sort by

256 publications mentioning hsa-mir-375 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-375. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 562
Interestingly, both BIRC5 and BCL2L1 were up-regulated in CRC tissue samples and down-regulated as a result of miR-375 up-regulation or siRNA silencing of YAP1 in HCT116 in the present study. [score:10]
Among others, YAP1 is up-regulated in many epithelial cancers, and is mainly known as an effector of the Hippo signaling pathway involved in cell growth, division and apoptosis [56], [57], whereas up-regulation of YWHAZ has been shown to be associated with low miR-375 expression and reduced overall survival in gastric cancer [58]. [score:9]
As expected, more mRNAs were down-regulated than up-regulated as a result of miR-375 ectopic expression (Figure 4B). [score:9]
Finally, miR-375 target analysis demonstrated that the pro-apoptotic role of miR-375 by may be exerted through direct targeting of YAP1 resulting in down-regulation of the anti-apoptotic genes BIRC5 and BCL2L1. [score:9]
Interestingly, six of these known miR-375 targets were also significantly down-regulated in HCT116 upon miR-375 ectopic expression. [score:8]
Additionally, miR-375 has previously been shown to be down-regulated in different cohorts of CRC samples [35], [36] and in several other human cancers (see Table S6 in File S1 for references) indicating that the down-regulation of miR-375 is a general event in tumor development. [score:8]
In addition, down-regulation of the YAP1 downstream targets BIRC5 (54%) and BCL2L1 (72%) as a result of miR-375 ectopic expression was also confirmed at the RNA level (Figure 4E). [score:8]
Interestingly, like YAP1 we found that BIRC5 and BCL2L1 were down-regulated as a result of miR-375 up-regulation in HCT116 (FC [(log2)]: −0.9 (BIRC5) and −0.7 (BCL2L1) and p<0.05). [score:7]
To identify biologically relevant miR-375 targets, we set out to analyze the correlation between the expression of the above identified putative miR-375 targets and miR-375 in clinical CRC samples (normal colon mucosa n = 10 and adenocarcinoma n = 11). [score:7]
Furthermore, results from our laboratory have shown that miR-375 is up-regulated upon inhibition of β-catenin/TCF4 activity in the dox inducible dominant negative (dn)TCF4 DLD1 cell line (DLD TR7), which has been used as a mo del to study Wnt regulation of miRNAs in CRC [25]. [score:7]
Subsequently, we analyzed whether mRNAs that had previously been identified as direct miR-375 targets in other tissue were affected in HCT116 cells upon up-regulation of miR-375. [score:7]
To identify potential miR-375 mRNA targets the expression of miR-375 was correlated to genome-wide mRNA expression profiles. [score:7]
Furthermore, like miR-375 ectopic expression, silencing of YAP1 resulted in down-regulation of BIRC5 (∼30%) and BCL2L1 (∼40–50%) further emphasizing the role of miR-375 and YAP1 in the regulation of these molecules in HCT116 cells (Figure 5A). [score:7]
While no miR-375 expression was observed in the HCT116_ScrH cells +/− dox, a minor level of miR-375 expression was observed in the untreated HCT116_miR-375H cells (Figure 7A), which could indicate a minor leakage from the miR-375-tRFP expression cassette in the absence of dox. [score:7]
The mRNAs with minimum one 7mer-m8 seed match within the 3′ UTR showed a higher propensity to down-regulation upon miR-375 over -expression. [score:6]
Overall, these results indicate that the down-regulation of miR-375 in CRC is a result of a reduction in the miR-375 expression in epithelial cells of the tumor. [score:6]
Expression of known direct miR-375 targets. [score:6]
Initial analysis confirmed the down-regulation of HELLS, NOLC1 and YAP1 at the mRNA and protein level in response to ectopic miR-375 expression in HCT116 cells (Figures 4D–F). [score:6]
The clearly epithelial origin of the high miR-375 expression in normal colon mucosa and the down-regulation of miR-375 in epithelial cells from adenocarcinomas led to the selection of miR-375 for further analysis. [score:6]
Thus down-regulation of BIRC5 and BCL2L1 may among others explain the apoptotic phenotype induced as a result of miR-375 ectopic expression. [score:6]
In all, 224 genes had at least one 7mer-m8, 7mer-m1 or 8mer miR-375 seed match in their 3′UTR and were down-regulated (FC [(log2)]≤−0.5 and p<0.05) upon miR-375 ectopic expression. [score:6]
We hypothesize that miR-375 exerts its tumor suppressive role partly by acting as an upstream regulator of BIRC5 and BCL2L1 through the targeting of YAP1 (Figure 8). [score:6]
The carried out in the present study, however, demonstrated that miR-375 is most likely not under direct β-catenin/TCF4 control and rather suggest that yet unidentified downstream targets of the Wnt pathway affect miR-375 expression in CRC. [score:6]
Stimulated by the observation that our in silico/in vitro approach accurately identified many known direct miR-375 targets, we decided to investigate if YAP1 and two other miR-375 target candidates HELLS and NOLC1 were directly regulated by miR-375 in CRC cells. [score:6]
Subsequently, genome wide microarray transcription profiling of HCT116 cells over -expressing miR-375 was carried out to screen for target candidates regulated at the transcriptional level. [score:6]
To further analyze the role of YAP1 down-regulation in the phenotypes induced by miR-375 ectopic expression, YAP1 was silenced in HCT116 cells using two different siRNAs. [score:6]
Overall, the frequent down regulation of miR-375 in cancer and the phenotypic characterization of miR-375 in vivo and in vitro clearly emphasize its tumor suppressive role and have encouraged the search for miR-375 targets mediating the tumor suppressive effects. [score:6]
Integration of the transcription data with in silico target prediction revealed, that miRNAs harboring miR-375 seed matches in the 3′UTR were more frequently down-regulated than mRNAs with no seed match (Figure 4B). [score:6]
We conclude that down-regulation of YAP1 mimics the apoptotic phenotype induced by miR-375 ectopic expression. [score:6]
Thorough analysis of MIR-375 methylation and expression in CRC cell lines and tissue samples only identified MIR-375 promoter methylation and concurrent miR-375 down-regulation in three CRC cell lines including HCT116. [score:6]
We showed that HELLS and NOLC1 were down-regulated both at the mRNA and protein level as a result of miR-375 ectopic expression. [score:6]
We next sought to elucidate whether HELLS and NOLC1 were directly or indirectly targeted by miR-375. [score:5]
miR-375 expression analysis demonstrated that HCT116, SW480 and Colo205 all exhibited lower expression of miR-375 than the cell lines with no methylation (Figure 3B). [score:5]
Induction of miR-375 expression significantly reduced the growth of the tumors confirming the results from esophageal squamous cell carcinoma in which miR-375 was shown to effectively suppress tumor formation and metastasis [42]. [score:5]
Identification of potential miR-375 targets based on mRNA profiling and in silico target predictionThe mRNA profiling of miR-375 transfected HCT116 cells and the clinical samples are described in the Supplementary Material (Methods S1). [score:5]
Scr and miR-375 transfected cell (∼3.5×10 [6]) were scraped of culture flasks on ice in gentle lysis buffer (20 mM TRIS pH 7.5, 10 mM NaCl, 0.5% NP-40, 2 mM EDTA supplemented with RNase inhibitor RNaseOut (Invitrogen) and Complete Mini Protease Inhibitor Cocktail (Roche)) and hypertonically lysed by increasing the NaCl concentration to 150 mM. [score:5]
Figure S5 miR-375 expression in cohort 2. (A) Box plots comparing the relative expression of miR-375 in 25 samples from normal colon mucosa and 63 primary MSS stage I–IV CRCs (T2-4, N0-3, M0/1)×Minimum and maximum outliers. [score:5]
None of the tissue samples demonstrated MIR-375 promoter methylation although miR-375 was clearly down-regulated in a subset of the samples indicating that in vivo miR-375 is mainly regulated by other mechanisms than hypermethylation in CRCs. [score:5]
Additionally, their knock-down reduced cell viability and induced cellular death mimicking the phenotype induced by miR-375, although they were not identified as direct miR-375 targets using a. 10.1371/journal. [score:5]
Additionally, miR-375 expression in normal epithelial cells was significantly higher than the expression in epithelial cells from adenocarcinoma (p = 0.03). [score:5]
mRNA profiling of HCT116 cells upon ectopic expression of miR-375 and miR-375 target identification. [score:5]
Furthermore, the apoptotic death induced by miR-375 could be inhibited with z-DEVD-fmk (Caspase 3/7 inhibitor) (Figure 2D) demonstrating that the induced apoptosis is dependent on Caspase 3/7 activity. [score:5]
Identification of potential miR-375 targets based on mRNA profiling and in silico target prediction. [score:5]
Indeed, individual elimination of HELLS and NOLCL1 reduced the viability and induced cellular death in a manner similar to miR-375 ectopic expression (Figures 6C and D) but did not induce apoptotic death (Figure 6E) and hence other miR-375 targets such as YAP1 are responsible for the apoptotic phenotype. [score:5]
In addition, suppression of colony formation and reduced migration and invasion has also been linked to miR-375 expression [37], [40], [42], [49]. [score:5]
Using TarBase6.0, we identified nine mRNAs, which had all been identified as direct miR-375 targets using (Table 3) [47]. [score:4]
A significant up-regulation of mature miR-375 was observed 24 hours post-transfection. [score:4]
Additionally, miR-375 has also been shown to be up-regulated upon 5-aza-2′-deoxycytidine treatment in HCT116 and to a less extent in DLD1 [53]. [score:4]
On the contrary, Infinium HumanMethylation450 BeadChip methylation analysis of normal colon mucosa with paired adenomas or adenocarcinomas did not identify any hypermethylation of MIR-375 in the adenomas and adenocarcinomas (Figure 3C), although miR-375 was down-regulated (FC (log2)>1.5) in 7/12 pairs (Figure 3D). [score:4]
miR-375 was significantly down-regulated not only in stage II tumors (p = 0.0002 and absolute FC = 4.9) but also in the cohort as a whole combining tumors of different stages (p = 0.0002 and absolute FC = 4.5). [score:4]
Recently, miR-375 was also shown to play a role in cell cycle regulation through the inhibition of G1/S transition in HCT116 cells [54]. [score:4]
The mechanism behind miR-375 down-regulation has been studied in several cancers. [score:4]
In addition to the results of the present study, down-regulation of miR-375 has been demonstrated in several types of cancer including CRC [35], [40], [49]– [51]. [score:4]
At present, YWHAZ, JAK2, PDK1 and YAP1 have been identified as cancer relevant direct miR-375 targets in human gastric, esophageal and liver cancer usings [37], [49], [50], [52], [55]. [score:4]
Methylation analysis in melanoma and esophageal cancer later confirmed that methylation played a role in miR-375 down-regulation not only in cell lines but also in tissue samples [37], [40], [42]. [score:4]
We showed that methylation of miR-375 is not a common mechanism behind miR-375 down-regulation in CRC. [score:4]
Finally, lymphoid-specific helicase (HELLS) and nucleolar and coiled-body phosphor protein 1 (NOLC1) were identified as down-stream targets of miR-375 potentially playing a role in cell cycle regulating pathways. [score:4]
* indicate the pairs of clinical samples with significant miR-375 down-regulation (FC [(log2)]>1.5). [score:4]
Validation of miR-375 down-regulation in clinical samples. [score:4]
Hence our data do not support the hypothesis that miR-375 expression is directly modulated by chromatin-bound β-catenin/TCF4 complexes. [score:4]
YAP1 knock-down affects the expression BIRC5 and BCL2L1 and mimics the phenotypes induced by miR-375. [score:4]
To validate the identified phenotypes, the miRNAs that were down-regulated in clinical samples and Top-40 ranked in the phenotype screen (miR-150, miR-375, miR23b, miR-138, miR-139-5p and miR-9) were subjected to detailed functional analysis using HCT116, HT29, LS174T TR4, DLD1 TR7 and SW480 colon cancer cell lines. [score:4]
The Ago2-IP analysis provided strong evidence that YAP1 is indeed a direct miR-375 target in CRC cells. [score:4]
The down-regulation of miR-375 in stage II CRC observed in the present study was confirmed in an independent cohort (cohort 2) of 25 normal colon mucosa samples and 63 primary CRCs of different stages (stage I–IV, T2-4, N0-3, M0/1) (Figures S5A and B). [score:4]
MIR-375 methylation analysis in CRC cell lines and clinical CRC samplesmiR-375 is an intergenic miRNA and is associated with a CpG island indicating that this miRNA may be down-regulated by epigenetic silencing. [score:4]
Previous studies have shown that miR-375 is indeed down-regulated due to hypermethylation in esophageal and breast cancer [37]– [40]. [score:4]
We cannot rule out that methylation of other CpG sites than the ones addressed in the present study are important for miR-375 down-regulation in CRC, however, previous methylation analysis of MiR-375 has demonstrated homogenous methylation throughout the analyzed genomic regions, making this unlikely. [score:4]
indicated that YAP1 is a direct miR-375 target in CRC. [score:4]
To add evidence for the direct interaction of miR-375 and YAP1 in CRC cells, we performed (Ago2-IP) using lysates from miR-375 and Scr transfected HCT116 cells followed by YAP1 expression analysis of immunoprecipitated RNA. [score:4]
These results indicate that miR-375 may act as an upstream regulator of BIRC5 and BCL2L1 through the targeting of YAP1. [score:4]
These results indicate that epigenetic silencing of MIR-375 is not the general mechanism of miR-375 down-regulation in CRC. [score:4]
miR-375 is an intergenic miRNA and is associated with a CpG island indicating that this miRNA may be down-regulated by epigenetic silencing. [score:4]
Finally, miR-375, miR-138 and miR-9 were selected for further analysis due to their down-regulation in clinical samples and their ability to induced phenotypic changes in vitro. [score:4]
YAP1 has previously been shown to be a direct miR-375 target in liver cells using a [49]. [score:4]
In the present study, only YAP1 demonstrated an inverse correlation with the expression of miR-375 both in vitro and in clinical CRC samples. [score:3]
The generation of stable HCT116 cells with inducible expression of miR-375 is described in detail in the Supplementary Material (Methods S1). [score:3]
miR-375 has also been shown to inhibit G1/S transition in HCT116 [54]. [score:3]
To gain insight into the over-all biological changes introduced by the ectopic expression of miR-375, the most effected transcripts (p-value<0.05, FC [(log2)]<−1.0 or >1.0 (206 genes) or FC [(log2)]<−0.5 or >0.5 (1236 genes)) were analyzed using the Ingenuity Pathway analysis (IPA) software. [score:3]
Identification of biological relevant miR-375 targets using clinical CRC samples. [score:3]
Figure S7 Ingenuity pathway analysis of genes affected by miR-375 over -expression. [score:3]
Whereas in the adenocarcinoma miR-375 was expressed at comparable levels in epithelial and stromal cells (p = 0.27). [score:3]
On the contrary, miR-375 was not differentially expressed between the tumors of different stages. [score:3]
In order to elucidate the mechanism behind the induction of apoptotic death by miR-375 we set out to identify miR-375 targets. [score:3]
In conclusion, reduced expression of HELLS and NOLC1 only partly mimic the phenotypes induced by miR-375 10.1371/journal. [score:3]
The tRFP fluorescence marker was used as a surrogate to sort for cell populations expressing the highest level miR-375 after induction of dox. [score:3]
In order to obtain a pool of cells with a more uniform expression of tRFP, and thus miR-375, upon dox induction, we applied FACS sorting. [score:3]
In conclusion, reduced expression of HELLS and NOLC1 only partly mimic the phenotypes induced by miR-375 10.1371/journal. [score:3]
The expression of miR-375 in the input and IP fractions is shown in Figures S8A (input) and B (IP). [score:3]
Dox dependent expression of mature miR-375 in the HCT116_miR-375H cells was analyzed using RT-qPCR as describe earlier. [score:3]
Initially, we analyzed the expression of mature miR-375 in HCT116 transfected with a miR-375 mimic at different time points post transfection (Figure 4A). [score:3]
These analyses showed that in normal colon mucosa miR-375 was expressed at a higher level in the epithelial cells than in stromal cells (p = 0.02) (Figure 2E). [score:3]
Most strikingly, YAP1 was found to be negatively correlated to miR-375 in CRC tissue samples indicating that targeting of YAP1 by miR-375 is also relevant for the tumorigenesis of colorectal cancer (Table 3 and Table S7 in File S1). [score:3]
To induce expression of miR-375, dox (Vibradox Sandoz)(0,2 mg/ml) was added to the drinking water of the mice in group A, when the tumors reached a size of approximately 50 mm [3]. [score:3]
Further functional studies indicated that the pro-apoptotic role of miR-375 most likely is mediated by YAP1 and its anti-apoptotic down-stream targets BIRC5 and BCL2L. [score:3]
In accordance with the in vitro results, the results of the in vivo analysis clearly indicate that miR-375 expression reduces tumor growth (Figure 7F). [score:3]
Of these, 18 genes were significantly up-regulated in CRC compared to normal mucosa and showed a negative correlation to miR-375 (Pearson≤−0.6) (Table S7 in File S1). [score:3]
Identification of miR-375 targets using transcription profiling. [score:3]
Expression of miR-375 in laser capture microdissected colorectal cancer tissue. [score:3]
In the present study, we identified several genes related to cell cycle progression among the clinically relevant putative miR-375 targets, including HELLS and NOLC1. [score:3]
These results indicate that HELLS and NOLC1are probably downstream targets in the cellular pathways affected by miR-375. [score:3]
These analyses showed that YAP1 is enriched in immunoprecipitates from miR-375 transfected cells compared to Scr transfected cells in an Ago2 dependent manner, thus providing strong evidence that YAP1 is indeed a direct miR-375 target in CRC cells. [score:3]
The ectopic expression of miR-375, miR-9 and miR-138 significantly reduced the viability of more than one cell line (MTT reduction >20% and p≤0.05) (Figure 2A (HCT116) and Figure S2), possible due to a general anti-proliferative or pro-apoptotic role of these miRNAs. [score:3]
Correlation analysis of both in vitro mo del systems and clinical CRC samples revealed that expression of Yes -associated protein 1 (YAP1) was negatively correlated to miR-375. [score:3]
Characterization of stable HCT116 with inducible miR-375 expression and in vivo tumor growthTo analyze the effect of miR-375 on tumor growth in vivo HCT116 cells stably transfected with a polycistronic dox-inducible expression cassette, producing both tRFP and miR-375, was generated. [score:3]
To analyze the effect of miR-375 on tumor growth in vivo HCT116 cells stably transfected with a polycistronic dox-inducible expression cassette, producing both tRFP and miR-375, was generated. [score:3]
All together, the above results strongly indicate that miR-375 has the ability to suppress tumor growth through the induction of apoptosis. [score:3]
To study the effect of miR-375 on tumor growth in vivo HCT116 cells stably transfected with an inducible miR-375 expression-cassette were used to generate mouse xenograft tumors. [score:3]
The location and number of miR-375 seed sequences (i. e. complementary to the position 2–8 of the miRNA) within the full length mRNA sequence were mapped using sequence data retrieved from TargetScan v5.2 and Ensembl 62 databases [26], [27]. [score:3]
Knock-down of HELLS and NOLC1 partly mimic the phenotype induce by miR-375. [score:2]
Compared to untreated HCT116_miR375H cells dox treated cells induced an eighteen-fold increase in miR-375 expression level. [score:2]
Next we analyzed whether knock-down of HELLS and NOLC1 could reduce the viability of HCT116 and induce a pro-apoptotic phenotype, thus mimicking the phenotype induced by miR-375. [score:2]
Mo del of the role of miR-375 in the regulation of apoptotic death. [score:2]
A previous study, has suggested a direct link between β-catenin activation and miR-375 repression in hepatocellular tumors [43]. [score:2]
Regulation of miR-375 by β-catenin/TCF4 activity. [score:2]
Alternatively, it has been suggested that miR-375 might be regulated negatively by the Wnt pathway [25], [43]. [score:2]
Additionally, knockdown of YAP1 using siRNAs mimicked the apoptotic phenotype induced by miR-375. [score:2]
Furthermore both BIRC5 and BCL2L1 were negatively correlated to miR-375 in clinical samples (Pearson = −0.6). [score:1]
In the present study, miR-375 was shown to reduce viability and to induce Caspase 3/7 dependent apoptotic death in CRC cell lines. [score:1]
Selected fragments of the 3′UTRs of HELLS (NM_018063) and NOLC1 (NM_004741) containing putative miR-375 binding sites were amplified from normal human genomic DNA and cloned downstream of the Renilla Luciferase gene in the siCHECK-2 vector (Promega, Fitchburg, WI, USA). [score:1]
The Relative expression of miR-375 was measured using RT-qPCR. [score:1]
The miR-375 expression was measured in triplicates and normalized to miR-340. [score:1]
Methylation of MIR-375 in CRC cell lines and clinical samples using Infinium HumanMethylation450 BeadChips. [score:1]
Next we analyzed whether the silencing of YAP1could reduce the viability of HCT116 cells through induction of apoptosis thus mimicking the phenotype induced by miR-375. [score:1]
using HELLS and NOLC1 3′UTRs and a miR-375 mimic demonstrated no binding of miR-375 to the wt 3′UTR of HELLS and NOLC1 (data not shown). [score:1]
Originally, MIR-375 hypermethylation was reported in cell lines originating from breast and gastric cancer [38], [52]. [score:1]
To address the functional role of miR-375, we and others have carried out in vitro phenotype analyses. [score:1]
We identified two TCF4 sites within 80–90 kb of the miR-375 hairpin and analyzed the binding of TCF4 to both sites using a chromatin immunoprecipitation (ChIP) approach with polyclonal TCF4 antibody in DLD1 TR7 cells (Figure S6). [score:1]
Although, we did find that TCF4 bound to the MYC enhancer region, we did not detect any TCF4 binding at the MIR-375 locus. [score:1]
Detection of miR-375, miR-138 and miR-9 in laser microdissected colorectal tissue. [score:1]
We specifically look at the methylation level of 11 CpG sites situated in close vicinity to the pri-miR-375 transcription start site [41]. [score:1]
These data encouraged us to study the methylation of MIR-375 in CRC cell lines and clinical CRC tissue samples using Infinium HumanMethylation450 BeadChips. [score:1]
Biological functions significantly associated with altered intracellular levels of miR-375 in HCT116 cells 48 h post transfection. [score:1]
Figure S8 from cell lysates of miR-375 or Scr transfected cells. [score:1]
Among the remaining miRNAs, miR-375 was identified as an apoptosis inducing miRNAs in the high-throughput screen. [score:1]
CpG sites in close proximity to MIR-375 (CpG1-11) were analyzed. [score:1]
0096767.g004 Figure 4(A) Reconstitution of mature miR-375 upon transfection with pre-miR-375 or Scr (RT-qPCR). [score:1]
The IDs of the CpG sites in close proximity to MIR-375 were as follows CpG1; cg00215432, CpG2; cg00218620, CpG3; cg00705280, CpG4; cg02257674, CpG5; cg04348419, CpG6; cg06214770, CpG7; cg14358282, CpG8; cg21615583, CpG9; cg22306928, CpG10; cg01822124 and CpG11; cg26394220. [score:1]
Among them miR-375 was selected for further in vitro and in vivo analyses, which confirmed that miR-375 reduces tumor growth through the induction of apoptotic death. [score:1]
0096767.g003 Figure 3Methylation of MIR-375 in CRC cell lines and clinical samples using Infinium HumanMethylation450 BeadChips. [score:1]
To elucidate the cellular origin of miR-375, miR-138 and miR-9, we measured their expression in laser captured microdissected colorectal adenocarcinomas and adjacent normal colon mucosa (Figure 2E and Figure S4). [score:1]
The reduction of cellular viability by miR-375 has previously been shown in cell lines from several cancers, [40], [49], [50], [52], [54] whereas the apoptotic phenotype has been demonstrated in cells from gastric and esophageal cancer [37], [52]. [score:1]
A 1∶1 ratio of the lysates from miR-375 and Scr transfected cells was used for FLAG immunoprecipitation. [score:1]
To investigate whether the miR-375 induced repression of HELLS and NOLC1 play a role in the phenotype induced by miR-375, we specifically silenced these mRNAs in HCT116 cells using two independent siRNAs to each target. [score:1]
Figure S6 Association of TCF4 with chromatin in the genomic region of miR-375 using ChIP followed by qPCR. [score:1]
MIR-375 methylation analysis in CRC cell lines and clinical CRC samples. [score:1]
Initially, MIR-375 was cloned into the 3′ UTR region of the turbo red fluorescence protein gene (tRFP) of the pSBInducer10 vector (MIR375_pSBInducer10). [score:1]
The phenotype induced by the miR-375 mimic was more pronounced than that induced by the YAP1 siRNAs, probably reflecting that YAP1 only represents one out of a number of critical nodes in the pleiotropic miR-375 network. [score:1]
We selected miR-375 for detailed functional characterization and target identification. [score:1]
Only mRNAs demonstrating p-values<0.05 and log2 ratios <−0.5 or >0.5 (1236 genes) (A) or <−1.0 or >1.0 (206 genes) (B), comparing miR-375 and Scr transfected cells, were included in the analyses. [score:1]
The MIR-375 methylation levels in CRC cell lines and clinical samples. [score:1]
The mRNA profiling of miR-375 transfected HCT116 cells and the clinical samples are described in the Supplementary Material (Methods S1). [score:1]
To study the binding of miR-375 to YAP1 in a physiologically relevant manner we carried out Ago2-IP. [score:1]
0096767.g008 Figure 8 In conclusion, combing high-throughput functional screening with miRNA profiling of CRC tissue samples, we have identified clinically relevant miRNAs in colorectal cancer including miR-375. [score:1]
In CRC MIR-375 promoter methylation has only been demonstrated in the cell line HCT116 [39]. [score:1]
Subsequently, the cells were treated with 50 ug/ml doxycycline (dox) (Sigma) for 48 hours leading to transcriptional activation of the tRFP- MIR375 cassette. [score:1]
Generation and characterization of stable HCT116 cells with inducible miR-375 expression (HCT116-miR-375H). [score:1]
The mice were divided into two groups with 6 animals in each: Group A; miR-375 (+ dox) and Group B; control (− dox). [score:1]
In conclusion, the validation analysis confirmed the anti-proliferative role of miR-9 and miR-138, and the apoptosis inducing capacity of miR-375 as identified in the high-throughput analysis. [score:1]
Generation and characterization of stable HCT116 cells with inducible miR-375 expression. [score:1]
Characterization of stable HCT116 with inducible miR-375 expression and in vivo tumor growth. [score:1]
We therefore asked whether we could detect chromatin occupancy of β-catenin/TCF4 complexes at TCF4 sites in proximity to the miR-375 hairpin. [score:1]
Hypermethylation of MIR-375 has also been demonstrated in melanoma and in the CRC cell line HCT116 cell [39], [40]. [score:1]
[1 to 20 of 162 sentences]
2
[+] score: 487
The overexpression of miR-375 suppressed FZD8 expression in HCT116 cells, whereas the up-regulation of FZD8 inhibited this effect, thus confirming a direct association between miR-375 and FZD8 (Figure 4D). [score:13]
Conversely, the transfection of miR-375 inhibitor in SW620 CRC cells upregulated the expression of TCF4, MMP7 and nuclear β-catenin and downregulated the expression of phosphorylated β-catenin protein. [score:13]
The overexpression of miR-375 suppressed FZD8 expression in CRC cell lines, whereas the up-regulation of FZD8 antagonized the suppressive effect of miR-375, which confirmed a direct interaction between miR-375 and FZD8. [score:13]
We found that FZD8-siRNA significantly reduced the expression of FZD8 protein and subsequently inhibited the levels of TCF4, MMP7 and nuclear β-catenin, whereas it upregulated the expression of phosphorylated β-catenin protein (Figure 5C); these effects recapitulated those of the overexpression of miR-375. [score:12]
Several in vitro and in vivo studies have shown that pancreatic miRNA-375 directly targets PDK1, plays key roles in the glucose regulation of insulin gene expression and β-cell growth and is down-regulated in pancreatic carcinoma [15]. [score:10]
For example, several studies reported that pancreatic miRNA-375, which directly targets PDK1, plays key roles in the glucose regulation of insulin gene expression and β-cell growth and was evidently downregulated in pancreatic carcinoma [14, 15]. [score:10]
Functional assays showed that the down-regulation of FZD8 inhibited HCT116 cell migration and invasion (Figure 5D), which resembled the inhibitory effects of miR-375 overexpression on cells described above. [score:9]
Therefore, we speculated that miR-375 may inhibit Wnt/β-catenin signaling pathway by suppressing its direct target-FZD8 to regulate the metastasis of CRC. [score:9]
Representative images show higher FZD8 expression in human samples expressing low miR-375 levels and lower FZD8 expression in human samples expressing high miR-375 levels. [score:9]
As anticipated, our data showed that the overexpression of miR-375 significantly inhibited the Wnt/β-catenin pathway and downregulated FZD8, which consequently decreased cancer cell invasion and metastasis. [score:8]
F. Altered FZD8 expression in HCT116 cell bearing up-regulated miR-375 in response to FZD8 transfection and the expression of phosphorylated β-catenin, TCF4, MMP7 and nuclear β-catenin protein were analyzed by western blotting. [score:8]
Likewise, PCR and western blot analyses confirmed that the ectopic restoration of miR-375 in HCT116 cells inhibited the expression of FZD8, whereas the knockdown of miR-375 in SW620 cells significantly elevated FZD8 expression (Figure 4C). [score:8]
miR-375 has been suggested to inhibit colorectal cancer growth by targeting the PI3K/Akt signaling pathway [37] and reduce cell viability by targeting YAP1 to induce apoptosis [38]. [score:7]
As shown in Figure 4F, the expression of FZD8 was higher in human tissue samples that expressed low miR-375 levels, whereas FZD8 was low in tissues that expressed high miR-375 levels. [score:7]
Western blot analyses showed that the ectopic restoration of miR-375 downregulated the expression of FZD8 protein. [score:6]
Moreover, the up-regulation of miR-375 suppressed colorectal cancer cell migration and invasion in vitro and reduced tumor metastases in murine mo dels established with both orthotopic implantation and spleen injection. [score:6]
A. Western blot analysis of phosphorylated β-catenin, TCF4, MMP7 and nuclear β-catenin protein expression response to deregulated miR-375 expression in the indicated cells. [score:6]
As expected, a western blot analysis demonstrated that FZD8 reversed the miR-375 -mediated inhibition of TCF4, nuclear β-catenin, and MMP7 and upregulated phosphorylated β-catenin protein (Figure 5F and Supplementary Figure S8). [score:6]
As shown in Figure 1A, miR-375 expression was distinctively downregulated in colorectal cancer tissues relative to their matched NCTs (p<0.0001). [score:6]
We further verified that Frizzled 8 (FZD8) is a direct and functional target of miR-375, and its overexpression is associated with decreased survival in CRC patients. [score:6]
Figure 5 A. Western blot analysis of phosphorylated β-catenin, TCF4, MMP7 and nuclear β-catenin protein expression response to deregulated miR-375 expression in the indicated cells. [score:6]
Moreover, wound-healing assays showed that miR-375 up-regulation inhibited the rate of HCT116 cell migration, whereas miR-375 knockdown increased this rate in SW620 cancer cells (Figure 2D–2E). [score:6]
Up-regulation of miR-375 inhibits CRC metastasis in vivo. [score:6]
For this purpose, we predicted likely targets of miR-375 using bioinformatics and identified FZD8, a member of the Frizzled (FZD) family, as a direct target of miR-375. [score:6]
To establish a cell line that stably expressed ectopic miR-375, miR-375 expression vectors were transfected into HCT-116 cells, and the cells were selected with G418 (400μg/ml) for 3-4 weeks. [score:5]
To further verify that FZD8 is a key factor in the miR-375 -mediated regulation of Wnt/β-catenin pathway, we used specific siRNAs against FZD8 to knockdown FZD8 expression in HCT116 cells. [score:5]
Moreover, we transiently transfected a miR-375 inhibitor into SW620 cells, which expressed relatively high levels of endogenous miR-375 (Supplementary Figure S2). [score:5]
Using target gene prediction and signal pathway analyses, we previously identified FZD8 as a likely target of miR-375 in CRC [17]. [score:5]
Because FZD8 is a key receptor for the initiation of Wnt/β-catenin signaling pathway [18], which is well known for its role in the development and promotion of cancer metastasis, we investigated the ability of miR-375 to regulate Wnt/β-catenin signaling by inhibiting FZD8 expression. [score:5]
We first confirmed that up -regulating miR-375 in vitro suppressed CRC cell migration and invasion, whereas miR-375 knockdown in colorectal cancer cells promoted their migration and invasion. [score:5]
Accordingly, the restoration of FZD8 expression neutralized the inhibition of Wnt/β-catenin signaling by miR-375. [score:5]
Taken together, our data show that miR-375 functions as an important tumor suppressor in CRC by suppressing tumorigenesis and metastatic colonization. [score:5]
These results indicate that miR-375 is a key inhibitor that suppresses CRC tumor cell growth and metastasis in vivo. [score:5]
Recently, Dai et al reported that miR-375 expression is frequently down-regulated in colorectal cancer tissues compared with the non-tumor counterparts [36]. [score:5]
Whereas miR-375 expression was low, FZD8 expression was drastically elevated in CRC patients, in liver and lymph nodes metastases. [score:5]
A transwell assay showed that miR-375 up-regulation drastically suppressed the invasiveness and migration of HCT116 CRC cells (Figure 2B). [score:5]
Therefore, we selected HCT116, which expressed the lowest levels of miR-375, to stably over-express miR-375 by plasmid transfection. [score:5]
Specifically, miR-375 expression was markedly downregulated in cancer tissues compared with their corresponding NCTs. [score:5]
B. CRC patients with vessel emboli (n=41) expressed lower levels of miR-375 than patients without vessel emboli (n=49) (** p=0.004), indicating that miR-375 expression may inversely correlate with the metastatic potential of CRC patients. [score:5]
However, the contribution of this down-regulation to the development and progression of CRC remains unknown, and the related mechanisms and functions of miR-375 in CRC are yet to be determined. [score:5]
Specifically, miR-375 expression was lowest in HCT116 cells, whereas SW620 cells expressed relatively high levels of miR-375 (* p<0.05). [score:5]
We observed that the expression of miR-375 was inversely associated with FZD8 expression in 33 CRC patients (p=0.006, r=−0.53, Figure 4E). [score:5]
However, the molecular mechanisms related to the downregulation of miR-375 in CRC have not been fully studied. [score:4]
We found that miR-375 was not only markedly downregulated in human CRC tissues but could also predict the metastatic potential of CRC patients. [score:4]
FZD8 is a direct target of miR-375 and is associated with poor prognosis in CRC patients. [score:4]
As expected, miR-375 overexpression and FZD8-siRNA decreased the transactivating activity of β-catenin in HCT116 cells, whereas miR-375 inhibitor increased the transactivating activity of β-catenin in SW620 cells, as determined by a β-catenin reporter assay (Figure 5E). [score:4]
miR-375 may function as an important negative regulator of the Wnt/β-catenin pathway by targeting FZD8. [score:4]
Collectively, these findings suggest that FZD8 is an essential functional mediator of miR-375-repressed cell migration and invasion and that miR-375 regulates the Wnt/β-catenin pathway by targeting FZD8 in CRC. [score:4]
The successful up-regulation of mature miR-375 was confirmed by qRT-PCR (Supplementary Figure S1). [score:4]
G. The migration and invasiveness of HCT116 cell bearing up-regulated miR-375 were analyzed after FZD8 transfection. [score:4]
In HCT116 cells, the overexpression of miR-375 inhibited the migration rate of cells at 24, 48 and 72 hours compared with the control cells, which were transfected with miR-NC vector (p=0.040,0.005 and 0.008, respectively). [score:4]
The overexpression of miR-375 markedly suppressed the invasiveness and migration of HCT116 cells compared with the control group (vs. [score:4]
As shown in Figure 5A, the levels of TCF4, MMP7 and nuclear β-catenin were downregulated by the ectopic restoration of miR-375 in HCT116 CRC cells. [score:4]
The down-regulation of miR-375 significantly increased cell migration and invasion (vs. [score:4]
Among these miRNAs, miR-375 has recently been documented to be downregulated in various types of cancers. [score:4]
We and other groups have found that the down-regulation of miR-375 is pronounced in the plasma and cancer tissues of colorectal cancer patients [16, 17]. [score:4]
C. PCR analyses showed that the ectopic restoration of miR-375 downregulated the mRNA levels of FZD8. [score:4]
Our findings provide novel insights into the functions and clinical relevance of miR-375 in CRC and suggest that miR-375 and FZD8 may be used as novel prognostic markers and potential therapeutic targets in clinical practice. [score:3]
Furthermore, we observed that miR-375 expression in CRC was not associated with gender, age, differentiation, stage, metastases or perineural invasion (all p>0.05) but correlated well with vessel embolus (p=0.004, Supplementary Table S1). [score:3]
We suggest that miR-375 may be clinically useful for developing a new prognostic biomarker and therapeutic target for CRC metastasis. [score:3]
As demonstrated in Figure 2C, the inhibition of miR-375 significantly increased cancer cell migration and invasion. [score:3]
Figure 2 A. Real-time PCR analysis of the relative expression levels of miR-375 in four CRC cell lines (HCT116, HCT29, SW480, and SW620) and noncancerous tissues (NCTs). [score:3]
In contrast, the median level of miR-375 in patients without vessel embolus was 0.3, whereas the median level in patients with vessel embolus was 0.1, suggesting that patients expressing low levels of miR-375 were more likely to develop a vessel embolus (Figure 1B, p=0.004). [score:3]
Considering the canonical role of the Wnt/β-catenin pathway in tumorigenesis and metastases and because FZD8 is an upstream receptor in the canonical Wnt/β-catenin signaling pathway [21], we hypothesized that miR-375 similarly inhibits the Wnt/β-catenin pathway. [score:3]
We also demonstrated that the level of miR-375 was significantly decreased in the plasma of CRC patients and correlated well with the expression observed in tissue samples, suggesting that miR-375 may serve an alternative biomarker of minimally invasive CRC [17]. [score:3]
E. An inverse correlation was observed between FZD8 and miR-375 expression in CRC patients. [score:3]
Figure 4 A. Schematic of the human FZD8 3′-UTR luciferase constructs containing wild-type and mutant (FZD8 3′-UTR) miR-375 target sequences. [score:3]
D. Changes in FZD8 expression in HCT116 cell bearing miR-375 in response to FZD8 transfection were analyzed by western blotting. [score:3]
miR-375 suppresses CRC cell migration and invasion in vitro. [score:3]
The nuclear translocation of β-catenin was also activated in the miR-375 inhibitor group. [score:3]
Our results showed that the overexpression of miR-375 diminished the number of liver metastases in both mo dels. [score:3]
A. Schematic of the human FZD8 3′-UTR luciferase constructs containing wild-type and mutant (FZD8 3′-UTR) miR-375 target sequences. [score:3]
Likewise, immunofluorescence staining showed that the overexpression of miR-375 reduced the nuclear accumulation of β-catenin in HCT116 CRC cells, which is an important feature of the activation of Wnt/β-catenin signaling (Figure 5B). [score:3]
Additionally, miR-375 was negatively associated with the FZD8 expression levels in human CRC tissues. [score:3]
Strikingly, the reductions in CRC cell migration, invasion and TCF/LEF transcriptional activity caused by miR-375 overexpression were effectively reversed by FZD8 (Figure 5G–5H). [score:3]
To further validate that miR-375 suppresses CRC metastasis, as described above, we established an orthotopic implantation murine mo del to represent tumor growth and metastasis. [score:3]
We injected HCT116 cells stably expressing miR-375 or miR-NC vector into the spleens of 6-week-old male BALB/C nude mice. [score:3]
Briefly, HCT116 cells stably expressing miR-375 or miR-NC vector (miR -negative control vector) were subcutaneously injected into 6-week-old male BALB/C nude mice. [score:3]
Low miR-375 expression predicts metastatic potential in human colorectal cancer (CRC) patients. [score:3]
A. Real-time PCR analysis of the relative expression levels of miR-375 in four CRC cell lines (HCT116, HCT29, SW480, and SW620) and noncancerous tissues (NCTs). [score:3]
Notably, our extensive analysis of clinical samples showed that low miR-375 expression was not only prominent in the tissues of CRC patients but also associated with metastatic. [score:3]
The average expression levels of miR-375 were normalized using U6 as a reference gene, and the 2 [−Δct] method was subsequently applied. [score:3]
miR-375 modulates the Wnt/β-catenin pathway by targeting FZD8. [score:3]
The miR-375 expression plasmid was generated by cloning the genomic pre-miR-375 gene, flanked by a 300-nt-sequence on each side, into OriGene's pCMV6-Mir Vector to generate the plasmid pCMV-miR-375. [score:3]
In the current study, we, for the first time, identified miR-375 as a novel metastasis inhibitor of CRC with clinical relevance. [score:3]
To this end, we searched for a correlation between the miR-375 levels and the expression of FZD8 in human CRC tissues. [score:3]
Furthermore, to test the impact of miR-375 on the survival of mice bearing tumors, we injected HCT116 cells stably expressing miR-375 or miR-NC vector into 2 groups of 6-week-old male NOD/SCID mice. [score:3]
The 2 [−ΔΔct] method was used to express the level of miR-375 in CRC tissues and matched normal mucosa samples. [score:3]
Taken together, these results suggest that miR-375 is inversely associated with FZD8, whose expression might serve as predictor of poor survival among human CRC patients. [score:3]
Low expression of miR-375 predicts the metastatic potential of human colorectal cancer. [score:3]
Compared with the miR-NC group, the number of total metastases, tumor volume and disease severity were lower in the miR-375 group (2 liver metastases for the miR-375 group vs. [score:2]
Collectively, these results suggest that miR-375 is a negative regulator of CRC metastasis. [score:2]
Collectively, these in vitro and in vivo results suggest that miR-375 plays an anti-metastatic role in CRC, which provides new insights into the functions of miR-375 in the development and progression of CRC. [score:2]
E. In SW620 cells, knocking down miR-375 increased the migration rate at various time points (vs. [score:2]
Among the samples from 90 colorectal cancer patients, 61 cases(67.7%) exhibited a >50% reduction in miR-375 expression compared with their NCTs. [score:2]
B. HCT116 cells were co -transfected with the luciferase constructs and miR-375. [score:1]
no metastases for the miR-375 group) (Figure 3B). [score:1]
Figure 3 A. Photographs of xenograft formation in mice implanted withHCT116 cells containing miR-375 or miR-NC vector. [score:1]
After 3 months, we observed that the miR-375 group exhibited a tendency for longer survival than the miR-NC group (Figure G). [score:1]
Figure 1 A. miR-375 expression was measured in 90 paired human CRC and adjacent noncancerous tissues (NCTs) by quantitative reverse transcription polymerase chain reaction (qRT-PCR). [score:1]
Because vessel emboli have been associated with an increased incidence of tumor metastasis (especially liver metastasis for CRC) and an overall decrease in the survival rate [19– 20], we investigated the relationship between low miR-375 expression and CRC metastasis. [score:1]
G. Six-week-old male NOD/SCID mice were subcutaneously injected with HCT116 cells stably expressing the miR-375 or miR-NC vector, and the survival rates of the two groups of mice were calculated. [score:1]
A. Photographs of xenograft formation in mice implanted withHCT116 cells containing miR-375 or miR-NC vector. [score:1]
However, possible other functions of miR-375 have not yet been identified. [score:1]
More importantly, orthotopically implanted miR-375 HCT116 cells gave rise to fewer liver metastases than orthotopically implanted miR-NC cells (2 liver metastases for the miR-NC group vs. [score:1]
Additionally, we performed a rescue experiment by co-transfecting HCT116 cells with miR-375 and FZD8. [score:1]
A. miR-375 expression was measured in 90 paired human CRC and adjacent noncancerous tissues (NCTs) by quantitative reverse transcription polymerase chain reaction (qRT-PCR). [score:1]
Finally, HCT116 cells stably expressing miR-375 or miR-NC were subcutaneously injected into 2 groups of 6-week-old NOD/SCID mice to investigate the association between miR-375 and the survival of nude mice. [score:1]
The correlation between miR-375 and FZD8 was determined with linear regression lines, and the significance was assessed with a Spearman correlation (p=0.006). [score:1]
Double-stranded oligonucleotides containing the wild-type (wt-3′UTR) or mutant (mt-3′UTR) miR-375 binding sites in the FZD8 3′ UTR were synthesized. [score:1]
The miR-NC mice displayed prominent liver metastases, peritoneal metastases and ascites, whereas significant liver metastases, peritoneal metastases or ascites were not observed in the miR-375 group (Supplementary Figure S3-4, Supplementary Table S2). [score:1]
The miR-375 group did not exhibit significant metastases, whereas the miR-NC group showed higher metastatic potential at various sites, including the lung, liver and peritoneum (no metastases for the miR-375 group vs. [score:1]
Anti-miR-375, a nonspecific anti-miR-375 control, FZD8 siRNA oligonucleotides, and the control siRNA oligonucleotides were purchased from Riobio(Guangzhou, China) and transfected at a concentration of 100nmol/l using riboFECT CP Reagent (Guangzhou, China). [score:1]
Next, we established another murine liver tumor metastasis mo del via spleen injection, which mimics the colonization and outgrowth phases of the tumor metastatic cascade, to further validate the role of miR-375 in CRC metastases. [score:1]
The identified link between miR-375 and FZD8 in CRC cell lines led us to attempt to recapitulate this relationship in human CRC. [score:1]
Two liver metastases were found in the miR-NC group, but no metastases were found in the in miR-375 group. [score:1]
Indeed, miR-375 was previously found to be restricted only to pancreatic islets, but it has since been revealed to have important functions in tumorigenesis [14, 35]. [score:1]
HCT116 CRC cells were co -transfected with the luciferase reporter vectors and the miR-375 or control vector in 24-well plates using Lipofectamine 2000 transfection reagent (Invitrogen). [score:1]
The metastasis rate in the miR-375 group was 33.3%, whereas it was 66.7% in the miR-NC group. [score:1]
On average, the miR-375 levels were decreased 2- to 3-fold in human colorectal cancer tissues relative to their NCTs. [score:1]
Survival tended to be longer in the miR-375 group than in the control group. [score:1]
In summary, the results presented herein show that miR-375 exerts anti-metastatic effects during the progression of CRC. [score:1]
In contrast, miR-375 did not decrease the luciferase activity of a mutant construct (Figure 4B). [score:1]
Additionally, we adopted two murine metastasis mo dels to deeply explore the role of miR-375 in the metastasis of CRC. [score:1]
B. The migration and invasiveness of HCT116 cells were analyzed after transfection with miR-375. [score:1]
We examined the miR-375 levels in all 90 pairs of human colorectal cancer tissues and their corresponding noncancerous tissues (NCTs) by qRT-PCR. [score:1]
C. The migration and invasiveness of SW620 cells after transfection with miR-375 inhibitor were also investigated. [score:1]
[1 to 20 of 127 sentences]
3
[+] score: 297
In 22Rv1 cell with miR-375 downregulation, RB1 was upregulated, whereas in miR-375 -overexpressing PC-3 cells, CCND2 was downregulated (P < 0.001 for both). [score:12]
Remarkably, CCND2 expression was found to be decreased in primary PCa samples, consistent with a putative target of miR-375 (which is overexpressed in those samples), whereas RB1 was overexpressed in the same set of primary tumors. [score:9]
We provide evidence that miR-375 deregulation disturbs several critical cellular pathways, especially cell cycle regulation, eventually through CCND2 targeting, which may, at the least partially, explain the frequent downregulation of CCND2 in primary PCa. [score:8]
It is tempting to speculate whether in the same tumor, along its progression, miR-375 may act initially as an oncomiR and later as a tumor suppressor, targeting different genes as disease progresses. [score:7]
Intriguingly, both anti-miR-375 transfection in 22Rv1 cells (causing 68% reduction in miR-375 expression levels) and forced miR-375 expression in PC-3 cells attenuated the malignant phenotype, whereas in RPWE-1 cells, forced miR-375 expression did not cause significant phenotypic alterations. [score:7]
The search for putative miR-375 targets comprised expression analysis of 61 genes implicated in some of the most important cellular pathways deregulated in cancer. [score:6]
In conclusion, our data provides further insight into miRNAs overexpression in PCa, suggesting that miR-375 upregulation might be act as oncomiR at the initial steps of prostate carcinogenesis, a role that could be impaired as PCa progresses, probably due to the cumulative genetic and epigenetic alterations endured by cancer cells. [score:6]
Thus, those cell lines were selected for subsequent functional experiments of miR-375 downregulation (22Rv1) or forced expression (PC-3 and RPWE-1). [score:6]
miR-375 directly targets CCND2 In silico analysis identified a miR-375 potential binding site at CCND2 3′untranslated region (UTR). [score:6]
Indeed, in gastric cancer, miR-375 forced expression increased apoptosis and reduced of cell viability in vitro [25], and janus kinase 2 (JAK2) was identified as a direct target [26]. [score:6]
It should be emphasized, however, that miR-375-altered expression reports are mostly based in microarray or validation platform analysis attempts to discriminate different tumor subgroups according to miRNAs expression, seldom providing biological clues to the role of miR-375 in cancer [19, 20, 27- 29]. [score:5]
Figure 8Expression levels of potential miR-375 targets for array validation (A) RB1 and (B) CCND2 (** P < 0.01). [score:5]
Figure 6Forced expression of miR-375 in RWPE-1. (A) Relative expression of miR-375 (normalized to miR-NC), (B) number of viable cells, and (C) relative apoptosis levels (normalized to miR-NC). [score:5]
Whereas miR-182 and miR-375 were significantly overexpressed in PCa (P < 0.001 for both), confirming the results of the array, no significant differences were found for miR-32 expression between PCa and MNPT (Figure  1A and Additional file 2: Figure S1). [score:5]
Although this and other studies [19- 21] implicate miR-375 upregulation in PCa, miR-375 has been mostly considered a tumor suppressor, namely in gastric, head and neck, pancreatic, and hepatocellular cancers [22- 25]. [score:5]
Our observations thus suggest that miR-375 overexpression may contribute to prostate carcinogenesis and disease progression. [score:5]
Correlation analysis for miRNAs expression showed that miR-375 was significantly co-expressed with miR-32 and miR-182 (r = 0.36 and r = 0.60, respectively; Table  3 and Figure  3). [score:5]
Figure 5Forced expression of miR-375 in PC-3. (A) Relative expression of miR-375 (normalized to miR-NC), (B) number of viable cells, (C) relative apoptosis levels (normalized to miR-NC), and (D) relative invasion (normalized to miR-NC). [score:5]
Furthermore, the luciferase assay confirmed that CCND2 is a target of miR-375 as CCND2 transcript levels were significantly reduced after miR-375 forced expression. [score:4]
Intriguingly, in 22Rv1 cells, which displayed the highest miR-375 expression, knockdown experiments also attenuated the malignant phenotype. [score:4]
However, it should be emphasized that in addition to miR-375, other epigenetic and/or genetic mechanisms, eventually more relevant in vivo, might be involved in RB1 expression regulation in PCa. [score:4]
miR-375 directly targets CCND2. [score:4]
To determine whether miR-375 was implicated in regulation of selected genes involved in cell cycle, apoptosis, DNA repair, mTOR, or MAPK/ERK pathways, a custom array panel (Roche Applied Science, Manheim, Germany) was designed for quantification of selected gene expression. [score:4]
Phenotypic impact of miR-375 downregulation in 22Rv1 cells. [score:4]
Furthermore, using a custom gene panel to search for potential targets followed by specific luciferase assay validation, CCND2 was identified and confirmed as miR-375 target in PCa. [score:4]
Modulation of miR-375 expression in two PCa cell lines (22Rv1 and PC-3) showed that this miRNA is involved in regulation of cell viability and apoptosis, in a cell-context -dependent manner. [score:4]
Thus, the cellular context in which miR-375 may act as oncomiR or tumor suppressor is likely to be conditioned by androgen receptor regulation. [score:4]
Because a report on miR-182 overexpression in PCa was published during the execution of this study [18], we then proceeded with miR-375 for further analysis. [score:3]
Our results thus suggest that miR-375 plays a dual role in PCa, acting either as an oncomiR or a tumor-suppressor miRNA, depending on the cellular context. [score:3]
miR-375 was transiently transfected in PC-3 and RWPE-1 cells with a Pre-miR™ miRNA precursor (pre-miR-375, PM10327, Applied Biosystems, Foster City, CA, USA) and an Anti-miR™ miRNA inhibitor (anti-miR-375, AM10327, Applied Biosystems, Foster City, CA, USA) was transfected for 22Rv1 cells. [score:3]
Thus, while in 22Rv1 cells an oncogenic role for miR-375 is suggested, a tumor-suppressive function is implied for PC-3 cells. [score:3]
We found that, in PCa tissues, miR-375 expression was higher than in normal prostate tissues, paralleling the results of body fluids analysis [19- 21]. [score:3]
Expression analysis results of miR-375 in prostate cells lines parallel those of primary tissues, as the lowest levels were found in RWPE-1, a benign prostate cell line. [score:3]
Interestingly, an association of higher miR-375 expression levels and regional lymph node metastases was depicted, providing additional confirmation of our results. [score:3]
Furthermore, gene ontology enrichment analysis disclosed that genes involved in cell cycle regulation were those more frequently deregulated in 22Rv1 and PC-3 cell lines (Figure  9), supporting a key role for miR-375 in PCa. [score:3]
At 72 h, forced expression or silencing of miR-375 were confirmed by RT-qPCR. [score:3]
Expression of three miRNAs, not previously associated with PCa, was subsequently assessed in large independent sets of primary tumors, in which miR-182 and miR-375 were validated, but not miR-32. [score:3]
Because several miRNAs were below detection level in quantitative reverse transcription-polymerase chain reaction (RT-qPCR) analyses (probably due to low expression levels), only three miRNAs (miR-32, miR-182, and miR-375) were assessed in the larger dataset. [score:3]
Prostate cancer MicroRNAs Epigenetics miR-375 CCND2 Prostate cancer (PCa), the second most incident cancer in men worldwide (31.1%) [1] and ranking first in incidence in the US (27%) [2], is very heterogeneous, ranging from clinical indolent to extremely aggressive disease, causing substantial morbidity and mortality [3]. [score:3]
Moreover, analysis of TCGA data disclosed a statistically significant negative correlation between miR-375 and CCND2 expression in PCa tissues (Spearman’s correlation, r = −0.57, P < 0.0001). [score:3]
Putative miR-375 targets. [score:3]
Following validation in clinical samples, miR-375 was also found to be upregulated in PCa cell lines compared to RWPE-1 (a benign prostate epithelial cell line). [score:3]
These observations were further validated in an independent dataset through meta-analysis of TCGA data available for miR-375 expression in prostate tissues. [score:3]
Figure 4 miR-375 expression levels in prostate cell lines. [score:3]
Patients in the N1 lymph node stage presented significantly higher expression of hsa-mir-375 than patients in the N0 stage. [score:3]
Figure 1Expression levels of miR-375 in PCa and normal prostate tissues (A), according to Gleason Score (B) and pathologic stage (C). [score:3]
are displayed after normalization to RWPE-1. At 72 h after transfection, miR-375 expression levels were increased 56,000 and 8,000 times in PC-3 and RPWE-1 cells, respectively (P < 0.001 for both) (Figures  5A and 6A). [score:3]
In silico analysis identified a miR-375 potential binding site at CCND2 3′untranslated region (UTR). [score:3]
A dual role for miR-375 in prostate cancer progression is suggested, highlighting the importance of cellular context on microRNA targeting. [score:3]
Interestingly, although derived from metastasis, 22Rv1 and LNCaP cell lines display the miR-375 expression profile typical of primary PCa from both series analyzed, and these are also androgen responsive as they represent clinically localized, androgen-ablation therapy-naïve tumors. [score:3]
Importantly, miR-182 and miR-375 overexpression was confirmed in the validation datasets. [score:3]
Validation in two large independent sets of patients demonstrated that miR-375 expression was increased in PCa with higher Gleason score and more advanced pathological stage, which entail worse prognosis. [score:3]
Figure 2Expression of has-mir-375 is increased in prostate cancer and associates with lymph node stage in patients from TCGA. [score:3]
Considering the potential dual role of miR-375 in PCa, the expression of 61 cancer-related genes, involved in critical cellular pathways, was assessed in PC-3 and 22Rv1 transfected cells. [score:3]
Expression levels of miR-375 were decreased by 68% 72 h after transfection (P < 0.001; Figure  7A) and this was associated with significantly reduced cell viability (P < 0.01). [score:3]
Identification of potential miR-375 target genes. [score:3]
It is noteworthy that PCa cell lines with the highest miR-375 expression levels are androgen-responsive (22Rv1 and LNCaP), whereas androgen-independent (DU145 and PC-3) cells display the lowest levels. [score:3]
Differences in miR-375 expression between N0 and N1 lymph node stage groups were assessed by Student’s t-test. [score:3]
Significantly higher expression levels of miR-375 were depicted in patients with higher Gleason score and more advanced pathological stage, as well as with regional lymph nodes metastases. [score:3]
Forced expression of miR-375 in PC-3 cells, which display the lowest miR-375 levels among PCa cell lines, increased apoptosis and reduced invasion ability and cell viability. [score:3]
Phenotypic impact of miR-375 forced expression in PC-3 cells and RWPE-1 cells. [score:3]
Figure 7Inhibition of miR-375 in 22Rv1. [score:3]
In RWPE-1 cells, miR-375 expression levels were lower than those of any PCa cell line, mimicking the results of PCa and MNPT tissues. [score:3]
PCa cell line 22Rv1 depicted the highest miR-375 expression levels, whereas the lowest were found in PC-3 cells (Figure  4). [score:3]
Potential miR-375 target cancer-related genes in 22Rv1 and PC-3 transfected cells, normalized to miR-NC. [score:3]
In CCND2 3′UTR vector and pre-miR-375 co -transfected PC-3 cells, a sixfold increase in miR-375 expression levels was apparent at 72 h (Figure  10A), whereas CCND2 3′UTR luciferase activity was 37% reduced, at 48 h (P < 0.01), and 71% at 72 h (P < 0.001) after transfection (Figure  10B). [score:3]
Interestingly, CCND2 is a key element in cell cycle regulation, and this pathway was found as the most relevant in which miR-375 was implicated, in gene ontology enrichment analysis of both transfected cell lines. [score:2]
Gene ontology analysis implicated miR-375 in several key pathways deregulated in PCa, including cell cycle and cell differentiation. [score:2]
In transfected RWPE-1 cells, and despite a significant increase in miR-375 levels, no significant alterations in cell viability and apoptosis were apparent (Figure  6B, C), suggesting that miR-375 deregulation is mostly relevant in the context of malignant prostate cell. [score:2]
was performed in PC-3 cells to determine whether miR-375 might regulate CCND2 transcription levels. [score:2]
MiR-375 expression in prostate cell lines. [score:2]
Moreover, CCND2 was identified as putative miR-375 target in PCa, confirmed by luciferase assay. [score:2]
The panel of altered genes was, indeed, different in each cell line, as it would be expected from the results of the phenotypic assays and the baseline expression levels of miR-375. [score:2]
Gene ontology enrichment (GOE) analysis was performed to ascertain which biological processes are regulated by miR-375 in PCa cell lines. [score:2]
Thus, expression profiles of PC-3 transfected (pre-miR-375) and 22Rv1 transfected (anti-miR-375) cells were compared to its respective controls (Additional file 5: Figure S3). [score:2]
MiR-375 expression levels were significantly higher in cases with higher Gleason score and more advanced pathological stage at diagnosis (P < 0.05, P < 0.001, Figure  1B, C). [score:2]
Strikingly, these results are in line with previous reports that associate DNMT activity, promoter methylation of miR-375 and androgens [34]. [score:1]
The comparative Ct method [37] was used to calculate fold-difference in gene expression between mir-375 transfected cells and respective miR-NC. [score:1]
A reporter construct containing a binding site at CCND2 3′UTR for miR-375 (GeneCopoeia, Rockville, MD, USA) was introduced into PC-3 cells using Turbofectin 8.0 transfection reagent (Origene, Rockville, MD, USA). [score:1]
At 72 h, miR-375 levels were measured by RT-qPCR to confirm its forced or silenced expression. [score:1]
Strikingly, miR-375 was significantly overexpressed in all tumors compared to matched normal samples (P < 0.0001; Figure  2A), as well as in patients with regional lymph node metastasis (N1) compared to those without regional lymph node involvement (N0) (P = 0.0017; Figure  2B). [score:1]
Representative display of (A) miR-NC cells and (B) pre-miR-375 50 nM transfected cells. [score:1]
However, due to the wi dely acknowledged heterogeneity of PCa, it may be reasonable to assume that in different prostate cancers (herein represented by different cell lines) miR-375 could play antagonistic roles. [score:1]
In these experiments, pre-miR-375, anti-miR-375, and miR-NC concentration was 50nM. [score:1]
Because PC-3 is highly invasive, this feature was evaluated following miR-375 forced expression and a maximum of 52% reduction was observed in transfected cells (P < 0.01) (Figure  5D and Additional file 4: Figure S2). [score:1]
MNPT) miR-449a# 3.92 miR-32 3.49 miR-548c-5p 2.71 miR-562 2.56 miR-103-as 2.53 miR-512-3p 2.41 miR-200c* 2.33 miR-147b 2.24 miR-770-5p 2.09 miR-518c* 2.00 miR-517b 1.88 miR-182 1.79 miR-615-3p 1.70 miR-496 1.59 miR-1200 1.58 miR-375 1.54 miR-551a 1.53 *Passanger strand. [score:1]
Vectors were co -transfected along with pre-miR-375 as described. [score:1]
[1 to 20 of 87 sentences]
4
[+] score: 268
Since target mRNA analysis may obscure miRNA effects manifested at the protein level, as a result of translation inhibition rather than transcript degradation, we performed mass spectrometric analyses for unbiased profiling of changes in gene expression induced in BCD cells by miR-375 overexpression. [score:11]
miR-375 overexpression in expanded islet cells resulted in MET, as judged by downregulation of N-cadherin and upregulation of E-cadherin. [score:9]
miR-375 overexpression downregulated GSK3α/β levels and activity, and upregulated the inactive form of GSK3β. [score:9]
However, the levels of human MTPN mRNA did not change following miR-375 overexpression in expanded islet cells, and miR-375 upregulation by RC did not inhibit GSIS in BCD cells [5]. [score:8]
The expression array analysis demonstrated a >12-fold downregulation in miR-375 expression in expanded human islet cells, relative to islets. [score:8]
Among the miRNAs highly expressed in islets, miR-375 has been shown to be required for normal mouse glucose homeostasis [10] and zebrafish β-cell development [11], and expressed at high levels during human islet development [12], as well as in mature islets [13, 14]. [score:7]
miR-375 levels in bleomycin-resistant transduced cells were upregulated by several hundred-fold (Fig 2B) and were comparable to the expression levels of miR-375 in islet cells prior to dedifferentiation (Fig 1B). [score:6]
In addition, miR-375 overexpression in expanded islet cells upregulated MAFB and GCG transcripts (Fig 2D). [score:6]
This synergy occurred despite the significant miR-375 upregulation induced by RC alone, suggesting a quantitative correlation between miR-375 levels and insulin expression in BCD cells. [score:6]
miR-375 overexpression downregulates GSK3. [score:6]
The protein downregulated to the largest extent was glycogen synthase kinase (GSK)-3α (1.6-fold difference between means of miR-375 overexpression and control). [score:6]
miR-375 overexpression in expanded islet cells downregulates the PDPK1-AKT pathway. [score:6]
Taken together, these findings suggest that GSK3 inhibition at least partially mediates the effect of miR-375 overexpression on BCD cell redifferentiation. [score:5]
To unravel the mechanism underlying these effects, we analyzed changes in expression of established and predicted miR-375 targets. [score:5]
Our findings demonstrate that overexpression of miR-375 alone activates BCD cell redifferentiation by affecting multiple targets. [score:5]
Expression of miR-375 by itself induced detectable C-peptide expression in only 12% of BCD cells, making it difficult to assess cell function, such as glucose-stimulated insulin secretion (GSIS). [score:5]
E. Suggested mo del for activation of insulin expression by miR-375 -mediated inhibition of GSK3. [score:5]
Changes in expression of established and predicted miR-375 targets in expanded islet cells infected at passages 4–12 with miR-375 or empty viral vectors, and analyzed by qRT-PCR. [score:5]
While overexpression of miR-375 did not cause a significant change in the expression levels of MTPN, HNF1B, PAX6, and NOTCH2, a small but significant 18% decrease was detected in transcripts encoding 3-phosphoinositide dependent protein kinase-1 (PDPK1) (S5 Fig). [score:5]
This is supported by the findings that miR-375 overexpression or the GSK3 inhibitor SB-216763 did not significantly increase β-catenin levels in expanded islet cells, and resulted in growth arrest. [score:5]
Changes in β-catenin and proliferation in expanded islet cells following miR-375 overexpression or GSK3 inhibitor treatment. [score:5]
PDPK1 is a serine-threonine kinase which mediates signaling downstream of PI3-kinase and is directly targeted by miR-375 [23]. [score:4]
PDPK1 has been shown to be a direct target of miR-375 in rodent islet cells [23]. [score:4]
miR-375 has been implicated in limiting GSIS under stress in MIN6 cells by downregulating myotrophin (Mtpn) transcripts [8]. [score:4]
These findings position PDPK1 as an important functional target of miR-375 in a pathway that regulates BCD redifferentiation (Fig 3M). [score:4]
Using miRNA microarray analyses we identified miR-375 as one of the miRNAs greatly downregulated during BCD cell proliferation in vitro. [score:4]
As seen in Fig 3A and 3B, PDPK1 protein levels increased by 50% during the first 3 weeks of human islet cell expansion in culture, whereas miR-375 overexpression resulted in a significant 30% reduction in PDPK1 levels (Fig 3C and 3D). [score:3]
B. Overexpression of miR-375. [score:3]
A pre-miR-375 retrovirus vector was used to overexpress pre-miR-375 and a bleomycin resistance gene in expanded BCD cells. [score:3]
Analysis of the PDPK1-AKT pathway revealed a reduction of 30% in PDPK1 protein levels following miR-375 overexpression, resulting in 80%-decrease in phospho-AKT levels. [score:3]
MAFA protein levels were elevated in expanded islet cells overexpressing miR-375 (Fig 5A and 5B). [score:3]
hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA 000564 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU 000268 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG 000174 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC 000149 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG 000420 hsa-miR-200a UAACACUGUCUGGUAACGAUGU 000502 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA 002251 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA 002300 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG 000402 Total protein was extracted from cells by incubation with a lysis buffer containing 0.5% NP-40 and protease inhibitor cocktail for 10 min. [score:3]
We therefore investigated changes in expression of both GSK-3α and GSK-3β during islet cell dedifferentiation and miR-375 overexpression. [score:3]
Effect of miR-375 overexpression on BCD cell redifferentiation. [score:3]
As with miR-375 overexpression, SB-216763 did not increase total β-catenin protein levels (Fig 6D and 6E), and resulted in growth arrest (Fig 6F). [score:3]
However, it is conceivable that additional protein kinases and phosphatases are involved in balancing the different phosphorylated states of GSK3 [34] following miR-375 overexpression. [score:3]
We hypothesized that restoration of miR-375 expression in expanded BCD cells may contribute to their redifferentiation. [score:3]
C, D. Changes in expression of mesenchymal genes (C) and islet cell genes (D) in expanded islet cells infected at passages 4–12 with miR-375 or empty viral vectors, and analyzed by qRT-PCR. [score:3]
Following miR-375 overexpression, β-catenin was predominantly localized near the plasma membrane, unlike control cells, in which it was detected throughout the cell (Fig 6C). [score:3]
Accordingly, miR-375 overexpression resulted in a 5-fold reduction in phospho-AKT levels (Fig 3I and 3J), while total AKT protein levels slightly increased (Fig 3K and 3L). [score:3]
Our findings demonstrate that restoration of normal levels of a single miRNA, miR-375, in BCD cells is sufficient for induction of β-cell gene expression, reduced cell proliferation, and a switch from NCAD to ECAD expression, which is characteristic of mesenchymal-epithelial transition. [score:3]
Our results suggest that miR-375 expression may contribute to future approaches for cell replacement therapy of diabetes based on in-vitro expansion and redifferentiation of donor islet cells. [score:3]
Synergistic effects of miR-375 overexpression and RC on BCD cell redifferentiation. [score:3]
of changes in expression of β-cell genes in expanded islet cells (C) infected at passages 4–12, and sorted GFP [+] BCD cells (D) infected at passages 4–7, with miR-375 or empty viral vectors and treated with RC for 4–6 days. [score:3]
miR-375 overexpression induced a significant decrease in total GSK-3α and GSK-3β protein levels (Fig 4E), as well as a decrease in the active forms of both proteins (Fig 4F). [score:3]
Recent work has identified SHOX2, an inducer of EMT in breast cancer cells, as a novel miR-375 target [38], suggesting a possible mechanism for restoration of the epithelial phenotype in BCD cells by miR-375. [score:3]
M. Scheme of miR-375 effect on AKT targets through PDPK1. [score:3]
E. Changes in expression of β-cell genes in sorted GFP [+] BCD cells infected at passages 4–7 with miR-375 or empty viral vectors, and analyzed 5 days later by qPCR. [score:3]
In view of the important developmental and functional roles of miR-375 in β cells, we evaluated the effect of miR-375 overexpression on BCD cell redifferentiation. [score:2]
Taken together, these findings demonstrate that miR-375 induces profound changes in BCD cells and directs them towards redifferentiation. [score:2]
Our results support an important function of miR-375 in regulation of the differentiated human β-cell phenotype, and emphasize the roles of PDPK1 and GSK3 in mediating its effects. [score:2]
Expanded islet cells subjected to a combined treatment of RC and miR-375 overexpression showed a 2-fold increase in β-cell transcripts, compared to RC treatment alone (Fig 7C). [score:2]
Since GSK3α and GSK3β transcripts do not contain miR-375 binding sites, these likely represent indirect effects. [score:2]
Clinical application will require non-viral delivery of miR-375, functional assessment of the redifferentiated cells in vitro and in vivo, and development of effective immunoprotective approaches. [score:2]
However, miR-375 overexpression synergized with RC treatment in promoting BCD cell redifferentiation, as manifested by a 3.7-fold increase in insulin transcript levels, and a 1.8-fold increase in the number of C-peptide -positive cells, compared with RC alone, which were highly reproducible in cells from multiple human donors. [score:2]
Pre-mmu-miR-375 was subcloned into pBABE-Bleomycin vector and co -transfected into human embryonic kidney 293T cells for virus production with the Ampo-helper packaging plasmid. [score:1]
A. of changes in miR-375 levels in expanded islet cells treated at passages 5–7 with RC for the indicated times. [score:1]
Quantitation of immunofluorescence analysis of C-peptide in expanded islet cells infected at passages 5–6 with miR-375 or empty viral vectors and treated with RC for 4 days. [score:1]
Minor changes in apoptosis rates were noted between uninfected cells (2.1±0.1%) and cells infected with miR-375 (2.5±0.2%) or empty viruses (S4 Fig). [score:1]
of cells infected at passages 4–6 with miR-375 or empty viral vectors. [score:1]
E. of total GSK-3α and GSK-3β proteins in expanded islet cells infected at passages 3–5 with miR-375 or empty viral vectors. [score:1]
I. Changes in proliferation of expanded islet cells infected at passages 3–5 with miR-375 or empty viral vectors, and analyzed 5 days later by immunofluorescence for Ki67. [score:1]
However, since the miR-375 -induced GCG, PPY, and SST transcript elevation in sorted GFP [+] BCD cells was insignificant (S2 Fig), we conclude that a distinct population of insulin -negative/glucagon -positive cells likely originates from non-BCD cells, in accordance with our previous results [5]. [score:1]
Morphological changes in expanded islet cells at passage 6, 12 days following infection with miR-375 viral vector. [score:1]
B. In-situ hybridization with miR-375 or scrambled probe following a 4-day treatment with RC of expanded islet cells at passage 5 labeled with the β-cell lineage tracing vectors. [score:1]
H. of inactive form of GSK-3α in expanded islet cells infected at passages 3–4 with miR-375 or empty viral vectors. [score:1]
0122108.g007 Fig 7. A. of changes in miR-375 levels in expanded islet cells treated at passages 5–7 with RC for the indicated times. [score:1]
Our findings implicate for the first time GSK3 in miR-375 activity in human islet cells. [score:1]
C, D. of PDPK1 in expanded islet cells infected at passages 4–6 with miR-375 or empty viral vectors. [score:1]
S2 FigRNA was extracted from sorted GFP [+] BCD cells 5 days following infection at passages 4–7 with miR-375 or empty viral vectors, and analyzed by qPCR. [score:1]
of AKT in expanded islet cells infected at passages 4–6 with miR-375 or empty viral vectors. [score:1]
I, J. of phosphorylated AKT in expanded islet cells infected at passages 4–6 with miR-375 or empty viral vectors. [score:1]
miR-375 in-situ hybridization in human islets. [score:1]
RC treatment resulted in a detectable increase in miR-375 levels in expanded islet cells (Fig 7A) and GFP [+] BCD cells (Fig 7B) during the first 4 days of treatment, and a further increase by 6 days (Fig 7A). [score:1]
Expanded islet cells, or sorted GFP [+] BCD cells, at passages 5–12 were infected with miR-375 or empty viral vectors and analyzed 5 days later by qPCR. [score:1]
F-H. Immunofluorescence analysis of C-peptide in expanded islet cells infected at passages 5–6 with miR-375 or empty viral vectors. [score:1]
Overall, these findings suggest that increased miR-375 levels interact with the pathways activated by RC and result in enhanced BCD cell redifferentiation. [score:1]
Furthermore, miR-375 was readily detected by in-situ hybridization in β cells of isolated adult human islets, and co-localized with C-peptide immunostaining (Fig 2A). [score:1]
0122108.g004 Fig 4. A. Proteomic profiling of sorted GFP [+] BCD cells infected at passages 4–6 with miR-375 or empty viral vectors. [score:1]
of MAFA in expanded islet cells infected at passages 4–6 with miR-375 or empty viral vectors. [score:1]
miR-375 further induced insulin protein formation, as judged by C-peptide immunofluorescence analysis (Fig 2F– 2H). [score:1]
C. Immunofluorescence of β-catenin in GFP-labeled expanded islet cells infected at passages 6 with miR-375 or empty viral vectors. [score:1]
Changes in apoptosis rates in expanded islet cells infected at passages 3–5 with miR-375 or empty viral vectors, and analyzed 5 days later by TUNEL. [score:1]
A. miR-375 in-situ hybridization in human islets. [score:1]
Slides were hybridized with Dig-labeled Linked Nucleic Acid probes hsa-miR-375 (38181–15 LNA, Exiqon) and scramble-miR (99004–15 LNA) overnight at 57–58°C. [score:1]
Our findings suggest that it is modulated by miR-375 in human islet cells as well. [score:1]
Restoration of miR-375 resulted in a 2-fold decrease in transcripts encoding the mesenchymal markers N-cadherin and vimentin (Fig 2C), and a 3-fold increase in E-cadherin mRNA levels (Fig 2D), as well as a change in cell morphology (S1 Fig), suggesting the induction of mesenchymal-epithelial transition (MET). [score:1]
Bar = 75 μm for miR-375, 50 μm for scrambled probe. [score:1]
Immunofluorescence analysis of C-peptide and PDX1 in GFP-labeled expanded islet cells infected at passage 5 with miR-375 or empty viral vector. [score:1]
A. Proteomic profiling of sorted GFP [+] BCD cells infected at passages 4–6 with miR-375 or empty viral vectors. [score:1]
[1 to 20 of 90 sentences]
5
[+] score: 268
Other miRNAs from this paper: hsa-mir-22, hsa-mir-139, hsa-mir-652
Downregulation of Putative miR-375 Target Genes, 14-3-3zeta and SP1, was Associated with miR-375 Upregulation in DOX -induced Senescent K562 CellsTo further identify the targets of miR-375, published literatures were searched and 21 putative miR-375 target genes were found by using TargetScan, PicTar and miRanda algorithms (Table S2). [score:15]
It is therefore reasonable to hypothesize that downregulation of miR-375 results in enhanced expression of 14-3-3zeta and SP1 and provides a survival advantage for cancer cells, in contrast, upregulation of miR-375 diminishes the expression of 14-3-3zeta and SP1 and leads to cellular senescence. [score:11]
Upregulated miR-375 expression was associated with downregulated expression of 14-3-3zeta and SP1 genes. [score:11]
In cells transfected with has-anti- miR-375 inhibitor followed by 50 nM DOX treatment or transfected with has- miR-375 precursor, the expression of 14-3-3zeta and SP1 genes was inversely associated with the down- or up-regulated expression of miR-375 (Fig. 4B). [score:10]
Both miR-375 and its target genes, 14-3-3zeta and SP1, might be therapeutic targets, and either restoring miR-375 expression or abolishing expression of 14-3-3zeta and SP1 genes could diminish malignant cell behaviors and consequently block the progression of cancer. [score:9]
A recent study has also demonstrated that miR-375-down-regulated gastric carcinoma cell line treated with both 5-aza-2′-deoxycytidine and Trichostatin A could upregulate miR-375 expression and reduced the cell viability [40]. [score:9]
Downregulation of Putative miR-375 Target Genes, 14-3-3zeta and SP1, was Associated with miR-375 Upregulation in DOX -induced Senescent K562 Cells. [score:9]
Treatment with miR-375 inhibitor was able to reverse the proliferation ability suppressed by DOX (p<0.05) and overexpression of miR-375 suppressed the normal proliferation of K562 cells. [score:9]
Inhibition of miR-375 can Partially Reverse the Proliferation Ability Suppressed by DOX in K562 CellsTo explore the function of miR-375 in DOX -induced senescence, K562 cells were transfected with has-anti- miR-375 inhibitor or has-anti- miR-375 inhibitor scramble negative control followed by 50 nM DOX treatment for 5 days. [score:9]
Upregulation of miR-375 was Associated with Upregulated ATG9B and ATG18 in DOX -induced Senescent K562 Cells. [score:7]
To further identify the targets of miR-375, published literatures were searched and 21 putative miR-375 target genes were found by using TargetScan, PicTar and miRanda algorithms (Table S2). [score:7]
In this present study, we observed an association between upregulated miR-375 and downregulated 14-3-3zeta and SP1 genes. [score:7]
In the absence of p53 and p16-pRb, the induction of cellular senescence by DOX in K562 cells was found to be associated with upregulation of miR-375, downregulation of 14-3-3zeta and SP1 genes, and the initiation of autophagy. [score:7]
In summary, cellular senescence induced by DOX is associated with upregulated miR-375 expression and autophagy initiation in the absence of p16 and p53 genes. [score:6]
The expression of miR-375 after transfection was checked to confirm the transient knockdown of miR-375 by has-anti- miR-375 inhibitor (Figure 3C). [score:6]
Overexpression of miR-375 by has- miR-375 precursor transfection resulted in an elevated expression of ATG9B and of ATG18 with a similar patterns as observed in DOX -treated K562 cells (Figure 5 E and F). [score:5]
Over -expression of miR-375 was shown to suppress the normal proliferation of K562 cells. [score:5]
Expression of putative miR-375 target genes in DOX -induced senescent K562 cells. [score:5]
In our DOX -induced senescent K562 cells, treatment with miR-375 inhibitor could partially rescue the cellular proliferation suppressed by DOX. [score:5]
0037205.g004 Figure 4Expression of putative miR-375 target genes in DOX -induced senescent K562 cells. [score:5]
Transfection experiments of K562 cells with anti-miR™ has-miR-375 inhibitor (Ambion), anti-miR™ miRNA inhibitors negative scramble control (Ambion), 100 nM has- miR-375 precursor (Ambion), and 100 nM has- miR-375 precursor negative scramble control (Ambion) were carried out using siPORT NeoFX Transfection Agent (Ambion). [score:5]
Expression of human housekeeping genes, ACTB (β-actin), GAPDH (glyceraldehyde- 3-phosphate dehydrogenase), HPRT (hypoxanthine phosphoribosyltransferase), 18S (18S ribosomal RNA), TBP (TATA box binding protein) and POLR2A (RNA polymerase II polypeptide A) were evaluated and validated for normalizing RNA expression in real-time quantitative RT-PCR of senescence -associated genes and miR-375 target genes (Figure S2). [score:5]
Cells transfected with has-anti- miR-375 inhibitor followed by 50 nM DOX treatment for 5 days did not showed the fluctuated expression of ATG9B and ATG18 (Figure 5 C and D). [score:5]
The expression of mature miR-375 was increased at post has- miR-375 precursor transfection day 3 and persisted up to day 5. A decreased in cell proliferation followed by an increased in mature miR-375 expression was observed in has- miR-375 precursor -treated K562 cells (Figure 3F). [score:5]
To explore the function of miR-375 in DOX -induced senescence, K562 cells were transfected with has-anti- miR-375 inhibitor or has-anti- miR-375 inhibitor scramble negative control followed by 50 nM DOX treatment for 5 days. [score:5]
Inhibition of miR-375 can Partially Reverse the Proliferation Ability Suppressed by DOX in K562 Cells. [score:5]
Upregulation of miR-375 was Associated with Upregulated ATG9B and ATG18 in DOX -induced Senescent K562 CellsWith the observation that DOX treatment inducing cells senescence and the eventual cell death, the alternative mode of cell death, autophagy, was also investigated. [score:5]
The expression of senescence associated genes and putative miR-375 target genes were analyzed using TaqMan® system. [score:5]
The expression of these 21 genes in K562 cells treated with 50 nM DOX for 3 and 4 days were analyzed, and the expression levels of 14-3-3zeta, LDHB, and SP1 genes were found to be diminished (p<0.05) as miR-375 increased (Figure 4A). [score:5]
This study has demonstrated that in the absence of p53 and p16, the induction of senescence by DOX was associated with upregulation of miR-375 and autophagy initiation. [score:4]
Our results suggested that upregulation of miR-375 were associated with the induction of autophagy in the DOX -induced senescence. [score:4]
In fact, down-regulated miR-375 has been reported in various types of cancers, including prostate [41], oral and pharyngeal [42], head and neck [43], gastric [40], and hepatocellular [44] carcinomas. [score:4]
MicroRNA profiling revealed upregulated miR-375 in DOX -induced senescent K562 cells. [score:4]
0037205.g003 Figure 3 miR-375 is upregulated in DOX -induced senescent K562 cells. [score:4]
miR-375 is upregulated in DOX -induced senescent K562 cells. [score:4]
These results suggested that 14-3-3zeta and SP1 genes are the possible targets of miR-375 in DOX -treated senescent K562 cells. [score:3]
Recent studies have identified targets of miR-375 in various types of cancers, such as Yes -associated protein (YAP) in liver cancer [45], MTDH/AEG-1 in head and neck squamous cell carcinoma and hepatocellular carcinoma [46], [47], IGF1R and PDK1 in esophageal squamous cell carcinoma [48], [49], LDHB in maxillary sinus squamous cell carcinoma [50], JAK2, PDK1, and 14-3-3zeta in gastric cancer [40], [51], [52], and SP1 in cervical cancer [53]. [score:3]
In addition, identification of miR-375 targets should help us to further elucidate the alternative pathway that is responsible for the DOX -induced senescence in the absence of both p16 and p53 genes. [score:3]
The anti-proliferative function of miR-375 is possibly exerted, at least in part, by targeting 14-3-3zeta and SP1 genes. [score:3]
miR-375 was chosen for further study due to its consistently high overall expression in DOX -treated K562 cells. [score:3]
An increase of miR-375 expression in DOX -induced senescent K562 cells was also observed. [score:3]
The value of the has- miR-375 expression at day 0 is designated 1, and the levels of all other days of the same treatment are calibrated to this value. [score:3]
The expression of miR-375 remained to be the highest among the 4 miRNAs (Figure 3B). [score:3]
In contrast, the expression of LDHB was not affected by the levels of miR-375 (Fig. 4B). [score:3]
The gene names, GenBank accession numbers, and assay ID of gene expression assays or primer sequences of senescence -associated genes and putative miR-375 target genes are list in Table S1 and S2, respectively. [score:2]
The expression of mature has- miR-375 was examined by TaqMan® microRNA assays using real-time quantitative RT-PCR. [score:2]
Four most strongly expressed miRNAs, miR-375, miR-652, miR-22, and miR139-5p, were selected for further validation by using individual TaqMan® microRNA assays. [score:2]
It was significantly higher in cells transfected with has-anti- miR-375 inhibitor scramble negative control as compared to cells treated with DOX only (p<0.05). [score:2]
Table S2Oligonucleotide primers for real-time quantitative RT-PCR analysis of the putative miR-375 target genes. [score:2]
As shown in Figure 3D, in cells transfected with has-anti- miR-375 inhibitor, cell proliferation was partially restored when compared with untreated cells. [score:2]
Further study on the cellular senescence pathways regulated by miR-375 and the mechanism of autophagy initiated by DOX should provide insights for better cancer therapy. [score:2]
Based on these results, miR-375 could play a protective role in tumorigenesis and possibly through the induction of cell senescence. [score:1]
[1 to 20 of 52 sentences]
6
[+] score: 204
Other miRNAs from this paper: hsa-mir-21, hsa-mir-451a, hsa-mir-451b
Finally, we retained candidate genes that followed 3 criteria i) down-regulated in TT cells vs other cell lines and in silico predicted to be targeted by miR-375, ii) down-regulated in pre-miR-375 transfected Nthy-ori 3-1 cells, and iii) up-regulated in the antagomiR-375 transfected TT cells. [score:12]
We selected 22 predicted miR-375 target genes (Figure 3) that followed the expected profile in the context of MTC: down-regulated in premiRNA-375 transfected Nthy-ori 3-1 cells and up-regulated in the antagomiR-375 transfected TT cells (Suppl. [score:9]
Since a high expression level of miR-375 is only found in TT cells, we then selected a set of predicted miR-375 targets (TargetScan V6.0) [32] specifically under-expressed in the TT cell line (Suppl. [score:9]
Previously, miR-375 was found to be significantly down-regulated in various types of cancers, suppressing core hallmarks of cancer by targeting several important oncogenes, such as PDK1, JAK2, AEG-1 [40]. [score:8]
Thus we modulated the expression of the most up-regulated miRNA, miR-375, in different tumor cell lines and identified SEC23A as a bona fide miR-375 target in MTC through a combination of in silico and experimental approaches. [score:8]
In breast cancers, it has been reported that down-regulation of miR-375 by antisense RNA inhibited the proliferation of the breast cancer cell line MCF-7 without inducing apoptosis [41], while increased expression of hsa-miR-375 in normal breast epithelium resulted in a loss of cellular organization and acquisition of a hyperplastic phenotype [42]. [score:8]
We propose that miR-375 over -expression associated with SEC23A down-regulation could improve the efficacy of vandetanib in targeting of tumor cells, constituting an alternative route for controlling cell proliferation. [score:8]
In the present studied cohort of 62 MTC patients, we showed up-regulation of miR-375, -129, -10a, and down-regulation of miR-451 in tumor vs non-tumor tissues, overlapping with results produced by different previously published studies [20– 22, 37]. [score:7]
MiR-375 was the most up-regulated and miR-451 the most down-regulated. [score:7]
Down-regulation of SEC23A is a reliable marker of high miR-375 expression in MTC. [score:6]
MiR-375 was the most significant up-regulated miRNA in our cohort and its gradual increase in expression from non-tumor-adjacent tissue to hyperplasia to MTC was consistent with previous observations [21]. [score:6]
Down-regulated genes in Nthy-ori 3-1 pre-mir-375 versus control were selected based on a log2 average expression value superior or equal to 6, a log2 fold change value inferior or equal to −1, and an adjusted P-value inferior or equal to 0.05. [score:6]
In summary, we demonstrated that over -expression of miR-375 in MTC resulted in decreased SEC23A protein expression in tumor tissue. [score:5]
Using an approach combining transcriptome analyses of miR-375 activation and inhibition as well as data exploration of the Cancer Cell Line Encyclopedia (CCLE) transcriptome database, we established SEC23A as a reliable miR-375 target, in accordance with previous reports in prostate carcinomas [33, 39]. [score:5]
Because SEC23A has been validated as a miR-375 target in a human prostatic carcinoma cell line [33], we further validated SEC23A expression at the protein level in MTC by immunoblotting and immunohistochemistry. [score:5]
We also found that the miR-375 expression gradually increased with disease progression (Figure 1C), even after an adjustment for the percentage weight based on the estimation of the C-cell content by calcitonin and haematoxylin staining. [score:5]
We screened miR-375 expression in B-CPAP (papillary thyroid carcinoma cell line), Nthy-ori 3-1 (normal follicular immortalized thyroid cell line), 8505C (thyroid anaplastic carcinoma cell line) and TT thyroid cell lines (HMTC, RET MEN2A) and showed that miR-375 expression was indeed restricted to the TT cell line (Figure 2). [score:5]
As expected, the validation set yielded over -expression of miR-375 and under -expression of miR-451 in tumor vs non-tumor tissues (Figure 1B). [score:5]
Furthermore, we also found increased cell mortality in the presence of vandetanib, underscoring that SEC23A down-regulation is likely associated with the miR-375 -mediated sensitization of vandetanib (Figure 6). [score:4]
It may also be possible to hypothesize that miR-375 may act as passenger miRNA expressed at the same time as strong oncogenes that counteract the action of miR-375. [score:3]
Relative expression of miR-375 and miR-451 in tumor vs non-tumor tissue of 22 patients (11 HMTC, 11 SMTC). [score:3]
We performed miR-375 specific target gene profiling by analyzing the impact of transfection of either a miR-375 mimic or an antagomiR-375 on the transcriptome of Nthy-ori 3-1 control cells or TT cells, respectively. [score:3]
As expected, the SEC23A levels decreased after transfection with a miR-375 mimic (Figure 4A), while SEC23A expression was increased in TT cells transfected with the antagomiR-375, according to the microarray results. [score:3]
Identification of miR-375-target genes. [score:3]
Taken together, our data indicate that the expression levels of miR-375 or SEC23A may be good predictive indicators for better use of vandetanib in MTC. [score:3]
However, over -expression of miR-375 has also been reported in breast and prostate cancer [33, 39, 41– 43]. [score:3]
These opposing effects could be due to differences in the type of mRNA targeted by miR-375 of different tissues. [score:3]
Expression of miR-375 in Nthy-ori 3-1 cells decreased cell proliferation after 24h as shown by both a reduction in S/G2 of the cell cycle together with an increase in the percentage of cells in G1 (Suppl. [score:3]
In conclusion, these results suggested an inverse correlation between miR-375 and SEC23A expression in vitro and in vivo. [score:3]
Quantitative real-time RT-PCR was performed for the validation set to check for the expression of the 2 selected miRNAs of interest (miR-375 and miR-451), according to the manufacturer's protocol (Applied Biosystems, SD, CA). [score:3]
Quantitative real-time RT-PCR was then performed for the expression of the miR-375 as described earlier using normalization to the housekeeping miRNA RNU-19. [score:3]
Relative expression of miR-375 in non-tumor adjacent tissue, C-Cell hyperplasia and MTC of 6 patients bearing these pathologies in their thyroid. [score:3]
SEC23A expression is negatively associated with miR-375 levels in the thyroid. [score:3]
Differentially expressed genes were analyzed based on two contrasts, pre-miR-375 versus the pre-miR-CTL transfection in the Nthy-ori 3-1 cells and the antagomiR-375 transfection versus the CTL in the TT cells. [score:3]
Together, these results demonstrated that the miR-375/SEC23A axis acts as a regulator of thyroid tumor cell proliferation and synergistically potentiates the therapeutic effect of vandetanib. [score:2]
Using immunoblotting and immunohistochemistry, we confirmed the under -expression of SEC23A in the presence of miR-375 in TT cells and in MTC compared to non-tumor adjacent thyroid tissue. [score:2]
Interestingly, miR-375 over -expression synergistically increased the sensitivity of transfected cells to vandetanib, with a stronger decrease in cell proliferation associated with a large increase in dead cells in transfected cells compared to control cells. [score:2]
We further focused on miR-375 since it was, by far, the most differentially-regulated miRNA in MTC. [score:2]
In in vitro experiments, miR-375 over -expression resulted in a decrease in proliferation and an increase in apoptosis of the transfected cells compared to control cells. [score:2]
E. TT cells were seeded and transfected with antagomiR-375 (anti-miR-375) or antagomiR-CTL (anti-miR-CTL) for 24h and vandetanib was then added for 48h. [score:1]
Moreover, miR-375 transfected cells showed increased mortality as evidenced by a significant increase in the number of dead cells (Figure 5B) and in PARP cleavage (Figure 5C). [score:1]
At 72 h, this anti-proliferative effect was easily visualized by microscopy with a strong difference of confluence between miR-375 transfected cells and control cells (Figure 5A). [score:1]
Effect of miR-375 on proliferation and cancer drug response. [score:1]
C. Nthy-ori 3-1 cells were seeded and transfected with pre-miR-375 or pre-miR-CTL at 20pM for 24h and vandetanib was then added for 48h. [score:1]
Figure 5 A. Nthy-ori 3-1 cells were seeded and transfected with pre-miR-375 or pre-miR-CTL at 20pM for 24h and vandetanib was then added for 48h. [score:1]
Finally, we analyzed the impact of this miR-375/SEC23A axis on cell proliferation and viability especially in association with vandetanib, a clinically relevant cancer drug for treatment of metastatic MTC patients. [score:1]
Transfection of miR-375 sensitized the cells to the drug, as shown by a stronger decrease in proliferation and pronounced increase in dead cells (Figure 5A, 5B and 5C) (P-value 5 × 10 [−5]). [score:1]
Decreased proliferation and increased toxicity was observed in cells silenced for SEC23A, in line with the pro-apoptotic effect of miR-375. [score:1]
The synergistic effect (combination index CI < 1) on proliferation reached a maximum CI of 0.54 at the concentration of 2.5μM of vandetanib and 6.25μM of miR-375. [score:1]
Semi quantitative real-time PCR of miR-375 in thyroid cell lines. [score:1]
A. Nthy-ori 3-1 cells were seeded and transfected with pre-miR-375 or pre-miR-CTL at 20pM for 24h and vandetanib was then added for 48h. [score:1]
D. Nthy-ori 3-1 cells were seeded in 96-well plates and transfected with pre-miR-375 or pre-miR-CTL either at 6.25, 12.5, 25 pM for 24h and then treated with either 1.25, 2.5, 5μM vandetanib for 48h. [score:1]
Moreover, to demonstrate that endogenous levels of miR-375 were sufficient to mediate this effect, TT cells were transfected with antagomiR-375 and treated with the drug. [score:1]
TT cells were transfected with antagomiR-375 (anti-miR-375) or antagomiR-CTL (anti-miR-CTL) for 48h. [score:1]
A. Nthy-ori 3-1 were transfected with pre-miR-375 or pre-miR-CTL for 48h. [score:1]
Figure 4 A. Nthy-ori 3-1 were transfected with pre-miR-375 or pre-miR-CTL for 48h. [score:1]
4464076), and Nthy-ori 3-1 cells with pre-miR-375 (ref. [score:1]
Total RNA of TT or Nthy-ori 3-1 cells transfected for 48h with either pre-miR-CTL, pre-miR-375 or antago-miR-375 was extracted using the RNeasy kit (Qiagen, Hilden, Germany). [score:1]
The role of miR-375 in cancer is still unclear but the level is increased in several pathologies including MTC due to its anti-proliferative and sometimes pro-apoptotic action. [score:1]
For this, we generated a cell cycle-reporter (Nthy-ori 3-1 FUCCI-2A) cell line and transfected miR-375. [score:1]
[1 to 20 of 60 sentences]
7
[+] score: 198
On the other hand, down-regulation of miR-9 after induction into islet-like aggregates by lentivirus containing miR-375 could significantly increase cellular response to different concentrations of glucose by increasing OC-2 protein expression that may consequently lead to a decrease in levels of its target gene, granuphilin, which has negative role in insulin secretion. [score:8]
Effects of up-regulation of miR-375 and down-regulation of miR-9 on pancreatic markers. [score:7]
So, in this study, the researchers examined whether up-regulation of miR-375 and down-regulation of miR-9 could induce functional islet-like cellular aggregates differentiation in MSCs derived from human BM. [score:7]
To determine whether up-regulation of miR-375 in MSCs [miR-375] and down-regulation of miR-9 in MSCs [miR-375+anti-miR-9] groups affected pancreatic islet cell differentiation, immunostaining of insulin, glucagon, PDX1 and Ngn-3 was performed. [score:7]
However, in derived IPCs mediated by miR-375 over -expression and then miR-9 down-regulation (MSCs [miR-375+anti-miR-9] group), insulin and C-peptide secretion and content were enhanced by different concentrations of glucose from 5.5 to 25mM. [score:6]
To assess the effect of over -expression of miR-375 and down-regulation of miR-9 on pancreatic islet-like differentiation, the researchers performed DTZ staining in the MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups. [score:6]
miR-375 has been identified as a highly expressed miRNA in pancreatic islets which is involved in islet development [14], control of insulin gene expression and secretion [15]. [score:6]
Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development. [score:6]
It was found that over -expression of miR-375 led to a reduction in levels of Mtpn protein in derived IPCs, while treatment with anti-miR-9 following miR-375 over -expression had synergistic effects on MSCs differentiation and insulin secretion in a glucose-regulated manner. [score:6]
Effect of miR-375 over -expression and miR-9 down-regulation on differentiated IPCs functions. [score:6]
Expression levels of miR-375 and miR-9 on day 4 after transduction in tests and control groups by quantitative real-time PCR test indicated that the over- expression of miR-375 in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups increased mature miR-375 expression by 85-fold and 87-fold as compared with MSCs [null] and MSCs control groups respectively (p-value < 0.05 Fig 4A). [score:6]
Targeted inhibition of miR-375 in zebrafish resulted in major defects in pancreatic development and aberrant formation of the endocrine pancreas [14]. [score:6]
Taken together, these results further confirmed that miR-375 up-regulation contributes to islet-like aggregate differentiation of hMSCs and identifies this miRNA as one of the main factors that induces IPCs development. [score:5]
The results show, for the first time, that whereas derived IPCs by over -expression of miR-375 alone in MSCs were capable to express insulin and other endocrine specific transcription factors, the infected cells lacked the machinery to respond to glucose. [score:5]
Simultaneous over -expression of miR-375 and down- regulation of miR-9 had synergistic effect on MSCs differentiation and insulin secretion in a glucose-regulated manner. [score:5]
Based on some studies on miRNAs pattern, the researchers in this paper investigated the pancreatic differentiation of human bone marrow mesenchymal stem cells (hBM-MSCs) by up-regulation of miR-375 and down-regulation of miR-9 by lentiviruses containing miR-375 and anti-miR-9. After 21 days of induction, islet-like clusters containing insulin producing cells (IPCs) were confirmed by dithizone (DTZ) staining. [score:5]
Down-regulation of miR-9 in MSCs [anti-miR-9] and MSCs [miR-375+anti-miR-9] groups decreased mature miR-9 expression by 6-fold and 5- fold as compared with MSCs [null] and MSCs control groups respectively (p-value < 0.05. [score:5]
The protein expressions of target genes, Myotrophin and Onecut-2, were also detected after lentiviral mediated differentiation into IPCs in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups. [score:5]
Protein level of Mtpn was markedly reduced after miR-375 up-regulation. [score:4]
The obtained results indicate that miR-375 up-regulation could be an effective factor for in vitro differentiation of hMSCs into islet-like cellular aggregates and might be the initial step in producing pancreatic islets by means of miRNAs. [score:4]
According to the findings, over -expression of miR-375 in MSCs impaired glucose dependent insulin secretion by down -regulating Mtpn, a protein that is involved in modulation of insulin vesicle exocytosis from β-cells and which results in a defect in insulin exocytosis. [score:4]
The role of miR-375 in pancreas development and islet integrity was revealed from knockdown experiments during zebrafish embryonic development [14]. [score:4]
The results revealed that all genes were expressed 7 days after infection and maximum levels of transcripts were detected on day 14 after induction and then gradually decreased in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups. [score:3]
It was found that miR-375 and miR-9 were strongly expressed in human BM-MSCs. [score:3]
Although derived IPCs by miR-375 alone were capable to express insulin and other endocrine specific transcription factors, the cells lacked the machinery to respond to glucose. [score:3]
Western blot analysis and the role of miR-375 in Myotrophin protein expression. [score:3]
miR-375 was involved in insulin secretion by Mtpn targeting. [score:3]
0128650.g008 Fig 8Western blot analysis detected expressions of insulin (5KD), glucagon (46KD), PDX1 (31KD) and Ngn3 (23KD) in differentiated IPCs (1) MSCs [miR-375] and (2) MSCs [miR-375+anti-miR-9] (3) MSCs [control]. [score:3]
On the other hand, investigations revealed that miR-375 has inhibitory role in glucose-stimulated insulin secretion (GSIS) [16] through targets myotrophin (Mtpn), a protein involved in insulin granule fusion [15, 17]. [score:3]
G (containing VSV-G gene) and hsa-mir-375 (containing the CMV and SV40 promoters) (Applied Biological Materials, Canada, mh10566) inhibitor hsa-III-miR-9-off (abm. [score:3]
In recent studies, the over -expression of miR-375 in murine pancreatic β-cell line (MIN6) resulted in a decrease in glucose dependent insulin secretion. [score:3]
In addition western blot analysis also confirmed pancreatic endocrine expressions after induction in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups (Fig 8). [score:3]
Despite insulin gene and protein expression, no response to glucose in derived IPCs by miR-375 lentivirus was detected. [score:3]
Western blot analysis detected expressions of insulin (5KD), glucagon (46KD), PDX1 (31KD) and Ngn3 (23KD) in differentiated IPCs (1) MSCs [miR-375] and (2) MSCs [miR-375+anti-miR-9] (3) MSCs [control]. [score:3]
Although the roles of miR-375 and miR-9 are well known in pancreatic development and insulin secretion, the use of these miRNAs in transdifferentiation was never demonstrated. [score:2]
Moreover, although the roles of miR-375 and miR-9 are well known in pancreatic development and insulin secretion, the use of these miRNAs in transdifferentiation was never demonstrated. [score:2]
On the other hand, functional knockdown of miR-375 in mice by using 2'-o-methyl antisense oligonucleotides had a converse effect and increased the insulin secretion in response to glucose [45]. [score:2]
miR-375 up regulation alone may not responsible for the cell responsive to glucose challenge. [score:2]
As expected, when hMSCs cells were treated with empty lentiviruses, miR-375 and miR-9 expression levels showed no significant alteration as compared to MSCs control group. [score:2]
In conclusion, we have shown that hMSCs can be induced by miR-375 and/or anti-miR-9 to differentiate into mature islet like clusters. [score:1]
Changes in transcript levels of miR-375 and miR-9 after infection. [score:1]
Measuring the expression levels of miR-375 and miR-9 by qRT-PCR. [score:1]
The lentivirus miR-375 and anti-miR-9 were generated from the co-transfection of 70–80% confluent HEK 293T cells with lentiviral packaging plasmids, psPAX2 (containing gag and pol genes), pMD2. [score:1]
Mtpn: (A) Control hMSCs (B) MSCs [miR-375] (C) MSCs [miR-375+anti-miR-9]. [score:1]
It was reported for the first time that miR-375 has essential role in MSCs differentiation into IPCs, while anti-miR-9 lentiviruses separately didn’t have any effect on MSCs differentiation into IPCs and subsequently insulin secretion. [score:1]
Therefore, the cells in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups were selected for further studies. [score:1]
Western blot results indicated that protein level of Myotrophin was markedly reduced in MSCs infected with miR-375 lentivirus. [score:1]
hMSCs transfected with lentivirus carrying miR-375 gene and/or anti-miR-9, control cells with empty lentivirus and hMSCs without any treatment were plated at a density of 10 [6] cells per well in a 6-well plate and maintained in culture media for 21 days. [score:1]
Spindle shaped and fibroblast-like cells (D0) were induced to islet-like cluster formation by miR-375 and/or anti-miR-9 transduction in 21 days. [score:1]
Granuphilin: (A) MSCs [miR-375+anti-miR-9] (B) MSCs [miR-375] (C) Control hMSCs, OC-2: (A) Control hMSCs (B) MSCs [anti-miR-9] (C) MSCs [miR-375+anti-miR-9]. [score:1]
detected nuclei localization of PDX1, Ngn3, and cytoplasmic localization of insulin, and glucagon in differentiated IPCs by (A) MSCs [miR-375] and (B) MSCs [miR-375+anti-miR-9] on day 21. [score:1]
2 as well as GLUT2 were observed in mature D14 IPCs in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups in comparison to undifferentiated hMSCs (p-value < 0.05). [score:1]
The researchers used control MSCs (MSCs [control]) without any treatment to compare the effects of empty vectors without carrying miR-375 and miR-9 on cell lineage decisions. [score:1]
The researchers tested whether miR-375 and/or anti-miR-9 lentiviruses infected cells were able to produce, store and secret insulin. [score:1]
During 2 weeks, the round cells became aggregate and some new islet-like clusters began to appear in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups but they were not observed in MSCs [anti-miR-9] (Fig 3). [score:1]
Significant amounts of insulin and C-peptide were obtained in MSCs [miR-375+anti-miR-9] group. [score:1]
The cells were transduced with miR-375 and/or miR-9 lentivirus and empty virus at a multiplicity of infection (MOI) of 10. [score:1]
The maximum levels of SOX-17 in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups were 563-and 419- fold and HNF-3 beta/FoxA2 transcripts were 123- and 163- fold respectively and they were identified by day 7 in comparison to undifferentiated hMSCs (Fig 5). [score:1]
By contrast, insulin content and secretion were enhanced by increasing glucose concentrations from 5.5 to 25mM in MSCs [miR-375+anti-miR-9]. [score:1]
0128650.g003 Fig 3 Spindle shaped and fibroblast-like cells (D0) were induced to islet-like cluster formation by miR-375 and/or anti-miR-9 transduction in 21 days. [score:1]
0128650.g007 Fig 7Immunofluorescence analysis detected nuclei localization of PDX1, Ngn3, and cytoplasmic localization of insulin, and glucagon in differentiated IPCs by (A) MSCs [miR-375] and (B) MSCs [miR-375+anti-miR-9] on day 21. [score:1]
Upon exposure to miR-375 and anti-miR-9 lentiviruses and serum free media, the adherent, spindle-like cells turned round and assembled together. [score:1]
Moreover, differentiated MSCs by miR-375 and anti-miR-9 lentiviruses simultaneously secreted insulin and c-peptide in a glucose -induced manner. [score:1]
The researchers used the same tracer (GFP) for MSCs [miR-375] and MSCs [anti-miR-9]. [score:1]
Differentiated MSCs with miR-375 lentivirus (MSCs [miR-375] group) didn’t have any response to various concentrations of glucose and no insulin and C-peptide were detected in this group (p-value > 0.05). [score:1]
0128650.g009 Fig 9Granuphilin: (A) MSCs [miR-375+anti-miR-9] (B) MSCs [miR-375] (C) Control hMSCs, OC-2: (A) Control hMSCs (B) MSCs [anti-miR-9] (C) MSCs [miR-375+anti-miR-9]. [score:1]
0128650.g002 Fig 2 (A) The results of miR-375 and anti-miR-9 transduction examined by fluorescent microscopy (X100). [score:1]
The study was performed in four groups; one group of cells was transduced with hsa-miR-375 lentiviruses carrying GFP (MSCs [miR-375]), another was infected with hsa-miR-9-off lentiviruses carrying GFP (MSCs [anti-miR-9]) (in this group the cells were briefly infected with hsa-miR-375 lentivirus and 7 days later the cells were exposed to hsa-miR-9-off lentivirus), the third was infected with both miRNAs (MSCs [miR-375+anti-miR-9)]) and the forth group was transduced with pLenti-empty lentiviruses carrying GFP (MSCs [null]). [score:1]
[1 to 20 of 68 sentences]
8
[+] score: 176
These results suggest a role of miR-375 in angiogenesis via downregulation of IGF1R since IGF1R upregulates angiogenesis [16]. [score:7]
These results suggest that AE may block angiogenesis via upregulating miR-375 which, in turn, downregulates IGF1R. [score:7]
Expression of candidate miRs that are upregulated (miR-27a and miR-195a) or down regulated (miR-10b, miR-375, miR-let7a, miR-let7c, miR-146a) in OC was assessed using RT-qPCR. [score:7]
MiR-375 inhibits cancer cell proliferation, invasion, and cell motility [25] and its expression is downregulated in ovarian cancer [37], gastric cancer [42], head and neck squamous cell carcinoma [43], and pharyngeal squamous cell carcinoma [44]. [score:7]
Principal findings of these studies show that AE caused more than 2000-fold increase in miR-375 expression and down regulated the expression of IGF1R and SNAIL1 in OC cells. [score:6]
Conversely, the expression of miR-375 is upregulated in ERα -positive breast cancer [45], lung adenocarcinoma patients [46] and prostate cancer patients [47]. [score:6]
Addition of AE (24 h) to cells transfected cells with miR-375 inhibitor caused a significant decrease in mRNA (P=0.014; Figure 4H) and protein (P≤0.001; Figure 4I and 4J) expression of IGF1R. [score:5]
To study the effect of AE, miR-375 inhibitor -transfected cells after 24 h of transfection were incubated with AE for additional 24 h. The cells were then processed to determine the expression of the genes and proteins. [score:5]
The release of miR-375 in exosomes, the down regulation of IGF1R, SNAIL1 and upregulation of E-cadherin suggest a likely effect of AE on the interaction between cancer cells and their environment. [score:5]
H. RT-qPCR results (fold change) show that AE blocks the effect of transfected miR-375 inhibitor on IGF1R gene expression in S KOV3 cells at 24 h. I. Immunostaining for IGF1R in S KOV3 cells transfected with anti-hsa-miR-375 miScript miRNA with (400 μg/mL) and without AE. [score:5]
In vitro experiments using S KOV3 cells show that AE upregulated miR-375 and adhesion protein E-cadherin but down regulated insulin-like growth factor 1 receptor (IGF1R) and epithelial-mesenchymal transition (EMT) factor SNAIL1. [score:5]
Figure 9Schematic of the proposed mechanism of action of E. officinalis on angiogenesis in OC In conclusion, this study indicates for the first time that AE inhibits growth of OC cells in vitro and in vivo, perhaps through the activation of miR-375 and by targeting the pro-angiogenic IGF1R and SNAIL1. [score:5]
MiR-375 regulates the expression of several target proteins including IGF1R [15]. [score:5]
AE -induced increase in the expressions of miR-375 and E-cadherin may attenuate EMT by targeting SNAIL1 in S KOV3 cells. [score:5]
Some cells were transfected with Anti-hsa-miR-375 miScript miR Inhibitor (MIMAT0000728: 5′UUUGUUCGUUCGGCUCGCGUGA3′, 2 μg; Life Technologies, Thermo Fisher Scientific, Carlsbad, CA) (miR-375 inhibitor). [score:5]
S KOV3 cells were transfected with miR-375 inhibitor for 24 h. Fluorescence microscopy at 48 h revealed an even distribution of miR-375 inhibitor in S KOV3 cells (Figure 4G) with approximately 70% transfection efficiency. [score:5]
Decreased AKTP in AE treated cells suggests that downregulation of AKT phosphorylation by miR-375 mediates the effect of AE. [score:4]
Additional experiments showed that total exosomal protein and miR-375 secreted with exosomes were upregulated following AE treatment. [score:4]
SNAIL1 is a transcriptional repressor of E-cadherin in epithelial cancer cells and downregulates miR-375 [52]. [score:4]
Epigenetic silencing of miR-375 causes the upregulation of IGF1R [48]. [score:4]
AE upregulates miR-375 in exosomes from S KOV3 cells. [score:4]
Table 1 shows changes in the expression of miR-27a, miR-195a, miR-10b, miR-375, miR-let7a, miR-let7c, miR-146a. [score:3]
These results suggest that AE strongly induces the expression of miR-375 in OC cells. [score:3]
Ectopic insertion of miR-375 resulted in a significant reduction of IGF1R expression and its downstream signaling molecule AKT at both mRNA and protein levels in other cancer cell lines [15]. [score:3]
MiR-375, expressed in many tissues including the ovary [37], was initially found to play an essential role in pancreatic islet development [38]. [score:3]
Therefore, changes in the expression of exosomal protein and miR-375 after AE treatment were determined. [score:3]
In vivo effects of AE on tumor growth and on miR-375 target IGF1R (promotes proliferation and growth), SNAIL1 (promotes EMT) and E-cadherin (opposes EMT) were assessed to confirm in vitro findings. [score:3]
Previous experiments showed that AE induces a significant increase in the expression of miR-375 in S KOV3 cells. [score:3]
AE increases the expression of miR-375 in S KOV3 cells. [score:3]
G. Representative image of transfected fluorescent anti-hsa-miR-375 miScript miRNA inhibitor in S KOV3 cells at 24 hour. [score:3]
These observations suggest that miR-375 may function as a suppressor of certain tumors. [score:3]
AE increases the expression of miR-375 in ovarian cancer cells as well as in exosomes in the medium. [score:3]
With variable low effect on other miRs analyzed, AE treatment caused a >14-fold and >2000-fold increase in the expression of miR-375 at 24 h and 48 h, respectively (Figure 4A). [score:3]
We determined the effect of AE on several miRs associated with OC and found a 2000-fold increase in miR-375 expression in S KOV3 ovarian cancer cells within 48 hours. [score:3]
In the present study we found that AE treatment increased miR-375 and E-cadherin but decreased SNAIL1 expression in S KOV3 cells and in the mouse xenograft. [score:3]
miR-375 blocks the expression of IGF1R. [score:3]
S KOV3 cells (3×10 [5]) at 70% confluency were divided into untreated control, miR-375 inhibitor -treated and miR -negative control groups. [score:3]
M. MiR-375 expression in exosomes of control and E. officinalis treated S KOV3 cells (48 h). [score:2]
MiR-375 suppresses malignant behavior of other cancer cells through the AKT signaling pathway [28]. [score:2]
A. RT-qPCR results showing a >2000-fold increase in miR-375 gene expression (48 h) in S KOV3 cells treated with AE compared to untreated control cells. [score:2]
IGF1R, a receptor for insulin-like growth factor, is regulated by miR-375 [15]. [score:2]
SNAIL1 also down regulates miR-375 [25]. [score:2]
Recently, miR-375 was identified as an important regulator in tumorigenesis and cancer progression [41]. [score:2]
AE appears to modulate the effect of OC cells on tumor microenvironment as shown by an increased release of exosomes containing miR-375 from S KOV3 cells. [score:1]
Thus, the C [T] number for detecting miR-375 was 39.12±2.56, 33.97±0.76 and 26.44±0.25 in untreated control and cells treated with AE for 24 h and 48 h, respectively (Figure 4L). [score:1]
Thus, these results suggest that miR-375 released from AE -treated OC cells modifies tumor microenvironment to attenuate cancer progression. [score:1]
Present data demonstrate that AE increases intracellular miR-375 and induces the release of exosomal miR-375. [score:1]
The interaction between miR-375 and SNAIL1 is a subject for separate future studies. [score:1]
Cells were incubated with AE (400 μg/mL) for 24 or 48 h. With a modest increase at 24 h, levels of miR-375 increased by 2207-fold at 48 h. Other microRNAs had relatively less effect at either time point. [score:1]
[1 to 20 of 49 sentences]
9
[+] score: 166
In addition, miR-375 was shown to suppress ERBB2 expression by directly targeting the 3′-UTR of ERBB2, and overexpression of miR-375 was shown to partially inhibit gastric cancer cell proliferation through the ERBB2 pathway. [score:12]
When the cells were cotransfected with the ERBB2 expression vector and miR-375 mimic, the cell proliferation ability was partially restored, as compared with the control, indicating that miR-375 overexpression mediates the suppression of cell growth through inhibiting ERBB2 expression. [score:10]
Thus, to explore the association between reduced miR-375 expression levels and ERBB2 overexpression, miR-375 targets were predicted using the online bioinformatic tools, TargetScan (http://www. [score:9]
Compared with the corresponding control, the level of ERBB2 protein expression was significantly suppressed by miR-375 mimic and upregulated by miR-375 inhibitor (Fig. 2D). [score:9]
These results indicate that miR-375 suppresses gene expression by binding to the seed sequence at the 3′-UTR of ERBB2, thus, ERBB2 may be a direct target of miR-375. [score:8]
Thus, BGC-823 cells were transfected with miR-375 mimic or inhibitor to determine whether the dysregulation of miR-375 expression affected endogenous ERBB2 expression. [score:8]
Although ERBB2 was identified as a target gene for miR-375, whether miR-375 regulated endogenous ERBB2 expression was unknown. [score:6]
Furthermore, luciferase activity was significantly upregulated by ~21.7% (P<0.05) with the miR-375 inhibitor, as compared with the anti-miR control. [score:5]
Therefore, miR-375 is a candidate tumor suppressor miRNA molecule in gastric cancer and may be a potential clinical classification marker and therapeutic target for human gastric cancer. [score:5]
miR-375 overexpression suppresses gastric cancer cell proliferation. [score:5]
These results indicate that miR-375 targets the 3′-UTR of ERBB2, leading to a change in firefly luciferase translation. [score:5]
According to the results of the online prediction, miR-375 targets ERBB2 directly. [score:4]
miR-375 regulates endogenous ERBB2 expression in human gastric cancer cells. [score:4]
The results demonstrated that miR-375 was downregulated in almost all the gastric cancer tissues. [score:4]
miR-375 is downregulated in gastric cancer tissues, particularly ERBB2 -positive tissues. [score:4]
Tissue miR-375 expression levels were analyzed using the Mann-Whitney U-test. [score:3]
Luciferase reporter vectors were cotransfected with miR-375 mimic or miR-375 inhibitor using Lipofectamine 2000. [score:3]
In addition, miR-375 expression levels were markedly reduced in ERBB2 -positive gastric cancer tissues (Fig. 1C). [score:3]
Human gastric adenoma BGC-823 cells were cotransfected with pGL3-ERBB2 and miR-375 mimic or inhibitor (Fig. 2B). [score:3]
In the present study, the expression levels of miR-375 were detected in 30-paired cases of normal and gastric cancer tissue samples. [score:3]
Mutant miR-375 target sites in the 3′-UTR of ERBB2 were used as corresponding controls. [score:3]
RNA extraction and miR-375 expression detection. [score:3]
The expression level of miR-375 was detected using TaqMan miRNA quantitative PCR. [score:3]
miR-375 was first identified in murine pancreatic β-cells and the expression was also shown to be enriched in human pancreatic islet cells. [score:3]
A number of studies have revealed that the expression of miR-375 is reduced in several human cancers, including head and neck squamous cell carcinoma, esophageal cancer and hepatocellular carcinoma (10– 12). [score:3]
Low expression levels of miR-375 were first reported by three studies in 2010 (9, 13, 14), which hypothesized that miR-375 was associated with gastric carcinogenesis. [score:3]
Quantitative PCR analysis was used to determine the relative expression levels of miR-375. [score:3]
The results of the present study indicate that ERBB2 expression level detection, associated with quantified miR-375, may be used to enhance the accuracy of clinical gastric cancer classification (16). [score:3]
Quantitative PCR was used to compare the expression levels of miR-375 among 30 cases of normal and gastric cancer tissue samples. [score:3]
ERBB2 is the target gene of miR-375. [score:3]
An miR-375 mimic and inhibitor were synthesized by Shanghai GenePharma Co. [score:3]
Notably, the expression level of miR-375 was significantly lower in ERBB2 -positive gastric cancer tissues as compared with ERBB2 -negative gastric cancer tissues. [score:2]
For the majority of cases, the expression level of miR-375 was significantly decreased in the gastric cancer tissues when compared with the corresponding non-cancerous tissues (Fig. 1A and B). [score:2]
Compared with the miRNA control, luciferase activity was significantly suppressed with miR-375 by ~34.5% (P<0.05). [score:2]
A seed sequence mutation clone was also used to further confirm the binding site for miR-375 (Fig. 2A). [score:2]
BGC-823 cells that had been transfected with miR-375 demonstrated a lower capacity of proliferation compared with cells that had been transfected with the miRNA control, indicating that miR-375 suppresses gastric cancer cell proliferation. [score:2]
However, miR-375 is not a tissue specific molecule, as it has also been detected in other tissues, including the brain and lungs, where it is important for maintaining normal function. [score:1]
A putative miR-375 binding region in the 3′-UTR of ERBB2 with four mutant nucleotides (pGL3-ERBB2-Mu) and the pGL3 empty vector were used as controls. [score:1]
In conclusion, the present study has partially clarified the associations between miR-375 and ERBB2 -positive gastric cancer. [score:1]
To the best of our knowledge, this is the first study to demonstrate that miR-375 is associated with ERBB2 -positive gastric cancer. [score:1]
For miR-375 detection, 30-paired gastric tissue samples were collected (cancer lesions and adjacent non-tumor mucosae) from patients that had undergone gastrectomy at Renji Hospital (Shanghai, China) from March 2011 to January 2013. [score:1]
To further investigate whether miR-375 exhibits tumor-suppressive functions by targeting ERBB2, the effect of ERBB2 on miR-375 -mediated cell proliferation was investigated. [score:1]
In addition, previous studies have indicated that miR-375 may be one of the most important miRNAs involved in the progression of gastric cancer (13, 14). [score:1]
Each sample was measured in triplicate for the detection of miR-375 expression. [score:1]
The cells were then transfected with miR-375 mimic or miR-375 mimic plus pcDNA3.1-ERBB2, with nonsense short RNA and miR-375 plus pcDNA-3.1 used as controls. [score:1]
Therefore, in the present study, the expression and mechanisms of miR-375 were investigated in gastric cancer with the aim of providing a novel candidate for the diagnosis and treatment of human gastric cancer. [score:1]
[1 to 20 of 46 sentences]
10
[+] score: 140
Thus, miR-375 inhibitor probably first modulate translation repression induced by miR-375, while an increase in E6Fl mRNA expression would require much longer exposure to miR-375 inhibitor. [score:9]
Altogether, these data show that global DNA demethylation by 5azadC upregulates miR-375 expression, which consequently likely leads to destabilization of HPV16 transcripts and loss of E6 protein expression. [score:8]
The weaker effect of miR-375 inhibitor on E6Fl mRNA compared to the effect on protein expression could be related to the mechanisms by which miRNAs regulate gene expression. [score:7]
Furthermore, miR-375, a tumor suppressor miRNA known to target HPV16 E6/E7 mRNA [24] is downregulated in cervical carcinomas compared to normal tissues or precancerous lesions [25, 26] thanks to promoter methylation [27]. [score:7]
Interestingly, after 5azadC exposure, the miR-375 expression was upregulated 7.4-fold and 2.2-fold in CaSki and SiHa cells respectively (Figure 5B). [score:6]
Interestingly, we observed that the miR-375 inhibitor restored E6Fl mRNA expression in 5azadC -treated cells, from 0.65 to 0.86 in Ca Ski cells and from 0.51 to 0.61 in SiHa cells (Figure 5C). [score:5]
Furthermore, Liu et al. recently showed that E6 participates in the silencing of miR-375 expression through overexpression of DNMT1, which in turn methylates miR-375 promoter [52]. [score:5]
During the last 24h, cells were transfected with miRIDIAN microRNA Human miR-375 hairpin inhibitor (IH-3006882-07) or miRIDIAN miRNA Hairpin Inhibitor Negative Control (IN-001005-01) (Dharmacon, GE Healthcare, LaFayette, USA) at 200 nM with Lipofectamine 2000 (Invitrogen, Villebon sur Yvette, France) according to the manufacturer's recommendations. [score:5]
The miR-375 exhibits tumor suppressor activity through inhibition of proliferation, invasion and motility [44]. [score:5]
Our results are consistent with those recently published by Stich et al. who also reported a 2- to 3-fold reduction in miR-375 promoter methylation following the treatment of HPV16 -positive cell lines with 5azadC [30], an observation consistent with a direct effect of this demethylating agent on miR-375 up-regulation. [score:5]
Moreover, the use of miR-375 inhibitor supported a role for miR-375 in the repression of E6 by 5azadC since it reverses the effect of the demethylating agent on E6 expression. [score:5]
This would explain why E6 expression is not totally rescued following miR-375 inhibitor treatment. [score:5]
Recently, it was reported that miR-375 mimics induced the suppression of E6 expression in HPV positive cell lines [24, 30]. [score:5]
Rather, we evidenced a destabilization of E6 mRNA thanks to miR-375 upregulation. [score:4]
As shown in Figure 5E, miR-375 inhibitor transfection induced an increase of 1.52- and 1.35-fold in E6 expression in Ca Ski and SiHa cells respectively compared to control cells at the limit of significance (p=0.06). [score:4]
Interestingly, Wilting et al. and Stich et al. have demonstrated that the treatment of HPV16 positive cervical and head and neck cancer cell lines by 5azadC led to miR-375 promoter demethylation, an observation consistent with a direct effect of 5azadC in miR-375 overexpression [27, 30]. [score:4]
miR-375 is involved in the decrease of E6 expression. [score:3]
Suppression of miR-375 activity. [score:3]
Experiments addressed the role of miR-375 only, but other miRNAs (miR-122, miR-875 and miR-3144) have been shown to repress the expression of E6/E7 transcripts [53, 54]. [score:3]
These data are consistent with those obtained by Jung et al. and Stich et al. who used miR-375 mimic to repress the expression of E6/E7 RNA and E7 protein in HPV16 positive carcinoma cell lines [24, 30]. [score:3]
Figure 5 (A, B) miR-375 relative expression was quantified by RT-qPCR and normalized to U6 snRNA level in C33A, Ca Ski, SiHa and U2OS cells (A) and in Ca Ski and SiHa cells (B) treated or not with 0.25 μM of 5azadC for 96h. [score:3]
In the absence of 5azadC, no significant change was observed in E6Fl mRNA level after addition of miR-375 inhibitor (Figure 5C) while the corresponding protein was increased (Figure 5D). [score:3]
Consistent with these observations, a 2.2 to 7.4-fold increase in miR-375 expression was observed in 5azadC -treated SiHa and Ca Ski cells, respectively, suggesting that miR-375 could play a role in E6 mRNA destabilization. [score:3]
Cells were transfected with miRIDIAN microRNA negative control or miR-375 inhibitors at 200 nM during the last 24h. [score:3]
To confirm the implication of miR-375 in HPV16 transcript repression, the effect of a miR-375 inhibitor was tested in HPV16 positive cells. [score:3]
Demethylation induces an increased expression of miR-375 which correlates with E6 RNA destabilization and protein loss. [score:3]
In this report, we confirmed that the treatment with a demethylating agent increases the expression of miR-375 in SiHa cells and to a greater extent in Ca Ski cells. [score:3]
Recently, several studies reported an aberrant expression profile of 341 miRNAs [22] in HPV -associated carcinomas and the detection of miR-424/miR-375/miR-218 from cervical smears has been proposed for cervical cancer screening [23]. [score:3]
Then, the E6Fl protein rescue was estimated in cells transfected with the miR-375 inhibitor in the presence or not of 5azadC. [score:3]
Thus, miR-375 promoter methylation may be one strategy developed by HPV16 to allow efficient and sustained expression of E6/E7 oncogenes to functionally inactivate anti-proliferative and anti-apoptotic signaling pathways. [score:3]
Recently, miR-375 has been shown to negatively regulate E6/E7 transcripts in HPV16 positive carcinoma cell lines [24, 30]. [score:2]
miR-375 expression was normalized by the endogenous control U6 snRNA (Primers: Table 1) using the 2 [−ΔΔCt] method. [score:2]
As shown in Figure 5A, miR-375 expression was low in Ca Ski and SiHa cells compared to the HPV negative cervical cancer cell line C33A or to the osteosarcoma cell line U2OS. [score:2]
To determine whether miR-375 level was modulated after DNA demethylation, RT-qPCR was performed in HPV16 positive cells treated or not with 5azadC. [score:1]
Additional studies on RISC composition and function following 5azadC treatment could help to better understand the role of miR-375 in E6 repression. [score:1]
Quantification of miR-375. [score:1]
[1 to 20 of 36 sentences]
11
[+] score: 117
Data suggest N-myc inhibits neuronal differentiation of neuroblastic cells possibly by upregulating miR-375 which, in turn, suppresses HuD. [score:8]
The expression of miR-375 is associated with tumorigenic neuroblastic cell phenotype and we report that its expression is regulated by N-myc. [score:6]
Moreover, miR-375 downregulates expression of the neuronal-specific RNA binding protein HuD. [score:6]
Expression of miR-375 is exclusive for N-myc -expressing neuroblastic cells and is regulated by N-myc. [score:6]
miR-375 expression levels in N- myc -expressing cells are ~4-fold higher compared to non -expressing cells. [score:6]
We next screened target prediction sites for miR-375 target genes to identify possible partners involved with malignancy and differentiation in NB. [score:5]
To determine whether this miRNA is involved in post-transcriptional regulation of HuD, BE(2)-C cells were transiently transfected with miR-375 inhibitor or negative control: miR-375 levels were reduced by ~95% (P < 0.05) and HuD protein levels increased 2.9-fold (P < 0.01) in inhibitor -treated cells compared to control (Figure 7C, D). [score:5]
Therefore, in N- and I-type cells, high miR-375 levels may suppress neuronal differentiation by targeting HUD and thereby maintain the cells in a less differentiated, more proliferative, state. [score:5]
Supporting its role as a tumorigenic miRNA in neuroblastoma, increased expression of miR-375 is associated with patients with unfavorable outcome and metastatic dissemination [17] and miR-375 is one of the ten miRNAs whose increased expression is associated with advanced stage neuroblastoma [31]. [score:5]
Thus, miR-375 appears to down regulate HUD expression. [score:4]
Therefore, expression of miR-375 might be regulated by N-myc. [score:4]
This oncoprotein regulates gene expression by binding to E-box sequences (CACGTG) and the promoter region of the miR-375 gene contains several cis-acting elements, including two conserved non-canonical E-box sequences which are essential for optimal activity [27]. [score:4]
Figure 6 miR-375 expression is regulated by N-myc. [score:4]
N-myc regulates expression of miR-375. [score:4]
A recent study showed that down regulation of HuD by miR-375 inhibits neuronal differentiation [30]. [score:4]
Conversely, N- myc sense transfectants of N- myc non-amplified SH-SY5Y cells, which have a 1.8-fold increase in N-myc protein [28], have a 5-fold increase in expression of miR-375 (Figure 6B). [score:3]
MiR-375 downregulates HuD, a gene involved in neuronal differentiation. [score:3]
D. Representative western blot of HuD protein levels in miR-375 -inhibitor and control oligo -treated BE(2)-C cells. [score:3]
Expression levels of two miRNAs, miR-124 and miR-375, were higher in the neuroblastic phenotype (Figure 2D and E). [score:3]
Neuroblastic cells express both N-myc [3] and miR-375 (Figure 2B and Figure 5A). [score:3]
The second miRNA associated with a neuroblastic lineage, miR-375, is expressed at similar levels in both N- and I-cells while being barely detectable in S-type cells (Figure 2E). [score:3]
miRNA inhibitors for miR-375, miR-335, and control oligos (100 nM) (Ambion, Austin, TX) were transiently transfected into BE(2)-C or SH-EP1 cells for 48 hrs using Lipofectamine 2000 (Invitrogen Corp. [score:3]
C. Chromatin immunoprecipitation analysis of N- myc regulation of miR-375. [score:2]
HuD is regulated by miR-375. [score:2]
C. Relative levels of miR-375 and HuD protein in miR-375 inhibitor -treated BE(2)-C cells compared to control oligo -treated cells. [score:2]
Three additional miRNAs, all showing higher expression in N compared to I cells— miR-124, miR-375 and miR-10b ― were selected for further analysis. [score:2]
Similarly, miR-375 levels in I cells treated with BrdU decrease ~ 50-fold (P < 0.01) (Figure 3B). [score:1]
This experiment also shows that RNA Polymerase II is associated with the promoter region of miR-375 in BE(2)-C cells (Figure 6C). [score:1]
ChIP experiments confirmed that N-myc binds to one of two E-box sequences in the promoter region of the miR-375 gene (Figure 6C). [score:1]
B. Conservation of the miR-375 binding site in 3’-UTRs of ELAVL4 mRNA across different species. [score:1]
validation confirmed that increased levels of miR-21, miR-221 and miR-335 are associated with the non-neuronal phenotype, whereas increased levels of miR-124 and miR-375 are exclusive to neuroblastic cells. [score:1]
Moreover, I-type stem cells differentiated to S-cells have barely-detectable levels of N-myc [3] and miR-375 (Figure 3A). [score:1]
Figure 7 MiR-375 regulates HUD. [score:1]
The HuD 3’-UTR has a 7-mer miR-375 binding site (Figure 7A), which is highly conserved among species (Figure 7B). [score:1]
The >2-fold decrease in N-myc correlated with a 4-fold reduction in miR-375 (Figure 6B). [score:1]
By contrast, S-cells have barely detectable levels of this proto-oncogene [3] or miR-375. [score:1]
A. ELAVL4 (HuD) mRNA 3’-UTR complement homology with miR-375 (http://www. [score:1]
We measured changes in N-myc protein and miR-375 expression levels in clones of N- myc amplified LA1-55n N-cells stably transfected with an antisense construct to N- myc[28]. [score:1]
[1 to 20 of 38 sentences]
12
[+] score: 113
For miR-375, in vitro and animal studies showed that pancreatic miRNA-375 directly targets PDK1, plays key roles in glucose regulation of insulin gene expression and β-cell growth and is down-regulated in pancreatic carcinoma [34, 35]. [score:10]
Recently, several studies have indicated that miR-375 expression is frequently down-regulated in colorectal cancer tissue compared to the non-tumor counterparts and could be used as new biomarkers for CRC [36, 37]. [score:5]
The results showed that gene regulated by miR-375 participated in most of the important biological process such as growth or developmental process and function as transcription regulators or molecular transducers which were closely related with the development and progression of cancer (Figure 5). [score:5]
Gene ontology and signal pathway analyses showed that most of the target genes that were regulated by miR-375 were involved in some critical pathways in the development and progression of cancer. [score:5]
Signal pathway analyses showed that most of the target genes that were regulated by miR-375 were involved in some critical pathways in the development and progression of CRC, such as MAPK, Wnt, TGF-beta signal pathways (Figure 6). [score:5]
MiR-375 inhibits colorectal cancer growth by targeting PI3K/Akt signaling pathway [38]. [score:4]
Our results indicate that the down-regulation of miR-375 in plasma and tissue is matched in CRC. [score:4]
For tissue samples, miR-375 (p < 0.0001), miR-150 (p < 0.0001), miR-125b (p = 0.0065) and miR-126*(p = 0.0009) were down-regulated. [score:4]
miR-375 was significantly down-regulated and positively correlated in both tissue and plasma samples (r = 0.4663, p = 0.0007). [score:4]
Only miR-375 was significantly down-regulated in both plasma and tissue samples. [score:4]
Wnt ligand initiates signaling through Frizzled (FZD) receptor, which was the predicted target of miR-375 [21]. [score:3]
Another study revealed that miR-375 reduced cell viability through the induction of apoptotic death by targeting YAP1 [39]. [score:3]
Target prediction and function analyses of miR-375. [score:3]
The results suggest that plasma miR-375, whose expression is consistent between tissue samples and plasma samples, could serve as a minimally invasive biomarker for CRC detection. [score:3]
A similar comparison of the paired cancer tissue and adjacent normal mucosa samples showed significant differences in the expression of 4 miRNAs (miR-375: p < 0.0001; miR-150: p < 0.0001; miR-125b: p = 0.0065; miR-126*: p = 0.0009) (Figure 2). [score:3]
Figure 5 The gene ontology (GO) analysis of the target genes of miR-375. [score:3]
Figure 6 The signal pathway analyses of the target genes of miR-375. [score:3]
A comparison between plasma samples of CRC patients and those of healthy controls revealed significant differences in the expression levels of miR-375 (p < 0.0001) and miR-206 (p = 0.0002) (Figure 1). [score:3]
Altogether our results suggest that plasma miR-375, whose expression is correlated with tissue samples, could serve as a minimally invasive biomarker for CRC detection. [score:3]
In the tissue samples, the expression levels of either miR-375, miR-150, miR-125b or the combination of the 3 miRNAs were useful biomarkers for differentiating cancer tissue from adjacent normal mucosa, with the area under the curve of 0.7081 (95% CI: 0.7078-0.8523; p < 0.0001) for the 3 markers together (Figure 4). [score:3]
For instance, miR-375 and miR-141 were both highly expressed in serum and tissue samples of prostate cancer patients [47]. [score:3]
The expression levels of miR-375 in tissue and plasma showed significant positive correlation (r = 0.4663, p = 0.0007), while miR-150, miR-125b, miR-126* and miR-206 revealed weak correlation (Table 3). [score:3]
In the plasma samples, the expression levels of either miR-375, miR-206 or the combination of the 2 miRNAs were useful and robust biomarkers for differentiating CRC patients from healthy controls. [score:3]
Our results indicated that the expression of miR-375 was correlated with both tissue and plasma samples. [score:3]
To investigate possible involvement of miR-375 in CRC, we applied gene ontology and KEGG analysis and found that miR-375 target a large number of genes involved in some critical signaling pathways in cancer and served as transcriptional regulator in cancer significant signal pathways [40]. [score:2]
The results indicated that for plasma sample, miR-375 (p < 0.0001) and miR-206 (p = 0.0002) were dysregulated and could discriminate CRC patients from healthy controls. [score:2]
Moreover, bioinformatics prediction revealed miR-375 association with some critical signal pathways in the development and progression of CRC. [score:2]
In order to investigate the role of the miR-375 in the process of CRC development and progression, we utilized four databases to select plausible targets of miR-375. [score:2]
MiR-375 appears to provide us a way to detect disease by using easily available clinical specimens. [score:2]
Plasma miR-375 is matched with tissue sample and has the potential to be an alternative of tissue biomarker. [score:1]
To our best knowledge, our study is the first one to evaluate the expression of miR-375 in CRC tissue and matched plasma samples. [score:1]
Moreover, plasma miR-375 with a sensitivity of 76.92%, specificity of 64.63% and AUC of 0.7489 has a stronger differentiation power than tissue miR-375 individually or in combination with other miRNAs. [score:1]
Importantly, at the cutoff value of 0.4852 for miR-375, sensitivity was 76.92% and specificity was 64.63%. [score:1]
Five of them (miR-375, miR-150, miR-206, miR-125b and miR-126*) were chosen to be validated in plasma and tissue samples. [score:1]
We screened 5 miRNAs (miR-150, miR-375, miR-125b, miR-206 and miR-126*) which appeared to have the most potential as biomarkers. [score:1]
Moreover, plasma miR-375 has a stronger differentiation power than tissue miR-375 individual or combination with other miRNAs. [score:1]
Area under the curve (AUC) was 0.7489 (95% CI: 0.6536-0.8442; p < 0.0001) for miR-375, 0.7053 (95% CI: 0.6122-0.7985; p = 0.0003) for miR-206 and 0.8458 (95% CI: 0.7746-0.9170; p < 0.0001) for the 2 markers together (Figure 3). [score:1]
The five miRNAs which appeared to have the most potential as biomarkers were miR-375, miR-150, miR-125b, miR-206 and miR-126*. [score:1]
Therefore, plasma miR-375 is a potential minimally invasive biomarker for the early detection of CRC. [score:1]
Therefore, plasma miR-375 holds great promise to be an alternative tissue biomarker for CRC detection. [score:1]
[1 to 20 of 40 sentences]
13
[+] score: 110
Based on these results we conclude that the reactivation of miR-375 expression in HPV 16 and 18 transformed cervical carcinoma and HNSCC cell lines after treatment with DAC is linked to the downregulation of the E6 and E7 oncogene expression. [score:8]
The tumor suppressive role of miR-375 seems to be not only mediated by its ability to interact with E6 and E7 transcripts, but also by the targeting of host cell mRNAs preventing the expression e. g. of the transcription factor SP1 that was reported to contribute to cancer development and progression [25, 56, 57], of the ubiquitin-protein ligase E6AP which is involved in the E6 -mediated degradation of p53 [24], as well as of the protein CIP2A which was shown to prevent the proteolytic degradation of MYC, a transcriptional repressor of p21 [58, 59]. [score:8]
Expression of tumor suppressive miR-375 is reactivated after DAC treatment and targets E6 and E7 transcripts. [score:7]
Recently, miR-375 was reported to play an important role in the regulation of HPV 16 and 18 oncogene expression as this miRNA was shown to target E6 and E7 transcripts [24]. [score:6]
Our data suggest that the reactivated expression of miR-375 under DAC treatment might be involved in targeting and subsequently degrading E6 and E7 transcripts in HPV-transformed cell lines. [score:5]
Interestingly, miR-375 was shown to suppress the expression of multiple host cellular and viral oncogenic factors including the transcription factor SP1, the E6 -associated protein (E6AP) and the HPV 16 and 18 oncogenes E6 and E7 [24, 25]. [score:5]
Therefore, we speculated that treatment with DAC might activate the expression of miR-375 in the included cell lines subsequently targeting HPV E6 and E7 transcripts. [score:5]
Finally, demethylation of E2BS 3 and 4 and reexpression of miR-375 were analyzed to evaluate their roles in regulating E6 and E7 expression. [score:4]
By downregulating these factors, miR-375 might also affect proliferation and colony formation independent of degrading the HPV E6 and E7 transcripts. [score:4]
However, the reduction of E6 and E7 levels and the decrease in proliferation could not be directly correlated with the reactivation of miR-375 expression under DAC treatment suggesting that a combination of different mechanisms activated by DAC seem to be involved in mediating these effects. [score:4]
Another recently described mechanism that potentially contributes to the activation of E6 and E7 is the downregulation of miR-375 [24– 26]. [score:4]
Treatment of UM-SCC-104 also resulted in a strong increase of miR-375 expression levels. [score:3]
Figure 6(A) Expression of endogenous E6*I and E7 mRNA in CaSki and SiHa cells transfected with miR-375 mimics was quantified using RT-qPCR. [score:3]
Expression of miR-375 was found to be repressed by methylation of CpG dinucleotides located in its promoter region [27]. [score:3]
In all tested cell lines we detected a significant increase in miR-375 expression after DAC treatment (Figure 5). [score:3]
Expression of miR-375 is reactivated after treatment with DAC in all tested cell lines. [score:3]
Expression of miR-375 was shown to be silenced by promoter hypermethylation which is frequently observed in HPV-transformed malignancies [27]. [score:3]
Consequently, expression of miR-375 decreases during HPV -mediated cervical transformation [25, 26]. [score:3]
To test the effects of increased miR-375 expression levels on the steady state level of E6 and E7 mRNA transcripts we transfected the HPV 16 transformed cell lines CaSki and SiHa with miR-375. [score:3]
The effects of DAC treatment on miR-375 expression in the HPV 18 transformed cell lines were similar. [score:3]
E6*I and E7 expression analysis, methylation-specific qPCR and miR-375 detection. [score:3]
Thereby, miR-375 may contribute to the intracellular surveillance to prevent the oncogenic activity and is therefore suggested to play a tumor suppressive role especially in HPV -associated cancers [28]. [score:3]
In the next step, we analyzed the effect of DAC treatment on the expression of miR-375. [score:3]
For the analysis of hsa-miR-375 expression TaqMan qRT-PCR was performed using TaqMan [®] MicroRNA Assays (Applied Biosystems) as described in the manufacturer`s instructions. [score:2]
Hsa-miR-375 mimics as well as non-specific negative controls (Mission [®] miRNA, Negative Control 1) were purchased from Sigma Aldrich. [score:1]
For this, genomic DNA was bisulfite converted as described in the following sections and the modified as well as methylated miR-375 promoter sequence was amplified in subsequent qPCR. [score:1]
Furthermore, miR-375 also causes the transcriptional repression and prevents the nuclear translocation of telomerase reverse transcriptase (TERT) [24]. [score:1]
Expression of snRNA U6 was measured to normalize hsa-miR-375 levels in each sample. [score:1]
Transfection of miR-375 in CaSki and SiHa. [score:1]
Treatment with 0.5 μM DAC resulted in demethylation of the miR-375 promoter region in CaSki, SiHa, UM-SCC-47, C4-1 and SW756 cells in comparison to DMSO treated control cells (Figure 4). [score:1]
Methylation level of miR-375 promoter under DAC treatment. [score:1]
Treatment of C4-1 cells with 0.5 μM DAC led to a more than 7 fold increase of miR-375 levels in comparison to DMSO and in SW756 cells miR-375 levels increased continuously with elevating DAC concentrations (up to 3.7 fold increase). [score:1]
Transfection of miR-375 mimics reduces HPV oncogene levels in CaSki and SiHa cells. [score:1]
Final concentration of 100 nM was used for miR-375 mimics as well as 25 nM for non-specific control miRNAs. [score:1]
To test this hypothesis we analyzed the methylation levels of CpG dinucleotides located in the miR-375 promoter region by performing methylation-specific qPCR as described previously [27]. [score:1]
Data are shown as mean miR-375 levels from at least three independent experiments and the error bars reflect the according standard deviation. [score:1]
[1 to 20 of 36 sentences]
14
[+] score: 107
Overexpression of AR in PC3 cells upregulates the level of miR-375, while knockdown of AR in LNCaP cells downregulates the level of miR-375. [score:10]
In conclusion, this study indicates that the AR regulated expression level of DNMTs is likely one of the mechanisms to influence the methylation status of the miR-375 promoter, which in turn regulates the expression of miR-375. [score:7]
In particular, miR-375 was initially believed to be a tumor suppressor, as it targets certain oncogenes and its expression levels are significantly low in most tumors, including esophageal squamous cell carcinoma (8), oral squamous cell carcinoma (9), gastric carcinomas (10), pancreatic cancer (11), hepatocellular carcinoma (12), melanoma (13), squamous cervical cancer (14) and head and neck squamous cell carcinomas (15). [score:7]
A recent study has shown that miR-375 is an oncogenic miRNA and targets the Sec23A tumor suppressor gene in prostate cancer (16). [score:5]
Additionally, PC3/AR cells, which are PC3 cells engineered to express AR (20), showed a high expression level of miR-375 (p<0.001, Fig. 1B). [score:5]
To determine whether DNA methylation was involved in the regulation of miR-375 gene expression, the 1 kb upstream of miR-375 gene was scanned for potential CpG islands using the Li Lab program at http://www. [score:4]
This differential methylation patterns in AR -negative and AR -positive cells were correlated with the expression of miR-375. [score:3]
To examine the expression levels of miR-375 in PCa cell lines, several AR -positive cell lines (LNCaP, C4-2, 22Rv1) and AR -negative cell lines (PC3 and DU 145) were analyzed by real-time PCR. [score:3]
Our results demonstrate that the AR status can influence the expression of miR-375. [score:3]
However, recently studies have indicated that miR-375 is overexpressed in prostate and breast cancers, suggesting that it might exert an oncogene function in these two cancer types (16, 17). [score:3]
The methylation -mediated transcriptional repression then determines the different expression level of miR-375 in these PCa cells. [score:3]
However, the relationship between androgen receptor and DNA methylation and the expression of miR-375 in prostate cancer cells is not yet known and therefore the subject of the present study. [score:3]
Expression levels of miR-375 are higher in PCa AR -positive cell lines than in PCa AR -negative cell lines. [score:3]
We have presented evidence that AR -negative PCa cells have high activity levels of total DNMT, hypermethylation of the miR-375 promoter and lower expression levels of miR-375. [score:3]
Real-time PCR analysis revealed an elevation in the expression of miR-375 in these cells 5 days post 5-Aza-dC (5 μM) treatment (p<0.05, Fig. 3). [score:3]
The results revealed that the expression levels of miR-375 were significantly higher in PCa AR -positive cell lines than in PCa AR -negative cell lines (p<0.001, Fig. 1A). [score:3]
The conclusion is further confirmed by our finding that the low expression level of miR-375 could be reversed through using a demethylating agent 5-Aza-dC in AR -negative DU145 and PC3 cells that otherwise show a hypermethylation pattern. [score:3]
5-Aza-dC reversed the expression of miR-375 in AR -negative DU145 and PC3 cell lines. [score:3]
Overexpression of AR in PC3 cells reversed the hypermethylation of the miR-375 promoter. [score:3]
For example, previous studies have shown that estrogen receptor α (ERα), a female hormone recentor, is involved in the DNA hypomethylation and the expression of miR-375 in breast cancer cells (17). [score:3]
To verify whether the low expression level of the miR-375 resulted in the promoter hypermethylation status of the AR -negative PCa cells, a demethylating agent 5-Aza-dC was used to treat AR -negative PC-3 and DU145 cells. [score:3]
Given that the hypermethylation of DNA is one of the important mechanism to silence gene expression, we further investigated whether the low expression level of miR-375 in AR -negative PCa cells was due to the effect of methylation. [score:3]
These results suggest that DNA methylation maybe one of the important factors to silence the miR-375 gene expression in AR -negative PCa cells. [score:3]
However, knocking down AR by lentivious shRNA interference in LNCaP cells did not change the hypomethylation status of miR-375 promoter (p>0.05, Fig. 2D). [score:2]
It should be pointed out that unexpectedly, knockdown of AR in LNCaP cells did not change the methylation status of miR-375. [score:2]
Hence, we propose that the total DNMT activity is negatively regulated by the AR, which results in hypomethylation or hypermethylation of the miR-375 promoter in AR -positive PCa cells or AR -negative PCa cells, respectively. [score:2]
While knocking down of AR by lentivious AR shRNA interference in LNCaP cells (Fig. 1C) reversed the high level of miR-375 (p<0.01, Fig. 1D). [score:2]
We found that the CpG islands in the miR-375 promoter region were hypermethylated (76–96%) in AR -negative PCa cells (PC3 and DU145), but only very limited methylation (0.0–4.4%) was seen in AR -positive PCa cells (LNCaP, C4-2, 22Rv1) (p<0.001, Fig. 2B). [score:1]
Our studies also show that AR -negative PCa cells, with a hypermethylator status of the miR-375, have a high level of total DNMT activity. [score:1]
In contrast, the promoter of miR-375 is hardly methylated in AR -positive PCa cells. [score:1]
While AR -negative PCa cells show a low level of miR-375, AR -positive PCa cells display a high level of miR-375. [score:1]
Our findings indicate that the promoter of miR-375 is hypermethylated in AR -negative PCa cell lines. [score:1]
We report that AR is negatively correlated with the methylation -mediated transcriptional repression of miR-375 in human prostate cancer cells. [score:1]
In addition, PC3/AR cells also showed a very low methylation (0.4%) status in the miR-375 promoter region, while the PC3-neo cells remained hypermethylation (78%) status in the miR-375 promoter region (p<0.001, Fig. 2C). [score:1]
However, it is unclear how AR interacts with miR-375. [score:1]
microRNA-375 promoter shows a hypermethylation phenotype in AR -negative PCa cells. [score:1]
This analysis revealed a CpG island in the region of miR-375 promoter (Fig. 2A). [score:1]
[1 to 20 of 37 sentences]
15
[+] score: 105
Other miRNAs from this paper: hsa-mir-17, hsa-mir-20a, hsa-mir-25, hsa-mir-93, hsa-mir-106b
We identified miRNAs targeting CIC from the miRNAs known to be overexpressed in prostate cancer tissues, and proposed that miR-93, miR-106b, and miR-375 could potentially contribute to the down-regulation of CIC levels in the process of prostate cancer progression. [score:8]
Moreover, disruption of the putative miRNA binding sites in the 3′UTR of CIC abrogated suppression of luciferase activity by the three miRNAs (Figure 6E), demonstrating that miR-93, miR-106b, and miR-375 directly target the 3′UTR of CIC to regulate CIC levels. [score:7]
We also measured CRABP1 levels in the same set of cells, and found that co -expression of miR-93, miR-106b, and miR-375 resulted in up-regulation of CRABP1, which was restored by overexpression of CIC in PC-3 cells (Figure 7D). [score:6]
Overexpression of miR-93, miR-106b, and miR-375 increased cell proliferation and invasion (Figures 7B and 7C and Supplementary Figure 16), accompanied with down-regulation of CIC levels (Figure 7A), suggesting the cancer promoting property of these three miRNAs in prostate cancer cells. [score:6]
The miRNAs -mediated increases in cell proliferation and invasion were partially abolished by recovery of CIC levels in PC-3 cells (Figures 7B and 7C and Supplementary Figure 16), suggesting that miR-93, miR-106b, and miR-375 promote prostate cancer progression in part by down-regulation of CIC expression. [score:6]
However, co-transfection with all three miRNA duplexes markedly down-regulated CIC levels in PC-3 cells (Figures 6B and 6C), indicating that miR-93, miR-106b, and miR-375 cooperatively regulate CIC levels. [score:5]
Comparative analysis on the selected miRNAs identified five miRNAs, miR-20a, miR-25, miR-93, miR-106b, and miR-375, which not only potentially target CIC, but are also known to be frequently overexpressed in prostate cancer cells (Supplementary Figure 15A). [score:5]
Inhibition of miR-375, but not miR-93 and miR-106b, significantly increased CIC levels (Figure 6D), suggesting that, among the three miRNAs, miR-375 is the most critical endogenous miRNA for regulation of CIC levels in PC-3 cells. [score:4]
We also examined whether CIC expression is regulated by endogenous miR-93, miR-106b, and miR-375 in PC-3 cells. [score:4]
miR-93, miR-106b, and miR-375 cooperatively down-regulate CIC levels. [score:4]
For clonogenic assay of PC-3 cells treated with miRNA duplexes and CIC-S expressing lentivirus, 5 × 10 [3] PC-3 cells were seeded in six well plates a day before transfection, and then co -transfected with miR-93, miR-106b, and miR-375 duplexes using Dhamafect 2. After 24 h, the cells were infected with lentivirus expressing CIC-S for 3 sequential days. [score:4]
Co-transfection with three miRNAs decreased luciferase activity in PC-3 cells (Figure 6E), suggesting that miR-93, miR-106b, and miR-375 down-regulate CIC levels through the 3′UTR of CIC. [score:4]
All error bars show s. e. m. To determine the impact of the miRNAs -mediated down-regulation of CIC on prostate cancer progression, we assessed cell proliferation and invasion in PC-3 cells transfected with either control, miR-93/miR-106b/miR-375 or siCIC duplexes. [score:4]
miR-93, miR-106b, and miR-375 cooperatively down-regulate CIC levels in PC-3 cells. [score:4]
Of the five miRNAs, we initially chose to evaluate miR-93, miR-106b, and miR-375, considering the number of putative binding sites for each miRNA in the 3′UTR of CIC and their frequency of overexpression in prostate cancer patients, and tested whether these miRNAs can down-regulate CIC levels. [score:4]
Inhibition of miR-375 significantly increased levels of CIC. [score:3]
All error bars show s. e. m. D. analysis for changes in CIC levels by inhibition of endogenous miR-93, miR-106b or miR-375 in PC-3 cells and its quantification. [score:3]
On the other hand, the three miRNAs still slightly repressed luciferase activity derived from the pGL3-CIC 3′UTR Mut compared with control vector (Figure 6E), implying that there might be other binding sites for miR-93, miR-106b, and miR-375 in the 3′UTR of CIC, or that the three miRNAs might also be able to repress CIC expression indirectly. [score:3]
To verify that miR-93, miR-106b, and miR-375 directly target the 3′UTR of CIC, we constructed luciferase reporter gene linked to the CIC 3′UTR (pGL3-CIC 3′UTR WT), and carried out dual luciferase assays. [score:3]
B. analysis for changes in CIC levels by overexpression of miR-93, miR-106b, and miR-375 in PC-3 cells. [score:3]
Taken together, these data demonstrate that miR-93, miR-106b, and miR-375 function cooperatively to regulate the CIC-CRABP1 axis in promoting prostate cancer progression. [score:2]
miR-93, miR-106b, and miR-375 cooperatively regulate CIC-CRABP1 axis to promote prostate cancer progression. [score:2]
In sum, our findings suggest that miR-93/miR-106b/miR-375-CIC-CRABP1 is a novel regulatory axis in prostate cancer progression (Figure 7E). [score:2]
For cell growth assay of PC-3 cells treated with miRNA duplexes and CIC-S expressing lentivirus, 1 × 10 [3] PC-3 cells were seeded in 24 well plates a day before transfection, and then co -transfected with miR-93, miR-106b, and miR-375 duplexes using Dhamafect 2 and set as day “0”. [score:2]
miR-93, miR-106b, and miR-375 co-regulate CIC-CRABP1 axis to promote cancer progression in PC-3 cells. [score:2]
Comparative miRNA profiling of prostate carcinomas with increasing tumor stages has revealed that levels of miR-375 and miR-106b gradually increase from normal to lymph node metastasizing tumors, whereas miR-93 increases from normal to extracapsular growing tumors [36], suggesting that these miRNAs are likely to participate in the gradual decrease in CIC levels during prostate cancer progression. [score:1]
All error bars show s. e. m. A. analysis for CIC levels in PC-3 cells transfected with control, miR-93, miR-106b, or miR-375 duplexes. [score:1]
Figure 6 in PC-3 cells A. analysis for CIC levels in PC-3 cells transfected with control, miR-93, miR-106b, or miR-375 duplexes. [score:1]
miR-375 sense; 5′-UUUGUUCGUUCGGCUCGCGUGA-3′, and antisense; 5′-ACGCGAGCCGAACGAACAAAUU-3′. [score:1]
There are two putative binding sites for miR-20a/miR-93/miR-106b, one for miR-25 and another for miR-375 in the 3′UTR of CIC (Supplementary Figure 15B). [score:1]
[1 to 20 of 30 sentences]
16
[+] score: 90
Details are listed in Supplementary Table 1. Details regarding the selective expression of these miRNAs are given in Supplementary Table 1. Among the group of miRNAs with statistically significant P [adj] < 0.05 and more than 2-fold (log2 value of > 1 or < −1) expression differences, miR-375 was detected in rectal cancer only with a mean expression of 2002 read counts, a log2 fold change of -1.76 and a P [adj] = 1.35E-09, while hsa-miR-133a-3p was detected in colon cancer only with mean expression of 620 read counts, a log2 fold change of -1.25 and a P [adj] = 1.58E-02. [score:9]
Details are listed in Supplementary Table 1. Details regarding the selective expression of these miRNAs are given in Supplementary Table 1. Among the group of miRNAs with statistically significant P [adj] < 0.05 and more than 2-fold (log2 value of > 1 or < −1) expression differences, miR-375 was detected in rectal cancer only with a mean expression of 2002 read counts, a log2 fold change of -1.76 and a P [adj] = 1.35E-09, while hsa-miR-133a-3p was detected in colon cancer only with mean expression of 620 read counts, a log2 fold change of -1.25 and a P [adj] = 1.58E-02. [score:9]
Recently, hsa-miR-375 was found to be significantly downregulated in multiple types of cancer lines and to suppress core hallmarks of cancer by targeting several important oncogenes like AEG-1, IGF1R, and PDK1 [35]. [score:8]
The specificity of hsa-miR-375 downregulation in rectal cancer is clearly visible (P [adj] = 1.35E-09 in rectal cancer but P [adj] = 3.82E-01 in colon cancer) similar to the specific downregulation hsa-miR-133a-3p in colon cancer (P [adj] = 1.58E-02 in colon and P [adj] = 9.05E-01 in rectal cancer). [score:7]
Also, in an Egyptian cohort of 64 patients, the expression pattern of hsa-miR-375 and hsa-miR-760 were significantly downregulated in serum of colorectal cancer compared to controls, in line with our data [38]. [score:5]
In contrast, Illumina expression analysis followed by ROC analysis revealed selective expression of hsa-miR-375 in rectal cancer and may be a new tool for understanding the differential cancer biology of tumor cells. [score:5]
Thus, hsa-miR-375 was the only miRNA that was significantly down-regulated and correlated (with a correlation coefficient of r = 0.47) in both tissue and plasma samples [39]. [score:4]
For tissue samples, hsa-miR-375, hsa-miR-150, hsa-miR-125b and hsa-miR-126 were down-regulated. [score:4]
Furthermore, in a very comprehensive British study, recent data indicate that the down-regulation of hsa-miR-375 in plasma and tissue is matched in CRC [39]. [score:4]
Hsa-miR-375 was first identified as a pancreatic islet-specific miRNA regulating insulin secretion, and studies revealed that hsa-miR-375 is a multifunctional miRNA participating in pancreatic islet development, glucose homeostasis, mucosal immunity, lung surfactant secretion, and tumorigenesis [35]. [score:3]
Four miRNAs were selected based on lowest P [adj] values and mean expression levels: hsa-miR-21-5p, hsa-miR-215-5p, hsa-miR-375 and -378a. [score:3]
Hsa-miR-375 was significantly upregulated in the colitis -associated cancer cohort (p = 0.0061) compared with active ulcerative colitis. [score:3]
Hsa-miR-375 also seems to affect colorectal cancer cell sensitivity to cetuximab by targeting PHLPP1 [36] and BRAF [29]. [score:3]
Recent studies suggest that miRNA hsa-miR-375 may have the potential to act as blood -based biomarker to monitor the activity and progression of disease in patients with ulcerative colitis. [score:3]
A strong correlation was observed for hsa-miR-378a (Pearson’s r = 0.9), hsa-miR-375 (r = 0.77) and hsa-miR-215-5p (r = 0.75), underlining that Illumina sequencing is a useful and correct tool for this screen while TaqMan PCR can be regarded as a quick and inexpensive way to determine the expression of a single miRNA. [score:3]
Strikingly, hsa-miR-375 was not detected in colon cancer at significantly dysregulated values. [score:2]
The results indicated that for plasma sample, hsa-miR-375 and hsa-miR-206 were dysregulated and could discriminate CRC patients from healthy controls. [score:2]
In that work, bioinformatics prediction revealed hsa-miR-375 association with some critical signal pathways in the development and progression of CRC. [score:2]
Due to a good tissue quality in this study, we were able to determine the selective dysregulation of certain miRNAs in colon cancer (hsa-miR-133a-3p), rectal cancer (hsa-miR-375), or both (hsa-miR-21-5p, -215-5p and -378a). [score:2]
Generally, a tumor-suppressive role for hsa-miR-375 in experimental cancer progression has been postulated; however, the mechanisms underlying the dysregulation of hsa-miR-375, its potential use in prognosis and diagnosis in clinical conditions, and the therapeutic prospects of hsa-miR-375 in cancer are still under investigation. [score:2]
Our data suggest that dysregulation of hsa-miR-375 and hsa-miR-133a is limited to rectal or colon cancer, respectively, and underline their potential to serve as a marker. [score:2]
ROC analysis also revealed that hsa-miR-375 had the best sensitivity for detecting rectal cancer, with an area under the curve (AUC) of 0.90 (95% CI 0.83–0.97) (B). [score:1]
There was a good correlation of the NGS with the TaqMan results with a strong relationship for hsa-miR-378a (Pearson’s r = 0.9), hsa-miR-375 (r = 0.77) and hsa-miR-215-5p (r = 0.75), but only a moderate relationship for hsa-miR-21-5p (r = 0.53). [score:1]
ROC analysis also revealed that hsa-miR-375 had the best sensitivity for detecting rectal cancer, with an area under the curve (AUC) of 0.90 (95% confidence interval: 0.83–0.97). [score:1]
normal tissue (C) and hsa-miR-375 in rectal cancer vs. [score:1]
The results of the correlation are visualized as bar diagrams on the left and scatter diagrams with regression lines on the right comparing next generation sequencing (blue/y-axis) and TaqMan fold changes (red/x-axis) for hsa-miR-378a (A), hsa-miR-375 (B), hsa-miR-21-5p (C) and hsa-miR-215-5p (D). [score:1]
[1 to 20 of 26 sentences]
17
[+] score: 66
In vitro studies have shown that miR-375 is involved in islet development [17], inhibits insulin gene expression in response to glucose [16], and regulates voltage-gated Na(+) channels and the exocytotic machinery [18]. [score:7]
Thus, altered circulating level of miR-375 at the beginning of T1D development could be also a general marker of metabolic alterations and/or inflammation associated with the disease, in addition to being representative of alterations of islet physiology. [score:4]
We found that miR-375 was downregulated in human islets treated with high glucose concentrations. [score:4]
Interestingly, miR-375 was downregulated in human islets exposed to high glucose concentrations, suggesting a close relationship between miR-375 and glucose (Figure 2). [score:4]
Nine miRNAs (miR-519a, miR-212, miR-320b, miR-27a [∗], miR-30d [∗], miR-23a [∗], miR-30d [∗], miR-23a [∗], and miR-10a [∗]) and 5 miRNAs (miR-375, miR-485-3p, miR-23b, miR-485-3p, miR-23b, miR-627, and miR-1197) were up- or downregulated by glucose, respectively (Figure 2). [score:4]
As miR-375 regulates insulin secretion and beta cell mass [16, 17], we postulated that its expression might be altered in beta cells concomitantly to its circulating level. [score:4]
org/10.1155/2016/1869082, 410 miRNAs were detected in human islets and miR-375 was the most expressed one. [score:3]
Moreover, quantification of circulating miR-375 in prediabetic individuals is now necessary to validate the role of this new biomarker during the early phases of the disease. [score:3]
Therefore, in addition to hyperglycemia and inflammation, expression of miR-375 might be also influenced by environmental factors such as viruses. [score:3]
In human, miR-375 is also strongly expressed in GI-tract, adipose tissue, liver, adrenal, and brain [34]. [score:3]
RT reactions were realized with 0.15  μL dNTP, 1.5  μL buffer (10x), 9  μL RNAse-free water, 0.2  μL RNAse inhibitor, 1  μL multiscribe RTase, and 3  μL of specific miR-375 RT primers (Life Technologies). [score:2]
MiR-375 is highly expressed in the endocrine pancreas (islet beta cells and nonbeta cells) and was first cloned from an insulin-secreting cell line MIN6B1 [16]. [score:2]
miR-375 was also predicted to regulate pathways involved in viral infections in human islets. [score:2]
miR-375 and miR-212 had been previously identified as regulated by glucose in rat islets [21]. [score:2]
These data are in agreement with previous studies on animal mo dels showing that plasma miR-375 is altered in streptozotocin -treated mice prior to the onset of hyperglycemia or 2 weeks before diabetes onset in nonobese diabetic mice [24]. [score:1]
Extracellular miR-375 pool is very heterogeneous and various cells and tissues can release this miRNA. [score:1]
A fixed volume of total RNA (5  μL for miR-375 and 1  μL for miR-39) was used for reverse transcription (RT) reaction. [score:1]
Thus, in this study, we have validated this hypothesis by quantifying the level of miR-375 in the sera from children at onset of T1D (before subcutaneous insulin treatment) and in age-matched controls. [score:1]
As shown in Figure 1, the level of miR-375 was significantly lower in the sera of the 22 T1D children than in the sera of the 10 healthy controls (mean normalized Ct values: 30.61 ± 0.20 versus 29.02 ± 0.57, p = 0.008). [score:1]
However, this hypothesis has to be temporized as it is likely that only a small proportion (≈1%) of circulating miR-375 is originated from beta cells, at least in mice [33]. [score:1]
We did not find any association between miR-375 serum concentration and HbA1c, glycaemia, and the number of autoantibodies (Table 3). [score:1]
On the contrary, T1D and T2DM patients with controlled glycemia have increased circulating levels of miR-375 [29– 31]. [score:1]
In line with this hypothesis, miR-375 concentration in serum is modified in individuals infected with hepatitis B virus [41]. [score:1]
We have also analyzed the global miRNA profile in human islets exposed to high glucose concentrations to determine whether glucotoxicity might affect the level of miR-375 in beta cells. [score:1]
Amplification of Seric miR-375 by qRT-PCR. [score:1]
The abundance of miR-375 in the miRNA profile of human islets found in this study confirmed its critical role in human pancreatic beta cells [25], mirroring its well-established role in rodent islet biology [16]. [score:1]
Taken together, our data demonstrated that miR-375 might be a potential biomarker at the onset of T1D that is also modulated in human islets exposed in vitro to glucose. [score:1]
KO-miR-375 mice are hyperglycemic and have elevated plasma glucagon levels [17]. [score:1]
As we have previously found that beta cells can release miR-375 in extracellular environment [32], our data could suggest a possible link between circulating miR-375 levels and early alterations of islet integrity and functionality reflecting glucotoxicity in humans. [score:1]
Therefore, we have quantified miR-375 in sera from children population at onset of T1D (immediate insulin-requiring diabetes with at least one positive autoantibody) before subcutaneous insulin treatment. [score:1]
Then, we have analyzed the global miRNA profile in human islets exposed to high glucose concentrations to determine whether glucotoxicity might affect the level of miR-375 in beta cells. [score:1]
Based on these data, we hypothesized that the level of miR-375 could be altered in the blood of T1D patients of recent onset. [score:1]
In this study, we have found that miR-375 is strongly decreased in the serum of newly identified T1D children, before the initiation of subcutaneous insulin treatment. [score:1]
[1 to 20 of 33 sentences]
18
[+] score: 64
To illustrate the potential regulatory impact of these 5′-shifted isomiRs we used TargetScan [43] to predict targets for miR-375 and its 5′-shifted isomiRs, miR-375+1 and miR-375-1. While miR-375 has 390 predicted targets conserved between human and mouse, miR-375-1 targets has more than twice that many, and strikingly, miR-375+1 has only 14 (Fig. 3C). [score:10]
Mtpn is a known target of 5′-reference miR-375 but not predicted as a target for either of the 5′-shifted miR-375 isomiRs; Atp6v0c is predicted to be preferentially targeted by miR-375+1; and Cdc42 is predicted to be preferentially targeted by miR-375-1. The x-axis lists the gene symbols for each of three genes tested. [score:9]
To further evaluate the putative differential targeting of the miR-375 5′-isomiRs, we selected the following three genes: Mtpn, which regulates insulin secretion, is a known target of the 5′-reference miR-375 [6], but is not predicted to be targeted by the 5′-shifted isoforms; Atp6v0c, which mediates glucose-sensitive intracellular vesicular transport and is predicted to be preferentially targeted by the 5′-shifted isoform miR-375+1; and Cdc42, which is essential for the second phase of insulin secretion and is predicted to be preferentially targeted by the 5′-shifted isoform miR-375-1. We transfected MIN6 cells with (1) transfection reagent only (mock), (2) 10 nM of miR-375 mimic, or (3) 10 nM of a mimic for one of the 5′-shifted isomiRs of miR-375, and measured the mRNA levels of each of the three genes by RT-qPCR. [score:8]
We evaluated several predicted gene targets of our top candidate regulatory hub, miR-29, and demonstrated the potential of the 5′-shifted isomiRs miR-375+1 and miR-375-1 to differentially regulate gene expression in MIN6 cells. [score:5]
Among the remaining 21, two were in the set of top 20 most highly expressed miRNAs in each of the MIN6 and human datasets: miR-375+1 and miR-375-1. Many of the 5′-shifted isomiRs, such as miR-375+1, miR-375-1, and miR-27b-3p-1, were expressed at similar levels in MIN6, human beta cell, and human islet samples (Fig. 3B). [score:5]
MIN6 cells were transiently transfected with (1) 10 nM mmu-miR-29 mimic (Dharmacon); (2) 200 nM mmu-miR-29 hairpin -inhibitor (Dharmacon); (3) 10 nM mmu-miR-375 mimic (Dharmacon); (4) 10 nM custom mmu-miR-375+1 mimic (Dharmacon: 5′-UUGUUCGUUCGGCUCGCGUGA-3′) or (5) 10 nM custom mmu-miR-375-1 mimic (Dharmacon: 5′UUUUGUUCGUUCGGCUCGCGUGA-3′). [score:3]
Numerous studies have identified miRNAs as important modulators of a wide variety of biological pathways [4], [5]; for example, miR-375 -mediated gene regulation is critical for both beta cell development and function [6], [7]. [score:3]
As depicted in Fig. 3C, miR-375 and its 5′-isomiRs have overlapping, but distinct predicted target gene profiles. [score:3]
The y-axis depicts the relative quantitative value (RQV; expression determined by RT-qPCR and normalized to Rps9) in response to the miR-375 mimic (gray), miR-375+1 mimic (orange), or miR-375-1 mimic (green) relative to mock transfection. [score:3]
All sets are mutually exclusive: for example, a total of 390 genes have predicted conserved miR-375 target sites (42 unique to miR-375, 3 shared with miR-375+1 only, 337 shared with miR-375-1 only, and 8 common to all three). [score:3]
Only eight genes (ELAVL4, HNF1B, NFIX, NPAS3, PAX2, SHOX2, SLC16A2, and TSC22D2) have predicted conserved target sites for miR-375 and both of its 5′-shifted isomiRs. [score:3]
Strikingly, three of the 10 candidate miRNA regulatory hubs in the T2D gene network were 5′-shifted isomiRs: miR-375+1, miR-375-1, and miR-183-5p+1 (Fig. 4A). [score:2]
This is particularly intriguing, given the already well-established role of 5′-reference miR-375 in beta cell formation and function. [score:1]
Atp6v0c and Cdc42 were also modestly repressed by the 5′-reference miRNA, though slightly more so by miR-375+1 and miR-375-1, respectively (Fig. 5). [score:1]
These 187 pre-miRNAs consisted of: 166 pre-miRNAs that generate at most one mature miRNA from each arm of the hairpin-like structure (“homogenous loci”), including one locus (pre-miR-5099) that produces only a 5′-shifted isomiR (mmu-miR-5099-2); and 21 pre-miRNAs that generate more than one mature miRNA from the same arm (“heterogeneous loci”), including one locus (pre-miR-375) that produces one 5′-reference miRNA and two 5′-shifted isomiRs. [score:1]
Effects of mimics for 5′-reference miR-375, 5′-shifted miR-375+1, and 5′shifted miR-375-1 in MIN6 cells on the mRNA levels of three genes are shown. [score:1]
0073240.g005 Figure 5Effects of mimics for 5′-reference miR-375, 5′-shifted miR-375+1, and 5′shifted miR-375-1 in MIN6 cells on the mRNA levels of three genes are shown. [score:1]
5′-shifted isomiRs of the Beta Cell-enriched miRNA, miR-375. [score:1]
These 187 pre-miRNAs consisted of: 166 pre-miRNAs that generate at most one mature miRNA from each arm of the hairpin-like structure (“homogenous loci”), including one locus (pre-miR-5099) that produces only a 5′-shifted isomiR (mmu-miR-5099-2); and 21 pre-miRNAs that generate more than one mature miRNA from the same arm (“heterogeneous loci”), including one locus (pre-miR-375) that produces one 5′-reference miRNA and two 5′-shifted isomiRs. [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 62
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
Recently, it has been shown that the expression of miR-375 is significantly downregulated in multiple tumor types [29], including HCC [30]. [score:6]
Overexpression of miR-375 strongly inhibits AKT/Ras but not c-Myc induced liver tumor formation in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
In agreement with the latter hypothesis, we found that miR-375 has limited tumor suppressor activity against c-Myc driven hepatocarcinogenesis, whereas it strongly inhibits AKT/Ras dependent liver tumor formation. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
miR-375 functions via targeting multiple genes involved in tumor development, including Yap [30], PDK1 [31], 14–3-3-ζ [31] and SHOX2 [32]. [score:4]
In striking contrast, miR-375 exhibited a strong tumor suppressor activity against AKT/Ras driven tumor development (Figure 4C and 4D). [score:4]
These findings suggest that genes targeted by miR-375 may have critical roles in AKT/Ras but not in c-Myc driven hepatocarcinogenesis. [score:3]
The mechanisms underlying the tumor suppressor activity of miR-375 on AKT/Ras dependent hepatocarcinogenesis remain to be defined. [score:3]
Thus, the present findings support a strong tumor suppressive role of miR-375 against AKT/Ras driven hepatocarcinogenesis and a limited antineoplastic activity toward c-Myc induced liver tumor formation. [score:3]
Overexpression of miR-375 slightly delayed c-Myc induced liver tumor formation (Figure 4A and 4B). [score:3]
miR-375 strongly inhibits AKT/Ras hepatocarcinogenesis but not c-Myc induced liver tumor formation. [score:3]
Indeed, none of the AKT/Ras/miR-375 injected mice showed any sign of tumor development 8 weeks post injection. [score:2]
Figure 4 (A) Macroscopic (upper panel) and microscopic (lower panel) appearance of livers from c-Myc/pT3 mice and c-Myc/miR-375 mice stained with H&E (100X), insets (400X). [score:1]
By 8 weeks post injection, all c-Myc/miR-375 injected mice succumbed due to the high tumor burden (Figure 4B). [score:1]
miR-375 was first identified as a pancreatic islet-specific miRNA involved in insulin secretion [28]. [score:1]
[1 to 20 of 17 sentences]
20
[+] score: 62
In humans, computational predictions show that miR-375 has two non-conserved target sites in the 3’UTR of AIFM1 mRNA (Target Scan v. 7.1 release June 2016) (Agarwal et al., 2015), and one target site in the CAV1 3’UTR identified by another miRNA target prediction program (RNA22 algorithm implemented at miRWalk 2.0) (Dweep & Gretz, 2015). [score:9]
In the rat insulin-secreting cell line, INS-1 832/13, we previously showed the reduction of Aifm1 and Cav1 mRNA expression upon miR-375 over -expression delineating the conserved targeting in rodents of these genes by miR-375 (Salunkhe et al., 2015). [score:7]
Although miR-375 is also predicted to target CAV1 3’UTR mRNA, miR-375 expression was not elevated at higher confluences, implying that CAV1 mRNA is potentially regulated by other factors. [score:6]
The negative effect of miR-375 on both the mRNA and protein levels of the two genes has been demonstrated, and in the islets of 375 KO mice, increased expression of these targets was also detected at the mRNA level (Poy et al., 2009). [score:5]
Expression of miR-375 and its targets in INS-1 832/13 cells (A–C) or in EndoC-βH1 cells (D–F). [score:5]
In INS-1 832/13 cells, we did not detect any significantly altered expression of neither miR-375 nor its targets among the different confluences (Figs. 2A– 2C). [score:5]
The genes Aifm1 and Cav1 are among the many genes shown to be directly targeted by miR-375 in mouse beta cells. [score:4]
Likewise in the human EndoC-βH1 cells, the expression of miR-375 was similar at all confluences (Fig.  3D). [score:3]
This study mainly addressed the issue whether confluence affects miR-375 expression, as it is one of the most enriched miRNAs in the pancreatic beta cells influencing diverse molecular processes, from insulin secretion to cellular growth and proliferation (Eliasson, 2017; Poy et al., 2004; Poy et al., 2009; Salunkhe et al., 2015). [score:3]
We found virtually no significant differences in the expression levels of miR-375, CAV1 mRNA and AIFM1 mRNA at higher confluences, from 60%–100%, either in the rat or human beta cell lines. [score:3]
Since its discovery, miR-375 has been shown to negatively regulate a plethora of genes involved in pancreatic beta cell function (Eliasson, 2017) such as in insulin secretion by regulating myotrophin (Mtpn) (Poy et al., 2004) and various voltage-gated sodium channels (SCNs) (Salunkhe et al., 2015). [score:3]
3503/fig-2 Figure 2(A) miR-375 expression at different cell confluence of INS-1 832/13 cells. [score:3]
Knock out of miR-375 in mouse (375 KO), resulted in hyperglycaemic animals with defective proliferative capacity of endocrine cells leading to decreased beta cell mass (Poy et al., 2009). [score:2]
Because many functional assays, e. g., insulin secretion assay, being performed on beta cell lines require optimal culture conditions including cell densities, we therefore set out to investigate whether confluence affects the expression of miR-375 and two of its validated targets in the mouse beta cell, Aifm1 and Cav1, in the rat INS-1 832/13 cells and in the human EndoC-βH1 cells. [score:1]
Although we showed that miR-375, which is one of the most enriched beta cell miRNA was not significantly influenced by confluence level in cultured rat and human beta cell lines, we clearly demonstrated that miR-132 and miR-212 are more dependent on cellular densities, as was shown for some miRNAs in other cells types (Hwang, Wentzel & Men dell, 2009; Van Rooij, 2011). [score:1]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
The first miRNA discovered in the pancreatic islet cells was miR-375 (Poy et al., 2004), which is one of the most highly-enriched miRNAs in the pancreatic islets. [score:1]
[1 to 20 of 17 sentences]
21
[+] score: 57
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-25
For prostate cancer the miR-375 was usually upregulated, but in Asian country the miR-375 was usually downregulated in gastroenterology cancers. [score:7]
Seven studies reported that miR-375 was upregulated in cancer patients and pooled sensitivity and specificity were 75% (95% CI: 47%–91%) and 72% (50%–87%), respectively. [score:4]
On the contrary, some literatures implied miR-375 was downregulated in plasm of cancer patients and the diagnosis accuracies were relatively similar. [score:4]
Therefore, the aim of our study was to conduct a first meta-analysis to determine whether detection of miR-375 expression can be an effective biomarker for cancers and when it is most applicable. [score:3]
Further studies reported that miR-375 was involved in multiple types of cancer by targeting several important genes like AEG-1, YAP1, IGF1R, and PDK1 [16– 19]. [score:3]
Nowadays, a meta-analysis suggests that miR-375 expression is associated with overall survival of cancer patients and could be a useful clinical prognostic biomarker [22]. [score:3]
The difference of miR-375 expression in cancer patients was inconsistent. [score:3]
However, the expression tendency of miR-375 in different kinds of cancer was inconsistent and race was also involved in the reasons. [score:3]
Among those cancer associated miRNAs, miR-375 was first identified as a pancreatic islet specific miRNA which regulated insulin secretion [15]. [score:2]
The PLR value of 3.0 suggests that patients with cancer have an approximately 3.0-fold higher chance of being miRNA-375 differently expressed compared to control patients without cancer. [score:2]
The articles were considered eligible if they met the following criteria: (1) cancer diagnosis was based on histopathological confirmation and healthy people or patients with benign disease were served as the control group; (2) they detected miR-375 expression in serum, plasma, urine, and other body fluids; (3) the studies utilized a case-control design and contained sufficient published data to construct two-by-two tables and calculate the diagnostic accuracy; (4) they were published in English. [score:2]
In the present study, we found that circulating miR-375 could discriminate cancer from controls and yielded an AUC of 0.82 (95% CI: 0.79–0.85) with a sensitivity of 78% (95% CI: 64%–87%) and a specificity of 74% (95% CI: 62%–84%). [score:1]
In addition, more and more attention has been focused on miR-375 and a meta-analysis conducted in 2014 has proven miR-375 was significantly related to cancer overall survival. [score:1]
Therefore, further validations of miR-375 in large cohort and independent studies are needed. [score:1]
This result of 0.82 suggests that miR-375 is a good potential noninvasive biomarker for cancer. [score:1]
The NLR value of 0.30 means that the probability of the person having cancer is 30% if the miR-375 is abnormal. [score:1]
Then we performed the meta-regression based on the variables including publication year, country and ethnicity, sample type, cancer type, miR-375 change tendency, number of patients, and quality score, to explain this heterogeneity. [score:1]
The miR-375 was reported to be increased in some studies. [score:1]
So more studies with larger number of cases and controls are indeed needed to assess the change tendency of miR-375. [score:1]
However, the diagnostic accuracy of miR-375 for cancers was inconsistent in literature and the results of every paper were restricted because of limited enrolled patient number. [score:1]
We identified that the pooled DOR was 10.04 (95% CI: 6.01–16.77), indicating that the overall accuracy of the miR-375 test for detecting cancer was relatively high. [score:1]
In conclusion, our meta-analysis suggests that miR-375 has potential diagnostic value with reasonable specificity and sensitivity for cancer. [score:1]
Additionally, plenty of studies have focused on the potential use of miR-375 as diagnosis biomarker. [score:1]
Figure S1: Forest plots of diagnosis score and DOR from test accuracy studies of miR-375 in the diagnosis of cancer. [score:1]
Komatsu et al. found that the circulating miR-21/miR-375 ratio might be a diagnostic marker in esophageal squamous cell carcinoma [20]. [score:1]
Finally, a lack of access to the original data from the included studies limited our ability to perform meta-analysis on miR-375 diagnosis effect. [score:1]
A pooled sensitivity and specificity of miR-375 were 78% (95% CI: 64%–87%) and 74% (95% CI: 62%–84%) in the diagnosis of cancer patients, respectively (Figure 2(a)). [score:1]
If validated in a large scale study, miR-375 might be useful as a noninvasive screening tool for clinical practice of cancer. [score:1]
For miR-375, the sensitivity, specificity, PLR, NLR, diagnostic score, and DOR of 13 studies in 12 included papers were performed by forest plots. [score:1]
The key words used in the research were “serum or plasma or blood or circulating” and “microRNA-375 or miRNA-375 or miR-375” and “ROC curve or diagnosis or sensitivity or specificity. [score:1]
Moreover, miR-375, miR-25, and let-7f were found able to separate HBV -positive HCCs from healthy controls [21]. [score:1]
The SROC curve for the included studies was shown in Figure 3. The AUC was 0.82 (95% CI: 0.79–0.85), indicating a good diagnostic accuracy of miR-375 for cancer diagnosis. [score:1]
[1 to 20 of 32 sentences]
22
[+] score: 56
The miR-375 regulates RASD1 by targeting the 3′ untranslated region in RASD1 mRNA [116]. [score:6]
The study also revealed that miR-375 directly targets metadherin (MTDH) and that there is an inverse correlation between the expression of miR-375 and MTDH in primary breast cancer cell lines. [score:6]
Data showed that miR-375 was one of the top downregulated miRNAs in resistant cells and that the reexpression of miR-375 showed increased sensitivity of tamoxifen-resistant cells, and also partly reversed EMT phenotype [117]. [score:6]
It was revealed that miR-375 is upregulated during lobular neoplasia progression and overexpressed in ILC progression. [score:6]
In accordance, inhibiting miR-375 expression in ERα -positive MCF-7 breast cells resulted in reduced proliferation and ERα activation. [score:5]
The transition from normal cells to invasive lobular carcinomas after upregulation of miR-375 suggests that it contributes to lobular neoplastic progression. [score:4]
Thus, concentrating on reexpression of miR-375 may serve as a potential therapeutic approach for breast cancer treatment. [score:3]
The study also identified RASD1 as a potential target of miR-375. [score:3]
On the other hand, a conflicting study reveals that miR-375 may also have tumor suppressive role. [score:3]
In addition, miR-375 has been shown to be differentially expressed during breast lobular neoplasia, which promotes loss of mammary acinar polarity in Homo sapiens [123]. [score:3]
When miR-375 was overexpressed in MCF-10A 3D culture mo del of mammary acinar morphogenesis, there was loss of cellular organization and progression of the hyperplastic phenotype. [score:3]
Studies on miR-375 show conflicting results in both oncogenic and tumor suppressive roles. [score:3]
Research showed that overexpression of miR-375 in ERα -positive breast cell lines contributed to proliferation [116]. [score:3]
This suggests that there is a positive feed-forward loop, and that miR-375 plays an oncogenic role in breast cancer. [score:1]
4.5. miRNA-375. [score:1]
[1 to 20 of 15 sentences]
23
[+] score: 48
As the cactus gene inhibits NF-κB transcription factor activation, it seems that aae-miR-375 allows for enhanced virus infection in AAG-2 cells via downregulation of cactus. [score:6]
CHIKV titers were significantly lower (p<0.05) in MIR-375 and MIR-2940 inhibited cells at both 24 and 48 h. p. i. No significant viral titer differences were observed at 72 h. p. i. for any miRNA inhibitor. [score:5]
MicroRNA inhibitors were designed based on the sequences of the following select microRNAs, aae-mir-12, aae-mir-125, aae-mir184, aar-mir-375, aae-mir-2490 and a control inhibitor with random sequence, Scramble, that was designed based on a previous study [30]. [score:5]
Furthermore, presence of aae-miR-375 mimics increased DENV-2 levels in AAG-2 cells which corresponded with our miRNA inhibition assay where a decrease in CHIKV replication was observed in AAG-2 and BHK-21 cells after exposure to aae-miR-375 inhibitors. [score:4]
Cactus and REL1 regulate the Toll immune pathway and were differentially expressed in response to aae-miR-375 mimics in Ae. [score:4]
The aae-miR-375 has been shown to be important in DENV replication [21] and was downregulated at least 34-fold in Ae. [score:4]
In another study, miR-375 function was enhanced by increased expression of AGO2 in mice suggesting a potential interaction of aae-miR-375 and AGO2 [60]. [score:3]
All miRNA inhibitors (MIR-12, MIR-125, MIR-184, MIR375 and MIR-2490) were synthesized by Integrated DNA Technologies [©]. [score:3]
0003386.g002 Figure 2 Mosquito (AAG-2 and C6/36) and mammalian (BHK-21) cells were transfected with miRNA inhibitors, a) MIR-12, b) MIR-125, c) MIR-184, d) MIR-375 and e) MIR-2940, and then infected with CHIKV at 72 hours post-transfection. [score:3]
Predicted target sites for miR-375 include the REL1 and prohibitin, the 5′UTR of cactus, the 3′UTR of DEAD box ATP -dependent RNA helicase, a hypothetical protein and the coding region of kinesin all of which showed significant modulation in response to Ae. [score:3]
Out of the 5 miRNAs inhibited, all demonstrated lower CHIKV titers in AAG-2 cells however, only miR-184, miR-375 and miR-2490, demonstrated decreased CHIKV titers in both mosquito (AAG-2) and mammalian (BHK-21) cells. [score:3]
Mosquito (AAG-2 and C6/36) and mammalian (BHK-21) cells were transfected with miRNA inhibitors, a) MIR-12, b) MIR-125, c) MIR-184, d) MIR-375 and e) MIR-2940, and then infected with CHIKV at 72 hours post-transfection. [score:3]
At 48 h. p. i., CHIKV titers were significantly lower (p < 0.05) in cells transfected with MIR-184 (Fig. 2C) and MIR-375 (Fig. 2D). [score:1]
aegypti mosquitoes injected with aae-miR-375 mimics [21]. [score:1]
[1 to 20 of 14 sentences]
24
[+] score: 41
The following analysis reveals that miR-375 directly targets HNF1β, and overexpression of miR-375 downregulates the protein level of HNF1β, while miR-7 directly targets PAX6, and overexpression of miR-7 decreases the expression level of PAX6 [21]. [score:16]
For example, Cadm1, as the direct target gene of miR-375, negatively regulates the G1/S transition and represses cell growth in various cancer cells lines [15]. [score:5]
Mice lacking miR-375 (375 KO) display decreased pancreatic β-cell mass as a result of impaired proliferation, and further analysis demonstrates that miR-375 works by targeting a number of growth-inhibiting genes and is required for β-cell proliferation [14]. [score:5]
Dynamic expression of miRNAs during the differentiation of human embryonic stem cells into islet-like cell clusters has been quantified, and four islet-specific miRNAs (miR-7, miR-375, miR-34a, and miR-146a) exhibit distinct expression patterns during this process. [score:5]
One of the most important miRNA regulators is miR-375, which is highly expressed in both human and mouse pancreatic β-cells and is indispensable in maintaining normal pancreatic β-cell mass. [score:4]
Later studies have also proven that miR-7 and miR-375 are essential for pancreatic β-cell differentiation and development [22], and in vitro forced expression of miR-7 or miR-375 helps to differentiate hPSCs into IPCs [23, 24]. [score:4]
Among them, miR-375 and miR-7 increase from day 4, peak on day 8, and then decline until the end of differentiation. [score:1]
Aside from the above, many other miRNAs are involved in pancreatic function, especially insulin secretion (e. g., miR-375, -184, -33, -187, -29a, and -30a) [28, 29, 30, 31, 32, 33, 34, 35, 36, 37]. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 39
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-758
miR-375 is generally considered to be a tumor suppressor and thus is down-regulated in many types of cancers, including esophageal squamous cell carcinoma [40], head and neck squamous cell carcinoma [41], Pancreatic cancer [42], melanoma [43], and Esophageal Cancer [44]. [score:5]
Ectopic expression of miR-375 inhibited melanoma cell proliferation, invasion, and cell motility [43]. [score:5]
Epigenetically deregulated in breast cancer, miR-375 was previously shown to form a positive feedback loop with estrogen receptor alpha in MCF-7 cells, with high expression of miR-375 in ERα -positive breast cell lines being a key driver of their proliferation [53]. [score:4]
Expression level of another miR candidate, miR-375, was found to be significantly associated with ER status, histological type, type of surgery and systemic therapy (Table 3). [score:3]
In contrast, higher expression of miR-375 has been identified in tumors of prostate cancer [49], in the sputum of lung adenocarcinoma patients [50], in the serum of HBV and HBV positive HCC patients [51], and gastric cancer patients with high risk of recurrence following surgical resection [52]. [score:3]
Conversely, ectopic expression of miR-375 is shown to repress cancer progression in pancreatic cancer [42], melanoma [43], gastric cancer [45], and liver cancer [46]. [score:3]
Thus, in general miR-9 is associated with cancer progression while miR-375 is thought to be a cancer suppressor. [score:3]
This is consistent with our observation that miR-375 expression is higher in ER positive tumors. [score:3]
Association of miR-9 and miR-375 expression levels with tumor estrogen receptor (ER) status. [score:3]
Although this is the first report associating these miRs with estrogen receptor and LR in breast cancer, miR-9 and miR-375 have been shown to play important roles in many biological processes including carcinogenesis at different biological sites. [score:1]
We report herein the discovery of two micro RNAs in breast tumor tissue, miR-9 and miR-375, which were associated with estrogen receptor status, one of them (miR-9) was significantly associated with local recurrence in ER positive tumors. [score:1]
The mean delta Ct values of miR-375 were 6.79 (range: 2.14 to 14.50) in ER negative samples and 3.80 (range: 0.27 to 6.83) in ER positive samples (p<0.001, Figure 3B). [score:1]
The capabilities of miR-9 and miR-375 to discriminate ER status are shown in ROC curves (panel C and D, respectively). [score:1]
We also found that miR-9 and miR-375 were strongly associated with ER status of breast tumors. [score:1]
Association of miR-9 and miR-375 with Tumor ER Status. [score:1]
However, there are conflicting reports regarding the association between miR-375 level and cancer prognosis, suggesting a more complex and possibly cancer specific relationship. [score:1]
[1 to 20 of 16 sentences]
26
[+] score: 36
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Furthermore, it has been shown that miR-375 concurrently downregulates expression of insulin by targeting the phosphoinositide -dependent kinase-1 in INS1-E cells [102]. [score:8]
More in detail, miR-375 leads to a reduced glucose-stimulated insulin secretion by downregulating myotrophin mRNA (encoding a key protein involved in cell membrane fusion with insulin granules) and therefore inhibiting exocytosis. [score:6]
Adipogenic differentiation[187] miR-375 ERK1/2 signaling pathway[77] miR-378 Adipocyte development and differentiation[188] miR-637 Sp7[189] Table 3 Anti-adipogenic miRNAs miRNA Target/process Reference let-7 FABP4 and PPARγ signaling pathway. [score:4]
An increase in miR-375 expression is observed during pancreatic islet cell development, whereas β-cell functioning is linked to its decrease [98]. [score:4]
Interestingly, the transcription factor neurogenin3 (Ngn3), considered as an early marker of pancreatic islet cells with a prominent role during the development of the endocrine lineages in mice [101], also interferes with miR-375 expression. [score:3]
Moreover, miR-375 targets a number of transcription factors, such as PDX1, HNF6, and INSM1, engaged in pancreatic islet functioning [100]. [score:3]
Conversely, miR-375 suppresses phosphorylation levels of ERK1/2 in 3T3-L1 cells [77]. [score:3]
One of the most relevant is miR-375, which is the most abundant in pancreatic islets and is essential in maintaining normal pancreatic β-cell mass [97]. [score:1]
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
Remarkably, miR-375 has been reported to be involved in the modulation of insulin secretion in stimulated cell line MIN6 [93]. [score:1]
miR-375 has been shown to promote 3T3-L1 adipocyte differentiation by increasing mRNA levels of C/EBPα and PPARγ2 and by inducting adipocyte fatty acid -binding protein (aP2) and triglyceride accumulation. [score:1]
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
[1 to 20 of 12 sentences]
27
[+] score: 34
Expression of miR-126, miR-21, miR-375 and the potential targets NF-κB inhibitor alpha (IκBα, IKBA or NFKBIA), Polo-like kinase 2 (PLK2) and v-Crk sarcoma virus CT10 oncogene homolog (CRK) were assessed in 52 colonic biopsies from patients with active UC, inactive UC, irritable bowel syndrome (IBS) and from healthy subjects by quantitative RT-PCR and immunofluorescence analyses. [score:7]
The genome-wide microarray screening study identified a group of miRNAs differentially expressed in active UC in the American population, including 3 downregulated miRNAs (miR-192, miR-375 and miR-422b) and 8 unregulated miRNAs (miR-16, miR-21, miR-23a, miR-24, miR-29a, miR-126, miR-195 and Let-7f) in the colons of active UC patients [18]. [score:7]
To determine whether miR-126, miR-21, and miR-375 are differentially expressed in UC patients from different ethnic groups, we analyzed the expression of these candidate miRNA in Chinese patients with active UC. [score:5]
An inconsistent finding between previous genome-wide screening [18] and our current study was observed for miR-375 expression in UC patients, which may be attributed to patient populations with different ethnic and genetic backgrounds. [score:3]
Differential Expression of miR-126, miR-21 and miR-375 in UC Tissues. [score:3]
However the expression of miR-375, PLK2 and CRK showed no difference between each group. [score:3]
However, there was no statistical significant difference in expression of miR-375 among the sample groups tested (P>0.05) (Figure 1C). [score:3]
0052782.g001 Figure 1Expression of (A) miR-126, (B) miR-21 and (C) miR-375 were measured by quantitative RT-PCR in RNA samples of active UC tissues (n = 12), inactive UC samples (n = 10), IBS samples (n = 15) and healthy controls (n = 15), respectively. [score:1]
Expression of (A) miR-126, (B) miR-21 and (C) miR-375 were measured by quantitative RT-PCR in RNA samples of active UC tissues (n = 12), inactive UC samples (n = 10), IBS samples (n = 15) and healthy controls (n = 15), respectively. [score:1]
A genome-wide microarray screening indicated that miR-126 and miR-21 are increased and miR-375 is decreased in sigmoid colons of active UC patients [18]. [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 34
This help explain why a significant inverse methylation -expression relationship was not observed for miRNA-34b, miRNA-210, or miRNA-375 as the average proportion of methylated miR-34b, miR-210, or miR-375 in SM and GC samples was relatively low (2% ~ 15%). [score:3]
We further analyzed the miRNA levels of 20 pairs of fresh GC and SM samples and found a significantly higher expression level of miRNA-200b, miRNA-375, and miRNA-210 in SMs than in GCs (Paired t-test: Ps≤0.030; Additional file 1: Figure S12). [score:3]
A weak inverse methylation -expression relationship was also found for miR-375 in these tissue samples (r [s] =0.287, P = 0.085; Figure 3O). [score:3]
Thus, CpG islands of 9 disease-related miR genes, including 5 extragenic miR genes or gene clusters (miR-9-3, miR-137, miR-200b/200a/429, miR-203, and miR-375) and 4 intragenic genes or gene clusters (miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210), were selected as the representative genes in the present study (Additional file 1: Table S1). [score:3]
However, a solid relationship between miR methylation and expression has not been thoroughly established as only weak supporting evidence has been provided in many of the previous studies, as we have summarized for 9 tested miR genes/clusters (extragenic miR-9-3, miR-137, miR-200b/200a/429, miR-203, miR-375; intragenic miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210) in this present study (Additional file 1: Table S2) [19- 27]. [score:3]
Inversed relationship between miR methylation of CpG islands and their corresponding expression levelsTo investigate the relationship between the above aberrant miR methylation and the transcription of the corresponding miR gene, we quantified the mature miRNA levels of miR-9-1, miR-9-3, miR-34b, miR-137, miR-210, miR-200b, (and miR-375), whose methylation status is related to the development of GC (and GC host adaptation) as described above, in a set of human cell lines with different methylation status of miR CpG islands. [score:2]
miR-375, miR-203, and miR-193b methylation might be host adaptation to the development of GCs. [score:2]
Because significant correlation between miR-375 methylation and H. pylori infection was not observed among the tested gastric samples, we suggest that miR-375 methylation might be a unique host adaptation to the development of GCs. [score:2]
These data imply that miR-375 (and miR-203) methylation is not GC-specific and might be one kind of host adaptation in the non-malignant tissues to the development of GCs. [score:2]
The miRNA levels were then analyzed using a TaqMan Gene Expression Master Mix kit (Life Technologies) with the corresponding probe and primers (Life Technologies, miR-375 #TM000564, miR-34b #TM000427, miR-137 #TM000593, and miR-9 #TM000583). [score:2]
miR-375 promotes cancer cell proliferation through RASD1-ERα pathway [63]. [score:1]
In the present study, we found that methylation or demethylation of all 7 tested miR CpG islands (GC-related miR-9-1, miR-34b, miR-9-3, miR-137, miR-210, miR-200b and host-related miR-375) was consistently, inversely correlated to a statistically significant level with their corresponding miRNA levels in a number of human cell lines in vitro. [score:1]
Furthermore, methylation of the miR-203 and miR-375 CpG islands might be one kind of host adaptations to gastric carcinogenesis. [score:1]
As is consistent with others’ reports [14, 15, 19, 25, 27, 36- 40], miR-9-1, miR-9-3, miR-34b, miR-137, and miR-375 methylation was observed in gastric carcinogenesis in the present study. [score:1]
We observed that the positive rate of miR-203 and miR-193b methylation increased in normal, gastritis, and SM tissues, but decreased in GCs as did miR-375 methylation pattern. [score:1]
In the Subset-2 samples, we also analyzed miR-375 methylation and found more miR-375 methylation in SMs than in GCs again (Pearson Chi-square test, P = 0.034; Additional file 1: Table S4). [score:1]
This implies that miR-203 and miR-375 methylation is not a GC-specific event, but rather a host adaptation to gastric carcinogenesis. [score:1]
DHPLC chromatogram of methylated and unmethylated miR-375 in various cell lines. [score:1]
In addition, miR-203 and miR-375 methylation increased gradually in gastritis and SM samples, but decreased in GC samples. [score:1]
[1 to 20 of 19 sentences]
29
[+] score: 33
The expression of endoderm-specific miRNAs–miR-375 [43], and miR-122, [31] was upregulated in response to NaB, though to a higher extent in the HES2 cell line. [score:6]
According to the data of Laurent et al., miR-122, miR-10a and miR-24 were upregulated in hESC differentiated towards extraembryonic endoderm, while miR-375's expression was unchanged [20]. [score:6]
Further, a few hepatic/endoderm markers such as FOXA2, Alpha-fetoprotein, Albumin (Fig. 7D–F) and miR-375 (Fig. 6B) were not upregulated, and there was a concomitant increase in the expression of the ESC-specific miR-302a* (Fig. 6C). [score:6]
These miRNAs were differentially-expressed upon NaB -induced differentiation and represent ES miRNAs (hsa-miR-302a*, hsa-miR-302d, hsa-miR-517b), endodermal miRNAs (hsa-miR-122, hsa-miR-375) and miRNAs that were upregulated in both lines (hsa-miR-10a, hsa-miR-24). [score:6]
Upon treatment with NaB, induction of the endodermal miR-122 and miR-375 was observed in parallel to induction of hepatic gene expression, while ESC-specific miRNA expression was reduced. [score:5]
When comparing these results to ours, it could be that miR-375's upregulation further allows for the distinction of definitive vs. [score:4]
[1 to 20 of 6 sentences]
30
[+] score: 33
Expression of miR-204 is associated with an insulin functional phenotype in PETsExpression of miR-204 and of the closely related miR-211, miR-375, and miR-9 was analyzed by real-time qRT-PCR in functional pancreatic neuroendocrine tumors (PET) of which 7 expressed insulin (Ins-F-PET), 4 glucagon or somatostatin (Gluc/Som-F-PET, 3 glucagonomas, 1 somatostatinoma), and in 7 non-functional tumors (NF-PET) (Supplementary Table  S1). [score:7]
Expression of miR-204 and of the closely related miR-211, miR-375, and miR-9 was analyzed by real-time qRT-PCR in functional pancreatic neuroendocrine tumors (PET) of which 7 expressed insulin (Ins-F-PET), 4 glucagon or somatostatin (Gluc/Som-F-PET, 3 glucagonomas, 1 somatostatinoma), and in 7 non-functional tumors (NF-PET) (Supplementary Table  S1). [score:5]
Box and whisker plot (min to max) of miR-204, miR-211, miR-375, and miR-9 levels expressed as fold change relative to median levels in human islets (HI) in Ins-F-PET (dark grey boxes), Gluc/Som-F-PET (light grey boxes), and NF-PET (clear boxes); the significance of differences was analyzed using the Mann Whitney test. [score:3]
In pancreatic islets expression of miR-9, another miRNA implicated in the regulation of insulin secretion, was markedly lower compared to both miR-204 and miR-375, with median levels 87 and 3857 fold lower, respectively. [score:3]
Logistic regression analysis, based on negative or positive immunohistochemical staining, showed that in PETs the expression of insulin at the protein level was predicted by both miR-204 (OR: 16.8, 1.49–189 p = 0.022) and miR-211 (OR: 9.65, 1.09–85 p = 0.041) but not by miR-375 (OR: 0.35, 0.09–1.34) or miR-9 (OR: 0.73; 0.23–2.26). [score:3]
The variability of expression of miR-375 in islets was less pronounced than that of miR-204 with a 10-fold change from the lowest to highest observed value. [score:3]
A consistent trend for higher expression of miR-375 and miR-9 in Gluc/Som-F-PET was also evident. [score:3]
Moreover, several miRNAs, like miR-375, miR-124a, miR-96, and miR-9, are implicated in the regulation of insulin secretion 5, 6, 21, 22. [score:2]
Neither the expression of miR-204 or miR-211 nor that of miR-375 and miR-9 correlated with any of the other evaluated genes (Supplementary Table  S2). [score:1]
2008.10.001 18977315 4. Poy MN miR-375 maintains normal pancreatic alpha- and beta-cell massProc. [score:1]
Box and whisker plot (min to max) of miR-204 (grey boxes), miR-211 (clear boxes), miR-375 (dark striped boxes), and miR-9 (dotted boxes) levels in human islets (HI), acinar, ductal, and pMSC cells. [score:1]
Levels of both miR-204 and miR-375 showed a trend towards a positive correlation with the degree of islet purity although statistically not significant (miR-204 Spearman R = 0.62, p = 0.14; miR-375 Spearman R = 0.68, p = 0.11). [score:1]
[1 to 20 of 12 sentences]
31
[+] score: 32
However, when the expression of hsa-miR-375 is significantly downregulated in ER− specimens, the expression of STAP2 changes, and instead of being downregulated, it is upregulated quite significantly. [score:14]
Pedro de Souza Rocha Simonini reported that hsa-miR-375 is overexpressed in breast cancer tumours with an ER+ status and that decreasing the expression of hsa-miR-375 will decrease the activity of ER accordingly [28]. [score:5]
The final results are shown in Table 2. First, we analysed the differentially expressed genes (DEGs) among ER -associated DE-MMPVs, and we found that they shared the same miRNA: hsa-miR-375. [score:3]
The final results are shown in Table 2. First, we analysed the differentially expressed genes (DEGs) among ER -associated DE-MMPVs, and we found that they shared the same miRNA: hsa-miR-375. [score:3]
Thus, we searched the relevant literature to examine five of the target mRNAs of hsa-miR-375. [score:3]
As another example, the regulation of has-mir-375 and FOLR1 is negative in the healthy population, while in ER+ specimens it is positive, whereas it is significantly negative in ER− specimens. [score:2]
Interestingly, the regulatory patterns of hsa-miR-375 and STAP2 in the healthy population and in ER− and ER+ breast cancer patients are all positive. [score:2]
[1 to 20 of 7 sentences]
32
[+] score: 30
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Another study showed that ectopic expression of the tumor suppressor miR-375 reduced cell viability in GC cells through the proliferative PI3K/Akt pathway (by targeting JAK2 and PDK1) and the anti-apoptotic NF-κB signaling pathway (by targeting the anti-apoptotic protein 14-3-3ζ) [86, 174, 175]. [score:9]
Ding L. Xu Y. Zhang W. Deng Y. Si M. Du Y. Yao H. Liu X. Ke Y. Si J. miR-375 frequently downregulated in gastric cancer inhibits cell proliferation by targeting JAK2 Cell Res. [score:8]
In GC, high expression of miR-195 [58], miR-199a [39, 58, 62, 63, 64, 65], miR-1952 [58], miR-335 [82, 83], miR-375 [39, 74, 86, 87, 88], miR-451 [58, 94, 95, 96] and miR-4512 [39], and low expression of miR-142-5p [39] are more likely to indicate relapse or recurrence of GC patients. [score:5]
In addition, oncomiR-20b, miR-150 [23], miR-214 [24, 74], miR-375 [39, 74, 86, 87, 88], tumor suppressor Let-7g [24, 109, 110], miR-125-5p [126], miR-146a [24, 134], miR-218 [154], miR-433 [24, 86, 109, 110, 174], and miR-451 [24, 94, 230] are associated with a poor survival prediction in GC. [score:3]
Conversely, several tumor-suppressor miRNAs circulating in the blood of GC patients can also be used as diagnostic biomarkers to distinguish GC patients from healthy individuals, including miR-122, miR-195-5p, miR-203, miR-218, and miR-375 [155, 189, 198, 209, 210, 211]. [score:3]
Zhang W. H. Gui J. H. Wang C. Z. Chang Q. Xu S. P. Cai C. H. Li Y. N. Tian Y. P. Yan L. Wu B. The identification of miR-375 as a potential biomarker in distal gastric adenocarcinoma Oncol. [score:1]
Zhang X. Yan Z. Zhang J. Gong L. Li W. Cui J. Liu Y. Gao Z. Li J. Shen L. Combination of hsa-miR-375 and hsa-miR-142-5p as a predictor for recurrence risk in gastric cancer patients following surgical resection Ann. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 30
The overexpressed miR-375 suppressed cell proliferation, blocked G1-to S cell-cycle transition, and inhibited cell migration and invasion in human cervical SiHa and CaSki cells, suggesting that miR-375 is a candidate tumor suppressor 42. [score:9]
In conclusion, from our systematic review study we identified that miR-21 is the most consistently reported upregulated microRNA and miR-375 is the most consistently reported downregulated microRNA in gastric cancer. [score:7]
The most consistently reported differentially expressed microRNA of downregulation in our systematic review is miR-375 which has an antioncogenic activity. [score:6]
In the consistently reported downregulated miRNAs, miR-375 was reported in six studies followed by two miRNAs, miR-148a, and miR-30d in five studies. [score:4]
MiR-375 was reported to be consistently downregulated in six studies followed by miR-148a and miR-30d in five studies. [score:4]
[1 to 20 of 5 sentences]
34
[+] score: 30
In Fig.   1b, four miRs finally selected for experimental validation (hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375) were in the opposite direction from the origin compared to CAKUT samples in Fig.   1a suggesting that these miRs might be responsible for the downregulation in the CAKUT gene expression data. [score:6]
The hsa-miR-200a, hsa-miR-183 and hsa-miR-375 were expressed in both patient’s and control’s tissue, but statistically significant difference in relative expression was not observed (Fig.   2; Table  2). [score:5]
These could be the reasons for hsa-miR-183, hsa-miR-200a and hsa-miR-375 expression deviations from results of the CIA. [score:3]
Predicted miRs were experimentally validated to be expressed in ureter tissue: hsa-miR-144, hsa-miR-375, hsa-miR-183 and hsa-miR-200a. [score:3]
The hsa-miR-200a, hsa-miR-183 and hsa-miR-375 weren’t differentially expressed in CAKUT. [score:3]
Fig.  2Difference in relative expression of hsa-miR-144, hsa-miR-183, hsa-miR-200a, and hsa-miR-375 between CAKUT patients (n = 36) and controls (n = 9). [score:3]
We received a notably reduced list containing 7 miRs (hsa-miR-144, hsa-miR-101, hsa-miR-375, hsa-miR-200a, hsa-miR-183, hsa-miR-495, hsa-miR-222) with a potential role in CAKUT development. [score:2]
The chosen mature forms for validation were: hsa-miR-144-3p, hsa-miR-200a-3p, hsa-miR-375-3p and hsa-miR-183-5p. [score:1]
This was the first ex vivo human study that investigated the expression of miRs: hsa-miR-144, hsa-miR-200a, hsa-miR-375 and hsa-miR-183 in human CAKUT. [score:1]
Therefore, by the observation of the plots, miRs hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375 are potentially associated with CAKUT according to their position To systematically identify miRs specifically associated with CAKUT, a supervised analysis was conducted by combining CIA and BGA. [score:1]
Both miRs from community 7 (hsa-miR-375 and hsa-miR-200a) had high rankings in the CIA (Table  1), thus both were experimentally validated as well. [score:1]
Therefore, by the observation of the plots, miRs hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375 are potentially associated with CAKUT according to their positionTo systematically identify miRs specifically associated with CAKUT, a supervised analysis was conducted by combining CIA and BGA. [score:1]
[1 to 20 of 12 sentences]
35
[+] score: 29
A recent study uncovered that miR-375 is involved in a forward feedback loop that regulates ESR1 expression, whereby ESR1 enhances miR-375 expression and miR-375 targets and reduces the expression level of RASD1 (ras dexamethasone -induced 1) gene, which is a transcriptional inhibitor of ESR1 [42]. [score:12]
miR-375 targets and inhibits the expression of RASD1 (ras dexamethasome -induced 1) gene, which is an inhibitor of the ESR1 gene expression. [score:11]
With this positive feedback, ESR1 can activate its own expression by reducing the inhibition of RASD1 through activation of miR-375. [score:5]
A) ESR1 activates the transcription of a microRNA, miR-375, probably by binding to the putative promoter of the microRNA. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 28
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
a Relationships among the target genes predicted by miR-98, miR-375, and miR-335. [score:3]
c Main pathway influenced by genes targeted by two or more miRNAs from miR-98, mir-375, and miR-335. [score:3]
a Main biological processes influenced by genes targeted by two or more miRNAs (miR-98, mir-375, and miR-335). [score:3]
GO analysis showed that the most significant biological processes for miR-98, miR-375, and miR-335 include positive regulation of transcription from RNA polymerase II promoter, regulation of transcription, DNA -dependent and ubiquitin -dependent protein catabolism, platelet-derived growth factor receptor signaling pathway, embryonic hindgut morphogenesis (Fig.   3a). [score:3]
Five miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) matched the criterion. [score:1]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These candidate miRNAs included representatives that exhibited regulated patterns of expression from each of the two primary classes detected, namely: those with highest expression in the caput (let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p), or highest expression in the cauda (miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:8]
In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
0135605.g008 Fig 8In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
In this context, qPCR confirmed highly significant down-regulation of let-7c-5p, let-7b-5p, miR-375-3p, miR-467d-3p, and miR-200c-3p between the proximal and distal epididymal segments. [score:4]
[1 to 20 of 4 sentences]
38
[+] score: 25
Consistently, miR-375 was also downregulated in FLS of arthritis rat mo del; an increased expression of miR-375 inhibited the canonical Wnt pathway by directly targeting Fzd8. [score:11]
Among these, the miR-152 and miR-375 were downregulated, and the miR-663 was upregulated in RA patients or rat mo dels. [score:7]
Functionally, the increased miR-375 reduced the pathogenesis of arthritis rat mo del, as indicated by decreased expression of disease markers, such as MMP3 and fibronectin. [score:5]
Recently, a series of investigations conducted by Miao et al. demonstrated that several miRNAs, including miR-152, miR-375, and miR-663, were involved in the pathogenesis of RA by targeting Wnt signaling pathways [35, 74, 77, 78]. [score:1]
Interestingly, such effect of miR-375 could be blocked in the presence of an active form of β-catenin [78]. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 23
MECP2 (methyl CpG binding protein), a circadian-cycle dependent epigenetic regulator of gene expression in the brain [42] is also a validated target of miR-375. [score:6]
In addition, p21 is a target of p53 which is targeted by both miR-375 (p = 0.0001) and miR-150-5p (p = 0.001). [score:5]
MiR-139-5p (p = 0.0006) targets IGF1R which together with PDK1 (a kinase downstream of IGF1R (both IGF1R and PDK1 are targeted by miR-375)) has been shown to be induced by light in a study of the coupling of cell proliferation with diurnal/circadian cycles in a human breast cancer mo del [51]. [score:5]
Finally, miR-375 also targets MYC which competes with the Clock-Bmal1 master circadian transcription factor for the same nucleotide sequence motifs in the genome [44]. [score:3]
In the case of miR-375 –a highly significantly fluctuating miRNA (p < 0.0001) there are a number of functionally validated targets of possible relevance including transcription factor SP1 which is among the top 5 transcription factors associated with circadian clocks in mice [41]. [score:3]
miRNA Mesor Amplitude Max time Min time P-value hsa-miR-375 -6.4 1.2 00:32 12:32 <0. [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 23
All 6 miRNAs (hsa-miR-21-5p, hsa-miR-31-5p, hsa-146a-5p, hsa-miR-155-5p, hsa-miR-375 and hsa-miR-650) with increased expression in active UC demonstrated a similar upregulated expression profile in both active CDc and IC compared to healthy controls. [score:7]
Remarkably, although initially identified in the microarray analysis as significantly downregulated, we identified a significant upregulation of hsa-miR-375 in active UC patients vs. [score:7]
The miRNA microarray expression data was confirmed by performing qRT-PCR for hsa-miR-200c-3p and 10 other differentially expressed miRNAs selected because of their highly significant p-value or fold change (hsa-miR-21-5p, hsa-miR-31-5p, hsa-miR-146a-5p, hsa-miR-155-5p, hsa-miR-196b-5p, hsa-miR-196b-3p, hsa-miR-200b-3p, hsa-miR-375, hsa-miR-422a and hsa-miR-650). [score:5]
Epithelium-expressed hsa-miR-375 has an important role in epithelium immune system by regulating goblet cell differentiation [43]. [score:4]
[1 to 20 of 4 sentences]
41
[+] score: 21
Analysis of the expression levels of the nine-miRNA panel revealed that three miRNAs (miR-122-5p, miR-150-5p, and miR-375) were similarly altered (all up-regulated) in mice with DSS -induced and TLR5 [−/−] colitis compared to the corresponding healthy controls (Fig.   3A). [score:5]
Among the commonly deregulated miRNAs, microRNA-375 was previously described as being up-regulated in serum from UC and CD patients [49] and in IL10 [−/−] mice [50]. [score:5]
miRNA nameIL10 [−/−] mice mo del Intestinal Inflammation Inflammation mmu-miR-29b-3p x mmu-miR-122-5p x x x mmu-miR-148a-3p x mmu-miR-150-5p x x mmu-miR-192-5p x mmu-miR-194-5p x mmu-miR-146a-5p x mmu-miR-375-3p x x x mmu-miR-199a-3p x We showed that our nine-miRNA signature could discriminate between the different forms of colitis and arthritis, as well as between non-colitic mice with and without a genetic predisposition to develop the disease (WT mice versus non-colitic IL10 [−/−] mice). [score:3]
Particularly, miR-375-3p and miR-199a-3p had similar expression levels in D98 anti-TNFα treated group and non -treated group. [score:3]
Thus, among the nine miRNAs of the identified signature, two were deregulated in both intestinal inflammation and arthritis (miR-122-5p and miR-375), one was specifically deregulated in all three intestinal inflammation mo dels (miR-150-5p), and the others appeared to be specific to the IL10 [−/−] mouse mo del. [score:3]
Expressional analysis of the nine-miRNA signature in sera of CAIA mice revealed that two of the miRNAs (miR-122-5p and miR-375) were increased in arthritic mice compared to non-arthritic control mice (day 2) as it was observed in the IL10 [−/−] mice (Fig.   3A). [score:2]
[1 to 20 of 6 sentences]
42
[+] score: 20
Several of the most highly expressed miRNAs in human islets (including miR-375, miR-7-5p, miR-148a-3p, miR-26a-5p and miR-127-3p) have been previously described in rodent or human islets [7], [17]– [20]. [score:3]
Our study establishes that miR-375 is also abundantly expressed in human islets and warrants further studies to define the contribution of miR-375 to the pathogenesis of T2D. [score:3]
Our data adds support for an islet-enriched expression pattern of six miRNAs previously highlighted by microarray studies (miR-184, miR-183-5p, miR-7-5p, miR-127-3p, miR-375, and miR-493-5p) [17], [20]. [score:3]
For example, amongst the most highly expressed miRNAs, miR-375 shows substantially higher abundance in enriched beta-cells as compared to islets (42% vs 27%) whilst the opposite is true for miR-143-3p (2% vs 16%). [score:2]
On the basis that an average islet contains ∼50% beta-cells [23], and, given an estimated 90% purity of the FACS-enriched beta-cell preparations, the ∼1.5 fold enrichment of miR-375 in beta-cells compared to islets indicates that, in human as in rodents [7], this miRNA is predominantly expressed in beta-cells. [score:2]
Furthermore, knockdown of miR-375 in obese ob/ob mice results in a more profound effect on glycaemia leading to a severe diabetic phenotype in these mice [40]. [score:2]
For example, miR-375 has been reproducibly shown to be involved in the regulation of glucose-stimulated insulin secretion in the murine insulin-secreting cell-line MIN6 [7], [8] and other miRNAs (let-7, miR-103 and -107) influence insulin sensitivity in rodents [9], [10]. [score:2]
PLoS Genet 6. 40 Poy MN, Hausser J, Trajkovski M, Braun M, Collins S, et al (2009) miR-375 maintains normal pancreatic alpha- and beta-cell mass. [score:1]
miR-375 null mice are hyperglycaemic and exhibit reduced beta-cell mass [40]. [score:1]
The abundance of miR-375 in the miRNA profile provides valuable support for a critical role in human pancreatic beta-cells, mirroring the well-established role in rodent islet biology. [score:1]
[1 to 20 of 10 sentences]
43
[+] score: 20
miR-375 was recently shown to directly target the transcriptional coactivator YAP1 in neuroendocrine-lung cancers [127], and was identified as a tumor suppressor gene in human papillomavirus -mediated cervical cancers [128]. [score:6]
In particular, the robust association of miR-141, miR-200b, and miR-375 with metastatic disease is noteworthy: These markers could potentially be applied at the time of diagnosis to identify patients with aggressive disease/micrometastases, and/or to predict recurrence following primary treatment. [score:5]
As there is an urgent need to increase the diagnostic specificity of prostate cancer tests, while maintaining—or even increasing—sensitivity, combination of a miRNA signature, including e. g., circulating miR-141, miR-125b, miR-200b, and miR-375 [118, 126, 130], with traditional protein markers, could translate into a better diagnostic tool with higher specificity, sensitivity, and accuracy, suitable for population-wide screening efforts. [score:3]
Various miRNAs were highly abundant in the sera of patients with metastatic disease, including miR-141, miR-375, miR-9-3p, miR-200b and miR-516a-3p. [score:3]
A recent study identified 16 miRNAs, including miR-141, miR-200b, and miR-375, at differential levels in the plasma of men with localized or metastatic prostate cancer [130]. [score:1]
Further validation identified circulating miR-141 and miR-375 to be the most pronounced markers for high-risk tumors. [score:1]
We recently achieved amplification-free detection of prostate cancer-specific (miR-141 and miR-375) and lung cancer-specific (miR-30d-5p and miR-25-3p) miRNAs at subpicomolar concentrations (T. K. and A. R., unpublished). [score:1]
[1 to 20 of 7 sentences]
44
[+] score: 20
Likewise, miR-375 was shown to be downregulated in HNSCC and to function as a tumor suppressor by regulating the expression of AEG-1/MTDH, CIP2A (cancerous inhibitor of protein phosphatase 2A). [score:11]
Transient transfection of miR-375 in HNSCC-derived cells reduced the expression of CIP2A (cancerous inhibitor of protein phosphatase 2A) [61, 62]. [score:5]
Furthermore, miR375 sensitized TNF- α -induced apoptosis probably through inhibiting NF- κB activation in vitro [63]. [score:3]
miR-31, miR-17/20a, miR-125b, miR-155, miR-181, miR-375 and miR-491-5p, miR-205, and miR-let7d were found to be associated with lymph node metastasis and poor OSCC patient survival [38, 59, 60, 65, 72, 77– 80]. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 20
The down regulation of IGF-1 in the parous breast, in association with the significant down-regulation of SOX6, EBF1 (early B-cell factor 1), ABHD5, RASD1, a potential miR-375 target that negatively regulates ER alpha expression in breast cancer [51], and RALGAPA2, could represent a significant driving force in the reduction of breast cancer risk conferred by pregnancy. [score:10]
The down-regulation of RASD1 (RAS, dexamethasone -induced 1), a potential miR-375 target that negatively regulates ER alpha expression in breast cancer further confirms that the genes involved in the estrogen receptor regulated pathways could be under permanent transcriptional modification as a manifestation of a higher degree of cell differentiation of the parous breast, in spite of the lack of transcriptomic differences in the levels of the receptor between parous and nulliparous breast tissues. [score:10]
[1 to 20 of 2 sentences]
46
[+] score: 19
Recent studies indicate that during human pancreatic development miR-7, miR-9, miR-375 and miR-376 are specific islet microRNAs expressed at high levels [18, 19]. [score:4]
The miR-375 gene promoter directs expression selectively to endocrine pancreas [32]. [score:4]
We found that only statistically significant increase of expression was for miR-7. miR-375 showed an increasing trend, however slightly below the threshold value (p = 0.08), which might be the result of a low sample number. [score:3]
miR-503miR-503 is expressed in a pattern similar to that of miR-375 in a mouse progenitor cells at e14.5 pancreas [13]. [score:3]
For example, knockdown of miR-375, an islet microRNA that negatively controls insulin secretion [15], has a deleterious effect on the developing pancreas of zebra fish [16]. [score:2]
MiR-7, miR-124, miR-9 and miR-375, are microRNAs previously reported as related to pancreatic islets [18- 20]. [score:1]
miR-375 K/O mice are hyperglycemic -more alpha cells; less beta-cells- [17]. [score:1]
Mice lacking miR-375 (375 KO) are hyperglycemic and exhibit an increase in total pancreatic alpha-cell numbers, whereas the pancreatic beta-cell mass is decreased [17]. [score:1]
[1 to 20 of 8 sentences]
47
[+] score: 19
MicroRNA-375 suppresses human colorectal cancer metastasis by targeting Frizzled 8. Oncotarget. [score:6]
MicroRNA-375 inhibits colorectal cancer growth by targeting PIK3CA. [score:4]
The expression of microRNA-375 in plasma and tissue is matched in human colorectal cancer. [score:3]
Expression levels of microRNA-375 in colorectal carcinoma. [score:3]
Although the miRNAs discussed in this section are oncogenic, both miR-215 (Chiang et al., 2012; Karaayvaz et al., 2011; Faltejskova et al., 2012; Slattery et al., 2015) and miR-375 (Dai et al., 2012; Faltejskova et al., 2012; Wang et al., 2014d; Xu et al., 2014, 2016) are tumor-suppressive miRNAs that could be used for CRC screening, although an analysis of miRNA levels in blood or stool is needed. [score:3]
[1 to 20 of 5 sentences]
48
[+] score: 19
He et al. reported that miR-375 targets astrocyte elevated gene-1 (AEG-1) in HCC and suppresses liver cancer cell growth in vitro and in vivo. [score:5]
These findings indicate that miR-375 targets AEG-1 in HCC and suppresses liver cancer cell growth [51]. [score:5]
Overexpression of miR-375 in liver cancer cells decreased cell proliferation, clonogenicity, migration, and invasion, and induced G1 cell cycle arrest and apoptosis. [score:3]
[50] miR-375 HCC AEG-1 Overexpression of miR-375 in liver cancer cells decreased cell proliferation, clonogenicity, migration, and invasion, and induced G1 cell cycle arrest and apoptosis. [score:3]
Direct administration of cholesterol-conjugated 2’-O-methyl -modified miR375 mimics significantly affected the growth of HCC xenografts. [score:2]
miR-375 in hepatocellular carcinoma (HCC) cells. [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 19
Specifically, miR-375 is predicted to be involved in a KEGG pathway associated with diabetes (Figure 2) and the cluster miR-19 a/b is associated with numerous pathways with a significant role in the biology of NAFLD, including apoptosis, mTOR, MAPK, adipocytokine and hedgehog signaling [2]; a full list of predicted pathways is shown in Figure 2. Figure 2The graph represents a heat-map of predicted targets aggregated in co -expression clusters and ranked according to their biological function based on KEGG (Kyoto Encyclopaedia of Genes and Genomes) pathways or Gene Ontology (GO) analysis. [score:5]
Specifically, miR-375 is predicted to be involved in a KEGG pathway associated with diabetes (Figure 2) and the cluster miR-19 a/b is associated with numerous pathways with a significant role in the biology of NAFLD, including apoptosis, mTOR, MAPK, adipocytokine and hedgehog signaling [2]; a full list of predicted pathways is shown in Figure 2. Figure 2The graph represents a heat-map of predicted targets aggregated in co -expression clusters and ranked according to their biological function based on KEGG (Kyoto Encyclopaedia of Genes and Genomes) pathways or Gene Ontology (GO) analysis. [score:5]
Predicted analysis of target genes, regulatory network and associated functional pathways of miR-375 and the cluster of miR-19a-b. DISCUSSION. [score:4]
Predicted targets of miR-375 consist of a list of 634 genes, 317 of which falling within the first 50th percentile. [score:3]
Specifically, we tested the hypothesis of an association between rs2829145 genotypes and circulating levels of mir-122, miR-192, miR-375 and the complex miR-19 a/b; these miRNAs were selected because we already found a significant association with NAFLD [24]. [score:1]
In the A-allele carriers, we observed increased circulating levels of the complex miR-19a (p =0.008) and miR-19b (p =0.0009), as well as circulating levels of miR-375 (p =0.029) (Figure 1). [score:1]
[1 to 20 of 6 sentences]
50
[+] score: 19
Interestingly, we found that TSLP positively correlated with miR-375 expression in colon tumors tissues (Supplementary Figure S4), implying a possible involvement of miR-375 in down-regulated TSLP expression in colon cancer cells. [score:8]
Various factors have been reported to regulate TSLP expression under different pathological conditions, among which miR-375 was shown to up-regulate TSLP in intestinal epithelial cells following helminth infection [27]. [score:7]
Recent study also showed that miR-375 was the single most down-regulated miRNA in rectal cancer [28]. [score:4]
[1 to 20 of 3 sentences]
51
[+] score: 19
In addition, the larger list of mRNA targets of mouse miR-375 is comparable to the human list, in terms of gene. [score:3]
Mir375 is also involved in regulating insulin expression and secretion. [score:3]
Mir375, specifically expressed in islet cells, is believed to play a role in the early stages of islet development, particularly as the embryonic stem cells differentiate into liver and insulin secretory cells [48]. [score:3]
Several, including Mir375, are differentially expressed in T2D patients and rodent mo dels such as the obese diabetic mouse and the GK rat. [score:2]
The only validated mRNA target of rat Mir375 is Pdk1, also validated for the human and mouse microRNA 375. [score:2]
And Mir375 is one of a number of involved in insulin synthesis and secretion (for instance Mir9 and Mir29a/b/c), insulin sensitivity in target tissue (Mir143 and Mir29) or glucose and lipid metabolism (Mir103/107 and Mir122) and thus, having potential roles in diabetes [see for instance, [52], [53]. [score:2]
The promoter region of MIR-375 contains binding sites for ONECUT1, (also known as HNF6) and INSM1 transcription factors, both important for the development of pancreatic islets. [score:2]
The results for the human MIR375 are shown [Fig.  10 and insets]. [score:1]
Interestingly, NEUROD1 and possibly PDX1 may have a role in the transcription of MIR-375—a microRNA associated with pancreatic function [48]. [score:1]
[1 to 20 of 9 sentences]
52
[+] score: 18
Poy et al. [12] reported that overexpression of miR-375 resulted in suppressed glucose-stimulated insulin secretion and its inhibition resulted in enhanced insulin secretion. [score:7]
Keller et al. [23] suggested the additional targets of miR-375 could be the pancreatic transcription factors pdx-1 and NeuroD1. [score:3]
Inhibition of Myotrophin production has similar effects of miR-375 on insulin secretion, making miR-375 an important modulator of β-cell function. [score:3]
Myotrophin, a protein that has a role in exocytosis, was identified as one of the targets of miR-375. [score:3]
This indicates that miR-375 may play important role in interacting with transcription factors that control pancreatic maintenance and development [24]. [score:2]
[1 to 20 of 5 sentences]
53
[+] score: 18
MiR-375, which is thought to downregulate CDK5R1, was downregulated in our AD cases and correlated significantly with Aβ [1–42] (r = 0.7481, p = 0.002). [score:6]
Most relevant gene targets identified by IPA were BACE1, REST for miR-103, MAPT for miR-219 and CDK5R1 for miR-375 (S4 Dataset). [score:3]
S3 DatasetLog2-transformed miRNA expression ratios obtained from RT-qPCR analysis are plotted for the most reliable (RF ≥ 0.8) miRNAs from set A: (A) miR-100, (B) miR-146a, (C) miR-1274B and the most informative (MoR-value d≥0.57) miRNAs from set B: (D) miR-505*, (E) miR-375, and (F) miR-103. [score:3]
Moreover, we could also confirm the 9 informative miRNAs (miR-505-5p, miR-4467, miR-766, miR-375, miR-708, miR-3622b-3p, miR-296, miR-219 and miR-103) from set B as significant biomarkers by MANCOVA all reaching Bonferroni corrected significance. [score:1]
Another discriminant analysis performed on the most reliable biomarker miR-100 from set A (Fig 2B and 2C and S3 Dataset) and the most abundant miR-103 and miR-375 from set B (S2 Dataset and S3 Dataset) revealed for the two test groups a total correct classification rate of 96% after substitution of missing values, positively classifying controls and AD cases with 96.4% and 95.5% accuracy, respectively. [score:1]
By performing discriminant analysis including candidate miRNAs of both subsets as well as in combination with CSF protein marker, we could, irrespective of FOC, demonstrate overall classification rates of 96% (miR-100, miR-375 and miR-103) and 86.4% (miR-146a and p-tau). [score:1]
S5 Dataset ROC curves for the combination of (A) miR-146a and p-tau, and (B) miR-100, miR-103 and miR-375 to separate 28 control- from 22 AD cases. [score:1]
The MoR plot illustrates the 9 most informative miRNAs, hsa-miR-505-5p, hsa-miR-4467, hsa-miR-766, hsa-miR-375, hsa-miR-708, hsa-miR-3622b-3p, hsa-miR-296, hsa-miR-219 and hsa-miR-103, each reaching a MoR value ≥ 0.57 (critical MoR value on the information chain). [score:1]
ROC curve analysis showed an AUC of 0.72 (miR-100), an AUC of 0.87 (miR-103) and an AUC of 0.99 (miR-375) for this combination (S5 Dataset). [score:1]
[1 to 20 of 9 sentences]
54
[+] score: 18
Some specific miRNA, such as miR-375 in LUSC, exhibited opposite expression patterns in females (up-regulated, log [2]FC = 1.53) and males (down-regulated, log [2]FC = -2.73), whereas the miRNA was identified as normally expressed miRNA based on the mixed samples (log [2]FC = -0.35). [score:11]
Interestingly, the specific miRNA, miR-375, was identified as up-regulated miRNA in female-specific UCEC (log [2]FC = 2.61, P = 0.0262), whereas it was also determined as up-regulated miRNA without statistical significance in male-specific PRAD (log [2]FC = 2.15, P = 6.93E-10) (S2 Table). [score:7]
[1 to 20 of 2 sentences]
55
[+] score: 18
Interestingly, 14 of these miRNAs (miR-596, miR-630, miR-422a, miR-490-5p, miR-375, miR-708, miR-345, miR-125b-2, miR-516a-3p, miR-135a, miR-1228, miR-1915, miR-134, and miR-663) have established roles in tumor suppression and drug resistance, while 5 miRNAs (miR-630, miR-375, miR-345, miR-1228, and miR-134) are known to inhibit epithelial–mesenchymal transition and invasion in cancer cells. [score:5]
A significant correlation of high expression of miR-596, miR-630, miR-490, miR-375, and miR-708 with overall long-term survival in breast cancer (GEO dataset IDs: GSE37405 and GSE37405) or nasopharyngeal carcinoma patients (GEO dataset ID: GSE36682) was observed when compared to low expression of the respective miRNA. [score:4]
Five highly up-regulated miRNA 12 h after 8 mM ascorbate treatment (miR-596, miR-630, miR-490, miR-375, and miR-708) were analyzed using the free online MIRUMIR database (28), which is incorporated into BioProfiling. [score:4]
We were able to find a strong correlation of high expression of miR-596, miR-630, miR-490, miR-375, and miR-708 with overall long-term survival in breast cancer or nasopharyngeal carcinoma patients when compared to low expression of the respective miRNA in the same cohorts of patients. [score:4]
The Kaplan–Meier plots as depicted in Figure 7 were automatically generated by MIUMIR upon submission of the respective miRNAs (miR-596, miR-630, miR-490, miR-375, and miR-708). [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In mammals, miR-7, miR-7b, miR-141, miR-200a, and miR-375 are enriched in the pituitary (Landgraf et al. 2007; Bak et al. 2008); similarly, in situ detection during zebrafish development shows the expression of miR-375 in pituitary (Wienholds et al. 2005; Kapsimali et al. 2007), indicating evolutionary conservation of miRNA in pituitary function. [score:4]
Some miRNAs, such as miR-375, are uniquely expressed in pancreatic cells; Kloosterman et al. (2007) have shown the importance of miR-375 in the insulin-secreting pancreatic islets, as miR-375-knockdown zebrafish embryos had dispersed islet cells. [score:4]
Poy et al. (2004) have demonstrated that miR-375 targets myotrophin and is involved in insulin exocytosis. [score:3]
In mammals, miR-7, miR-9, miR-29b, miR-30d, miR-124a, and miR-375 regulate the secretion and islet development (Poy et al. 2004; Baroukh and Van Obberghen 2009; Tang et al. 2009; Pullen et al. 2011). [score:3]
This process is negatively regulated by miR-375 in mice (Zhang et al. 2013a). [score:2]
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
[1 to 20 of 6 sentences]
57
[+] score: 17
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
2) Some miRNAs, including let-7 family (let-a, -b and -c), miR-16, miR-23b, miR-26, miR-31 and miR-375, were always highly expressed either before or after transdifferentiation (data not shown). [score:3]
[1 to 20 of 3 sentences]
58
[+] score: 17
Curiously, the upregulation of let-7d-3p and miR-375 and downregulation of miR-21-3p and miR-146b-5p are opposite to what one would have expected based on a previously published review of miRNAs in allergic diseases[49]. [score:9]
On the other hand, a number of breast milk miRNAs found to be associated with the development of atopic dermatitis were the relatively highly expressed miRNAs: miR-22-3p, miR-146b-5p, miR-21-5p, miR-375 and let-7f-5p. [score:4]
However, a number of them are relatively highly expressed including miR-146b-5p, miR-21-5p, miR-22-3p, miR-375 and let-7f-5p. [score:3]
Experimental evidence in support of this theory comes from mouse studies which have demonstrated improved epithelial barrier function associated with miR-146b[43], involvement of miR-375 in epithelium-immune system crosstalk[44] and promotion of innate immune tolerance in the neonatal period by miR-146a[45]. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 16
The expression levels of miRNA-146a, miR-150, miRNA-375, and miRNA-19a were significantly downregulated in patients with AF. [score:6]
Only the expression tendencies of miRNA-150, but miRNA-146a, miRNA-19a, and miRNA-375, correspond to the result of the in-depth analysis. [score:3]
Absolute expression values of miR-146a, miR-150, miR-19a, and miR-375 in PAF patients (n = 30), PersAF patients (n = 30), and the control group (n = 30). [score:3]
In contrast, miR-150 and miRNA-375 had a significantly lower levels of expression in the PAF group than in the healthy group (fold change = 0.06; 0.11 respectively, P<0.01). [score:3]
Four candidate microRNAs (miRNA-146a, miRNA-150, miRNA-19a and miRNA-375) were tested using an independent cohort of 90 plasma samples with qRT-PCR. [score:1]
[1 to 20 of 5 sentences]
60
[+] score: 16
Interestingly, miR-375 that is specifically expressed in islet cells of the pancreas and regulates insulin expression [32] was found to be significantly decreased exclusively in serum of T2DM subjects. [score:6]
The level of the diabetes-related miR-375 was found to be significantly decreased in T2DM patients while some T2DM -associated miRNAs were upregulated such as miR-221 and miR-222 (Fig 4B). [score:4]
Since the decrease of miR-375 expression in beta islet cells has been shown to cause an increase of insulin production, the decrease of circulating levels of serum miR-375 observed in our study might reflect the high insulin production that is a hallmark of T2DM. [score:3]
The figure presents serum levels, based on normalized sequencing reads, of significantly altered miRNAs in APAP, HBV, LC, T2DM an HC for miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p (A) and miR-221-5pp, miR-222-3p, miR-375 and miR-885-5p (B). [score:1]
Furthermore, since several miRNAs such as miR-122 or mir-375 show excellent tissue specificity, miRNA platforms show promise as potential tissue specific biomarkers. [score:1]
0177928.g004 Fig 4 The figure presents serum levels, based on normalized sequencing reads, of significantly altered miRNAs in APAP, HBV, LC, T2DM an HC for miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p (A) and miR-221-5pp, miR-222-3p, miR-375 and miR-885-5p (B). [score:1]
[1 to 20 of 6 sentences]
61
[+] score: 16
Other miRNAs from this paper: hsa-mir-21, hsa-mir-29b-1, hsa-mir-29b-2
However, the accuracy of miRNA expression might be interfered by different materials and methods used in these experiments, For example, miR-21, which has been recognized as an oncomir in most of cancers, did not show any differences between case and control groups in some experiments [21]; miR-375, which was found to be down-regulated in multiple cancers, was shown to be up-regulated in some cancers [22- 24]. [score:9]
When users plan to query the expression pattern in all kinds of cancer, they can choose the key word “hsa-miR-375” from the “Search by miRNA Name” drop-down list and retrieve all the systematic documentation of the selected miRNA. [score:3]
For instance, hsa-miR-375 was reported in a lot of original publications and it was hard to make a full understanding of its expression pattern in various cancer. [score:3]
After that, a“search results" web page emerges and shows all of information involved in “hsa-miR-375” from queried cancer papers. [score:1]
[1 to 20 of 4 sentences]
62
[+] score: 15
The expression of SLK, a Ste20-related kinase, is regulated by miR-375 [39], so low abundance of this miRNA could produce overexpression of SLK able to induce stress fiber disassembly, dysregulate cytoskeletal organization in responses to apoptotic stimuli in patients with LN-IV and LNN. [score:7]
CTCF binds to unmethylated DNA in the CpG islands of ERα -negative cells and induces silencing of miR-375 expression [38] similar to what we found in patients with LN-IV and LNN. [score:3]
DNA hypermethylation is observed in the CpG island of ERα -positive breast cancer cells showing high expression of miR-375, whereas DNA hypomethylation and histone H3 K9 dimethylation are observed in the CpG islands of ERα -negative breast cancer cells. [score:3]
There are CpG islands in the upstream region of the miR-375 gene. [score:1]
The miRNA miR-375-3p was found 5.54 (log FC = -2.77) times less in patients with LN-IV than in healthy individuals, and 4.68 (log FC = 2.34) times more in patients with LN-IV than LNN. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Luminal-restricted miRNAs included miR-10a (targets KLF4 and PIK3CA) [41, 42], miR-200a/b (targets EMT (epithelial mesenchymal transition) genes) [43], miR-148a (targets Bim) [44] and miR-375 (targets PDK1) [45]. [score:9]
Tsukamoto Y Nakada C Noguchi T Tanigawa M Nguyen LT Uchida T MicroRNA-375 is downregulated in gastric carcinomas and regulates cell survival by targeting PDK1 and 14-3-3zetaCancer Res. [score:6]
[1 to 20 of 2 sentences]
64
[+] score: 15
To correct (to the extent possible) for this difference, we excluded a further 20 target sites with GU pairs and mismatches in the seed region for miR-134, and 8 target sites for miR-296 (all target sites for miR-375 have WC matches in the seed region), and report the results of 65 target genes examined for miR-134, 6 for miR-296 (for miR-296, all six sites examined were validated), and 22 for miR-375. [score:9]
miRNA Condition Number of targets miR-134 WC bp at nt 2–7 True positives 43 Sensitivity = 0.551 False negatives 35 Specificity = 0.666 False positives 3 True negatives 6 Total 87 WC bp at nt 2–7, and 40% FE threshold (−18.64) True positives 36 Sensitivity = 0.462 False negatives 42 Specificity = 0.666 False positives 3 True negatives 6 Total 87 miR-296 WC bp at nt 2–7 True positives 8 Sensitivity = 0.80 False negatives 2 Specificity = 0.50 False positives 1 True negatives 1 Total 12 WC bp at nt 2–7, and 40% FE threshold (−19.44) True positives 7 Sensitivity = 0.70 False negatives 3 Specificity = 0.50 False positives 1 True negatives 1 Total 12 miR-375 WC bp at nt 2–7 True positives 9 Sensitivity = 0.375 False negatives 15 Specificity = 0.929 False positives 1 True negatives 13 Total 38 WC bp at nt 2–7, and 40% FE threshold (−16.68) True positives 8 Sensitivity = 0.333 False negatives 16 Specificity = 0.929 False positives 1 True negatives 13 Total 38Of 158 genes experimentally tested for regulation by miR-134, 85 occur in our database, as do 14 of 24 tested for regulation by miR-296, and 22 of 44 tested for regulation by miR-375. [score:6]
[1 to 20 of 2 sentences]
65
[+] score: 15
After the first round of random walk, we chose the top 10 predicted target miRNAs and discovered that the 3rd target (hsa-mir-450a-2), the 5th target (hsa-mir-23a), the 6th target (hsa-mir-29b-2), the 7th target (hsa-mir-320b-1) and the 10th target (hsa-mir-375) were associated with the predicted disease breast neoplasms [44]. [score:15]
[1 to 20 of 1 sentences]
66
[+] score: 14
Two clusters (V and X) significantly correlated with the expression of E genes suggesting that in GBM miRNAs other than miR-200, miR-7, miR-203, or miR-375 regulate the epithelial nature of the cancer cells. [score:4]
The epithelial miRNAs also included three miRNAs we previously identified as novel epithelial regulators, miR-7, miR-203, and miR-375 (highlighted in orange in Figure  1C). [score:2]
In addition, we identified and validated three other miRNAs that regulated EMT: miR-7, miR-203 and miR-375 [4]. [score:2]
In addition to the miR-200 family members, the EMT signature also contained miR-7, miR-203, and miR-375, which we previously identified and validated as novel EMT regulating miRNAs [4]. [score:2]
Exact functional opposites were found in the miRNA group that contained the miR-200 families plus miR-7, miR-203, and miR-375 (Figure  1C). [score:1]
In OvCa, only miR-375 was part of the cluster with the strongest epithelial nature. [score:1]
In OvCa, the cluster most significantly correlating with the E genes was cluster V. While this cluster contained the epithelial miRNA miR-375, all 5 members of the miR-200 family were part of cluster VI, which did not correlate with the E genes as significantly as cluster V miRNAs. [score:1]
miRNAs: red, miR-200 family; blue, miR-17 family; orange, other EMT-related miRNAs recently identified [4] (miR-7, miR-203, and miR-375). [score:1]
[1 to 20 of 8 sentences]
67
[+] score: 14
Similarly, AUF1 knockdown significantly increased the abundance of miR-1, miR-21, and miR-375, while Dicer1 knockdown reversed the upregulation of these miRNAs in Huh7 cells. [score:6]
Just as its impact on miR-122, AUF1 knockdown resulted in the decreased levels of miR-1, miR-21, and miR-375. [score:2]
It is noteworthy that miR-122, miR-1, miR-21, miR-125b, and miR-375 are so called onco-miRs, which play various roles in tumor development such as carcinogenesis, malignant transformation, and metastasis [40, 41]. [score:2]
To this end, four miRNAs (miR-1, miR-21, miR-125b, and miR-375) were selected to represent the impact of AUF1. [score:1]
Huh7 cells were transfected with siAUF1 and siDicer1 for 36–48 h. (A– E) The levels of oncogenic miRNAs (miR-1, miR-21, miR-125b, miR-375) and miR-122 were determined by qRT-PCR. [score:1]
The levels of four oncogenic miRNAs (miR-1, miR-21, miR-125b, and miR-375) were determined by qRT-PCR. [score:1]
Figure 6Huh7 cells were transfected with siAUF1 and siDicer1 for 36–48 h. (A– E) The levels of oncogenic miRNAs (miR-1, miR-21, miR-125b, miR-375) and miR-122 were determined by qRT-PCR. [score:1]
[1 to 20 of 7 sentences]
68
[+] score: 14
These changes in the expression levels of full length and shorter isoforms may be sustained, at least in part, by deregulation of 17 miRNAs, with particular reference to miR-200a-3p and miR-375 that exhibited very high levels of downregulation in all samples in the exploratory cohort (Figs. 5 and 6). [score:7]
Finally, 17 miRNAs to target TP53 transcripts were deregulated highlighting the levels of miR-200a-3p and miR-375 downregulation of (Fig.   5; Additional file  8: Table S6). [score:7]
[1 to 20 of 2 sentences]
69
[+] score: 14
Luo et al. [313] performed an integrated analysis of miRNAs and mRNA expression profiles in 12 BC cell lines, identifying 35 functional target genes of three significantly down-regulated miRNAs in invasive cell lines (miR-200c, miR-205, and miR-375). [score:8]
miR-106b-25 expression was proven significantly predictor of good relapse time [136], while miR-375 was found negatively regulate ER expression [137]. [score:6]
[1 to 20 of 2 sentences]
70
[+] score: 13
Another study revealed low expression levels of miR-375 in gastric cancer tissues, showing that its ectopic expression in gastric carcinoma cells reduced cell viability via suppressing JAK2, PDK1 and 14-3-3zeta, indicating that miR-375 is a candidate tumour suppressing miRNA in gastric carcinoma (Refs 85, 86). [score:9]
Clinicopathological characteristic miRNAs Overall survival and recurrence: miR-10b, miR-21*, miR-214*, miR-335*, miR-375(78, 94, 121, 122, 123, 124, 125, 126, 127, 128) Tumor-suppressor-miRs: Let-7a*, Let-7 g*, miR-125a*, miR-126, miR-146a, miR-142-5p, miR-223, miR-338, miR-433 *miRNAs are also reported to be aberrantly expressed in human ovarian cancer. [score:3]
Their results indicated that the combination of miR-375 and miR-142-5p could predict recurrence risk for gastric cancer patients. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 13
For example, miR-375 that was identified as "pancreas islet-specific" miRNA and functions as a regulator of insulin secretion from the islet cells [32], but we clearly showed that this miRNA belong to the epithelial subgroup of the GI/epithelial expression cluster, and was preferentially expressed in organs lined with epithelium (Group III in Figure 3). [score:6]
It was proposed by the authors that miR-375 could be a pharmacological target for treating diabetes [32], but the possibility of its functions in non-insulin-secreting epithelial cells suggested by our data should not be dismissed, especially any possible collateral effects from other tissues when targeting miR-375 for pancreas treatment is considered. [score:4]
For example, a prominent expression of a group of miRNAs (miR-141, miR-200 family, miR-429, miR-375, and miR-31) mainly in epithelial tissues, such as lung, breast, and the gastrointestinal organs (r = 0.72, Figure 2), contributed to separate all the normal tissues examined into two parts. [score:3]
[1 to 20 of 3 sentences]
72
[+] score: 13
The hsa-miR-98 and hsa-miR-375 miRNAs were upregulated, whilst hsa-miR-7-5p, hsa-miR-615-3p and hsa-miR-577 were downregulated. [score:7]
The log [2] (MN/NC) values of hsa-miR-98 and hsa-miR-375 were 4.28 and 2.63, respectively, again confirming the previous data, indicating that they were upregulated. [score:4]
The expression levels of 5 randomly selected miRNAs: hsa-miR-7-5p, hsa-miR-615-3p, hsa-miR-577, hsa-miR-98 and hsa-miR-375, were compared. [score:2]
[1 to 20 of 3 sentences]
73
[+] score: 13
For instance, modulation of miRNA-375 expression alters voltage-gated Na(+) channel (VGNC) properties and exocytosis in insulin-secreting cells [23]. [score:3]
Notably, as has been previously discussed [6], neither of the examined miRNAs (miR-375 and miR-200c) in the study of Title et al [19] was highly expressed in the wild-type mother’s milk of this murine mo del, whilst both of these miRNAs are known to be involved in the control of endocytosis and/or exocytosis and to modulate epithelial function, which may influence exosome endocytosis and hence their uptake. [score:3]
Title et al [19] studied two genetic mo dels of miRNA-375 and miRNA-200c/141 knockout (KO) mice, which received milk from wild-type foster mothers. [score:2]
Thus, the miRNA-375 and miRNA-200c KO mice appear to also be inappropriate mo dels to study milk exosome uptake, which may be critically dependent on physiological miRNA-375 and miRNA-200c signaling involved in endocytotic exosome pathway regulation. [score:2]
The nutritional hypothesis is based on three problematic mouse mo dels: 1) miRNA-375 KO mice, 2) miRNA-200c/141 KO mice, and 3) transgenic mice presenting high levels of miRNA-30b in milk. [score:1]
Further, most recent studies have shown that miRNA-375 misses a miRNA sequence motif {(A/U)(C2-4)(A/U)} that is essential for miRNA packaging into exosomes [27]. [score:1]
miRNA-375 and miRNA-200c/141 KO mice. [score:1]
[1 to 20 of 7 sentences]
74
[+] score: 13
It has been previously demonstrated that miR-375, found up-regulated in our PDX mo del, is a tumor suppressor in colon cancer and pancreatic cancer, by inhibiting PI3K/Akt via [50, 51]. [score:8]
The analysis performed on PDX mo del showed a deregulation of only five microRNAs, two up-regulated (miR-4284 and miR-375) and three down- (miR-22-3p, let-7c, and miR-214-3p). [score:5]
[1 to 20 of 2 sentences]
75
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Stimulation of HCC proliferationBudhu et al., 2008; Gramantieri et al., 2008; Huang et al., 2009, 2011 miR-373 Invasion and metastasisMeng et al., 2007; Bartels and Tsongalis, 2009; Wu et al., 2011 miR-374 DevelopmentWang et al., 2008; Wong et al., 2008, 2010; Koh et al., 2013 miR-375 Stimulation of HCC proliferationLiu et al., 2010; He et al., 2012 miR-376a Proliferation and apoptosisMeng et al., 2007; Zheng et al., 2012b miR-423 Enhanced CDK2 activityLin et al., 2011 miR-491-5p Inhibition of TNF-α-related apoptosisYoon et al., 2010 miR-500 Elevated in HCC, returned to physiologic level after surgical interventionYamamoto et al., 2009 miR-637 Active STAT3Zhang et al., 2011 let-7a/a-1/a-2/b/c/d/e/f/f-2/g Development. [score:5]
MicroRNA-375 targets Hippo-signaling effector YAP in liver cancer and inhibits tumor properties. [score:4]
MicroRNA-375 targets AEG-1 in hepatocellular carcinoma and suppresses liver cancer cell growth in vitro and in vivo. [score:4]
[1 to 20 of 3 sentences]
76
[+] score: 12
They proposed that seven upregulated miRNAs (gga-mir-221, gga-mir-222, gga-mir-1456, gga-mir-1704, gga-mir-1777, gga-mir-1790, and gga-mir-2127) might play a tumorigenic role, whereas downregulation of five other miRNAs (gga-let-7b, gga-let-7i, gga-mir-125b, gga-mir-375, and gga-mir-458) was associated with loss of tumor suppressive functions (143). [score:9]
In agreement with this, gga-miR-375 was found to be downregulated in the liver of ALV-J-infected chicken compared to non-infected animals. [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 11
Other miRNAs like miR-138, miR-375, miR-593, miR-133a were down-regulated in esophageal cancer tissue, serving as tumor suppressors, while miR-34b, miR-16, miR-208, miR-423, miR-21, miR-31, miR-223 and miR-373 could have oncogenic actions [18– 23] (Figure 1). [score:6]
miR-21 level was significantly elevated in esophageal cancer, while miR-375 was down-regulated. [score:4]
The combination of miR-21 and miR-375 level was identified to be a biomarker for early diagnosis and prognosis of esophageal cancer [19]. [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
The postoperative cause-specific survival rate of patients with a high expression level of plasma miR-21 was lower than that of the low concentration group, while the high plasma miR-375 group showed better survival. [score:3]
Our group previously identified the preoperative expression levels of circulating miRNAs, such as miR-21 and miR-375, as postoperative prognostic biomarkers in patients with esophageal cancer [74]. [score:3]
We also found that the expression levels of miR-221, miR-375, miR-223, and miR-744 in plasma have potential as biomarkers in PCa [64, 65, 66]. [score:3]
Komatsu S. Ichikawa D. Takeshita H. Konishi H. Nagata H. Hirajima S. Kawaguchi T. Arita T. Shiozaki A. Fujiwara H. Prognostic impact of circulating miR-21 and miR-375 in plasma of patients with esophageal squamous cell carcinoma Expert Opin. [score:1]
Moreover, the prognosis of patients with high miR-21 and low miR-375 plasma levels was significantly poorer than that of other patients, and the presence of high miR-21 and low miR-375 levels was identified as an independent prognostic factor [74]. [score:1]
[1 to 20 of 5 sentences]
79
[+] score: 11
Overexpression of miR-375 reduces cell viability and miR-375 is downregulated in gastric cancer (Figure 2) [19]. [score:6]
miR-375 targets 3-phophoinositide dependent protein kinase (PDK1), a kinase that directly phosphorylates Akt, thereby regulating the PI3K/Akt signaling pathway. [score:5]
[1 to 20 of 2 sentences]
80
[+] score: 10
Viral expression of miR-375 in expanded β-cells increased expression of the epithelial marker E-cadherin, as well as the islet/β-cell transcription factors PDX1, MAFA, and NEUROD1. [score:5]
In cells treated with a miR-375 virus, expression of the mesenchymal markers N-cadherin and vimentin decreased. [score:3]
miR-375, a microRNA previously implicated in both definitive endoderm formation and islet function [15, 16], was identified as critical regulator of MET and β-cell de-differentiation [17]. [score:2]
[1 to 20 of 3 sentences]
81
[+] score: 10
MiR-203 was indicated by a study [52] as an anti-metastatic miRNA in PC, intervening the advancement of the cancer via repressing a cohort of premetastatic targets; miR-93 was commonly overexpressed in PC patients and worked collectively with miR-106b and miR-375 to attenuate Capicua levels and facilitate PC progression [53]; a reduction or loss of miR-146b expression was suggested as an omen of PC invasion by the literature [54]; miR-486-5p, the 5p arm of the pre-miRNA for miR-486, stagnated the migration and invasion of PC by lowering the protein expression of Snail, a key regulator of the epithelial–mesenchymal transition for cancer metastasis [55]. [score:10]
[1 to 20 of 1 sentences]
82
[+] score: 10
Whereas Mascaux and colleagues (2013) [109] showed that miR-375 is upregulated in current smokers compared with former smokers, Shen and colleagues (2014) [64] reported that it is downregulated between smokers with and without lung cancer. [score:6]
Despite the interesting findings of the direct association of miR 210 and miR-375 with smoking and miR-223 with tobacco and alcohol use, the pathways involved between these miRNAs and the use of these risk factors have not been elucidated. [score:2]
According to the studies addressed in this review, the major miRNAs associated with tobacco and alcohol are miR-21, miR-34a, miR-34c [30, 97, 98, 109], miR-223 [12, 70], miR-375, and miR-210 [63, 64], which are involved in many signaling pathways, such as proliferation [52], transformation [9, 13], inflammation [9, 13], angiogenesis [13], apoptosis, and the cell cycle [12, 30, 70, 71, 98, 109]. [score:1]
miR-375 was found in two studies. [score:1]
[1 to 20 of 4 sentences]
83
[+] score: 10
In addition, miR-375 is downregulated in gastric cancer and its overexpression inhibits cancer cell proliferation by targeting the oncogene Janus kinase 2 (7). [score:10]
[1 to 20 of 1 sentences]
84
[+] score: 10
Luo J MiR-375 suppresses IGF1R expression and contributes to inhibition of cell progression in laryngeal squamous cell carcinomaBioMed. [score:6]
In previous studies, several miRNAs, such as miR-7 [11], miR-122 [12], miR-139 [13] and miR-375 [14] have shown therapeutic potential that can delay the progression and development of certain human cancers by epigenetically interfering of primary signalling by targeting IGF-1R. [score:4]
[1 to 20 of 2 sentences]
85
[+] score: 10
Kloosterman W. P. Lagendijk A. K. Ketting R. F. Moulton J. D. Plasterk R. H. Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development PLoS Biol. [score:6]
Furthermore, miRNAs such as miR-375, miR-7, and miR-26a are crucial for pancreatic endocrine cell differentiation by regulating transcription factor expression and DNA methylation [100, 101, 102]. [score:4]
[1 to 20 of 2 sentences]
86
[+] score: 10
MiR-375 targets Pdk-1 and decreases downstream insulin signaling [43]; this miRNA is among the most downregulated miRNAs with age in our dataset. [score:6]
Carcinogenesis doi: 10.1093/carcin/bgs130 43 El Ouaamari A Baroukh N Martens GA Lebrun P Pipeleers D 2008 miR-375 targets 3'-phosphoinositide -dependent protein kinase-1 and regulates glucose -induced biological responses in pancreatic beta-cells. [score:4]
[1 to 20 of 2 sentences]
87
[+] score: 10
In Table 1, numerous miRNAs tied to androgen response in PCa are strikingly downregulated, such as miR-27b-3p, miR-141-3p, miR-181a-5p, miR-221-3p, and miR-375-3p. [score:4]
To discover the molecular mechanisms through which Runx1, Runx2, and the Runx -targeting miRNAs, miR-23b-5p, miR-139-5p, miR-205-5p, miR-221-3p, miR-375-3p, miR-382-5p, and miR-384-5p, drive prostate tumorigenesis, we interrogated well-accepted bioinformatics tools; DAVID [57, 58] and Ingenuity Pathway Analysis (IPA-www. [score:3]
These are miR-23b-5p and miR-205 which function as tumor suppressors in many ways [26, 51], miR-375-3p is well characterized as a valuable marker of disease progression for diagnosis and prognosis [reviewed in 54], and miR-384-5p. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 10
However in one dyad, hsa-miR-141-3p was downregulated in post-feed milk compared to pre-feed milk, whereas in another dyad hsa-miR-375 was upregulated in post-feed milk. [score:6]
The HM cell highly expressed miR-375-3p is a regulator of JAK2. [score:4]
[1 to 20 of 2 sentences]
89
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-328, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1246, hsa-mir-1908, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Therefore the miR-375 down-regulated in metastatic CRC, and it has important role for Bcl-2 blocking, with the significant minimally invasive prognostic biomarker for CRC through suppression of malignant proliferation and dissemination (Zaharie et al., 2015). [score:6]
Recently study illustrated that miR-375 promoted the growth inhibitory effect, Cell progression and dissemination of colon cancer through the Bcl-2 pathway. [score:3]
[1 to 20 of 2 sentences]
90
[+] score: 9
miR-375 is frequently down-regulated in gastric cancer and function as a tumor suppressor to regulate gastric cancer cell proliferation potentially by targeting the JAK2 oncogene [10]. [score:9]
[1 to 20 of 1 sentences]
91
[+] score: 9
Metabolic diseases have been linked to certain miRNAs including the control of insulin secretion by miR-375 [12] and lipid metabolism in the liver by miR-122 [13]. [score:3]
Three miRNAs, miR-375, miR-449 and miR-200c were specifically expressed only in the airway samples. [score:3]
Two miRNAs, miR-375 and miR-449 were specific only to airway samples, indicating that these miRNAs are expressed in a cell type that is explicit the airways. [score:3]
[1 to 20 of 3 sentences]
92
[+] score: 9
The results are shown in Figure 4A, bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-193a-5p, bta-miR-339b, bta-miR-375, bta-miR-487b, and bta-miR-100 were differentially expressed in peak and late lactation, and the expression levels of bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-339b, bta-miR-375, and bta-miR-487b in late lactation tissue were higher than the expression levels in peak lactation, bta-miR-100 was down regulated in late lactation compared with peak lactation, the expression pattern was consistent with the Solexa sequencing results (Table S1), only bta-miR-107 was not consist with Solexa sequencing results, this may be caused by deviation of qRT-PCR. [score:9]
[1 to 20 of 1 sentences]
93
[+] score: 9
On the other hand, miR-210 and miR-375 overexpression significantly inhibited TNF induced reporter activity by 8.1- and 14.3-fold (P ≤0.005, Figure 3B), respectively. [score:5]
Next, we selected representative miRNAs for secondary screening: those that activated the reporter in the -TNF screen (miR-517a, miR-517c), inhibited the reporter in the +TNF screen (miR-210, miR-375), or activated the reporter in both screens (miR-483). [score:3]
Interestingly, none of the validated hits from our +TNF secondary screen (miR-210, miR-375 or miR-483) were hits in the Keklikoglou et al. study. [score:1]
[1 to 20 of 3 sentences]
94
[+] score: 9
Finally, we observe most of highly expressed miRNAs in both the normal and cancer STAD groups, including miR-143, miR-21, miR-22, miR-148a, miR-10a, miR-192, miR-375, miR-99b and miR-30a. [score:3]
In Figure 3A, the utmost ten expressed miRNAs are miR-143, miR-148a, miR-21, miR-22, miR-375, miR-10a, miR-30a, miR-192, miR-99b and miR-145. [score:3]
The highly expressed miRNA genes (combined 5p-arm and 3p-arm together) in the STAD cancer group are: miR-21, miR-143, miR-22, miR-148a, miR-10a, miR-192, miR-375, miR-99b, let-7a-2 and miR-30a. [score:3]
[1 to 20 of 3 sentences]
95
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
Salunkhe V. A. Esguerra J. L. Ofori J. K. Mollet I. G. Braun M. Stoffel M. Wendt A. Eliasson L. Modulation of microRNA-375 expression alters voltage-gated Na(+) channel properties and exocytosis in insulin-secreting cells Acta Physiol. [score:3]
These 12 microRNAs (let-7a-5p, miR-182-5p, miR-191-5p, miR-200c-3p, miR-21-5p, miR-25-3p, miR27b-3p, miR-30a-5p, miR-30c-2-5p & -1-5p, miR-30d-5p, miR-375-3p, and miR-574-3p) [51] are all immune-related and they regulate immune response genes and proteins [140]. [score:2]
A recent study utilized a mouse mo del of miR-375 and miR-200c knockout (KO) pups fed by wildtype (WT) foster mothers or KO mothers [91]. [score:2]
The study concluded that no evidence was found for intestinal uptake in KO or WT pups of miR-375 and miR-200c derived from foster mother milk [91]. [score:1]
Further, both miR-375 and miR-200c are known to be involved in the control of endocytosis and/or exocytosis and to modulate epithelial function, which may influence exosomal endocytosis and thus uptake of the examined microRNAs [92, 93]. [score:1]
[1 to 20 of 5 sentences]
96
[+] score: 9
As illustrated in Fig 3, 7 miRNAs including miR-29c, miR-217, miR-375, miR-215, miR-19b, miR-133a and let-7a had relatively low and stable expression levels (P < 0.05) in early period, and increased significantly (P < 0.01) from 12 to 13 weeks when the gonads entered into rapid development. [score:4]
Of the 9 members, miR-217 and miR-375 are regulators of chicken ovary maturity [29]. [score:2]
miR-375 and let-7a also play roles in regulation of insulin sensitivity and glucose metabolism [41, 42, 43]. [score:2]
According to previous reports and our sequencing results, 9 miRNAs, including miR-29c-3p, miR-375, miR-215-5p, miR-9-5p, miR-19b-3p, miR-133a-3p, let-7a, miR-217-5p and miR-155 were determined as candidates. [score:1]
[1 to 20 of 4 sentences]
97
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Bleck et al. discovered that miR-375 upregulates thymic stromal lymphoprotein (TSLP) mRNAs and proteins (which in cytokine-linking innate and Th2-adaptive immune disorders are overexpressed as a result of exposure to environmental pollutants) in human bronchial epithelial cells exposed to diesel exhaust particles and ambient particulate matter [93]. [score:6]
Investigators also confirmed that miR-375 downregulates the aryl hydrocarbon receptor (AhR), leading to activation of NF-κB pathway. [score:2]
Bleck B. Grunig G. Chiu A. Liu M. Gordon T. Kazeros A. Reibman J. MicroRNA-375 regulation of thymic stromal lymphopoietin by diesel exhaust particles and ambient particulate matter in human bronchial epithelial cellsJ. [score:1]
[1 to 20 of 3 sentences]
98
[+] score: 9
Other miRNAs from this paper: dre-mir-375-1, dre-mir-375-2
Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development. [score:6]
Subsequent studies showed that loss of miR-375 in mice leads to a reduction in β-cell number (Poy et al., 2009). [score:1]
For example, Kloosterman and colleagues demonstrated that miRNA-375 is necessary for normal islet clustering and formation in the zebrafish (Kloosterman et al., 2007) (Table 1). [score:1]
miR-375 maintains normal pancreatic alpha- and beta-cell mass. [score:1]
[1 to 20 of 4 sentences]
99
[+] score: 9
E. g. miR-148a/b and miR-375 are downregulated very strongly in pancreatic cancer relative to normal pancreatic tissues. [score:4]
miR-375 has been shown to play a major role in pancreatic islet development [57], and function as well as in the maintenance of glucose homeostasis [58], [59] and it is noteworthy that one early symptom of PDAC can be adult onset diabetes mellitus. [score:2]
In spite of a>100-fold reduction of miR-375 and miR-148a/b during malignant transformation of pancreatic tissues, it is striking that their serum levels are not reduced in animals with PDAC (see Figure 2C and 4A). [score:1]
In contrast, serum levels of miR-21, miR-148b and miR-375 where indistinguishable between the groups. [score:1]
Serum levels of miR-100 and miR-375 were reduced by >2-fold after the treatment though only the controls showed statistically significant differences (p<0.05). [score:1]
[1 to 20 of 5 sentences]
100
[+] score: 8
However a combined addition of miR-124 and let-7b together with miR-375 lead to a substantially greater target inhibition than any effects observed by any other combinations [39]. [score:5]
For example in a study conducted by Krek and colleagues, it was discovered that miR-375, miR-124 and let-7b share a common gene target, Mtpn [39]. [score:3]
[1 to 20 of 2 sentences]