both in normal and H/SD conditions (Fig.   1d, e).

In addition, miRBase showed that the binding sites of miR-34a are evolutionarily conserved in both human and mouse (Fig.   2a).

Quantitative RT-PCR (qRT-PCR) was performed to analyze the level of miR-34a with the miRcute miRNA First-Strand cDNA Synthesis Kit and the miRcute miRNA qPCR Detection Kit (SYBR Green; Tiangen, Beijing, China).

a, b Apoptosis was analyzed by measuring Annexin V [+]/PI [–] cells using flow cytometry in cultures of siRNA-SIRT1, siRNA-NT, or siRNA-SIRT1 cotransfected with miR-34a inhibitor -treated MSCs, under normal and H/SD conditions (MSCs were transfected for 72 hours and exposure to H/SD and maintained as such for 6 hours).

Our study revealed that the activation of SIRT1/FOXO3a and the intrinsic apoptosis pathway of CASP3–PARP1 might be involved in the pro-apoptotic function of miR-34a.

2

Figure 9 Note: A. histogram analysis of the expression of miR-34a in each group; B. histogram analysis of the mRNA expression of Notch1 in each group; C. histogram analysis of the mRNA expression of Notch4 in each group; D. histogram analysis of the mRNA expression of Hes1 in each group; *, P < 0.05 compared with the blank group and the NC group; NC, negative control; Hes1, hairy and enhancer of split 1. (Figure 10) showed that at 48 h after transfection with miR-34a mimics, liver cancer Huh7 cells had down-regulated protein expressions of Notch signaling pathway-related Notch1, Notch4 and Hes1 and apoptosis-related Bcl-2 and Bcl-xL, but had up-regulated expressions of cell cycle-related P21 and apoptosis-related Bax when compared with the blank group and the NC group (all P < 0.05).

As miR-34a can significantly down-regulate the expressions of Bcl-2, Bcl-w and Bcl-xL [35], and up-regulate the expressions of Bax and P21 [36], it can be concluded that the low expression of miR-34a could results in the inhibition of cell apoptosis, which is in consistent with our findings.

Figure 4 Note: A. the mRNA expressions of miR-34a and Notch receptors during LR; B. the protein expressions of Notch receptors during LR; Hes1, hairy and enhancer of split 1. Note: A. the mRNA expressions of miR-34a and Notch receptors during LR; B. the protein expressions of Notch receptors during LR; Hes1, hairy and enhancer of split 1. An online predicting software Target Scan was used to identify the target site on which Notch1 bound to miR-34a.

For instance, miR-17~92 facilitated LR in an oestrogen -dependent manner [16], an increased expression of miR-34a led to inhibited hepatocyte proliferation during the late phase of LR [17], and miR-21 was upregulated in the early stage of LR, which targeted Pellino-1 to regulate NF-kappaB signaling [18].

Moreover, the expressions of miR-34a, P21 and Bax were up-regulated, while the expressions of Notch receptors, and Bcl-2 and Bcl-xL were down-regulated in this group.

According to the results of qRT-PCR (Figure 9), the liver cancer Huh7 cells in the miR-34a inhibitor group had decreased expression of miR-34a and increased mRNA expressions of Notch1, Notch4 and Hes1 in comparison to the blank group and the NC group (all P < 0.05), while the cells in the miR-34a mimics group had increased expression of miR-34a and decreased mRNA expressions of Notch, Notch4 and Hes1 when compared with the blank group and the NC group (all P < 0.05).

According to qRT-PCR and (Figure 4), it was found that from 0 d to 1 d after PH, the protein and mRNA expressions of Notch1, Notch 4 and Hes1 kept increasing, while the expression of miR-34a decreased to its lowest level at 1 d. Since 1 d, the mRNA and protein expressions of Notch4 started to decrease, and they dropped to the lowest level at 5 d, after which the expressions gradually increased to the level before liver resection.

Figure 4 Note: A. the mRNA expressions of miR-34a and Notch receptors during LR; B. the protein expressions of Notch receptors during LR; Hes1, hairy and enhancer of split 1. An online predicting software Target Scan was used to identify the target site on which Notch1 bound to miR-34a.

Additionally, miR-34a could down-regulate expression of Notch1, hence low expression of miR-34a contributes to the development and progression of human malignancies through promotion of Notch1, including pancreatic cancer and prostate cancer [38– 40].

Besides, it is found that over -expression of miR-34a led to reduced expression of Notch receptors (Notch1 and Notch4) and Notch target gene (Hes1), suggesting that miR-34a regulates Notch signaling pathway in a negative manner.

In cervical cancer and choriocarcinoma, forced expression of miR-34a could inhibit Jagged1 and Notch1 expression, thereby causing a reduced invasion capacity of tumor cells [9].

Besides, miR-34a suppressed the proliferation and induced apoptosis of human glioma U87 cells by reducing the expression of target gene Notch1 [29].

In general, the mRNA expression of Notch1 was negatively related to that of miR-34a, and the protein expression of Notch1 decreased from 1 d to 5 d and increased from 5 d to 7 d. As for the expression of Hes1, it presented two ascending tendencies: the first peak appeared 1 d, and the second at 5 d which was, however, a little lower than the first peak.

In contrast, liver cancer Huh7 cells transfected with miR-34a inhibitors had increased protein expressions of Notch1, Notch4, Hes1, Bcl-2 and Bcl-xL but decreased expressions of P21 and Bax when compared with the blank group and the NC group (all P < 0.05).

Though miR-34a was proved to target Notch signaling pathway in multiple tumors, such as glioblastomas, breast cancer, cervical cancer and choriocarcinoma [9, 12, 13], the role of miR-34a interacting with Notch signaling pathway in liver cancer remains to be discussed, so this study would like to explore whether miR-34a affects LR and cancer development by targeting Notch signaling pathway.

In conclusion, the present study revealed that miR-34a could promote LR and suppress the development of liver cancer by inhibiting Notch signaling pathway.

To conclude, at the early stage of LR, the expression of miR-34a was significantly in negative correlation with the expressions of Notch1, Notch4 and Hes1.

Our study demonstrates that miR-34a regulated LR and the development of liver cancer by inhibiting Notch signaling pathway.

At 48 h and 72 h, the growth of cells in the miR-34a mimics group were inhibited obviously, with its OD value being significant lower than those in the blank group and the NC group (both P < 0.05), while the growth of cells in the miR-34a inhibitors group was speeded up, with its OD value being statistically higher than those in the blank and NC groups (both P < 0.05).

MicroRNA-34a (miR-34a), belonging to miR family with high conservation, is encoded on human chromosome 1 and is considered as a suppressor in human malignancies through its regulation of target genes [7].

Cells were divided into four groups: blank group (without any transfected sequence), NC group (transfected with negative control sequence 5′-UUCUCCGAACGUGUCACGUTT-3′), miR-34a mimics group (transfected with miR-34a mimics sequence 5′-ACCGUCACAGAAUCGACCAACA-3′), and miR-34a inhibitors group (transfected with miR-34a inhibitor sequence 5′-ACAACCAGCUAAGACACUGCCA-3′).

Finally, it's demonstrated that the low expression of miR-34a in liver cancer Huh7 cells resulted in a larger proportion of cells in the S phase, facilitated cell proliferation and lower cell apoptosis rate, implying that miR-34a acts as a suppressor in liver cancer.

Our data indicated that miR-34a regulated LR and liver cancer development by targeting Notch signaling pathway.

Expressions of Notch signaling pathway-related proteins and cell cycle and apoptosis-related proteins in the blank, NC, miR-34a mimics and miR-34a inhibitors groups.

A previous study found that miR-34a mimic might be a novel target molecule for the treatment of liver cancer as it significantly suppressed tumor cell growth [8].

Expressions of miR-34a and Notch receptor mRNA in the blank, NC, miR-34a mimics and miR-34a inhibitors groups.

The inactivation of apoptosis is central to cancer development, therefore low expression of miR-34a can results in the occurrence and progress of cancer [37].

In line with these studies, we found that in liver cancer Huh7 cells in the miR-34a mimics group, miR-34a expression significantly increased, while the expressions of Notch1, Notch4 and Hes-1 decreased when compared with the blank and NC groups.

Figure 6 Note: transfection of miR-34a mimics inhibited cells growth, while transfection of miR-34a inhibitors speeded up cells growth; *, P < 0.05 compared with the blank group and the NC group; NC, negative control.

Note: transfection of miR-34a mimics inhibited cells growth, while transfection of miR-34a inhibitors speeded up cells growth; *, P < 0.05 compared with the blank group and the NC group; NC, negative control.

It is why miR-34a was gradually up-regulated to normal level in our study.

Deregulation of miR-34a occurs owing to altered p53 expression [22].

In addition, elevated miR-34a in the late phase of LR can greatly repress the proliferation of rat hepatocytes by down -regulating INHBB and Met expression in regenerating livers [23], as the silencing of INHBB could greatly decelerate the growth of rat hepatocytes in LR and an increase in Met could cause impaired LR [23, 24].

Growth of xenograft tumor in nude mice in the blank, NC, miR-34a mimics and miR-34a inhibitors groups.

There was no significant change in the expression of miR-34a in the SH group.

Cell cycle in the blank, NC, miR-34a mimics and miR-34a inhibitors groups detected by PI staining.

Therefore, that variation of p53 during LR is believed to contribute to the changing expression of miR-34a.

Hereafter, the expression of miR-34a in the PH group began to increase and reached the highest level at 5 d which was significantly higher than that in the SH group (P < 0.05).

In early stage of LR, the expressions of Notch receptors and miR-34a were negatively correlated.

was applied detect to the expressions of miR-34a and Notch receptor mRNA.

Expression of miR-34a during LR.

The results of qRT-PCR were presented in Figure 3. The miR-34a expression at 0.5 d after PH decreased to half of the level at 0 d (P < 0.05), and it reached the lowest level at 1 d which was about a quarter of that in the SH group (P < 0.05).

In the study, the expression of miR-34a decreased at the beginning of LR and then gradually increased to normal level, indicating the involvement of miR-34a in LR.

According to the results of PI staining (Figure 7), the proportions of cells in G1 phase in the blank, NC, miR-34a mimics and miR-34a inhibitors groups were (56.68 ± 2.23)%, (56.80 ± 2.33)%, (57.65 ± 2.04)% and (55.33 ± 2.19)%, respectively; the proportions of cells in S phase in the four groups were (26.06 ± 1.01)%, (26.97 ± 2.21)%, (15.63 ± 1.68)% and (34.72 ± 2.55)%, respectively; the proportions of cells in G2/M phase in the four groups were (17.26 ± 1.22)%, (16.23 ± 0.12)%, (26.72 ± 0.36)% and (9.95 ± 0.37)%, respectively.

Notch 1 is a direct target gene of miR-34a [28], as the dual-luciferase reporter assay verified that miR-34a bound to the 3′ UTR -binding sites of Notch 1 mRNA in the present study.

The results suggested that miR-34a could inhibit tumorigenicity of liver cancer cells.

The findings provide a tantalizing hint that miR-34a might be a new therapeutic target for liver cancer.

U6 was used as the internal reference of miR-34a, and β-actin as the internal reference of rest target genes.

According to the results for Annexin V/PI staining (Figure 8), the apoptosis rates of cells in the blank, NC, miR-34a mimics and miR-34a inhibitors groups at 48 h after transfection were (1.89 ± 0.22) %, (1.91 ± 0.25) %, (18.31 ± 1.56) % and (0.91 ± 0.06) %, respectively.

Meanwhile, the sequences of Notch1-3′-untranslated region (UTR)-WT (wild-type Notch 3′UTR) and Notch1-3′-UTR-MT (mutant-type Notch1 3′UTR missing the binding site of miR-34a) were designed.

However, there was no statistically significant difference in the expressions of miR-34a, and Notch1, Notch4 and Hes1 mRNA between the blank group and the NC group (all P > 0.05).

miR-34a targeted Notch1.

The expressions of miR-34a and Notch receptors in rats.

The growth of xenograft tumor in nude mice the blank, NC, miR-34a mimics and miR-34a inhibitors groups.

This study aimed to investigate the role of microRNA-34a (miR-34a) in regulating liver regeneration (LR) and the development of liver cancer in rats by targeting Notch signaling pathway.

The target gene of miR-34a was analyzed using biological prediction website (microRNA.

In the experiment of tumor formation in nude mice (Figure 11), liver cancer cells in the miR-34a mimics group had attenuated tumorigenicity, with reduced tumor volume and weight (0.430 ± 0.044 g) in nude mice, while those in the miR-34a inhibitors group had obviously heavier tumor (1.125 ± 0.151 g), which showed significant difference in comparison to the blank group (0.759 ± 0.103 g) and the NC group (0.795 ± 0.123 g) (all P < 0.05).

Cell cycle in the blank, NC, miR-34a mimics and miR-34a inhibitors groups.

Cell apoptosis in the blank, NC, miR-34a mimics and miR-34a inhibitors groups.

Cell proliferation in the blank, NC, miR-34a mimics and miR-34a inhibitors groups.

The miR-34a inhibitors group showed contrary tendencies.

Human liver cancer Huh7 cells were transfected and divided into blank, negative control (NC), miR-34a mimics and miR-34a inhibitors groups.

Cell apoptosis in the blank, NC, miR-34a mimics and miR-34a inhibitors groups at 48 h after transfection detected using Annexin V/PI staining method.

From these two aspects, it could be well concluded that miR-34a is an inhibitor in liver cancer.

Expression of miR-34a in the PH and SH groups during LR.

Compared to the blank and NC groups, the cell growth was inhibited, cell cycle was mainly arrested in the G2/M phase and cell apoptosis rate increased in the miR-34a mimics group.

Note: A. the sequence of 3′-UTR where Notch1 mRNA bound to miR-34a; B. dual-luciferase reporter gene assay, which indicated that miR-34a mimics could inhibit the luciferases activity of miR-34a/Notch1-WT plasmid, while it had no effect on the luciferases activity of miR-34a/Notch1-MT; *, P < 0.05; WT, wild type ; MT, mutant type.

Compared with the blank group and the NC group, the miR-34a mimics group had increased percentage of cells in G2/M phase and decreased percentage of cells in S phase (both P < 0.05), indicating that the proliferation of liver cancer Huh7 cells was significantly inhibited.

Compared to the SH group, miR-34a expression in liver tissues in the PH group decreased first and then increased to the normal level during LR.

Compared with the blank group and the NC group, the miR-34a inhibitors group had decreased percentage of cells in G2/M phase and increased percentage of cells in S phase (both P < 0.05), suggesting increased number of liver cancer Huh7 cells in mitotic phases.

MiR-34a targeted Notch1.

Figure 5 Note: A. the sequence of 3′-UTR where Notch1 mRNA bound to miR-34a; B. dual-luciferase reporter gene assay, which indicated that miR-34a mimics could inhibit the luciferases activity of miR-34a/Notch1-WT plasmid, while it had no effect on the luciferases activity of miR-34a/Notch1-MT; *, P < 0.05; WT, wild type ; MT, mutant type.

Compared with cells in the blank group and the NC group, the liver cancer Huh7 cells in the miR-34a inhibitors group had significantly lower apoptosis rate, while those in the miR-34a mimics group had significantly higher apoptosis rate (all P < 0.05).

Figure 5A shows the sequence of 3′-UTR where Notch1 mRNA bound to miR-34a.

Additionally, the tumor growth in the miR-34a mimics group was reduced.

It was found that miR-34a mimics exerted no significant influence on the luciferases activity of miR-34a/Notch1-MT plasmid (P > 0.05), but it led to 65% reduction in the luciferases activity of miR-34a/Notch1-WT plasmid (P < 0.05) (Figure 5B).

The miR-34a induces cell-cycle arrest, apoptosis or senescence in cancer cells [33].

Association between miR-34a and Notch receptors at the early stage of LR.

Inactivation of miR-34a has been found in colorectal, urothelial, mammary, ovarian and renal cell carcinomas [41].

The inactivation of Notch1 signaling pathway by miR-34a was also proved to attenuate the aggressiveness of prostate cancer [30].

The liver cancer cell lines (Huh7) were transfected with miR-34a/Notch1-WT or miR-34a/Notch1-MT recombinant plasmids.

The miR-34a is wi dely known for anti-oncogenic activity in liver cancer, and the activation of miR-34a by the transcription factor p53 suggests its potential role in the modulation of hepatic cell behavior [19– 21].

However, further studies are needed to test the effect of miR-34a on more hepatic cell types to further support our finding.

3

High Glucose Suppresses the Activation of SIRT1/AMPK α via Inducing miR-34a Higher Expression in RMCsmiR-34a regulates the development of obesity and age-related diseases via inhibiting SIRT1 expression [23].

3.5. miR-34a Upregulates Egr1 Expression via Suppressing the Activation of SIRT1/AMPK α in High Glucose-Cultured RMCsOur research has demonstrated that high glucose-stimulated miR-34a higher expression.

There are studies that discovered that metformin downregulates miR-34a expression in nonalcoholic fatty liver disease and inhibits liver fibrosis [15].

miR-34a regulates the development of obesity and age-related diseases via inhibiting SIRT1 expression [23].

This suggests that inhibition of miR-34a gene expression could suppress Egr1 expression induced by high glucose in RMCs.

This suggests that suppressing miR-34a expression reverses the inhibitory effects of high glucose on AMPK α activation via promoting SIRT1 expression.

Meanwhile, metformin prevents liver fibrosis by downregulating miR-34a expression in nonalcoholic fatty liver disease [15].

What is more, metformin downregulates miR-34a expression in nonalcoholic fatty liver disease and results in preventing liver fibrosis [15].

Moreover, downregulating miR-34a expression inhibits cell proliferation and then alleviates glomerular hypertrophy in diabetic mice [18].

3.5. miR-34a Upregulates Egr1 Expression via Suppressing the Activation of SIRT1/AMPK α in High Glucose-Cultured RMCs.

Based on transfecting with miR-34a inhibitor, we treated the RMCs with SIRT1-siRNA, which suppressed SIRT1 protein expression with a reduction of 65.91% (p < 0.001) (Figure 6(a)).

In addition, miR-34a inhibition increases the levels of phosphorylated AMPK α separately through mediating PPAR α regulation and SIRT1 pathway to suppress the development of fatty liver [17].

In addition, the inhibition of miR-34a inhibitor on Egr1 expression can be restored when we transfected MCs with SIRT1-siRNA in high glucose medium.

miR-34a inhibition increases phosphorylated AMPK α through mediating SIRT1 to suppress the development of fatty liver.

High Glucose Upregulates miR-34a Expression in RMCs.

We speculated that metformin might promote SIRT1/AMPK α activity and downregulate the downstream Egr1 protein via suppressing miR-34a in high glucose-stimulated MCs.

These results suggest that miR-34a suppresses AMPK α phosphorylation via downregulating SIRT1 in high glucose-cultured MCs.

However, it is not yet clear about the function and mechanism of metformin on Egr1 expression in MCs under high glucose conditions and whether miR-34a could regulate Egr1 expression via SIRT1/AMPK α pathways.

We did not find Egr1 is a direct target protein of miR-34a according to TargetScan Release 5.0.

We have drawn inferences that miR-34a suppresses AMPK α phosphorylation via downregulating SIRT1 in high glucose-cultured MCs.

To confirm the role of miR-34a on regulating the activation of SIRT1/AMPK α pathways in high glucose conditions, we transfected RMCs with miR-34a inhibitor, which had a reduction of 74.51% in miR-34a mRNA expression (p < 0.001) (Figure 5(a)).

miR-34a inhibitor attenuates the negative effects of high glucose on the expression of SIRT1 protein in RMCs.

Then we extended to clear whether miR-34a indirectly regulates Egr1 expression via adjusting the activity of SIRT1/AMPK α signaling pathways.

SIRT1-siRNA significantly increased Egr1 expression though RMCs had been transfected with miR-34a inhibitor in high glucose conditions (p < 0.001) (Figure 6(b)).

The effects of high glucose on suppressing the activation of SIRT1/AMPK α pathways were significantly reversed in miR-34a inhibitor -transfected cells (p < 0.001) (Figure 5(b)).

Inhibiting miR-34a transcript reversed the suppressing effects of high glucose on the activation of SIRT1/AMPK α pathways.

The siRNAs were for silencing rat Egr1 mRNA (GenBank number NM_012551), and the inhibitor for suppressing rat miR-34a was designed and synthesized by GeneChem (Shanghai, China), whose sequences are listed in Table 1. Reagent used in these experiments was Lipofectamine 2000 (Life Technologies, Carlsbad, CA, USA).

The results examined by western blot revealed that miR-34a inhibitor dramatically reduced the high glucose-stimulated Egr1 protein expression (p < 0.001), while it had no effect on the basal levels under normal glucose (Figure 5(b)).

High Glucose Suppresses the Activation of SIRT1/AMPK α via Inducing miR-34a Higher Expression in RMCs.

Therefore, we further explored whether miR-34a regulates Egr1 expression via regulating the activation of SIRT1/AMPK α pathways.

Restraining miR-34a expression can inhibit cell proliferation and relieve glomerular hypertrophy in diabetic mice [18].

It still needs more detailed researches to elucidate whether the beneficial effect of metformin on miR-34a expression is direct or indirect and to explore the possible mechanism.

Treatment with miR-34a inhibitor restrained the Egr1 expression stimulated by high glucose in MCs.

In addition, miR-34a regulates AMPK α activity through mediating SIRT1 pathway to suppress the development of fatty liver [17].

This suggests that miR-34a inhibitor could mediate Egr1 overexpression via activating SIRT1/AMPK α pathways.

And we enriched the effects of miR-34a pathways regulating Egr1 expression in high glucose-cultured MCs.

In previous study, Ding et al. [17] have found a similar result: miR-34a inhibition increases the levels of phosphorylated AMPK α separately through mediating PPAR α regulation and SIRT1 pathway in hepatic steatosis mice.

We transfected MCs with miR-34a inhibitor to clarify the effects of miR-34a on regulating the activity of SIRT1/AMPK α in high glucose environment.

It suggests that metformin might alleviate the inflammation and fibrosis in high glucose-stimulated MCs via regulating miR-34a -mediated SIRT1/AMPK α activity and the downstream Egr1 protein expression.

It is well established that the expression of SIRT1 is negatively regulated by miR-34a [16].

We presumed that miR-34a might indirectly promote Egr1 -mediated inflammation and fibrosis via suppressing the activation of SIRT1/AMPK α in high glucose-cultured RMCs.

We then explored whether metformin regulated miR-34a expression in high glucose-cultured RMCs.

It is well established that SIRT1 is a direct target of miR-34a [16].

However, more detailed researches are needed in order to further explore the specific mechanism of metformin regulating miR-34a expression.

The results, examined by qReal-time PCR, indicated that miR-34a expression in RMCs pretreated with metformin was obviously lower than high glucose group (p < 0.001) (Figure 9).

As well, miR-34a inhibitor reverses the negative effects of high glucose on AMPK α activity.

In this study, we demonstrated that high glucose obviously increases miR-34a expression in RMCs.

SIRT1-siRNA obviously decreased phosphorylated AMPK α though RMCs had been transfected with miR-34a inhibitor in high glucose conditions (p < 0.001) (Figure 6(b)).

To clarify the function of Egr1 on the inflammation and fibrosis in high glucose-cultured MCs, as well as to explore the effects of metformin on miR-34a pathway and Egr1 expression.

Metformin Prevents High Glucose-Induced miR-34a Expression in RMCs.

This suggests that metformin restrains high glucose-stimulated miR-34a expression.

miR-34a suppresses the activation of SIRT1/AMPK α and results in promoting Egr1 in high glucose-cultured MCs.

Whereas there was no statistically significant difference between normal glucose and high mannitol conditions in miR-34a expression (Figure 4), we eliminated the influence of osmotic pressure.

Consequently, our experimental results show that miR-34a suppresses the activation of SIRT1/AMPK α and results in promoting Egr1 -mediated inflammation and fibrosis in high glucose-cultured RMCs.

As a result, the high glucose-stimulated miR-34a expression was significantly reduced after metformin treatment.

What is more, RMCs were transfected with miR-34a inhibitor as well as SIRT1-siRNA, then exposed for 24 hours to high glucose.

Our research has demonstrated that high glucose-stimulated miR-34a higher expression.

It should be noted that treatment with siRNA-SIRT1 prevents the activating effects of miR-34a inhibitor on AMPK α in high glucose-stimulated MCs.

Firstly, we transfected RMCs with miR-34a inhibitor for 6 hours and then cultured with high glucose for 24 hours.

To analyze the effects of high glucose on miR-34a expression in RMCs, we treated RMCs with normal glucose, high mannitol, or high glucose, respectively, for 24 hours.

We transfected MCs with miR-34a inhibitor.

Studies have shown that high glucose promotes miR-34a expression in mesangial cells (MCs).

The aim of this study is to clarify the function of Egr1 on the inflammation and fibrosis in high glucose-cultured rat mesangial cells (RMCs) in vitro, as well as to explore the effects of metformin on miR-34a pathway activity and Egr1 expression.

We have demonstrated that the expression of miR-34a increased under high glucose in MCs in this study.

High glucose can promote miR-34a overexpression in MCs.

Meanwhile, metformin attenuates high glucose-stimulated inflammation and fibrosis in RMCs by regulating miR-34a -mediated SIRT1/AMPK α activity and the downstream Egr1 protein (Figure 11).

However, the specific mechanism of miR-34a regulating Egr1 activity still needs more researches to elucidate.

Metformin attenuates high glucose-stimulated inflammation and fibrosis in MCs by regulating miR-34a -mediated SIRT1/AMPK α activity and the downstream Egr1 protein.

We enriched the effects of miR-34a pathway regulating Egr1 in high glucose-cultured MCs.

The results, examined by qReal-time PCR, indicated that high glucose raised miR-34a expression when compared to normal glucose (p < 0.001) (Figure 4).

Isolation of MicroRNAs and miR-34a Quantitative Real-Time PCR.

4

We then further confirmed that miR-34a was able to directly bind to ATG9A 3′-UTR and suppressed the levels of ATG9A protein, whereas upregulation of ATG9A expression increased autophagic activity, cardiomyocytes area and expression of hypertrophy-related genes, but miR-34a activity was antagonized by Ang II treatment.

Indeed, level of miR-34a expression is various in different pathological conditions; for example, in the ageing heart [25] or myocardial infarction [26], miR-34a was up-regulated, whereas in a number of cancers, such as lung cancer and bladder cancer [27], [28], miR-34a expression was markedly down-regulated.

Indeed, our current study showed increased autophagy activity and upregualtion of LC3 expression, but downregulation of p62 expression in the rat mo del of cardiomyocyte hypertrophy and after miR-34a expression.

But transduction of miR-34a mimics reduced expression of ATG9A protein by a 38% decrease, while transduction of miR-34a inhibitors induced levels of ATG9A protein by 1.7-fold (Fig. 4D), suggesting that miR-34a suppressed expression of ATG9A protein at the post-transcriptional level.

Since miR-34a was aberrantly expressed in hypertrophic mouse heart [15], we thus assessed miR-34a expression in these rat heart tissues and found that miR-34a expression was significantly downregulated in the TAAC group of rats compared to that of the Sham group (Fig. 2C).

For example, a previous study demonstrated that an ectopic expression of miR-34a substantially inhibited growth of IMR90 cells and molecularly, miR-34a suppressed expression of c-MET and cell cycle-related genes [13].

In hypertrophic stage of myocardial remo deling, miR-34a expression was down-regulated [15], but it was up-regulated in the myocardial remo deling of heart failure stage [26].

We found that the rat myocardial hypertrophy heart tissues increased autophagic activity and upregulated expression of autophagy-related ATG9A and LC3 II/I proteins, but reduced p62 and miR-34a expression.

In our current study, we demonstrated the role of miR-34a in the suppression of cardiomyocyte hypertrophy by directly targeting ATG9A expression.

However, in Ang II -induced hypertrophic cardiomyocytes, upregulation of miR-34a by miR-34a mimics antagonized Ang II-stimulated cardiomyocyte hypertrophy, whereas knockdown of miR-34a by miR-34a inhibitors aggravated Ang II -induced cardiomyocyte hypertrophy (Figs. 8A and B).

For example, miR-34a is a multifunctional regulator, which is involved in cell division [11], senescence [12], apoptosis [13] and proliferation [14] through regulating the expression of its target genes.

Many previous studies have reported that miR-34a is not only involved in regulation of the cell cycle, differentiation, and apoptosis through expression of the target genes, such as CDC25C, CREP and Bcl-2 [12]– [14], but is also implicated in the regulation of autophagic activity [46], [47].

Thus, our current finding indicated that miR-34a can suppress expression of ATG9A, thereby suppressing the autophagic activity in cardiomyocytes.

These data further indicate that miR-34a plays an important role in regulation of Ang II -induced cardiomyocyte hypertrophy through inhibition of ATG9A expression.

Effect of miR-34a on direct suppression of ATG9A expression in cardiomyocytes.

In contrast, miR-34a expression was downregulated (Fig. 3B).

However, it is unknown whether and how these factors work together to regulate cardiac hypertrophy, whether ATG9A mediated autophagic activity is excessively activated in Ang II induced cardiomyocyte hypertrophy, and whether miR-34a can modulate Ang II -induced cardiomyocyte hypertrophy by targeting ATG9A expression.

Our data demonstrated that miR-34a did play an important role in regulation of Ang II -induced cardiomyocyte hypertrophy by inhibition of ATG9A expression and autophagy.

Another study confirmed these data in esophageal cancer cells whereby transfection of miR-34a into various esophageal cancer cell lines suppressed tumor cell growth and expression of c-MET and cyclinD1 [35].

Our data showed that 1 µmol/L Ang II -treated cardiomyocytes induced cardiomyocyte hypertrophy in terms of expression of the cardiomyocyte hypertrophy markers ANP and β-MHC mRNA and a cell area of cardiomyocytes, and decreased miR-34a expression (Figs. 3A and B).

Furthermore, our in vitro data showed that Ang II -induced cardiomyocyte hypertrophy had decreased expression levels of miR-34a, but ATG9A expression was elevated.

However, lentiviral transduction of miR-34a expression modulates Ang II -induced cardiomyocyte hypertrophy and expression of hypertrophy-related genes (i. e., ANP and β-MHC).

In our current study, neonatal cardiomyocytes stimulated by Ang II were transduced with miR-34a mimics and it was shown that miR-34a was able to inhibit autophagic activity, and that these cells when transduced with miR-34a inhibitor caused enhancement of autophagic activity.

The following treatments were pursued for the cell cultures, i. e., stimulation of cardiomyocytes with 1 µmol/L Ang II (human angiotensin II from Sigma, St Louis, MO); Lentivirus carrying miR-34a mimics (miR-34a), miR-34a inhibitor (miR-34a inhibitors), negative control of miR-34a, ATG9A siRNA, or negative control-siRNA, all having been purchased from the corporation of GenePharma, China (sequences are shown in Table 1).

Our current study demonstrated that ATG9A can be directly targeted by miR-34a, which further confirmed a previous study [16] using Hela and HEK293 cells.

To demonstrate the role of miR-34a in the regulation of ATG9A expression, we performed the luciferase assay to directly assess whether miR-34a can bind to the 3′-UTR of ATG9A mRNA (Fig. 4A) using a bioinformatics approach (www.

An animal mo del of myocardial hypertrophy, dysregulation of miR-34a expression, and autophagic activity.

Meanwhile, we determined the effect of miR-34a on regulation of ATG9A expression.

miR-34a regulation of ATG9A expression.

Effect of miR-34a expression on regulation of Ang II -induced cardiomyocyte hypertrophy.

After 5 days culture, the cells were transduced with a lentivirus containing miR-34a mimic, miR-34a inhibitor or miR-34a negative control and 12 hours later, pGL3 luciferase reporter vector including 3′-UTR of ATG9A (with the wild type or mutant type) was cotransfected with the pRL-TK vector into the cardiomyocytes using Lipofectamine LTX and PLUS Reagents (Invitrogen) for 48 hours.

The report plasmid in which the luciferase coding sequence was fused to ATG9A-3′-UTR-Wild or ATG9A-3′-UTR-Mutant and miR-34a mimics, miR-34a inhibitors, and negative control were cotransfected into cardiomyocytes.

Moreover, level of miR-34a expression might not be the same in different pathological stages of cardiac remo deling due to pressure overload via transverse aortic constriction [15], [26].

In this study, we first produced a rat mo del of myocardial hypertrophy using the TAAC operation and then an in vitro cardiomyocytes hypertrophic mo del using Ang II treatment, ATG9A cDNA transfection, or lentiviral infection of miR-34a inhibitor, or miR-34a mimics, or ATG9A siRNA.

Future studies will verify miR-34a as a target for clinical control of myocardial hypertrophy.

Altered miR-34a and ATG9A expression in Ang II -induced myocardial hypertrophy mo del in vitro.

Altered miR-34a and ATG9A expression, autophagic vacuoles, and autophagy in a rat cardiac hypertrophy mo del.

Actually, in our current data on miR-34a expression were consistent with a previous microarray profiling study [15].

Ang II -induced myocardial hypertrophy and ATG9A and miR-34a expression in vitro.

Effects of ATG9A and miR-34a expression on Ang II -induced autophagic activity in cardiomyocytes.

We then assessed the effect of miR-34a on suppression of autophagic activity in Ang II -treated cardiomyocytes.

The cardiomyocytes were treated with control lentivirus or Ang II plus control lentivirus or Ang II plus miR-34a mimics or Ang II plus miR-34a inhibitors and then subjected to qRT-PCR analysis of the hypertrophy-related genes ANP and β-MHC mRNA.

Using microarray profiling, Cheng at al. [15] demonstrated that miR-34a was aberrantly expressed in hypertrophic mouse hearts.

As we known, each miRNA, such as miR-34a, can target multiple genes.

PLoS One 8. 28 Wang W, Li T, Han G, Li Y, Shi LH, et al (2013) Expression and role of miR-34a in bladder cancer.

Moreover, TEM data confirmed the effects of miR-34a in suppression of autophagic activity induced by Ang II (Fig. 6E).

We then determined whether miR-34a expression can modulate Ang II -induced cardiomyocyte hypertrophy in vitro.

In addition, miR-34a is a downstream gene of the tumor suppressor p53 protein [13], [36].

Molecularly, expression of ATG9A protein was altered by Ang II and miR-34a mimics.

Effect of miR-34a on suppression of autophagic activity in Ang II -treated cardiomyocytes.

However, the molecular mechanism regulating cardiac hypertrophy by miR-34a has been poorly understood.

Thus, we hypothesized that during development of cardiac hypertrophy, miR-34a could modulate Ang II induced myocardial hypertrophy by repression of ATG9A mediated autophagic activity.

In contrast, transduction with miR-34a inhibitor resulted in a 1.38-fold increase in the relative luciferase activity, compared to cells treated with a negative control.

Effects of miR-34a on regulation of Ang II -induced myocardial hypertrophy.

These results elucidate to the fact that both ATG9A and miR-34a are involved in development of myocardial hypertrophy induced by Ang II.

The data showed that compared to the negative control, miR-34a was unable to significantly express ATG9A mRNA as shown by real-time PCR analysis (Fig. 4C).

Compared to the negative control, Ang II treatment increased the ratio of autophagic activity in cardiomyocytes, whereas overexpression of miR-34a using miR-34a mimics decreased the ratio of autophagic activity induced by Ang II (Fig. 6C).

Yang et al. [16] elucidated that miR-34a modulated Caenorhabditis elegans lifespan via the repression of ATG9A -mediated autophagic activities.

0094382.g004 Figure 4(A) Sequence alignment between miR-34a and the 3′-UTR of ATG9A in different species and schematic diagram of construction of pGL3-ATG9A 3′-UTR-Wild Type and pGL3-ATG9A 3′-UTR-Mutant Type plasmids.

However, after in cardiomyocytes were transfected with pGL-3-ATG9A 3′-UTR-Mutant Type, the effects of miR-34a was lost (Fig. 4B).

Thus, miR-34a may have various roles in different types of cells during various physiological and pathological conditions.

In summary, the present study shows that miR-34a can modulate Ang II -induced cardiomyocyte hypertrophy.

However, further studies are needed to clarify the importance of the role which miR-34a plays in cardiomyocyte hypertrophy because other studies have revealed the role of different miRNAs in cardiomyocyte hypertrophy.

However, further studies will be needed to verify our current data on miR-34a controlled ATG9A -induced cardiac hypertrophy.

5

46, 47 In addition, miR-34a expression is upregulated in brain tissue, [48] blood mononuclear cells, [49] and cerebrospinal fluid (CSF), [50] of Alzheimer's disease patients.

In agreement with previous studies, we found that miR-34a overexpression in developing neurons causes a reduced expression of several synaptic proteins, [9] and receptor subunits, some of which are not among the predictable targets of miR-34a.

Western blot analysis on synaptosomal membranes from infected cortical cultures showed that miR-34a upregulation causes a lower expression of several receptor subunits including GluR1 (46% reduction), NMDAR1 (34%), NMDAR2A/B (55%) and several synaptic proteins such as PSD95 (38%), synaptophysin (33%) and synaptotagmin (Figure 3e and data not shown).

We found that miR-34a was dramatically upregulated, on average 10-fold, after infection and confirmed its co -expression with the marker EGFP.

Collectively, these results show that miR-34a operates as a regulator during neuronal development in part by directly targeting DCX transcript.

Importantly, we identified DCX as a new miR-34a target whose downregulation might be in part responsible for the effects mediated by miR-34a in brain.

However, we cannot exclude, as suggested by Agostini et al., [9] that miR-34a overexpression might enhance neuronal plasticity also by preferentially disrupting inhibitory inputs.

When the platform was removed from the pool to assess memory retention, miR-34a rats were successful in spending more than 25% of the allotted time (chance level) searching the platform in the target quadrant, whereas control rats did not reach the chance level showing a poorer cognitive performance (F(1,14)=3.225; P=0.0334; post hoc comparison: target quadrant, miR-34a versus empty vector, P<0.05, Figure 8c).

To this aim, we exploited a recombinant adeno -associated (rAAV) -mediated gene delivery system to overexpress miR-34a gene (pri-miR-34a) along with the EGFP, under two independent constitutive promoters and, as a control, an AAV empty vector overexpressing only EGFP (Supplementary Figure S1b).

TargetScan 6.2, PicTar and miRanda were used to identify one predicted miR-34a target site in the long 3′UTR region of DCX.

Because of the observed delay in the maturation of neurons overexpressing miR-34a, we next analysed the expression of Doublecortin (DCX), a neuronal cytoskeleton protein that is critical for maturation and establishment of neuronal morphology.

In particular, we present evidence that miR-34a overexpression results in: (i) increased proliferation of precursor cells; (ii) inhibition of neurite branching and delayed maturation of developing neuronal cells; (iii) altered physiological features of mature neurons; (iv) improvement in behavioural outcomes.

Thus, in our condition, it is possible that immature miR-34a overexpressing neurons show enhanced plasticity because of specialized membrane properties and different rules for LTP expression.

Next, we investigated whether the reduction of DCX expression could be directly caused by miR-34a targeting this transcript.

43, 44 In mammals miR-34a orthologue also increases with age 5, 45 and is misregulated in degenerative diseases.

Using bioinformatic databases, we have identified one highly conserved binding site in the 3′UTR of DCX and confirmed, by luciferase assay, that miR-34a can bind to it and directly regulate DCX expression.

miR-34a regulates progenitor proliferation and phenotypic maturation of new neurons in vivo in adult rat brainWe then injected miR-34a and empty rAAV expressing vectors into the cerebral lateral ventricles of rat pups at birth (P0).

[19] As shown in Figures 2b and c, upregulation of miR-34a induces an increased BrdU incorporation (2.8-fold) in neurons (Figure 2b, upper panel) with very few BrdU+ glial cells (Figure 2b, lower panel), thus demonstrating that miR-34a acts as a mitogen for neuronal committed precursors.

We therefore took a bioinformatic approach to identify DCX mRNA potential sites as target of miR-34a.

To confirm DCX as a potential target for miR-34a, we performed a luciferase reporter assay in N2a cells to assess transcript regulation through its 3′UTR.

We then injected miR-34a and empty rAAV expressing vectors into the cerebral lateral ventricles of rat pups at birth (P0).

Overall, behavioural analysis demonstrated that miR-34a overexpression improves cognitive abilities in the MWM performance and reduces anxiety in a social context in adult rats.

After having established that dynamic changes in the expression of miRNA-34a occur during precursor cell differentiation, we investigated whether overexpression of miR-34a levels could affect neuronal formation and maturation.

To further validate the interaction between miR-34a and its target DCX-3′UTR, we mutated the seed sequence of miR-34a located within the DCX-3′UTR reporter (Figures 5b and c).

25, 26 and western blot analysis on extracts from miR-34a infected cultures, both showed a significant decrease of DCX expression (Figures 4a and b), which reached approx.

However, we cannot exclude that some effects mediated by miR-34a overexpression are due to other cellular players.

Indeed, we found that miR-34a overexpressing neurons are morphologically different from neurons infected with the empty vector.

[27]We injected one group of animals (n=6 for each experiment, 5 experiments) with rAAV vector expressing miR-34a, and another group with the empty vector (n=6 for each experiment).

[17] Because miR-34a has a well-demonstrated effect on cell proliferation, [18] we analysed whether miR-34a overexpression could influence the proliferative state also of neuronal precursors.

miR-34a overexpressing neurons show modified physiological properties.

[28] Interestingly, we found that miR-34a overexpressing sections show a significant reduction of DCX labelling in the progenitor cells located in the SVZ regions (Figure 6d) and a decreased number of DCX+ migrating neuroblasts (Figures 6d and e).

These results indicate that, although miR-34a overexpressing neurons have lower basal level of GluR1, they respond to a synaptic stimulus more efficiently than control neurons.

45, 46 Moreover, inactivation of miR-34 expression has been recently shown to lead to accelerated neurodegeneration and ageing in D. melanogaster, [44] whereas in vertebrates its elevation has been suggested to be either protective or contribute to age -associated events.

Indeed, we observed that, from the first days of miR-34a overexpression, cortical cultures had a higher number of dividing precursors along with a lower number of apoptotic cells (Figures 1b and c).

We then examined whether miR-34a high levels of expression could affect the dendritic growth of newly born neurons in the DG, by immunostaining with DCX.

We first verified, by real-time PCR, that miR-34a was overexpressed after rAAV infection (Supplementary Figure S1c).

On the basis of these observations, it is possible that miR-34a, harbouring cell cycle-related functions in dividing and differentiating cells, may have evolutionary acquired functions to silence genes that promote age -associated decline and age-related diseases.

miR-34a is well recognized as a tumour suppressor in brain and many other tissues.

[35] Indeed, we found that miR-34a overexpression affects migration of neuroblasts immediately adjacent to the SVZ.

First, we cloned the 3′UTR of DCX containing the predicted miR-34a target site from rat brain cDNAs into a Renilla luciferase (R-luc) reporter construct (Figure 5c).

The elevated levels of expression of miR-34a led us to investigate whether miR-34a could be found in exosomal preparations of overexpressing cultures.

rAAV -mediated miR-34a overexpression increases cortical precursor cell proliferation in vitroFirst, we measured miR-34a expression levels at different days in vitro (DIV) in neuronal precursors isolated from cortex of E15 rat embryos, using real-time PCR.

rAAV -mediated miR-34a overexpression increases cortical precursor cell proliferation in vitro.

miR-34a overexpression in vivo influences emotionality and cognitive abilities.

Moreover, we found that rats overexpressing miR-34a in the brain have better learning abilities in the acquisition phase and memory retention in MWM test and a reduced emotionality in the SIT.

We have identified DCX as a new miR-34a target.

[24] It would be important to determine whether, depending on the cellular context and the abundance and availability of target transcripts, the DCX pathway becomes dominant and prevalent on other possible effectors of miR-34a action.

[17]Because miR-34a has a well-demonstrated effect on cell proliferation, [18] we analysed whether miR-34a overexpression could influence the proliferative state also of neuronal precursors.

8, 31 In agreement with these findings, we found that high levels of miR-34a expression induce an increased number of proliferating precursors both in vitro and in vivo confirming its distinct growth effects depending on the stimuli and cellular context.

[27] We injected one group of animals (n=6 for each experiment, 5 experiments) with rAAV vector expressing miR-34a, and another group with the empty vector (n=6 for each experiment).

Co-transfection experiments revealed that overexpression of miR-34a leads to a decrease in R-luc activity by approx.

Doublecortin is a new target of miR-34a.

Along with this, we showed a decrease in NMDA-evoked current density further suggesting a delayed maturation of miR-34a overexpressing cells.

Interestingly, the peak amplitude of the NMDA current in miR-34a cells was greatly suppressed as compared with control neurons (Figures 3c and d) by normalizing NMDA -induced current to cell capacitance (empty vector cells, 8.2±5.3 pA/pF, n=28; miR-34 A cells, 5.4±2.5 pA/pF n=25; P<0.05; all cells were recorded at 11 DIV).

miR-34a regulates progenitor proliferation and phenotypic maturation of new neurons in vivo in adult rat brain.

A link between DCX and miR-34a was previously suggested by Genovese et al. [32] in a network of miRs in which miR-34a acts as a master regulator.

To examine the knockdown potencies of miR-34a on the 3′UTR region of rat DCX, we constructed reporter genes with the psiCheck2 vector (Promega, Madison, WI, USA).

8, 9 Our data confirm and extend in vivo the observation that miR-34a has an important role in the development of neuritic arborization and growth of newly generated neurons.

miR-34a regulates neuronal morphology.

[18] For instance, miR-34a knockout mice show a reduced number of precursor proliferating cells in the DG.

It is noteworthy that miR-34a overexpressing cultures, examined under a fluorescence microscope, showed a cell confluence higher as compared with control cultures infected with the empty vector, suggesting an increase in the total number of cells (Figure 1a).

We found that the levels of the endogenous miR-34a dramatically increase in the initial stages of development then remaining high and stable in the tardive stages of differentiation and maturation (Supplementary Figure S1a).

Consistently, recent reports have implicated miR-34 family in regulating genes that mediate the behavioural changes in response to stress.

For assessment of the knockdown potency of miR-34a, the transfection on N2a was conducted with the following plasmids: 500 ng psiCheck2- 3′UTR plasmid and 2  μg rAAV-miR-34a or rAAV empty vector.

First, we measured miR-34a expression levels at different days in vitro (DIV) in neuronal precursors isolated from cortex of E15 rat embryos, using real-time PCR.

Therefore, we analysed the current in response to NMDA application (0.2 mM) in the presence of glycine (3 mM) in control and miR-34a cells by whole-cell patch-clamp recordings at a constant voltage of −60 mV.

As for the remaining behavioural items miR-34a and empty vector treated subjects did not differ from each other (frequencies: F(1,18)=0.284; 0.005; 0.962; P=0.6007; 0.9423; 0.3397; durations: F(1,18)=0.277; 0.029; 1.680; P=0.6053; 0.8656; 0.2113, respectively for affiliative, explorative and play soliciting behaviours).

Moreover, the unique miR-34a binding site is conserved in the DCX-3′UTR from different species (Figure 5b).

[30] However, several studies also point out a progrowth function and highlight variable miR-34a effects depending on cell type.

Here we show for the first time that miR-34a has an important modulatory role in neurogenesis and maturation of newly born neurons both in vitro and in vivo.

Previous in vitro studies showed that miR-34a has profound effects on the arborization of cortical neurons.

Because miR-34a is involved in cellular motility of neural precursors, [36] it is possible that this function is mediated by DCX which in turn would control the cytoskeletal rearrangements necessary for cellular motility in rodent brain.

Together, these results indicate that miR-34a has a role in controlling neurite complexity.

We found that miR-34a increases in vivo progenitor proliferation and alters phenotypic maturation of new neurons in the DG of adult rats.

Moreover, it is noteworthy that miR-34a is present in exosomes released in the medium of neuronal cultures since it may indicate that miR-34a can affect cells both cell-autonomously and non-cell-autonomously.

miR-34a acts on different mRNAs of known or potential relevance in neuronal function and plasticity including Notch1 and Numb-Like (NumbL).

were tattooed on the footpads to identify the groups injected with the rAAV-empty vector or rAAV-miR-34a.

60 and 180% in empty vector and miR-34a cultures, respectively (Figure 3f).

For a complete description of behavioural items, see Circulli et al. [59] and Berry et al. [60] Experimental subjects (miR-34a=10; empty vector=10) underwent a 1-day MWM test.

All together these results confirm that miR-34a acts as a mitogen for precursors both in vivo and in vitro.

miR-34a overexpression in vivo influences emotionality and cognitive abilitiesTo investigate whether alterations of hippocampal neurogenesis and neuronal maturation, induced by miR-34a, were associated with specific changes in cognitive and emotional behaviour, experimental subjects were tested for learning and memory in a spatial navigation test, the Morris water maze (MWM) and for social anxiety in the (SIT).

41, 42 miR-34 increases with age in C. elegans and D. melanogaster.

[9] Moreover, p73 -deficient mice, which display reduced levels of miR-34a, present important malformations of telencephalon and reduced adult neurogenesis.

Therefore, we used BrdU labelling to establish the proliferative effect of miR-34a in neuronal precursors.

[20] On the contrary, no significant differences were found in the total length of major neurites (neurons DIV 7, 115.3±21.8  μm for miR-34a neurons; 109.4±14.3  μm for empty vector neurons).

Interestingly, as shown in Figure 3a, empty vector-infected neurons have more prominent neurites emanating from the cell body, thus acquiring a multipolar aspect, whereas miR-34a overexepressing neurons show a significant reduction in neurite complexity as confirmed by (Figure 3b).

We then investigated whether the effects of miR-34a overexpression on neurite morphology had functional consequences, in particular at the electrophysiological level.

For a complete description of behavioural items, see Circulli et al. [59] and Berry et al. [60]Experimental subjects (miR-34a=10; empty vector=10) underwent a 1-day MWM test.

To determine the long-term fate of mitotically active cells in the DG of miR-34a animals, we administrated three pulses of BrdU starting at the day of viral injection (P0) and then killed animals at the fifth week after infection (Figure 7a).

A schematic drawing of rat DCX mRNA and the location of miR-34a binding site are illustrated in Figure 5a.

Thus, miR-34a could influence learning and anxiety-related behaviours by enhancing production of new neurons and modulating their maturation stage.

Four subjects were discarded from the analysis (two empty vector and two mir-34a -treated rats) because they never reached the platform during the acquisition phase.

To estimate the number of BrdU -labelled cells present in the SVZ and dentate gyrus, we sampled every three sections throughout the rostrocaudal extent of each structure from the rAAV-empty vector and rAAV-miR-34a stained sections labelled for BrdU.

In addition, miR-34a animals also performed a reduced amount of displacement behaviours (F(1,18)=1.886; P=1.886, Figure 8b) suggesting a reduced social anxiety; duration of this behavioural category did not differ between the two groups (Z=−0.680; P=0.4963).

Indeed, we found a strong increase of miR-34a exosomal preparation, as compared with uninfected cultures (Supplementary Figure S2), suggesting that its regulatory effects could be also mediated through a cell non-autonomous mechanism.

This mutation did not significantly change R-luc activity as compared with control, suggesting that the action of miR-34a is specific to the miR-34a seed region within the DCX-3′UTR.

Nevertheless, we cannot exclude that other factors may mediate the reduction of DCX by miR-34.

6

They found that under hypoxia, inhibition of miR-34a significantly enhanced H9c2 cell viability through suppression of apoptosis by targetting Bcl-2. The roles of miR-34a in our reports were consistent with their discovery, suggesting that miR-34a is a potential drug target for treatment in myocardial I/R injury.

Interestingly, we found that under short hypoxia, miR-34a was down-regulated but long hypoxia exposure significantly up-regulated miR-34a, which is inverse to the glycolysis rate under hypoxia, indicating inhibition of hypoxia -induced miR-34a could protect cardiomyocytes through recovering glycolysis.

Figure 5 MiR-34a directly targets LDHA in cardiomyocytes(A) Potential miR-34a target was predicted from TargetScan.

Western blot results showed overexpression of miR-34a significantly down-regulated LDHA expressions (Figure 5C).

To examine whether the miR-34a inhibition mediated cardiomyocytes survival under hypoxia was through direct targetting LDHA, we transfected specific LDHA siRNA into the miR-34a -inhibited H9c2 cells (Figure 6D).

It been known that down-regulation of miR-34a could reduce myocardial I/R injury by inhibiting cardiomyocyte apoptosis through targetting BCL-2 [13], suggesting a protective role of miR-34a during heart ischemia stress.

To test whether inhibition of endogenous miR-34a could promote the glucose metabolism, we transfected miR-34a inhibitor or control inhibitor into H9c2 cells (Figure 4D).

Consistently, miR-34a was up-regulated in long-time hypoxia exposure (14 days) in rat cardiomyocytes (Figure 3B), suggesting that the hypoxia -mediated up-regulation of miR-34a might contribute to the cardiomyocyte cell death.

MiR-34a directly targets LDHA in cardiomyocytesTo further examine the molecular mechanisms for the miR-34a-modulated glycolysis suppression, the potential targets of miR-34a were investigated.

In addition, H9c2 cells were transfected with control siRNA or siLDHA for 48 h. Cells were then exposed to hypoxia for 48 or 72 h. Consistent results demonstrated that miR-34a was not up-regulated under hypoxia in H9c2 cells with inhibition of glycolysis by siLDHA (Figure 3D).

Then cells were exposed to hypoxia for 48 or 72 h. As we expected, suppression of glycolysis by Oxamate contradicted the up-regulation of miR-34a (Figure 3C).

With the inhibition of glycolysis, we did not detect the up-regulation of miR-34a by hypoxia, suggesting an adaptive induction of miR-34a.

In summary, we report an adaptive up-regulation of miR-34a by long-time hypoxia, leading to suppression of glycolysis rate in cardiomyocytes.

As we expected, overexpression of miR-34a in H9c2 cells significantly suppressed glucose uptake to 40% (Figure 4B) and lactate production to 42% (Figure 4C).

To determine whether LDHA is a direct target of miR-34a, we performed a luciferase reporter analysis by cotransfecting with miR-34a mimic or control miRNA with a vector containing reporter-luciferase fused with either the wild-type 3′-UTR sequence or a sequence with a mutation in the predicted binding site of the 3′-UTR of LDHA mRNA.

Figure 6Inhibition of miR-34a attenuates the hypoxia -induced cardiomyocytes dysfunction through restoration of glucose metabolism(A) H9c2 cells were transfected with control inhibitor or miR-34a inhibitor for 48 h, cells were treated with hypoxia at 0, 48, or 72 h. The glucose uptake, (B) lactate product, and (C) cell viability were measured.

Our results in Figure 6A,B demonstrated inhibition of miR-34a increased glucose uptake and lactate production under 48 and 72 h hypoxia, suggesting inhibition of miR-34a might protect cardiomyocytes through restoration of glucose metabolism.

Under hypoxia, low miR-34a expressing H9c2 cells with knocking down of LDHA showed decreased survival rate under 48 or 72 h hypoxia compared with control miRNAs inhibitor or control siRNA (Figure 6E).

Moreover, we observed an invert correlation between miR-34a and LDHA in rat primary cardiomyocytes, low miR-34a expressing heart muscle tissues displayed high LDHA mRNA expressions (Figure 5E,F).

We identified LDHA as a direct target of miR-34a, which binds to the 3′-UTR region of LDHA mRNA.

Adaptive up-regulation of miR-34a by hypoxia.

In our future projects, we will focus on the roles of miR-34a in regulating cardiovascular disease using human cardiomyocytes from patients and their matched healthy cardio tissues.

To the best of our knowledge, it has not been reported that LDHA is a direct target of miR-34a in cardiomyocytes.

These results revealed that miR-34a is adaptively regulated under hypoxia, suggesting that miR-34a might be a therapeutic target for improvement of cardiomyocyte functions during ischemia.

These results demonstrate that LDHA is a direct target of miR-34a in cardiomyocytes.

Taken together, the above results demonstrated inhibition of the hypoxia -induced miR-34a could protect cardiomyocytes through restoration of LDHA and glucose metabolism.

Inhibition of miR-34a attenuates the hypoxia -induced cardiomyocytes dysfunction through restoration of glucose metabolism.

The suppressive roles of miR-34a in glucose metabolism in multiple cancer types have been reported.

In addition, the potential targets of miR-34a in the glycolysis pathway will be identified.

MiR-34a directly targets LDHA in cardiomyocytes.

Amongst the miRNAs we screened, miR-34a was found to be inhibited by short hypoxia exposure to 71% but induced by long hypoxia at 48 and 72 h to 181 and 302%, respectively (Figure 3A).

Taken together, the above results demonstrated that miR-34a acts as a glycolysis suppressor in rat cardiomyocytes.

To experimentally demonstrate whether miR-34a targets LDHA in cardiomyocytes, miR-34a mimic or control mimic was transfected into H9c2 cells.

Moreover, inhibition of miR-34a attenuated hypoxia -induced cardiomyocytes dysfunction.

Our results demonstrated that miR-34a could target LDHA in cardiomyocytes, which has not been reported before.

Furthermore, although we illustrated the binding sites of miR-34a on its target, LDHA was conserved in humans, rats, and other species (Figure 5B) and both in vitro and in vivo results consistently demonstrated the roles of miR-34a under hypoxia, the present study did not use human primary cardiomyocytes as its primary mo del.

The expressions of miR-34a were examined by real-time quantitative PCR (qPCR).

To further examine the molecular mechanisms for the miR-34a-modulated glycolysis suppression, the potential targets of miR-34a were investigated.

MiR-34a mimic, inhibitor, or control miRNAs were transfected into H9c2 cells at a concentration of 50 nM for 48 h using Lipofectamine 3000 (Invitrogen, CA, U. S. A. ) following the manufacturer’s instructions.

As we expected, H9c2 cells displayed significantly increased survival rates from 195 to 355% with inhibiting miR-34a under 72 h hypoxia (Figure 6C).

Figure 4 MiR-34a suppresses glucose metabolism in cardiomyocytes(A) H9c2 cells were transfected with control mimic or miR-34a mimic for 48 h, the expressions of miR-34a were measured by qRT-PCR.

MiR-34a mimic, miR-34a inhibitor, and their corresponding negative control were purchased from Shanghai GenePharma Co.

By searching the public miRNA database TargetScan, we found the 3′-UTR of LDHA contains a highly conserved binding site for miR-34a (Figure 5A,B).

To investigate whether inhibition of the hypoxia -induced miR-34a could protect cardiomyocytes under low oxygen conditions, we exposed H9c2 cells with or without miR-34a inhibition to hypoxic conditions.

In the present study, we report the protection effects on the hypoxia induced cardiomyocytes dysfunction by attenuating miR-34a expression.

Consistently, inhibition of miR-34a promoted glucose uptake (Figure 4E) to 144% and lactate production to 134% (Figure 4F).

IHC; immunohistochemistry Adaptive up-regulation of miR-34a by hypoxiaThe above results demonstrated that the hypoxia-modulated glycolysis in cardiomyocytes, to investigate the molecular mechanism.

Figure 3 MiR-34a is adaptively regulated by hypoxia(A) H9c2 cells were treated with low oxygen conditions for 0, 12, 24, 48, or 72 h, the expressions of miR-34a were measured by qRT-PCR.

MiR-34a targets LDHA in breast cancer [23], colon cancer [26], cervical cancer [27], and liver cancer [28].

MiR-34a suppresses glucose metabolism in cardiomyocytes.

The present study illustrates roles of miR-34a in the hypoxia -induced cardiomyocytes dysfunction and provides molecular mechanisms for the regulation of glycolysis by miR-34a.

MiR-34a inhibits anaerobic glycolysis in cardiomyocytes.

The position 406–413 of LDHA 3′-UTR contains putative binding sites for miR-34a.

In a recent publication, miR-34a was reported to be involved in the I/R -induced cardiomyocyte apoptosis [13].

We demonstrated that hypoxia adaptively induced miR-34a, leading to the impaired cardiomyocytes survival at a later stage (Figures 1– 3).

According to our results, we hypothesized that the long-time hypoxia exposure induced miR-34a may be due to an adaptive response to increased glycolysis, which contributes to the survival of cardiomyocytes under hypoxia.

Attenuation of the hypoxia -induced miR-34a protects cardiomyocytes through restoration of LDHA.

Cells were cotransfected with 100 ng plasmids containing wild-type or mutant 3′-UTR of LDHA with 50 nM miR-34a mimic or control miRNAs for 48 h according to manufacturer’s instructions using Lipofectamine 2000 reagent (Thermo Fisher Scientific).

It has been reported that miR-34a could repress cellular glycolysis [23].

MiR-34a inhibits anaerobic glycolysis in cardiomyocytesTo investigate the roles of miR-34a in the hypoxia-modulated glycolysis, we transfected miR-34a mimics or control mimics into cardiac cell line, H9c2 (Figure 4A).

MiR-34a is adaptively regulated by hypoxia.

Primary rat cardiomyocytes were isolated for measurement of miR-34a expressions by qRT-PCR.

Cotransfection of miR-34a decreased the luciferase activity of the reporter containing the wild-type 3′-UTR of LDHA to 32% in H9c2 cells (Figure 5D).

Attenuation of the hypoxia -induced miR-34a protects cardiomyocytes through restoration of LDHAWe demonstrated that hypoxia adaptively induced miR-34a, leading to the impaired cardiomyocytes survival at a later stage (Figures 1– 3).

7

miR-34a up-regulation in a transgenic mice mo del of Alzheimer’s disease resulted in a higher expression level of activated caspase-3 protein by inhibiting bcl-2 translation, suggesting that bcl-2 is an important target for miR-34a [22].

Because abnormal expression of miR-34a may contribute to the pathogenesis of Alzheimer’s disease, it is speculated that seizure -induced up-regulation of miR-34a may also play a role in the pathophysiology of epilepsy, at least in part by affecting bcl-2 expression.

What accounts for the neuroprotective effect is most likely due to a milder inhibitory effect of reduced miR-34a expression on bcl-2 translation, resulting in a lowered expression level of activated caspase-3 protein and subsequent reduction in seizure -induced neuronal death.

The results show that miR-34a is up-regulated during seizure -induced neuronal death or apoptosis, and targeting miR-34a is neuroprotective and is associated with an inhibition of an increase in activated caspase-3 protein.

The expression of activated caspase-3 protein in the post-SE rat hippocampus both before and after miR-34a antagomir/antagomir-control treatments as detected by western blot analysis is shown in B. Western blot detected an up-regulation in the expression of activated caspase-3 protein at 7 days post-SE in the rat hippocampus, when compared with control (* p <0.05, n = 6 for each group).

Experiments with the miR-34a antagomir revealed that targeting miR-34a led to an inhibition of activated caspase-3 protein expression, which may contribute to increased neuronal survival and reduced neuronal death or apoptosis.

Sano and Henshall reported that miR-34a is up-regulated during seizure -induced neuronal death [7] and concluded that prolonged seizures cause up-regulation of miR-34a in a subfield-specific, temporally restricted manner.

Furthermore, Sano et al. reported miR-34a up-regulation during seizure -induced neuronal death in a mouse mo del [7] and concluded that miR-34a up-regulation in subfield-specific, temporally restricted manner is most likely not important for seizure -induced neuronal death.

The expression of miR-34a after targeting and the expression change of activated caspase-3 protein were examined.

Because miR-34a was up-regulated in this work and in a previous study [14], we hypothesized that miR-34a is up-regulated in the rat hippocampus after status epilepticus and contributes to seizure -induced neuronal death.

This is somewhat different from our results, as we have not only found an up-regulation of miR-34a in the post-status epilepticus rat hippocampus but also detected a neuro-protective effect of targeting miR-34a during seizure -induced neuronal death.

Our results showed that miR-34a is up-regulated in rats after status epilepticus and targeting miR-34a in vivo could alleviate seizure -induced neuronal death or apoptosis and increase the number of surviving neurones in the hippocampus.

This study also demonstrated up-regulation of miR-34a in seizure -induced neuronal death or apoptosis and showed the neuro-protective effect of targeting miR-34a.

Our study showed the expression profile of miRNAs in the hippocampus in a rat mo del of temporal lobe epilepsy and an increase in the expression of the pro-apoptotic miR-34a in post-status epilepticus rats.

We antagonised the expression of miR-34a in post-SE rat hippocampus by using an antagomir that specifically targets miR-34a.

miR-34a antagomir treatment had an inhibitory effect on activated caspase-3 protein expression and led to an increase in neuronal survival as well as a decrease in seizure -induced neuronal death at 7 days post-SE in the rat hippocampus (Table 2, Figure 8 and Figure 9).

We focused on the effects of antagonising miR-34a on the expression of the end-phase apoptosis executor, the caspase-3 gene, to show that pro-apoptotic miR-34a and caspase-3 expression levels are related.

Inhibition of miR-34a expression by the miR-34a antagomir at 7 days post-SE in the rat hippocampus is shown in.

Moreover, activated caspase-3 protein expression was significantly down-regulated in the post-SE rat hippocampal CA1 and CA3 regions after miR-34a antagomir treatment (Figure 7G and Figure 7K) when compared with the antagomir-control -treated group (Figure.

In conclusion, our results demonstrate the expression profile of miRNAs in the hippocampus in a rat mo del of TLE and the pattern of expression increase of the pro-apoptotic miR-34a in post-SE rats.

In this mo del, neuronal injury leads to miR-34a up-regulation, and the protective effect of the miR-34a antagomir in our study may be related to the ability of miR-34a to induce apoptosis in post-status epilepticus rats.

The Sano study did not detect a protective effect of the miR-34a antagomir in the kainic acid -induced status epilepticus mouse mo del, although they showed an up-regulation of miR-34a in hippocampal subfields after status epilepticus.

A. The miR-34a antagomir significantly inhibited the expression of miR-34a in the post-SE rat hippocampus when compared with the antagomir-control (Data are presented as the mean ± SEM, * p < 0.05; n = 6 for each group).

miR-34a was significantly up-regulated at 1 day, 7 days and 2 weeks post-status epilepticus and at 2 months after temporal lobe epilepsy.

The potential mechanism of miR-34a regulation of downstream targets needs further mention.

As up-regulation of miR-34a caused by prolonged seizures in vivo has already been shown, we propose that miR-34a may have a more important role in the lithium- pilocarpine -induced status epilepticus in rats.

The expression of the pro-apoptotic miR-34a was detected at 1 day, 7 days and 2 weeks post-status epilepticus and at 2 months after temporal lobe epilepsy.

Expression of the pro-apoptotic miR-34a in the rat hippocampus was examined.

Because seizure -induced neuronal death may be more prominent when miR-34a has much stronger pro-apoptotic function, targeting miR-34a may result in subsequent neuroprotective effects.

The expression pattern of miR-34a is shown in Figure 5. Pro- apoptotic miR-34a was significantly increased in post-SE rat hippocampus at all four time points chosen (* p <0.05).

This is consistent with results from previous studies that identified bcl-2 as a miR-34a target [23- 26].

Furthermore, the miR-34a antagomir specifically targeting miR-34a did not exert any antagonising effects on other miRNAs in the rat hippocampus at 7 days post-SE (data not shown).

This research indicates the neuroprotective effects of targeting miR-34a in seizure- induced neurone cell death or apoptosis in post-status epilepticus rats.

To look for expression changes of miR-34a and its potential downstream molecules in post-SE rats that had received infusions of miR-34a antagomir and antagomir-control, rats were anesthetised using chloral hydrate (10%, 5 mL/kg, ip. )

at 7 days post-SE before their hippocampal tissue was removed for detection of miR-34a expression and detection of its potential downstream molecules including activated caspase-3 protein.

Figure 5 The expression pattern of miR-34a is shown.

miR-34a expression post-SE.

Furthermore, an increase in expression of the pro-apoptotic miR-34a was demonstrated in the post-status epilepticus rat hippocampus.

The effects of altering the expression of miR-34a and activated caspase-3 protein on neuronal survival and neuronal death or apoptosis post-status epilepticus were assessed.

Recent work by Agostini et al. found that pro-apoptotic miR-34a regulates neurite outgrowth, spinal morphology and function [5], and this work highlights the importance of miR-34a in neuronal differentiation and synaptogenesis.

Moreover, the expression level of activated caspase-3 protein at 7 days post-SE in the rat hippocampus decreased after miR-34a antagomir treatment, when compared with the miR-34a antagomir-control -treated group (* p <0.05) (Figure 6B).

The expression of activated caspase-3 protein at 7 days post-SE in the rat hippocampus, however, decreased in the miR-34a antagomir -treated group, when compared with the antagomir-control -treated group (** p < 0.05, n = 6 for each group).

miR-34a antagomir treatment significantly reduced the expression of miR-34a in the rat hippocampus at 7 days post-SE (* p <0.05), when compared with the miR-34a antagomir-control -treated group (Figure 6A).

The pro-apoptotic miR-34a displayed increased expression at all four time points chosen (Data are presented as the mean ± SEM, * p <0.05; n = 6 for each group), when compared with control.

For example, the pro-apoptotic miR-34a was detected in our study as a significantly deregulated miRNA, and further investigation of the expression and function of miR-34a in the mechanism of epilepsy was performed.

The time points chosen for miR-34a detection were 1 day, 7 days, 2 weeks post-SE and 2 months (TLE).

Whether miR-34a mediates seizure -induced neuronal death and how it is involved in that process in the wi dely used status epilepticus (SE) rat mo del remains to be explored.

miR-34a as an epigenetic factor may play a role in modulating apoptosis-related genes such as bcl-2 and the caspases after status epilepticus.

miR-34a antagomir experiments.

The study of miR-34a in the mouse mo del of epilepsy has delineated a restricted role for this pro-apoptotic miRNA.

Seizure -induced neuronal death was less prominent after treatment with the miR-34a antagomir in the post-status epilepticus rat hippocampus.

However, they suggested that miR-34a is most likely not important for seizure -induced neuronal death in the mouse mo del.

A miR-34a antagomir or an antagomir-control (miR-Ribo [TM]; RiboBio Co.

Figure 6 The results of the miR-34a antagomir experiment.

Furthermore, the degree to which miR-34a can induce apoptosis may vary between different mo dels.

miR-34a antagomir outcomes.

In the same regions, however, neuronal death or apoptosis was decreased and neuronal survival was increased significantly after miR-34a antagomir or antagomir-control treatment ([b] P < 0.01, miR-34a antagomir vs antagomir-control, n = 6 /group).

To study the potential function of miR-34a in post-SE rat hippocampal neuronal apoptosis, a miRNA antagomir strategy was adopted.

The antagomir of miR-34a was then utilised.

For example, there is evidence for miR-34a having varying effects in the promotion of apoptosis [20, 21].

8

Knockout of miR-34a expression enhanced the hepatoprotective effect of H [2]S on old ratsAs the expression of miR-34a is abundant in hepatocytes of the old rats, we wondered whether the hepatoprotective effect of H [2]S would be enhanced if its expression was down-regulated by an miR-34a inhibitor.

H [2]S reduced miR-34a expression in hepatocytes of the young rats but has no effect in old ratsTo further study the mechanism of H [2]S on Nrf-2 expression in the liver after I/R, we detected the expression of many miRNAs including miR-34a, miR-28, miR-155, miR-27a, miR-144 and miR-153, which may be involved in regulating the expression of this transcription factor [28].

As the expression of miR-34a is abundant in hepatocytes of the old rats, we wondered whether the hepatoprotective effect of H [2]S would be enhanced if its expression was down-regulated by an miR-34a inhibitor.

To further study the mechanism of H [2]S on Nrf-2 expression in the liver after I/R, we detected the expression of many miRNAs including miR-34a, miR-28, miR-155, miR-27a, miR-144 and miR-153, which may be involved in regulating the expression of this transcription factor [28].

Second, miR-34a inhibitor significantly increased the expression of Nrf-2 and its downstream target gene in the old rats with or without NaHS pretreatment.

H [2]S might promote Nrf-2 -mediated signaling pathway through the down-regulation of the expression of miR-34a.

As shown in Figure 6A and 6B, miR-34a mimic could reduce the expressions of Nrf-2, NQO1, GST and HO-1 in the young rats after hepatic I/R pretreated with NaHS, suggesting that the promotion of Nrf-2 -mediated signaling pathway by NaHS might act through down-regulation of the miR-34a level.

In addition, miR-34a expression was regulated in a partial hepatectomy mo del, which resulted in the inhibition of hepatocyte proliferation [14].

Hepatoprotective effect were improved in the I/R group treated with NaHS and the miR-34a inhibitor compared to those in the miR-34a inhibitor-only group (Figure 5A, P<0.01), with the inhibitor further attenuating the pathological changes in the livers of the NaHS -treated old rats (Figure 5B, P<0.01).

First, in the young rats, miR-34a mimic reduced the expression of Nrf-2 and its downstream target gene in hepatic I/R pretreated with NaHS.

As shown in Figure 3E and 3F, NaHS significantly decrease miR-34a expression in hepatocytes from young rats after I/R, but it had no effect on miR-34a expression in the hepatocytes of the old rats.

The old rats (20 months) were also randomly and equally divided into six groups: sham, hepatic I/R, hepatic I/R +20 µmol/kg of NaHS, hepatic I/R+ anti-NC, hepatic I/R+ an miR-34a inhibitor, hepatic I/R+NaHS+anti-NC, and hepatic I/R+NaHS+an miR-34a inhibitor.

Overexpression of miR-34a inhibited the hepatoprotective effect of H [2]S on young rats.

0113305.g004 Figure 4Overexpression of miR-34a inhibited the hepatoprotective effect of H [2]S on young rats.

More importantly, the inhibition of miR-34a expression enhanced the effect of H [2]S on hepatic I/R injury in the old rats.

Overexpression of miR-34a could inhibit hepatoprotective effect of H [2]S on young rats.

On the other hand, miR-34a inhibitor significantly increased the expressions of Nrf-2, NQO1, GST and HO-1 in the old rats after hepatic I/R injury with NaHS treatment (Figure 6C and 6D), suggesting that miR-34a -mediated Nrf-2 signaling pathway is involved in hepatoprotective effects of H [2]S. 10.1371/journal.

Overexpression of miR-34a could inhibit hepatoprotective effect of H [2]S on young ratsNext, the role of miR-34a in the hepatoprotective effect of H [2]S on young rats was further explored.

On the other hand, miR-34a inhibitor significantly increased the expressions of Nrf-2, NQO1, GST and HO-1 in the old rats after hepatic I/R injury with NaHS treatment (Figure 6C and 6D), suggesting that miR-34a -mediated Nrf-2 signaling pathway is involved in hepatoprotective effects of H [2]S. 10.1371/journal.

NaHS significantly decreased miR-34a expression in the hepatocytes of the young rats but had little effect on miR-34a expression in the old rats due to the hepatoprotective effect of H [2]S. To investigate the relationship between miR-34a and the effect of NaHS on hepatic I/R, we used miR-34a mimic and miR-34a inhibitor.

Based on that, we believe that the oxidative stress defense function of NaHS might rely on the regulation of miR-34a expression.

Knockout of miR-34a expression enhanced the hepatoprotective effect of H [2]S on old rats.

Knockout of miR-34a expression enhanced the hepatoprotective effect of H [2]S on the old rats.

0113305.g005 Figure 5Knockout of miR-34a expression enhanced the hepatoprotective effect of H [2]S on the old rats.

The injection of miR-34a inhibitor increased the mRNA (C) and protein (D) levels of Nrf-2, NQO1, GST and HO-1 in the old rats in the with I/R+pretreatment with NaHS group.

The effect of H [2]S on miR-34a expression in the I/R liver.

In addition, NaHS pretreatment decreased miR-34a expression in the hepatocytes of the young rats treated with hepatic I/R.

The protective effect of NaHS when it was combined with miR-34a inhibitor in the old rats provided further evidence for the role of miR-34a in hepatic I/R.

Pretreatment with NaHS had little effect on the serum levels of ALT and AST, which were significantly decreased by miR-34a inhibitor in the old rats with I/R.

In the old rats, the combination of NaHS and the miR-34a inhibitor prevented the damage caused by hepatic I/R.

Third, miR-34a level was negatively correlated with Nrf-2 expression, which is consistent with the finding of a previous report [13].

An increase in the expression of miR-34a was reported to be involved in age -dependent loss of oxidative defense in the liver [13].

Real-time PCR assays showed that, among these miRNAs, miR-34a was significantly up-regulated in the hepatocytes of the young and old rats after I/R (Figure 3A and B).

In addition, the expression of miR-34a was significantly increased in the hepatocytes of the young rats administered NaHS and the miR-34a mimic (Figure 4B, P<0.01).

0113305.g003 Figure 3The effect of H [2]S on miR-34a expression in the I/R liver.

As a target gene of miR-34a, nuclear erythroid-related factor 2 (Nrf-2) is involved in the detoxification process.

An miR-34a mimic (5′-UGGCAGUGUCUUAGCUGGUUGU-3′, 10 nmol) or miR-34a inhibitor (5′-ACAACCAGCUAAGACACUGCCA-3′, 10 nmol) in 0.1 ml of saline buffer was injected into the tail vein of the rats for 48 h before the administration of NaHS and subsequent liver I/R.

To explore the mechanism of miR-34a in the hepatoprotective effects of H [2]S, the expression of Nrf-2, NQO1, GST and HO-1 was measured in the young and old rats after injection of miR-34a mimic or inhibitor.

Our results also suggested that the hepatoprotective effect of NaHS in the young rats was due to decreased miR-34a expression, which resulted in the promotion of Nrf-2 signaling pathway.

miR-34a mediation of Nrf-2 signaling pathway was implicated in the hepatoprotective effects of H [2]STo explore the mechanism of miR-34a in the hepatoprotective effects of H [2]S, the expression of Nrf-2, NQO1, GST and HO-1 was measured in the young and old rats after injection of miR-34a mimic or inhibitor.

H [2]S reduced miR-34a expression in hepatocytes of the young rats but has no effect in old rats.

As expected, the administration of the miR-34a inhibitor administration decreased serum levels of ALT and AST in the old rats with hepatic I/R.

A cholesterol-conjugated miR-34a mimic or an miR-34a inhibitor (both from RiboBio, Guangzhou, China) was used for in vivo RNA delivery.

In recent years, the role of miR-34a in the regulation of liver function and survival has received a great deal of attention [11]– [12].

Our data also indicated that miR-34a mediation of the Nrf-2 signaling pathway was implicated in the hepatoprotective effect of H [2]S. There are several lines of evidence to support this.

The levels of miR-34a were higher in the hepatocytes of the old rats than in those of the young rats.

We also measured the expression of miR-34a in the liver following I/R and treatment with NaHS.

However, the miR-34a mimic significantly reversed the effect of H [2]S on hepatic I/R injury (Figure 4A, P<0.01).

Our data also showed that miR-34a was implicated in H [2]S -induced prevention of liver damage in the young rats.

The young rats (3 months) were randomly and equally divided into six groups: sham, hepatic I/R, hepatic I/R +20 µmol/kg of NaHS, hepatic I/R+ a negative control oligonucleotide (NC), hepatic I/R+ an miR-34a mimic, hepatic I/R+NaHS+NC, and hepatic I/R+NaHS+an miR-34a mimic.

miR-34a mediation of Nrf-2 signaling pathway was implicated in the hepatoprotective effects of H [2]S. miR-34a mediated Nrf-2 signaling pathway was implicated in the hepatoprotective effects of H [2]S..

0113305.g006 Figure 6miR-34a mediated Nrf-2 signaling pathway was implicated in the hepatoprotective effects of H [2]S. The injection of miR-34a mimic decreased the mRNA (A) and protein (B) levels of Nrf-2, NQO1, GST and HO-1 in the young rats in the I/R+pretreatment with NaHS group.

Injection with miR-34a mimic diminished the protective effect of NaHS on hepatic I/R injury in the young rats.

Levels of miR-34a were lower in the young rats in the sham group (C) and the in I/R group (D) than in the old rats.

After a tail vein injection of the cholesterol-conjugated miR-34a mimic, a slight increase in the serum levels of ALT and AST was observed in hepatic I/R young rats.

The levels of miRNAs (miR-34a, miR-28, miR-155, miR-27a, miR-144 and miR-153) were quantified with a TaqMan PCR kit.

Next, the role of miR-34a in the hepatoprotective effect of H [2]S on young rats was further explored.

These results indicate that miR-34a was involved in the hepatoprotective effect of H [2]S on hepatic I/R in the young rats.

The serum levels of ALT and AST were significantly decreased in the young rats following the pretreatment with NaHS, and this decrease was reversed by miR-34a mimic.

However, the role of miR-34a in hepatic I/R damage remains largely unknown.

MiR-34a was previously reported to be involved in the regulation of liver function and survival [11].

The injection of miR-34a mimic decreased the mRNA (A) and protein (B) levels of Nrf-2, NQO1, GST and HO-1 in the young rats in the I/R+pretreatment with NaHS group.

9

Taken together, our results have demonstrated that miR-34a-5p was up-regulated in myocardium and plasma of rats with Dox -induced cardiotoxicity, and DEX could suppress the Dox-promoted upregulation of miR-34a-5p.

MiR-34a-5p could augment p66shc expression through suppressing Sirt1 to result in increased expression of Bax, activated caspase-3 and decreased expression of Bcl-2, contributing to Dox -induced apoptosis of cardiomyocytes.

Furthermore, we separately transfected H9c2 cells with miR-34a-5p mimic and siRNA targeting Sirt1, followed by examining expressions of Bax and Bcl-2. Western blotting showed that Bax was increased, but Bcl-2 was down-regulated in H9c2 cells transfected with miR-34a-5p mimic or Sirt1 siRNA.

MiR-34a-5p enhances p66shc expression by targeting Sirt1, resulting in increases of Bax and the activated caspase-3, and a decrease of Bcl-2 (Bcl-2 is also a direct target of miR-34a-5p), and contributing to Dox -induced apoptosis of cardiomyocytes.

In addition, inhibition of P53 by P53 siRNA could also suppress Dox-promoted miR-34a-5p expression (Fig.   6C).

Moreover, our data showed that Bcl-2 protein, but not Bcl-2 mRNA, was significantly suppressed by miR-34a-5p (Figs  3D, 5C), indicating that miR-34a-5p modulates Bcl-2 expression at the post-transcriptional level, which is also supported by the previous report that Bcl-2 was a target gene of miR-34a-5p [42].

Overexpression of miR-34a-5p increased the mitochondrial depolarization (Fig.   3E), Bax expression and the activated caspase-3, and attenuated Bcl-2 expression in H9c2 cells (Figs  3D, 5C, Supplementary Figure  2).

of Western-blotting showed that miR-34a-5p mimic and Sirt1 siRNA could efficiently suppress the protein expression of Sirt1, but enhance p66shc expression, along with increases of Bax and the activated caspase-3, and a decrease of Bcl-2 (Fig.   5C, Supplementary Figure  2A).

MiR-34a-5p could enhance the apoptosis of cardiomyocytes by increasing Bax expression and the activated caspase-3, and inhibiting Bcl-2 expression.

Knockdown of P65 by P65 siRNA inhibited Dox-promoted miR-34a-5p expression in H9c2 cells (Fig.   6C).

We used NF-κB P65 siRNA, NF-κB P65 inhibitor JSH23 and QNZ, and P53 siRNA to further verify the participations of NF-κB P65 and P53 in Dox-promoted upregulation of miR-34a-5p in H9c2 cells.

The present study also showed that Dox -upregulated miR-34a-5p was decreased after enforced expression of Sirt1 in H9c2 cells, this result has been supported by the negative feedback loop between miR-34a-5p, SIRT1 and p53 39, 40.

Meanwhile, results of RT-qPCR assay demonstrated that miR-34a-5p was significantly up-regulated by Dox, but could be reversed after over -expression of Sirt1 (Fig.   5F).

The above results revealed that miR-34a inhibits Sirt1 expression at the post-transcriptional level.

Overexpression of miR-34a-5p could markedly increase expression of Bax mRNA, but not Bcl-2 mRNA, in H9c2 cells (Fig.   3D).

Collectively, our data suggest that up-regulation of miR-34a-5p in Dox -induced cardiomyocytes results from the activations of NF-κB and P53 signaling.

Sirt1 mRNA expression (D) and protein expression (E) in miR-34a-5p -modified H9C2 RT-qPCR and Western blot assay, respectively.

MiR-34a-5p expression in Dox -induced H9c2 cells with separate pre-treatment with NF-κB inhibitor JSH23 and QNZ (B), or with knockdown of P65 (C) and P53 (D), was assessed by RT-qPCR assay.

Figure 6Up-regulation of miR-34a-5p in H9c2 cells through NF-κB pathway.

Consistent with the Heatmap analysis of the dysregulated miRNAs over 1.5 fold in rat plasma, results of RT-qPCR assay confirmed that plasma miR-34a-5p was significantly upregulated in the 4-week Dox -treated rats, but was reversed in rats received 4-week Dox plus DEX treatments (Fig.   2A,B).

Our data demonstrated the NF-κB signal pathway mediates the upregulation of miR-34a-5p in cardiomyocytes exposed to Dox treatment.

Compared with the negative scramble control, Sirt1 protein expression was significantly decreased in miR-34a-5p -modified H9c2 cells (p < 0.01), without significant change of Sirt1 mRNA expression (Fig.   4D,E).

Consistent with the Heatmap analysis of the dysregulated miRNAs over 1.5 fold in rat myocardium, results of RT-qPCR assay confirmed that miR-34a-5p was significantly upregulated in the myocardium of 4-week Dox -treated rats, but were reversed in the myocardium of rats received 4-week Dox plus DEX treatments (Fig.   1F,G).

We also concluded that activation of NF-κB signaling pathway mediates the upregulation of miR-34a-5p in Dox -induced cardiomyocytes.

Our data showed that Sirt1 protein expression was significantly reduced in miR-34a-5p -modified H9c2 cells, but Sirt1 mRNA level remained unchanged.

Therefore, the present study suggests that miR-34a-5p might be a potential target for therapy and diagnosis of Dox -induced cardiotoxicity (as shown in Fig.   7).

MiR-34a-5p is up-regulated by Dox through the NF-κB pathway in cardiomyocytes.

Collectively, we demonstrated that miR-34a-5p participated in Dox -induced cardiotoxicity by targeting Sirt1.

This conclusion has been supported by previous studies showing that Sirt1 was a target gene of miR-34a-5p 39– 41.

org) showed that Sirt1was a potential target gene of miR-34a-5p.

The present study has provided several lines of evidence to support the notion that miR-34a-5p enhances Dox -induced apoptosis through targeting Sirt1.

Sirt1 was identified as a target gene of miR-34a-5p in Dox -induced cardiotoxicity.

The RT-qPCR result demonstrated that treatment with either JSH23 or QNZ prevented Dox -induced miR-34a-5p expression (Fig.   6B).

Identification of Sirt1 as a target of miR-34a-5p.

Sirt1 was confirmed as a target of miR-34a-5p, and Sirt1/p66shc pathway mediated the pro-apoptotic effect of miR-34a-5p on cardiomyocytes.

MiR-34a-5p was upregulated in the myocardium of Dox -treated rats.

Figure 4Identification of Sirt1 as a target of miR-34a-5p.

Expression of miR-34a-3p in rat myocardium and H9c2 cells was detected by RT-qPCR as previous report [19].

MiR-34a-5p is upregulated in Dox -induced H9c2 cells via NF-κB pathway.

Using a site-directed mutagenesis kit (TransGen, Beijing, China), miR-34a-5p complementary binding sequence ACUGCC was replaced with AGACGC to construct recombinant luciferase reporter plasmids containing the mutant potential miR-34a-5p binding sequences.

n = 3. Determination of miR-34a-5p (C), Bax and Bcl-2 mRNA expression (D) in H9C2 cells by RT-qPCR assay.

First, the in silico prediction indicated that Sirt1 was a potential target of miR-34a-5p, and the dual luciferase assay revealed that miR34a-5p specifically bound to the 746–752, 1236–1242 sites in the 3′-UTR of Sirt1.

Plasma miR-34a-5p was elevated post-anthracyclines treatment.

Figure 7 Schematic diagram of the mechanism whereby miR-34a-5p exerts the pro-apoptotic effect in DOx -induced toxic cardiomyopathy.

At 24 h post-transfection of miR-34a-5p mimic or scramble control, H9c2 cells were washed thrice with PBS (pH 7.2, 1 mL), then incubated for 15 min with 3 μM rhodamine 123 (Molecular Probes, USA) in PBS.

Figure 5Sirt1 mediates the pro-apoptosis effect of miR-34a-5p in Dox -treated H9C2 cells.

RT-qPCR result showed that miR-34a-5p was efficiently transfected into H9c2 cells (p < 0.001) (Fig.   4C).

Additionally, hsa-miR-34a-5p was found significantly elevated in plasma of DLBCL patients received 9-week or 16-week epirubicin treatment.

Sirt1/p66shc pathway mediates the pro-apoptotic effect of miR-34a-5p on cardiomyocyres.

Therefore, miR-34a-5p was shown involved in Dox -induced cardiotoxicity, and it was also a potential biomarker for Dox -induced cardiotoxicity.

As in our previous report [21], the recombinant luciferase reporter plasmids containing sequences of potential miR-34a-5p binding sites in 3ʹ UTR of Sirt1 gene were constructed.

The 2 [−∆∆Ct] method was used to calculate relative expression levels of coding genes and miR-34a-5p between treatments.

Levels of plasma hsa-miR-34a-5p was also determined in DLBCL patients received continual 9 and 16-week epirubicin therapy.

The seed sequence of miR-34a-5p is CCGUCA, and the complementary nucleotide sequences are shown in red words.

Meanwhile, miR-34a-5p was observed significantly increased in H9c2 cells exposed to Dox treatment, as well as in the supernatant (Fig.   3C, Supplementary Figure  1).

Human embryonic kidney (HEK) 293 cells (3 × 10 [5] cells per well in 12-well plate) were co -transfected with 200 ng of recombinant luciferase reporter plasmid, 50 nM miR-34a-5p mimic, and 20 ng of pRL-TK as an internal control (Promega, Madison, WI).

Notablely, miR-34a-5p was observed consistently increased in the myocardium and plasma of 4-week Dox -treated rats, but was reversed in the myocardium and plasma of 4-week Dox plus DEX -treated rats, as well as in the myocardium and plasma of rats received 8-week Dox or Dox plus DEX treatments (data not shown).

These data indicated that the elevated plasma miR-34a-5p of Dox -treated rats and of DLBCL patients received epirubicin treatment was derived from myocardium with Dox -induced cardiotoxicity.

Overall, we identified miR-34a-5p/Sirt1/p66shc pathway mediates doxorubicin -induced apoptosis of cardiomyocytes and possibly provided a valuable way to protect against Dox -induced cardiotoxicity.

Figure 2The plasma miR-34a-5p was increased in rats and patients received Dox treatment.

Cells were transfected with 50 nM scramble, miR-34a-5p mimic, Sirt1 siRNA and NF-κBP65 by oligofectamine reagent (Invitrogen, Carlsbad, CA), and were transfected with pcDNA3-Sirt1 by lipofectamine 2000 reagent (Invitrogen, CA).

To normalize RNA content, the exogenous cel-miR-54 was used for plasma miR-34a-5p template normalization.

In the present study, we observed that miR-34a-5p was markedly increased in the apoptotic H9c2 cells after Dox treatment, as well as in the supernatant.

Therefore, activation of Sirt1/p66shc pathway mediated the pro-apoptotic effect of miR-34a-5p on cardiomyocytes in Dox -induced cardiotoxocity.

These data revealed that miR-34a-5p exerted the pro-apoptotic effect in Dox -treated cardiomyocytes, which was supported by previous reports 36, 37.

MiR-34a-5p was identified consistently increased in the myocardium and plasma of Dox -treated rats, and plasma hsa-miR-34a-5p was also confirmed increased in lymphoma patients received Dox therapy.

Two matching positions for miR-34a-5p within 3′-UTR of Sirt1 are shown in Fig.   4A.

Determination of miR-34a-5p in the supernatant of H9c2 cells or in the plasma of rats and DLBCL patients were performed by using the poly(A) method [20] as follows.

Next, H9c2 cells were separately transfected with scramble control and miR-34a-5p mimic for 24 hrs.

10

miR-34a expression has been found to be increased in animal mo dels or human patients with alcoholic liver injury, non-alcoholic fatty liver disease (NAFLD), liver fibrosis or HCC, and its expression level correlates with disease severity [15– 20].

Considering that upregulation of miR-34a is a common event in many liver diseases and that SIRT1 is frequently involved, we hypothesize that the activation of the miR-34a/SIRT1/p53 signaling pathway is closely related to hepatocytes and contributes to the progress of liver disease.

However, previous studies have revealed that miR-34a is upregulated in many liver diseases, from fatty liver disease to HCC [29– 31].

miR-34a is transcriptionally regulated by the p53 tumor suppressor protein and regulates a plethora of target proteins, which are involved in the cell cycle, apoptosis, differentiation and cellular development [25].

miR-34a is the direct target gene of p53, and one of the miR-34a targets is sirtuin 1 (SIRT1), which can inhibit p53 -dependent apoptosis by deacetylating all major p53 acetylation sites [21, 22].

Consequently, Ac-p53 was upregulated in miR-34a mimic -treated cells, and SRT1720 reversed the upregulation induced by miR-34a (Fig 4B).

Using a CCl [4] -induced rat liver fibrosis mo del, the upregulation of miR-34a and Ac-p53 and downregulation of SIRT1 were observed.

The increases in the mRNA levels and protein expression were significantly downregulated when miR-34a transfected hepatocytes were treated with SRT1720 (Fig 5A and 5B).

SIRT1 expression decreased with the upregulation of miR-34a, and SRT1720 abolished the miR-34a -induced decrease (Fig 4B).

SIRT1 has long been identified as the target protein of miR-34a [36], although there have been no reports linking upregulation of miR-34a with SIRT1 in liver fibrosis.

miR-34a was upregulated in the CCl [4] group and showed slightly decreased expression in the CCl [4] + SRT1720 -treated group (Fig 3A).

Downregulation of miR-34a has been found in many cancers [26– 28]; thus, miR-34a is thought to be a tumor suppressor.

As shown in Fig 2A, miR-34a expression increased significantly in a CCl [4] treatment time -dependent manner, and SRT1720 treatment significantly reversed the CCl [4] -induced upregulation of miR-34a.

Upregulation of miR-34a may inhibit SIRT1, thus activating p53 and forming a positive feedback loop [22].

Because miR-34a is also upregulated in liver fibrosis, the extent to which the miR-34a/SIRT1/p53 signaling pathway is involved in liver fibrosis and the manner in which it affects hepatocytes and HSCs are unclear.

Although it has been reported that miR-34a can target acyl-CoA synthetase long-chain family member 1 and impair the lipid metabolism in the liver, resulting in the development of liver fibrosis [19], the function of the classical miR-34a/SIRT1/p53 signaling pathway in liver fibrosis is presently unclear.

Taken together, upregulation of miR-34a induced the apoptosis of hepatocytes and thus activated HSCs through the activation of the miR-34a/SIRT1/p53 signaling pathway.

The Upregulation of miR-34a -induced apoptosis of hepatocytes.

Upregulated concentration of miR-34a was observed in a dose -dependent manner in miR-34a mimic -transfected L-02 cells with or without SRT1720 (Fig 4A).

Because miR-34a upregulation was only observed in hepatocytes, we wondered how miR-34 functions in liver fibrosis.

The expression of miR-34a in hepatocytes was determined 24 h after transfection.

0158657.g003 Fig 3Primary hepatocytes and HSCs were isolated from rats at 4 and 8 w. Expression of miR-34a (A, C), SIRT1, p53, Ac-p53 and β-actin (B, D) were detected in the two types of primary cells.

However, no changes in the expression of miR-34a or these proteins were observed in primary HSCs (Fig 3C and 3D), although the variability of miR-34a in primary HSCs was a little great, which may be related with the culture activation of primary HSCs isolated from different rats.

As shown in Fig 4C, miR-34 significantly induced the apoptosis of L-02 cells in a dose -dependent manner, and the induced apoptosis was then inhibited by SRT1720.

Expression of miR-34a (A), SIRT1, p53, acylated p53 (Ac-p53) and β-actin (B) were detected in four rat groups at three time points.

The miR-34a -induced apoptosis of hepatocytes significantly increased the mRNA levels of α-SMA, TGF-β1, and collagen I (Fig 5A) and the protein expression of α-SMA and collagen I (Fig 5B).

0158657.g002 Fig 2Expression of miR-34a (A), SIRT1, p53, acylated p53 (Ac-p53) and β-actin (B) were detected in four rat groups at three time points.

Thus, the miR-34a/SIRT1/p53 signaling pathway forms a positive feedback loop wherein p53 induces miR-34a and miR-34a then activates p53 by inhibiting SIRT1, playing an important role in cell proliferation and apoptosis [22].

0158657.g005 Fig 5HSCs LX-2 cells were co-cultured with pre -treated L-02 cells without SRT1720 for 24 h. L-02 cell were transfected with miR-34a mimics (20, 50 nM) in the presence/absence of SRT1720 for 24 h. The mRNA levels of α-SMA, TGF-β1 and collagen I (A) and the protein expression ofα-SMA and collagen I (B) in LX-2 cells were detected.

Human normal hepatocytes cell line L-02 cells were transfected with miR-34a mimics (20, 50 nM) or negative miRNA control (NC) with or without SRT1720 for 48 h. Expression of miR-34a was confirmed (A) at 24 h after transfection.

HSCs LX-2 cells were co-cultured with pre -treated L-02 cells without SRT1720 for 24 h. L-02 cell were transfected with miR-34a mimics (20, 50 nM) in the presence/absence of SRT1720 for 24 h. The mRNA levels of α-SMA, TGF-β1 and collagen I (A) and the protein expression ofα-SMA and collagen I (B) in LX-2 cells were detected.

Primary hepatocytes and HSCs were isolated from rats at 4 and 8 w. Expression of miR-34a (A, C), SIRT1, p53, Ac-p53 and β-actin (B, D) were detected in the two types of primary cells.

miR-34a mimic -transfected L-02 cells treated with or without SRT1720 were cultured for 24 h and then co-cultured with HSCs LX-2 cells without SRT1720 for another 24 h. The mRNA levels of several liver fibrosis-related proteins, including α-SMA, TGF-β1 and collagen I, and the protein expression of α-SMA and collagen I in HSCs were detected.

Moreover, activation of SIRT1 decreased the expression of miR-34a and the acylation of p53.

0158657.g004 Fig 4Human normal hepatocytes cell line L-02 cells were transfected with miR-34a mimics (20, 50 nM) or negative miRNA control (NC) with or without SRT1720 for 48 h. Expression of miR-34a was confirmed (A) at 24 h after transfection.

Next, the expression of miR-34a, SIRT1, p53 and Ac-p53 were determined.

miR-34a repression of SIRT1 regulates apoptosis.

The miR-34a/SIRT1/p53 signaling pathway is activated in hepatocytes but not in HSCs.

This might because of the excessed miR-34a mimics in the transfected cells.

Hepatocyte L-02 cells were seeded 6-well plates 4 h before transfection, and then transfected with mimics of miR-34a or negative control miRNAs (Jima, Shanghai, China) using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen).

Our data indicated that the miR-34a/SIRT1/p53 signaling pathway participated in the liver fibrosis process by inducing the apoptosis of hepatocytes, and thus activating HSCs.

The activation of the miR-34a/SIRT1/p53 signaling pathway was always related to apoptosis; thus, we examined the apoptosis of these treated L-02 cells.

Our results also showed that activating the miR-34a/SIRT1/p53 signaling pathway induced hepatocyte apoptosis.

Effect of microRNA-34a in cell cycle, differentiation, and apoptosis: a review.

For detection of the miRNA level by RT-qPCR, a TaqMan [@] microRNA assay (Applied Biosystems) was used to quantify the relative expression level of miR-34a (assay ID.

These data indicate that the miR-34a/SIRT1/p53 signaling pathway was activated in the liver fibrosis process.

Normal hepatocyte L-02 cells were transfected with miR-34a mimics (0, 20, 50 nM) and then treated with or without SRT1720.

We wondered if this classical miR-34a/SIRT1/p53 signaling pathway was also involved in liver fibrosis and how the pathway functioned during this process.

miR-34a -induced apoptosis of hepatocytes activates HSCs.

Further experiments showed that the miR-34a/SIRT1/p53 signaling pathway was only activated in hepatocytes and not in HSCs.

As the central component of the miR-34a/SIRT1/p53 signaling pathway, SIRT1 plays an important role in liver fibrosis.

The miR-34a/SIRT1/p53 signaling pathway was reported to be activated in NAFLD and involved in the apoptosis of hepatocytes [16].

To further investigate the underlying mechanism of the miR-34a/SIRT1/p53 signaling involved in liver fibrosis, primary hepatocytes and HSCs were isolated in four rat groups, and the expression of miR-34a, SIRT1, p53 and Ac-p53 in hepatocytes and HSCs were analyzed.

These results revealed the activation of the miR-34a/SIRT1/p53 signaling pathway during liver fibrosis.

To investigate the expression of miR-34a/SIRT/p53 signaling proteins and the possible function of this signaling pathway during liver fibrosis in vivo, we established a CCl [4] -induced rat liver fibrosis mo del and studied the effect of the SIRT1 activator SRT1720 on liver fibrosis.

Briefly, hepatocyte L-02 cells were seeded into the bottom chamber of rat-tail collagen-coated 6-well transwell plates (0.4-μm-pore membrane, Thermo Fisher Scientific) 4 h before transfection, and then transfected with mimics of miR-34a or negative control miRNAs with or without 20 μg/mL SRT1720.

SRT1720 treatment decreased the concentration of miR-34a a little while the difference was not statistically significant.

For miR-34a detection, first-strand cDNA was synthesized using the Taqman miRNA RT Kit (Applied Biosystems, Carlsbad, CA, USA).

Thus, we examined the effects of miR-34a on hepatocytes and thus how the affected hepatocytes influenced HSCs.

The miR-34a/SIRT1/p53 signaling pathway is activated during liver fibrosis.

Recently, the miR-34a/SIRT1/p53 signaling pathway was reported to be involved in human NASH and positively related to NAFLD severity, which is the result of a link between hepatocyte apoptosis and the miR-34a/SIRT1/p53 signaling pathway [16].

It was recently reported that the miR-34a/SIRT1/p53 signaling pathway was activated in NAFLD and participated in the apoptosis of hepatocytes [16].

The miR-34a/SIRT1/p53 signaling pathway may contribute to the antifibrotic function of resveratrol.

In conclusion, in this study, we found that the miR-34a/SIRT1/p53 signaling pathway was involved in liver fibrosis by inducing the apoptosis of hepatocytes but not HSCs.

The relative miR-34a expression was calculated from three different experiments.

11

In the present luciferase reporter analysis, overexpression of mir-34a and -34c both inhibited Arc, but only the 34a -mediated inhibition was reversed by substitution mutation of the seed region, suggesting a preferential interaction of miR-34a with Arc.

Zhou et al showed that the mood stabilizing drugs lithium and valproate downregulate miR-34a, which in turn regulates expression of metabotropic glutamate receptor 7 in hippocampal neurons [71].

Co -expression of miR-34a with miR-19a, miR-378, or miR-326 did not modulate the inhibition induced by miR-34a expression alone.

miR-34a negatively regulates dendritic branching of immature cortical neurons in vitro and downregulates expression of synaptotagmin and syntaxin.

miR-34c reduced wildtype Arc expression to 62% of control levels, whereas miR-34a expression had a much stronger effect, reducing expression to 18% of control.

A significant difference in luciferase expression was observed after substitution mutation or deletion of the miRNA binding sites for miR-19a, miR-34a and miR-326 in response to expression of the respective miRNAs, relative to the wildtype Arc 3′UTR.

miR-34a, miR-326 and miR-193a downregulate Arc protein expression in cultured hippocampal neurons.

In contrast, Arc -regulating miR-34a, miR-326, miR-19 and miR-193a were not significantly regulated, although there was trend for miR-34a upregulation at 30 minutes post-BDNF (p = 0.07).

In situ hybridization confirms miRNA expression in adult dentate granule cells and hippocampal pyramidal cells, while qPCR analysis shows enhanced expression of miR-19a, miR-34a, and miR-326 in synaptoneurosomes relative to cell body restricted, small nucleolar RNA.

Ectopic expression of miR-193a, miR-326, and miR-34a all enhanced BDNF-evoked Arc protein expression.

The positive control comprised of a fully complementary sensor sequence of miR-34a was efficiently inhibited by miR-34a overexpression.

Expression of the sensor reporter for miR-34a was effectively inhibited to approximately 10% of control.

In brain, miR-34a is developmentally upregulated through embryonic and post-natal maturation under control of the p53 family transcription factor, TAp73 [68], [69].

miR-34a and miR-326 were expressed alone and in combination with other Arc -targeting miRNAs.

miR-34a and 34b/c are suppressive in many tumor types and they inhibit the epithelial-mesenchymal-transition [64]– [66].

At early stages of differentiation there was an inverse relation between the expression of Arc mRNA and miR-34a, -19a, -326 and -193a expression.

The impact of miR-34a site mutation was more pronounced, as expression in the mutant reporter was significantly enhanced 2-fold relative to wildtype Arc 3′UTR.

We therefore compared the effects of ectopic expression of miR-34a and miR-34c on Arc expression.

Introducing three point mutations in the binding seed resulted in partial but significant rescue of luciferase expression for miR-34a and miR-326 (Figure 2A).

Furthermore, point mutation of the miR-34 binding site rescued inhibition induced by miR-34a, but not miR-34c.

miR-34a, miR-326, and 193a downregulate Arc protein in hippocampal neurons.

However, the miR-34 family genes are differentially expressed and regulated.

A significant downregulation of Arc protein was seen in miR-34a transfected cells.

Mutations in the seed region of three miRNAs (miR-34a, miR-326, and miR-19a) partially or fully rescue reporter expression.

Interestingly, Arc synthesis is also required for contextual fear conditioning [73], and the present work identifies Arc as another potentially important target for miR-34a.

For miR-34a, complete recovery of expression was obtained in the substitution and deletion mutants (Figure 2B).

Note, however, that miR-34a gave significantly stronger inhibition of both the wildtype and sensor constructs.

Regulation of Arc by miR-34 and miR-326 is attenuated by point mutations and deletion of the microRNA seed region.

miR-34 family microRNAs (miR-34a, -34b, -34c) share a common seed sequence and therefore share many of the same targets in many cell types.

Thus, miR-34a and miR-326 have Arc and Notch as common targets.

miR-34a and miR-34c are also coexpressed following acute restraint stress and chronic social defeat stress in mice.

Prominent miR-34a and miR-326 expression was observed in the cell body layers of the dentate gyrus and hippocampus proper.

Thus, at DIV10, expression of miR-19a, miR-34a, miR-326 and miR-193a were decreased while Arc mRNA was elevated.

For further validation we selected the four miRNAs (miR-34a, miR-193, miR-378, and miR-512-5p) with strongest inhibitory effect on the Arc 3′UTR.

In contrast, miR-19a, miR-34a, miR-326 and miR-193a were not significantly regulated.

Dramatic changes in mature miR-19a, miR-34a, miR-326 and miR-193a were observed during development, with maximum changes of more than 100-fold.

Collating results from mutation studies in HEK cells with effects of miRNA manipulation in hippocampal neurons, we provide evidence that miR-19a, miR-34a, miR-193a, and miR-326 are capable of modulating Arc.

Interestingly miR-19, miR-34 and miR-326 are all dysregulated in multiple sclerosis patients [62].

We chose to study miR-34a and miR-326 as strong candidates from the point mutation analysis and miR-193a because of its synergistic effects.

The following combinations: miR-34a/miR-193a, miR-326/378 and miR-326/193a gave enhanced inhibition of luciferase activity compared to miR-34a and miR-326 alone.

We confirmed that PNA-AS transfection almost completely eliminated PCR-detectable miR-326, miR-34a and miR-193 (Figure 5B).

0041688.g004 Figure 4 Cultured hippocampal neurons were transfected with either empty vector-DsRed, miR150-DsRed, miR34a-DsRed, miR326-DsRed or miR193a-DsRed.

Taken together, the results suggest that under basal (non-stimulated) conditions the levels of miR-34a and miR-326 in distal dendrites is much lower than in the cell body.

The microRNAs included were miR-19a, miR-34a, miR-193a and miR-326.

However, the combination of miR-34a and miR-193a significantly enhanced repression relative to miR-34a alone.

The seed binding site of miR-193a is close (5 nts) to the first miR-326 site but 360 nts distant from miR-34a.

B) Deletion of the miR-34a site resulted in full recovery of luciferase activity.

The miR-34 family has three members, miR-34a, -34b and -34c, that are predicted to bind the same sites.

A) representative images of cells transfected with empty vector-DsRed and miR34a-DsRed, respectively.

Mean Arc levels were comparable between cells transfected with empty vector and miR-150 controls, but were significantly reduced in neurons transfected with miR-34a, miR-326, or miR-193a (Figure 4C and E).

One day before transfection the medium was changed and replaced with fresh medium containing 2 mg/ml vitamin C. In the second set of experiments neurons were transfected with DsRed only, DsRed-miR150, or DsRed-miR34a using Lipofectamine LTX and Plus Reagent (Invitrogen) according to manufacturer's instructions.

Arc mRNA was significantly increased after treatment with miR-326, but not miR-34a, PNA-AS (Figure 5C).

B) Quantitative relative real-time PCR of miR- miR-133, 19a, miR-34a, miR-326 and miR-193a.

Cultured hippocampal neurons were transfected with either empty vector-DsRed, miR150-DsRed, miR34a-DsRed, miR326-DsRed or miR193a-DsRed.

miR-34b and -34c are co-transcribed from the same cluster distinct from the miR-34a gene.

For miR-34a, the staining was observed approximately 30 µm into the apical dendrites of CA1 pyramidal cells.

Three nucleotides in the seed -binding region of miR-34, -193, -326, -378 and -512_5p were mutated in the Arc 3′UTR and the whole seed binding region was removed for miR-19.

Unstimulated hippocampal neurons were transfected at DIV8 with PNA-AS complementary to miR-34a, miR-326 and miR-193a and cells were harvested 48 hours later for qPCR or western blot.

PNA modified antisense oligonucleotides (PNA-AS) complementary to miR-326, miR-34a and miR-19a were purchased from Panagene Inc.

B) miRNA in situ hybridization was performed on coronal hippocampal sections using LNA probes for miR-326, miR-34a, and scrambled control.

miR-378 and miR-34a also have a synergistic effect yet bind to quite wi dely separated (1000 nt) sites.

Data analysis: Using Microsoft Excel, the average intensity of DsRed in non -transfected cells was determined from the cumulative frequency plot, and the miR-34a transfected cells were normalized to that value.

miR-193a enhanced repression by both miR-34a and miR-326.

While little is currently known about mir-193a and miR-19a, new studies have shed light on miR-34 and miR-326 function in the nervous system.

For the miR-34a experiments nuclei were automatically identified from the DAPI images.

The effects of miR-19a and miR-34a and miR-326 is dependent on intact microRNA binding sites.

miR-34a staining was also apparent in the proximal apical dendrites of pyramidal cells, but not in dendrites of granule cells.

B) Quantitative relative real-time PCR of miR-19a, miR-34a, miR-326, miR-193a and miR-132.

12

To further assess the mechanisms which underlie the above miR-34a mediated processes in DOXO toxicity, we examined the expression of some direct or indirect miR-34a targets, which have previously been linked to cellular survival, apoptosis and senescence.

Recent evidences describe the dysregulation of miRNAs across the heart upon DOXO treatment [43– 45] and importantly, miR-34a expression has been found upregulated in the heart of DOXO-cardiomyopathic mice [16].

Our data indicate that DOXO exposure upregulates, both in vitro and in vivo, miR-34a expression in rat cardiac cells and increases its release from rCPCs and endothelial cells, supporting the hypothesis that this miRNA could be the possible mediator of the negative consequences driven by DOXO.

Practically, a positive feedback loop regulates p53-miR-34a-SIRT1 axis: p53 induces miR-34a and miR-34a activates p53 by inhibiting the expression SIRT1 [11, 23].

In particular, miR-34a the one predominantly expressed in the heart [10] modulates several target proteins involved in cell cycle, apoptosis, senescence, differentiation and cellular development [11].

The 3′ untranslated region (UTR) luciferase assay confirmed that SIRT1 is a direct target of miR-34a.

As on one hand the intrinsic ability of miR-34a to target different DOXO-related pathways makes its inhibition an attractive therapeutic perspective, on the other its clinical implications remain to be determined.

Genotoxic stress activates p53, the strongest inducer of miR-34a that inhibits SIRT1 expression, which in turn inactivates p53 by its deacetylation.

Among miR-34a direct targets, Bcl-2 and SIRT1 expression was evaluated.

qPCR results indicated that DOXO administration upregulated miR-34a in heart, liver, kidney, skeletal muscle (Figure 7C).

SIRT1, one of several miR-34a targets, is a member of the Sirtuin family of class III histone deacetylases, which regulates cell cycle, cellular survival, senescence and metabolism [21, 22].

MiR-34 family members (miR-34a, -34b, and -34c) are upregulated in the heart in response to stress (i. e. myocardial infarction) and contribute to the age -dependent decline in cardiac function [9, 10].

Our results indicated that plasma of rats treated with DOXO is highly enriched in miR-34a and, although anthracycline administration upregulated miR-34a not only in the heart but also in liver, kidney and skeletal muscle, the cardiac contribution seems to be predominant.

Real time PCR (qPCR) results showed a significant upregulation of miR-34a in all cardiac cells after DOXO treatment except for H9c2 (Figure 1A).

To silence miR-34a, rCPCs were exposed for 24 hours to 10 nM has-miR-34a-5p mirVana miRna inhibitor (Ant34a) (Ambion).

Therefore, we investigate whether miR-34a inhibition could modulate SIRT1 and p53 expression and function in DOXO -treated rCPCs.

Moreover, in our experimental settings, miR-34a inhibition decreased DOXO -induced p53 acetylation.

Thus, miR-34a inhibition could protect rCPCs from DOXO -induced senescence.

showed that the number of apoptic cells were markedly reduced by inhibition of miR-34a in DOXO -treated rCPCs (51% vs AntCTL+DOXO) (Figure 3A).

In DOXO -treated rCPCs miR-34a inhibition increased vitality and proliferation and reduced apoptosis and senescence.

C. qPCR analysis indicated miR-34a expression in tissues of DOXO -treated rats sacrificed at 3 weeks.

In particular, in presence of DOXO, miR-34a inhibition increased vitality by 29% and the percentage of BrdU positive rCPCs raised more than 2-fold with Ant34a+DOXO treatment with respect to AntCTL+DOXO (Figure 2A and 2B).

These results shed light on the complex pathways that underlie DOXO cardiac damage and propose miR-34a inhibition as a promising therapeutic approach for anthracycline -induced cardiotoxicity.

Notably pharmacological inhibition of miR-34a could revert these effects.

First, miR-34a increases in rat cardiac cells exposed to DOXO and its inhibition in rCPCs can partially prevent the negative effects driven by DOXO not only in these cells but also in neighboring ones.

Moreover, a recent study revealed an increased expression of miR-34a in mouse heart as an early molecular event of cardiac tissue injury during DOXO treatment [16].

Notably, miR-34a released by DOXO -treated rCPCs has negative paracrine consequences on other cardiac cells and its inhibition could revert these effects.

Importantly, miR-34a inhibition was able to reduce the cytotoxic effect of DOXO.

In the view of discording studies that have reported a different role of miR-34a in modulating tumor progression [23, 41, 42], it could be suitable to address miR-34a inhibition exclusively to the heart.

The findings that the damage at the level of CPC population is responsible of DOXO -induced cardiotoxicity [13, 14, 15], prompted us to consider whether miR-34a inhibition in rCPCs could provide therapeutic benefit to DOXO toxicity.

Levels of miR-34a were detected and were normalized byRNU6B (U6) as internal control for miRNAs expression studies.

Pharmacological inhibition of miR-34a improves cardiac regeneration and function in experimental mo dels of myocardial infarction and pressure overload -induced hypertrophy [9, 10, 12], suggesting the silencing of this miRNA as a future therapeutic option for cardioprotection.

Nevertheless, miR-34a expression was significantly increased in these cells after 48h of DOXO exposure (Supplementary Figure 1).

To assess if the protection from cell death is mediated by Bcl-2, a target of miR-34a, the expression of this antiapoptic protein was measured.

A. rCPC viability was determined by MTT assay after miR-34a inhibition followed by DOXO exposure.

B. SA-β-galactosidase assay was performed to identify senescent rCPCs after miR-34a inhibition and DOXO exposure; senescent cells (light blue) were showed in representative pictures.

It has been reported that SIRT1 plays an important regulatory role in the connection between DNA damage, p53 and miR-34a [11].

Figure 2 A. rCPC viability was determined by MTT assay after miR-34a inhibition followed by DOXO exposure.

MiR-34a expression in DOXO-exposed cardiac cells.

In this paper, we have focused our attention on miR-34a, a miRNA involved in several cellular processes implicated in DOXO cardiotoxicity, such as apoptosis and senescence [11] and recently recognized as a key regulator in cardiac dysfunction and ageing [9, 10, 12, 17].

MiR-34a expression and release in DOXO -treated rat cardiac cells.

MiR-34a inhibition in DOXO-exposed rCPCs.

1 μg pGL3-Sirt1-3′UTR plasmids plus mimic-miR-34a-5p (100 nM and 200 nM) (pre-miR-34a) or mimic-miR-CTL (200 nM) (pre-miR-CTL) were used.

Paracrine role of miR-34a on rat cardiac cells.

To determine whether miR-34a take part to the complex mechanisms involved in DOXO -induced cardiotoxicity, its expression was evaluated in rat cardiac cells.

Additionally, miR-34a induces cell senescence through the most commonly accepted p53-miR34a-SIRT1 axis with a positive feedback loop [36, 37].

Following the demonstration that in vitro miR-34a secretion by rCPCs and endothelial cells is enhanced after DOXO exposure, we evaluated if, also in vivo, DOXO triggers the expression of miR-34a in heart tissue.

p53-miR-34a-SIRT1 axis in DOXO-exposed rCPCs.

Quantitative real-time PCR of miR-34a from cells and tissues.

However, in DOXO -treated animals the heart contribution seems to be predominant since, with respect to the other organs, miR-34a levels were higher in cardiac tissue (Figure 7C).

Interestingly, miR-34a has been identified as a predictive plasma marker of future heart failure in patients after acute myocardial infarction [17].

Therefore, cardiac cells could release miR-34a in the peripheral circulation and it could be potentially used as a marker of DOXO -induced cardiac damage.

of miR-34a from cells and tissuesMiRNAs were extracted from cells by MirVana miRNA Isolation Kit (Ambion) according to the manufacturer's instructions.

Data of the present investigation indicate that miR-34a pharmacological inhibition in DOXO exposed rCPCs significantly reduce both p53-acetylated forms according to SIRT1 increased levels.

miRCURY LNA detection probe hsa-miR-34a, 5′-DIG and 3′-DIG labeled and control probe LNA U6 snRNA, 5′-DIG labeled (Exiqon) were used at 50 nM and 10 nM respectively and denatured as suggested by manufacturer's instructions.

In addition, miR-34a has been identified as a predictive circulating marker of future heart failure in patients after acute myocardial infarction [17].

These findings prompted us to determine whether miR-34a could be a potential circulating biomarker of DOXO -induced cardiac damage.

Second, in the light of its increasing levels in heart and plasma of DOXO-cardiomyopathic rats, miR-34a could be a potential circulating biomarker of anthracycline induced cardiac damage.

We documented remarkably higher miR-34a levels in plasma with respect to cardiac tissue of DOXO-cardiomyopathic rats.

At the same time, miR-34a is the first miRNA entered into phase I clinical trials as emerging antitumor approach (NCT01829971 clinicaltrials.

Figure 1 A. qPCR analysis of intracellular miR-34a levels in rCPCs, H9c2, fibroblasts and RAOECs after treatment with 0.5 μM DOXO for 24h.

of miR-34a from cell culture media, rat plasma and exosomesCell culture media were collected after cell treatment and concentrated by Centrifugal Filter Units (Millipore).

Moreover, corroborating in vitro experiments, miR-34a in situ hybridization in heart sections of DOXO -treated animals showed higher levels of this miRNA in cardiac cells, including c-kit positive rCPCs (Figure 7D and 7E).

P53 is linked to miR-34a in a multifaceted manner and the most common identified pathway is SIRT1, which deacetylates its non-histonic substrate p53.

Cardiac function and miR-34a levels in DOXO -treated rats.

In particular, based on our previous studies that have demonstrated that detrimental effects of DOXO on cardiac progenitor cells (CPCs), negatively affect myocardial homeostasis [13, 14, 15], we investigated the possibility that miR-34a expression is modified in rat CPCs (rCPCs) after DOXO exposure.

Therefore, the hypothesis that miR-34a could represent a possible circulating marker for DOXO -induced cardiotoxicity has been explored.

These results indicated that miR-34a released by DOXO -treated rCPCs can have negative consequences also on other cardiac cells in a paracrine manner.

Role of miR-34a in apoptosis of DOXO-exposed rCPCs.

Circulating miR-34a increases in the animals treated with DOXO sacrificed at 3 weeks, but its levels could be also higher during, at the end or also upon DOXO administration.

To determine whether miR-34a inhibition could interfere with anthracycline antitumor activity, the effects of increasing concentration of Ant34a were evaluated on breast cancer cell line (MCF7) exposed to DOXO.

MiR-34a levels were detected and normalized by using C. elegans miR-39 miRNeasy Serum/Plasma Spike-in control.

Moreover, it remains to verify if cells from other organs could release miR-34a after DOXO exposure thus concurring to secrete this miRNA in plasma.

Importantly, plasma and exosome fraction from rats affected by DOXO -induced cardiomyopathy were highly enriched in miR-34a respect to control animals.

In conclusion, DOXO -induced apoptosis and senescence in rCPCs can be counteracted by miR-34a pharmacological repression.

Since previous studies have demonstrated that resident CPCs are very sensitive to DOXO that severely impairs their functions and regenerative capacity in vitro and in vivo [13, 14, 24], influencing the subsequent and progressive cardiac damage, we verified if miR-34a pharmacological silencing in these cells prevents anthracycline toxicity.

A. qPCR analysis of intracellular miR-34a levels in rCPCs, H9c2, fibroblasts and RAOECs after treatment with 0.5 μM DOXO for 24h.

D. In situ hybridization with digoxigenin-labeled miR-34a probe in heart sections of DOXO -treated rats.

In fact, transfection of miR-34a precursors clearly reduced luciferase activity for the wild-type reporter but did not for the mutant types SIRT1 3′UTR both at 24h (Figure 4A and 4B) and 48h (Supplementary Figures 2A and 2B).

Quantitative real-time PCR of miR-34a from cell culture media, rat plasma and exosomes.

13

Force induced miR-34a targets GSK-3β after orthodontic force loading, which downregulates the inhibition of β-catenin protein phosphorylation.

MiR-34a endogenously inhibited osteoclasts that block osteoporosis and bone metastasis by suppressing osteoclastogenesis and TGIF2 expression.

MiR-34a expression was upregulated and reached a maximum at day 7 under orthodontic force loading (Figures 1F and 2G) in vivo and in vitro.

GO and KEGG analysis revealed that miR-34a expression improved and β-catenin expression increased during bone repair [44].

MicroRNA-34a (miR-34a) was expressed in multiple stages of tooth growth and regulated bone remolding [11] and dental stem cell differentiation [12– 13].

The miR-34a antagomir had an opposite effect on gene expression compared to inhibitor-NC (Figure 4A).

The regulatory mechanism of miR-34a might be attributed to its effect on the GSK-3β target.

The expression level of miR-34a was approximately 29-fold with miR-34 agomir and 0.4-fold with miR-34a antagomir (Figure 5A).

An injection of 2 μg/time/lateral ensured local expression of miR-34a in the experimental area of the alveolar bone.

Figure 4Osteogenic differentiation under orthodontic strain was improved by the MiR-34a agomir in vitro (A) Quantitative real-time PCR analysis of Runx2 and ColI mRNA expression of agomir transfected rBMSCs for 7 days.

We demonstrated that miR-34a elevated osteogenic gene and protein expression, early osteogenic secretion function, and local alveolar bone anabolism under orthodontic force loading in vivo and in vitro.

We determined the expression of Wnt/β-catenin pathway-related proteins in rBMSCs transfected with N-Ac- l-Leu-PEI/miR-34a agomir or antagomir to elucidate the mechanism of miR-34a -mediated osteogenesis during force loading.

The miR-34a antagomir had an adverse effect on GSK-3β and active β-catenin expression (Figure 9).

Our study supported miR-34a involvement in tooth development [12, 13], mechanical force loading [36], and regulation of bone metabolism [11, 37– 41].

Marker gene and protein expression were analyzed in vitro to determine the effect of miR-34a on early functions of osteogenic differentiation under orthodontic force.

Osteogenesis and miR-34a expression of alveolar bone under orthodontic force loading.

The enhanced osteogenesis in vitro from our data was inconsistent with Chen L [38], Wei J [39] and Tamura M [40], who reported that miR-34s and miR-34a inhibited osteogenesis under static conditions.

Figure 7Declining osteogenesis of local N-Ac- l-Leu-PEI -mediated miR-34a antagomir delivery on alveolar bone and OTM in vivo (A-E) The alveolar bone of rats was locally injected with N-Ac- l-Leu-PEI/miR-34a antagomir (and inhibitor-NC), and the legends of Figure 7A–7G corresponded to those from Figure 6 (A– G).

The variation in miR-34a expression was consistent that of osteogenic differentiation factors.

GSK-3β was downregulated after N-Ac- l-Leu-PEI/miR-34a agomir delivery compared to the N-Ac- l-Leu-PEI/miR-NC strain group under conditions of orthodontic strain.

We demonstrated that GSK-3β was the target protein of miR-34a under orthodontic force loading.

Though the movement distance of first molar on N-Ac- l-Leu-PEI/miR-34a antagomir lateral was not statistically different from that of N-Ac- l-Leu-PEI/inhibitor-NC lateral (Figure 7A, 7B, 7E), the fullness and height of the first molar buccal alveolar bone were remarkably reduced according to the micro-CT image (Figure 7E).

MiR-34a regulation of strain -induced osteogenesis was determined by gene and protein expression and early secretion function.

Genetic software and previous reports [29– 30] indicated that many miR-34a target genes in bone metabolism were associated with the Wnt/β-catenin pathway.

1 and 2 presented the inhibitor-NC lateral and miR-34a antagomir lateral.

After transfection of miR-34a agomir or antagomir, the rBMSCs with N-Ac- l-Leu-PEI/miR -negative control (NC) and the inhibitor-NC control group were subjected to an orthodontic strain force.

Figure 2 In vitro promotion of osteogenic differentiation by orthodontic strain and miR-34a expression in rBMSCs (A) rBMSCs under non-tension condition (ctrl group) in the first image and BMSCs under orthodontic force condition (force group) for 5 days in the second image.

P53 induced the Wnt/β-catenin pathway by direct miR-34a regulation of Axin2 and GSK-3β [45].

MiR-34a agomir and its antisense oligonucleotide antagomir (miR and anti-miR control), stable negative control, inhibitor negative control, fluorescein isothiocyanate (FITC)-labeled miR-34a, U6, and SYBR Green Hairpin-it miRNAs kit were purchased from GenePharma (Suzhou, China).

MiR-34a agomir elevated ALP expression and activity (Figure 4D–4E) after exposure to force loading conditions for 7 days.

Understanding the miR-34a mechanism under orthodontic force by grafting target agents on the N-Ac- l-Leu-PEI delivery system could lead to optimal specificity and efficiency of miR-34a -mediated bone remo deling.

The results indicated that the miR-34a agomir induced Runx2 and ColI gene expression.

1, 2, 3, 4 presented miR-NC, miR-34a agomir, inhibitor-NC and miR-34a antagomir.

MiR-34a regulation of osteogenic differentiation under orthodontic strain in vitroWe determined miR-34a regulation of osteogenic differentiation under orthodontic force loading.

In vitro promotion of osteogenic differentiation by orthodontic strain and miR-34a expression in rBMSCs.

MiR-34a is a potential target of molecular orthodontic therapy for local alveolar bone remo deling.

We explored the role of miR-34a delivered by an N-Ac- l-Leu-PEI carrier in the regulation of bone remo deling induced by orthodontic force.

Schematic of the regulatory mechanism of miR-34a in osteogenesis during strength loading.

Despite insufficient regulation of systemic bone formation [11], miR-34a could attenuate local bone loss or alveolar bone remo deling to achieve stability of anchorage teeth.

We determined miR-34a regulation of osteogenic differentiation under orthodontic force loading.

We explored the mechanism of miR-34a regulation of force -induced osteogenic differentiation.

Lipofectamine [2000]/miR-34a (Life, USA) or N-Ac- l-Leu-PEI/miR-34a complexes of varying mass ratios with a miR-34a concentration of 1 μg/mL were transfected into cells.

N-Ac- l-Leu-PEI -mediated miR-34a delivery led to high local transfection efficiency and compatibility in vivo.

Specifically, miR-34a was previously demonstrated as an important factor in bone metabolism in phase I clinical trials [26].

The transfection efficiency and serum biocompatibility of N-Ac- l-Leu-PEI -mediated miR-34a delivery in vivo were determined to account for differences between in vitro and in vivo microenvironments.

Osteogenesis analysis of OTM with local miR-NC or miR-34a agomir application in vivo.

Moreover, miR-34a decreased the OTM.

We used N-Ac- l-Leu-PEI as a carrier to overcome the limitations of injection -based miR-34a delivery.

However, miR-34a did not enhance osteogenesis enough to attenuate systemic bone loss in OVX mice or bone cancer metastases [11].

Figure 5 N-Ac- l-Leu-PEI -mediated miR-34a delivery led to high local transfection efficiency and compatibility in vivo (A) analysis of N-Ac- l-Leu-PEI carrying miR-34a during OTM for 14 days.

The N-Ac- l-Leu-PEI and miR-34a were mixed in different mass ratios and incubated at room temperature for 30 min before use.

We concluded that a small local injection dose of miR-34a did not affect the liver or kidney function of the rats.

The transfection efficiency of N-Ac- l-Leu-PEI and Lipofectamine [2000] in rBMSCs was estimated to be 70–80% and 50–60%, respectively, from the percentage of FAM-miR-34a positive cells observed by inverted fluorescence microscopy (Figure 3C).

Groups were treated with PBS, N-Ac- l-Leu-PEI/miR-34a agomir, or antagomir (2 μg oligo/lateral/time), respectively, on the experimental lateral bone by local injection for biochemical detection.

We propose a potential mechanism for miR-34a in osteogenic differentiation during orthodontic force loading.

Wnt signal pathway as a potential mechanism of miR-34a -mediated osteogenic differentiation under orthodontic force loading.

We demonstrated that miR-34a enhanced force -mediated osteogenic differentiation in vitro and in vivo and alleviated OTM by increasing local osteogenesis of the alveolar bone.

The numbers 1, 2, 3 represented the control group, miR-34a agomir group, miR-34a antagomir group, respectively.

Our results suggested that GSK-3β was sensitive to miR-34a under orthodontic strain.

MiR-34a regulation of the Wnt/β-catenin signal pathway.

N-Ac- l-Leu-PEI efficiently delivered miR-34a to rBMSCs (≈70%) and alveolar bone (29-fold).

Figure 9 (A and B) Western blot (quality in A and quantity in B) analysis of the Wnt/β-catenin signal pathway proteins, GSK-3β and active β-catenin, after 2 h of strain and transfection with miR-34a.

After the tooth movement mo dels were successfully established, the experimental rats were divided into three groups: control, miR-34a agomir, and miR-34a antagomir.

We established an in vitro mo del of bone marrow stem cells (BMSCs) under mechanical force and an in vivo mo del of orthodontic tooth movement (OTM) in rats to investigate miR-34a as a local therapeutic target of orthodontic treatment.

These results were superior to those of Krzeszinski [11], who obtained an approximately 5-fold efficiency increase in bone marrow with pre-miR-34a delivered by chitosan nanoparticles after a single injection.

Alveolar bone remo deling by N-Ac- l-Leu-PEI -mediated miR-34a delivery in vivo.

MiR-34a regulation of osteogenic differentiation under orthodontic strain in vitro.

We established a bilateral tooth movement mo del in rats to investigate the local expression of miR-34a delivered by N-Ac- l-Leu-PEI.

The orthodontic force loading mo del was built with a four-point bending system [27] to determine the effect of miR-34a on osteogenesis under force loading in vitro.

However, the improvement of alveolar bone mass was completely reversed by N-Ac- l-Leu-PEI/miR-34a antagomir delivery (Figure 7).

N-Ac- l-Leu-PEI delivered miR-34a in vitro and in vivo with sufficient biocompatibility and transfection efficiency.

We demonstrated that alveolar bone anabolism in vivo was stimulated by orthodontic force for 24 h. The extended force loading time enhanced miR-34a -mediated osteogenic stimulation.

Immune-related adverse events of MRX34 (liposomal miR-34a mimic) have been observed over the course of clinical trials [28].

The rats were stochastically divided into the miR-34a agomir and miR-34a antagomir groups.

The other rats were treated with N-Ac- l-Leu-PEI/miR-34a agomir or antagomir (2 μg oligo/lateral/time) on the experimental lateral bone by local injection.

N-Ac- l-Leu-PEI and miR-34a formed a stable nanocomplex with a mass ratio of 2 (Figure 3A).

The internal controls of mRNAs and miR-34a were β-actin and U6, respectively.

MiR-34a regulation during orthodontic alveolar bone remo deling.

The influence of miR-34a on hepatic and renal function in rats was assessed.

The differences between the control, miR-34a agomir, and miR-34a antagomir groups were not statistically significant.

The condensing capacity of N-Ac- l-Leu-PEI improved in the presence of miR-34a.

We concluded that miR-34a had a positive effect on osteogenic differentiation under force loading conditions in vitro.

Osteogenic differentiation under orthodontic strain was improved by the MiR-34a agomir in vitro.

1 and 2 presented the miR-NC lateral and miR-34a agomir lateral.

N-Ac- l-Leu-PEI/miR-34a delivery stabilized the anchorage teeth and promoted osteogenic differentiation in vitro and local alveolar bone formation in vivo during orthodontic force loading.

efficiency and biocompatibility of N-Ac- l-Leu-PEI -mediated miR-34a delivery in vivoThe transfection efficiency and serum biocompatibility of N-Ac- l-Leu-PEI -mediated miR-34a delivery in vivo were determined to account for differences between in vitro and in vivo microenvironments.

We determined the effect of miR-34a on the strain -induced bone formation and the safety and efficiency of the N-Ac- l-Leu-PEI delivery system.

We selected the PEI-derivative, N-Ac- l-Leu-PEI, as a delivery vehicle for miR-34a.

efficiency and biocompatibility of N-Ac- l-Leu-PEI -mediated miR-34a delivery in vivo.

These results indicated that N-Ac- l-Leu-PEI delivered miR-34a locally in vivo.

Declining osteogenesis of local N-Ac- l-Leu-PEI -mediated miR-34a antagomir delivery on alveolar bone and OTM in vivo.

MiR-34a also regulated the osteogenesis process of osteosarcoma inversion to osteogenic differentiation [14].

14

Overexpression of miR-34a in BRL-3A cells could significantly inhibit cell proliferation and down-regulate the expression of inhibin βB (INHBB) and Met.

As shown in Figure 1A, we identified 8 up-regulated and 2 down-regulated miRNAs, in which miR-34a had at least 5-fold difference in expression between PHx and SH, with a P value <0.01.

By qRT-PCR and westernblot analysis, we observed intensive down-regulation of INHBB and Met on both mRNA and protein levels in PHx rats, indicating that miR-34a and its two candidate target genes were inversely expressed (Figure 5A,B).

2011.1002.1031 17 Li N Fu H Tie Y Hu Z Kong W 2009 miR-34a inhibits migration and invasion by down-regulation of c-Met expression in human hepatocellular carcinoma cells.

In this study, we show that miR-34a not only inhibits INHBB in a direct way (Figure 3) but also may result in the down-regulation of INHBB in regenerating liver (Figure 5).

To determine whether miR-34a potentially regulates the expression of INHBB and Met during LR, we tested the expression of INHBB and Met in regenerating liver tissues at 5 d after PHx, when miR-34a was highly induced.

In the present study, we mainly focused on miR-34a based on its expression pattern after PHx and its antiproliferative function in rat hepatocytes, along with its target genes.

qRT-PCR and westernblot analysis revealed that miR-34a drastically inhibited the expression of INHBB and Met on both mRNA and protein levels (Figure 3A,B).

Bioinformatic tools for putative miR-34a target genes (Targetscan, http://www.

MiR-34a expression was upregulated during the late phase of liver regeneration.

Expression of miR-34a candidate target genes in regenerating liver tissues.

To determine how miR-34a influences the hepatocyte proliferation, we then used a Molecular Annotation System (MAS) to categorize all putative target genes of miR-34a predicted by Targetscan (Table S1).

Elevated miR-34a greatly suppressed hepatocyte proliferation by targeting INHBB and Met.

0020238.g003 Figure 3(A) miR-34a decreased mRNA expression of inhibin beta B (INHBB) and Met by qRT-PCR.

MiR-34a down-regulates INHBB and Met expression.

Therefore, we hypothesized that miR-34a was a key suppressor of hepatocyte proliferation and might be a negative regulator during LR, like other ‘stop’ signals as TGF-β and activins.

Analyses of candidate target genes of miR-34a.

However, in previous study, ectopic miR-34a was shown to induce a cell cycle arrest in the G1-phase, thereby suppressing tumor cell proliferation [18], [22], [23].

MiR-34a -mediated regulation of INHBB and Met may collectively contribute to the suppression of hepatocyte proliferation.

In accordance with previous study, our investigation suggests that miR-34a -mediated inhibition of Met may also contribute to the suppression of hepatocyte proliferation during LR.

Table S1 Candidate genes of rno-miR-34a, predicted by TargetScan.

Interestingly, we identified INHBB as a target gene of miR-34a in the activin pathway.

As shown in Figure 3C,D, miR-34a remarkably repressed the expression of luciferase containing an original miR-34a binding site (INHBB-UTR) but not a mutant binding site (INHBB-Mu-UTR).

Our data suggests that miR-34a might also be a potential ‘stop’ signal that contributes to the suppression of hepatocyte proliferation during the late phase of LR.

Therefore, we presumed that miR-34a may possess some target genes associated with these pathways.

We then studied how miR-34a expression changes during LR on different time points.

In the present study, Met and INHBB were confirmed as the target gene of miR-34a.

Our data showed that miR-34a drastically inhibited BRL-3A cell growth and induced a significant G2/M arrest (Figure 2).

Apart from INHBB, we also confirmed Met as another target of miR-34a in the regenerating livers.

The relative expression of target genes (miR-34a, u6, INHBB, Met, INHBA and Actin) was calculated with the 2 [−△△]Ct method [30].

The growth inhibitory effect of miR-34a can also be sustained by the data of cell cycle analysis, in which the percentages of G2 phase cells in miR-34a and NC groups were (23.14±4.26)% and (8.48±2.93)% respectively, indicating a subpopulation of cells arrested in G2 phase by miR-34a (Figure 2B,C).

In BRL-3A cells, INHBB was identified as a direct target of miR-34a by luciferase reporter assay.

Although Met has been proved to be a target of miR-34a in HeLa cells and HepG2 cells [17], [18], it is still involved in validation in BRL-3A cells.

MiR-34a induced growth inhibition in rat hepatocytes.

As revealed by qRT-PCR analysis, the regeneration of the remnant livers after PHx caused a transient increase in miR-34a expression with ∼2-fold and ∼6-fold at 3 and 5 d when compared with SH control on each time point (Figure 1B).

MiR-34a inhibits BRL-3A cell proliferation.

BRL-3A cells transfected with miR-34a mimics (miR-34a) or negative control (NC) (GenePharma) and cells transfected with INHBB siRNA or control siRNA in the 24-well plate were re-seeded in 96-well plates at an optimized density cells 48 hours (h) after transfection.

This study aims to explore the effect of miR-34a in hepatocyte proliferation and its potential role in liver regeneration termination.

To confirm the role of miR-34a in normal hepatocytes, we used cultured rat liver cells (BRL-3A cells) as cell mo dels.

The 3′-UTR of INHBB containing the INHBB-miR-34a response element was cloned into the XhoI/ FseI site of pGL3 control Luciferase vector (Promega).

BRL-3A cells were cultured in 6-well plates and then treated with miR-34a or NC.

In conclusion, miR-34a is strongly induced in the late phase of LR after PHx.

The levels of INHBB, Met and Actin were determined in whole-cell extracts from liver tissues (5 d after PHx or SH) or transfected cells (miR-34a or NC).

BRL-3A cells were co -transfected with a luciferase reporter vector containing the 3′-UTR or mutated sequence of INHBB and miR-34a mimics (miR-34a) or negative control (NC).

Briefly, BRL-3A immortalized rat liver cells were transfected with miR-34a or NC.

As shown in Figure 2A, miR-34a markedly reduced BRL-3A cell growth at 4 d and more remarkably at 6 d (P<0.01).

Intriguingly, miR-34a is well known for its anti-oncogenic activity in several cancers, including hepatocellular carcinoma [17], [19]– [21].

miR-34a levels were normalized to that of u6.

BRL-3A cells were seeded in a 24-well plate (1×10 [5] per well) and transfected with INHBB-UTR-pGL3/Mu-INHBB-UTR-pGL3 (200 ng), Renilla luciferase control vector (20 ng) and miR-34a/NC (15 pmol).

0020238.g002 Figure 2(A) BRL-3A cells treated with miR-34a mimics (miR-34a) or negative control (NC) were seeded in 96-well plates and examined at indicated time points.

Our data also provided a tantalizing hint that miR-34a might be a ‘stop’ signal in regenerating hepatocytes.

Table S2 Pathways analysis of miR-34a candidate genes using MAS software (http://bioinfo.

15

Moreover, the upregulated genes were significantly depleted from miR-34a targets (Fig.   7d, ESM Table 6) and, although the values did not reach statistical significance (p < 0.071), the downregulated genes tended to be enriched in the predicted targets of this miRNA (Fig.   7c, ESM Table 7).

Although Pdgfra expression is upregulated in islet beta cells after DICER deletion and global miRNA suppression [33], its targeting by miR-34a in beta cells has not been explored.

Indeed, the 3′ UTR of the upregulated genes was depleted from potential recognition sequences for this miRNA, and the putative miR-34a targets tended to be more frequent in genes downregulated in ageing.

We observed that overexpression of miR-34a (Fig.   6a, b) or downregulation of miR-181a (Fig.   6c, d) did not affect basal beta cell proliferation, but did inhibit proliferation stimulated by exendin-4 or PDGF-AA.

The islets of these animals displayed modifications at the level of several miRNAs, including upregulation of miR-34a, miR-124a and miR-383, and downregulation of miR-130b and miR-181a.

In cell lines, overexpression of miR-124a and miR-34a has previously been reported to inhibit insulin secretion [25, 28, 39] but this observation was not confirmed in another study, although glucose -induced Ca [2+] fluxes were affected by miR-124a overexpression [24].

Overexpression of miR-34a resulted in reduced luciferase activity, confirming that Pdgfra is indeed a direct target of miR-34a (Fig.   8b).

Indeed, analysis of miR-34a expression by qPCR confirmed an upregulation of this miRNA in the islets of both 12- and 23-month-old rats (Fig.   2e).

Indeed, p53 induces the expression of miR-34a and the miRNA targets and represses SIRT1, preventing SIRT1 -mediated deacetylation of p53 and, in turn, promoting the activity of the transcription factor [43].

Computational analysis of the transcriptomic modifications observed in the islets of 12-month-old rats revealed that the differentially expressed genes were enriched for miR-34a and miR-181a targets.

The median number of recognition elements (M [obs]) for miR-181a (a, b) and miR-34a (c, d) predicted in the 3′ UTR of all down- (a, c) and upregulated (b, d) mRNAs in ageing (arrows) was compared with a null distribution of the median number of predicted recognition elements obtained for 1,000 randomly sampled sets of 3′ UTRs from mRNAs expressed in rat islets.

Ctrl, control To unravel the mechanisms underlying the effects of miR-34a and miR-181a on age -associated beta cell dysfunction, we searched for potential targets within genes expressed in the islets of aged animals.

This will particularly hold true for individuals expressing single nucleotide polymorphisms within the precursor of miR-34a that result in increased expression of this miRNA [46].

Some of the targets of miR-34a might be directly involved in the proliferative defect.

Indeed, we demonstrated that the mRNA coding for PDGFRα is directly targeted by miR-34a.

Fig. 8PDGFRα is a direct miR-34a target.

In addition to being upregulated in islets, the level of miR-34a was also elevated in the liver and brain of old rats, pointing to a general role for this miRNA in the ageing process.

In contrast, and in line with the literature [26, 27], miR-34a was upregulated in the liver and brain of older rats relative to 3-month-old rats (Fig.   3b, c).

The changes in the levels of these miRNAs might be sufficient to compensate for the proapoptotic effect elicited by the concomitant upregulation of miR-34a.

mRNA coding for alpha-type platelet-derived growth factor receptor, which is critical for compensatory beta cell mass expansion, is directly inhibited by miR34a and is likely to be at least partly responsible for the effects of this miRNA.

Indeed, we have previously reported that, in insulin-secreting cells, this transcription factor binds to the promoter of miR-34a and triggers expression of the miRNA [40].

Fig. 3Age -associated changes in miR-34a expression in human islets and in other rat organs.

Interestingly, overexpression of miR-34a or blockade of miR-181a was sufficient to reproduce this phenotypic trait in the islets of younger animals.

Thus, the translational repression of Pdgfra exerted by the induction of miR-34a is likely to contribute to the loss of proliferative capacity observed during ageing.

These observations suggest that age -associated changes in miR-181a and miR-34a levels contribute to the gene expression differences observed in the islets of aged rats.

We found that overexpression of miR-34a triggers apoptosis of rat (Fig.   5a) and human islet cells (Fig.   5b).

PDGFRα is a predicted target of miR-34a (www.

Moreover, western blot analysis of rat islet cells overexpressing miR-34a confirmed that the miRNA reduces the levels of PDGFRα (Fig.   8c, d).

miR-34a expression in brain (b) and liver (c) of rats.

Fig. 7Number of miR-34a and miR-181a recognition elements in the 3′ UTR of differentially expressed mRNAs in islets of 12-month-old rats.

Thus, although overexpression in beta cells of young animals did not significantly impair insulin release, we cannot exclude the possibility that the presence of higher levels of miR-34a or miR-124a would exacerbate the secretory decline of ageing beta cells.

The islet gene -expression profile of ageing animals also appears to be influenced by the induction of miR-34a.

Islet miR-34a expression was also positively correlated with age in human islets from normoglycaemic donors of different ages (r [2] = 0.58, p = 0.007) (Fig.   3a).

To experimentally verify PDGFRα as a target for miR-34a in these cells, INS832/13 cells were transfected with a luciferase construct containing the 3′ UTR of Pdgfra mRNA.

Being at the crossroad between ageing and metabolic imbalance, these findings point to miR-34a induction as an important risk factor for the development of type 2 diabetes.

Indeed, the induction of miR-34a and reduction of miR-181a in the islets of young animals mimicked the impaired beta cell proliferation observed in old animals.

A luciferase reporter construct was generated by inserting 212 nucleotides of the 3′ UTR sequence of rat Pdgfra surrounding the putative binding site of miR-34a between the XhoI and EcoRI sites of psiCHECK-1 (ESM ).

Although they did not reach statistical significance, the microarray data suggested a possible increase of miR-34a, miR-34b and miR-34c in the islets of old animals (ESM Table 4).

The increase in the level of miR-34a in the islets of ageing rats is probably linked to the activation of p53 signalling.

p53 and miR-34a are linked in a positive-feedback loop to sirtuin-1 (SIRT1).

Consistent with this mo del, we found that increases in p53 and miR-34a in the islets of ageing animals were indeed associated with reduced levels of SIRT1.

16

Fig. S1 Effects of methyl donor deficiency and folic acid supplementation on the expression of let-7a as depicted by in situ hybridization in the hippocampus, cerebellum and cerebral cortex from E20 fetuses (PDF 230 kb) Fig. S2 Effects of methyl donor deficiency and folic acid supplementation on the expression of miR-34a as depicted by in situ hybridization in the hippocampus, cerebellum and cerebral cortex from E20 fetuses (PDF 201 kb) Fig. S3 Consequences of miR-34a silencing on the morphology of control and folate -deficient (MDD) H19–7 cells at 13 h after induction of their differentiation (Si- = non -targeting siRNA, Si-miR-34a = miR-34a targeted siRNA).

Regarding miR-34a, the average downregulation of its targets was ∼5-fold in deficient samples, 96 % being downregulated by more than 3-fold (Fig. 5a, b).

MicroRNA Targets RT [2] Profiler PCR ArraysRat microRNA Targets RT [2] Profiler PCR Arrays (Qiagen, Courtaboeuf, France) in a 96-well plate format were used to monitor the expression of the most relevant experimentally documented or bioinformatically predicted gene targets for let-7a and miR-34a.

Rat microRNA Targets RT [2] Profiler PCR Arrays (Qiagen, Courtaboeuf, France) in a 96-well plate format were used to monitor the expression of the most relevant experimentally documented or bioinformatically predicted gene targets for let-7a and miR-34a.

Although the use of non -targeting siRNA (Si−) had no patent effect on the expression of Notch signaling proteins in differentiating cells, silencing miR-34a increased significantly the expression of ddl1, Notch1, and Hes1, while protein amounts of Mash1 were reduced (Fig. 7b).

In conclusion, we showed that methyl donor deficiency was associated with enhanced expression of let-7a and miR-34a, with subsequent alterations of their development regulatory targets such as Trim71 and Notch signaling partners.

Described as belonging to a “late-brain development” expression cluster in the mouse [61], miR-34a regulates numerous target genes involved in cell cycle, apoptosis, differentiation, and neuron maintenance [62].

b Expression levels of Notch signaling proteins and effects of miR-34 siRNA in control (C) and folate -deficient (MDD) H19-7 cells at 13 h after induction of differentiation (Si− = non -targeting siRNA, Si+ = miR-34 -targeted siRNA).

Statistically significant differences between MMD and MDD-B9: * P < 0.05, ** P < 0.01 (PDF 176 kb) Table S2Downregulation of miR-34a gene targets, according to their known functions, in methyl donor deficient (MDD) and supplemented deficient (MDD-B9) brain fetuses.

Cells are colabeled with antibodies against actin (green) and NF68 (red) and their nuclei counterstained by Dapi (blue) The Notch receptor ligand delta-like 1 (dll1) is a target of miR-34, and during morphogenesis of the central nervous system, differentiation of neural progenitors is known to be inhibited by hairy and enhancer of split homolog 1 (Hes1), whereas it is stimulated by mammalian achaete-scute complex homolog 1 (Mash1) [46].

Cells are colabeled with antibodies against actin (green) and NF68 (red) and their nuclei counterstained by Dapi (blue) The Notch receptor ligand delta-like 1 (dll1) is a target of miR-34, and during morphogenesis of the central nervous system, differentiation of neural progenitors is known to be inhibited by hairy and enhancer of split homolog 1 (Hes1), whereas it is stimulated by mammalian achaete-scute complex homolog 1 (Mash1) [46].

While it cannot fully prevent early-occurring NTDs such as spina bifida, maternal supplementation with folic acid during the period corresponding to the last trimester of pregnancy in women appeared to help preserve a normal development, at least partly through restoring let-7 and miR-34 normal expression.

Early Methyl Donor Deficiency Alters the Expression Pattern of a Wide Range of Genes Influenced by Let-7 and miR-34 and Involved in Various Aspects of Development.

In the present study, we provide the first evidence that the epigenetic overexpression of let-7a and miR-34a, along with the disruption of their related pathways, would be key players in the deleterious effects of early methyl donor deficiency on the anatomical and functional development of the central nervous system.

Methyl Donor Deficiency Increases Expression Levels of Let-7 and miR-34: Reversion by Folic Acid Supplementation.

The siRNA oligonucleotide duplexes were purchased from Ambion (Applied Biosystems) for targeting the rat let-7a (hsa-let-7a-5p) or miR-34a (hsa-miR-34a-5p) in H19-7 cells.

Fig. 7Effects of methyl donor deficiency and folic acid supplementation on Notch signaling proteins, targets of miR-34.

Similar observations could be made regarding the expression patterns of miR-34a (Fig. 3c, d).

Under the conditions of methyl donor deficiency, we observed a disruption of the expression of let-7a and miR-34a and their related pathways.

An increase in miR-34a would lead to a decrease in MTHFR expression, reducing methionine amounts to finally decrease methylation reactions and increase homocysteine levels.

Regarding miR-34a, its expression levels were also found to be significantly higher under methyl donor deficiency.

More specifically, an increase in the expression of miR-34a leads to a decrease of dll1, which mediates its effects by binding to the Notch receptor, causing its proteolytic cleavage and release of the Notch intracellular domain [63].

Interestingly, MTHFR is a predicted target of miR-34a [27].

Analysis of Let-7a and miR-34a Expression.

Furthermore, overexpression of miR-34a has been reported to alter neurite outgrowth and synaptogenesis, with functional consequences, in particular at the electrophysiological level [67].

c Expression levels of miR-34 in the midbrains of control and deficient rat embryos, and effects of folic acid supplementation.

Methyl Donor Deficiency Affects Protein Expression Levels of Known Downstream Pathways of Let-7 and miR-34: Reversion by Folic Acid Supplementation.

Statistically significant differences between MMD and MDD-B9: * P < 0.05, ** P < 0.01 Fig. 5Transcriptional alteration of relevant experimentally documented or bioinformatically predicted gene targets of miR-34a in fetal brain under methyl donor deficiency: effects of folic acid supplementation.

Let-7a and miR-34a expression in cell cultures was silenced using small interfering RNA.

Among the subset of miRNAs known to be regulated by methylation [28], let-7 (lethal 7) and miR-34 are believed to exert a requisite role at various steps of cerebral development, while they would influence the occurrence of NTDs [27, 29].

The siRNA sequence is (sense strand indicated): 5′-UGAGGUAGUAGGUUGUAUAGUU-3′ for let-7a, 5′-UGGCAGUGUCUUAGCUGGUUGU-3′ for miR-34a, and mirVana™ miRNA Inhibitor Negative Control #1 was used as control for evaluation of the effect of the experimental miRNA inhibition.

Most importantly, folic acid supplementation helped restoring the levels of let-7 and miR-34 and their respective targets.

Fig. 3Effects of methyl donor deficiency on the expression of let-7 and miR-34: influence of folic acid supplementation.

Taken together, the positive impact observed after folic acid supplementation and following siRNA strategy, along with the associated normalization of let-7a and miR-34a, strengthen the potential role of these microRNAs and their related signaling pathways in the developmental defects consecutive to gestational methyl donor deficiency.

Taken together, our data therefore suggest that the alterations observed in let-7 and miR-34 pathways in response to methyl donor deficiency may participate to a disruption of the proliferation/differentiation balance, resulting in improper development of the central nervous system, and influencing the occurrence of NTDs.

Products of RT reaction (1.33 μL) were used in a real-time PCR reaction, which also included 10 μL of the TaqMan Universal Master Mix II, and 1 μL TaqMan miRNA assay containing the sequence-specific primers of either the target miRNA (let-7: UGAGGUAGUAGGUUGUAUAGUU, miR-34: UGGCAGUGUCUUAGCUGGUUGU) or the U6SnoRNA (CACGAATTTGCGTGTCATCCTT) used as an endogenous control for normalization.

The in situ detection of let-7a and miR-34a was performed on paraffin-embedded sections from normal and methyl donor -deficient brain tissues by locked nucleic acid (LNA)-oligo in situ hybridization, as previously described by Kloosterman et al. [40].

Slides were then redehydrated and prehybridized in hybridization buffer with 0.5 nm specific probe (LNA -modified and digoxygenin (DIG)-labeled oligonucleotide, Exiqon, Copenhagen, Denmark) complementary to let-7a (AACTATACAACCTACTACCTCA ) or miR-34a (ACAACCAGCTAAGACACTGCCA).

Silencing Let-7a and miR-34a Restores Their Related Pathways and Contributes to Rescue Cells Exposed to Folate Deficiency.

By using the microarray approach, the identification of new putative target genes affected in response to methyl donor deficiency via let-7 and miR-34 warrants further investigations.

Consequences of silencing miR-34a on differentiating H19-7 cells.

In order to identify further mechanisms underlying the effect of maternal B-vitamin status on neural tube and brain development, in line with potential epigenetic dysregulations, we investigated the participation of let-7 and miR-34 as well as their related pathways in the consequences of methyl donor deficiency both in vivo on a validated rat mo del of maternal deficiency [30, 31] and in vitro in hippocampal progenitors [32].

17

The protective effects of CA are associated with the downregulation of miR-34a expression and are accompanied by SIRT1/p66shc signaling pathway activation, resulting in a significant reduction in cleaved caspase-3 levels and in the upregulation of Bcl-xL.

The dual luciferase assay revealed that miR-34a overexpression significantly decreased SIRT1 expression; no changes were observed in cells that were transfected with the mutant plasmid, suggesting that miR-34a directly binds to and downregulates SIRT1.

Following PA -induced miR-34a overexpression, SIRT1 expression decreased, and p66shc expression increased.

In addition, miR-34a overexpression decreased SIRT1 expression by approximately twofold (P<0.01; Figure 3c) with a concomitant increase in p66shc expression (Figure 3d).

Consistent with the in vivo results, miR-34a was upregulated in PA -treated L02 cells, but miR-34a expression decreased after treatment with CA or antago-miR-34a (Figure 4c).

CA decreased miR-34a expression, but cholic acid was a strong inducer of miR-34a expression (Figure 2a, right panel).

CA -mediated inhibition of miR-34a has an antiapoptotic effect in hepatocytes by targeting the SIRT1/p66shc pathway.

As expected, CA diminished miR-34a expression and elicited the same effect as antago-miR-34a (miR-34a inhibitor) in the cell mo del.

Although luciferase activity was significantly repressed by miR-34a overexpression, it increased in response to CA in both control and miR-34a -overexpressing cells (Figure 3a).

Together, these data suggested that SIRT1 is a target of miR-34a and that CA -mediated inhibition of miR-34a confers protection against NAFLD, which is related to the activation of the SIRT1/p66shc signaling pathway.

Furthermore, CA had the same effect as antago-miR-34a (a miR-34a inhibitor), which blunted the overexpression of miR-34a in L02 cells exposed to PA (Figures 4a, c and d).

To test the hypothesis that miR-34a downregulation and SIRT1/p66shc activation are associated with the CA -mediated attenuation of NAFLD, we measured the changes in the expression of miR-34a, SIRT1 and p66shc in response to CA in vivo and in vitro.

Thus, these results suggested that miR-34a downregulation and SIRT1/p66shc activation are involved in the protective effect of CA against NAFLD.

17, 43 Together with our data, these findings indicate that a miR-34a/SIRT1/p66shc -dependent mechanism targeted by CA is involved in regulating oxidative stress and apoptosis in NAFLD.

CA -mediated protection against NAFLD involves miR-34a downregulation and SIRT1/p66shc activation.

Therefore, the miR-34a/SIRT1/p66shc proapoptotic pathway may represent an attractive pharmacological target for the development of new drugs to impede the progression of NAFLD.

Furthermore, CA reversed the loss of SIRT1 and the increase in p66shc levels induced by miR-34a overexpression.

Moreover, CA treatment significantly blunted the HFD -induced increase in miR-34a expression.

These results suggested that the effect of CA on NAFLD may be related to inhibiting hepatocyte apoptosis at least partly by modulating the miR-34a /SIRT1/p66shc pathway.

These results indicate that CA confers protection against NAFLD, at least in part, by inhibiting the miR-34a/SIRT1/p66shc pathway.

[37] Interestingly, increased miR-34a levels have been reported in serum from NAFLD patients, and the expression of miR-34a in human liver significantly increases with NAFLD severity.

21, 32 Because SIRT1 is the best-characterized direct target of miR-34a, we investigated the relationship between the CA -induced downregulation of miR-34a and SIRT1/p66shc pathway activation.

Importantly, CA and antago-miR-34a proportionally inhibited FFA -induced apoptosis (Figures 4a and b).

Thus, miR-34a represents a potential therapeutic target for CA in the treatment of NAFLD.

Notably, CA reversed the loss of SIRT1 and the increase in p66shc induced by miR-34a overexpression (P<0.01).

Thus, we concluded that CA may target the miR-34a/SIRT1/p66shc apoptotic signaling pathway in NAFLD.

Consistent with the luciferase assays, miR-34a expression was markedly increased after ago-miR-34a transfection compared with the control, whereas CA significantly diminished miR-34a expression (Figure 3b).

However, CA treatment markedly alleviated the NAFLD induced by HFD in rats and diminished the increase in miR-34a expression, thereby indicating that CA may have the same effect as silencing miR-34a with LNA -modified ONs to protect rats against NAFLD.

[32] In addition, miR-34a overexpression in lean mice resulted in obesity-related outcomes, and conversely, antagonism of miR-34a by LNA -modified ONs in diet -induced obese mice alleviated steatosis, inflammation and glucose intolerance.

These results revealed that CA increases SIRT1 expression at least partly in a miR-34a -dependent manner.

To further elucidate the cellular effects of CA on SIRT1, we transfected L02 cells with ago-miR-34a in the presence or absence of CA and determined the expression levels of miR-34a, SIRT1 and p66shc.

Overexpression of miR-34a has been suggested to significantly increase lipid accumulation and FFA -induced apoptosis in cultured primary rat hepatocytes.

32, 38 In this regard, HFD-fed rats exhibited increased miR-34a expression, lipid accumulation and apoptosis.

As shown in the left panel of Figure 2a, miR-34a expression was increased in the HFD group compared with the ND group.

Plasmid DNA (wt-Luc-SIRT1, mut-Luc-SIRT1, or control vector) and ago-miR-34a or the ago-miR negative control were co -transfected into L02 cells.

Our findings showed that CA exerts an antiapoptotic effect in NAFLD through the miR-34a/SIRT1/p66shc signaling axis.

To validate the modulation of SIRT1 by CA via miR-34a, we co -transfected ago-miR-34a and luciferase reporter plasmids containing the miR-34a-SIRT1 response element (wt-Luc-SIRT1) or a mutant miR-34a-SIRT1 response element (mut-Luc-SIRT1) in the presence or absence of CA.

In addition to p53/p66shc signaling, we suggest that the miR-34a/SIRT1/p66shc -mediated proapoptotic pathway has a pivotal role in NAFLD.

Plasmids containing the wild-type miR-34a-SIRT1 response element (wt-Luc-SIRT1) and the corresponding mutant (mut-Luc-SIRT1) were purchased from GenePharma Corp.

[32] For the experiments, L02 cells were transfected with 10 nM ago-miR-34a (GenePharma, Shanghai, China) or ago-miR -negative control using Lipofectamine 2000 (Invitrogen).

18

Members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [14- 19].

It was previously demonstrated that miR-34a targets Sirt1 and is regulated by p53, which in turn, is activated by Sirt1 suppression [59].

Notably, miR-34a expression was also gradually upregulated after NGF treatment.

In fact, miR-34a upregulation in ES cells after LY treatment, as well as in NT2N cells after incubation with the mitosis inhibitor, supports this hypothesis.

The expression of miR-16, let-7a and miR-34a was consistently upregulated in neural differentiation mo dels.

Because miR-34a upregulation coincides with the onset of postmitotic neurons, we investigated the effect of miR-34a upregulation in this population by evaluating NeuN expression.

Given that miR-34a has been shown to regulate genes involved in cell cycle arrest, it is possible that miR-34a upregulation is related to cell cycle exit and the subsequent appearance of immature postmitotic neurons.

A role for miR-34a in megakaryocytic differentiation was recently reported, where the miRNA regulates the expression of MYB, and CDK4 and CDK6, thus promoting cell cycle arrest [22].

In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family.

In conclusion, the identification of miR-16, let-7a and miR-34a, whose expression patterns are conserved in mouse, rat and human neural differentiation, implicates these specific miRNAs in mammalian neuronal development.

After a 3-fold increase at 3 days (p < 0.01), miR-34a was further upregulated at day 6 by ~ 11-fold (p < 0.001), comparing with undifferentiated cells.

Interestingly, herein we showed a significant upregulation of miR-34a during mouse NS cell differentiation, and this paralleled the appearance of postmitotic neurons.

Interestingly, and similar to miR-34a/b/c, miR-16 was upregulated at both 3 and 8 days of neural differentiation.

Furthermore, miR-34a is involved in dendritic cell differentiation [23], and is required for proper differentiation of mouse ES cells by targeting Sirt1 [24].

Our results showed that the differential expression of miR-16, let-7a and miR-34a during mouse NS cell differentiation was not associated with cell death.

A and B) miR-16, let-7a and miR-34a expression during PC12 and NT2N differentiation, respectively.

Importantly, it has been previously reported that miR-34a overexpression had no effect on cell cycle arrest and survival/apoptosis of astrocytes [57, 58].

In addition, in vitro transient overexpression of miR-34a increased the proportion of NeuN -positive cells.

miR-34a was the most significantly upregulated miRNA during mouse NS cell differentiation (~ 11-fold between days 3 and 6; p < 0.001) compared to other apoptosis -associated miRNAs.

Figure 7 miR-34a overexpression increases the ratio of postmitotic neurons in mouse NS cells.

C) Expression of miR-16, Let-7a and miR-34a at 4 and 8 days of ES cell differentiation and in control (DMSO -treated) and LY411575 -treated rosette cultures at 8 days.

Similarly to miR-16 and let-7a, a decrease in miR-34a expression occurred from day 6 to day 8. Figure 2 Apoptosis -associated miRNAs are modulated during mouse NS cell differentiation.

B) Representative blot showing increased NeuN expression in pre-miR-34a transfected cells.

Overexpression of miR-34a increased the proportion of postmitotic neurons of mouse NS cells.

miR-34a expression was modulated using 100 nM of precursor control and pre-miR-34a (Applied Biosystems, Foster City, CA).

In fact, several potential miR-34a targets might be involved in the transition towards postmitotic neurons.

In addition, it has been previously shown that miR-34a can suppress cell-cycle genes and induce neural phenotype in neuroblastoma tumors [56].

Figure 6 Differentiation of PC12 and NT2N cells were associated with modulated levels of miR-16, let-7a and miR-34a expression.

In conclusion, our results demonstrate that apoptosis -associated miRNAs are differentially expressed during neural differentiation, in the absence of cell death, and identify miR-16, let-7a and miR-34a as important players.

Similarly to miR-16 and let-7a, a decrease in miR-34a expression occurred from day 6 to day 8. Figure 2 Apoptosis -associated miRNAs are modulated during mouse NS cell differentiation.

To further validate the role of the proapoptotic miRNAs, miR-16, let-7a and miR-34a in neural cell differentiation, we investigated whether they were upregulated in other neural differentiation mo dels, including mouse ES cells, PC12 and NT2N cell lines.

In addition, miR-34a may also regulate the differentiation process by influencing Notch signaling pathway [57, 60].

In fact, at this stage of differentiation, expression levels of miR-16, let-7a and miR-34a were increased when compared with day 4 (Figure 5B).

In independent repetitions of these experiments, similar increases in the relative number of NeuN -positive cells were observed in cultures overexpressing miR-34a when compared to control pre-miR -transfected cells.

Surprisingly, increased differentiation after replating was associated with a significant decrease in both miR-16 and let-7a expression by ~ 2 (p < 0.05) and 5-fold (p < 0.001), while miR-34a increased by 4.5-fold (p < 0.05), compared with non-replated cells.

In this regard, miR-34a has been shown to regulate genes involved in cell cycle control and apoptosis, including cyclin -dependent kinase 4 (CDK4), CDK6, cyclin D1, E2F3 and SIRT [17, 20, 21].

Expression of specific proapoptotic (miR-16, let-7a and miR-34a) and antiapoptotic miRNAs (miR-20a and miR-19a) were analyzed by quantitative Real Time-PCR from 10 ng of total RNA using specific Taqman primers and GAPDH for normalization.

A) Percentage of NeuN positive cells in negative control and pre-miR-34a -transfected cells, 24 and 72 h after transfection.

Notably, LY411575 -induced neurogenesis resulted in a significant increased of miR-16 and miR-34a, by 3- and 2-fold (Figure 5B), respectively (p < 0.05), supporting the potential involvement of both miRNAs in neuronal differentiation.

Mouse NS cells were transfected using 100 nM of either control or pre-miR-34a, and collected 24 and 72 h after transfection.

Figure 5 miR-16, let-7a and miR-34a are increased during mouse ES cell differentiation.

In contrast, miR-34a was not modulated during cell differentiation.

These results strongly suggested that modulation of miR-16, let-7a and miR-34a was most likely due to cell differentiation rather than cell death.

A specific role for miR-34a during neuronal differentiation has not been reported.

In contrast to let-7a and miR-16, miR-34a was barely detected in undifferentiated cells, supporting its specific involvement in cell differentiation.

No changes were detected in the proportion of astrocytes in the pre-miR-34a transfected cells (data not shown).

Next, we characterized the expression of proapoptotic miRNAs, including miR-16, let-7a and miR-34a in distinct mo dels of neural differentiation, including mouse embryonic stem cells, PC12 and NT2N cells.

miR-34a, in turn, was modulated primarily beyond the third day of differentiation.

These results indicated that miR-34a contributes to neuronal differentiation in mouse NS cells.

Based on a possible link between miR-16, let-7a and miR-34a with known apoptotic molecules that have already been associated with differentiation, we decided to validate microarray data for the three proapoptotic miRNAs throughout mouse NS cell differentiation by quantitative real time-PCR (Figure 2).

19

Furthermore, our study revealed that the global upregulation of miR-21 and downregulation of miR-34a in breast carcinogenesis could be reversed by 3,6-DHF, which significantly upregulated miR-34a expression and decreased miR-21 expression - inducing apoptosis of breast cancer cells in vitro and in vivo.

The results revealed the global upregulation of miR-21 expression and downregulation of miR-34a expression at all time points in breast carcinogenesis.

In this study, we revealed the global upregulation of miR-21 expression and downregulation of miR-34a expression at all the three time points after MNU injection, which could be reversed by 3,6-DHF oral administration.

3,6-DHF significantly upregulated miR-34a expression and decreased miR-21 expression, inducing apoptosis of breast cancer cells in vitro and in vivo.

As shown in Figure 3, 3,6-DHF administration could significantly inhibit the upregulation of miR-21 and effectively increase the expression of miR-34a.

Detections using quantitative RT-PCR indicated 3,6-DHF treatment significantly upregulated the miR-34a level and decreased miR-21 expression of breast cancer cells in vitro and in vivo (Figure 5B, C).

Furthermore, overexpression of miR-34a induced by plasmid transfection or inhibition of miR-21 by oligonucleotides markedly promoted the pro-apoptotic effect of 3,6-DHF, while inactivation of miR-34a or overproduction of miR-21 compromised the anticancer effects of 3,6-DHF.

Overexpression of miR-34a induced by plasmid transfection or inhibition of miR-21 by oligonucleotides markedly promoted the pro-apoptotic effect of 3,6-DHF.

miR-34a was demonstrated to be a direct transcriptional target of p53, and a component of the p53 transcriptional network [29- 31].

miR-34a expression is sufficient to induce apoptosis through p53 -dependent mechanisms [32, 33].

3,6-DHF: 3,6-dihydroxyflavone; DMEM: Dulbecco's modified Eagle's medium; FITC: fluorescein isothiocyanate; HPLC: high-performance liquid chromatography; JC-1: 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethyl-imidacarbocyanine iodide; miRNA: microRNA; miR-21: microRNA-21; miR-34a: microRNA-34a; MNU: 1-methyl-1-nitrosourea; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; RT: reverse transcriptase; T/ C: median tumor volume of treated animals/median tumor volume of controlled animals; TUNEL: terminal deoxynucleotidyl transferase -mediated dUTP nick end-labeling; UTR: untranslated region; V [t]: tumor volume.

We detected the expressions of miR-21 and miR-34a in rat breast tissue at 0, 4, 8 and 18 weeks after MNU injection, respectively.

Quantitative RT-PCR analysis of miR-34a and miR-21 expression.

To construct plasmids expressing miR-34a and miR-21, the genomic fragment containing miR-34a and miR-21 precursor was amplified from MDA-MB-453 cells and cloned into the pcDNA6.2-GW/EmGFP vector.

Expression of miR-34a and miR-21 in breast carcinogenesis and the influence of 3,6-dihydroxyflavone.

The expression of miR-34a and miR-21 was detected by quantitative RT-PCR as mentioned below.

In transfected breast cancer cells, overexpressed miR-34a markedly promoted 3,6-DHF -induced cytotoxicity and apoptosis.

Monitoring miR-34a expression in human tumors and manipulating its levels may provide new clues for cancer prevention, diagnosis, and therapy.

Figure 5 Increasing intracellular miR-34a or silencing miR-21 expression promoted 3,6-dihydroxyflavone -induced breast cancer cell cytotoxicity and apoptosis.

For detection of miR-34a and miR-21 expression, stem-loop RT-PCR was performed as previously described [20, 21].

Figure 3 Expressions of miR-21 and miR-34a in breast carcinogenesis and the influence of 3,6-dihydroxyflavone.

Detection of miR-34a and miR-21 expression in breast tumors.

Expression of microRNA-21 (miR-21) and microRNA-34a (miR-34a) in rat breast tissue was detected by quantitative RT-PCR at 0, 4, 8, 18 weeks after 1-methyl-1-nitrosourea injection, respectively.

The flavonoid suppressed carcinogenesis and induced apoptosis of breast cancer cells partially through miR-21 and miR-34a association.

Inhibition of miR-34a in cancer cells led to a marked decrease in 3,6-DHF -induced cytotoxicity and apoptosis.

As a pro-apoptotic transcriptional target of p53, miR-34a exerts anti-proliferative effects and contributes to p53 -mediated apoptosis [10, 11].

To explore the effects of miR-34a and miR-21 in the anticancer activities of 3,6-DHF, we constructed plasmids expressing miR-34a or miR-21, respectively.

Transient transfection of these plasmids led to substantial production of mature miR-34a or miR-21 in breast cancer cells (Figure 5B, C).

Inactivation of miR-34a or overproduction of miR-21 compromised the anticancer effects of 3,6-DHF.

Among those p53-related miRNAs, microRNA-34a (miR-34a) is a typical one.

Anti-miR-34a oligonucleotides (5'-ACAACCAGCTAAGACACTGCC-3') were from Exiqon (Vedbaek, Denmark).

Furthermore, a locked nucleic acid oligonucleotide complementary to the miR-34a sequence (anti-miR-34a) served to block miR-34a function.

These findings indicate that 3,6-DHF is a potent natural chemopreventive agent, and that miR-34a and miR-21 play roles in MNU -induced breast carcinogenesis and the anticancer mechanism of flavonoids.

Furthermore, our study also reveals that miR-34a and miR-21 play roles in MNU -induced breast carcinogenesis and the anticancer mechanism of the flavonoid.

The expression of microRNA-34a (miR-34a) and microRNA-21 (miR-21) was evaluated by real-time quantitative RT-PCR.

miR-34a and miR-21 play roles in 3,6-dihydroxyflavone -induced apoptosis in breast cancer cells.

TX, tumor xenograft of MDA-MB-231 breast cancer cells; MC, MDA-MB-453 cells transfected with blank plasmids (mock cells); TC [34a], MDA-MB-453 cells transfected with pcDNA6.2-GW/miR-34a; TC [21], MDA-MB-453 cells transfected with pcDNA6.2-GW/miR-21.

20

Taken together, these results reveal that miR-375 targets Psen1, miR-30a targets Psen2, and miR-34a targets Notch1 by regulating the relevant 3′utr regions and repressing their translation, thereby suppressing the NICD1 level in INS-1 cells.

The expression level of miR-375 was downregulated to 22.9%, that of miR-30a was downregulated to 28.1%, and that of miR-34a to 22.7% after anti-miRNAs transfection.

In the present study, we showed that miR-375 targets Psen1, miR-30a targets Psen2, and miR-34a targets Notch1, all of which are newly identified targets that converge onto one signaling pathway.

Inhibiting miR-375, miR-30a, and miR-34a rescued glucotoxicity -induced defectsThe function of these three miRNAs was further clarified by knocking down their expression levels in INS-1 cells using miRNA inhibitors (Fig. 5A).

Specifically, miR-375 targets Psen1, miR-30a targets Psen2, and miR-34a targets Notch1 itself, but they all decrease the NICD1 level and inactivate Notch1 signaling.

MiR-375 targeted Psen1, miR-30a targeted Psen2, and miR-34a targeted Notch1.

These GK rats also showed that miR-375 and miR-30a expressions were decreased, while miR-34a expression was significantly increased (Fig. 6D).

A combination of literature screening, bioinformatics analysis, and experimental assays confirms that miR-375, miR-30a, and miR-34a regulate NICD1 protein expression via diverse targets involving γ-secretase -mediated Notch1 cleavage.

The combined use of bioinformatics prediction softwares (TargetScan and miRanda) and literature screening pointed to miR-375, miR-30a, and miR-34a as potential targets for further exploration.

MiR-34a targets VAMP2 and BCL2 expression, leading to beta cell damage 23 37.

Protein levels were determined following overexpression or knockdown of miR-375 (C), miR-30a (F), or by miR-34a (I).

The levels of miR-375 and miR-34a were modestly elevated (Fig. 7D), in parallel with the decreased gene expression levels of components of γ-secretase and Notch1 (Fig. 7E).

miR-375 and miR-34a expression levels (D).

miR-375, miR-30a, and miR-34a mimicked glucotoxicity -induced defectsThe expression of miR-375, miR-30a and miR-34a was significantly induced by high glucose in both rat pancreatic islets (Fig. 4A) and INS-1 cells (Fig. 4B).

The expressions of miR-375, miR-30a and miR-34a were determined after 24 h miRNA transfection (C).

Inhibiting miR-375, miR-30a, and miR-34a rescued glucotoxicity -induced defects.

Therefore, the elevated levels of miR-34a observed are likely an effect of triggering of p53 activity by high glucose in our study, as miR-34a is a conventional target gene of p53.

miR-375, miR-30a and miR-34a expression levels (D).

Several reports have demonstrated that miR-34a expression is increased in primary islets from high-fat-diet (HFD) mice and genetic diabetic db/db mice, as well as in beta cells treated with cytokines and palmitate 16 23.

These data demonstrated that inhibition of miR-375, miR-30a, and miR-34a can partially rescue the beta cell apoptosis caused by glucotoxicity.

Elevated levels of miR-375, miR-30a, and miR-34a decreased the K [+]-stimulated insulin secretion index (KSI) (SEM Fig. 3A), insulin content (SEM Fig. 3B), and insulin gene expression (SEM Fig. 3B), and increased the numbers of apoptotic cells (Fig. 4D).

No alteration of Notch1 mRNA level by miR-34a overexpression was observed (data not shown).

The expression of miR-375, miR-30a and miR-34a was significantly induced by high glucose in both rat pancreatic islets (Fig. 4A) and INS-1 cells (Fig. 4B).

Effects of miR-375, miR-30a, and miR-34a expression of INS-1 cells.

In conclusion, we have shown that miR-375, miR-30a, and miR-34a orchestrate the regulation of γ-secretase -mediated Notch1 cleavage in a glucotoxicity setting in pancreatic beta cells.

Further, miR-34a could regulate the Notch1 3′utr region (Fig. 3H) and reduce the NOTCH1 protein level, without affecting PSEN1 and PSEN2 levels (Fig. 3I).

This study was undertaken to elucidate the regulatory networks operating between miRNAs (miR-375, miR-30a, and miR-34a) and the presenilin/Notch1 pathway in the context of glucotoxicity -induced pancreatic beta cell impairment.

How to cite this article: Li, Y. et al. A Presenilin/Notch1 pathway regulated by miR-375, miR-30a, and miR-34a mediates glucotoxicity induced-pancreatic beta cell apoptosis.

Wt and mt plasmids were cotransfected with relative miRNAs for 24 h, and luciferase reporter activities were analyzed for miR-375 toward Psen1 (B), miR-30a toward Psen2 (E), and miR-34a toward Notch1 (H).

However, Notch1 signaling is only associated with glucotoxicity -induced beta cell apoptosis and its effects are unlike those evoked by miR-375, miR-30a, and miR-34a.

Elevated levels of miR-34a were also observed in the present study in INS-1 cells stimulated by high glucose and in primary islets from diabetic GK rats and aged rats.

As shown in Fig. 3A,D,G, the miRNA response element (MRE) was well matched between miR-375 and Psen1, between miR-30a and Psen2, and between miR-34a and Notch1.

miR-375, miR-30a, and miR-34a mimicked glucotoxicity -induced defects.

The present study and other studies have shown that elevation of miR-375, miR-30a, or miR-34a individually results in beta cell dysfunction, decreases cell survival, and increases apoptosis, thereby mimicking the cellular phenotype provoked by glucotoxicity.

The miRNA mimics were introduced to enforce cellular levels of miR-375, miR-30a, and miR-34a in INS-1 cells (Fig. 4C).

Taken together, these results suggest that miR-375, miR-30a, and miR-34a are capable of mimicking glucotoxicity -induced beta cell impairment and NOTCH1 inactivation associated with these miRNAs -induced beta cell apoptosis.

The repression of PSEN1 by high glucose was recovered by anti- miR-375, repression of PSEN2 was recovered by anti-miR-30a, and repression of NOTCH1 was recovered by anti- miR-34a; all of these responses resulted in the recovery of NICD1 protein level (Fig. 5B).

21

Given AR expression is inhibited by miR-34a [37, 38] and miR-34a expression is inhibited by XRN1 (Fig. 5D), it is expected that knockdown of XRN1 might reduce AR expression via miR-34a expression.

Furthermore, given low expression of miR-34a is not sensitive to knockdown of XRN1 in CL-1 cells (Fig. 5D), inhibition of CD44 expression by XRN1 (Fig. 5C) suggests that XRN1 regulates CD44 expression in the way independent of miR-34a in NEPC cells.

In this loop, androgen up-regulates XRN1, by repressing miR-204 expression, while XRN1 raises AR expression by reducing expression of miR-34a (Fig. 5G).

In addition, We also demonstrated that XRN1 selectively down-regulates expression of miR-34a, an AR -targeting micro -RNA (Fig. 5D), and that inactivation of miR-34a reduces expression of AR (Fig. 5F) [39] and increases aggressiveness of PAC cells [39].

miR-204 and XRN1 regulate AR expression, and miR-34a is a XRN1 target that down-regulates AR.

Finally, it should be noted that down-regulation of miR-34a by XRN1 might contribute to PCa progression independent of AR, since miR-34a can act as a tumor suppressor through directly inhibiting CD44 in tumorigenic and metastatic PCa stem cells [42].

In contrast to the miR-34a inhibitor, the miR-204 inhibitor marginally changed the AR expression after it was co -transfected into LNCaP cells with XRN1-siRNA.

Consistent with this, AR expression was induced moderately in LNCaP cells transfected with the miR-34a inhibitor when compared to its control (Fig. 5F), supporting that miR-34a is an AR -targeting miRNA [37].

Similarly, since CD44 is a target of miR-34a [42], high levels of CD44 expression in NEPC cells [8- 10] are probably resulted from low levels of miR-34a.

In addition, AR expression in LNCaP cells transfected with XRN1-siRNA alone was approximately 31% of that in the cells transfected with GFP-siRNA, but approximately 78% of that in cells co -transfected with XRN1-siRNA and the miR-34a inhibitor (Fig. 5F).

For example, miR-34a expression is activated transcriptionally by the tumor suppressor p53 [43].

Given that TP53 is mutated in majority of NE tumor cells, which is important for progression of SCNC [44], it may help us to understand why compared with LNCaP cells that express wild-type p53, p53 -null CL1 and PC-3 cells [33, 45] express low levels of miR-34a (Fig. 5E) [46].

Taken together, our results indicated that XRN1, via miR-34a, positively regulated AR expression.

XRN1 induces AR expression via its downstream effector miR-34a.

To test this, we examined the impact of XRN1-siRNA on levels of four reported AR -targeting miRs (i. e. miR-34a,-488,-185,-297) in LNCaP and CL-1 cell lines.

This low level of miR-34a in CL-1 cells might be below the threshold needed for the exoribonuclease activity of XRN1, which may account for ineffectiveness of XRN1 on miR-34a expression in this cell line.

In conclusion, we have demonstrated that AR-miR-204-XRN1-miR-34a feedback loop (Fig. 5F) plays an important role in regulating growth of PAC cells.

Function of AR/miR-204/XRN1/miR-34a loop could be regulated by many factors associated with PCa progression.

Because of this, there might be a mutually functional regulation between XRN1 and p53 through miR-34a in PCa cells.

Given that miR-204 and XRN1 are regulated by AR (Figs. 1 and 3), these results established an AR-miR-204-XRN1-miR-34a feedback loop functionally active in PAC cells (Fig. 5G).

Our results showed that one of them, i. e, miR-34a was significantly increased by XRN1-siRNA (~2.78 folds) in LNCaP cells but not in CL-1 cells (Fig. 5D).

Therefore, our analysis further expands AR-miR-204-XRN1 axis to AR-miR-204-XRN1-miR-34a feedback loop.

miR-34a, miR-204 (RiboBio, Guangzhou), AR-siRNA and XRN1-siRNA (GenePharma, Shanghai) were transfected into cells using Lipofectamine 2000 (Invitrogen).

Our result also showed that level of miR-34a in CL-1 cells is approximately 14.7% of that in LNCaP cells (Fig. 5E).

22

Upregulating miR-34a changes its target genes expression involving in multiple signal transduction pathways, represses tumor growth significantly [20, 21], and may be an efficient strategy for cancer treatment.

Our study showed that 3,6-DHF effectively increases TET1 expression by inhibiting DNMT1 and DNA hypermethylation, and consequently up-regulates miR-34a in breast carcinogenesis.

Our study showed that 3,6-DHF increases TET1 expression during carcinogenesis and up-regulates miR-34a level by regulating the methylation status of DNA.

Thus we can conclude that 3,6-DHF inhibits DNMT1 activity, modulates the imbalance of DNA methylation and demethylation status, increases TET1 expression, re-expresses miR-34a, and as a consequence, prevents breast carcinogenesis.

These data suggests that 3,6-DHF up-regulates miR-34a by increasing TET1 expression and thus demethylation of miR-34a promoter.

In our previous research, we observed that 3,6-DHF up-regulates the miR-34a and over-expressed miR-34a promoted cytotoxicity and apoptosis in breast cancer cells induced by 3,6-DHF [22].

Fig. 33,6-DHF reactivates the expression of tumor suppressor miR-34a through increasing TET1 level in breast cancer cells.

Further study indicated that TET1 siRNA and pcDNA3/Myc-DNMT1 inhibited the 3,6-DHF reactivation effect on expression of miR-34a in breast cancer cells.

In our research, we observed that 3,6-DHF could reverse the global down-regulation of miR-34a in breast carcinogenesis by regulating the miR-34a promoter methylation.

The results also showed that DNMT1 over -expression significantly reduces 3,6-DHF activation of miR-34a (Fig.   3c) and inhibits the demethylation effect of 3,6-DHF on the miR-34a promoter (Fig.   4a, b).

The results showed that inhibition of TET1 significantly suppresses the effects of 3,6-DHF on miR-34a (Fig.   3c).

DNMT1 over -expression blocked the effect of 3,6-DHF on increasing miR-34a mRNA and miR-34a promoter demethylation, suggesting that 3,6-DHF could reactivate tumor suppressor genes silenced by promoter methylation during tumorigenesis by repressing DNMT1 activity.

In this paper, we demonstrate that 3,6-DHF demethylases the miR-34a promoter by inhibiting DNMT1 activity and increasing TET1 expression.

We blocked TET1 expression by siRNA to evaluate the role of TET1 in 3,6-DHF -induced up-regulation of miR-34a in MDA-MB-231 cells (Fig.   3a, b).

Furthermore, DNMT1 over -expression in part blocked the effect of TET1 on miR-34a by TET1 promoter demethylation.

Wong KY Yu L Chim CS DNA methylation of tumor suppressor miRNA genes: a lesson from the miR-34 familyEpigenomics.

3,6-DHF reactivates the tumor suppressor miR-34a via promoting TET1.

MiR-34a is a miRNA regulated by the p53 network at the transcriptional level and has been shown to be remarkably down regulated in a variety of cancers.

We evaluated the mechanism of 3,6-DHF on the expression of tumor suppressor miR-34a by transfecting them with DNA methyltransferase (DNMT)1 plasmid and TET1 siRNA in breast cancer cells.

TET1 inhibition with siRNA in MDA-MB-231 cells blocked the effect of 3,6-DHF on increasing miR-34a mRNA and miR-34a promoter demethylation, suggesting that the increase of TET1 could be one of the mechanisms of breast cancer prevention by 3,6-DHF.

Methylation-specific PCR assays indicated that TET1 siRNA and pcDNA3/Myc-DNMT1 inhibit the effect of 3,6-DHF on the demethylation of the miR-34a promoter.

MSP assays showed that 3,6-DHF decreases the methylation of the miR-34a promoter, and that TET1 inhibition could counteract the effect of 3,6-DHF on the miR-34a promoter (Fig.   4a, b).

This finding prompted us to further study the mechanism of 3,6-DHF in regulating DNA methylation of the miR-34a promoter.

MiR-34a levels are not only determined by transcriptional regulation, but also by processes relating to miRNA biogenesis.

d Flow chart illustrating mechanism of 3,6-DHF in regulating DNA methylation of the miR-34a promoter We examined the effect of 3,6-DHF on global DNA methylation in breast cancer MDA-MB-231 cells.

MiR-34a may counteract the p53 response to DNA damage [18] and miR-34a hypermethylation occurs in pre-cancerous lesions in tumor formation [19].

Bisulfite template DNA of miR-34a and TET1 were also detected by quantitative PCR (qPCR).

Breast cancer Carcinogenesis 3,6-Dihydroxyflavone TET1 DNMT1 miR-34a Methylation Breast cancer is a common cancer and the leading cause of cancer deaths in China [1].

Methylation-specific PCR detected methylation of the miR-34a promoter.

a The methylation status of miR-34a promoter in MDA-MB-231 cells with 3,6-DHF (20 μM) treatment for 24 h, or transfecting TET1 siRNA before 3,6-DHF (20 μM) treatment for 24 h. or transfecting pcDNA3/Myc-DNMT1 before 3,6-DHF (20 μM) treatment for 24 h. b The level of the DNA methylation of miR-34a promoters in MDA-MB-231 cells as determined by qPCR according to Fig.  4a.

In this paper, we explored how DNA methylation and demethylation influence the effect of 3,6-DHF on miR-34a.

qRT-PCR analysis for miR-34a.

Research shows that the miR-34a promoter hypermethylation leads to its epigenetic inactivation [14– 17].

c The effect of 3,6-DHF (0, 20 μM) on the levels of miR-34a in MDA-MB-231 cells after transfecting TET1 siRNA or pcDNA3/Myc-DNMT1(DNMT1) as detected by qRT-PCR.

We used qRT-PCR to analyze miR-34a and ten-eleven translocation (TET)1, TET2, TET3 levels in breast cancer cells.

In previous study, we determined that 3,6-dihydroxyflavone (3,6-DHF) increases miR-34a significantly in breast carcinogenesis, but the mechanism remains unclear.

23

The results of the present study showed that crocin pretreatment (1) protected the rat's liver against hepatic IR -induced injury; (2) upregulated the protein expression of Nrf2; (3) downregulated the expression levels of miR-122 and miR-34a; (4) improved the liver enzymes AST, ALT, and ALP; (5) increased the antioxidant activity of SOD, GPx, and CAT; and (6) decreased the protein expression of p53 following hepatic IR -induced injury.

On the other hand, a study indicated that chemical suppression of p53 inhibits miR-34a upregulation and dramatically decreased oxidative stress, apoptosis, and hepatic steatosis [31].

The results of the current study showed that crocin (a) decreased the increased serum levels of miR-122 and miR-34a in rats following IR -induced injury; (b) downregulated the protein expression of p53 in the liver; (c) decreased the increased serum levels of liver enzymes; (d) increased the decreased level of antioxidant activity of SOD, GPx, and CAT in the liver; (e) mitigated the histopathological changes induced by hepatic IR injury; and (f) increased Nrf2 expression.

miR-34a is a direct target of p53 [17] which inhibits cell proliferation and regulates liver function [18].

These reports suggest that the lower expression of miR-34a in crocin pretreated rats could be due to the inhibitory effect of crocin on p53 expression.

These findings together suggest that the promotion of Nrf2 by crocin decreased IR -induced ROS accumulation which led to downregulating the expression of miR-34a.

Therefore, these findings suggest that crocin similar to carnosic acid [63] and hydrogen sulfide [54] through silencing the expression of miR-34a protects the rat liver by inhibiting apoptosis against IR -induced cell injury.

A study showed that the activity of Nrf2 and its ARE target in liver is inhibited by miR-34a [54].

These results together suggest that miR-34a by inhibiting the activity of Nrf2 and its downstream target genes decreased the activity of antioxidants.

It has been shown that inhibition of miR-34a protects the liver function against IR- and nonalcoholic fatty liver disease- (NAFLD-) induced injury [21].

Under the condition of endoplasmic reticulum (ER) stress, a transmembrane endoplasmic kinase-endoribonuclease cleaves precursor of miR-34a which in turn causes apoptosis by upregulating the apoptotic protein caspase 2 [27, 28].

The findings of the present study showed that crocin as a potent antioxidant through downregulating miR-122 and miR-34a effectively controls ROS -induced liver injury.

Additionally, it was identified that induction of miR-34a as a fine tuning of gene expression by p53 significantly leads to changes such as apoptosis and regulation of cell cycle [62].

Therefore, the increased production of ROS following IR injury [57] could be the other mechanism caused to the overexpression of miR-34a.

Moreover, inhibition of miR-34a has been demonstrated to mitigate the pathological changes in other organs such as heart [19], intestine, and lung [22].

Therefore, p53 increases the expression level of miR-34a [64, 65].

It has been shown that the expression of miR-34a is involved in age-related loss of antioxidant defense system in the liver [53].

The current results also showed that crocin pretreatment decreased the expression levels of miR-34a and increased the activity of antioxidant enzymes.

Our study also demonstrated that crocin pretreatment decreased the overexpression of p53 and miR-34a following hepatic IR injury.

It has been shown there is a positive correlation between p53 and miR-34a via SIRT1-p53 pathway which regulates apoptosis [60].

The mature miR-34, a 22-nucleotide microRNA, has three members: miR-34a, miR-34b, and miR-34c.

The present qRT-PCR results also showed that the serum level of miR-34a increased following hepatic IR injury.

Our results showed that there is an inverse correlation between the serum level of miR-34a and Nrf2.

In the sham group, the levels of miR-122 and miR-34a were minimal (P < 0.001 in both cases).

The highest level of miR-34a and lowest level of Nrf2 were observed in IR group.

Effect of Hepatic IR Injury and Crocin Pretreatment on the Serum Levels of miR-122 and miR-34a.

Several studies have shown that miR-34a increases during stress -induced injuries [19, 20].

Bader has demonstrated that miR-34a elevated after IR -induced liver injury in rats [52].

miR-34a is the another microRNA that reflects liver damage [16].

Moreover, the involvement of miR-34a in age-related loss of antioxidant defense system has been reported [54].

Another mechanism contributing in apoptosis is Let-7/CD95/p53/miR-34a pathway [61].

P53 [a stress-related transcription factor] by activating Drosha facilitates the processing of pri-miR-34a to pre-miR-34a.

As demonstrated in Figures 3(a) and 3(b), according to qRT-PCR results, the serum levels of miR-122 and miR-34a were significantly increased following hepatic IR injury.

24

A comparison of these validated targets with our previously published LTP-regulated mRNA data derived at 20 min (Ryan et al., 2011, 2012) highlighted Arc, and the calcium -dependent protease Capn8, both of which are up-regulated and targeted by miR-34a-5p.

Our data suggest that down-regulation of miRNA, in particular miR-132-3p and miR-34a-5p, releases tonic inhibition and allows the expression of key plasticity-related proteins, including MAP kinase and glutamate receptor subunits which in turn may contribute to the consolidation of LTP.

At 24 h post-DBS, a time we previously reported to be associated with a generalized down-regulation of mRNA expression (Ryan et al., 2012), there was no alteration in the expression of either miR-34a-5p (p = 0.67, n = 4, Figure 3A) or miR-132-3p (p = 0.74, n = 4, Figure 3B).

While previously we have shown that miR-34a-5p is down-regulated at 5 h post-DBS (Ryan et al., 2012), further analyses showed no significant down-regulation of miR-132-3p at this time-point (p = 0.58, n = 7; Figure 3B), thus suggesting that the peak of its reduction lies closer to 20 min.

Having found that miR-34a-5p and miR-132-3p were rapidly down-regulated following LTP induction, we set out to explore the biological significance of this by identifying potential targets for miR-34a-5p and miR-132-3p.

For example, miR-34a-5p, which shares seed similarity to miR-34c-5p, elevated levels of which have been shown to be detrimental to memory (Zovoilis et al., 2011), has been shown to regulate the synthesis of Arc, a cytoskeletal protein involved in trafficking of AMPAR subunits (Wibrand et al., 2012), as well as Grm7, a metabotropic glutamate receptor subunit (Zhou et al., 2009), Sirt1, an epigenetic regulator of gene expression (Yamakuchi and Lowenstein, 2009), and the neurotransmitter release-related genes Syt1, Syn1, and Stx-1a (Agostini et al., 2011).

When DBS was given in the presence of the NMDAR antagonist CPP, LTP of both the fEPSP and PS was blocked (Figures 1B,C), as was the down-regulation of miR-34a-5p and miR-132-3p.

Down-regulation of the microRNAs miR-34a, miR-127, and miR-200b in rat liver during hepatocarcinogenesis induced by a methyl -deficient diet.

This rapid down-regulation occurs via post-transcriptional mechanisms, at least for miR-34a-5p and miR-132-3p, and is likely to contribute to the consolidation of LTP at multiple levels, including amplifying the protein response.

One possible mechanism underlying the LTP -induced down-regulation of miR-34a-5p and miR-132-3p is a reduction in transcription and a concomitant decrease in the levels of their primary transcripts.

Indeed, we have reported decreases in miR-24-3p and miR-34a-5p expression at 5 h post-LTP in awake adult rats (Ryan et al., 2012), and others have shown regulation of specific miRNA both in anaesthetized rats (Wibrand et al., 2010, 2012) and in vitro (Park and Tang, 2009; Lee et al., 2012).

FUNCTIONAL SIGNIFICANCE OF miR-34a-5p AND miR-132-3p DOWN-REGULATION.

RAPID DOWN-REGULATION OF MATURE microRNA, miR-34a-5p AND miR-132-3p, IS NMDAR DEPENDENT.

A subset of the rapidly down-regulated miRNA (miR-34a-5p, miR-34c-5p, miR-132-3p, miR-181c-5p, miR-214-3p) were chosen for more in-depth analysis by RT-qPCR, based on previous associations with plasticity processes (Wayman et al., 2008; Schonrock et al., 2010; Agostini et al., 2011; Zovoilis et al., 2011; Ryan et al., 2012).

By focusing on the plasticity-related miR-34a-5p (Agostini et al., 2011), we found that LTP results in a rapid and transient down-regulation of the mature transcript independent of any alteration in levels of its primary transcript.

Furthermore, the precise mechanisms underpinning the observed rapid down-regulation, including that of miR-132-3p and miR-34a-5p, are unknown.

As LTP induction is crucially dependent on activation of NMDARs, we tested whether down-regulation of miR-34a-5p or miR-132-3p was dependent on the activation of NMDARs (Abraham and Mason, 1988).

Our findings differ from those reported by Wibrand et al. (2010, 2012) who, in anesthetized animals, found no rapid changes in miR-34a-5p or miR-132-3p, but an up-regulation of miR-132-3p at 2 h (Wibrand et al., 2010, 2012).

Using this approach, we found no significant change in pri-miR-34a expression at 20 min (with and without CPP), 5 h, or 24 h post-DBS, following normalization to HPRT (Figure 4A).

This approach identified several plasticity-related genes as likely targets of miR-34a-5p and miR-132-3p (Table 2).

PREDICTED miR-34a-5p AND miR-132-3p TARGETS.

Using individual TaqMan qPCR assays, we confirmed reduced expression of miR-34a-5p and miR-132-3p (miR-34a-5p: p = 0.0001, n = 8; miR-132-3p: p = 0.001, n = 8; Figure 3), but not miR-34c-5p (p = 0.14, n = 9), miR-181c-5p (p = 0.46, n = 10) or miR-214-3p (p = 0.65, n = 9).

These results suggest that a solely post-transcriptional mechanism regulates the levels of mature miR-34a-5p.

FIGURE 4 Long-term potentiation differentially regulates the primary miRNA transcripts of miR-34a-5p and miR-132-3p.

microRNA-34a regulates neurite outgrowth, spinal morphology, and function.

FIGURE 3 Long-term potentiation differentially regulates mature miR-34a-5p and miR-132-3p.

This finding of an evoked activity-related increase in miRNA is in accord with the findings of Wibrand et al. (2010) in urethane-anesthetized animals, and raise the possibility that in awake animals the NMDAR -mediated reduction in the levels of mature miR-34a-5p and miR-132-3p out-competes a second, NMDAR-independent process, working to increase them.

25

In addition, Bcl-2 has also been described as the target of miR-34a [27], so we have evaluated its protein level to reveal a significant decrease in D-gal -induced aging rats and an obvious up-regulation upon DHM administration, suggesting the expression of miR-34a is highly correlated with the aging and DHM can accomplish its anti-aging function through inhibiting apoptotic signal pathway under the down-regulated miR-34a condition.

In our study, D-gal -induced overexpression of senescence -associated proteins including p-p53, p53 and p21 and down-regulation of SIRT1 in hippocampus can be recused upon DHM supplementation with the accompany of a significant decrease in miR-34a expression.

In conclusion, DHM can ameliorate cognitive impairments in D-gal -induced aging rats by the induction of autophagy in hippocampus tissues through suppressing aging-related astrocyte activation and inhibiting mTOR signal pathway as well as down -regulating miR-34a, which provides the important theoretical supports of DHM for preventing or treating aging -associated neurological disorders.

In the present study, the D-gal -induced rat mo del with brain aging was used to validate our hypothesis through evaluating protein and gene expression associated with miR-34a/SIRT1/mTOR signal pathway, which will provide a new theoretical basis for the application of DHM in the prevention and treatment of aging -associated diseases, and a theoretical reference for the development and utilization of natural products for health promotion and disease therapy.

Based on above documentation, DHM could execute possible inhibition on miR-34a and its corresponding targets for the prevention and treatment of D-gal -induced aging were systematically explored.

The expression level of miR-34a was defined from the threshold cycle (Ct), and relative expression level of miR-34a was calculated using the 2 [−ΔΔCt] method after normalization with reference to the expression of U6 small nuclear RNA.

Interestingly, DHM treatment can significantly decrease gene expression of miR-34a, which stimulates us to further explore the target genes of miR-34a during the rescuing process of brain aging upon DHM treatment.

Recently, emerging evidences have shown that miR-34a is over-expressed in aging-related diseases including AD [25].

In addition, silent mating type information regulation 2 homolog 1 (sirtuin 1, SIRT1), is an NAD -dependent deacetylase for modulating cellular metabolism, extending lifespan, and delaying the onset of a number of neurodegenerative disorders including AD [11], which is confirmed to be a direct target of miR-34a [12].

These results revealed that the up-regulation of miR-34a was positively correlated with brain aging of D-gal -induced rats.

However, the administration of DHM markedly mitigated the up-regulation of miR-34a induced by D-gal.

In order to examine whether down-regulated miR-34a by DHM is connected to the modulation of SIRT1 signaling, the effect of DHM on SIRT1 protein expression was also evaluated using Western blotting analysis.

DHM down-regulated D-gal -induced miR-34a in hippocampus tissue.

miR-34a is a critical player for the induction of senescence, cell cycle arrest and apoptosis, which is highly correlated with a variety of aging-related diseases including AD [5].

In order to verify whether miR-34a -induced senescence is correlated with p53, we determined the protein expression of p-p53, p53 and p21 by Western blot.

Therefore, miR-34a may represent not only an initiator of apoptotic signal pathway, but also a promising therapeutic target in preventing the death of neurons during aging process.

Based on these findings, we have analyzed the expression of miR-34a in D-gal -induced brain aging mo del.

Thus, we hypothesize that its potential for prevention and treatment of aging -associated diseases may be accomplished by induced autophagy through miR-34a/SIRT1/mTOR signal pathway.

Figure 3 The expression of miR-34a in different groups was analyzed through quantitative RT-PCR.

We examined the change of miR-34a expression by qRT-PCR through comparative Ct (ΔΔCt) method in hippocampus tissue before and after DHM treatment.

The expression of miR-34a in different groups was analyzed through quantitative RT-PCR.

The expression of miR-34a in hippocampus tissue was distinctly different in each group.

Recent studies have demonstrated that miR-34a is involved in p53 and SIRT1 signal pathways [13], thus implying that miR-34a may be involved in the regulation of autophagy.

As shown in Figure 3, D-gal treatment significantly increased the expression of miR-34a when compared with the normal control group.

As shown in Figure 4, a positive correlation among p53, p21 and miR-34a was observed.

The miR-34a was activated in hippocampus tissue in D-gal -induced aging rats.

Real-time PCR of miR-34a.

Consistent with previous reports [5], our data have also shown that increased miR-34a in D-gal -induced aging mo del is involved in common pathological events of brain aging.

26

In lung samples obtained from BOS patients, miR-34a was clearly expressed in normal bronchiolar, alveolar epithelia and reactive pneumocytes, but it was also expressed in proliferating fibroblasts, suggesting that its dysregulated expression might play a role in the fibrogenic process of BOS.

Human CTR(1) ACUTE REJECTION(1) BOS(5) miR-34a Bronchial and // BO fibroblasts (+++), alveolar epithelia (++) // Reactive pneumocytes (++), // Bronchial and alveolar epithelia (++) miR-21 Absent // BO fibroblasts (+++), // Reactive pneumocytes (++) Rat CTR(2) ACUTE REJECTION(1) CHRONIC REJECTION(1) miR-34a Bronchial and Bronchial and Reactive pneumocytes (++), alveolar epithelia (++) alveolar epithelia (++), Fibroblasts (++), Inflammatory infiltrates (++) Bronchial and alveolar epithelia (++), Endothelia (++) miR-21 Absent Reactive pneumocytes (+), Reactive pneumocytes (++), Fibroblasts (++), Fibroblasts (+++) Inflammatory infiltrates (+) BO: bronchiolitis obliterans; (+): scarce expression; (++): moderate expression; (+++): strong expression.

Analogously, in the rat orthotopic lung transplantation with chronic bronchiolar rejection, miR-34a was strongly expressed in proliferating fibroblasts (Fig 9C), bronchial epithelial cells, endothelia and inflammatory cells, mostly plasma cells, while in the setting of acute cellular rejection, miR-34a expression was detectable only in epithelial cells and in inflammatory infiltrates (Fig 9D).

In lung explants from BOS patients, miR-34a was strongly expressed in bronchiolar and reactive alveolar cells and moderate expression was also detectable in proliferating fibroblasts of BO lesions (Fig 9B).

Our preliminary results documented the dysregulated expression of miR-34a and miR-21 in human and rat transplanted lungs with BOS (Table 1).

Specifically, ISH analysis showed that in normal human and rat lungs, miR-34a was diffusely expressed in bronchial and alveolar epithelial cells and in some inflammatory cells, mostly plasma cells (Fig 9A).

miR-34a and miR-21 expression in human and rat transplanted lungs.

0161771.g009 Fig 9 miR-34a and miR-21 expression in human and rat transplanted lungs.

MicroRNA-34a regulates cardiac fibrosis after myocardial infarction by targeting Smad4.

All observations of miR-34a and miR-21 expression were validated with alpha 1-actin and Movat (Fig 9F) connective tissue stains on consecutive sections.

Published evidence of a profibrogenic role of miR-34a and of its expression by proliferating fibroblasts is however very limited.

Upper panel: miR-34a expression in bronchial epithelial cells in normal human lung (A, blue staining), in myofibroblasts in lung explants from a BOS patient (B), in proliferating fibroblasts in rat lungs with chronic rejection (C) and in epithelial cells in remo deled areas in the animal mo del of acute cellular rejection (D).

Profile and expression analysis of miR-34a and miR-21 in human and rat lung samples: normal lung, human chronic rejection (BOS), acute and chronic rat graft rejection.

miR-34a expression was evident both in control cells and BOS MCs (data not shown).

For miR-34a, a less-abundantly expressed miRNA, 100nM labeled probe was used and hybridization was carried out at 37°C for 20h.

We were able to document diffuse expression of miR-34a in bronchial and alveolar epithelial cells, as well as in endothelial and inflammatory cells of normal adult lungs.

In comparison with lung recipients without BOS, clear dysregulation of miR-34a, miR-193b, miR-9 and miR-15a, likewise present in the VTM list in Fig 5, was also detected in peripheral mononuclear cells obtained from BOS patients in a RT-PCR evaluation of miRNA expression by Xu at al. [3].

P-values obtained from the miRNA targets enrichment analysis for miR-34a and miR-21 paired with all considered pathways.

MicroRNA-34a: a potential therapeutic target in human cancer.

In addition to miR-34a and miR-21, other miRNAs have recently been described as being dysregulated in BOS.

For these reasons, while we did demonstrate miR-34a and miR-21 dysregulation in fibroblasts obliterating the bronchiolar lumen, we cannot provide mechanistic insights into their role in BOS pathogenesis, and these should be addressed in specifically designed studies.

Recently, miR-34a and miR-34c have been shown able to down regulate peroxisome proliferator-activated receptor (PPAR) in hepatic stellate cells thus inducing their activation, a hallmark of liver fibrosis [53].

0161771.g010 Fig 10P-values obtained from the miRNA targets enrichment analysis for miR-34a and miR-21 paired with all considered pathways.

The first factor chosen for the validation phase was miR-34a, which ranked first in the VMTs list (Fig 5) and eleventh in the CMTs list (Fig 6).

As an example, Fig 4 reports a sample of the computations performed in the analysis of a single miRNA (miR-34a) using VMTs.

Further data are required to clarify the molecular mechanisms underlying the pro-fibrotic role of miR-34a in BOS that we suggest in this study.

We proceeded to validate the analysis of the ranked lists of miRNAs by means of wet lab experiments (ISH) on two highly-ranked miRNAs that appeared in both lists: miR-34a and miR-21.

Moreover, miR-21 and miR-34a had not yet been described in BOS in previous human studies.

0161771.g001 Fig 1Two selected miRNAs (i. e., miR-34a and miR-21) obtained from the computational analysis were then validated in wet lab experiments (blue boxes).

Given these premises, we selected miR-34a, the top-ranked miRNA in Fig 5 (VMTs) and miR-21, as candidate miRNAs for ISH analysis.

Preliminary validation of the selection of miRNAs was attained both through literature analysis during the computational phase; and by subsequent in situ hybridization experiments on miR-34a and miR-21, two of the resulting candidate miRNAs.

ISH for two candidate miRNAs (miR-34a and miR-21) was performed on formalin-fixed/paraffin-embedded samples of normal human and rat lungs, lung explants of BOS patients and rat mo dels of acute and chronic lung rejection (outbred CD SPF/VAF), and on mesenchymal cells obtained from bronchoalveolar lavage (BAL) of lung recipients.

miR-34a and miR-21 are double-DIG labeled miRCURY LNA®microRNA Detection Probes and have the sequences 5'-ACAACCAGCTAAGACACTGCCA-3', and 5'-TCAACATCAGTCTGATAAGCTA-3' respectively.

The factors present in both lists were: let-7a, miR-34a, miR-21 and miR-9 family.

Two selected miRNAs (i. e., miR-34a and miR-21) obtained from the computational analysis were then validated in wet lab experiments (blue boxes).

Furthermore, to prevent miR-34a release and extra-tissutal diffusion during hybridization, an additional miRNA fixation step, using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, was added on tissue sections to anchor miRNAs into the protein matrix [46].

27

Such correlation between upregulated miR-34a, the downregulation of its target E2F3, and the upregulation of p53 allows us to suggest that ionizing radiation at specific high and low doses leads to cell cycle arrest and a possible initiation of apoptosis.

For instance, 2.5 Gy of X-rays caused upregulation of miR-34a and downregulation of miR-7 in hematopoietic tissues [9].

MiR-34a directly inhibits the expression of transcription factor E2F3 that is necessary for cell progression through cell cycle and the expression of actin cross-linking protein, transgelin, which may contribute to the replicative senescence.

Treatment Group MiRNA changed Log2 (G/CT) Validated targets 80 kVp/0.1 Gy 2 Low fold change – 80 kVp/0.1 Gy Low signals – – 80 kVp/1 Gy miR-34a 1.55 E2F3, Tagln, INHBB miR-29c −1.02 Tpm1 miR-20b-5p −1.65 – miR-204 −1.39 – 30 kVp/2.5 Gy miR-34a 1.08 E2F3, Tagln, INHBB miR-20b-5p −1.55 – miR-98 −1.16 – miR-127 2.08 – The elevated expression of miR-34a was interesting to us, and we decided to proceed with identifying protein levels of its targets E2F3 and transgelin as well as p53, the key protein in DNA damage response.

Upregulation of miR-34a has been found to be common for both doses, and the expression level has been increased 1.55- and 1.08-fold after 80 kVp/2.5 Gy and 30 kVp/0.1 Gy, respectively.

Targets for miR-34a are oncogenes myc, notch1, e2f3, and cyclinD1; miR-7 targets a regulator of DNA methylation, a lymphoid-specific helicase (LSH).

The elevated expression of miR-34a was interesting to us, and we decided to proceed with identifying protein levels of its targets E2F3 and transgelin as well as p53, the key protein in DNA damage response.

Treatment Group MiRNA changed Log2 (G/CT) Validated targets 80 kVp/0.1 Gy 2 Low fold change – 80 kVp/0.1 Gy Low signals – – 80 kVp/1 Gy miR-34a 1.55 E2F3, Tagln, INHBB miR-29c −1.02 Tpm1 miR-20b-5p −1.65 – miR-204 −1.39 – 30 kVp/2.5 Gy miR-34a 1.08 E2F3, Tagln, INHBB miR-20b-5p −1.55 – miR-98 −1.16 – miR-127 2.08 – Relative miR expression values are represented in folds in the irradiated cells in comparison to non-irradiated control cells as analyzed by miRNA microarray.

We further decided to conduct Western blot analysis to identify protein levels of E2F3 and transgelin that are targets of p53 and miR-34a targets, E2F3 and transgelin.

Interestingly, several reports have shown that the miR-34 family is a direct target of p53, and its activation induces apoptosis and cell cycle arrest [31, 32].

In his report, Hermeking described the role of p53 as a mediator of tumor suppression through the activation of miR-34 family members.

The increased expression of miR-34a may be linked to cell cycle arrest and apoptosis.

Bommer et al. showed that Bcl-2 was targeted by miR-34a [31].

Furthermore, the high expression of miR-34a has been shown to induce apoptosis [29].

The main targets of miR-34a are E2F3 transcription factor, transgelin, and possibly CDK4/6, cyclin E2, c-myc [30].

The ectopic expression of miR-34 genes is known to cause a G1 phase arrest [28].

In addition, the activation of miR34-a by p53 feeds back to p53, and such positive feedback leads to further activation of p53 [30].

28

As a well-known tumor suppressor, the expression of miR-34a was significantly inhibited in patients with HCC in clinical studies 41, 42.

Rno-miR-34a-5p was selected due to its consistent upregulation across the entire course of treatments as well as its critical function as tumor suppressor in HCC.

It is interesting to note that a decreasing trend of the fold change for this DEM was observed with all three doses at 7-d and 14-d. Moreover, an increasing in the expression fold change values of rno-miR-34a-5p was observed with low (except 28-d) and middle doses (all four time points), however, for high dose, a mixed expression trend was observed.

Furthermore, the results obtained from qPCR experiments confirmed a significant elevation in the expression of miR-34a-5p after treatments and these outcomes showed a similar pattern of miRNAs expression with results from NGS technology (Figure  S2).

Notably, rno-miR-34a-5p and rno-miR-455-3p were detected differentially expressed following all time-points and doses compared to the control group (Fig.   6), indicating the significant relevance of the expression of both miRNAs to the treatments.

Additionally, the second arm of miR-34a (i. e. rno-miR-34a-3p) was also upregulated with more than 3-fold in 7 out of 12 treatment conditions.

Amongst them, rno-miR-34a-5p, an upregulated DEM, is the most responsive candidate with more than 4 fold change in most of the treatment conditions studied (Fig.   6).

Especially, rno-miR-34a-5p was the most upregulated DEMs throughout the entire treatment, suggesting its potential to be utilized as early and sensitive biomarkers to detect TAA-modulated carcinogenicity.

Previously, miR-34a has been reported to play important roles in the pathogenesis of several human diseases, including liver carcinogenesis 40, 41.

Notably, a significant increase in the expression of rno-miR-34a-5p was identified across all doses following 7-d, 14-d and 28-d of treatment.

Significantly increased expression of rno-miR-34a-5p was identified across all doses following 7-d, 14-d, and 28-d of treatments.

On the contrary, expression of rno-miR-34a-5p was significantly increased (logFC > 1.5 to 4.7) after treatment and consistently presented over time and doses (Fig.   6).

Importantly, the expression levels of two DEMs (i. e., rno-miR-34a-5p and rno-miR-455-3p) were found to be changed with almost all treatment conditions.

Expression of miR-34a-5p, miR-455-3p and miR-122.

Rno-miR-34a-5p is highly significantly and consistently overexpressed among different doses and time points, suggesting the potential of this miRNA to be considered as an early and sensitive biomarker for monitoring TAA -induced hepatocarcinogenesis during low to high exposures.

Similar, signaling cascades such as Wnt, proteolysis, metabolism, MAPK, cell cycle and apoptosis were predicted to be significantly regulated by miR-34a-5p.

PCR results demonstrated that expression of rno-miR-34a-5p was significantly increased across three time points (p < 0.05 at 7-d, and 14-d, p < 0.005 at 28-d) treatments compared to the control group (Figure  S2).

These observations may suggest that the rno-miR-34a-5p tends to give up its regulatory function at a higher dose.

Two potential biomarkers (miR-34a-5p and miR-455-3p) out of 48 overlapping DEMs are found common across all the treatments.

Rno-miR-34a-5p was detected to be very low in the baseline read count over the full-time course in the control group.

Notably, miR-455-3p and miR-34a-5p were involved most of the cancer-related functional pathways.

Thus, chemicals showing the capability of the restoration of miR-34a function could be proposed as a potential therapeutic agent for HCC.

Previous investigations have already been demonstrated a key role of miR-34a in liver cancer, however, so far there is no single study exists which have studied its expression and role in TAA -induced hepatocarcinogenicity along different doses and time intervals.

The miR-34a-5p and miR-455-3p were selected to investigate their expression changes during TAA treatments.

To further evaluate the correlation between these two DEMs and cancer progression, we carried out a regression analysis between the histopathological features and the expression patterns of miR-34a-5p, and miR-455-3p during TAA exposures.

For example, the single cell necrosis was found to obtain the maximum (AUC = 0.75) for miR-34a-5p.

Information on two potential early and sensitive miRNA biomarkers (miR-34a-5p and miR-455-3p) and their associated signaling is given on the top two rows.

To validate the findings from miRNA-seq, we therefore measured the expression levels of miR-34a-5p at high dose exposures of TAA using real-time qPCR (RT-qPCR).

In addition to miR-34a-5p, we found miR-455-3p which can potentially be used as an early and sensitive biomarker for the detection of liver injury and pre HCC.

In case of miR-34a-5p, the cellular infiltration, eosinophilic change, fibrosis, bile duct proliferation and single cell necrosis features were found to cover more than 0.5 AUC (area under curve).

29

Suppression of SIRT-1 expression has been shown to be regulated by epigenetic mechanisms such as up-regulation of miR34a [41, 60].

Evidence is provided demonstrating that vascular senescence involves epigenetic changes including up-regulation of miR34a [41].

Quantification of miR34a expression by qPCR (Fig 6D) further confirmed the results of the ISH by showing a significant increase in total retinal expression of miR34a in the diabetic retinas as compared to control, normoglycemic, 4.5 month old rat retinas (*p<0.01 vs control).

x ± S. D, *p<0.01 vs C 4.5 month rat retina, n = 6. ISH revealed that miR34a expression is localized around retinal blood vessels (white arrow), but also in other cells of the inner retina as well as in the RPE of the diabetic retinas (Fig 6B).

To further analyze the effects of hyperglycemia on accelerated vascular senescence, we have assessed miR34a expression and localization in retinal sections via a highly specific in situ hybridization (ISH) technique for miRNA detection in tissue samples.

x ± S. D, *p<0.01 vs C 4.5 month rat retina, n = 6. ISH revealed that miR34a expression is localized around retinal blood vessels (white arrow), but also in other cells of the inner retina as well as in the RPE of the diabetic retinas (Fig 6B).

Our data, therefore, suggest the interesting possibility that in the hyperglycemic milieu different retinal cells can contribute to the induction of retinal microvascular cell senescence through stress-related expression and release of miR34a.

Images in Fig 6 indicate that miR34a reactivity is up-regulated in the diabetic retina (Fig 6B) as compared to normoglycemic aging (Fig 6C) and control adult retina (Fig 6A).

Assessment of miR34a expression.

MiR34a expression was then quantified using miRCURY LNA Universal RT microRNA PCR (Exiqon, Woburn, MA).

Expression of miR34a in the diabetic and aging retina.

Retinal expression of miR34a, measured by qPCR, was also found to be slightly increased in the aging retinas, however this was not statistically different from the normoglycemic adult control (Fig 6D).

Slides were incubated overnight at 58°C with a double- (5’ and 3’)-digoxigenin (DIG)-labeled probe for the senescence -associated microRNA 34a (/5DigN/ACAACCAGCTAAGACACTGCCA/3Dig_N/; hsa-miR-34a; Exiqon, Woburn, MA).

Interestingly, in situ hybridization showed that miR34a is also produced in non-vascular retinal cells (Fig 6A–6C).

This system combines a Universal RT reaction, a primer set for miR-103a-3p, an endogenous control, with LNA-enhanced PCR primers designed by the company for the target sequence of miR34a (ACAACCAGCTAAGACACTGCCA; catalog #204486).

MitomiRs in human inflamm-aging: a hypothesis involving miR-181a, miR-34a and miR-146a.

In situ hybridizations (ISH) of miR34a.

30

The expression of its target genes LCAM1 AND AMACR were down-regulated, but 7 out of 9 miR-34a's targets were up-regulated including TUBBS, LDHA, NAMPT, ENO3, GGH, TXNRD2, and LMNA which are associated with mitochondrial dysfunction, DNA damage and repair, and apoptosis (Figure  3C).

In this study, it remains intriguing that up-regulation of miRNAs such as miR-21 and miR-34a is associated with activation of their target oncoprotein expression after AA treatment for 12 weeks.

Similarly, we found that AA treatment increased expression of miR-450a and miR-542, and that AA induced a DNA damage response indicated by up-regulation of miR-34a.

In order to validate the changes in miRNA expression detected by a deep-sequencing, we conducted quantitative real-time PCR analysis to examine expression levels of six miRNAs including rno-miR-378, rno-miR-182, rno-miR-21, rno-miR-34a, rno-miR-34b, and rno-miR34c.

rno-miR-881, rno-miR-880, miR-741-3p, miR-511*, miR-187, miR-449a, as well as 6 members of miR-34 family, miR-34a, miR-34a*, miR-34b, miR-34b*, miR-34c, and miR-34c*, showed over 10-fold up-regulation.

miR-34a was up-regulated.

It was followed by activation of P53 and the binding P53 to the promoter of miR-34a resulted in mir-34 activation [41].

31

Specifically, p53-activated miR-34a inhibits cell growth by downregulating the expression of E2F, c-Myc, CDK4, CDK6, CyclinD1, and CyclinD2 [17– 19].

In the CNS, Agostini et al. [22] show that miR-34a can mediate SYT-1 and Syntaxin-1A expression, inhibit their functions, and reshape hippocampal spinal morphology, suggesting potential roles for miR-34s in CNS diseases.

Much as with our findings, a recent study by Sano et al. [23] found that upregulation of microRNA-34a and neuronal death co-existed and correlated with each other in a mouse seizure mo del.

Sano et al. [23] also demonstrated the upregulation of micro-34a during seizure -induced neuronal death, further indicating the involvement of miR-34 family in seizure pathology.

Moreover, miR-34a mRNA level is negatively correlated with Bcl-2 protein level and directly modulates Bcl-2 expression in hepatocellular carcinoma (HCC) [21].

Overexpression of miR-34a in several cancer cell lines induces pro-caspase-3 activation and PARP disassociation, resulting in caspase-3 -dependent cell death [20].

Among these candidates, miR-34b-5p attracted our attention because of previous studies about the miR-34 family in CNS diseases.

Among these, miR-34a has been studied extensively and considered a promising target for cancer therapies [16].

Previous studies have revealed that miR-34a interplays with key cell proliferation and death molecules in cancer cells, including p53, the Bcl-2 family, c-Myc, and PDGF.

The miR-34 family is composed of three mature non-coding microRNAs-miR-34a, miR-34b, and miR-34c-found at three different loci across the genome.

Currently, the majority of research in this field emphasises the study of miR-34a.

We discovered that miR-34b-5p, a member of the miR-34 family, increased significantly in flurothyl -treated rat hippocampus tissue.

32

In the present study, miR-29a and miR-34a were upregulated after IRI, and they were both downregulated by huMSC treatment.

In addition, miR-34a regulates the expression of silent information regulator 1 (SIRT1), which increases the levels of cell-cycle inhibitor proteins, such as p21 [30], and miR-34a has also been reported to increase with ageing [31, 32], as well as in chronic inflammatory states [33].

Senescence-related proteins (β-galactosidase, p21 [Waf1/Cip1], p16 [INK4a] and transforming growth factor beta 1) and microRNAs (miR-29a and miR-34a) were overexpressed after IRI and subsequently downregulated by the treatment.

Using qPCR, we found that the expression of some senescence-related miRs in kidney tissue (mainly miR-29a and miR-34a; Fig.   4e, f) on D2 was higher in IRI rats than in control rats (4.6 ± 1.1 vs 1.0 ± 0.3 and 8.7 ± 2.7 vs 1.0 ± 0.0, p = 0.05) although the expression of both was protected in IRI + huMSC rats (0.3 ± 0.2 and 0.7 ± 0.5, respectively, p < 0.05 and p = 0.05).

MnSOD is a potential target of miR-335, and thioredoxin reductase 2, another antioxidant gene, is a potential target of miR-34a [19].

Oxidative stress can also be modulated by miRs, such as miR-34a and miR-335, which can promote a senescent profile in mesangial cells obtained from young animals, by antioxidant inhibition [19, 29].

f Bar graphs showing renal miR-34a expression.

The miRs studied were miR-29a, miR-29b, miR-335 and miR-34a (Applied Biosystems; Thermo Fisher Scientific).

33

Table S7 Targets of miR-34a predicted by TargetScan, miRanda and PicTar.

This resulted in the identification of 30 genes that were predicted to be targeted by MIR34a and 19 genes predicted to be targeted by MIR24-1 (Table S7 and S8).

Prediction of MIR34a targets revealed 239 genes according to TargetScan, 438 according to miRanda, and 354 according to PicTar.

We tested this hypothesis using TaqMan microRNA qPCR and found a significant downregulation of MIR34A (0.53 ± 0.16 (average ± S. E. M), n = 5, p<0.05 two-tailed t-test) and MIR24-1 (0.59 ± 0.12, n = 9, p<0.05 two-tailed t-test) 5 h post-LTP (Figure 8).

However, when we screened our LTP datasets (5 h or 24 h) for the algorithm-predicted MIR34a and MIR24-1 target genes, we found no crossover between the groups.

This does not discount the involvement of these microRNA in LTP consolidation but predicts that MIR34a and MIR24-1 at least contribute to LTP consolidation at the level of translational repression.

Potentially, as antagonism of MIR24-1 has been shown to promote cell proliferation [52] and MIR34A regulates neural stem cell differentiation [53], these data suggest microRNA may also regulate LTP-related neurogenesis.

To investigate the potential mRNA targets of MIR34a and MIR24-1 we used the algorithms TargetScan, PicTar and miRanda.

This is the first report of microRNA regulation following perforant path LTP in awake freely moving rats and is particularly relevant as the seed recognition sequence of the MIR34 family has recently been reported to rescue learning impairment [51].

In 5 h-Network 2 (Figure 7B; Score 33) the microRNA MIR24-1 formed a hub, while MIR34A is present within 5 h-Network 3 (Figure 7C; Score 18).

34

mir-200a, mir-34, mir-195, and mir-381-3p are usually downregulated in presence of SIRT1 expression, and vice versa low expression of SIRT1 relates to miRNAs upregulation [9, 11, 17, 18, 26– 28].

Comparing the miRNAs expression of LPS -treated rats with LPS + RvD1, a significant downregulation of the levels of miR-195-5p, miR-200a-3p (related to SIRT1 expression and activity), miR-145-5p (related to both SIRT1 and p53 regulation), and miR-34a-5p (candidate for p53 regulation) in ocular tissues of LPS + RvD1 1000 ng/kg treated rats compared to the LPS -treated group (P < 0.01 versus LPS group; Figure 6) was noted.

Interestingly, the protective action of intravitreal RvD1 was associated with an increased level of endogenous SIRT1 within the eye and a downregulated expression of miR-195-5p, miR-200a-3p, miR-34a-5p, and miR-145-5p.

These miRNAs are notoriously and inversely related to SIRT1 expression in tissues as, for example, 195-5p and miR-200a-3p relate to SIRT1 expression and activity, miR-145-5p relates to SIRT1 and p53 levels, and miR-34a-5p relates to p53 regulation [9– 11].

35

With exception of miRNA-155, down-regulated in serum of AMD patients and in serum of Aβ injected rats, six miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-126) showed an up-regulation in serum of AMD patients.

Analysis of these 13 miRNAs revealed that 7 miRNAs showed a significant up-regulation in serum of AMD patients in comparison to control group (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-155, and miR-126).

In particular, up-regulation of miR-9, miR-23a, miR-27a, miR-34a, miR-126, and miR-146a was found in serum of AMD patients.

The following groups of miRNAs were analyzed: miR-27a, miR-146a, miR-155 miR-9, miR-23a, miR-27a, miR-34a, miR-126,miR-146a, miR-155 miR-155 GraphPad Prism (version 4.0; GraphPad Software, San Diego, CA, USA) was used for statistical analysis and graphical representation of miRNA differential expression data.

Age -dependent increase in miRNA-34a expression in the posterior pole of the mouse eye.

In conclusion, the modified miRNA levels we found in rat retina (miR-27a, miR-146a, miR-155) and serum of AMD patients (miR-9, miR-23a, miR-34a, miR-126, miR-27a, miR-146a, miR-155) suggest that, among others, miR-27a, miR-146a, and miR-155 have an important role in AMD and could represent suitable biomarkers and appealing pharmacological targets.

Inhibitory effect of microRNA-34a on retinal pigment epithelial cell proliferation and migration.

Incidentally, we showed that changes in circulating levels of some miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-126, miR-146a, miR-155) as found in AMD patients are associated to Alzheimer's disease and modulate genes involved in neurodegenerative and inflammatory pathways.

36

Significant age-related increases in miR-34a expression (7.1- and 13.2-fold maximum age difference in females and males, respectively; microarray data) were also confirmed by qPCR, which showed significant (p < 0.05) 7.2- and 8.7-fold differences in expression across the life span in females and males, respectively (Fig.   6d).

Li et al. [33] have also shown age -dependent increases in the expression of miR-34a and miR-93, and that these miRNAs target Mgst1, Sirt1, and Nrf2, three genes that encode proteins important in the defense against oxidative stress, a common feature in DILI.

The average log2 relative expression per group of qPCR and microarray data are displayed for miR-29b, miR-34a, miR-96, and miR-154* such that the global average expression for qPCR (n = 5) and microarray data (n = 4 or 5) is equal to zero.

miR-34a is a downstream target of p53 and its expression correlates positively with age [39].

As rats mature from adults to old-age, miRNAs involved in cell death, cell proliferation, and cell cycle (miR-29 family and miR-34a) were found to change expression.

The expression of six (miR-29a, miR-29b, miR-29c, miR-34a, miR-375, and miR-466b-2*) was altered in both males and females (Table  1).

The miR-29 family and miR-34a, whose expression was altered in both older males and older females, are relatively well-studied miRNAs, and their roles in cell proliferation and apoptosis are established [75, 76].

37

Of the 30 miRNAs they found upregulated in traumatic spinal cord injury, miR-223, miR-214, miR-20b-5p, miR-17, miR-146a, miR-199a-3p, miR-221-3p, miR-146b, and miR-145 were also upregulated in our study, and among the 16 downregulated miRNAs in traumatic spinal cord injury, miR-34a and miR-338 were also downregulated after ventral combined with dorsal root avulsion in our study.

Furthermore, 40 of the miRNAs, including miR-34b-3p, miR-25-3p, miR-126-5p, miR-142-5p, and miR-324-5p, were only transiently upregulated (Figure  2A); the other 23 miRNAs, including miR-34a-3p and miR-324-5p, were transiently downregulated on the 3rd day but returned to normal levels by the 14th day (Figure  2B).

After normalizing the signal intensities for all miRNA expression levels, miR-124-3p, miR-9a-3p, miR-34a-5p, miR-9a-5p, miR-125b-5p, miR-let-7c-5p, miR-29a-3p, miR-23b-3p, miR-451-5p, and miR-30c-5p were the miRNAs expressed at the highest levels (Figure  1).

38

Specifically (1) P53 was identified as an activated upstream regulator of furan effects (supplementary Table_ S5) in male rats treated with 2 mg/kg bw/day; (2) Ccng1, Fas and Cdkn1a, which all play roles in DNA damage response and other pathways, were significantly up-regulated in male rats at the highest dose; (3) P53 upstream pathways, such as P38 Mapk and Erk Mapk pathways, were among the most sensitive pathways identified using a BMD approach; and (4) miR-34a (P53 target miRNA) is significantly up-regulated.

As a direct target of P53 transcriptional regulation, miR-34a is a well-known tumor suppressor and is involved in apoptosis, cell cycle arrest and senescence (Hermeking 2010).

qRT-PCR results confirmed the increased expression of miR-34a in both genders and also showed an increase in the expression of miR-200b in male rats only (Fig.   2).

miRNA results were examined in more detail by qRT-PCR for miR-34a and three other miRNAs (miR-122 and miR-200a/b) that were perturbed by 30 mg/kg bw/day furan treatment over 3 months in male Sprague- Dawley (SD) rats in another study (Chen et al. 2012).

The single miRNA significantly changed in our study was miR-34a.

Only miR-34a achieved a FDR p ≤ 0.05 and absolute FC ≥ 1.5 in either male or female rats based on microarray analyses that showed miR-34a increased by 2.4-fold in both genders.

39

Notably, rno-miR-214 was predicted to have maximum number of binding sites within the representative members of down-regulated pathways, whereas, rno-miR-34a was detected as miRNA hub having maximum number of interactions within the members of up-regulated pathways.

3 miRNAs (miR-34a, -21 and -503) were predicted to target Bcl2 gene (down-regulated).

The rno-miR-34a and -214 were noticed as the highly overrepresented miRNAs within up- and down-regulated genes, respectively.

For example, the putative seeds of miR-199a-5p (9nt long seed) and miR-34a (7nt long seed) within 3′-UTR region of p27 (Cdkn1b) suggest the possibility that this gene may be down-regulated by these 2 miRNAs in PKD.

The miR-34a was determined as the 2 [nd] highest targeting miRNA which can anneal with 693 genes.

40

miR-21-5p, miR-34a-5p, miR-146b-5p, miR-149-3p, miR-224-5p, miR-451-5p, miR-1949, miR-3084a-3p, and miR-3084c-3p demonstrated more abundant expression and a two-fold or greater significant increase in expression with Cd treatment.

Several rodent studies have demonstrated that drug -induced kidney injury is associated with increased expression of p53-responsive miR-34a, and this miRNA has been shown to suppress autophagy in tubular epithelial cells in a mouse mo del of ischemia/reperfusion -induced acute kidney injury [40, 41, 42, 43].

miR-21-5p, miR-34a-5p, miR-146b-5p, miR-149-3p, miR-224-5p, miR-451-5p, miR-1949, miR-3084a-3p, and miR-3084c-3p were more abundantly expressed and demonstrated a two-fold or greater increased expression in the Cd-treatment group.

We used real-time PCR to confirm the increased expression of miR-21-5p, miR-34a-5p, mir-146b-5p, miR-224-5p, miR-3084a-3p, and miR-3084c-3p in the renal cortices from Cd -treated animals versus the saline controls.

Selected miRNAs that demonstrated a statistically significant (p ≤ 0.05) altered expression using µParaflo™ microRNA microarray were validated using the following TaqMan [®] Advanced miRNA assays: miR-21-5p (rno481342_mir), miR-34a-5p (rno481304_mir), miR-146b-5p (rno480941_mir), miR-224-5p (rno481010_mir), miR-3084a-3p (rno481040_mir), miR-3084c-3p (rno481313_mir), and miR-455-3p (rno481396_mir).

Liu X. J. Hong Q. Wang Z. Yu Y. Y. Zou X. Xu L. H. MicroRNA-34a suppresses autophagy in tubular epithelial cells in acute kidney injuryAm.

As shown in Figure 3, real-time PCR demonstrated a significant increase in the Cd -treated group for the following miRNAs: a 2.7-fold increase in miR-21-5p (Figure 3A), a 10.8-fold increase in miR-34a-5p (Figure 3B), a 2-fold increase in miR-146b-5p (Figure 3C), a 10.2-fold increase in miR-224-5p (Figure 3D), a 2.4-fold increase in miR-3084a-3p (Figure 3E), and a 3.3-fold increase in miR-3084c-3p (Figure 3F).

41

The Effect of 2 Weeks of CMS on the Expression Levels of miR-18a-5p, miR-34a-5p, miR-135a-5p, miR-195-5p, miR-320-3p, miR-674-3p, and miR-872-5p in Mesocortical Pathway.

Although there was no statistically significant effect of stress on miR-34a-5p expression level in PCx, resilient animals exhibited trend to have decreased level of this miR.

It is noteworthy that miR-34a-5p, miR-34b-5p, and miR-34c-5p are members of the same miRNA family, possessing identical seed region and therefore similar potential targets.

One-way ANOVA revealed increased expression levels of all miRNAs of interest (except miR-135a-5p, see Fig. 3c) after 2 weeks of CMS in VTA (Fig. 4a, b, d–g) of stressed animals as compared to non-stressed group of rats (miR-18a-5p F [2,29] = 4.34, p < 0.05; miR-34a-5p F [2,29] = 8.03, p < 0.01; miR-195-5p F [2,29] = 12.88, p < 0.001; miR-320-3p F [2,29] = 11.31, p < 0.001; miR-674-3p F [2,29] = 19.99, p < 0.0001; miR-872-5p F [2,29] = 18.18, p < 0.0001).

Moreover, statistical analysis showed that stress exposure for two consecutive weeks also decreased the expression levels of all examined miRNAs (except miR-34a-5p, see Fig. 3b) in rat PCx (Fig. 3a, c–f) as compared to control group of rats (miR-18a-5p F [2,29] = 14.19, p < 0.0001; miR-135a-5p F [2,29] = 16.95, p < 0.0001; miR-195-5p F [2,29] = 4.13, p < 0.02; miR-320-3p F [2,29] = 10.57, p < 0.001; miR-674-3p F [2,29] = 4.03, p < 0.05; miR-872-5p F [2,29] = 15.67, p < 0001).

Moreover, for the first time, we revealed that resilient animals exhibited decreased expression levels of almost all examined (except miR-34a-5p) miRNAs in PCx as compared to the control group of rats.

miR-34a-5p is important in regulating the behavioral and neurochemical response to acute stress [8] and modulates neurogenesis and synaptogenesis [28].

This observation suggests that altered serum miRNA level may be one of the markers reflecting efficient coping strategies, without necessarily serving as a factor for determining resilient phenotype because basal level of miR-34a-5p was similar among all animals (see Fig. 3b).

However, further studies are needed to define the exact role of miR-34-5p/449-5p family in stress-related pathologies because it has been shown that both resilient animals and depressed patients exhibit increased miR-34 levels.

Based on our previous study [20] and literature survey, we chose a set of seven different miRNAs (i. e., miR-18a-5p, miR-34a-5p, miR-135a-5p, miR-195-5p, miR-320-3p, miR-674-3p, miR-872-5p) which are associated with stress response and functioning of the central nervous system.

Two-way ANOVA analysis of variances showed significant effect of time (F [2,54] = 5.81; p < 0.01) and interaction stress × time (F [4,54] = 3.86; p < 0.01) on the serum level of miR-34a-5p (Fig. 4b).

Dynamic Changes in the Serum Levels of miR-18a-5p, miR-34a-5p, miR-135a-5p, miR-195-5p, miR-320-3p, miR-674-3p, and miR-872-5p during 2 Weeks of the CMS Procedure.

Among all miRNAs tested in our study, only serum level of miR-34a-5p was altered after 2 weeks of CMS.

42

Some studies observed that silent information regulator 1 (SIRT1) and SIRT1-related microRNA-34a were expressed in endothelial progenitor cells obtained from patients with coronary artery disease, and microRNA-34a level was higher than that in non-coronary artery disease subjects.

Atorvastatin could contribute to the beneficial effects on endothelial function by up -regulating SIRT1 expression via inhibiting microRNA-34a expression [33].

Therefore, statins, particularly simvastatin, might play a crucial role in ameliorating the progression of NAFLD, such as hepatic steatosis, inflammation and fibrosis, via regulating microRNA-34a/Sirtuin-1 pathway.

In addition, with the progress of NAFLD, microRNA-34a, apoptosis and acetylated p53 were found to be increased gradually in the hepatic tissues, while SIRT1 decreased [35].

43

Previous studies showed that inhibition of miR-34 expression in vivo using LNA -based antimiRs or antagomiRs improved cardiomyocyte survival after MI and thereby preserved cardiac contractile function [35, 36].

Therefore, increased expression of miR-29 and miR-24 and reduced expression of miR-34, miR-130 and miR-378 may be responsible for the beneficial effects exerted by MSC-Exo.

We found that the expression of miR-130, miR-378, and miR-34, which negatively regulate cardiac functions, was relatively low.

Moreover, our results showed that the expression of miR-34 was decreased in both MSC-Exo and MSCs.

44

Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121].

Similarly, miR-34, an established p53 effector that is typically downregulated in malignant lung cancer [105], was upregulated in microadenomas but not in adenomas, as demonstrated in the present study.

Thus, maintenance of miR-34 expression is a prerequisite to avoid the passage from benign to malignant cancer lesions in lung tissue.

45

Another tumor suppressor regulated by miR-34a was CAMTA1 [76], a reduction in whose levels correlates with poor outcome in neuroblastoma [77].

For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively.

miR-34a is known to be over-expressed in various tumors and associated with cell proliferation [74].

In Figure 3B-E, we plot the qRT-PCR expression levels of ERBB4, SFRP1, SLC12A1 and VEGFA versus Agilent chip measured levels of their regulatory microRNA (miR-224, miR-34a, miR-21 and miR-200c) for the twelve samples of Figure 3A.

B-E. Agilent chip expression levels of miR-200c, miR-244, miR-34a and miR-21 versus the levels of mRNA that they regulate: VEGFA, ERBB4, SFRP1 and SLC12A1 respectively as measured by qRT-PCR for 12 validation set samples The dark circles represent the values in ccRCC and the light circles in normal kidney.

As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively.

46

Similarly, Lin et al. showed that inhibition of miR-34a restored the down-regulated expression of anti-apoptotic gene Bcl-2 and thus decreased apoptotic rate in pancreatic β-cell [49].

Lin X. Guan H. Huang Z. Liu J. Li H. Wei G. Cao X. Li Y. Down-regulation of Bcl-2 expression by miR-34a mediates palmitate -induced Min6 cells apoptosis J. Diabetes Res.

MicroRNAs from miR-8 family and miR-34 family were reported to be involved in the regulation of ceramide signaling pathway in the frontal cortex and dopamine signaling pathway in the hippocampus respectively [17].

47

Among those DEMs, rno-miR-30d and rno-miR-34a were found to target 8 differentially expressed mRNAs, respectively.

MiR-34a has been reported to regulate the expression of sirtuin 1 (SIRT1) in the liver, evidenced by the fact that the increased miR-34a levels in a high-fat and high calorie Western-style diet -induced obese mice led to reduced SIRT1 levels [57].

In our study, fish oil feeding diminished the elevated rno-miR-33-5p and rno-miR-34a-5p expression levels in Western-style diet -induced NAFLD rats, indicating that these two miRNAs may contribute to the protective effects of fish oil on hepatic triglyceride and cholesterol metabolic disorder.

Among these DEMs, the expression of rno-miR-33-5p and rno-miR-34a-5p was reduced in FOH compared with WD group.

The functional roles of miR-33 and miR-34a in metabolic syndrome have been well reviewed [23].

48

In input samples, all three miRNAs examined (miR-34a, miR-19a, miR-326) showed enhanced expression 30 min post-HFS and decreased expression below the contralateral control level when HFS was given in the presence of AP5 (Figure 4A).

Analysis of the Ago2 IP and Ago2 IP/input expression ratios revealed enhanced NMDAR -dependent association of miR-34a with Ago2 make this (Figures 4B,C).

Target gene list sizes for miRNAs with activity -dependent association with Ago2 for the 8 enhanced miRNAs were 97 (miR-20a), 156 (miR-219), 58 (miR-223), 114 (miR-29b), 30 (miR-330), 91 (miR-34a), 156 (miR-384), and 53 (miR-592) and for the 5 depleted miRNAs were 52 (let-7f), 55 (miR-338), 47 (miR-212), 255 (miR-19a), 32 (miR-326).

When comparing miRNA Ago2/input expression ratios, eight miRNAs (miR-384, miR-29b, miR-219, miR-592, miR-20a, miR-330 miR-223, and miR-34a) exhibited increases relative to the contralateral dentate gyrus, whereas five miRNAs (miR-let7f, miR-338, miR-212, miR-19a, and miR-326) showed decreases in this ratio.

49

Li N. Muthusamy S. Liang R. Sarojini H. Wang E. Increased expression of miR-34a and miR-93 in rat liver during aging, and their impact on the expression of Mgst1 and Sirt1 Mech.

There are several other miRNAs, such as miR-7, miR-124a, miR-9, miR-34a and miR-195, that play a role in the regulation of insulin secretion and β cell development [17].

In endothelial cells, the anti-angiogenic effect of miR-34a via targeting SIRT1 is modulated by metformin [63].

The eight circulating miRNAs, miR-29a, miR-34a, miR-375, miR-103, miR-107, miR-132, miR-142-3p and miR-144, and the two tissue-specific miRNAs, miR-199a-3p and miR-223, were identified to be significantly altered in T2D across a meta-analysis of controlled profiling studies [51].

Arunachalam G. Lakshmanan A. P. Samuel S. M. Triggle C. R. Ding H. Molecular interplay between microRNA-34a and sirtuin1 in hyperglycemia -mediated impaired angiogenesis in endothelial cells: Effects of metformin J. Pharmacol.

miR-34a is a potential plasma marker of brain aging identified in old mice, starting to increase approximately two-fold at an age of 48 weeks [60].

50

In our previous studies we demonstrated the expression profile of miRNAs in the hippocampus in a rat mo del of TLE and showed the neuroprotective effect of targeting miR-34a (Hu et al., 2011, 2012).

MicroRNA expression profile of the hippocampus in a rat mo del of temporal lobe epilepsy and miR-34a -targeted neuroprotection against hippocampal neurone cell apoptosis post-status epilepticus.

MicroRNA-34a upregulation during seizure -induced neuronal death.

51

Upregulation of miR-34a-5p and the associated inhibition of Bcl-2/Bcl-w are involved in mediating stearic acid cytotoxicity [20].

It was reported that miR-34a promotes palmitate -induced apoptosis in INS-1 cells, and the downregulation of miR-34a by GLP-1 alleviated the lipotoxicity caused by palmitate [19].

Overexpression of miR-34a, miR-146a, miR199a-5p or miR-29 in MIN6 cells negatively impacts on beta cell function [6].

52

Four of these miRNAs were downregulated in the liver of rats born to DEX -treated mothers (miR-34a-5p, miR-34c-5p, miR-124-3-3p and miR-150-5p).

Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc.

Additionally, an increase in phosphorylated AKT after the inhibition of the miR-34 family has been observed [39].

Expression of miR-34a-5p, miR-34c-5p, miR-124-3p, and miR-150-5p (respectively, 52%, 56%, 47% and 20% lower than CTL; P < 0.05) but not miR-449a was reduced in the liver of 60-hour fasted rats born to DEX -treated mothers (Fig.   5G).

53

MiR-34a is known to target p53-related apoptosis signaling and has been previously shown to be upregulated in the kidney in conjunction with cisplatin -induced renal toxicity [47].

A second age-affected DEM among the highest PC1 loading values is miR-34a, which shows increasing expression with age in both sexes (Figure  7).

Significant age differences in the expression of miR-34a, miR-223, and miR-130b (Figure  7A,E,F) were confirmed by qPCR.

Old age -associated miRNAs showed enrichment in pathways related to endocrine system disorders (miR-129-1, miR-375, miR-223, miR-664, miR-29b, miR-34a), cancer (miR-223, miR-29b, miR-375, miR-96), and cellular movement/invasion of cells (miR-29b, miR-29c, miR-7a, miR-96, miR-34a, miR-375).

It is not clear how the age-related increase in miR-34a may influence susceptibility, but its role in cell death may be a key.

54

Intriguingly, miR-34 and HMGA1 generate an intricate regulatory loop since HMGA1 is able to negatively regulate the expression of miR-34 (Puca, unpublished observations) and p53 (61), being the latter able to induce the expression of miR-34.

In this process, HMGA1 has a central role since, upon its overexpression, alters miR-34 pathway by acting directly and indirectly on it, through the repression of p53 (Figure 1C).

55

The expression levels of miR-34a and miR-26b were significantly up regulated in serum of diabetic and IOMe -injected rats (Fig 5B), whereas the expression levels of these miRNAs are normally low.

The expression levels of miRNAs miR-34a and miR-26b were up-regulated in serum of diabetic and in IOMe-AG538 -injected rats (B).

56

We performed network analyses using top 10 identified miRNAs (up-regulated: let-7i, let-7c, let-7a, miR-124, miR -145, miR-143, miR-34a, miR-466; down-regulated: miR-21, miR-146b) to predict their potential target transcripts.

B: microRNAs let-7i, let-7a, let-7c, miR-34a, miR-124, miR-145, and miR-143 were up regulated; miR-21 was down regulated 12 weeks post-irradiation vs.

57

These results indicated the expression of rno-miR-344b-3p, rno-miR-195-3p, rno-miR-30b-3p, and rno-miR-34a-5p was significantly upregulated in rats with adriamycin -induced nephropathy, whereas triptolide treatment could reverse the elevated expression of rno-miR-344b-3p and rno-miR-30b-3p to normal levels.

Chip analysis showed that, compared to that observed in the normal group, 19 miRNAs were significantly upregulated (rno-miR-344b-3p, rno-miR-195-3p, rno-miR-30b-3p, rno-miR-34a-5p, etc. )

58

Overexpression of miR-34a reduced ethanol -induced apoptosis by targeting caspase-2 and sirtuin 1 (8).

Chronic ethanol feeding was observed to alter the expression levels of several miRNAs during liver regeneration, including miR-34a, miR-103, miR-107, miR-122 (11) and miR-21 (12).

Treatment of normal human hepatocytes and cholangiocytes with ethanol induced a significant increase in miR-34a expression levels.

59

Nine miRNAs (miR-21, miR-24, miR-214, miR-132, miR-195, miR-210, miR-144, miR-150 and miR-34a) were found in exosomes obtained from rats subjected to RIPC, but only miR-24 was significantly upregulated ([#] P < 0.05, n = 4).

Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc.

b, c Flow cytometric analysis of the uptake of exosomes by H9c2 cells at various time points We further determined the expression of nine miRNAs (miR-24, miR-21, miR-214, miR-132, miR-195, miR-210, miR-144, miR-150 and miR-34a) in both RIPC-EXO and EXO (Fig.   3a).

Since the subject of our study was IRI, we selected nine miRNAs that have been reported to be involved either in oxidative stress (such as miR-150 and miR-21) 14, 15 or in cardiomyocyte apoptosis (such as miR-195, miR-132, miR-140, miR-144, miR-24, miR-214 and miR-34a) 16– 21 in our investigation and, using quantitative PCR (qPCR), explored whether RIPC could modify the expression level of these nine miRNAs in plasma exosomes.

60

Interestingly, miR-34a induces vascular smooth muscle cell senescence via sirtuin 1 downregulation and promotes the expression of pro-inflammatory secretory factors such as IL-1β, monocyte chemoattractant protein 1 (MCP1), and IL-6 [30].

Aranha et al. [20] showed that miR-16, let-7a and miR-34a, whose expression patterns are conserved in mouse, rat and human neural differentiation, are involved in mammalian neuronal development.

61

We recently showed that miR-34a is increased by DCA in a JNK -dependent manner, contributing to liver damage 11, while miR-21 expression is inhibited in primary rat hepatocytes 25.

As such, it may be additionally targeted by DCA via miR-34a, as we have recently described 11.

This is not surprising, since DCA is thought to engage a series of different apoptotic pathways including, for instance, the miR-34a/SIRT1/p53 pathway 11.

The time- and dose -dependent effects of DCA on the NF-κB/miR-21/PDCD4 axis are further consistent with our previous data showing that modulation of miR-34a by DCA is attenuated beyond 52 h of incubation, after which cell death becomes predominantly necrotic 11.

62

Murakami et al. reported that 11 miRNAs including miR-34, miR-199a-5p, miR-199, miR-200, and let-7e were up-regulated in a CCl [4] -induced fibrosis mo del mouse [31].

Recently, Li et al. reported that 16 miRNAs including miR-34, miR-199a-5p, miR-221, miR-146b, and miR-214 showed progressive up-regulation in rat with hepatic fibrosis caused by dimethylnitrosamine [30].

In our CCl [4] -induced fibrosis mo del, the miR-34a in plasma was increased, whereas the miR-199a-5p in plasma was not changed.

Among them, miR-34 and miR-199a-5p were common in the two mo dels.

63

Furthermore, miR-34a (up-regulated in the cerebellum and the substantia nigra) may modulate the cellular response to IGF-1 through the regulation of vascular endothelial growth factor A, which is targeted by miR-34a [58].

Moreover, the expression profile for miR-34a overlaps with that reported in zebrafish [42].

64

Lee et al. [33] showed that cisplatin treatment mostly downregulated miR-122, whereas it upregulated miR-34a expression using microarray analyses in mouse kidneys injured by treatment with cisplatin, indicating that both miR-34a and miR-122 are involved in the molecular biological mechanism of cisplatin -induced nephrotoxicity.

Bhatt et al. [32] reported that miR-34a might have a cytoprotective role for renal tubular cells through p53 during cisplatin -induced nephrotoxicity.

65

Among the miRNAs, miR-34a, miR-32, miR-376a, miR-384-3p, miR-29b and miR-142-3p were the highly overexpressed, with fold induction of 11.8, 24.2, 12.7, 14.4, 11.6 and 19.1, respectively.

We noted that miRNAs miR-34a, miR-18a, miR-19a, miR-32, miR-96, miR-142-3p miR-29b and miR-7b were significantly upregulated in the AOM rat fecal colonocytes compared to those obtained from the saline controls and the degree of induction was greater in the tumor bearing AOM rats compared to the tumor non-bearing AOM rats (Fig. 3B).

Furthermore, fecal colonocytes from the tumor bearing AOM rats showed a significantly higher induction of miR-34a, miR-18a, miR-19a and miR-142-3p (3.0, 2.3, 2.2 and 2.1 fold induction respectively) (p<0.05), Thus, it is evident that the miRNA dysregulation in the histologically normal colonic mucosa of the AOM rats was mirrored in the fecal colonocytes and the miRNA modulation was augmented by the presence of neoplasia in the colon thus supporting potential role as a minimally intrusive modality for field carcinogenesis detection.

Similarly, in the fecal colonocytes, the miRNAs miR-34a, miR-18a and miR-19a, showed an AUROC of 0.926, 0.918 and 0.968, respectively.

In the 16 week colonic biopsies, we observed that while all miRNAs trended to increase (versus age-matched saline treated animals) although only 7 miRNAs (miR-34a, miR-21, miR-18, miR-376a, miR-19a, miR-9 and miR-29b) achieved statistical significance (fold inductions of 1.73, 2.72, 2.15, 2.26, 2.18, 1.53, and 1.71,respectively) (Table 2).

66

A recent report showed that microRNA 34a (miR-34a), a tumour suppressor gene inhibiting Sirt1 expression also increases acetylated p53 levels, thus stimulating transcriptional targets of p53 responsible for promoting cell-cycle arrest, and apoptosis [73].

67

MiR-34a is up-regulated and contributes to the suppression of hepatocyte proliferation by inhibiting inhibin βB (Inhbb) and Met as described in our previous studies [10].

68

Other microRNAs to have been reported to be related to depression are miR-34 acting as a regulator of CRF signaling, miR-134 and miR-124a levels were significantly downregulated after treatment with duloxetine and miR-144 was found to have an increased expression in both lithium- and valproate -treated animals (Haramati et al., 2011; Hansen and Obrietan, 2013; Pan and Liu, 2015).

MicroRNA as repressors of stress -induced anxiety: the case of amygdalar miR-34.

69

Changes in the expression of miR-21 and miR-34a were found in our study and in a study by Risbud and Porter using the hippocampus from epileptic rats [25].

There are 6 common miRNAs (miR-138, miR-301a, miR-33, miR-34a, miR-146a, and miR-23a) between our data set and work of Hu et al. who studied miRNA expression profiles in a pilocarpine -induced mo del of epilepsy [23].

The use of antagomirs against miR-34a decreased apoptotic markers in the hippocampus following pilocarpine -induced status epilepticus but was not effective in the intra-amygdala kainic acid injection mo del [23, 66].

Another miRNA that may be involved in neuroprotection is miR-34a.

70

The expression of these four miRNAs (miR-125b, miR-30d, miR-34a and miR-1) did not change during UPR, with exception of miR-125b whose expression was increased after Tg treatment (Figure 3).

The four miRNAs (miR-125b, miR-30d, miR-34a and miR-1) were included as control miRNAs whose expression did not show significant change during conditions of UPR.

71

The prospect that a similar function may extend to other miRNAs is suggested by the conservation of several miRNAs (e. g. miR-25, miR-34a/b/c, miR-135a/b, miR-194, and miR-200a) that are capable of directly targeting the Wnt/β-catenin, a signaling pathway that has been wi dely implicated in the control of oncogenic hallmarks such as cell proliferation, metastasis, angiogenesis, telomerase activity, and apoptosis (reviewed by [49]).

For instance, among the 66 uniformly expressed miRNAs for which IPA assigned functions, we identified 12 candidates that have been implicated in androgen regulation, including: let-7a-5p, miR-15a-5p, miR-17-5p, miR-19b-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-30a-5p, miR-34a-5p, miR-140-5p, miR-193a-3p, miR-205-5p (S1 Fig).

72

37Tryndyak VP, Ross SA, Beland FA, Pogribny IP (2009) Down-regulation of the microRNAs miR-34a, miR-127, and miR-200b in rat liver during hepatocarcinogenesis induced by a methyl -deficient diet.

36Dutta KK, Zhong Y, Liu Y-T, Yamada T, Akatsuka S, et al. (2007) Association of microRNA-34a overexpression with proliferation is cell type -dependent.

Some miRNAs identified in our experiments as early markers for prediction of a carcinogenic potential are also mentioned in connection with cancer in the literature, e. g., rno-miR-34a and rno-miR-200b [36], [37].

73

miRNAs such as miR-133a, miR-185, miR-152, miR-34a and miR-342 which were reported to show increased expression were also up-regulated in our rat mo del.

The authors investigated the expression of seven diabetes-related miRNAs (miR-9, miR-29a, miR-30d, miR-34a, miR-124a, miR-146a and miR-375), four (miR-29a, miR-30d, miR-175 and miR-146a) of which were also found to be dysregulated in our study.

74

In another study, bone marrow mononuclear cell-released insulin-like growth factor (IGF)-1 inhibited the expression of pro-apoptotic miRNA-34a, thereby exerting an anti-apoptotic effect [15].

In recent studies, miRNAs, including miRNA-15b [14], miRNA-34a [15], miRNA-92a [16], and miRNA-320 [17] have been reported to be involved in the regulation of cardiomyocyte apoptosis after MI.

75

miRNAs that had approximately 2-fold upregulation included members of miR-29 family and miR-34 family and that were downregulated by about 2-fold were members of the miR-181 family and miR-183 family.

76

It has been shown that miR-29, miR-15 and miR-107 are upregulated; while miR-124, miR-34 and miR-153 are downregulated in patients with AD (Delay et al., 2012; Lau et al., 2013).

77

Activation of the SIRT1/p66shc antiapoptosis pathway via carnosic acid -induced inhibition of miR-34a protects rats against nonalcoholic fatty liver disease.

CA exerts antitumor activity by down -regulating miR-15b (Gonzalez-Vallinas et al., 2014), and increases miR-34a to exert an anti-apoptotic effect (Shan et al., 2015).

78

For example, Li et al. found that miR-28 promotes cardiac ischemia by targeting mitochondrial ALDH2 in mouse cardiac myocytes [27], and Fan et al. found that miR-34a promotes cardiomyocyte apoptosis through down -regulating ALDH2 [28].

Considering that one mRNA can be regulated by several different miRNAs, we hypothesized that ALDH2 is simultaneously regulated by different miRNAs other than miR-28 and miR-34a.

79

In addition, miR-34a induces apoptosis by down -regulating the expression of SIRT1 and stimulating the p53 pathway [9], while miR-16 was implicated in cell proliferation and apoptosis through the targeting of Bcl-2 [10].

80

A pathway involving farnesoid X receptor and small heterodimer partner positively regulates hepatic sirtuin 1 levels via microRNA-34a inhibition.

In contrast, several lines of evidence suggest that the FXR-SHP pathway lies upstream of Sirt1 and regulates this protein via the p53/miR-34a pathway (Lee J. et al., 2010).

81

On the other hand, the NF-κB system also down-regulates SIRT1 -mediated function via the miR-34a expression and reactive oxygen species [95, 102].

82

In previous studies, miR-34a and miR-132 were found to be increase after SE, and silencing miR-34a or miR-132 by microinjection of antagomirs led to the inhibition of caspase-3 expression, which was accompanied by reduction in apoptotic neurons, indicating a positive regulation of these two miRNA on neuronal apoptosis [12], [13].

83

Jionghua H miR-34a modulates angiotensin II -induced myocardial hypertrophy by direct inhibition of ATG9A expression and autophagic activityPLoS One.

84

B) Differential expression of mir-34a confirmed by qPCR.

For the strain-specific miRNA expression, i. e. mir-34a and let-7a, we applied the miRNA taqman assay according to the manufacturer's gui delines, with 5 ng total RNA as input material.

The student's T-test (2-sided) only assigned significance (p < 0.01) to mir-34a.

85

Additionally, Hu and co-workers showed that the up-regulation of miR-34a in the rat hippocampus activated the caspase-3 protein and that antagomirs (synthetic miRNA inhibitors) of miRNA-34a could block miR-34a–Bcl-2–caspase-3 signalling, resulting in a neuro-protective effect [43].

86

miR-335 directly, while miR-34a indirectly modulate survivin expression and regulate growth, apoptosis, and invasion of gastric cancer cells.

87

Metformin induces growth inhibition and cell cycle arrest by upregulating miR-34a in renal cancer cells [27].

88

Silencing microRNA-34a inhibits chondrocyte apoptosis in a rat osteoarthritis mo del in vitro.

17), miR-34a, [30] miR-27b, [19] and other miRNAs, were found to function in cartilage degradation and considered as promising therapeutic targets of OA.

89

This decrease was observed to a lower extent with other members of the miR-34 family (Figure 5C) suggesting that miR-34c interacted directly and specifically with the 3′-UTR of Sipa1.

Reporter assay experiments further support that Sipa1 mRNA is a target of the miR-34 family, in particular miR-34c (Figure 5).

Cells (2×10 [5] per well) were co -transfected with the reporter constructs (20 ng/well) and synthetic mmu-miR-34a, b or c (40 or 80 nM) mimics (Dharmacon, Lafayette, CO) in serum-free medium, using Lipofectamine 2000 (Invitrogen, Carlsbad, CA).

90

More recently, hippocampus-expressed miRNAs such as miR-134 and miR-34 have been shown to target the deacetylase sirtuin-1 (SIRT1) and thereby influence learning and memory processes (Gao et al., 2010; Zovoilis et al., 2011).

91

MicroRNA expression profile of the hippocampus in a rat mo del of temporal lobe epilepsy and miR-34a -targeted neuroprotection against hippocampal neurone cell apoptosis post-status epilepticus.

92

The Significance of miR-34a Expression in Endometrial Carcinogenesis: Correlation With Expression of p16 and Ki-67 Proteins in Endometrial Cancers.

93

In vitro studies showed that miR-34a regulates human dental papilla cell differentiation by targeting NOTCH and TGF-beta signaling [9].

94

Increased expression of mir-34a-5p and clinical association in acute ischemic stroke patients and in a rat mo del.

Among these miRNAs, miRNAlet-7a, miRNA-124, and miRNA-137 were reported to induce neuroprotection after cerebral ischemia, while miRNA-34a, microRNA-181c, and miRNA-17–92 were reported to exacerbates brain injury in ischemic Stroke (Szulwach et al., 2010; Liu et al., 2013; Hamzei Taj et al., 2016; Liang and Lou, 2016; Ma et al., 2016; Wang et al., 2016).

95

In our previous study, ALDH2 was proved to protect myocardial cells against ischemia-reperfusion injury through regulation of autophagy via AMPK- and Akt-mTOR signaling [3]; furthermore, microRNA-34a was shown to reduce the expression of ALDH2 via binding on ALDH2 mRNA in MI rats [6].

96

The miR-34 family was recently shown to be upregulated in the gut of patients during severe aGvHD (18).

97

Another p53 transcriptional target, microRNA-34a, also regulates neurite outgrowth, spinal morphology, and function [11].

98

revealed that four miRNAs (miR-29b-3p, miR-145-5p, miR-24-2-5p, miR-665) were significantly regulated (P<0.05), three miRNAs (miR-21-3p, miR-466b-2-3p, miR-466d) tended to be significantly regulated (P<0.15), and one miRNA (miR-34a-5p) was not confirmed to be significantly regulated by qRT-PCR (Table 2 ).

99

Several miRNAs are demonstrated that associated with OA development and modulation such as miR-18a (chondrocyte differentiation), miR-27b (controlling the expression of MMP-13), miR-34a (prevention of cartilage degradation), miR-140 and miR-222 (controlling cartilage homeostasis), miR-146 (promotion of inflammatory OA), miR146a (OA cartilage pathogenesis), miR-675 (cartilage repair) [30, 31].

100

Another study found that the expression of miR-34a during alcoholic liver injury might be regulated by methylation [39].