sort by

137 publications mentioning hsa-mir-99b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-99b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 166
Expression is significantly augmented in response to LV -mediated overexpression of miR-99b, miR-181a and miR-181b, and suppressed in response to LV -mediated overexpression of a miRZipTM anti-sense microRNA RNAi hairpin, miR- 99b, miR-181a or miR-181b as compared to uninfected and scramble sequence controls (MOI 25). [score:8]
Inhibition of miR-99b intriguingly also augmented expression of PDPN and the arterial genes, Hey2 and Jagged2, but suppressed expression of the arterial gene, Ephrin B2, and venous genes, EphB4 and NR2F2, when compared with scrambled sequence control samples (Supporting Information Fig. S6). [score:8]
Our study is impaired toward identifying targets of miR-99b, -181a, and -181b as most of these predicted targets will not be expressed in pluripotent, mesoderm, or ECs and their precursors. [score:7]
miR-99b overexpression also suppressed expression of the lymphatic marker, podoplanin (PDPN) (Fig. 6). [score:7]
In conclusion, this is the first study to demonstrate that miR-99b, -181a, and -181b are upregulated during hESC differentiation to ECs and can potentiate EC differentiation from pluripotent hESCs; miR-99b and -181a/b overexpression can improve the differentiation efficiency of hESC lines, which are refractory to specified lineage differentiation and enhance postischemic neoangiogenesis induced by hESC-ECs. [score:6]
No additive or synergistic effect on endothelial marker expression or NO production was observed with combinatorial overexpression or knockdown of miR-99b, -181a, and -181b together (Fig. 5, Supporting Information Fig. S5). [score:6]
miR overexpression elicited a greater effect in H1 cells, resulting in a 33% (miR-99b, MFI: 27.5), 34% (miR-181a, MFI: 33.5), and 33% (miR-181b, MFI: 28.9) increase in cells expressing one or both Pecam1 and VE Cadherin at day 14 of differentiation (vs. [score:5]
Conversely, inhibition of miR-99b, -181a, and -181b evoked a reduction in NO production, with suppression observed at day 14 (Supporting Information Fig. S5C). [score:5]
A: mRNA expression of VE Cadherin and Pecam1 in H1 hES cells subject to LVmediated suppression of miR-99b, miR-181a, miR-181b, all together (miR ×3), or uninfected and scramble sequence controls. [score:5]
Overexpression of the premiR sequence for miR-99b, -181a, and -181b induced a significant increase in mature miR-99b, -181a, and -181b expression, respectively, thus signifying efficient processing of pre-miRNAs (Supporting Information Fig. S4). [score:5]
We subsequently confirmed the expression of miR-99b, -181a, and -181b in adult human SVECs, with no notable differences observed in mature miR-99b expression levels between the adult ECs and SA461 hES-ECs differentiated for 10 days (Supporting Information Fig. S3A). [score:5]
miR-99b, miR-181a, miR-181b or all together (miR ×3) overexpression suppresses NO production. [score:5]
We noted that miR-99b, -181a, and -181b were expressed in all tissues but that high expression was detected in brain (miR-99b, -181a, and -181b), heart (miR-99b, -181a, and -181b), and lung and thymus tissue (miR-181a and -181b) (Supporting Information Fig. S3B). [score:5]
There are several predicted targets for miRNAs miR-99b, -181a, and -181b; however, most of these targets have not been experimentally validated. [score:5]
We next assessed the expression of miR-99b, -181a, and -181b in adult SVECs in comparison with SA461 hESC-ECs differentiated for 10 days and observed no differences in miR-99b expression between the aforementioned cell types (Supporting Information Fig. S3A). [score:5]
Expression of mature miRNAs after LV -mediated expression of premiR sequences, or a miRZipTM anti-sense microRNA RNAi hairpin to miR-99b, miR-181a or miR- 181b. [score:5]
In addition, we have demonstrated that there is very low expression of miR-99b, -181a, and -181b in cells that are differentiated toward neural (ectopic) or hematopoietic (mesoderm) lineages; however, this is greatly potentiated in cells directed toward EC lineage (Fig. 4). [score:4]
Overexpression and knockdown strategies for miR-99b and -181b failed to determine a similar pattern; however, speculatively, it is possible that these miRs may be more involved in the function of hES-ECs. [score:4]
Knockdown studies also failed to elucidate the role of miR-99b, -181a, and -181b, with a significant reduction observed in vascular endothelial markers at the transcript level and a reduction in NO production, but no effect on the cell population expressing endothelial marker proteins (Supporting Information Fig. S5). [score:4]
We analyzed early stages of EC lineage commitment and the miRNA transcriptome to identify miR-99b, -181a, and -181b specifically upregulated during differentiation. [score:4]
Suppression of miRNA function was achieved by a miRNA Zip plasmid specific for miR-99b, -181a, and -181b (Cambridge Bioscience, Cambridge, U. K., http://www. [score:3]
We identified and validated the expression of miR-99b, -181a, and -181b in the early stages of EC differentiation from three pluripotent hESC lines. [score:3]
Overexpression of miR-99b evoked a significant induction of the arterial gene, Hey2, and the lymphatic gene, FLT4. [score:3]
Overexpression of miR-99b and -181b also augmented NO production at days 10 and 14, respectively (Fig. 5C). [score:3]
We observe improvement in hES-EC NO production at later differentiation time points for overexpression of miR-99b and -181b than for -181a (Fig. 5). [score:3]
In addition, we observed significantly improved therapeutic angiogenesis in a mouse mo del of peripheral ischemia after transplantation of hESC-ECs differentiated for 14 days, which overexpressed either miR-99b or -181b but interestingly not miR-181a (Fig. 7). [score:3]
Finally, we demonstrate that the transplantation of hESC-ECs overexpressing either miR-99b or -181b into the muscle of immunodeficient mice subjected to hind limb ischemia promoted therapeutic neovascularization and blood flow recovery. [score:3]
We next assessed whether expression of miR-99b, -181a, and -181b would be induced in hESC-derived hematopoietic cells (mesoderm lineage) or neural cells (ectoderm lineage). [score:3]
Supplementary Figure 3: A: Expression of miR-99b, miR-181a and miR-181b in SA461 pluripotent D0 (white bars), D10 hES-EC (black bars), and adult SVEC cells (dark grey bars). [score:3]
miR-99b, −181a, −181b, all together (miR ×3), or overexpression potentiates NO production. [score:3]
To this end, it remains likely that miR-99b, -181a, and -181b are also expressed to a certain extent on cells of mesoderm origin, for example, hematopoietic cells owing to the common precursor that HSC and EC develop through [53]. [score:3]
We identified miR-99b, -181a, and -181b as miRNAs enriched in hES-ECs differentiated from pluripotent stem cells and confirmed their expression in adult venous ECs. [score:3]
In agreement with improved blood perfusion data, transplantation of hESC-EC subjected to miR-99b or -181b overexpression also enhanced capillary density of the ischemic adductor at 21 days postischemia, whereas miR-181a had no effect (Fig. 7C). [score:3]
The expression of miR-99b, -181a, and -181b was, in contrast, increased in a time- and differentiation -dependent manner compared with time-matched pluripotent samples (Fig. 4A). [score:2]
At 21 days postinduction of ischemia, blood flow to the ischemic foot was improved by hESC-ECs overexpressing either miR-99b or -181a, when compared with the virus control. [score:2]
B: Expression of miR-99b, miR-181a and miR-181b across a human tissue panel, compared to SA461 pluripotent D0. [score:2]
Overexpression of miR-99b, -181a, and -181b evoked an increase in NO production in hES-ECs after 4 days of differentiation, when compared with control samples. [score:2]
Expression of mature miR-99b, -181a, and -181b is induced in an endothelial differentiation-specific manner, when compared with time-matched pluripotent samples in SA461 hESC line. [score:2]
In addition, we assessed the expression of miR-99b, -181a, and -181b across a panel of human tissues, when compared with pluripotent hESCs. [score:2]
We sought to define the effect of miR-99b, -181a, and -181b modulation on EC differentiation from pluripotency. [score:1]
miR-99b is an intergenic miRNA and transcribed in a cluster with miR-125a and Let7e. [score:1]
However, this does highlight that in some capacity miR-99b, -181a, and -181b could be acting to promote cell cycle and generic differentiation progression from the pluripotent state, as previously reported for miR-195 and -372 [54]. [score:1]
We next determined whether the modulation of miRNAs miR-99b, -181a, and -181b would have an effect on the lineage specification of hESC-ECs. [score:1]
miR-99b and -181a augmentation was capable of significantly increasing the vascular EC marker genes, Pecam1 and VE Cadherin, at the transcript level in both hESC lines (Fig. 6). [score:1]
The identification of miR-99b [49], -181a [50], and -181b [19] is consistent with previous miR profiling data performed in ECs, but to our knowledge none have been associated with differentiation from pluripotency to endothelial lineage. [score:1]
We sought to determine whether modulation of miR-99b, -181a, or -181b would elicit any effect of the differentiation capacity of pluripotent stem cells toward an EC lineage. [score:1]
[1 to 20 of 46 sentences]
2
[+] score: 141
As shown in Figure 4C and D, cell growth and proliferation were significantly inhibited after downregulation of mTOR expression by miR-99b precursor whereas cells were more resistant to radiation after upregulation of mTOR by miR-99b inhibitor. [score:13]
showed that radiation dramatically upregulated mTOR expression in all these three groups compared with parallel samples without radiation, whereas miR-99b precursor suppressed and miR-99b inhibitor upregulated mTOR under the basal and radiation conditions when compared with control group (Figure 4B). [score:11]
Considering that miRNAs participated in various physiological and pathological processes by directly regulating target genes expression, we purposely detected various putative miRNAs that may repress mTOR and miR-99b was found to be down-regulated by radiation. [score:10]
In conclusion, the results of this study demonstrate the upregulation of mTOR by radiation via downregulating miR-99b and provide the first evidence of the regulatory effects of radiation on mTOR expression and activation. [score:10]
In this study, we identified that mTOR is positively regulated by radiation in both human pancreatic biopsy specimens and cell lines, and this mTOR upregulation is promoted by radiation induced miR-99b downregulation. [score:8]
Considering mTOR was up-regulated by radiation through miR-99b and mTOR signal pathway plays critical roles in regulating cancer cell survival, proliferation and apoptosis, we wonder whether mTOR inhibition have synergistic effects with radiotherapy. [score:7]
Downregulation of miR-99b, a key mediator of mTOR kinase, contributes to radiation induced mTOR upregulation. [score:7]
To further test whether miR-99b is able to regulate the expression of endogenous mTOR, miR-99b precursor or inhibitor was transfected into PANC-1 cells with or without radiation. [score:6]
Our results not only provide some new clues for mTOR upregulation in radiation -treated pancreatic clinical samples and cell lines, but also demonstrated that miR-99b played important roles in pancreatic cancer radioresistance and maybe a candidate therapeutic target for pancreatic cancer. [score:6]
Ionizing radiation promoted mTOR expression and activation in pancreatic cancer cells through reducing miR-99b expression, which negatively regulated mTOR. [score:6]
Figure 4 Radiation down-regulates miR-99b which targets mTOR in pancreatic cancer cells. [score:6]
All these data suggested that downregulation of miR-99b might induce cell resistance to ionizing radiation via enhanced mTOR expression. [score:6]
Not surprisingly, mTOR was reversely regulated when miR-99b was overexpressed or knocked down under both basal and radiation conditions. [score:5]
Numerous studies have shown that miR-99b, miR-100, miR-199a-3p, miR-451, miR-144 and miR-101 can directly or indirectly mediate mTOR expression [18- 23], and reduction of these miRNAs was connected with the elevated levels of mTOR in prostate cancer and endometrial carcinoma [18, 24]. [score:5]
To identify whether miRNAs were involved in radiation induced mTOR aberrant expression and activation, several miRNAs which targeted mTOR kinase including miR-101, miR-144, miR-100, miR-451, miR-199a and miR-99b were tested before and after radiation treatment. [score:5]
miR-99b reduction was involved in mTOR upregulation and therefore affected the radiotherapy sensitivity of pancreatic cancer cells. [score:4]
All these findings disclose that reduction of miR-99b contributed to the upregulation of mTOR kinase in pancreatic cells and putatively influenced the cell sensitivity to radiotherapy. [score:4]
Click here for file mTOR is a target gene of miR-99b. [score:3]
In order to validate whether miR-99b could affect the cell sensitivity towards radiotherapy, PANC-1 cells were treated with radiation before and after miR99b precursor/inhibitor transfection. [score:3]
mTOR is a target gene of miR-99b. [score:3]
PANC-1 cells were suspended in DMEM supplemented with 10% FBS and seed in 6-well plates (1 × 10 [6]/well) and transfected with miR-99b precursor or inhibitor (Ambion) with Lipofectamine™ 2000 (Invitrogen) according to the manufacturer’s instruction. [score:3]
control with IR or miR-99b inhibitor with IR. [score:3]
Western blot bands of mTOR were further quantified by the ImageJ software for calculating the expression of mTOR before and after miR-99b precursor/inhibitor transfection, **, P < 0.01 vs. [score:3]
Although it was reported that mTOR was a target gene of miR-99b, we confirmed this with the luciferase reporter assay system and results showed that miR-99b can specifically recognize the seed sequence located in the 3′UTR of mTOR (Additional file 1: Figure S1). [score:2]
We found that miR-99b decreased most significantly by 2.7 fold after treatment with radiation at 5 Gy (Figure 4A). [score:1]
In addition, cell sensitivity to radiotherapy was also influenced by miR-99b. [score:1]
[1 to 20 of 26 sentences]
3
[+] score: 122
The IL-4 -induced upregulation of miR-342-3p and downregulation of miR-99b and miR-125a-5p proved to be STAT6 -dependent, which was also validated by stem-loop RT-qPCR (Fig.   3c). [score:7]
These findings suggest that although the IL-4 -mediated regulation of miR-99b and miR-125a expression is STAT6 -dependent, (i) it might not be regulated via direct STAT6 DNA binding or (ii) the regulatory region might be outside of that explored within this study (Fig.   5a). [score:7]
In addition, several target prediction algorithms predict Irf4 as a direct target gene of miR-99b. [score:6]
The IL-4-regulated expression of miR-342-3p, miR-99b, and miR-125a-5p is dependent on IL-4Rα and STAT6 expression as demonstrated by loss of function genetic experiments. [score:6]
The expression of miR-342-3p was unchanged while miR-193b expression was slightly induced during the monocyte-to-macrophage transition, while both increased significantly in response to IL-4. In contrast, miR-99b and miR-125a-5p showed a significant induction during monocyte–macrophage differentiation. [score:5]
In addition, miR-99b and miR-125a-5p expression were attenuated in IL-4-stimulated macrophages in all four human donors, although the IL-4 -dependent reduction of mir-99b expression did not reach statistical significance (p = 0.056) (Fig.   1c; Additional file 6a). [score:5]
These results suggest that the conserved IL-4 -dependent regulation of miR-342-3p, miR-99b, and miR-125a-5p expression holds in vivo relevance. [score:4]
We studied the regulation of miR-342-3p, miR-99b, and miR-125a-5p expression during IL-4 -induced differentiation in vitro in human and murine macrophages as well as in nematode implantation -induced alternatively activated murine macrophages in vivo. [score:4]
As shown in Fig.   3b, IL-4 -mediated negative regulation of mature miR-99b and miR-125a-5p expression proved to be Stat6 -dependent in mouse macrophages; hence, it was logical to assume that IL-4 represses the primary miRNA in a similar manner. [score:4]
Conserved IL-4Rα/STAT6 signaling -dependent regulation of miR-342-3p, miR-99b, and miR-125a-5p expression during in vitro and in vivo mouse alternative macrophage activation. [score:4]
Therefore, we focused our efforts on the identification of the upstream regulator(s) of miR-342-3p, miR-125a, and miR-99b expression during mouse alternative macrophage activation. [score:4]
We found that IL-4 -dependent repression of pri-miR-99b-125a was completely abolished in the absence of Stat6 (Fig.   5c), suggesting that Stat6 is the key transcriptional mediator of the IL-4 -dependent repression of miR-99b and miR-125a-5p expression. [score:3]
Finally, we chose two members of the miR-99b-125a miRNA polycistron, including miR-99b and miR-125a-5p, where IL-4 was able to reduce the dramatic human monocyte–macrophage transition -dependent induction of miRNA expression. [score:3]
b Pri-miR-99b-125a, miR-99b, and miR-125a-5p expression in bone marrow cells (BM), MCSF, and MCSF + IL-4 -treated BMDMs. [score:3]
Based on this, we determined miR-342-3p, miR-99b, and miR-125a-5p expression in nematode-elicited macrophages at different time points after infection (the experimental design is shown in Additional file 3c). [score:3]
Furthermore, both miR-99b and miR-125a-5p showed reduced expression during B. malayi -induced alternative macrophage activation, also reinforcing our in vitro findings (Fig.   2b). [score:3]
These data raise the possibility that decreased miR-125a and miR-99b levels might contribute to alternative macrophage activation by leading to increased Irf4 expression. [score:3]
As expected, we found that both the IL-4 -mediated induction of miR-342-3p as well as the reduction of miR-99b and miR-125a-5p expression were completely abolished in IL-4Rα -deficient macrophages, confirming the requirement of the receptor for transmitting the IL-4 stimulus (Fig.   3a). [score:3]
c Stem-loop RT-qPCR -based quantification of miR-342-3p, miR-99b, and miR-125a-5p expression in IL-4-stimulated or unstimulated WT and Stat6 KO mouse bone marrow-derived macrophages. [score:3]
1 and the signal-specific transcription factor STAT6 in the IL-4 -mediated repression of pri-miR-99b-125a expression, we sought to identify the Pu. [score:3]
In order to determine whether IL-4 represses miR-99b and miR-125a expression at the transcriptional or mRNA maturation level, we measured the expression of both primary (pri-miR-99b-125a) and mature transcripts in mouse bone marrow as well as IL-4-stimulated or unstimulated BMDMs (the genomic localization of the pri-miR-99b-125a-specific primer pair is shown in Additional file 9). [score:2]
Similarly to the analyses described above (Fig.   4a), we took advantage of publicly available GRO-seq datesets from unstimulated as well as ChIP-seq datasets from IL-4-stimulated and unstimulated mouse macrophages [65] to identify the primary transcripts coding miR-99b and miR-125a and further investigate the regulation of miR-99b and miR-125a expression. [score:2]
miR-99b, miR-125a-5p, and pri-miR-99b-125a expression levels were increased to a similar extent in BMDMs compared with the bone marrow cells (Fig.   5b). [score:2]
By using IL4Rα- and STAT6 -deficient macrophages, we were able to show that IL-4 -dependent regulation of miR-342-3p, miR-99b, and miR-125a-5p is mediated by the IL-4Rα–STAT6 signaling pathway. [score:2]
We observed that the majority of IL-4-regulated miRNAs were strictly STAT6 -dependent in mouse macrophages, including miR-342-3p, miR-125a-5p, and miR-99b-5p, as well as the previously studied miR-511-5p and miR-324-5p. [score:2]
As shown in Fig.   2a, miR-342-3p, miR-99b, and miR-125a-5p were regulated by IL-4 similar to the human cells. [score:2]
These findings suggest that the miR-99b-125a polycistron and Spaca6 form one STAT6-regulated transcription unit and they are encoded by the same primary transcript. [score:2]
These findings suggest that the IL-4 -mediated regulation of miR-342-3p, miR-99b, and miR-125a-5p is conserved between humans and mice. [score:2]
These findings collectively suggest a complex role of miR99b, miR-125a, and miR-125b in the regulation of alternative macrophage activation. [score:2]
Intriguingly, IL-4 -dependent regulation of miR-342-3p, miR-99b, and miR-125a-5p is conserved between human cells and mouse bone marrow-derived macrophages. [score:2]
Furthermore, IL-4 was able to reduce the expression of both pri-miR-99b-125a and the mature miRNAs in BMDMs compared with untreated cells (Fig.   5b). [score:2]
We found that three IL-4-responsive miRNAs (miR-342-3p, miR-125a, and miR-99b) showed conserved regulation in both human and mouse alternatively activated macrophages in vitro and in B. malayi nematode-infected mice in vivo. [score:2]
e RT-PCR -based detection of a common transcript of pri-miR-99b-125a and Spaca6 in IL-4 -treated or nontreated WT mouse BMDMs. [score:1]
1- and Stat6 -binding activity could not be detected within the predicted functional domain of pri-miR-99b-125a. [score:1]
Based on this observation, we hypothesized that the miR-99b-125a polycistron and Spaca6 might have common primary transcripts in macrophages. [score:1]
a Stem-loop RT-qPCR -based measurement of miR-342-3p, miR-193b, miR-99b, and miR-125a-5p expression in IL-4-stimulated and unstimulated mouse bone marrow-derived macrophages. [score:1]
Fig. 5IL-4 -dependent and Stat6 -mediated repression of the miR-99b-125a miRNA polycistron. [score:1]
We identified only one overlapping H3K4m3 peak with a divergent GRO-seq signal, a hallmark of an active enhancer, downstream of the miR-99b and miR-125a-coding genomic region, confirming the common TSS and polycistronic transcription of miR-99b and miR-125a (Fig.   5a). [score:1]
c Stem-loop RT-qPCR -based measurement of miR-342-3p, miR-193b, miR-99b, and miR-125a-5p expression in human monocytes, 72-h nontreated, and IL-4-stimulated macrophages. [score:1]
Interestingly, H3K27 acetylation (the active histone mark) of the TSS of pri-miR-99b-125a was IL4 -dependently reduced in WT but not in STAT6 -deficient BMDMs (Fig.   5a, d), which further suggests that IL-4 represses transcription of the miR-99b-125a polycistron in a STAT6 -dependent manner. [score:1]
Alternative macrophage activation-specific repression of the miR-99b-125a miRNA polycistron is mediated at the transcriptional level by IL-4/STAT6 signaling. [score:1]
We found IL-4 -dependent induction of miR-342-3p and miR-193b and repression of miR-99b and miR-125a-5p. [score:1]
b Stem-loop RT-qPCR -based quantification of miR-342-3p, miR-99b, and miR-125a-5p in mouse thioglycolate-elicited and in vivo alternatively activated macrophages. [score:1]
IL-4 -dependent induction of miR-342-3p and repression of miR-99b along with miR-125a-5p occurred in both human and murine macrophages in vitro. [score:1]
1, and Stat6 ChIP-Seq signals in IL-4-stimulated and unstimulated mouse macrophages at the miR-99b-125a and Spaca6 loci visualized by the Integrative Genomics Viewer. [score:1]
a miR-342-3p, miR-99b, and miR-125a-5p expression in IL-4-stimulated or unstimulated wild-type (WT) and IL-4Rα-defficient (IL-4Rα KO) mouse bone marrow-derived macrophages as measured by stem-loop RT-qPCR. [score:1]
Therefore, the expression level of pri-miR-99b-125a was measured in IL-4-stimulated and unstimulated BMDMs derived from WT and Stat6 -deficient mice. [score:1]
[1 to 20 of 47 sentences]
4
[+] score: 106
In this case, the upregulation of miR-99b, which targets IGF1R, could be related more to fine-tuning regulation in order to achieve the proper levels of this protein instead of blocking the expression of it. [score:9]
For instance, miR-99b was found to target the 3′ UTRs of IGF1R, miR-125a targeted ETV6, TNFAIP3 and CX3CR1, and let7e targeted TNFAIP3 and ITGA4. [score:7]
To perform the miRNA inhibitor experiments, we used unlabeled miRCURY LNA™ microRNA Power inhibitors to inhibit miR-99b (reference 4101513), miR-let-7e (reference 4103550), miR-125a (reference 4103094), miR-132 (reference 4103093), miR-212 (reference 4104787) or a control (Negative Control A, reference 199006) Exiqon, Vedbaek, Denmark. [score:7]
In the case of the miR-99b/let-7e/125a cluster, inhibition of miR-99, miR-125a and let-7e resulted in the specific upregulation of IGF1R, TNFAIP3 and IGF1R, and of ITGA4 and THBS1, respectively. [score:6]
In this study, analysis of miRNA expression changes in osteoclast differentiation from human primary monocytes revealed the rapid upregulation of two miRNA clusters, miR-212/132 and miR-99b/let-7e/125a. [score:6]
We also examined the expression levels of these miRNAs following p65 depletion and found that the RANKL/M-CSF-stimulated upregulation of the miRNAs within the miR-99b/let-7e/125a cluster was partially impaired following p65 depletion (Figure  6C). [score:6]
Our analysis on the functional effects of depletion of the miRNAs within the miR-99b/let-7e/125a cluster reveals a possible common pathway of commitment into cells with strong NF-κB -dependent responses, suggesting the targeting of the anti-inflammatory molecule TNFAIP3 (A20) by these microRNAs, which are upregulated in the conversion into OCs, dendritics cells and macrophages. [score:6]
These assays confirmed that miR-99b targets IGF1R, miR-125a targets TNFAIP3, and let-7e targets ITGA4 and THBS1. [score:6]
Secondly, our results reinforce the key role of the NF-κB transcription factor as a direct regulator of miRNA upregulation, specifically focusing on the miR-99b/let-7e/125a and miR-212/132 clusters. [score:6]
The second major conclusion of our study is the role of NF-κB in directly upregulating the miR-212/132 and miR-99b/let-7e/125a clusters, and perhaps other miRNAs. [score:5]
Our analysis of the functional effects of the depletion of the miRNAs within the miR-99b/let-7e/125a and miR-212/132 clusters, as well the analysis of their targets, shows that these molecules have a direct role in repressing MO-specific and immunomodulatory genes like TNFAIP3, IGF1R and IL15. [score:4]
The raw expression data are listed in full in Additional file 1. The array expression data were validated in the samples used (validation set), and in a larger cohort of samples obtained from independent donors (replication set) using Exiqon microRNA LNA™ PCR primer sets (hsa-miR-99b-5p, reference 204367; hsa-miR-125a-5p, reference 204339; hsa-miR-132-3p, reference 204129; hsa-miR-212-3p, reference 204170; hsa-miR-103a-3p, reference 204063). [score:4]
We confirmed the overexpression of all the miRNAs within the miR-99b/let-7e/125a and miR-212/132 clusters using quantitative RT-PCR (qRT-PCR) (Figure  1E). [score:3]
Figure 4 Comparison of changes in the expression levels of the miRNAs within the miR-99b/125a/let7e and miR-132/212 clusters during osteoclast differentiation, and changes during monocyte-to-macrophage and monocyte-to-dendritic cell differentiation. [score:3]
Specifically, after RANKL/M-CSF stimulation, the miR-99b/let-7e/125a cluster miRNAs underwent rapid overexpression during the first four days and the levels remained stably high until day 21 (Figure  1F, top). [score:3]
Our results show that IGF1R is targeted by miR99b and miR125a also suggesting a coordinated shutdown of signal transduction that block NF-κB pathways. [score:3]
Inhibition of miRNAs within the miR-99b/let-7e/125a and miR-212/132 clusters impairs osteoclastogenesis. [score:3]
We transfected primary MOs with specific inhibitors or antagomirs for each of the individual miRNAs contained in the miR-99b/let-7e/125a and miR-212/132 clusters. [score:3]
miRNAs within two clusters ranked top in terms of the coefficient of change and relative expression levels, specifically miR-99b/let-7e/125a (group I, average fold change = 49.4 between MOs and 48 h post-MCSF/RANKL stimulation) and miR-212/132 (group VI, average fold change = 50.57 between MOs and 48 h post-MCSF/RANKL stimulation) (Figure  1D). [score:3]
Analysis of the expression changes of all miRNAs within the miR-99b/let-7e/125a and miR-212/132 clusters showed these are common to all three processes (Figure  4B). [score:3]
Additional file 2: (A) Heatmaps corresponding to putative targets for all miRNAs within the miR-99b/125a/let7e and miR-132/212 clusters using miRWalk. [score:3]
We carried out these assays in HeLa cells, in which we had previously estimated the expression of high levels of miRNAs of the miR-99b/let-7e/125a and miR-212/132 clusters. [score:2]
For instance, inhibition of miR-99b and miR-125a also affected PTGS2, which was not validated in luciferase assays but also contains putative recognition sites at its 3′ UTR for miR-99b and miR-125. [score:2]
An opposite effect was observed for the MO-specific gene CX3CR1 with miR-99b and miR-125a (Figure  2B). [score:1]
For example, miR-99b and miR-125a levels are increased by 300-fold and 100-fold respectively, whereas miR-let-7e induction is only increased by 10- to 12-fold. [score:1]
This analysis showed that the p65 NF-κB consensus binding site is present in the majority of miRNA TSSs, including the miRNAs within the miR-99b/let-7e/125a and miR-212/132 clusters (Figure  5A). [score:1]
[1 to 20 of 26 sentences]
5
[+] score: 49
Known endothelial cell expressed putative targets of miR-99b found under the peak include mechanistic target of rapamycin (MTOR), sonic hedgehog (SHH), mannin -binding lectin serine peptidase 1 (MASP1), and forkhead box O3 (FOXO3). [score:7]
Although some miRNAs are upregulated at higher confluence, miRNAs miR-20b, miR-99b and let-7b have not been shown to be modulated by this effect, and furthermore, there was no consistent pattern of a single EC line, overexpressing a variety of miRNAs [27]. [score:6]
We observed a similar expression pattern of pri-miRNAs transcripts (normalized to β-actin) to the mature miRNAs let-7b and miR-99b demonstrating that these miRNA clusters are regulated from a common promoter region in these cell types (Additional file 2, Figure S1). [score:4]
First, among the ECs, the chromosomal clusters for miRNAs, let-7b, miR-20b and miR-99b all had relative expression patterns that were consistent and supported by RT-PCR of primary transcripts for two clusters (Figure 1C, Additional file 2, Figure S1). [score:3]
Let-7a, in a cluster with let-7b, shared a common expression pattern as did miRNAs let-7e and miR-125a (3p & 5p) both in a cluster with miR-99b (Figure 1C). [score:3]
Higher expression of miR-99b is associated with lymph node metastases in esophageal adenocarcinoma [36]. [score:3]
We used the summation of the data to demonstrate a clear increase in miRNA binding sites for let-7b, miR-20b and miR-99b in genes that were variably expressed across EC types in this additional data set. [score:3]
We identified 166 expressed miRNAs, of which 3 miRNAs (miR-99b, miR-20b and let-7b) differed significantly between EC types and predicted EC clustering. [score:3]
The miR-99b, let-7e, miR-125 cluster modulates HMGA2 and SWI/SNF-related, matrix -associated, actin -dependent regulator of chromatin, subfamily A, member 5 (SMARCA5) [37]. [score:2]
The 3' UTR miRNA binding site for miR-99b is TACGGGTT and is shared with miR-99a and miR-100. [score:1]
Interestingly, the SAM significant miRNAs miR-99b, miR-20b and let-7b were identified 15 times in this group (Figure 3). [score:1]
Having miRNAs miR-20b, miR-99b and let-7b represent 15 binding sites was significantly greater than chance (p < 0.0001). [score:1]
The three SAM significant miRNAs - miR-20b, miR-99b and let-7b - are located in miRNA clusters on chromosomes X, 19 and 22 respectively. [score:1]
RT-PCR data results for miR-20b, miR-99b and let-7b and pri-miRNA cluster data for let-7a and miR-99 clusters. [score:1]
For measuring expression of the miR-99b and let-7a primary transcripts, cDNAs were created from total RNA using the QuantiTect reverse transcript kit (Qiagen) following the manufacturers protocol. [score:1]
There is only limited information on the role of miRNAs let-7b, miR-20b and miR-99b in ECs, although this information is intriguing. [score:1]
In our Sylamer data, because multiple miRNAs can bind to the same consensus sequence, the data we present for miR-20b, miR-99b and let-7b could be data for other related miRNAs such as miR-17, miR-100 or another let-7 miRNA. [score:1]
Only 3 of these 59 miRNAs, let-7b, miR-20b and miR-99b, were also significantly different across all ECs as detected by the SAM algorithm, having 2.1, 1.6 and 1.8 fold variability respectively. [score:1]
No other collection of 3 miRNAs were identified 15 times in the data set, indicating highly significant (p < 0.0001) selection for binding sites for miRNAs miR-99b, miR-20b and let-7b. [score:1]
Of these 162 sites, 15 were predicted 3' UTR binding sites for miRNAs miR-20b, miR-99b, and let-7b. [score:1]
However, we were able to identify three miRNAs, miR-99b, miR-20b and let-7b, which were modestly, but significantly variable among the EC lines by three different types of analysis: LIMMA, SAM and. [score:1]
Also, most of the peaks we identified for miRNAs miR-99b, miR-20b and let-7b were not at the extreme edge of the graph (Figure 3). [score:1]
As a direct measure of the regulation of a polycistronic cluster, we attempted to investigate the expression of the primary transcripts (pri-miRNAs) for the miR-99b, let-7a (containing let-7b) and miR106a (containing miR-20b) clusters that encode these miRNAs. [score:1]
We identified 51, 98 and 571 genes under the peaks for miR-99b, miR-20b and let-7b respectively (Figure 3A). [score:1]
[1 to 20 of 24 sentences]
6
[+] score: 38
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-100, hsa-mir-708
The miR-99 family (miR-99a, miR-99b, and miR-100) has been reported to be upregulated following DNA damage, and their expression has been correlated with radiation sensitivity, in breast and PCa cell lines, by their ability to downregulate the chromatin remo deler SWI/SNF-related, matrix -associated, actin -dependent regulator of chromatin (SMARC) A5 (SNF2H) [21]. [score:10]
Analysis of our published miRNA expression array data demonstrates that the miR-99 family members, miR-99a and miR-100 (miR-99a/100), are significantly suppressed in prostate stem-like cells (SC) compared to their differentiated progeny; committed basal (CB) cells (Figure 1A, 1B) [24, 25]. [score:4]
Quantitative real time polymerase chain reaction (qRT-PCR) analysis of commonly used cell lines showed that more tumorigenic PCa cell lines, such as DU145 and 22Rv1, had a lower expression of the miR-99 family than less tumorigenic PCa cell lines, e. g. LNCaP (Figure 1I). [score:3]
H. Comparison of miR-99 and miR-100 expression in unfractionated primary prostate samples from BPH (n=3), tnCancer (n=3) and CRPC (n=3). [score:3]
I. Expression profiles of miR-99 and miR-100 in prostate cancer cell lines (n=3). [score:3]
A previous study showed that higher expression of the miR-99 family correlated with radiation sensitivity of prostate cell lines [21]. [score:3]
Simultaneous inhibition of SMARCA5 and miR99-a, but not of SMARCD1, reduced H3-acetylation suggesting that miR-99a mediated chromatin relaxation is predominantly mediated by SMARCA5 only. [score:3]
Cell viability assays revealed that the radiation sensitivity of the tested PCa cell lines (Figure 2A) is higher in cells with low expression of the miR-99 family (Figure 1I). [score:2]
We have shown in multiple near-patient PCa samples that the two miR-99 family members miR-99a/miR-100 play an important role in regulation of post-irradiation DNA damage response (via SMARC proteins) in the rare tumor initiating CSC population. [score:2]
This result agrees with previous findings by Mueller et al, who showed a role for the miR-99 family in DNA repair [21]. [score:1]
These data are consistent with other large-scale sequencing studies, which have also reported a decrease of the miR-99 family in PCa [28– 30]. [score:1]
This study shows, for the first time the role of two members of the miR-99 family (miR-99a and miR-100) in DNA damage repair following radiation in primary PCa cell mo dels, and provides additional functional and mechanistic details about the miR-99a family-DNA repair relationship. [score:1]
Thus, induction of the members of the miR-99 family represents a switch by which cells subjected to multiple rounds of radiation might be sensitized to RT. [score:1]
Taken together, these data reveal the potential of the miR-99 family as a marker for bad prognosis. [score:1]
[1 to 20 of 14 sentences]
7
[+] score: 30
miR-19b-3p targets TIMELESS and NR1D2 and many of its correlated neighbours, let-7e-5p, miR-99b-5p and, indirectly, miR-140-3p (separated by 1 degree and connected via miR-214-3p and miR-212-3p) are instead down-regulated, suggesting a potential regulation of miR-19b-3p on these miRNAs. [score:8]
miR-19b-3p is correlated with miR-99b-5p, targeting PER1, RORA and TIMELESS mRNAs and, indirectly, with miR-140-3p, targeting NPAS2 and TIMELESS mRNAs. [score:6]
Besides, these miRNAs are involved in the pathways controlling cancer cell proliferation and invasiveness (Supplementary Table S6) Table 2 Fold Change (Tumor versus Control) Targets let-7e-5p Down PER1, CLOCK miR-125b-5p Down PER1, RORA, TIPIN miR-140-3p Down NPAS2, TIMELESS miR-99b-5p Down PER1, RORA, TIMELESS miR-19b-3p Up TIMELESS, NR1D2 miR-139-5p Down TIMELESS Figure 3 Multi-layer network of clock genes and targeting miRNAs in which nodes represent clock genes or miRNAs, while edges represent correlation or interaction among miRNAs or genes. [score:5]
Besides, these miRNAs are involved in the pathways controlling cancer cell proliferation and invasiveness (Supplementary Table S6) Table 2 Fold Change (Tumor versus Control) Targets let-7e-5p Down PER1, CLOCK miR-125b-5p Down PER1, RORA, TIPIN miR-140-3p Down NPAS2, TIMELESS miR-99b-5p Down PER1, RORA, TIMELESS miR-19b-3p Up TIMELESS, NR1D2 miR-139-5p Down TIMELESS Figure 3 Multi-layer network of clock genes and targeting miRNAs in which nodes represent clock genes or miRNAs, while edges represent correlation or interaction among miRNAs or genes. [score:5]
As illustrated in Table 2 and Figure 3, miR-125b-5p, miR-140-3p, let-7e-5p and miR-99b-5p are all down-regulated in tumor as compared to non-tumor tissues and all target clock genes. [score:5]
Noteworthy, miR-19b-3p is weakly (−0.47) anti-correlated with miR-99b-5p in the control subset, but the anti-correlation strength becomes stronger in the tumor subset. [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 19
Because HuCCT1 cells were more sensitive to Gem than were HuH28 cells, HuCCT1 cells were used as the standard in this comparison; expression of 10 miRNAs (miR-29b, 130a, 141, 200a, 200b, 200c, 205, 221, 222 and 429) was downregulated in HuH28 cells, while expression of eight others (miR-99b, 125a-5p, 143, 377, 452, 589, 597, and 708) was upregulated. [score:11]
In our study, miR-99b was also downregulated in HuH28 cells relative to its expression in HuCCT1 cells by a factor of more than 2log [2]2, but selective suppression of miR-99b did not significantly change the relative cell number ratio when anti-oligonucleotide -treated cells were compared with control oligonucleotide -treated cells; 72 hr after 1×10 [−4] M, relative cell viabilities were 69 ± 3 % and 70 ± 6 %, respectively (p value  = 0.37, Figure S3). [score:7]
The genes encoding the precursors to miR-125a-5p, miR-99b and let7e are located in a conserved gene cluster on Chromosome 19 in humans. [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
They found three polymorphisms in miR-99b/let-7e/hsa-miR-125a gene cluster derived from the same precursor that influence maturation of their primary transcripts and deltaF508- CFTR mutation can induce an upregulation of miR-99b and miR-125a gene expression, indicating that these miRNAs are important in CF pathogenesis. [score:7]
Endale Ahanda M. L. Bienvenu T. Sermet-Gau delus I. Mazzolini L. E delman A. Zoorob R. Davezac N. The hsa-miR-125a/hsa-let-7e/hsa-miR-99b cluster is potentially implicated in cystic fibrosis pathogenesisJ. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 17
Let-7e, in fact, belongs to the let-7 family of oncosuppressive miRNAs acting on key oncogenes, such as Ras, MYC and CDK6 [58] whereas miR-99b targets IGF-1R in human keratinocytes, mTOR in colorectal cancer cells, and FGFR3 in non-small lung cancer 59, 60. [score:5]
These data strongly suggest that the genomic DNA sequence located between -3875 and -3006 bp from pre-miR-99b drives the expression of SPACA6 gene and its intronic miR-99b/let-7e/miR-125a cluster. [score:3]
Taken together, the data suggest the following miRNA expression pathway (Fig.   5B): miR-99b/let-7e/miR-125a are co-transcribed with SPACA6 from the promoter experimentally validated in this work; then, prevailing of splicing produces the SPACA6 transcription variant 2 and represents the first step of miRNA biogenesis and production of SPACA6 protein isoform 2, whereas prevailing of Drosha processing releases the SPACA6 transcription variant 1, leading to production of protein isoform 1. This way, timing of Drosha processing, prior or after splicing, affects pre-mRNA maturation leading to different transcripts and gene products. [score:3]
Identified molecules may then provide a valuable tool in cancer research as promoter induction should also increase expression of the other members of the miRNA cluster, let-7e and miR-99b, both displaying an antiproliferative activity. [score:3]
It is located 3029 bp upstream of human pre-miR-99b and belongs to a transcript encoding a different isoform of SPACA6 protein of 283 amino acid residues, denominated isoform 2 (Fig.   1A). [score:1]
The genomic sequence of miR-125a-5p is located on chromosome 19, in close proximity to those of let-7e and miR-99b (Fig.   1A). [score:1]
To verify these hypotheses, different genomic segments, spanning nucleotides -36 to -3875 (with the first nucleotide of pre-miR-99b assigned as 1), were isolated by PCR from genomic DNA and cloned upstream the coding sequence of firefly luciferase into pGL3-basic promoterless vector (Fig.   1B). [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 16
MiR-99b, miR-193a-5p, miR-322-3p and miR-142-5p respectively regulated 25, 20, 2 and 1 targets (Table B in S1 File). [score:4]
Consistent with their findings, we found a positive association between Zr levels in the hair and expression of miR-99b; interestingly this miRNA was found to play a major role in regulation of cell migration after epithelial damage [31]. [score:4]
In the present study on an obese population, we found that the exposure to Zr levels traced in hair is associated with a distinct signature of 7 miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) expressed in peripheral blood. [score:3]
The seven miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) associated with Zirconium levels with FDR P < 0.1, were selected for downstream target prediction analysis. [score:3]
Using an FDR linear step-up adjustment for multiple comparisons (FDR P < 0.1), we found 7 miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) specifically associated with Zr levels traced in the hair (Table 2). [score:1]
Seven miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) resulted specifically associated with Zr levels. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 15
Among them, 12 miRNAs (let-7e-5p, miR-151a-3p, miR-21-5p/-3p, miR-221-5p/-3p, miR-222-3p, miR-424-3p, miR-450a-5p, miR-450b-5p, miR-503-5p, and miR-99b-5p) were up-regulated by IL-27 and two miRNAs (miR-99a-5p and miR-125b-5p) were down-regulated. [score:7]
It is reported that miR-21, let-7e, miR-99b, and miR-125a are coordinately up-regulated during iDC differentiation through regulation of WNT1 and JAG1 genes in the Notch/Wnt signaling pathway [43]. [score:5]
In the present study, the aforementioned miRNAs (miR-21-3p/-5p, let-7e-3p/-5p, miR-99b-3p/-5p, miR-125a-3p, miR-221-3p/-5p, and miR-222-3p/-5p) affecting DC functions were differentially regulated by IL-27 based on the sequencing results, suggesting that they may play a role in IL-27 regulation of DC function. [score:3]
[1 to 20 of 3 sentences]
13
[+] score: 13
Recent studies showed that miR-99 family was upregulated following DNA damage and miR-99 expression correlated well with radiation sensitivity due to down regulation of SNF2H, a miR-99 family target [35]. [score:9]
A recent study showed that the upregulation of the miR-99 family following radiation decreased the efficiency of repair factor recruitment and the rate of DNA repair after a second exposure to radiation [35]. [score:4]
[1 to 20 of 2 sentences]
14
[+] score: 13
This study describes how p19 affects the RNA world and shows that: i) miR-342, miR-206, miR-330, miR-138 and miR-99b are upregulated by p19 but not by p19W164A mutant; ii) anti-miR-206 can restore the G2 phase in the presence of p19; iii) p19 and p21Q61L regulate their own alternative splicing; iv) miR-206 and miR-138 are differentially regulated by p19 and p21 H-Ras and v) P19G12S Costello mutants show a clear upregulation of miR-374, miR-126, miR-342, miR-330, miR-335 and let-7. These results allow us to conclude that the H-Ras G12S mutation plays an important role in miRNA expression and open up a new line of study to understand the consequences of this mutation on Costello syndrome. [score:13]
[1 to 20 of 1 sentences]
15
[+] score: 13
Using miRNA microarray analysis, qRT-PCR, and bioinformatics, we identified and selected four downregulated miRNAs including hsa-miR-302a-3p and 27 upregulated miRNAs including hsa-miR-30a-5p, hsa-miR-23a-3p, hsa-miR-195a-5p, hsa-miR-99b-5p and hsa-let-7c-5p under these two conditions as having the potential to target genes involved in the regulation of autophagy (Table 2). [score:10]
Among these miRNAs, the predicted target genes of hsa-miR-99b-5p included mTOR. [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 13
Among the genes identified in the SAM analysis there were (I) miRNAs specifically up-regulated in psoriasis (e. g. miR-203), (II) miRNAs with increased expression in both psoriasis and atopic eczema (e. g. miR-21), (III) miRNAs specifically down-regulated in psoriasis (e. g. miR-99b), and (IV) miRNAs uniformly down-regulated in both skin diseases (e. g. miR-122a), as compared to healthy skin. [score:13]
[1 to 20 of 1 sentences]
17
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
18
[+] score: 11
We also noted that expression of miR-99b, miR-125a and miR-21a was inhibited by Sp110 (Fig. 5f). [score:5]
Moreover, Sp110 significantly inhibited the miR-99b-let-7e-125a cluster, miR-152, miR-21a, miR-23a and miR-27b (Fig. 5b,). [score:3]
Of note, in both uninfected and Mtb-infected macrophages, Sp110 induced miR-155, miR-342, miR-3470a and miR-532, but inhibited let-7e, miR-1249, miR-125a, miR-132, miR-152, miR-16-1, miR-182, miR-183, miR-23a, miR-28a, miR-5114, miR-99a and miR-99b. [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 11
In our study, the down-regulation of miR-99b-5p could contribute to an activation of double-strand breaks repair in irradiated keratinocytes. [score:4]
The miR-99 family, including miR-99b-5p, regulates the DNA-damage response in breast and prostate cancer cells by targeting the chromatin remo deling factor SNF2H [30]. [score:4]
When the miR-99 cluster is over-expressed in irradiated cells, the rate and the overall efficiency of repair by both NHEJ and homologous recombination are reduced [30]. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 10
Six miRNAs were overexpressed (hsa-miR-193a-3p, hsa-miR-29b-1-5p, hsa-miR-505-5p, hsa-miR-194-5p, hsa-miR-99b-3p, and hsa-miR-200b-3p) and 14 (hsa-miR-3663-3p, hsa-miR-513a-5p, hsa-miR-146b-5p, hsa-miR-1972, hsa-miR-718, hsa-miR-3138, hsa-miR-21-5p, hsa-miR-630, hsa-miR-575, hsa-miR-301a-3p, hsa-miR-636, hsa-miR-34a-3p, hsa-miR-21-3p, and hsa-miR-516a-5p) were downregulated in aortic tissue from AS patients (Table 2). [score:6]
Six overexpressed miRNAs (hsa-miR-193a-3p, hsa-miR-29b-1-5p, hsa-miR-505-5p, hsa-miR-194-5p, hsa-miR-99b-3p, and hsa-miR-200b-3p) and 14 downregulated miRNAs (hsa-miR-3663-3p, hsa-miR-513a-5p, hsa-miR-146b-5p, hsa-miR-1972, hsa-miR-718, hsa-miR-3138, hsa-miR-21-5p, hsa-miR-630, hsa-miR-575, hsa-miR-301a-3p, hsa-miR-636, hsa-miR-34a-3p, hsa-miR-21-3p, and hsa-miR-516a-5p) were identified in patients with AS, relative to normal controls, and their general characteristics and functional annotations were analyzed using bioinformatic tools. [score:4]
[1 to 20 of 2 sentences]
21
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Gonadotropin-releasing hormone regulates multiple miRNA expression in gonadotrope cell lines, producing downregulation of miR-99b and miR-125b, and upregulation of miR-132, miR-151, miR-212, miR-222, miR-350, and miR-424 (Godoy et al. 2011). [score:10]
[1 to 20 of 1 sentences]
22
[+] score: 10
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-10b, hsa-mir-122, hsa-mir-200c
Mueller et al showed that expression of the miR-99 family was upregulated in response to radiotherapy of breast cancer cells and reduced tumor cells' ability to repair damaged DNA [23]. [score:6]
Thus, the current study provides a strong support of miR-99 -targeted mTOR/p-4E-BP1/p-S6K1 signaling pathway in breast cancer cells. [score:3]
Both miR-99a and the related miR-99b can modulate TGF-beta -induced epithelial to mesenchymal transition in normal murine mammary gland cells [10]. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 9
In NSCLC tissues, many onco-miRs/tumor suppressor-target or tumor suppressor-miRs/onco-target pathways have been demonstrated to participate in the tumorigenesis of lung cancer, including miR7/BCL2 axis, miR-99b/FGFR3 axis, miR-101/EZH2 axis, miR-192/RB1 axis and miR-196/HOXA5 axis [26- 30]. [score:9]
[1 to 20 of 1 sentences]
24
[+] score: 9
The highly expressed miRNA genes (combined 5p-arm and 3p-arm together) in the STAD cancer group are: miR-21, miR-143, miR-22, miR-148a, miR-10a, miR-192, miR-375, miR-99b, let-7a-2 and miR-30a. [score:3]
In Figure 3A, the utmost ten expressed miRNAs are miR-143, miR-148a, miR-21, miR-22, miR-375, miR-10a, miR-30a, miR-192, miR-99b and miR-145. [score:3]
Finally, we observe most of highly expressed miRNAs in both the normal and cancer STAD groups, including miR-143, miR-21, miR-22, miR-148a, miR-10a, miR-192, miR-375, miR-99b and miR-30a. [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 9
For example, miR-143 and miR-145 are downregulated in colon cancer [27], miR-127 is down regulated or silenced in T24 cell (Bladder transitional carcinoma cell); on the otherhand miR-99 is overexpressed/amplified in pancreatic cancer. [score:7]
In [38], it has been reported that miR-99, miR-100, miR-100-1, miR-125a, miR-125b-1, miR-199a-1 and miR-199a-2 are overexpressed both in pancreatic cancer and chronic pancreatitis compared with normal pancreatic tissue indicating that these can be a common inciting event for neoplastic growth. [score:2]
[1 to 20 of 2 sentences]
26
[+] score: 9
790.03miR-7662.080.01 miR-99b 1.82 0.01*A fold change >1 indicates up regulation after 12 months, whereas a value <1 indicates down-regulation after 12 months; **Paired t-test. [score:5]
In the main study plasma from the 77 subjects were analysed for expression of 12 miRNAs (let-7a, let-7f, miR-19a, miR-22, miR26a, miR28-5p, miR-99b, miR151-5p, miR-221, miR-532-3p, miR-548-3p, miR-766). [score:3]
39, 0.18) miR-99b−3.42(−3.61, -3.12)−3.34(−3.73, -3.04)0.03(−0.42, 0.27)−3.43(−3.75, -3.14)−3.42(−3.91, -3.23)0.04(−0.33, 0.20)*19 subjects given 20.000 IU and 21 subjects given 40.000 IU vitamin D [3] per week. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 9
MiR-99 was reported to mediate down-regulation of mTOR/FGFR3 and suppress tumor growth; miR-100 is known to inhibit mTOR signaling and enhance sensitivity to Everolimus in clear cell ovarian cancer (Nagaraja et al., 2010; Oneyama et al., 2011); and mTORC1 was recently reported to regulate miR-1 in skeletal myogenesis (Sun et al., 2010). [score:9]
[1 to 20 of 1 sentences]
28
[+] score: 8
By performings that assess viral RNA replication and protein translation, we identified let-7a, let-7b, miR-181a, and miR-99b as restriction factors impacting either HCV IRES -mediated translation specifically or both translation and replication (Fig.   3c). [score:7]
Among them, three are proviral miRNAs (miR-122, miR-151-5p, and miR-17-5p), and nine others, including let-7a, let-7b, miR-130a, miR-148a, miR-181a, miR-196a, miR-30a-5p, miR-99b, and miR-25, are antiviral factors (Fig.   2c). [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 8
miR-99b-5p and miR-125a-5p both belong to the same cluster and are known to be expressed in endothelial cells [26]. [score:3]
Based on inspection of the volcano plots and an in silico analysis of regulated pathways with DIANA miRPath v. 2.0 [10] we chose a set of 16 miRNAs for confirmation in microdissected glomeruli from patients with only HLA-class I DSAs: miR-let-7c, miR-28-3p, miR-29b, miR-30d, miR-99b, miR-125a-5p, miR-133a, miR-138, miR-146b, miR-195, miR-374b-3p, miR-484, miR-501-3p, miR-520e, miR-625-3p, miR-885-5p (Table  1). [score:2]
The top three miRNAs which contributed the most to the classification performance were miR-125a-5p, let-7c-5p, and miR-99b-5p. [score:1]
Glomerular miR-let-7c-5p (a), miR-28-3p (b), miR-30d-5p (d), miR-99b-5p (e), miR-125a-5p (f) and miR-195-5p (j), miR-374b-3p (k), miR-484 (l), miR-501-3p (m), miR-520e (n) and miR-885-5p (p) were higher in DSA+ than to controls. [score:1]
0.24; 0.15; 0.48; p = 0.013), miR-99b-5p (1.27; 0.50; 3.29 vs. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 8
Hepatic expression of tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22 and miR-125b, and tumor promoting miRNAs, miR-10b and miR-99b in NASH-HCC mo del male and female mice. [score:5]
As shown in Fig. 4, the tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were lower, whereas the tumor-promoting miRNAs, miR-10b and miR-99b were higher in males than in females in both the STZ-HFD group and the control group. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 8
To confirm the validity of the NanoString results, we performed targeted microRNA qPCR on two targets (Figure 2c: miR-99-5p, P=3.96 × 10 [−5]; Figure 2d: mir-9-5p, P=6.23X10 [−9]). [score:5]
These four microRNAs, (mir99, [42] mir9, [43] mir30b [44] and mir92a-3p [45]) are associated with differentiation or suppression of proliferation, further supporting our hypothesis. [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 8
Induction of mir-99b by infection of DCs with M. tuberculosis inhibits TNF-α production, whereas knockdown of mir-99b leads to a decrease in bacterial burden (Singh et al., 2013). [score:4]
Mycobacterium tuberculosis controls microRNA-99b (miR-99b) expression in infected murine dendritic cells to modulate host immunity. [score:3]
M. tuberculosis infection (late) N-WASP, IRAK-1 Disruption of phagocytosis, altered TLR signaling miR-99b (human and mouse) Dendritic cells↑ M. tuberculosis infection TNF-α Increased bacterial burden miR-146a (mouse) Dendritic cells↑ BCG vs. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 7
For example, miR-125b, miR-320b, miR34a-5p and miR-497–5p have been associated with acute myocardial infarction [61, 68– 70] affecting its occurrence, pathogenesis and mortality risk, and miR-125b, miR-320b, miR-497–5p and miR-99b-5p have been associated with atherosclerosis and coronary artery disease development [61, 71, 72]. [score:4]
Comparison of the pericardial fluid miRNA profile to other biofluids revealed that 7 miRNAs (miR-21–5p, miR-148a-3p, miR-152, miR-93–5p, miR-29b-3p, miR-184 and miR-218–5p) were present in all fluid types and 6 miRNAs (miR-125b-5p, miR-320b, miR-34a-5p, miR-497–5p, miR-99b-5p and let-7d-3p) were specific to pericardial fluid. [score:1]
Whereas miR-99b-5p and members of the let-7 family have been suggested to play a role in endothelial cell differentiation [75] and contribute to the diversity of endothelial cells [76], respectively. [score:1]
When comparing the miRNAs detected from the pericardial fluid samples over the global mean (i. e. Cp < 30) with the 12 body fluid types profiled previously by Weber and others [25], six of the miRNAs (miR-125b-5p, miR-320b, miR-34a-5p, miR-497–5p, miR-99b-5p and let-7d-3p) were found to be specific for pericardial fluid (Table 5). [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 7
We confirmed that miR-99b* and miR-493 were significantly upregulated in IAs, while miR-340* was downregulated (Figure  3). [score:7]
[1 to 20 of 1 sentences]
35
[+] score: 7
By analyzing miRNA expression profiles in DCs using qRT-PCR, we identified 4 miRNAs (miR-7, miR-9, miR-155, and miR-182) uniquely overexpressed in aDCs treated for 6 h or 24 h with LPS and IFN- γ compared to untreated immature iDCs and to tDCs cultured with IL-10 and TGF- β. Recent investigations in different immune cell types have shown that TIRs and TNF- α receptor activation results in the rapid expression of miRNAs including miR-9, miR-99b, miR-146a, miR-146b, and miR-155 [29]. [score:4]
On the other hand, we identified 4 miRNAs (miR-99b, miR-135a, miR-147, and miR-214) that were downregulated in 24 h tDCs when compared to 24 h aDCs. [score:3]
[1 to 20 of 2 sentences]
36
[+] score: 7
miR-99b is able to inhibit the secretion of pro-inflammatory cytokines in Mtb infection, suggesting a new approach for designing miRNA -based therapies and control of TB (Singh et al., 2013). [score:3]
Mycobacterium tuberculosis controls MicroRNA-99b (miR-99b) expression in infected murine dendritic cells to modulate host immunity. [score:3]
Among the candidates for this approach we can cite miR-155, miR-146a, miR-145, miR-99b, miR-19b-2 [∗], miR-27a, or miR-27b. [score:1]
[1 to 20 of 3 sentences]
37
[+] score: 7
Noveski et al. determined that miR-23b, miR-32, miR-154 and miR-99 in MArrest and SCOS were up-regulated [42], and we found that these genes were also up-regulated in NOA. [score:7]
[1 to 20 of 1 sentences]
38
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Five differentially expressed miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Furthermore, the differential expression pattern of five miRNAs (bta-miR184, miR-24-3p, miR-148, miR-486 and bta-let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Interestingly, our study shows that a different set of five miRNAs (miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli bacteria while another set of four (miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus bacteria. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 6
Interestingly, several of the highly expressed and up-regulated miRNAs are encoded by miRNA gene clusters (miR-99b-5p, let-7e and miR-125a-5p on 19q; miR-222-3p and miR-221-3p on Xp; miR-23a-3p and miR-27a-3p on 19p). [score:6]
[1 to 20 of 1 sentences]
40
[+] score: 6
Among the top 20 expressed miRNAs only 50% of the miRNAs had their canonical form as their major expressed isoform and these were let-7a-1, miR-22, miR-26a-1, miR-100, let-7f-1, miR-148a, let-7i, let-7c, miR-99b and miR-92a1. [score:5]
AGO2-RIP-Seq Log2Fold (Control vs IL-1β), Q-value 1 mir-27b-3p 11Yes [21] −1, 1.43E-08 2 mir-10b-5p 2 No NS 3 let-7a-5p 9 No NS 4 mir-22-3p —Yes [43] NS 5 mir-26a-5p 5Yes [48] NS 6 mir-100-5p 14 No NS 7 let-7f-5p 18 No NS 8 mir-140-3p 1Yes [20] NS 9 mir-148a-3p —Yes [13] NS 10 mir-125a-5p — No NS 11 mir-21-5p 15Yes [13] NS 12 mir-199a-3p — No NS 13 mir-125b-5p 12Yes [13] NS 14 mir-222-3p —Yes [49] NS 15 let-7i-5p — No 1.01, 1.12E-23 16 let-7c-5p 17 No NS 17 mir-99b-5p 20 No NS 18 mir-92a-3p —Yes [50] 0.94, 4.87E-07 19 mir-99a-5p —Yes [51] NS 20 mir-92b-3p — No 1.35, 3.31E-09 NS, non-significant. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 6
Other miRNAs from this paper: hsa-mir-99a, mmu-mir-99a, mmu-mir-99b
To validate that hypothesis we generated target site predictions for the human miRNA family miR-99, consisting of four different miRNAs, for all 9158 human mRNAs by training on the 10 most-abundantly expressed human miRNAs. [score:5]
We were able to successfully predict 134 out of 155 MTIs in the miRTarBase database for the miR-99 miRNA family, thereby achieving a recall value of 86.5 %. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 6
Interestingly, Guo and colleagues recently reported [32] that members of miR-99b-125a cluster increased the number of hematopoietic stem cells in vivo by inhibiting pro-apoptotic genes Bak1. [score:3]
Especially, all of miR-302b, miR-182, miR-183, miR-93 and miR-99b, which were from rpESCs enriched miRNAs cluster (Fig. 3D), were also highly expressed in IVF3.2 and IVF3.3 (counts TPM>10000). [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
[1 to 20 of 1 sentences]
44
[+] score: 6
P Observed up Observed down <0.05 mir-99b, 375, 462, 639 mir-142-5p, 155, 211, 489, 494, 594, 597 <0.02 mir-429, 642 mir-142-3p, 324-5p, 515-3p Another complementary method of analyzing the miRNA expression data is to identify pairs of miRNAs that are co-regulated in their expression, up or down, across individuals within a single group. [score:6]
[1 to 20 of 1 sentences]
45
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
Significant differences between the GCK-MODY, type 1 diabetes and control groups were less numerous, with miR-24 showing higher expression in controls than in patients with type 1 diabetes (adjusted p = 0.0060); miR-24, along with miR-23a, miR-145 and miR-99b, also showed significantly lower expression levels in GCK-MODY than in controls (p = 0.0011, p = 0.0103, p = 0.0042 and p = 0.0236, respectively). [score:5]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 5
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
It was determined that increased expression of miR-181a, miR-181b, and miR-213 in OVCA cell lines results in resistance to doxorubicin and gemcitabine and increased expression of miR-99b and miR-14 leads to docetaxel and paclitaxel resistance. [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 5
Sun D miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation Cancer Res. [score:5]
[1 to 20 of 1 sentences]
50
[+] score: 5
The overall fold change in expression was comparable for miR-887 and miR-4299, but the fold change for miR-99b* was lower in qPCR than in the chip data. [score:3]
The expression of miR-99b* (A), miR-887 (B), and miR-4299 (C), was significantly higher in irradiated PBMCs compared to non-irradiated PBMCs 20 hours after irradiation. [score:2]
[1 to 20 of 2 sentences]
51
[+] score: 5
A microarray analysis found six miRNAs (miR-148a, miR-181a, miR-20a, miR-221, miR-625 and miR-99b) that were upregulated in patients with MM compared to healthy controls [20]; miR-221 and miR-99b were related to the karyotype of the disease, whereas miR-148a and miR20a were related to relapse-free survival [20]. [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 5
Similarly, transcriptional regulation may also be important for many of the significantly repressed miRNAs in smoker alveolar macrophages because ten downregulated miRNAs were processed from four polycistronic pri-miRNAs (miR-224/miR452, miR-200a/miR-200b/miR-429, miR-449a/miR-449b/miR-449c, and let-7e/miR-99b/miR-125a). [score:5]
[1 to 20 of 1 sentences]
53
[+] score: 5
miRNA-99b-5p suppresses liver metastasis of colorectal cancer by down -regulating mTOR. [score:4]
One odd but significant feature of the arrangement of the miR-10 gene family is that the miR-99, miR-100, and miR-125 genes (all except miR-10a/b) are physically clustered with the loci that encode Let-7 miRNAs. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 5
For example, miR-625, miR-103/miR-107, miR-21 and miR-301 have been found to promote CRC to invade and metastasize by stimulating multiple metastasis-promoting genes [27– 30], whereas miR-99, miR-137, miR-132 and miR-128 function as tumor suppressors to inhibit the metastasis of CRC [31– 34]. [score:5]
[1 to 20 of 1 sentences]
55
[+] score: 5
In lung cancer, miR-99b and miR-102 showed higher expression levels in adenocarcinoma than squamous cell carcinoma, adenocarcinoma patients with high miR-155 and low let-7a-2 expression were related with poor survival [7]. [score:5]
[1 to 20 of 1 sentences]
56
[+] score: 5
Let-7e, miR-99b and miR-125a-3p were highly upregulated in SS and arise from the same chromosomal loci. [score:4]
They performed supervised hierarchical clustering and found five miRNAs, miR-92a, miR-99b, miR-132, miR-193-5p, and miR-422 that could significantly differentiate between good and poor responders to IFO. [score:1]
[1 to 20 of 2 sentences]
57
[+] score: 5
We found that miR-204, miR-99b-3p, miR-191, miR-509-3-5p, miR-99b, miR-10b, miR-126, miR-126-5p, miR-103 are downregulated in samples from men with SCO pathology pattern. [score:4]
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 4
We identified mir-21, miR-24, miR-328, miR-99b, miR-let-7c and miR-1274B as not regulated between groups, and as potential reference genes for normalization of miRNA expression levels in CSF. [score:4]
[1 to 20 of 1 sentences]
59
[+] score: 4
In the presence of MYCN amplification several miRNAs, including miR-17-5p, miR-92, miR-93, miR-99, miR-106a, and miR-221, are upregulated. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 4
MiRNAs miR-324-3p (1.73x), miR-1227 (1.95x), miR-362-3p (1.85x), miR-99b-3p (2.21x), miR-19b-1-5p (4.11x), miR-628-3p (2.77x), miR-26a-1-3p (42.47x), miR-576-3p (2.49x) and miR-27a-5p (108x) were up-regulated, in OROV-infected cells relative to uninfected cells. [score:4]
[1 to 20 of 1 sentences]
61
[+] score: 4
We found that compared to medium, moDCs stimulated with B0213 showed significantly increased expression of hsa-miR-132-3p, hsa-miR-144-3p, hsa-miR-147a, hsa-miR-155-5p, hsa-miR-503-3p, and hsa-miR-99b-5p and a decreased expression hsa-miR-222-3p (Fig.   3c). [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
For instance, hsa-miR-99a showed 79% identity to and 71% identity to HIV-1; however, 68% identity to HBV was observed in relation to hsa- miR-99b, a branch of miR-99. [score:1]
The main focus of this study is hsa-miR-3065-3p and not hsa-miR-122, hsa-miR-99, or has-miR-548. [score:1]
As summarized in Table 1, we also show that three hsa-miRs (miR-3065-3p, miR-99, and miR-548) exhibited a significant mutual identity to genomic sequences of these three viruses. [score:1]
In addition, hsa-miR-99, hsa-miR-548, and hsa-miR-122 also showed mutual identity with these three viral genomes, albeit at a lower degree (∼52–88%). [score:1]
[1 to 20 of 4 sentences]
63
[+] score: 4
miR-99 can also mediate HR repair by regulating its target, SNF2H, which is required for recruitment of BRCA1 and RAD51 to sites of breaks. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 4
Czimmerer et al. profiled miRNA expression in IL-4 -mediated activation and identified miR-342-3p, miR-99b, and miR-125a-5p as regulators of MΦ survival (83). [score:4]
[1 to 20 of 1 sentences]
65
[+] score: 4
miR-99/100 and Let-7a/c have been reported to regulate the cardiac regenerative response in zebrafish and mouse hearts [15]. [score:2]
Consistent with this, Hippo/Yap pathway components 9, 10, the transcription factor Meis1 [11], and a series of microRNA including members of the miR-15 family [12], miR-199a, miR-590 [13], miR-17-92 cluster [14], miR-99/10, and Let-7a/c [15] have been separately implicated in the regulation of CM proliferation. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 4
hsa-miR-99b Both Targetscan and miRanda: MTOR, HOXA1. [score:3]
The miRNAs were miR-130a and miR-155 (cluster 1), miR-146a (cluster 2), miR-34c-3p (cluster 3), miR-99b (cluster 4), miR-183 and miR-26a (cluster 5), and miR-27a and miR-223 (cluster 6). [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 4
MiR-21, miR-29a, miR-92, miR-93, and miR-126 were significantly overexpressed in the serum of ovarian cancer patients compared to controls, while miR-99b, miR-127, and miR-155 were significantly underexpressed. [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 4
Apart from these three significantly regulated miRNAs, we identified a panel of miRNAs with divergent pattern between patients and controls in our array analysis, of which a striking number had been previously studied in the context of liver disease and organ fibrosis, including miR-99 (up) [22], miR-30e (down) [23], miR-132 (up) [24], miR-196b (down) [25] and miR-221 (up) [26] (Figure 1 A). [score:4]
[1 to 20 of 1 sentences]
69
[+] score: 3
Mycobacterium tuberculosis controls microRNA-99b (miR-99b) expression in infected murine dendritic cells to modulate host immunity. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
These studies had shown that the activation of TIRs and TNF-α receptor results in rapid expression of a host of miRNAs including let-7, miR-9, miR-99b, let-7e, miR-125a, miR-132, miR- 146a, miR-146b, miR-155, miR-187, and miR-223 (Taganov et al., 2006; Tili et al., 2007; Bazzoni et al., 2009; Ceppi et al., 2009). [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
A few pri-miRNAs exhibit conservation along the entire length of the pri-miRNA (for example mir-497~195, mir-99b~let-7c~mir-125a, mir-124-2, mir-130a and mmu-mir-568) (Figure 10). [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Other report [29] also showed that bovine mammary epithelial cells challenged with Staphylococcus aureus (S. aureus) or Escherichia coli (E. coli) resulted in dysregulation of 17 miRNAs of which five miRNAs including miR-148, miR-486 and let-7a-5p were unique to E. coli while four miRNAs including miR-23a and miR-99b were unique to S. aureus. [score:2]
Similarly, in the current study, miR-148b, miR-486-5p, miR-23b, miR-99b and members of the let-7 families were altered in animals affected by subclinical endometritis. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 3
We focused on targets predicted by at least two prediction data bases and containing a miR-92-8mer or miR-99-8mer seed match in the respective 3′UTR region 7, 20. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
Mycobacterium tuberculosis controls microRNA-99b (miR-99b) expression in infected murine dendritic cells to modulate host immunity. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Similarly, Jin et al. (2014a) demonstrated a differential expression of nine miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486, and let-7a-5p, miR-2339, miR-499, miR-23a, and miR-99b) upon challenge of MACT-cells (bovine mammary epithelia cell line) with heat inactivated E. coli and S. aureus bacteria. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
Next, to further explore the functions of these miRNAs in HCC, we selected miRNAs with a fold change >5, namely hsa-miR-636, hsa-miR-671, hsa-miR-489, hsa-miR-26a, hsa-miR-320, hsa-miR-628, hsa-miR-505, hsa-miR-100, hsa-miR-664, hsa-miR-942, hsa-miR-192, hsa-miR-99b, hsa-miR-125b, hsa-miR-10b, hsa-miR-30b, and hsa-miR-145, for GO (Gene Ontology) enrichment analysis [21] of their target genes using the web -based software WebGestalt 2.0 [22]. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
In addition, hsa-miR-582-5p [33], hsa-miR-99b [34], hsa-miR-125a [35], hsa-miR-26a [31] and hsa-miR-32* have also been shown to be affected in their respective expression in the context of M. tuberculosis infection. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
miRNAs [a]Presence in samples [b]Median editing (in %) Seed editing event Position in precursor Target Prediction [c]Overlap (%) Before/After editing hsa-mir-598-3p 6/5/0 0.49/0.34/0 Yes 62 11/9 0 (0) hsa-mir-376a-1-5p 6/6/0 11.24/8.43/0 Yes 9 131/166 4 (3.05) hsa-mir-337-3p* 4/1/0 4.21/−/0 Yes 66 146/197 11 (7.53) hsa-mir-376c-3p 6/5/2 3.72/1.9/− Yes 48 156/192 11 (7.05)hsa-mir-1301-3p [#,*] 6/6/2 7.59/3.94/− Yes 52 230/7 2 (0.87) hsa-mir-421 6/6/3 1.40/0.61/0.57 Yes 54 271/4 1 (0.37) hsa-mir-99b-3p* 6/6/2 3.61/1.65/− Yes 47 33/21 0 (0) hsa-mir-641-5p 6/6/3 5.62/7.08/3.35 Yes 18 355/128 11 (3.1) hsa-let-7e-3p* 4/0/0 2.09/0/0 Yes 57 5/3 0 (0)hsa-mir-1251-5p [#,*] 4/4/0 11.98/11.87/0 Yes 10 58/305 4 (6.9)hsa-mir-381-3p [#] 6/6/5 6.87/7.15/3.07 Yes 52 638/302 48 (7.52) hsa-mir-411-5p 6/6/5 27. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
Similarly, inhibition of miR-511 and miR-99b resulted in reduced DC-SIGN levels (Tserel et al., 2011). [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Other miRNAs specific to MAB-S-infected cells have also been found to differ in their expression levels between different strains of MTB (miR-99b and miR-140) or between latent and active tuberculosis (miR-877) [54]. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
Four of these families are reported to be oncogene or tumour suppressors in breast cancer, while two of them, miR-99 and miR-506, have a role in prostate/head-and-neck cancer and melanoma, respectively. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Interestingly, miRNAs located on the same region showed co -expression in some cancers, such as a cluster at 19q13.41 (including mir-99b and -125a). [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This together with our finding that all members of miR-99b~let-7e~125a cluster were increased by HDI further confirm that HDI modulation of miRNA expression occurs through modulation of miRNA primary transcript. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
The largest increases in expression occurred in miR-149-3p, miR-486-5p, miR-483-3p, miR-34b-5p, miR-99b-3p and miR-140-5p at 5.925, 1.968, 1.965, 1.628, 1.503 and 1.488 fold of the control level, respectively. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
Of note, we also identified miR-10b-5p and miR-99b-3p as exclusively expressed in the CD4 [TGF/atRA] condition. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Finally, the most expressed cardiac families are miR-21, miR-10 (miR-10a, miR-10b, miR-99a, miR-99b, miR-100, miR-125a and miR-125b), miR-143 (composed only by miR-143), miR-30 (miR-30a, miR-30b, miR-30c and miR-30d), miR-26 (miR-26a and miR-26b) and miR-1 (miR-1 and miR-206). [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
The results of RT-qPCR showed that miR-34b-5p, miR-7a-1-3p, and miR-99b-5p levels were similar to those found using sncRNA-Seq. [score:1]
miR-7a-1-3p and miR-99b-5p levels were similar to those found with sncRNA-Seq. [score:1]
We also selected miR-7a-1-3p and miR-99b-5p as controls, as their levels did not vary in control and exposed mice. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 3
In a study by another group, miRNA-99b-5p was shown to be expressed at higher levels in metastasis-free CRC patients relative to tumors of those who developed CRLM [25]. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Additionally, we identify one new miRNA (miR-99) and four lincRNA that are associated with these traits. [score:1]
In addition, using these quantitative pathologic traits that are more precise than a categorical diagnosis of AD, we find that some new miRNAs, such as miR-99b, that may have a stronger effect on a specific pathology, such as Tau/NFT. [score:1]
In addition, we found that, among the tested miRNAs, miR-129-3p (P = 1.8 × 10 [−6]) was associated with NP, and miR-99b (P = 6 × 10 [−5]) was associated with NFT, exceeding our significance threshold (p < 0.00016). [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 3
BBR was determined to suppress miR-99~125b, miR-17~92 and miR-106~25 in MM cells. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Thus, only four of all miRNAs differentially expressed (P < 0.05) between pregnant (Day 24) and non-pregnant animals in the PCR array, i. e. miR-99b, miR-152, miR-101, miR-103, were also different (P < 0.05) between pregnant and non-pregnant groups (all comparisons) in the sequencing dataset. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-328, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1246, hsa-mir-1908, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Bellavia et al. (2017) GATA1, FOXP3, SHIP1, ID1, E2F1, CEBP-a and -b, Myc, and MEF2C, specifically, nucleophosmin 1 (NPM1), FLT3, CXCR4, MMP9, IGF-IR, Let-7a, MiR-9, MiR-99b, MiR-150, MiR-155, MiR-191, MiR-223, MiR-146a, and MiR-150The acute myelogenous leukemia (AML) cell lines HEL, HL-60, Molm-14, and U937 The blood plasma of AML patients Igf-1r knockout (R [−]) mouse embryonic fibroblasts and R [−] cells expressing human insulin-like growth factor (IGF)-IR cDNA (termed R [+]) qRT-PCR analysis, Flow cytometry assay, and Western blotting Profiling the mRNA content of these microvesicles indicated the presence of transcripts relevant to AML prognosis (FLT3-ITD, NPM1), treatment (FLT3-ITD, IGF-IR, CXCR4), and niche function (IGF-IR, CXCR4, MMP9). [score:2]
[1 to 20 of 1 sentences]
93
[+] score: 2
Nine distinct binding sites of six human miRNAs, hsa-miR-25, hsa-miR-92a, hsa-miR-93, hsa-miR-99b, hsa-miR-191, and hsa-miR-503 were top ranked by the prioritization with binding energy lower than -37 KCal/Mol and having at most two amino acid substitutions without effects on physical properties (see Additional file 3). [score:1]
Human miRNAs hsa-miR-99b and hsa-miR-503 has an MRE with only single amino acid substitution on segment 6 (NA) and segment 4 (HA), respectively. [score:1]
[1 to 20 of 2 sentences]
94
[+] score: 2
Among the 5 miRNAs, miR-99b and miR-18a were also reported to be misregulated in FSHD biopsies. [score:2]
[1 to 20 of 1 sentences]
95
[+] score: 2
For example, some highly modified miRNAs observed at 6 hpi were still present at high levels at 24 hpi (e. g. miR-125b-5p, miR-99b-5p, miR-29a-3p) and some miRNAs that appeared unmodified at 6 hpi were massively reduced by 24 hpi (e. g. miR-16-5p and miR-411-5p). [score:1]
Some miRNAs showed very high levels of modification (e. g. miR-125b-5p, miR-99b-5p, miR-29a-3p, miR-92a-3p, miR-148b-3p) whilst others showed very low levels of modification (e. g. miR-16-5p, miR-411-5p, miR-410-5p, miR-30e-5p and miR-125b-3p). [score:1]
[1 to 20 of 2 sentences]
96
[+] score: 2
For example, the expression of miR-125a and miR-99b were quite lower in HCC compared to normal liver [74]. [score:2]
[1 to 20 of 1 sentences]
97
[+] score: 2
Member(s) of the hsa-miR-181 14 and hsa-miR-29 families 15 exhibit both anticancer and pro-cancer regulation under different clinical conditions, while members of hsa-miR-126 16, hsa-miR-129 17, hsa-miR-136 18, hsa-miR-204 19, hsa-miR-663 20, hsa-miR-99 21, hsa-miR-378 22, hsa-miR-92 23, and hsa-miR-409 24 families are recognized as having anticancer properties under different clinical conditions. [score:2]
[1 to 20 of 1 sentences]
98
[+] score: 2
In saliva, significantly different expressions of miR-10b, miR-145, miR-99b, miR-708, and miR-181c were observed in progressive low grade dysplasia (LGD) as compared to nonprogressive LGD leukoplakia patients [76]. [score:2]
[1 to 20 of 1 sentences]
99
[+] score: 2
Jin Y Tymen SD Chen D Fang ZJ Zhao Y Dragas D Dai Y Marucha PT Zhou X MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healingPLoS One. [score:2]
[1 to 20 of 1 sentences]
100
[+] score: 2
MiR-99a and miR-100, two members of the miR-99 family, were found by Bloomston et al. to be overexpressed in PDAC tissue compared with normal pancreatic tissue and chronic pancreatitis [17]. [score:2]
[1 to 20 of 1 sentences]