sort by

123 publications mentioning mmu-mir-222 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-222. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 370
Using mouse EOC mo dels, we demonstrated an inverse relationship between miR-222-3p expression and mouse tumor size, and in-vitro experiments showed that its overexpression decreased cell proliferation, affected cell cycle kinetics and inhibited migration, thereby acting as a tumor suppressor. [score:9]
Furthermore in S KOV3/DDP cells, GNAI2 was suppressed following overexpression of miR-222-3p (P = 0.0065; Figure 6D) and in S KOV3 (high miR-222 and low GNAI2) GNAI2 was increased when miR-222-3p was inhibited by its inhibitor (P < 0.0001; Figure 6E). [score:9]
Analogously, in gastrointestinal stromal tumors, Wiemer et al. [17] found in 2013 that overexpressing miR-222 significantly inhibits cellular proliferation, affects cell cycle kinetics and induces apoptosis by down -regulating its predicted target genes KIT and ETV1 in human gastrointestinal stromal tumors. [score:8]
Collectively, we demonstrated that GNAI2 mRNA expression was inversely correlated with the expression of miR-222-3p, suggesting that miR-222-3p could negatively regulate GNAI2 expression in human EOC. [score:8]
And then fourteen candidate genes were commonly predicted to be the possible targets of miR-222-3p by all of the three algorithms (Figure 6A); finally, we evaluated whether these predicted target genes would be down-regulated in vitro after overexpression of miR-222-3p in ovarian cancer cells using qRT-PCR. [score:8]
To identify the potential intermediary responsible for pAKT inhibition induced by miR-222-3p, firstly we performed an online bioinformatics prediction search for putative mRNA targets of miR-222-3p by using three online predicting algorithms (PicTar, TargetScan and miRDB). [score:7]
Moreover also we inhibited miR-222-3p expression using its inhibitor, we found that AKT phosphorylation at both residues was increased in S KOV3 cells, comparing to the control cells (both P < 0.0001; Figure 5C, 5D). [score:7]
Interestingly, it also can function as a tumor suppressor-miR in other cancer types, for example, in erythroblastic leukemia [16], and gastrointestinal stromal tumors [17, 18], miR-222 inhibits cell growth and induces apoptosis by targeting KIT [16, 17] and ETV1 [17]. [score:7]
Western blot analysis showed a reduction in pAKT levels (ser473, thr308), but no change in total AKT expression, suggesting that the target gene for miR-222-3p was not AKT expression. [score:7]
In prostate cancer, Seki et al. [44, 45] revealed that miR-222 was able to directly target Ecm29 so as to significantly suppress cancer cell migration and invasion, but many other researchers have reported opposing results where miR-222 promoted prostate cancer cell proliferation or migration [14, 46]. [score:6]
Furthermore, overexpression of miR-222-3p in S KOV3/DDP cells would block cellular migration (P = 0.0005; Figure 4I, 4J), while inhibition of miR-222-3p in S KOV3 cells would promote cellular migration (P = 0.0007; Figure 4K, 4L). [score:5]
miR-222 can play a role as an onco-miR in some cancer types, such as cervical cancer [13], prostate carcinoma [14], since it can target tumor suppressors, such as PTEN [13, 15], p27Kip1 [14], and TIMP3 [15], promoting the proliferation, migration and invasion of cancer cells. [score:5]
However, the observed decrease/increase of pAKT after transfection are not due to total AKT (tAKT) differences since we did not found changes on the expression levels of tAKT following miR-222-3p mimic/inhibitor transfection (both P > 0.05; Figure 5A–5D and Supplementary Figure S2). [score:5]
Our data showed that AKT phosphorylation at both Ser473- and Thr308- residues was inhibited after transfection of miR-222-3p mimic into Tara R182 cells (both P < 0.0001; Figure 5A, 5B); this effect was time dependent reaching maximal inhibition at 72 h (supplementary Figure S2). [score:5]
3 The relative expression levels of miR-222-3p (cutoff value = 1.60): 1) high, those who exhibited expression above 1.60; and 2) low, for those below 1.60. [score:5]
Interestingly, we found an inverse correlation between the cell proliferation rates of these six cell lines and their miR-222-3p expression levels, suggesting a potential role for miR-222-3p in inhibiting cell growth and proliferation (Figure 3B). [score:5]
In order to explore the effects of miR-222-3p on EOC cell proliferation, we transiently transfected miR222-3p mimic into the low -expressing miR-222-3p cell lines, and found that the cellular proliferation was inhibited significantly, which correlated with changes in the phosphorylation state of AKT. [score:5]
Therefore, whether miR-222 functions as an onco-miR or a tumor suppressor-miR mainly depends upon the cellular context of cancer cells and their target genes. [score:5]
EOC patients with high miR-222-3p expression (N = 33) had significantly longer overall survival than those with low miR-222-3p expression (N = 41) did (The mean overall survival time was 49.394 months vs. [score:5]
Figure 6(A) Schematic diagram of the predicted miR-222-3p -targeting genes by TargetScan, PicTar and miRDB. [score:5]
Figure 9 To determine whether miR-222-3p might be differentially expressed and associated with clinical outcome in patients with ovarian cancer we analyzed miR-222-3p expression by qRT-PCR in seventy-four EOC patients diagnosed at Xiangya Hospital of Central South University between September 2010 and December 2012. [score:5]
To determine whether miR-222-3p might be differentially expressed and associated with clinical outcome in patients with ovarian cancer we analyzed miR-222-3p expression by qRT-PCR in seventy-four EOC patients diagnosed at Xiangya Hospital of Central South University between September 2010 and December 2012. [score:5]
Our data demonstrates that miR-222-3p is a major regulator of GNAI2 expression and its function through its effect on the AKT pathway, a central regulator of cell proliferation and cell death. [score:5]
The relationships between miR-222-3p expression levels and different clinicopathologic factors are summarized in Table 3. But we did not observe any significant correlations between miR-222-3p expression and these clinicopathologic factors such as age, histologic type, FIGO stage, histologic differenciation, or histologic grade (all P > 0.05). [score:5]
hsa-miR-222-3p inhibitor: gcgauguagaccgaugacca; miRNA inhibitor NC: AAACAUGAUGUGUU UUCAUGAC. [score:5]
MiR-222-3p overexpression decreases EOC cell proliferation and migration in vitroTo further explore the potential role of miR-222-3p in EOC cells, we transiently transfected miR222-3p mimic into S KOV3/DDP and HO8910 cell lines (low expression of miR-222-3p). [score:5]
To further confirm that GNAI2 was the intermediary factor mediating miR-222-3p inhibition of AKT phosphorylation and EOC cells proliferation, a recombinant pEGFP-N1 plasmid containing a full-length GNAI2 ORF (Open Reading Frame) without 3′-UTR was constructed and transiently transfected into S KOV3, which expressed low levels of GNAI2. [score:5]
Additionally, we also transiently transfected miR-222-3p inhibitor into S KOV3 and HO8910-PM cell lines (high expression of miR-222-3p). [score:5]
Then the seventy-four cases were divided into two groups according to the relative expression levels of miR-222-3p (cutoff value = 1.60): 1) high, those who exhibited expression above 1.60; and 2) low, for those below 1.60. [score:5]
In the multivariate Cox proportional hazards analysis, which included miR-222-3p expression, histologic type, and histologic grade, miR-222-3p expression was found to be an independent prognostic factor for overall survival (P = 0.006; hazard ratio 0.347; 95% CI 0.164 to 0.734). [score:5]
Furthermore, our data showed a direct correlation between miR-222-3p expression and overall survival in ovarian cancer patients. [score:4]
Therefore, we might identify a novel regulatory axis in EOC cell lines, miR-222-3p/GNAI2/AKT and its potential application as a therapeutic target for EOC patients. [score:4]
miR-222-3p directly targets the 3'UTR of GNAI2. [score:4]
And by CCK-8 assay, we further confirmed that GNAI2 overexpression enhanced cells proliferation while the miR-222-3p mimic suppressed it (Figure 8G). [score:4]
Collectively, these results demonstrated that GNAI2 is a direct target gene of miR-222-3p. [score:4]
Thus, our results suggest that the target of miR-222-3p is not AKT but potentially a protein regulator of AKT-phosphorylation. [score:4]
miR-222-3p down-regulates GNAI2 mRNA and protein levels. [score:4]
The proliferation of S KOV3 transfected with miR-222-3p inhibitor was reduced, compared with that transfected with miR-control inhibitor. [score:4]
We described GNAI2 as a direct target of miR-222-3p that controls cell proliferation in ovarian cancer cells. [score:4]
MiR-222-3p inhibits GNAI2 expression. [score:4]
To verify that GNAI2 is a direct target of miR-222-3p the full-length 3′-UTR fragment containing the predicted miR-222-3p binding site (positions 837–843) was cloned downstream of the luciferase open reading frame of a psi-CHECK2™ vector. [score:4]
MiR-222-3p overexpression reduces ovarian cancer cell proliferation by inhibiting phosphorylation of AKT. [score:4]
For miRNA detection, the reverse transcribed cDNA was synthesized with the All-in-One™ miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia, Rockville, MD, USA), and the relative miR-222-3p expression levels were normalized against U6 small nuclear RNA expression, using the All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA) and their respective All-in-One™ miRNA qPCR Validation primer (GeneCopoeia, Rockville, MD, USA). [score:4]
Indeed, gene analysis identified GNAI2 as the potential target of miR-222-3p for regulating pAKT. [score:4]
Figure 9 In the present study we identify a novel target for miR-222-3p associated with AKT regulation and function. [score:4]
Contrary relationship between expression of miR-222-3p and proliferation, migration of human EOC cell lines. [score:3]
Using twenty EOC patients’ samples and ten normal ovary samples we examined miR-222-3p and GNAI2 expression by qRT-PCR. [score:3]
Thus, S KOV3/DDP and Tara R182 cells which exhibit high cell growth rate have low levels of miR-222-3p, while S KOV3 and HO8910-PM cells, which have a low cell growth rate, express high levels of miR-222-3p (Figure 3B). [score:3]
A Pearson correlational analysis of these thirty samples exhibited an inverse correlation between GNAI2 and miR-222-3p expression levels (r = −0.6103, P = 0.0003; Figure 9), which was consistent with the results found in the cell lines (r = −0.972, P = 0.0012; Figure 6C). [score:3]
Univariate survival analyses indicated that miR-222-3p expression (P = 0.010), histologic type (P = 0.019), histologic grade (P = 0.039) were associated with overall survival, while age (P = 0.247) and FIGO stage (P = 0.137) were not associated with overall survival. [score:3]
Collectively, these results suggest a predictive role for miR-222-3p in the prognosis of EOC patients; that is, the higher the mean expression level of miR-222-3p, the longer the median overall survival time of EOC patients. [score:3]
First, by measuring miR-222-3p expression in 74 EOC patients, we found that patients with high levels of miR-222-3p survived significantly longer than did the low expressing group, which indicated that miR-222-3p might constitute a better prognostic index for EOC patients. [score:3]
We observed a negative correlation between miR-222-3p and GNAI2 expression levels (r = −0.972, P = 0.0012; Figure 6C). [score:3]
Interestingly, one group announced that miR-222 promoted growth in H460, which is a human non-small cell lung cancer cell line [47]; however, almost simultaneously, Yamashita and associates [48], using six lung cancer cell lines, demonstrated that miR-222 promoted growth in two cell lines but suppressed growth in three lung cancer cells. [score:3]
Patient characteristics are shown in Table 1. The relative expression levels of miR-222-3p according to different clinicopathologic factors are shown in Table 2. Decreased miR-222-3p expression was found to be significantly associated with histologic grade (Grade 1+2 vs. [score:3]
Next, we detected miR-222-3p expression levels in a mouse mo del of EOC. [score:3]
Figure 3(A) Differential relative mRNA expression of miR-222-3p in six EOC cell lines. [score:3]
Figure 1Kaplan-Meier overall survival curves for EOC patients with high and low miR-222-3p expression. [score:3]
Inverse correlation between miR-222-3p and GNAI2 expression in ovarian cancer patient samples. [score:3]
Figure 4MiR-222-3p overexpression decreases EOC cell proliferation and migration in vitro(A) Transfection efficiency of miR-222-3p mimic in S KOV3/DDP by qRT-PCR 48h after transfection, using miR-control mimic as a negative control. [score:3]
These findings suggest that miR-222-3p/GNAI2/AKT axis, might constitute a potential new therapeutic target for ovarian cancer. [score:3]
The correlation between the expression of miR-222-3p and clinicopathological characters was assessed with the two-sample Student's t test. [score:3]
In conclusion, miR-222-3p might function as a tumor suppressor since it is negatively correlated with overall survival in EOC patients and chemo-response. [score:3]
In addition, our in-vivo experiments showed that chemo-sensitive tumors in the mice expressed relatively higher levels of miR-222-3p, supporting the clinical data. [score:3]
3 Relative miR-222-3p expression (Median values) with 25th–75th percentile in parentheses. [score:3]
MiR-222-3p directly targets the GNAI2 3′-UTR. [score:3]
Kaplan-Meier overall survival curves for EOC patients with high and low miR-222-3p expression. [score:3]
Correlation between miR-222-3p expression, proliferation and migration of human EOC cell lines. [score:3]
As shown in Figure 3A, S KOV3, HO8910PM and S KOV3-IP had higher levels of miR-222-3p, while HO8910, Tara R182 and S KOV3/DDP had relatively low expression levels of miR-222-3p. [score:3]
The Pearson's Correlation analysis clearly showed negative correlation between miR-222-3p and GNAI2 mRNA expression in tumor samples from EOC patients (n = 30, r = −0.6103, P = 0.0003). [score:3]
Quantification of miR-222-3p expression levels by qRT-PCR in the CTX343-CIS (P = 0.0081) and CTX347-PAC (P = 0.0012) mice revealed significant higher levels than those observed in the CTX270-control group (Figure 2B). [score:3]
To further explore the potential role of miR-222-3p in EOC cells, we transiently transfected miR222-3p mimic into S KOV3/DDP and HO8910 cell lines (low expression of miR-222-3p). [score:3]
miR-222-3p is highly expressed in the chemo-sensitive S KOV3 cells, but low in the chemoresistant S KOV3/DDP cells which correlates with our human data showing that patients that respond to chemotherapy have higher levels of miR-222-3p (Figure 1). [score:3]
First, we determined miR-222-3p expression by qRT-PCR analysis in six ovarian cancer cell lines (Tara R182, S KOV3, S KOV3/DDP, S KOV3-IP, HO8910 and HO8910-PM). [score:3]
Kaplan-Meier curves and survival curves showed that patients with high levels of miR-222-3p survived significantly longer than did the low -expressing group (the mean overall survival time was 49.394 months vs. [score:3]
These data showed a negative association between tumor growth after chemo-treatment and miR-222-3p expression levels. [score:3]
Negative correlation between miR-222-3p expression and mouse tumor size. [score:3]
Elevated expression of miR-222-3p is associated with improved overall survival of EOC patients. [score:3]
MiR-222-3p overexpression decreases EOC cell proliferation and migration in vitro. [score:2]
MiR-222-3p suppresses EOC cell proliferation via the GNAI2/AKT pathway. [score:2]
MiR-222-3p suppresses EOC cell proliferation via GNAI2/AKT pathway. [score:2]
The association between miR-222-3p and GNAI2 mRNA expression was assessed by means of Pearson's correlation analysis using the Pearson correlation coefficient r. All tests were two tailed and data were considered statistically significant if the P value was less than 0.05 (* P < 0.05; ** P < 0.01; *** P < 0.001). [score:2]
On the contrary, if we transfect miR-222-3p inhibitor into S KOV3, we observed an increase in cell proliferation demonstrated by a lower G0/G1 phase cell percentage and a higher percentages of cells in S and G2/M phases compared to the control cells (P < 0.0001; Figure 4G, 4H, Supplementary Figure S1G, and S1H). [score:2]
It has been shown that the phosphorylation status of AKT is closely correlated with cellular proliferation, thus, we tested the hypothesis that miR-222-3p could regulate cell proliferation by affecting the AKT pathway. [score:2]
MiR-222-3p expression and tumor growth in different EOC athymic nude mouse mo dels. [score:2]
We next performed a CCK-8 cell proliferation assay and data showed that the proliferation rates for S KOV3/DDP and HO8910 cells transfected with the miR222-3p mimic were lower than for cells transfected with the miRcontrol mimic (P < 0.0001, Figure 4C; P < 0.0001, Supplementary Figure S1C); In contrast, after transfecting miR-222-3p inhibitor into S KOV3 and HO8910-PM, the cell proliferation rate was increased compared with the control cells (P < 0.0001, Figure 4D; P < 0.0001, supplementary Figure S1D). [score:1]
The sequences of the above small molecules are as follows: hsa-miR-222-3p mimic: agcuacaucuggcuacugggu; miRNA mimic NC: UUUGUACUACACAAAAGUA CUG. [score:1]
Figure 7(A) Schematic diagram of the putative binding site in GNAI2 mRNA 3'UTR for miR-222-3p (The identical GNAI2 wild-type (WT) seed sequences AUGUAGC and mutant (Mut) 3'UTR sequences TACATCG for miR-221/222 as shown above). [score:1]
Initially, miR-222 was described as an oncogenic microRNA in gastric cancer [30], cervical cancer [13], bladder cancer [31], hepatocellular carcinoma [32], breast cancer [33], endometrial carcinoma [34], melanoma [35, 36], pancreatic cancer [37], glioblastoma [38], thyroid cancer [39], multiple myeloma [40, 41], chronic lymphocytic leukemia [42], and oral squamous cell carcinoma [43]. [score:1]
As stated above, miR-222 plays multiple roles in many cancer types. [score:1]
Similarly, the miR-222-3p high, chemosensitive S KOV3 cells have low migration capacity (P = 0.0003; Figure 3D, 3E). [score:1]
We then co -transfected the luciferase-3’-UTR construct (wild or mutant type) with miR-222-3p mimic into HEK-293T cells, and the ratio of Renilla/Firefly luciferase activities was determined. [score:1]
Our next objective was to investigate the role of miR-222-3p as a tumor suppressor-miR. [score:1]
Relative to the miR-control mimic, miR-222-3p mimic reduced the luciferase ratio of the wild-type 3’-UTR construct, but not that of the mutant (P < 0.0001; Figure 7C). [score:1]
Before co-transfection, the transfection efficiency of miR-222-3p mimic was confirmed by qRT-PCR in HEK-293T cells (P < 0.0001, Figure 7B), using miR-control mimic as negative control (NC). [score:1]
Association of miR-222-3p expression with clinicopathological characteristics of EOC patients. [score:1]
Therefore, to assess the functional role of miR-222-3p in EOC, we first investigated the basal expression levels of miR-222-3p in six EOC cell lines. [score:1]
Later, in 2015, Ihle et al. [18] further proved that miRNA-222 can induce apoptosis via a signaling cascade involving KIT, AKT and BCL2. [score:1]
A Cox proportional hazards analysis was used to further evaluate the potential of miR-222-3p expression as a prognostic biomarker (Table 4). [score:1]
Relative expression levels of miR-222-3p were characterized by their median ranges. [score:1]
However, no significant correlation was observed between miR-222-3p and other clinicopathologic variables such as age, histologic type, and FIGO stage (all P > 0.05). [score:1]
Figure 5(A) Tara R182 cell line was transfected with miR-222-3p mimic, Western blot analysis of AKT phosphorylation levels at both Ser473- and Thr308- residues and total AKT were detected. [score:1]
However, the role of miR-222 in ovarian cancer is not yet clear. [score:1]
The significant association of higher levels of miR-222-3p with good overall survival agrees with Figure 1. Table 4 Characteristics Univariate analysis Multivariate analysisHR [1]95% CI [2] P valueHR [1] 95% CI [2] P value Expression of miR-222-3p  (low vs. [score:1]
miR-222-3p relative expression levels according to different clincopathological characteristics of EOC patients. [score:1]
The significant association of higher levels of miR-222-3p with good overall survival agrees with Figure 1. Table 4 Characteristics Univariate analysis Multivariate analysisHR [1]95% CI [2] P valueHR [1] 95% CI [2] P value Expression of miR-222-3p  (low vs. [score:1]
[1 to 20 of 106 sentences]
2
[+] score: 275
Both qRT-PCR and western blot analysis revealed that ectopic expression of miR-222-3p in RL95-2 cells leads to a robust down-regulation of ERα (Fig. 4B and Fig. 4C), while inhibiting miR-222-3p resulted in a significant elevation in expression of ERα (Fig. 4B and Fig. 4C). [score:10]
Our results showed that miR-222-3p expression was much lower in ERα -positive than in ERα -negative EC tissue samples (P<0.0001, Fig. 1A), and level of miR-222-3p expression was correlated inversely with ERα expression (Fig. 1A). [score:7]
As shown in Fig. 1G, the expression of miR-222-3p in AN3CA cells were 12-fold (P<0.0001) and 38-fold (P<0.0001) than that of RL95-2 and MCF-7 cells, respectively; the expression of miR-222-3p in KLE cells was 14-fold (P<0.0001) and 46-fold (P<0.0001) than that of RL95-2 and MCF-7 cells, respectively; the expression of miR-222-3p in RL95-2 cells was 3-fold (P = 0.0031) than that of MCF-7 cells. [score:7]
ERα levels decreased when miR-222-3p was upregulated in response to the miR-222m in RL95-2 cells, whereas the reverse was observed for ERα expression when miR-222-3p was knocked down in AN3CA cells. [score:7]
A search for potential targets of miR-222-3p using miRanda, PicTar, and TargetScan revealed ERα as a target for miR-222-3p (Fig. 4A). [score:7]
As miR-222-3p directly inhibited ERα protein expression, we then further explored whether alterations of miR-222-3p have effects on cellular reaction to raloxifene (a SERM already in clinical use) in EC cells. [score:6]
MiR-222-3p directly targets ERα and inhibits other EREs (estrogen regulated elements) genes. [score:6]
Furthermore, increasing level of miR-222-3p expression, decreased effectively downstream of ERα regulating genes expression, such as pS2 (P<0.0001), cyclinD1 (P = 0.0003) and PR (P<0.0001) (Fig. 4D). [score:6]
Since RL95-2 cells enhanced invasive potential after miR-222-3p upregulated, we found that expression of MMP-2 and MMP-9 was increased. [score:6]
Down-regulated miR-222-3p of AN3CA cells inhibited EC tumor growth in a mouse xenograft mo del. [score:6]
Expression of miR-222-3p is up-regulated in EC. [score:6]
100-nM miR-222-3p inhibitor (miR-222i) or inhibitor negative control (miR-222i NC) were transfected into 1×10 [6] of AN3CA cells. [score:5]
The downstream genes of ERα, including PR, cyclinD1 and pS2, were also inhibited after miR-222-3p ectopic expression in our study. [score:5]
Unlike Zhao's study, we found that miR-222-3p inhibited ERα expression at both protein and mRNA level in EC cells. [score:5]
In the current study, we found that miR-222-3p also inhibits ERα expression in EC cell lines. [score:5]
The oligonucleotides were as follows: has-miR-222-3p mimics (miR-222m): 5′-AGCYACAUCUGGCUACUGGGU-3′ (sense) and 5′-CCAGUAGCCAGAUGUAGCUUU-3′ (antisense); and mimics negative control (miR-222m NC): 5′-UUCUCCGAACGUGUCACGUTT-3′ (sense) and 5′-ACGUGACACGUUCGGAGAATT-3′ (antisense); and has-miR-222-3p inhibitor (miR-222i): 5′-ACCCAGUAGCCAGAUGUAGCU-3′; and inhibitor negative control (miR-222i NC): 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:5]
We found that increased miR-222-3p induced resistance to raloxifene in RL95-2 cells, while down-regulation of miR-222-3p restored sensitivity of AN3CA cells to raloxifene via promoting notably cell apoptosis. [score:4]
After miR-222-3p being inhibited by LV-miR-222i, the expression of PTEN and TIMP3 were lightly increased in tumor tissues, as compared with LV-miR-222i NC transfected group. [score:4]
Besides the oncogenic role of miR-222-3p in vitro, tumor formation assay confirmed that decreased miR-222-3p expression could inhibit the proliferation of EC cells in a mouse xenograft mo del. [score:4]
In this study, we tested 75 cases of EC samples, and demonstrated up-regulation of miR-222-3p in ERα -negative EC tissues. [score:4]
To directly demonstrate the functional role of miR-222-3p in tumorigenesis, we over-expressed or silenced miR-222-3p in RL95-2 and AN3CA cells respectively. [score:4]
MicroRNA, specifically miR-221 and miR-222-3p have been established as regulators of PTEN expression [19], [38]. [score:4]
With miR-222-3p up-regulated, RL95-2 cells showed less sensitivity to raloxifene (P = 0.0002, Fig. 6B). [score:4]
IHC results also showed that miR-222-3p knockdown lightly increased PTEN and TIMP3 expression in vivo (Fig. S1). [score:4]
Oppositely, knockdown of miR-222-3p inhibited cell growth in AN3CA cells (Fig. 2C). [score:4]
Conversely, miR-222-3p expression was negative-related with ERα status. [score:3]
Consistent with these published findings, our results support the concept that overexpression of miR-222-3p could increase cell proliferation, enhance invasiveness and promotes the transition from G1 to S phase. [score:3]
Increased expression of miR-222-3p upon transfection, confirmed by qRT- PCR (Fig. 2A), significantly affected luciferase expression, measured as relative luciferase activity (Fig. 4A). [score:3]
In contrast, as miR-222-3p decreased in AN3CA cells, the expression of pS2 (P = 0.0086), cyclinD1 (P>0.05) and PR (P = 0.0151) were increased (Fig. 4D). [score:3]
Given that many other mechanisms like single nucleotide polymorphism [41] and promoter hypermethylation [42] were involved, we hypothesize miR-222-3p overexpression was one of the reasons for ERα loss in AN3CA cells. [score:3]
In contrast, AN3CA cells became more sensitive after miR-222-3p being inhibited. [score:3]
Elevated miR-222-3p expression has been found in highly metastatic lung cancer [19] and in glioblastoma [33]. [score:3]
Our results demonstrated that miR-222-3p overexpression was a novel mechanism for raloxifene resistance in EC patients. [score:3]
Furthermore, miR-222-3p expression was significantly higher in ERα -negative cells, AN3CA and KLE, than in those of ERα -positive cells. [score:3]
In our previous study using microRNAs microarray, we found that miR-222-3p significant overexpression in ERα -negative EC cells (vs. [score:3]
Conversely, when we performed luciferase assays by using a plasmid harboring the 3′ UTR of ERα mRNAs, where the binding site for miR-222-3p was inactivated by site-directed mutagenesis, we observed a consistent reduction in miR-222-3p inhibitory effect in RL95-2 cells (P<0.0001, Fig. 4A). [score:3]
By ectopic expressing miR-222-3p, the potential of cell proliferation and invasion was apparently enhanced in RL95-2 cells. [score:3]
In a previous report, Zhao et al. have demonstrated that ERα is suppressed by miR-221 and miR-222-3p [17]. [score:3]
In vivo, dampening of miR-222-3p could significantly inhibit tumor growth. [score:3]
The expression of miR-222-3p correlated with ERα and clinicopathological parameters in endometrial carcinoma. [score:3]
There was a significant rising of miR-222-3p expression in ERα -negative EC cells (vs. [score:3]
In contrast, AN3CA cells were more sensitive after miR-222-3p being inhibited (P = 0.0007, Fig. 6C). [score:3]
In breast cancer, miR-222-3p directly repressed ERα and knockdown of miR-222-3p sensitized MDA-MB-468 cells to tamoxifen -induced cell growth arrest and apoptosis [17]. [score:3]
On the contrary, inhibiting miR-222-3p resulted in an accumulation of cells in G0/G1 phase and a decrease in S phase in AN3CA cells (Fig. 3A). [score:3]
0087563.g002 Figure 2 efficiency and cell proliferation after miR-222-3p expression changes. [score:3]
These tissues were analyzed for miR-222-3p expression by TaqMan based qRT-PCR, followed by immunohistochemistry for ERα as described in “”. [score:3]
Overexpression of miR-222-3p in RL95-2 cells increased MMP-2 and MMP-9 levels (Fig. 3C). [score:3]
Inhibiting miR-222-3p decreases tumor growth in a mouse xenograft mo del. [score:3]
Transfection efficiency and cell proliferation after miR-222-3p expression changes. [score:3]
Also, miR-222-3p overexpression is correlated to higher grades, later stages and more nodal metastasis. [score:3]
Here, we represent a comprehensive analysis of miR-222-3p expression in atypical hyperplasia, clinical EC tumor samples and normal endometrium. [score:3]
Excluding the influence of cell proliferation in different treatment, relative cell invasion ability was also enhanced in RL95-2 cells with miR-222-3p overexpressing (Fig. 3B). [score:3]
Therefore, miR-222-3p could serve as potential therapeutic targets for a subset of ERα -negative ECs and might be developed as a biomarker for EC. [score:3]
Since miR-222-3p was higher in ERα negative ECs than in ERα positive cases, we further studied miR-222-3p expression level and its association with clinicopathologic parameters in ECs. [score:3]
Ectopic expression of miR-222-3p impaired invasion and the secretion of MMP2 and MMP9 in EC cells (Fig. 3C). [score:3]
A group of mice (n = 4) received AN3CA cells (1×10 [7]) transfected with LV-has-miR-222-3p-down (miR-222-3p inhibitor in lentivirus vector; LV-miR-222i). [score:3]
These findings provided new insights into the invasive mechanisms in EC, and encouraged exploring miR-222-3p as a target for intervention. [score:3]
0087563.g004 Figure 4 (A) ERα 3′ UTRs is a target of miR-222-3p. [score:3]
The level of miR-222-3p expression was lower in tumors of lower grades (1 and 2 vs. [score:3]
Up -regulating miR-222-3p promoted cell proliferation, enhanced invasiveness and induced a G1 to S phase transition. [score:2]
Factors previously reported to be regulated by miR-222-3p, including PTEN [19], TIMP3 [19], TRPS1 [34], CDKN1C/p57 [20] and p27kip1 [35] might also contribute to its oncogenic effect. [score:2]
Furthermore, cell cycle analyses indicated that RL95-2 cells overexpressing miR-222-3p had a significant increase in S phase population, as compared with miR-222m NC cells, with a concomitant decrease of the G1 portion (Fig. 3A). [score:2]
The expression of miR-222-3p was quantified by qRT-PCR using TaqMan microRNA assays (Applied Biosystems, Carlsbad, CA, USA) and normalized to endogenous control U6B. [score:2]
MiR-222-3p was overexpressed in ERα -negative EC tumors and was associated with high grade, late stage and nodal metastasis. [score:2]
Knockdown of miR-222-3p led to a decrease in anchorage-independent colony forming ability of AN3CA cells. [score:2]
MiR-222-3p overexpression facilitate the growth, metastasis and invasion of a variety of malignant tumors, including breast cancer [17], [18], lung cancer [19], colorectal carcinoma [20], and melanoma [21] via genetic or epigenetic mechanisms. [score:2]
LV-miR-222i significantly decreased the expression of miR-222-3p in AN3CA cells by nearly 85% (Fig. 5B), and decreased the size and weight of the xenograft tumor as compared with LV-miR-222i NC treated group (Fig. 5C and Fig. 5D). [score:2]
0087563.g001 Figure 1(A) MiR-222-3p expression level was much higher in ERα -negative ECs than in ERα -positive samples. [score:2]
MiR-222-3p expression level was positively correlated with poor clinicopathological parameters. [score:2]
The proliferation assay and colony formation assay showed that overexpression of miR-222-3p in RL95-2 cells accelerated the cell growth (Fig. 2B). [score:1]
With miR-222-3p increasing, the cell viability of RL95-2 cells was much higher, showing less sensitivity to raloxifene. [score:1]
These results indicated that miR-222-3p could enhance invasive potential of ECs via promoting MMP-2 and MMP-9 secretion. [score:1]
Oppositely, in AN3CA cells, these ERα downstream genes were increased with miR-222-3p dampened. [score:1]
To investigate the tumorigenic potential of miR-222-3p, we transfected AN3CA cells, which express high level of miR-222-3p, with LV-miR-222i (Fig. 5A). [score:1]
In addition, miR-222-3p was associated positively with lymphatic nodal metastasis (P = 0.0214, Fig. 1D). [score:1]
The results in both cells showed that high level of miR-222-3p promoted the ability of relative cell invasion. [score:1]
Most previous studies suggest that miR-222-3p acts as an oncogene. [score:1]
High level of miR-222-3p was a mechanism for raloxifene resistance in EC therapy. [score:1]
Taken together, these results indicate that miR-222-3p is a crucial oncogene and may be an important determinant of ERα status in EC. [score:1]
These results suggest that miR-222-3p could be an oncogenic microRNA in EC. [score:1]
MiR-222-3p negatively regulates ERα. [score:1]
Another negative control group received AN3CA cells (1×10 [7]) transfected with LV-has-miR-222-3p-down NC (lentivirus vector alone; LV-miR-222i NC). [score:1]
The effects of raloxifene and miR-222-3p on RL95-2 and AN3CA cells. [score:1]
1×10 [6] of RL95-2 cells were transiently transfected with 100-nM miR-222-3p mimics (miR-222m) or mimics negative control (miR-222m NC) using the Lipfectamine2000 transfection reagent (Invitrogen, Carlsbad, CA, USA). [score:1]
By contrast, dampening of miR-222-3p reduced the secretion of MMP-2 and MMP-9 in AN3CA cells (Fig. 3C). [score:1]
In summary, our findings confirmed proto-oncogenic role of miR-222-3p. [score:1]
Effects of miR-222-3p on cell cycle, invasion ability and secretion of MMPs. [score:1]
[1 to 20 of 87 sentences]
3
[+] score: 256
In this study, we demonstrated that miR-222 expression is up-regulated in the livers of G+HFHSD-fed mice and further showed that Irs-1 mRNA is a target of miR-222. [score:8]
Increased miR-222 expression was confirmed in the livers of high fat/high sucrose diet (G+HFHSD)-fed mice, and miR-222 overexpression in hepatocytes caused a substantial decrease in IRS-1 expression, leading to impaired insulin signaling. [score:7]
In hepatocytes overexpressing miR-222, IRS-1 protein expression but not Irs-1 mRNA expression significantly decreased (Fig 2B and 2C). [score:7]
These findings suggested that up-regulation of miR-222 expression could affect the development of insulin resistance in the liver. [score:7]
In accordance with previous microarray data [17], miR-222 expression was up-regulated in the livers of G+HFHSD-fed mice (Fig 1E). [score:6]
Together, these findings suggested a novel mechanism in which up-regulation of miR-222 expression in obesity causes insulin resistance via hepatic IRS-1 repression. [score:6]
miR-222 expression is up-regulated in the livers of G+HFHSD-fed mice. [score:6]
We consider up-regulation of miR-222 could be one of the factors that represses IRS-1 expression in the livers of obese insulin resistant mo dels. [score:6]
To address whether increased miR-222 expression contributed to the development of insulin resistance, we overexpressed miR-222 in primary mouse hepatocytes. [score:6]
In summary, we have demonstrated that hepatic miR-222 is up-regulated in an insulin-resistant state, which in turn impairs insulin signaling through the repression of IRS-1 expression. [score:6]
miR-222 expression levels are up-regulated in the livers of G+HFHSD-fed mice. [score:6]
On the other hand, up-regulation of miR-222 expression in the skeletal muscle or adipose tissue was not observed (S1B Fig). [score:6]
As previously mentioned, our study showed up-regulation of miR-222 expression in the livers of G+HFHSD-fed mice. [score:6]
To address whether increased miR-222 expression contributed to the development of insulin resistance, we overexpressed miR-222 in primary mouse hepatocytes (Fig 2A). [score:6]
miR-222 overexpression attenuates insulin-stimulated phosphorylation of Akt and increases in gluconeogenic gene expressions. [score:5]
Irs-1 mRNA expression was not reduced in the cells overexpressing miR-222 (Fig 2C). [score:5]
miR-222 overexpression significantly inhibited the luciferase activity of the WT Irs-1 3' UTR reporter, but it had no effect on the activity of the mutated Irs-1 3' UTR reporter (Fig 3C). [score:5]
IRS-1 luciferase reporter constructs [IRS-1 wild-type (WT)] were constructed by inserting a mouse or human IRS-1 3' UTR fragment containing the miR-222 binding site into the pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI, USA). [score:5]
In HuH-7 cells overexpressing miR-222 (Fig 4A), IRS-1 protein expression, and insulin -induced Akt and FoxO1 phosphorylation were significantly decreased (Fig 4B). [score:5]
Both mouse and human IRS-1 3′ UTRs contain a predicted binding site for miR-222, and IRS-1 protein expression was reduced in hepatocytes and HuH-7 cells overexpressing miR-222. [score:5]
IRS-2 protein expression was also decreased in the livers of G+HFHSD-fed mice but not in the hepatocytes overexpressing miR-222 (Fig 2B and 2C). [score:5]
In vitro, however, miR-222 overexpression did not alter IRS-2 protein expression, and IRS-2 mRNA did not have any predicted binding site for miR-222. [score:5]
It has been reported that some adipokines or interleukins such as tumor necrosis factor–α, interferon–γ [27], or other hormones such as estradiol [28], which are dysregulated in insulin resistant states affect miR-222 expression. [score:4]
Previously, miR-222 was found to play a role in cancer cell growth and cell cycle progression via directly targeting p27, p57, and PTEN [23]. [score:4]
We did not observe miR-222 up-regulation in the skeletal muscle or adipose tissue of these mice. [score:4]
Mouse Irs-1 mRNA is a direct target of miR-222. [score:4]
Furthermore, we demonstrated that miR-222 directly targets the 3′ UTR of IRS-1 mRNA. [score:4]
We also demonstrated that miR-221, which is a paralog of miR-222, was up-regulated in the livers of G+HFHSD-fed mice. [score:4]
These results indicated that mouse Irs-1 mRNA is a direct target of miR-222. [score:4]
Furthermore, we confirmed that the 3′ UTRs of both mouse and human IRS-1 mRNAs are indeed direct targets of miR-222. [score:4]
Furthermore, miR-221, which is a paralog of miR-222, was also up-regulated in the livers of G+HFHSD-fed mice (Fig 1F). [score:4]
A recent study of circulating miRNA profiling demonstrated an increase in miR-222 expression in the plasma of patients with type 2 diabetes [25]. [score:3]
In addition, we showed that Irs-1 mRNA is a target of miR-222. [score:3]
Effect of miR-222 overexpression on insulin signaling in primary mouse hepatocytes. [score:3]
In our present experiments, the decrease in IRS-1 protein by miR-222 overexpression was only 20% in primary hepatocytes. [score:3]
Because the seed sequences of miR-222 and miR-221 are identical, both may be able to affect the same target genes. [score:3]
In addition, metformin, which is an oral antidiabetic drug administered to improve insulin sensitivity, reduced miR-222 expression in cancer cell lines such as A549 and NCI-H358 human lung cancer cell lines. [score:3]
To identify target genes of miR-222, we used miRWalk, which allowed us to aggregate and compare results from other miRNA-to-mRNA databases [22]. [score:3]
In this study, we focused on miR-222 because its expression was elevated in both of the aforementioned obese mouse mo dels [17]. [score:3]
miR-222 overexpression decreased the luciferase activity of the WT human IRS-1 3' UTR reporter, but had no effect on the mutated human IRS-1 3' UTR reporter (Fig 4D). [score:3]
Target site of miR-222 in the 3' UTR of mouse Irs-1 and assessment of its binding. [score:3]
miR-222 and miR-221 expression were analyzed by qRT-PCR (n = 8 per group). [score:3]
In accordance with reduced Akt phosphorylation, phosphoenolpyruvate carboxykinase 1 (Pck1) and glucose-6-phosphatase catalytic subunit (G6pc), gluconeogenic genes, mRNA abundance under insulin stimulation were increased in the cells overexpressing miR-222 (Fig 2D). [score:3]
miR-222 also targets human IRS-1 mRNA. [score:3]
After 2 days of transfection, miR-222 overexpression in the cells was confirmed by qRT-PCR (n = 6 per group). [score:3]
The expression of IRS-2 is another key insulin-signaling molecule in the liver, but IRS-2 mRNA does not have any predicted binding site for miR-222 (data not shown). [score:3]
These findings suggest that miR-222 could be a novel target for the treatment of obesity -associated metabolic disorders. [score:3]
However, miR-222 expression was not increased in these mouse mo dels. [score:3]
miR-222 overexpression led to a reduction in IRS-1 protein, and insulin-stimulated Akt and FoxO1 phosphorylation (Fig 2B). [score:3]
0191553.g003 Fig 3Target site of miR-222 in the 3' UTR of mouse Irs-1 and assessment of its binding. [score:3]
Effect of miR-222 overexpression in HuH-7 cells. [score:3]
After 2 days of transfection, miR-222 overexpression was confirmed by qRT-PCR (n = 6 per group). [score:3]
Consequently, mouse Irs-1 was identified as a possible target of miR-222. [score:3]
Therefore, IRS-1 is most likely a target gene of miR-222 in humans as well. [score:3]
Luciferase reporter constructs containing the mutated miR-222 binding site were generated by mutation of the mouse or human miR-222 binding site [IRS-1 mutant-type (Mut)]. [score:2]
Human embryonic kidney (HEK)-293 cells provided by RIKEN BRC were transfected with the luciferase reporter construct together with 30 nM of the miR-222 mimic or negative control oligos using HilyMax. [score:1]
The plasmid, which contained the mutated (Mut) miR-222 binding site, was also analyzed and served as a negative control (Fig 3B). [score:1]
We stimulated primary hepatocytes with high glucose or a high dose of insulin, but we did not observe a change in miR-222 levels (data not shown). [score:1]
These results indicated a strong relationship between insulin resistance and miR-222 levels, but the exact roles of miR-222 in insulin signaling had yet to be defined. [score:1]
Therefore, in our present experiments, miR-222 induced reduction in IRS-1 levels was confirmed only in the livers but not in the muscles or adipose tissues. [score:1]
Next, miR-222 expression levels were measured in the livers of these mice. [score:1]
To note, circulating miR-222 was markedly decreased upon metformin treatment. [score:1]
To assess miRNA expression levels, total RNA was reverse-transcribed using a miR-222 or 221-specific stem-loop primer (Assay ID: 002276, 000524, Applied Biosystems, Waltham, MA, USA) and the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). [score:1]
However, in the liver of G+HFHSD-fed mice, 2-fold increase of miR-222 led to a 60% reduction in IRS-1 protein. [score:1]
The pmirGLO -based human IRS-1 3' UTR reporter vector, containing a potential miR-222 binding site (WT) or a mutated miR-222 binding site (Mut), was constructed (Fig 4C). [score:1]
0191553.g002 Fig 2(A) Primary hepatocytes were transfected with 30 nM negative control oligos (control) or miR-222 mimic using HilyMax. [score:1]
A pmirGLO -based 3′ UTR reporter vector consisting of luciferase cDNA followed by the 3′ UTR of mouse Irs-1, which contained a potential miR-222 binding site (WT), was constructed (Fig 3B). [score:1]
0191553.g004 Fig 4(A) HuH-7 cells were transfected with 30 nM of the negative control or miR-222 mimic. [score:1]
Fig 3A shows a predicted binding site for miR-222 in the 3′ UTR of mouse Irs-1 mRNA. [score:1]
Primary hepatocytes and HuH-7 cells were transfected with 30 nM of the miR-222 mimic (product ID: MC11376, Invitrogen, Waltham, MA, USA) or negative control oligos (Invitrogen) using HilyMax (Dojido, Kumamoto, Japan). [score:1]
Hence, we concluded that miR-222 could involve hepatic insulin resistance at least in part through IRS-1 repression. [score:1]
To further confirm the direct interaction between miR-222 and the 3′ UTR of Irs-1 mRNA, a dual-luciferase reporter assay was performed. [score:1]
The 3' UTR of human IRS-1 mRNA was also a predicted binding site for miR-222. [score:1]
Further studies are needed to identify factors that increase miR-222 levels in liver under the state of insulin resistance. [score:1]
The pmirGLO -based Irs-1 3′ UTR reporter was co -transfected with the miR-222 mimic or negative control oligos into HEK-293 cells. [score:1]
[1 to 20 of 75 sentences]
4
[+] score: 247
Gastrin induces miR-222 expression in AGS [GR] cellsmiScript miRNA PCR Arrays were used to identify differentially expressed miRNAs between AGS [GR] cells treated with and without 10 nM G17 for 24 h. Three miRNAs showed increased expression and three miRNAs showed decreased expression beyond the 2-fold threshold (Figure 1A). [score:9]
miR-222 overexpression is also associated with reduced expression of VGLL4 in human gastric cancer cell lines and tissues suggesting that miR-222 inhibits the translation of VGLL4 and promotes YAP-TEAD activation, which is sufficient to increase tumor proliferation, epithelial-mesenchymal transition and invasion [45]. [score:9]
In parental AGS cells (not stably transfected with the CCK2R), gastrin treatment had no significant effect on miR-222 expression at concentrations of 0–100 nM for 2–48 h. However in AGS [GR] cells which express the CCK2R, miR-222 expression increased dose and time dependently following gastrin treatment and was maximal after administering 10 nM G17 for 24 h (Figure 1C and 1D). [score:7]
Gastrin -induced miR-222 overexpression decreases the expression of p27 in vitro and in vivo, via the PKC and PI3K pathwaysIn AGS [GR] cells, qPCR primer assays showed that p27 mRNA expression decreased in dose (Figure 4A) and time (Figure 4B) dependent manners following G17 treatment, which was maximal after 10 nM G17 for 24 h. s indicated that AGS [GR] cells incubated with G17 also showed dose (Figure 4C) and time (Figure 4D) dependent decreases in p27 protein expression. [score:7]
Figure 5(A) A chemically synthesised miR-222 mimic significantly reduced p27 mRNA and protein expression (B, D) whereas a chemically synthesised miR-222 inhibitor partially reversed the reduced p27 mRNA and protein expression that was caused by 10 nM G17 treatment for 24 h (C, E) in AGS [GR] cells. [score:7]
In the GI tract, miR-222 is upregulated in cancers of the esophagus, stomach, colon, liver and pancreas and shows decreased expression in cholangiocarcinoma and gastrointestinal stromal tumors (reviewed in [38]). [score:6]
The chemically synthesised miR-222 inhibitor at concentrations > 500 nM also partially reversed the decrease in p27 mRNA and protein expression caused by 10 nM G17 (Figure 5C and 5E). [score:5]
Activation of the CCK2 receptor by gastrin leads to increased miR-222 expression via the PKC and PI3K pathways in AGS [GR] cellsIn order to investigate the signalling mechanisms downstream of CCK2R that were responsible for the observed increase in miR-222 expression, we used known inhibitors of these pathways. [score:5]
Gastrin -induced miR-222 overexpression was almost fully reversed when AGS [GR] cells were pre -treated with Ro-32-0432 (1 μM), LY294002 (20 μM), YM022 (100 nM) and netazepide (100 nM) suggesting that miR-222 expression is increased via activation of the CCK2 receptor and subsequent PKC and PI3K pathways. [score:5]
miR-222 also targets the tumor suppressor PTEN in SGC7901 gastric cancer cells [46]. [score:5]
These data suggest that gastrin stimulates CCK2R activation leading to increased miR-222 expression which in turn decreases p27 mRNA and protein expression via the PKC and PI3K signalling pathways. [score:5]
Gastrin -induced miR-222 overexpression resulted in reduced expression and cytoplasmic mislocalisation of p27 [kip1], which in turn caused actin remo delling and increased migration in AGS [GR] cells. [score:5]
Gastrin -induced miR-222 overexpression decreases the expression of p27 in vitro and in vivo, via the PKC and PI3K pathways. [score:5]
However, there was only a partial reversal caused by the inhibitor of MAPK activation, indicating that this is not the major pathway for miR-222 expression (Figure 1E). [score:5]
Mature miR-222 inhibits the translation of p27 which increases cell migration and epithelial mesenchymal transition in AGS [GR] cells. [score:5]
Further investigation of downstream signalling was performed by pre-treating AGS [GR] cells with and without PKC and PI3K inhibitors followed by activation of PKC via PMA 100 nM for 24 h. The activation of PKC stimulated a significant increase in miR-222 expression which was also significantly, but not completely reversed by pre-treatment with the PI3K inhibitor. [score:5]
Several studies have suggested that miR-222 -induced inhibition of p27 influences tumor development. [score:4]
One of the upregulated miRNAs, miR-222, was further investigated using samples obtained from hypergastrinemic mice and humans and upstream and downstream signalling pathways were defined in AGS [GR] cells using various inhibitor compounds and siRNA approaches. [score:4]
Increased gastrin -induced miR-222 expression leads to increased migration and the extension of long processes in AGS [GR] cells, cellular events which are associated with gastric tumor development. [score:4]
Specifically in the stomach, increased miR-222 expression in H. pylori infected AGS cells post-transcriptionally regulates RECK and promotes cancer-cell growth and invasion [43, 45]. [score:4]
Gastrin -induced miR-222 upregulation appears to be functionally important. [score:4]
Chemically synthesised mimics and inhibitors were used to assess cellular phenotypical changes associated with miR-222 dysregulation. [score:4]
Chemically synthesised miR-222 mimic (MSY0000279), miR-222 inhibitor (MIN0000279), miR-1 mimic positive control (MSY0000416) and miScript negative control (1027271) were all from Qiagen (Sussex, UK). [score:3]
These data indicate that gastrin-CCK2 receptor activation increases miR-222 expression via both the PKC and PI3K pathways in AGS [GR] cells (Figure 1F). [score:3]
miR-222 expression did not significantly change following G17 treatment of untransfected AGS cells (C, D). [score:3]
Gastrin induces miR-222 expression in AGS [GR] cells. [score:3]
In order to investigate the signalling mechanisms downstream of CCK2R that were responsible for the observed increase in miR-222 expression, we used known inhibitors of these pathways. [score:3]
miR-222 expression is increased in the plasma of patients with gastric cancer relative to patients with chronic active gastritis and healthy controls. [score:3]
AGS [GR] cells transfected with a chemically synthesised miR-222 mimic showed a dose dependent decrease in p27 mRNA and protein expression (Figure 5B and 5D); this was significant at miR-22 mimic concentrations > 50 nM. [score:3]
miR-222 expression decreased whilst patients were taking netazepide and returned to baseline after cessation of treatment, in short (12 weeks, C and D) and long (1 year, E and F) term studies. [score:3]
Activation of the CCK2 receptor by gastrin leads to increased miR-222 expression via the PKC and PI3K pathways in AGS [GR] cells. [score:3]
Ro-32-0432 (1 μM) also completely reversed while LY294002 (20 μM) partially reversed the miR-222 overexpression induced by 100 nM PMA treatment of the same cell line for 24 h (F). [score:3]
AGS [GR] cells were transfected with either a chemically synthesised miR-222 mimic (MSY0000279) or inhibitor (MIN0000279), a miR-1 positive control (MSY0000416) or miScript negative control (1027271) for 24–72 h according to the manufacturer's instructions and with the use of HiPerfect transfection reagent (301704)(all from Qiagen). [score:3]
Chemically synthesised miR-222 inhibitors dose dependently reversed the extension of long processes induced by 10 nM G17 in AGS [GR] cells, which was significant after treatment with concentrations > 50 nM (Figure 3F). [score:3]
Increased miR-222 expression results in decreased abundance of p27 mRNA and protein and causes p27 mislocalisation into the cytoplasm. [score:3]
In summary we have demonstrated that miR-222 expression is increased in AGS [GR] cells following G17 treatment and that the abundance of this miRNA is also increased in the gastric mucosa and serum of hypergastrinemic mice and humans. [score:3]
miR-222 has several downstream mRNA targets including p27 [kip1], p57, PUMA, PTEN, Bim and MMP1 (reviewed in [44]). [score:3]
Overexpression of miR-222 occurs in several other malignancies including breast, lung, papillary thyroid, prostate and glioblastoma [33– 37]. [score:3]
miR-222 expression was therefore assessed in FVB/N and transgenic INS-GAS mice on the same genetic background. [score:3]
Whereas miR-222 inhibitors significantly reduced the migration (E) and extension of long processes (F) that were stimulated by 10 nM G17 treatment of AGS [GR] cells, in a dose dependent manner and statistical significance was determined using two-way ANOVA with Sidak post-hoc test. [score:3]
miR-222 expression increases with age in hypergastrinemic INS-GAS mice. [score:3]
miR-222 exerts these effects at least in part by decreasing p27 expression and causing this protein to be mislocalised in the cytoplasm (Figure 8). [score:3]
In conclusion, gastrin induced the expression of miR-222 in CCK2R bearing cells. [score:3]
Similarly, whilst patients were taking netazepide, serum miR-222 expression significantly decreased and returned towards baseline after cessation of treatment (Figure 2D and 2F). [score:3]
miR-222 expression is increased in the serum and gastric corpus of patients with hypergastrinemia and type 1 gastric neuroendocrine tumors, and is significantly reduced by netazepide treatment. [score:3]
miR-222 expression was increased in the serum and gastric corpus mucosa of hypergastrinemic INS-GAS mice and hypergastrinemic patients with autoimmune atrophic gastritis and type 1 gastric NETs; it decreased in patients following treatment with the CCK2R antagonist netazepide (YF476). [score:3]
We also assessed miR-222 expression in both gastric corpus biopsies and serum samples from patients with autoimmune atrophic gastritis, hypergastrinemia and type 1 gastric NETs who had been enrolled on a phase-2 clinical trial to assess the short and long term effects of the CCK2R antagonist netazepide [4]. [score:3]
Gastrin increased miR-222 expression in AGS [GR] cells, with maximum changes observed at 10 nM G17 for 24 h. Signalling occurred via CCK2R and the PKC and PI3K pathways. [score:3]
LY294002 (20 μM), YM022 (100 nM), netazepide (100 nM) and Ro-32-0432 (1 μM) all completely reversed while PD98089 (20 μM) partially reversed the miR-222 overexpression caused by 10 nM G17 treatment of AGS [GR] cells for 24 h (E). [score:3]
The pri(mary)-miR-222 transcript is cleaved by the RNAse II enzyme Drosha into a hairpin structure (pre-miR-222) which is transported from the nucleus to the cytoplasm via exportin-5. Pre-miR-222 is cleaved by a second RNase II enzyme, Dicer, into mature miR-222 which associates with RISC to target imperfect complementary mRNA sequences. [score:3]
miR-222 expression was significantly increased in mucosal scrapings taken from the gastric corpus (A) and in the serum (B) of 30 week old hypergastrinemic INS-GAS mice relative to 30 week old FVB/N mice, with significant differences also being observed between 12 week and 30 week old INS-GAS mice in the serum (n = 10 per group). [score:3]
There was a significant but small increase in miR-222 expression in the gastric corpus biopsies of hypergastrinemic patients before taking netazepide relative to normogastrinemic controls, which significantly decreased whilst patients were taking 50mg netazepide daily and returned to baseline after cessation of treatment, in both the short-term (12-week treatment with 12-week follow-up) and longer-term (12-month treatment) regimens (Figure 2C and 2E). [score:3]
miR-222 expression increased dose and time dependently in AGS [GR] cells and was maximal following treatment with 10nM G17 for 24h in serum free media. [score:3]
miR-222 overexpression increases migration and the extension of long processes in AGS [GR] cellsGastrin has previously been shown to increase the migration of AGS [GR] cells dose dependently after 8 h treatment with concentrations of 30 pM to 3 nM G17 [22]. [score:3]
By contrast, chemically-synthesised miR-222 inhibitors significantly reversed 10 nM G17 induced AGS [GR] cell migration at concentrations 50–100 nM and completely reversed gastrin-stimulated (10 nM) migration at concentration 500 nM (Figure 3E). [score:3]
miR-222 overexpression increases migration and the extension of long processes in AGS [GR] cells. [score:3]
miR-222 expression is also increased in gastric cancer tissue-derived mesenchymal stem cells [41] and in the stomachs of H. pylori infected individuals [42, 43]. [score:3]
miR-222 expression was also significantly increased in the serum of the same hypergastrinemic patients with a 5.7-fold increase in the short-term study and a 5-fold increase in the longer study, when compared to healthy controls. [score:2]
In AGS [GR] cells treated with 10nM G17 compared with untreated controls, miScript miRNA PCR arrays showed 3 miRNAs that increased and 3 miRNAs that decreased in expression beyond the 2-fold threshold, with only miR-222 and miR-376c proving significant. [score:2]
In both gastric corpus biopsies (C, E) and serum samples (D, F) from patients with hypergastrinemia and type 1 gastric neuroendocrine tumors (n = 8), miR-222 expression was significantly higher at baseline compared with normogastrinemic healthy controls who had a normal stomach at endoscopy (n = 10). [score:2]
miR-222 expression was significantly increased in both the gastric mucosal scrapings and serum of 30 week old INS-GAS mice compared with age-matched FVB/N wild-type. [score:2]
Among the miRNAs dysregulated in gastric cancer is miR-222. [score:2]
Chemically synthesised miR-222 mimics at concentrations 10–100 nM also significantly increased AGS [GR] cell migration dose dependently (Figure 3C). [score:1]
However, only miR-376c and miR-222 proved significant with fold changes of 5.2 (P < 0.01) and 2.3 (P < 0.0001) respectively. [score:1]
miR-221 and miR-222 are encoded in tandem from a gene cluster located on chromosome Xp11.3 [32]. [score:1]
Increased amounts of miR-222 were also detected in the gastric mucosa and sera of hypergastrinemic patients with type 1 gastric NETs. [score:1]
Our observation of cytoplasmic mislocalisation of p27 following gastrin treatment is therefore consistent with the increase in migration and change in morphology that was observed in AGS [GR] cells following treatment with gastrin and a miR-222 mimic. [score:1]
Figure 3Scratch wound assays were performed to assess cell migration (A) and scattering assays used to assess the expression of long processes (B) following G17 treatment of AGS [GR] cellsChemically synthesised miR-222 mimics significantly increased migration (C) and the extension of long processes (D) with statistical significance determined using one way ANOVA with Tukey post-hoc test. [score:1]
Chemically synthesised miR-222 mimics significantly increased migration (C) and the extension of long processes (D) with statistical significance determined using one way ANOVA with Tukey post-hoc test. [score:1]
miR-222 may also be a promising biomarker for monitoring gastrin induced premalignant changes in the stomach. [score:1]
Chemically synthesised miR-222 mimics dose dependently increased the extension of long processes in AGS [GR] cells and this was significant at concentrations > 10 nM (Figure 3D). [score:1]
Further work is however needed to investigate whether increased serum miR-222 abundance is specific to patients with type 1 gastric NETs or whether it is also increased in patients who have other causes for hypergastrinemia such as long-term proton pump inhibitor use. [score:1]
miR-222 has been shown to bind to the 3′ end of the p27 locus [48]. [score:1]
miR-222 transcription is increased via the PKC and PI3K pathways and partially via the MAPK pathway. [score:1]
One of the best characterised downstream targets of miR-222 is p27 [kip1] (p27). [score:1]
[1 to 20 of 75 sentences]
5
[+] score: 232
Furthermore, given the prominent inhibitory effect of miR-222-5p mimics on αSMA expression both at the gene expression and the protein levels, it was postulated that αSMA 3′-UTR might be directly targeted by miR-222-5p. [score:10]
Collectively, the evidence implies that miR-222-5p could directly target αSMA 3′-UTR and lead to down-regulation of αSMA both at the gene expression and the protein level. [score:9]
Dual transfection of the plasmid encoding αSMA 3′-UTR sequence and miR-222-5p mimics into HEK293 cells revealed that miR-222-5p mimics inhibited αSMA 3′-UTR, and the mutation of the target site within the 3′-UTR rescued the inhibition to a certain degree (Fig. 8 D). [score:8]
D, dual transfection of plasmids and miR-222-5p into HEK293 cells demonstrated the inhibition of miR-222-5p on the 3′-UTR of αSMA, and mutation of the predicted target site recovered the inhibition. [score:8]
After establishing that miR-222-5p mimics decreased ROCK2 expression and ROCK2 played a functional role in promoting SMC differentiation, we explored whether miR-222-5p could inhibit ROCK2 through direct targeting of ROCK2 3′-UTR. [score:8]
Thus far, we established that the up-regulation of miR-503 and the down-regulation of miR-222-5p both regulate MSC to SMC differentiation. [score:8]
However, the mutation of the target site complementary to the 5′-end of the miRNA did not consistently recover the inhibition of the miR-222-5p on plasmids containing αSMA 3′-UTR, implying that the site complementary to the 3′-end might also have some effect in inducing the complementary binding of miR-222-5p to αSMA 3′-UTR and promoting the inhibitory effect. [score:8]
Consistent with the microRNA array results, the up-regulation of miR-503-5p and the down-regulation of miR-222-5p were time -dependent (Fig. 3 A). [score:7]
Furthermore, target site mutation experiments confirmed that αSMA 3′-UTR might be a direct target of miR-222-5p. [score:7]
During SMC differentiation, miR-222-5p down-regulation might work together with miR-503 up-regulation. [score:7]
It was established in our study that miR-503 targets SMAD7 to promote MSC to SMC differentiation, and miR-222-5p targets ROCK2 to inhibit the differentiation process. [score:7]
Increased level of miR-222-5p prompted the down-regulation of SMC markers, including calponin and αSMA both in the mRNA expression by Q-PCR (Fig. 6 B) and at the protein level by and immunofluorescent staining (Fig. 6, C and D). [score:6]
The postulation that downstream targets of miR-222-5p may also regulate miR-503 expression would merit further examination. [score:6]
Q-PCR analysis showed the down-regulation of ROCK2 mRNA expression 1 day after miR-222-5p mimic treatment (Fig. 7 B). [score:6]
Furthermore, the mechanistic study implied that miR-503 mimics or miR-222-5p inhibitors carry the potential to improve the performance of these vascular grafts through enhancing SMC differentiation from MSCs while avoiding possible off-target effects from the use of TGFβ1. [score:5]
Although they target different pathways regulating SMC differentiation, whether miR-503 and miR-222-5p directly interact with each other merited further examination. [score:5]
This suggested that miR-222-5p could affect the expression of miR-503, but miR-503 does not interfere with the expression of miR-222-5p. [score:5]
Furthermore, the expression of miR-503 could be inhibited by miR-222-5p. [score:5]
Taken together, ROCK2 expression increased in a time -dependent manner during differentiation and could be inhibited by miR-222-5p mimic treatment. [score:5]
with insertions of either αSMA 3′-UTR sequence or mutated sequence at predicted complementary sites were then utilized to validate whether 3′-UTR of αSMA mRNA could be directly targeted by miR-222-5p. [score:4]
A, alignment of miR-222-5p and ROCK2 3′-UTR showed the postulated target -binding sites (red) and induced mutations (blue). [score:4]
Figure 8. 3′-UTRs of ROCK2 and αSMA were direct targets of miR-222-5p. [score:4]
The level of miR-222-5p was down-regulated in the differentiation process. [score:4]
However, only the mature strand was examined in the study, whereas the down-regulated miR-222-5p during SMC differentiation in our experimental system is the passenger strand, in which role has not yet been established. [score:4]
” It was revealed that ROCK2 contains two putative seed sites that strongly implied that it might be directly targeted by miR-222-5p. [score:4]
Therefore, we concluded that ROCK2 3′-UTR is a direct target of miR-222-5p. [score:4]
miR-222-5p mimic transfection resulted in miR-503 down-regulation. [score:4]
ROCK2 was shown to be a direct target of miR-222-5p in our study. [score:4]
B, alignment of miR-222-5p and the 3′-UTR of αSMA showed the postulated target -binding sites (red) and induced mutations (blue). [score:4]
3′-UTR segments of ROCK2 and αSMA are direct targets of miR-222-5p. [score:4]
miR-222-5p inhibits SMC differentiation. [score:3]
However, 24 h after transfection of the miR-222-5p mimic in MSCs, the level of miR-503 was significantly down-regulated as shown by TaqMan microRNA assay (Fig. 8 E). [score:3]
Thus, components of both pathways were examined for potential miR-222-5p targets. [score:3]
ROCK2 3′-UTR contains two target -binding sites (site 1 and site 2) of miR-222-5p, which were mutated alone (m1, m2) or together (m1+ m2). [score:3]
ROCK2 was also inhibited at the mRNA level with miR-222-5p mimic treatment in human adipose tissue-derived MSCs (Fig. S4 C). [score:3]
C, co-transfection of miR-222-5p mimics and reporter plasmid with WT ROCK2 3′-UTR showed reduced relative luciferase activity as compared with vector with empty plasmid, whereas mutation of both target -binding sites (m1+ m2) recovered the reduction. [score:3]
The results above demonstrated the capacity of miR-222-5p mimics in inhibiting SMC differentiation. [score:3]
B, miR-222-5p mimic treatment in αMEM with 1% FBS and 5 ng/ml TGFβ1 for 2 days inhibited the level of ROCK2 mRNA as shown by Q-PCR. [score:3]
The implication from our in vitro study is that miR-503 mimics and miR-222-5p inhibitors may have the potential to augment the performance of vascular grafts by promoting the differentiation of stem cells toward SMCs. [score:3]
Figure 7. ROCK2 3′-UTR is a potential target of miR-222-5p. [score:3]
Induction of SMC markers was also shown with miR-222-5p inhibitor treatment; however, the effect is moderate (Fig. S5), possibly due to the already significantly reduced level of miR-222-5p in the differentiation process. [score:3]
We also showed that miR-503 was regulated by miR-222-5p. [score:2]
The lack of complementary sequence between miR-503 and miR-222-5p suggests that they are unlikely to directly bind to each other (data not shown). [score:2]
E, level of miR-503 was inhibited by miR-222-5p mimic treatment after 1 day as shown with TaqMan microRNA assay. [score:2]
However, to date, there is no report available on the direct relation between miR-222 and the TGFβ1-signaling pathway. [score:2]
Finally, miRNA-centered mechanisms involved in the differentiation process into SMCs were elucidated with the identification of novel regulatory miRNAs (miR-503-5p and miR-222-5p). [score:2]
Data were obtained from at least three independent experiments and shown as mean ± S. D. *, p < 0.05; **, p < 0.01; and ***, p < 0.001. mim ctrl, miRNA mimic negative control; mim 222-5p, miR-222-5p mimic. [score:1]
C, and analysis of ROCK2 after miR-222-5p mimic treatment in αMEM with 1% FBS and 5 ng/ml TGFβ1 for 2 days. [score:1]
); miR-222-5p mimic (4464066 MC12656, Life Technologies, Inc. [score:1]
miR-222 participates in numerous physiological and pathophysiological conditions, including cancer progression (41), skeletal muscle regeneration (42), and vascular remo deling (43). [score:1]
Data were obtained from at least three independent experiments and shown as mean ± S. D. *, p < 0.05; **, p < 0.01, and ***, p < 0.001. mim ctrl, miRNA mimic negative control; mim 222-5p, miR-222-5p mimic, si ctrl, siRNA negative control; si ROCK2, siRNA ROCK2. [score:1]
miR-222, which belongs to the same miRNA family as miR-221, was identified as an important modulator in platelet-derived growth factor–induced SMC phenotypic change (23). [score:1]
To test this hypothesis, the sequence of miR-222-5p was aligned with αSMA mRNA, and complementarity was found at both the 5′- and 3′-end of miR-222-5p with the 3′-UTR of αSMA mRNA (Fig. 8 B). [score:1]
In our stem cell to SMC differentiation system, miR-222-5p, which is the passenger strand of miR-222, was examined. [score:1]
On the contrary, 24 h after transfection of miR-503 mimic in MSCs, the level of miR-222-5p was not affected (Fig. 8 F). [score:1]
In addition, the mature strand miR-222-3p was examined in most studies. [score:1]
Although the passenger strand of miR-222 (i. e. miR-222-5p) was wi dely accepted to be destined for degradation without any function after maturation, recent studies have begun to depict the pathological importance of passenger strands of miRNAs (24, 25). [score:1]
Interaction of miR-503 and miR-222-5p. [score:1]
The success of miRNA mimic transfection was confirmed by the significant increase of miR-222-5p levels (Fig. 6 A). [score:1]
3′-UTR sequences of selected genes were subjected to screening for the putative seed site of miR-222-5p, “CTACTGA. [score:1]
D, immunofluorescent staining showed the intensity of SMC markers (calponin and αSMA) after miR-222-5p treatment for 2 days. [score:1]
[1 to 20 of 61 sentences]
6
[+] score: 214
18s was used as endogenous control, * P < 0.05 versus oxLDL and EMP [miR-222-down-regulated], n = 8. To further confirm ICAM-1 as target for miR-222 in EMP, miR-222 inhibitor was used to generate EMP [miR-222-down-regulated] and corresponding EMP [mock -transfected]. [score:11]
18s was used as endogenous control, * P < 0.05 versus oxLDL and EMP [miR-222-down-regulated], n = 8. To further confirm ICAM-1 as target for miR-222 in EMP, miR-222 inhibitor was used to generate EMP [miR-222-down-regulated] and corresponding EMP [mock -transfected]. [score:11]
As we found that genetic knock-down of miR-222 in EMP abrogated EMP -mediated inhibition of ICAM-1 expression (Fig. 3D and E), we next tested the effect of a biological reduction in miR-222 expression in iEMP derived under hyperglycaemic conditions. [score:8]
Down-regulation of miR-222 in EMP abrogated EMP -induced inhibition of ICAM-1 expression after TNF-α stimulation. [score:8]
In this study, we found that EMP reduce TNF-α -induced endothelial inflammation in vitro by transferring functional miR-222 to target ECs with subsequent down-regulation of ICAM-1. These findings emphasize that EMP act as anti-inflammatory mediator by functionally influencing endothelial target cells. [score:8]
To generate EMP [miR-39], EMP [miR-222-down-regulated] and EMP [mock -transfected], HCAEC were transfected with cel-miR-39 (1 nM; Qiagen), miR-222 inhibitor or microRNA inhibitor control (1 nM, all from Applied Biosystems) using lipofectamine 2000 (Invitrogen) for 16 hrs and exposed to media without growth media supplements for 24 hrs to generate modified EMP as previously described 10. [score:8]
Treatment of ApoE−/− mice fed high cholesterol diet with EMP [miR-222-down-regulated] abrogated the EMP-promoted inhibition of vascular ICAM-1 expression (* P < 0.05, n = 7–8, Fig. 3F). [score:8]
Finally, in parallel to the in vivo mo del, stimulation of oxLDL -treated HCAEC with EMP [miR-222-down-regulated] abolished the EMP -induced inhibition of endothelial ICAM-1 expression (* P < 0.05, n = 6–7, Fig. 3G). [score:8]
Treatment of endothelial target cells with the modified EMP showed that EMP contain functional miR-222 that regulate ICAM-1 expression in target ECs (*** P < 0.01, n = 5–6, Fig. 3D and E). [score:8]
Furthermore, ICAM-1 showed a clear trend towards an augmented expression in HCAEC treated with sera from CAD patients (1.00 ± 0.06 versus 1.32 ± 0.19, P = 0.07, n = 10, Fig. 5C), supporting our hypothesis that miR-222 inhibits ICAM-1 expression (Fig. 6). [score:7]
We found that EMP contain and transfer miR-222 into endothelial target cells and inhibit ICAM-1 expression. [score:7]
Figure S4 Efficient down-regulation of miR-222 in EMP [miR-222-down-regulated]. [score:7]
Intercellular adhesion molecule-1 is one predicted target of miR-222 and a direct inhibition of ICAM-1 by miR-222 has been demonstrated by Ueda et al. 30. [score:6]
Efficient miR-222 down-regulation in EMP using miR-222 inhibitor was confirmed by real-time PCR (Fig.  S4). [score:6]
Interestingly, this is in accordance with findings from Togliatto et al., who demonstrated that hyperglycaemic conditions inhibit EC proliferation through down -regulating miR-222 expression on ECs 37. [score:6]
Importantly, reduced miR-222 level in iEMP resulted in altered inhibition of TNF-α -induced endothelial ICAM-1 expression (Fig. 4B and C) and subsequent monocyte adhesion (Fig. 4D). [score:5]
As we found that miR-222 selectively inhibits endothelial ICAM-1 expression, which contributes to vascular inflammation and atherosclerosis, we finally explored whether miR-222 levels are altered in patients with CAD (CAD). [score:5]
To explore the effect of patient’s sera on the endothelium, HCAEC were stimulated with sera from patients with and without CAD for 24 hrs, and miR-222 and ICAM-1 expression in target cells was assessed. [score:5]
In conclusion, we show that EMP reduce ICAM-1 expression in a miR-222 -dependent mechanism in endothelial target cells. [score:5]
Next, three online databases (miRanda, PicTar5, TargetScanHuman6.0) were independently used to find predicted mRNA targets for miR-222. [score:5]
HCAEC pre -treated with EMP, EMP [miR-222-down-regulated], EMP [mock -transfected] or vehicle were stimulated with TNF-α or vehicle for 24 hrs. [score:4]
EMP -mediated ICAM-1 down-regulation is miR-222 dependent. [score:4]
Furthermore, miR-222 controls neovascularization by regulating signal transducer and activator of transcription 5A expression 32. [score:4]
Among those, miR-222 was the strongest regulated miR between EMP and HCAEC with a significantly higher expression in EMP (Fig. 3A and B). [score:4]
All mice received a high-fat, cholesterol-rich diet that contained 21% fat, 19.5% casein and 1.25% cholesterol (Ssniff special nutrition, Soest, Germany) for a total of 8 weeks (or 4 weeks for EMP [miR-222-down-regulated] experiments) and were injected intravenously twice per week with 1 × 10 [7] AnnexinV [+] EMP diluted in 200 μl sterilized PBS. [score:4]
Figure 6 Proposed mechanism: Endothelial microparticles reduce ICAM-1 expression in a microRNA-222 -dependent mechanism. [score:3]
Interestingly, all of the used databases predicted ICAM-1 as target for miR-222. [score:3]
Further experiments demonstrated increased miR-222 level in EMP -treated endothelial target cells, suggesting an efficient transfer of miR-222 by EMP. [score:3]
Extending these experiments, treatment of HCAEC with EMP markedly increased the abundance of miR-222 in target ECs, whereas TNF-α treatment alone did not influence miR-222 level (1 ± 0.0 versus 1.18 ± 0.1 versus 1.81 ± 0.25, * P < 0.05, n = 6–8, P < 0.05, Fig. 3C). [score:3]
Figure 3EMP contain and transfer functional miR-222 to endothelial target cells. [score:3]
Figure 5Coronary artery disease is associated with reduced circulating miR-222 levels. [score:3]
Intercellular adhesion molecule-1 and miR-222 expression was analysed using real-time PCR as described in the previous sections. [score:3]
In vascular smooth muscle cells (VSMCs), miR-222 has been shown to act as crucial modulator of proliferation by targeting p27 [Kip1] and p57 [Kip2] 31. [score:3]
Extending these findings, we show that hyperglycaemic conditions reduce miR-222 expression on EC-derived microparticles. [score:3]
Coronary artery disease is associated with reduced circulating miR-222 levels. [score:3]
Our miR array experiments show that miR-222 is the highest regulated miR between EMP and their releasing endothelial parent cells. [score:2]
experiments revealed a significantly reduced miR-222 expression in iEMP compared to EMP (0.64 ± 0.09 versus 1.12 ± 0.14, n = 14–16, P < 0.05, Fig. 4A). [score:2]
Gain and loss of function experiments showed that knock-down of miR-222 in EMP abrogated the EMP -mediated anti-inflammatory effects. [score:2]
Stimulation of HCAEC with sera from CAD patients resulted in a significantly reduced miR-222 expression compared to sera from patients without CAD (1.00 ± 0.16 versus 0.59 ± 0.14, * P < 0.05, n = 10, Fig. 5B). [score:2]
We found that iEMP derived under high glucose conditions show significantly reduced miR-222 expression and reduced anti-inflammatory capacity in vitro compared to EMP derived from untreated cells. [score:2]
Assuming an anti-inflammatory role of miR-222, one may speculate that apoptotic EC package miR-222 as a vasculo-protective message into EMP to shelter adjacent ECs from further damage. [score:1]
These at first sight contradictory results suggest that the effect of MPs and probably of miR-222 depends not only on the state of the releasing cells but also on the pro- or anti-inflammatory condition of the recipient cell. [score:1]
Apparently, under pro-inflammatory conditions, iEMP derived under pathological hyperglycaemic concentrations lose their anti-inflammatory properties because of decreased miR-222 levels. [score:1]
These results indicate that EMP can act as biological vectors that deliver functional miR-222 into recipient ECs (Fig. 6). [score:1]
Figure 4High glucose condition reduces miR-222 in iEMP, which subsequently lose their anti-inflammatory properties. [score:1]
First, although we see a specific effect of miR-222 in EMP, we cannot rule out the influence of other miR or bioactive molecules present in EMP in our findings. [score:1]
Interestingly, the effects of miR-222 seem to be cell specific with opposite effects on VSMCs and ECs 33. [score:1]
EMP derived from glucose -treated ECs contain less miR-222 and lose their anti-inflammatory capacity. [score:1]
These data demonstrate an efficient transfer of miR-222 by EMP to recipient cells. [score:1]
According to our miR array data, apoptotic ECs seem to specifically package miR-222 in EMP. [score:1]
The role of miR-222 in vascular biology is just beginning to become apparent. [score:1]
Endothelial microparticles derived from high glucose-damaged ECs contain less miR-222 and lose their anti-inflammatory capacity. [score:1]
[1 to 20 of 52 sentences]
7
[+] score: 175
By analyzing the 3′ untranslated region (3′UTR) of β1-syntrophin, we found that three miRs could target this protein, and we established that one of these, miR-222, is upregulated in the muscles of mdx mice and is involved in the downregulation of the β1-syntrophin isoform in dystrophic muscles. [score:11]
Thus, these results demonstrate that miR-222 is expressed in skeletal muscles, and notably upregulated in mdx mice, suggesting a potential role of miR-222 in downregulating β1-syntrophin expression in dystrophic muscles. [score:11]
In fact, miR-222 has been found to be upregulated in 10 different myopathies: a study by Eisenberg et al. [31] reported that a large number of miRs were differentially expressed in various muscular pathologies and, that, in particular, the expression of five miRs (miR-146b, miR-221, miR-155, miR-214, miR-222) was altered in all the analyzed syndromes. [score:8]
The obtained results (Fig. S3) showed that miR-222 regulated the expression of these myogenic miRs: miR-222 overexpression reduced the expression of all these three miRs. [score:8]
Conversely, anti-miR-222 treatment that inhibited endogenous miR-222 exerted no effect on the expression of miR-1, miR-133 and miR-206, probably due to the low miR-222 expression of in C [2]C [12] cells. [score:7]
These authors observed that in quails, murine primary muscle cells, and myogenic rodent cell lines, the miR-221/miR-222 cluster was highly expressed in proliferating myoblasts but downregulated in differentiated myotubes. [score:6]
Taken together, these data demonstrate that miR-222 regulates β1-syntrophin protein expression, and silencing miR-222 can restore β1-syntrophin protein expression to normal in dystrophic cells in culture. [score:6]
Among the possible microRNAs (miRs) found to be upregulated in the skeletal muscle tissue of mdx compared to wt mice, we demonstrated that miR-222 specifically binds to the 3′-UTR of β1-syntrophin and participates in the downregulation of β1-syntrophin. [score:6]
In muscle cells and the hepatic cell line Hep2, it was shown that endogenous β1-syntrophin protein levels were reduced after transfection with miR-222 and that the inhibitory effect of miR-222 was blocked in the presence of anti-miR-222, which then restored β1-syntrophin protein expression to normal. [score:5]
The results showed that β1-syntrophin expression was reduced by approximately 60% in the hepatic cells transfected with miR-222, and its expression was restored in the cells co -transfected with miR-222 and anti-miR-222 (Fig. 7A). [score:5]
In conclusion, our results showed that in dystrophic muscle increased miR-222 expression lead to the decrease in β1-syntrophin expression by specifically binding to the 3′-UTR of β1-syntrophin. [score:5]
Together, these data indicated a potential role of miRs in dystrophy and our data confirmed the miR-222 upregulation in muscular dystrophy. [score:4]
Cardinali et al. showed that p27 acts as a direct target of miR-222, thus implying a prominent role of this miR in the myogenic process. [score:4]
Among these miRs, five (miR-146b, miR-221, miR-155, miR-214, and miR-222) were found to be consistently dysregulated in the different analyzed diseases [31]. [score:4]
Furthermore, overexpression of miR-222 in proliferating C [2]C [12] myogenic cells, induced a modulation of myogenic miRs suggesting a potential novel regulatory role of miR-222 in the differentiation process. [score:4]
To address the role of miR-222 in regulating β1-syntrophin expression, we investigated the effect of overexpressing or silencing miR-222 on endogenous β1-syntrophin levels in cells. [score:4]
Another potential role of miR-222 could be the modulation of other miRs specifically expressed in skeletal muscles. [score:3]
The highest concentration of miR-222 employed (5×10 [−8]M) caused a decrease of 50% in luciferase activity, in agreement with the inhibitory effect observed in other cellular systems by the same miR [35], [36]. [score:3]
The decreased expression of miR-222 during C [2]C [12] differentiation could explain the corresponding two- to three-fold increase in β1-syntrophin levels in differentiating versus proliferating C [2]C [12] cells [40]. [score:3]
This experiment clearly indicates that the impairment of β1-syntrophin protein expression in dystrophic cells is due to the elevated levels of endogenous miR-222, and that β1-syntrophin protein levels can be restored by anti-miR treatment. [score:3]
miR-222 expression levels in wt and dystrophic skeletal muscle tissues. [score:3]
As shown in Fig. 6B, a mutation of binding site 1 almost completely abolished the activity of miR-222, whereas a mutation of binding site 2 only slightly reduced miR-222 activity, indicating that the majority of miR-222 activity is due to the binding to the first consensus sequence. [score:3]
The miR-222 levels in dystrophic samples are expressed as fold change relative to those in control samples. [score:3]
In addition, in agreement with a recent report by Cardinali et al. [39], we also detected a reduction in miR-222 expression during myogenic differentiation of C [2]C [12] cells. [score:3]
A specific antagonist of miR-222 allow rescued β1-syntrophin protein expression in dystrophic satellite cells. [score:3]
In our study, we showed, for the first time, that the β1-syntrophin protein is a target of miR-222. [score:3]
When miR-222 was overexpressed in satellite cells from wt mice, a 40% reduction in β1-syntrophin level was observed; this reduction was abolished when miR-222 activity was blocked by the corresponding antagomir (Fig. 7B). [score:3]
To confirm the target specificity of miR-222, two pGL3-3′UTR β1-syntrophin constructs, carrying deletions of the complementary sequences that could potentially be involved in the binding of miR-222, were used. [score:3]
In satellite dystrophic cells expressing high levels of miR-222, anti-miR-222 treatment slightly increased β1-syntrophin protein levels. [score:3]
As shown by the luciferase activity assays, miR-222 efficiently targeted the 3′-UTR of β1-syntrophin. [score:2]
B: Luciferase activity of COS1 cells was assessed in cells transfected with pGL3-3′UTR-β1-syntrophin or two vectors with mutations in the first (Mut1) or second (Mut2) putative binding site for miR-222 in the absence or presence of 5×10 [−8]M of miR-222. [score:2]
RNA levels in cells treated with miR-222 or anti-miR-222, are expressed as fold change compared to those in the untreated cells. [score:2]
Recently, Greco et al. [32], investigated miR expression in the adductor muscles from mdx mice and DMD bioptic samples, and miR-222 was among the eleven dysregulated miRs identified in that study. [score:2]
In another series of experiments, C [2]C [12] cells were transfected with miR-222 or antimiR-222 and the expression levels of miR-1, miR-133, miR-206 were measured. [score:1]
MiR-222 level was higher in dystrophic muscles compared to that in wt muscles, and the levels increased with the progression of the disease. [score:1]
In particular, a 50% increase in miR-222 levels was observed in the muscles of 20- and 30-day-old mdx mice, and a maximum of three-fold increase was evident in the muscles of five-month-old mdx animals (Fig. 5). [score:1]
Thus, we investigated whether miR-222 is involved in the expression of three myogenic miRs: miR-1, miR-133 and miR-206. [score:1]
The Hep2 cells were transfected with miR-222 and/or anti-miR-222, and β1-syntrophin protein levels were determined by western blot. [score:1]
MiR-222 was also the only miR specifically binding the 3′-UTR of the β1-syntrophin mRNA. [score:1]
By analyzing this 3′-UTR, we identified putative consensus binding sites for three miRs: miR-24, miR-222 and miR-339. [score:1]
MiR-222 expression was also detectable in primary satellite cell cultures and was 50% higher in myogenic cells from young mdx mice compared to that in wt cells. [score:1]
Hep2 cells (A) and, muscle satellite cells from wt mice (B) or from mdx mice (C) were transfected with miR-222 and/or antimiR-222. [score:1]
To determine whether the β1-syntrophin mRNA is the real target of miR-222, the activity of a luciferase reporter construct containing the 3′-UTR of β1-syntrophin RNA was evaluated in the presence of miR-222. [score:1]
MiR-222 expression was significantly elevated in the gastrocnemius muscles from mdx mice compared to those from wt mice. [score:1]
To perform this experiment, the 3′-UTR of β1-syntrophin was cloned into the pGL3 vector, and the construct was transiently transfected into COS1 cells cultured in the absence or presence of different concentrations of miR-222. [score:1]
We demonstrated that miR-222 modulates the β1-syntrophin protein in the cells of different tissues. [score:1]
The 3′-UTR of β1-syntrophin contains two putative consensus sites for miR-222 binding. [score:1]
Analysis of miR-222 responsive elements within the 3′-UTR of β1-syntrophin. [score:1]
In the satellite cells from dystrophic muscles of young mice, the expression level of miR-222, measured by qRT-PCR, was 50% higher than that in wt cells (data not shown). [score:1]
RNA levels of miR-206, miR-1, and miR-133 in C [2]C [12] cells transfected with miR-222 (5×10 [−8]M) or anti-miR-222 (5×10 [−8]M) were assessed by qRT-PCR; relative gene expression was calculated by the comparative Ct method (2 [−ddCt]). [score:1]
0012098.g007 Figure 7Hep2 cells (A) and, muscle satellite cells from wt mice (B) or from mdx mice (C) were transfected with miR-222 and/or antimiR-222. [score:1]
This result indicates that exogenous miR-222 reduces the protein level of endogenous β1 syntrophin, regardless of the cell origin. [score:1]
Luciferase activity in the presence of miR-222. [score:1]
This result strongly suggested an interaction between miR-222 and the 3′-UTR of β1-syntrophin. [score:1]
For western blot analysis, the cells were plated at a density of 70,000/well and transfected either with or without 5×10 [−8] M miR-222 or antimiR-222 (Ambion/Applied Biosystem, Piscataway, NJ, USA). [score:1]
Therefore, to obtain a significant signal, the hepatic cell line, Hep2, was used to assess β1-syntrophin modulation in the presence of exogenous miR-222. [score:1]
Among the several miRs predicted to bind the β1-syntrophin 3′-UTR, three miRs (miR-222, miR-24, and miR-339) were identified by the different databases utilized. [score:1]
The results showed that luciferase activity was dose -dependently decreased by miR-222 and no luciferase activity was detected when a “scrambled” negative control or an anti-miR specific to miR-222 was used in its place (Fig. 6A). [score:1]
A: Luciferase activity in COS1 cells transfected with pGL3-3′-UTR-β1-syntrophin was assessed in the absence or presence of different concentrations of miR-222 and or antimiR (5×10 [−8]M). [score:1]
miR-222 modulation of β1-syntrophin levels. [score:1]
0012098.g006 Figure 6A: Luciferase activity in COS1 cells transfected with pGL3-3′-UTR-β1-syntrophin was assessed in the absence or presence of different concentrations of miR-222 and or antimiR (5×10 [−8]M). [score:1]
To this end, C [2]C [12] cells were transfected with miR-222 or anti-miR-222. [score:1]
No reduction in β1-syntrophin level in response to exogenous miR-222 was observed in these cells, whereas treatment with anti-miR-222 led to a slight increase in β1 syntrophin level, thus counteracting the elevated endogenous level of miR-222 in the mdx muscles (Fig. 7C). [score:1]
[1 to 20 of 63 sentences]
8
[+] score: 131
Other miRNAs from this paper: hsa-mir-17, hsa-mir-221, hsa-mir-222, mmu-mir-17, mmu-mir-221
MiR-221 and miR-222 are two highly homologous microRNAs whose upregulation has been recently described in several types of human tumors, for some of which their oncogenic role was explained by the discovery of their target p27, a key cell cycle regulator. [score:7]
As a first step to test this hypothesis, we pre -transfected PC3 cells, a high miR-221 and miR-222 expressing prostate carcinoma cell line [9], with LNA oligonucleotides targeting mir-221 and miR-222, in order to abolish their expression. [score:7]
We also checked if antagomir -mediated suppression of miR-221/222 resulted in a correspondent increase of p27 levels, as compared to untreated tumors; Fig. 3D shows a representative image of Western blot analyses of total protein extracts from the same tumors already tested for miR-221/222 expression: in all cases assayed, a high p27 expression was measured where miR-221 and miR-222 were kept low by antagomir action, whereas the lack of inhibition of the two microRNAs matched with a low level of p27 expression. [score:7]
In our work we aimed to demonstrate that the overexpression of miR-221 and miR-222, a couple of microRNAs that we had previously shown to be strongly upregulated in vitro in aggressive prostate carcinoma cell lines, is relevant to prostate carcinoma cell growth in vivo, both in mouse mo dels and in human tumor samples. [score:6]
The numerical values under each lane indicate the relative expression of miR-221 and of p27, where each p-221 transfected tumor is compared to its controlateral control (pCDNA3.1) tumor, whose miR-221 and p27 expression levels are set as  = 1. G p27 mRNA 3′UTR sites targeted by miR-221 and miR-222. [score:6]
We previously described that miR-221/222 expression is directly correlated with the aggressiveness of cell mo dels of prostate carcinoma, and that the forced overexpression of miR-221 or miR-222 in the poorly aggressive prostate carcinoma LNCaP cell line is sufficient to accelerate their proliferation and in vitro tumorigenicity [9]. [score:6]
When the values of p27 protein expression were plotted against miR-221 and miR-222 expression, an inverse correlation was evident (Fig. 4C, Spearman: p = 0.0164 for miR-221 and p = 0.0057 for miR-222). [score:5]
The reason accounting for the recognition of shared targets for both miR-221 and miR-222 is found in their “seed” sequences, short (∼7–8 nt) regions at their 5′ ends through which they bind their target sites in mRNA 3′UTRs: these “seeds” are identical in miR-221 and miR-222 and are also very well evolutionarily conserved, likely indicating the common involvement of these two microRNAs in the same pathways. [score:5]
In vivo intratumoral knockdown of miR-221 and miR-222 upregulates p27 and reduces tumor growth of PC3 xenografts. [score:5]
MiR-221 and miR-222 are highly expressed in human prostate carcinoma primary samples and their expression is inversely correlated to that of p27. [score:5]
Thus, our prostate carcinoma xenograft data demonstrate, as a whole, that miR-221 (and most likely miR-222, even if here we are not providing a direct evidence for this) is sufficient to strongly enhance prostate carcinoma growth and, consequently, that the inhibition of miR-221 and miR-222 is necessary, and in fact effective, to reduce the in vivo growth of this tumor. [score:4]
After approximately one week, when the tumors reached an average volume of ∼50 mm [3], the tumors were directly injected with a cocktail of antagomirs (Dharmacon, CelBio, Italy) targeting miR-221 and miR-222 on one flank, or with a control antagomir on the other. [score:4]
Once more, we show that treated tumors growing smaller than controls maintain reduced levels of miR-221 and miR-222 for the whole duration of the experiments, and that this produces a permanent upregulation of p27, otherwise low in control tumors. [score:4]
This observation led us to check the p27 status in transfected tumors, in search of the inverse correlation expected on the basis of the in vitro validated negative regulation of p27 by miR-221 [9], exerted by miR-221 and miR-222 via the specific recognition of two target sequences in the p27 3′UTR (Fig. 1G ). [score:4]
Real-time PCR showed a consistent upregulation of both miR-222 and miR-221 in about 80% of the tumor samples analyzed with respect to normal counterparts, even if no correlation was observed with Gleason and stage (Fig. 4A and Table 1). [score:4]
As shown in Fig. 2A, LNA oligoes efficiently depleted miR-221 and mir-222 from PC3 cells, to such an extent that miR-221/222 expression was almost undetectable by Northern blot. [score:3]
To assess the significance of our results in human tumor samples, we analyzed miR-221 and miR-222 expression in 21 patients with stage II–III prostate cancer. [score:3]
0004029.g002 Figure 2 In vitro inhibition of miR-221 and miR-222 reduces tumor growth of PC3 derived tumors in SCID mice. [score:3]
The intratumoral injection of anti-miR-221 and anti-miR-222 antagomirs into PC3-derived tumors reduces tumor growth and has long lasting effects on miR-221 and miR-222 endogenous expression. [score:3]
On the other hand, we sought to investigate if it is possible to inhibit miR-221 and miR-222 expression in mouse mo dels of established prostate carcinoma, in order to set up the premises for a future therapeutic approach. [score:3]
Altogether, these results indicate that intratumoral injection of antagomirs targeting miR-221 and miR-222 can effectively keep low the concentration of these two microRNAs for as long as 24 days (i. e. time elapsed from third and last antagomir injection to animal sacrifice), concomitantly increasing p27 amount and ultimately reducing the growth of PC3 xenografts. [score:3]
In vitro inhibition of miR-221 and miR-222 reduces tumor growth of PC3 derived tumors in SCID mice. [score:3]
However, of course, the great interest of this observation lies in its reverse implications: that inhibiting miR-221 and miR-222 in prostate carcinoma may be a way to reduce its growth potential. [score:3]
We have pre -transfected cells from the highly aggressive PC3 cell line with LNA antisense oligonucleotides targeting miR-221 and miR-222, and subsequently followed the growth of tumor xenografts obtained through the injection of pre -transfected cells into SCID mice. [score:3]
We have recently shown that miR-221 and miR-222 are positive regulators of in vitro prostate carcinoma growth through the repression of p27 [9]. [score:2]
The graph shows the log fold change of miR-221 and miR-222 expression as compared to the value obtained for non-tumoral control sample N1. [score:2]
To achieve this goal, we treated pre-established tumors induced by the s. c. injection of PC3 cells into SCID mice, with anti-miR-221 and anti-miR-222 “antagomirs”, cholesterol-conjugated antisense molecules previously shown to own a good bioavailability and stability in vivo [25], [26]. [score:1]
The specific probes, end-labeled with T4 polynucleotide kinase in the presence of γ- [32]P-ATP, were: miR-221, 5′-gaaacccagcagacaatgtagc-3′; miR-222, 5′-gagacccagtagccagat-3′; U6, 5′-cacgaatttgcgtgtcatccttgcgcaggggcc-3′. [score:1]
0004029.g003 Figure 3 A Tumor growth curves depicting the average±SEM values of PC3 derived tumors injected either with a negative control antagomir (ctrl) or with a mixture of anti-miR-221 and anti-miR-222 antagomirs (anti-miR221/222). [score:1]
C Quantitative real-time PCR of miR-221 (upper panel) or miR-222 (lower panel) in tumors excised from four representative mice (A10, D3, D10, E3) at the day of sacrifice, 24 days after the last antagomir injection. [score:1]
For the experiments with in vitro transfected PC3 cells, LNA oligonucleotides against miR-221 and miR-222, and a negative control oligonucleotide were obtained from Ambion Inc. [score:1]
Among oncomiRs, we and others previously found that miR-221 and miR-222 are involved in several different types of human neoplasms, such as glioblastoma [5]– [8], prostate carcinoma [9], non-small cell lung cancer [10], [11], hepatocellular cancer [12], [13], pancreatic cancer [14], and many others. [score:1]
The in vitro depletion of miR-221 and miR-222 renders PC3 cells less efficient in the establishment of in vivo xenografts. [score:1]
A Tumor growth curves depicting the average±SEM values of PC3 derived tumors injected either with a negative control antagomir (ctrl) or with a mixture of anti-miR-221 and anti-miR-222 antagomirs (anti-miR221/222). [score:1]
Antagomir sequences were 5′-g [s]a [s]aacccagcagacaaugu [s]a [s]g [s]c [s]u-Chol 3′ (anti-miR-221), 5′-g [s]a [s]gacccaguagccagaugua [s]g [s]u [s]c [s]u-Chol 3′ (anti-miR-222). [score:1]
C Average volume fold increase of tumors derived from PC3 cells transfected with anti-miR-221+anti-miR-222 LNA oligonucleotides (anti-221/222) or with a negative control LNA oligonucleotide (ctrl). [score:1]
0004029.g004 Figure 4 A MiR-221 and miR-222 expression measured by quantitative real-time PCR in primary cell lines from prostate carcinomas (T samples) or normal prostate (N samples). [score:1]
To answer this question, we performed Q-RT-PCR on total RNA extracted from excised tumors, and verified an effective and persistent reduction of miR-221 and miR-222 in treated tumors vs control ones (Fig. 3C ). [score:1]
40 µl of PBS containing 1 µg of each anti-miR-221 and anti-miR-222 antagomir, or control antagomir, were injected intratumorally at day 0, 5 and 9, for a total of three injections per tumor. [score:1]
C Spearman correlation analysis performed between miR-221, miR-222, and p27 levels in 18 primary cell lines derived from prostate carcinoma tissues. [score:1]
A Northern blot analysis of total RNA extracted from PC3 cells transfected in vitro with anti-miR-221+anti-miR-222 LNA oligonucleotides (anti-221/222). [score:1]
Both approaches clearly aimed at reducing miR-221 and miR-222 in the tumors but, while the first one theoretically conferred a delay to pretransfected cells that received the LNA oligoes, before they settled in the host environment and started assembling a true tumor, the second one more closely mimicked a “treatment”, as it was performed in already grown tumors, where cells had already formed their network of contacts within the host body. [score:1]
For each mouse, the tumor on one flank was injected with a mixture of anti-miR-221 and anti-miR-222 antagomirs, while the controlateral tumor was injected with a control antagomir. [score:1]
A MiR-221 and miR-222 expression measured by quantitative real-time PCR in primary cell lines from prostate carcinomas (T samples) or normal prostate (N samples). [score:1]
Our findings indicate that miR-221 and miR-222 are key modulators of prostate carcinoma also in vivo. [score:1]
Each animal received control cells on one flank and anti-miR-221+anti-miR-222 pre -treated cells on the other. [score:1]
On the other hand, we have injected anti-miR-221 and anti-miR-222 antagomirs into pre-established PC3 xenografts. [score:1]
[1 to 20 of 47 sentences]
9
[+] score: 106
Other miRNAs from this paper: hsa-mir-222
We subsequently ran a pathway analysis (Ingenuity Pathway Analysis, IPA, Qiagen) from a microarray comparing NRVM with precursor-miRNA -mediated miR-222 overexpression to controls (pre-miR-222 and Ctr-pre) and found cell cycle regulators in general, and with subsequent analysis (Fig.   5f), TEAD2 specifically, to be upregulated with miR-222 expression, suggesting that they are not direct targets of miR-222’s effects in this context. [score:12]
We went on to specifically check CCNG2 expression in miR-222 overexpressing neonatal rat ventricular cardiomyocytes (NRVMs), and found an increase in CCNG2 expression, strongly suggesting that this is not a direct miR-222 target (Fig.   5c). [score:10]
In contrast, we did find that increased expression of CCNG2 (cyclin G2), a relevant cell cycle regulator, but could not find CCNG2 as a predicted miR-222 target (through Pictar and Targetscan). [score:8]
Next, we inhibited miR-222 upregulation by weekly injection of a sequence-specific locked nucleic acid inhibitor (LNA)-anti-miR-222, together with [15]N-thymidine administration during the 8-week voluntary exercise protocol. [score:8]
Error bars represent ± s. e. m To further explore the mechanisms by which miR-222 regulates exercise -induced cardiomyogenesis, we performed quantitative gene expression analysis from sedentary and exercised mouse hearts for relevant genes previously validated as direct targets of miR-222 [18]. [score:7]
Error bars represent ± s. e. mTo further explore the mechanisms by which miR-222 regulates exercise -induced cardiomyogenesis, we performed quantitative gene expression analysis from sedentary and exercised mouse hearts for relevant genes previously validated as direct targets of miR-222 [18]. [score:7]
e Exercised mouse hearts show downregulation of miR-222 target HIPK1. [score:6]
a miR-222 is upregulated after eight weeks of voluntary wheel running in young adult mice (n = 6 mice per group, * p = 0.01, Student’s t test). [score:4]
Fig. 5Hypoxia and hippo pathways are not directly targeted by miR-222. [score:4]
Taken together with our previously published data demonstrating that HIPK1 is a direct target of miR-222 with anti-proliferative effects in cardiomyocytes [18], these data strongly suggest that HIPK1 contributes to miR-222’s modulation of exercise -induced cardiomyogenesis. [score:4]
Inhibition of miR-222 blocks exercise -induced cardiac growth. [score:3]
First, we confirmed that voluntary wheel running induced miR-222 expression in the adult mouse heart (Fig.   4a). [score:3]
Mechanistically, we show that the exercise -induced increase in cardiomyocyte [15]N-thymidine labeling can be abolished by inhibition of miR-222, a microRNA increased by exercise in both animal mo dels and humans. [score:3]
Fig. 4Inhibition of miR-222 prevents exercise -induced cardiomyogenesis. [score:3]
miR-222 inhibition. [score:3]
f Gene expression signal specifically for CCGN2 and TEAD2 detected in a microarray conducted from neonatal rat ventricular myocytes (NRVM) treated with control precursor (ctl-pre) and miR-222 precursor (pre-miR-222), respectively (n = 4 individual samples per group, * p < 0.05, Student’s t test). [score:3]
Moreover, these studies indicate that miR-222, and potentially other miR-222-independent cell cycle regulators, are necessary for exercise -induced cardiomyogenesis and suggest that enhanced cardiac regeneration may contribute to the benefits of exercise after myocardial injury. [score:2]
The cardiac hypertrophic response was attenuated in exercised mice treated with LNA-anti-miR-222, confirming that miR-222 is necessary for exercise -induced cardiac growth even over longer duration (8 weeks) than previously examined [18]. [score:1]
Although our prior work had suggested a role for miR-222 in cardiomyocyte proliferation [18], these studies were based on work in neonatal rather than adult cardiomyocytes, and proliferation markers that could not unambiguously identify mitotic events in vivo [18]. [score:1]
However, these changes were not significantly affected by suggesting they do not contribute to miR-222’s modulation of cardiomyogenesis (Fig.   5b). [score:1]
f Contingency table showing the absolute numbers of [15]N-labeled mononucleate/diploid cells of total counted cardiomyocytes from each group (sedentary:exercise = 0.4%:2.7%, p = 0.004, Fisher’s exact test, OR = 6.931, CI 1.87–30.83) To explore the mechanism of the cardiomyogenic exercise response, we studied the role of miR-222, a microRNA (miRNA) that increases in response to exercise in both animal mo dels and humans, and plays an important role in the cardiovascular effects of exercise 18, 31. [score:1]
sedentary hearts (a) and hearts from mice treated with LNA-anti-miR222 or LNA-scr-miR undergoing voluntary wheel running (b) (n = 3–5 mice per group, * p < 0.05, Student’s t test). [score:1]
Liu X miR-222 is necessary for exercise -induced cardiac growth and protects against pathological cardiac remo delingCell Metab. [score:1]
We conclude that exercise stimulates cardiomyogenesis in the injured and uninjured adult mouse heart and that miR-222 is necessary for the cardiomyogenic response. [score:1]
sedentary hearts (d) and hearts from mice treated with LNA-anti-miR222 or LNA-scr-miR undergoing voluntary wheel running (e) (n = 3–5 mice per group, * p < 0.05, Student’s t test). [score:1]
However, exercised mice treated with LNA-anti-miR-222 demonstrate a reduced number of [15]N-thymidine -positive cardiomyocytes closer to sedentary baseline levels (800–1350 cells from four mice per group were counted * p = 0.0255, Fisher’s exact test). [score:1]
c p value from significantly differential pathways analyzed by ingenuity pathway analysis (IPA, Qiagen) of a microarray conducted from neonatal rat ventricular myocytes (NRVM) treated with control precursor (ctl-pre) and miR-222 precursor (pre-miR-222), respectively (n = 4 individual samples per group). [score:1]
Exercised mice injected with scrambled LNA-anti-miR (LNA-Ctr) and sedentary mice treated with LNA-anti-miR-222 served as controls. [score:1]
Further exploration of the role of the Hippo pathway in endurance exercise although apparently independent of miR-222 may be of interest for future studies. [score:1]
sedentary LNA-anti-miR-222, one-way ANOVA with Tukey’s post-test for multiple comparisons). [score:1]
miRNA-222 as well as control precursors (pre-miR) were purchased from Invitrogen. [score:1]
Two-month-old C57Bl/6 male mice were subcutaneously injected with 10 mg kg [−1] of LNA -modified anti-miR-222 (LNA-anti-miR-222) or scrambled control (LNA-Ctr) reconstituted in saline for three consecutive days after osmotic pump implantation and then weekly after pump exchanges throughout the experiment. [score:1]
b underwent simultaneous [15]N-thymidine infusion and LNA-anti-miR-222 or control LNA-anti-miR (LNA-Ctr) treatment for 8 weeks of sedentary activity or voluntary wheel running. [score:1]
[1 to 20 of 33 sentences]
10
[+] score: 94
Finally, we demonstrate that intra-arterial administration of MuStem cells results in up-regulation of miR-133a and miR-222 concomitantly with a down -expression of two sarcomeric proteins corresponding to miR-222 targets. [score:8]
Expression of miRNA-222 in myoblasts induces myogenin expression followed by inhibition of sarcomeric protein accumulation. [score:7]
We observe a decrease in sarcomeric myosin heavy chain proteins expression in GRMD [MuStem] dog, reflecting the inhibition of sarcomeric protein accumulation concordant with miR-222 overexpression [20] (Fig.   5a and b). [score:7]
Lastly, while miR-222 is up-regulated in GRMD versus healthy dog muscle, it is found to be even more up-regulated in GRMD [MuStem] versus mock GRMD dog muscle (p = 0.03) (Fig.   4a). [score:7]
In accordance with previous observations made in the mdx mouse mo del and DMD patients [10, 22, 25, 26], we find that miR-222 and miR-486 exhibit a marked up-regulation and a down-regulation in 9-month-old GRMD dog muscle, respectively. [score:7]
We find that miR-222 expression is markedly up-regulated in GRMD dog muscle compared to healthy dog, while miR-486 tends to be down-expressed. [score:7]
We determine, for the first time, that miR-222 displays a differential expression pattern in GRMD dog muscle as shown by its marked up-regulation. [score:6]
Secondly, we demonstrate an up-regulation of miR-133a and miR-222 expression after systemic delivery of MuStem cells. [score:6]
We show that miR-133a (p = 0.03) and miR-222 (p = 0.03) are up-regulated in GRMD [MuStem] dogs compared to mock GRMD dogs (Fig.   4a), while miR-1, miR-206 and miR-486 expressions appear unchanged. [score:5]
In the dystrophic context, we observe a markedly increased expression of miR-222 (p = 0.03) and a tendency to decreased expression of miR-486 (p = 0.14) (Fig.   1a). [score:5]
In addition, we demonstrate an up-regulation of both miR-133 and miR-222 4 months after MuStem cell transplantation, highlighting their potential use as novel markers for the follow-up of effects associated with MuStem cell delivery in a dystrophic context. [score:4]
Our finding on the down -expression of two sarcomeric proteins MYH7 and MHC in GRMD [MuStem] muscle suggests that miR-133a and miR-222 could be involved in the remo delling of the sarcomeric assembly, thus preventing the accumulation of sarcomeric component aggregates observed in dystrophic muscle. [score:3]
We point out a differential muscle expression of miR-222 and miR-486 associated with the pathophysiology of the clinically relevant GRMD dog mo del with a tissue localization focused on regenerated fibres. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in 9-month-old healthy (n = 5) and GRMD (n = 3) dog muscle by real-time PCR and were normalized to RNU6B levels. [score:3]
We also establish a modified expression of miR-133a and miR-222 subsequent to MuStem cell infusion. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in muscles (right and left Biceps femoris) of three 9-month-old GRMD and six mock GRMD dog by real-time PCR and normalized by RNU6B levels. [score:3]
For this reason, we aim at establishing, for the first time, a description of miRNA dysregulations in GRMD dog skeletal muscle based on a dedicated set: miR-1, miR-133a, miR-206, miR-222 and miR-486. [score:2]
Expression levels of miR-1, miR-133a, miR-206, miR-222, and miR-486 were determined in muscles (right and left Biceps femoris) of six 9-month-old GRMD [MuStem] dogs compared to six mock GRMD dogs. [score:2]
In addition, we establish that MuStem cell infusion is characterized by an up-regulation of both miR-133a and miR-222, positioning them as potential useful markers to assess the efficacy of a cell -based strategy. [score:2]
Other miRNAs, such as miR-29, miR-34, miR-222 and miR-486, also play key-roles in modulating important pathways of skeletal muscle processes [19– 22]. [score:1]
To corroborate this result, we investigated the protein abundance of miR-222 targets (sarcomeric proteins: myosin heavy chain (MHC) and MYH7). [score:1]
Unfortunately, we failed to detect significant signal for miR-222 and miR-133a. [score:1]
Also, this indicates that miR-222 is involved in the molecular pathways linked to the cell cycle, the insulin signalling pathway and ubiquitin mediated proteolysis. [score:1]
[1 to 20 of 23 sentences]
11
[+] score: 85
Other miRNAs from this paper: hsa-mir-221, hsa-mir-222, mmu-mir-221, mmu-mir-1928
The animal treatment was initiated after the detection of palpable tumors, approximately 2 weeks following MM cells injection with 1mg/kg per mouse of miR-221 inhibitor or miR-222 inhibitor, or both miR-221/222 inhibitors, or NC as control (mirVana custom inhibitor, Life Technologies). [score:9]
Importantly, by q-RT-PCR analysis of tumor tissues retrieved from animals treated with miR-221 inhibitors, we found a >60% knocking down of both miR-221 and miR-222 expression (Fig. 7A), confirming the in vivo interaction between miR-221 and miR-222. [score:6]
Figure 3 In vitro anti-proliferative activity of miR-221 and miR-222 inhibitors on MM cell lines A-B) Cell growth analysis of OPM2 (A) and NCI-H929 (B) cells transfected with miR-221/222 inhibitors or scrambled oligonucleotides (NC). [score:5]
We then compared the activity of single inhibitors and we observed higher anti-tumor activity of miR-221 inhibitors as compared to miR-222 inhibitors (Fig. 6B). [score:5]
Subcutaneous OPM2 xenografts were repeatedly treated every 2 days, with 20 μg of NLE-miR-221 inhibitors, or NLE-miR-222 inhibitors, or NLE-NC. [score:5]
Conversely, we selected OPM2 and NCI-H929 cells, both t(4;14), which respectively express moderate and high levels of miR-221/222 to explore the anti-tumor activity of miR-221 and/or miR-222 inhibitors. [score:5]
Histogram bars indicate miR-221 or miR-222 expression values normalized by miRNA QC Tool (Affymetrix). [score:3]
A) Differential expression of miR-221 and miR-222 in immunoselected CD138+ cells from 3 healthy donors, 38 MM and 2 PCL, by microarray analysis. [score:3]
miR-221 and miR-222 expression in primary CD138+ normal plasma cells, primary MM and PCL cells and established MM cell lines. [score:3]
Figure 7 A) q-RT-PCR of miR-221 and miR-222 in retrieved tumors treated with unformulated-miR-221 inhibitors or unformulated-NC. [score:3]
Figure 1 A) Differential expression of miR-221 and miR-222 in immunoselected CD138+ cells from 3 healthy donors, 38 MM and 2 PCL, by microarray analysis. [score:3]
B) Effects of treatments with formulated miR-221 or miR-222 individual inhibitors. [score:3]
When OPM2 MM tumors became palpable, animals were randomized and treated with miR-221 and/or miR-222 inhibitors or controls. [score:3]
Figure 4 A) miR-221 and miR-222 q-RT-PCR 24 hours after transfection with miR-221/222 inhibitors and NC in OPM2 cells. [score:3]
A) q-RT-PCR of miR-221 and miR-222 in retrieved tumors treated with unformulated-miR-221 inhibitors or unformulated-NC. [score:3]
In vitro anti-proliferative activity of miR-221 and miR-222 inhibitors on MM cell lines. [score:3]
C-D) BrdU incorporation after transfection of synthetic miR-221 and/or miR-222 inhibitors or NC in OPM2 (C) and NCI-H929 (D) cells. [score:3]
miR-221 and miR-222 are reported as raw expression values. [score:3]
B) Differential expression of miR-221 and miR-222 in 16 MM cell lines by Affymetrix GeneChip® miRNA 1.0 Array. [score:3]
In vivo anti-tumor activity of miRNA-221/222 against MM xenograftsIn the light of translation of our findings in a therapeutic mo del, we investigated the effect of miR-221 and/or miR-222 inhibitors against MM xenografts in CB-17 severe combined immunodeficient non-obese diabetic (SCID/NOD) mice. [score:3]
A) miR-221 and miR-222 q-RT-PCR 24 hours after transfection with miR-221/222 inhibitors and NC in OPM2 cells. [score:3]
In the light of translation of our findings in a therapeutic mo del, we investigated the effect of miR-221 and/or miR-222 inhibitors against MM xenografts in CB-17 severe combined immunodeficient non-obese diabetic (SCID/NOD) mice. [score:3]
For cell proliferation analysis, 1.5x10 [5] MM cells were seeded in 24 well plates, electroporated with synthetic miR-221 and/or miR-222 or with miR -inhibitors or NC, and then harvested and counted at 24-hour intervals using a Trypan Blue viable cell-excluding assay. [score:2]
[1 to 20 of 23 sentences]
12
[+] score: 84
2.4 miRNA mimics (miR-106b, miR-222 and non -targeting control) (mirVana miRNA mimics, Ambion, TX, USA), anti-miRNAs (anti-miR-106b-5p, anti-miR-222-3p and non -targeting control) (mirVana miRNA inhibitors, Ambion) or fluorescein-labeled miRNA mimics (miR-106b and miR-222) (Cosmo Bio, Tokyo, Japan) were used in the experiments. [score:7]
miRNA mimics (miR-106b, miR-222 and non -targeting control) (mirVana miRNA mimics, Ambion, TX, USA), anti-miRNAs (anti-miR-106b-5p, anti-miR-222-3p and non -targeting control) (mirVana miRNA inhibitors, Ambion) or fluorescein-labeled miRNA mimics (miR-106b and miR-222) (Cosmo Bio, Tokyo, Japan) were used in the experiments. [score:7]
To clarify the mechanism(s) whereby administering synthetic mimics of miR-106b and miR-222 causes β-cell regeneration, we first examined pancreatic expressions of Cip/Kip family members (p21Cip1, p27Kip1 and p57Kip2), which are reportedly down-regulated by these miRNAs (Bueno and Malumbres, 2011). [score:6]
3.5To clarify the mechanism(s) whereby administering synthetic mimics of miR-106b and miR-222 causes β-cell regeneration, we first examined pancreatic expressions of Cip/Kip family members (p21Cip1, p27Kip1 and p57Kip2), which are reportedly down-regulated by these miRNAs (Bueno and Malumbres, 2011). [score:6]
Exogenous Administration of miR-106b and miR-222 down-Regulates the Expression of Cip/Kip Family Members in Islets. [score:6]
First, to elucidate the mechanism of BMT -induced β-cell regeneration, we comprehensively examined miRNA levels in serum exosomes from BMT-mice and found two increased miRNAs, miR-106b and miR-222, which reportedly suppress expressions of Cip/Kip family members. [score:5]
Inhibition of miR-106b-5p and miR-222-3p Suppresses BMT-Induced β-Cell Regeneration. [score:5]
miR-106b-5p and miR-222-3p contribute to post-injury β-cell proliferation through down-regulation of Cip/Kip family members (p21Cip1and p27Kip1). [score:4]
Each mouse was restrained and slowly administered 200 μl of mixtures, containing 4 nmol of miRNA mimics (2 nmol of miR-106b and 2 nmol of miR-222), 4 nmol of anti-miRNAs (2 nmol of anti-miR-106b-5p and 2 nmol of anti-miR-222-3p) or 4 nmol of the non -targeting control, via the tail-vein using a disposable insulin syringe (TERUMO Myjector 29G × 1/2″, TERUMO, Tokyo, Japan). [score:3]
In contrast, islet expressions of primary transcripts of these miRNAs, pri-miR-106b and pri-miR-222, were not affected by BMT. [score:3]
Then, islet cells were co -transfected with 10 pmoles of miR-106b mimics and 10 pmoles of miR-222 mimics (Ambion), or transfected with 20 pmoles of non -targeting control (Ambion) using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. [score:3]
Collectively, these results indicate that administering synthetic miRNA mimics for miR-106b and miR-222 increased pancreatic β-cells due mainly to promoting proliferation, rather than suppression of apoptosis. [score:3]
As shown in Fig. 3e, co-transfection of isolated islet cells with miR-106b and miR-222 mimics significantly increased the expression levels of Ki-67. [score:3]
Expressions of miR-106b-5p and miR-222-3p in total BM-cells tended to be and were significantly increased, respectively, in STZ-BMT-mice as compared with STZ-mice (Fig. 1e). [score:2]
Consistent with their expressions in BM cells, quantification of the levels of these two miRNAs in cultured media of BM cells revealed that miR-106b-5p tended to be increased and that miR-222-3p was significantly increased in exosomes from culture media of BM cells obtained from STZ-BMT-mice as compared with STZ-mice (Fig. 1f). [score:2]
Thus, miR-106b and miR-222, which BM cells secrete higher amounts of in response to BMT, are involved in the mechanism underlying BMT -induced β-cell regeneration. [score:1]
It should be noted that the sequences of miR-106b-5p and miR-222-3p are identical in mice and humans. [score:1]
We found that two microRNAs, miR-106b-5p and miR-222-3p, contribute to BMT -induced β-cell regeneration. [score:1]
Thus, systemic administration of miR-106b and miR-222 mimics promotes post-injury β-cell regeneration, thereby ameliorating insulin -deficient diabetes. [score:1]
These results suggest that miR-106b-5p and miR-222-3p, with increased serum levels, play important roles in BMT -induced β-cell regeneration. [score:1]
To address this issue, miR-106b and miR-222 mimics mixed with atelocollagen (miRNAs/atelo) were intravenously injected into STZ-mice on days 5, 8 and 11 after initial STZ administration. [score:1]
• Injection of miR-106b and miR-222 mimics promotes β-cell proliferation and improves hyperglycemia in STZ -treated mice. [score:1]
In contrast, miR-222-3p was transiently increased and then decreased, reaching levels similar to those of control mice 10 days after BMT (Fig. 1b). [score:1]
2.5 Fluorescein-labeled miRNA mimics (2 nmol of miR-106b and 2 nmol of miR-222) mixed with atelocollagen were injected into the tail veins of STZ -treated mice. [score:1]
miR-106b-5p and miR-222-3p are Secreted by BM-cells, and are Increased in Pancreatic Islets after BMT. [score:1]
BMT Increases miR-106b-5p and miR-222-3p Levels in Serum Exosomes. [score:1]
In an attempt to block endogenous miR-106b-5p and miR-222-3p functions, we intravenously administered anti-miRNAs specific for miR-106b-5p and miR-222-3p after BMT. [score:1]
These findings suggest that BMT increases miR-106b-5p and miR-222-3p in islets due to transfer from the external environment of islet cells, such as via circulating exosomes and/or exosomes secreted from BM cells infiltrating the areas around regenerating islets. [score:1]
Image 1 • BMT regenerates β-cells in mice with STZ -induced diabetes and increases miR-106b and miR-222 in serum exosomes and islets. [score:1]
Fluorescein-labeled miRNA mimics (2 nmol of miR-106b and 2 nmol of miR-222) mixed with atelocollagen were injected into the tail veins of STZ -treated mice. [score:1]
In addition to these in vivo experiments, we further examined the effects of miR-106b and miR-222 mimics on cellular proliferation using islet cells isolated from mice. [score:1]
Exogenous Administration of miR-106b and miR-222 Promotes Post-Injury β-Cell Regeneration, thereby Ameliorating Diabetes. [score:1]
Therefore, exosomal miR-106b-5p and miR-222-3p might be transferred from these BM-derived cells infiltrating the areas around the regenerating islets, in addition to via the circulation, although further examinations are required to clarify what type(s) of BM cells, such as hematopoietic stem cells, endothelial progenitor cells or mesenchymal stem cells, secrete exosomes, how BMT enhances exosome secretion and how the secreted exosomes are selectively delivered to β-cells. [score:1]
We quantitatively confirmed that STZ-BMT-mice exhibited significantly higher levels of exosomal miR-106b-5p and miR-222-3p in their sera than controls, by 2- and 2.5-fold, respectively, while STZ-mice did not, on day 13 after the first STZ administration (6 days after BMT) (Fig. 1a). [score:1]
[1 to 20 of 34 sentences]
13
[+] score: 81
The induction of miR-222 expression might reduce ERα expression [49], or it could also be a direct result from downregulation of ERα [50]. [score:9]
Further studies in culture cells verified that the increase in miR-222 expression might contribute to ERα downregulation but not the growth deterrence of cells. [score:6]
The administration of miR-222 inhibitor did not change ERα expression compared with that of miR-222 inhibitor –ve control. [score:6]
MiR-222 expression of celecoxib and aspirin are shown in A & B, while C & D are the miR-98 expression of celecoxib and aspirin, respectively. [score:5]
Figure 9 Protein expression in miR-98 and miR-222 over-expressed MCF-7aro cells. [score:5]
On the other hand, miR-222 was consistently upregulated by celecoxib administration in both in vivo and in vitro systems. [score:4]
MiR-222 expression was induced by celecoxib in MCF-7aro cells in vitroBy using real-time PCR assay, we determined the expression of miR-222/-98 in cells treated with celecoxib and aspirin. [score:4]
However, celecoxib might also upregulate the undesirable miR-222. [score:4]
Compared to the control, androgen administration suppressed the expression of miR-222 and miR-98. [score:4]
Among these, miR-98 (Figure  5A) and miR-222 (Figure  5B) were downregulated in AD mice. [score:4]
Figure 8 MiR-98 and miR-222 expression in MCF-7aro cells treated with aspirin and celecoxib. [score:3]
Among the breast cancer-related miRNAs, miR-222 expression was elevated in samples treated with celecoxib. [score:3]
Aspirin and celecoxib could reverse the suppression of miR-98 and miR-222, respectively. [score:3]
Relationship between the differentially expressed genes and miR-222/-98. [score:3]
Ten μM celecoxib significantly (P < 0.05) reversed the suppression of miR-222 (Figure  8A), whereas no significant changes were observed for miR-98 (Figure  8C) or those cultures treated with aspirin (Figure  8B & D). [score:3]
By using real-time PCR assay, we determined the expression of miR-222/-98 in cells treated with celecoxib and aspirin. [score:2]
MiR-222 expression was induced by celecoxib in MCF-7aro cells in vitro. [score:2]
MiR-222 could be a factor for ERα suppression. [score:2]
Expression of breast cancer -associated miRNAs, including miR-let-7c, miR-let-7 g, miR-98, miR-221, miR-222, miR-101, miR-145 and miR-17-5p, in the xenografts was also measured. [score:1]
Cells are treated with androstenedione and transfected with miR-98 or miR-222. [score:1]
The low baseline level of miR-222 could be the contributing factor. [score:1]
Increased miR-222 species is associated with drug resistance and estrogen-independent growth [44]. [score:1]
In order to investigate the connection between miR-222/-98 and the protein expression profile, MCF-7aro cells were transfected with mimic miR-222 and miR-98. [score:1]
No significant difference in cell growth was observed in cells transfected with miR-222 or -98 mimic after 72-h incubation (data not shown). [score:1]
The miR-222 mimic further lowered the ERα protein, while other proteins tested were not affected. [score:1]
MCF-7aro cells were cultured in OptiMEM (Invitrogen Life Technology) and transfected with miR-222 or miR-98 mimics (Invitogen Life Technology) in Lipofectamine 2000 (Invitrogen Life Technology). [score:1]
The interrelationship between miR-222 and ERα in the current study was not determined. [score:1]
[1 to 20 of 27 sentences]
14
[+] score: 70
The present data indicate that miR-221 and miR-222 directly regulate cell invasion by targeting TIMP3 and act as prognostic factors for glioma patients. [score:5]
These findings indicate that TIMP3 is a critical target of miR-221 and miR-222 and that these two miRNAs could be critical therapeutic targets and survival predictors in glioma. [score:5]
[12] To detect whether TIMP3 is indeed regulated by miR-221 and miR-222 in glioma cells, we knocked-down miR-221/222 and ectopically expressed miR-221/222 in U251 and LN229 cells. [score:5]
To determine the mechanism of action of miR-221 and miR-222 in glioma cell invasion, we performed a miRNA target search using TargetScan and found that the “seed sequence” of miR-221 and miR-222 matched the 3′ UTR of the TIMP3 gene (Figure 3A), which has been evidenced in non small cell lung cancer cells. [score:5]
MiR-221 and miR-222 (miR-221/222), upregulated in gliomas, can regulate glioma cell cycle progression and apoptosis, respectively. [score:5]
However, recent data showed that miR-221 and miR-222 were downregulated in GBM and neither prognostic nor predictive associations were found for miR-221or miR-222 [28]. [score:4]
MiR-221 and miR-222 share the same seed sequence, which are short, evolutionarily conserved regions through which miRNAs bind their target sites in mRNA 3' UTRs, indicating an important role in coordinated regulation and function. [score:4]
These results indicate that TIMP3 is a major target of miR-221 and miR-222 in regulating glioma cell invasion. [score:4]
TIMP3 is a direct target of miR-221 and miR-222. [score:4]
Figure 3 TIMP3 is a target for miR-221 and miR-222. [score:3]
Kaplan-Meier analysis was employed to assess the survival rate of patients relative to expression levels of miR-221 and miR-222. [score:3]
Notably, we found that miR-221 and miR-222 are associated with glioma cell invasion by integrating expression and DTI data. [score:3]
Kaplan-Meier survival curve analysis showed that a highly statistically significant correlation was observed between the overall survival and the expression levels of miR-221 (P = 0.011) and miR-222 (P = 0.020) in high-grade gliomas (Figure 6C). [score:3]
The Pearson correlation showed that a significant negative correlation existed between FA values and miR-221 and miR-222 expression in these 22 gliomas (R = 0.755, P < 0.005 and R = 0.612, P < 0.005, respectively) (Figure 1C). [score:3]
Figure 1 DTI and expression of miR-221 and miR-222 in gliomas. [score:3]
MiR-221 expression was significantly increased in high-grade gliomas compared with low-grade gliomas, and a similar trend for miR-222 was detected (Figure 1B). [score:2]
Therefore, miR-221 and miR-222 are required for glioma cell invasion. [score:1]
The sequences are: 2'-OMe -miR-221 (miR-221), 5'-AGCUACAUUGUCUGCUGGGUUUC-3'; 2'-OMe -miR-222 (miR-222), 5'-AGCUACAUCUGGCUACUGGGU-3'; 2'-OMe-As-miR-221 (As-miR-221), 5'-AGCUACAUUGUCUGCUGGGUUUC-3'; 2'-OMe-As-miR-222 (As-miR-222), 5'-AGCUACAUCUGGCUACUGGGU-3'. [score:1]
High-grade glioma patients with high levels of miR-221 or miR-222 had a significantly worse outcome. [score:1]
Figure 2 MiR-221 and miR-222 play an important role in glioma cell invasion. [score:1]
MiR-221 and miR-222-LNA oligonucleotides with digoxigenin modification contained LNAs at five locations (underlined): 5′-GAAA CCC AGC AGAC AATGTA GCT-3′ (miR-221); 5′-GAGA CCC AGTA GCCA GATG TAGCT-3′ (miR-222). [score:1]
Because the levels of miR-221 and miR-222 are frequently elevated in glioblastoma and because they play an important role in cell survival, we further examined the effects of miR-221/222 on tumor growth in a glioblastoma xenograft mo del. [score:1]
For quantitative analysis of miR-221 and miR-222 in frozen tumor tissues of 22 patients, we performed real-time PCR. [score:1]
Then As-miR-221 and/or As-miR-222 (200 pmol) were transfected using Lipofectamine 2000 (Invitrogen). [score:1]
LNA-miR-221 uses DIG modification and LNA-miR-222 uses BIO modification in 3' distal end. [score:1]
[1 to 20 of 25 sentences]
15
[+] score: 52
In contrast, it has been shown that simultaneous targeted inhibition of miR-221-3p and miR-222-3p affects multiple pro-oncogenic pathways, reverses the aggressive HCC phenotype, and suppresses tumor growth [24, 29, 32]. [score:7]
Importantly, several of the identified miRNAs, including miR-34a, miR-93-5p, miR-221-3p, and miR-222-3p, were also significantly over-expressed in human HCC suggesting that aberrant expression of these miRNAs may serve as an indicator of the hepatocarcinogenic process. [score:5]
Several reports have demonstrated over -expression of miR-221-3p and miR-222-3p in human HCC, which is associated with inhibition of apoptosis, activation of the TGF-β, Wnt/β-catenin, and mTOR signaling pathways, cell migration, invasion, and the formation of a more aggressive tumor phenotype [27– 31]. [score:5]
We also demonstrated that over -expression of miR-25-3p, miR-93-5p, miR-106b-5p, miR-221-3p, and miR-222-3p was accompanied by the reduced protein levels of their targets, including E2F1, PTEN, and CDKN1A. [score:5]
Among the miRNAs distinctively over-expressed in NASH-derived HCC, miR-221-3p and miR-222-3p, which exhibited a carcinogenesis stage -dependent increase in expression, and miR-25-3p, miR-93-5p, and miR-106b-5p, which are members of the oncogenic miR-106b∼25 cluster, are of special interest. [score:5]
Additionally, it has been demonstrated that miR-221-3p and miR-222-3p also target PTEN and CDKN1A [44, 45], indicating that the oncogenic activity of miR-93-5p, miR-221-3p, and miR-222-3p may be attributed to the silencing of these key cancer-related genes and consequent impairment in cell-cycle arrest and inhibition of apoptosis. [score:5]
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Figure 3 shows that the expression of four miRNAs, miR-34a-5p, miR-93-5p miR-221-3p, and miR-222-3p, that were over-expressed in mouse NASH-derived HCC was also significantly greater in human HCC (n = 358) as compared to non-tumor liver tissue samples (n = 50). [score:4]
The statistical analyses of miR-34a-5p, miR-93-5p, miR-221-3p, and miR-222-3p expression datasets in human HCC samples were conducted by the Mann-Whitney Rank Sum test. [score:3]
Among these 19 differentially expressed miRNAs in HCC (20 weeks), 10 of the miRNAs were significantly different from that in NASH-fibrotic livers (12 weeks), among which miR-221-3p, miR-222-3p, and miR-223-3p showed a progressive stage -dependent increase (Figure 2A). [score:3]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
Importantly, five of these miRNAs (miR-34a-5p, miR-93-5p, miR-106b-5p, miR-221-3p, and miR-222-3p) were in common with those in the 10-miRNA set in our study. [score:1]
Levels of miR-34a-5p, miR-93-5p, miR-221-3p, and miR-222-3p in human HCC samples. [score:1]
[1 to 20 of 13 sentences]
16
[+] score: 46
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-1a-2, mmu-mir-221, mmu-mir-1b
Serum-stimulated downregulation of p27 (Fig. 2A) and incorporation of EdU (Fig. 2B) were only slightly reduced in wild-type VSMCs expressing anti-miR-222 or in cells expressing the p27T187A allele. [score:8]
To directly compare the roles of miR-221/222 and Skp2 on p27 regulation, we transfected wild-type and p27T187A VSMCs with a modified RNA oligonucleotide complementary to miR-222 (hereafter called the “anti-miR”) that effectively inhibits the expression of both miR-221 and 222 ([32] and Fig. S2). [score:7]
Importantly, forced expression of miR222 downregulated the levels of p27 (Fig. 3B) and promoted S phase entry (Fig. 3C) despite cicaprost treatment. [score:6]
Cells were then stimulated directly in the dish with regular growth medium for 24 h. For rescue experiments, we transfected near confluent VMSCs in 100-mm dishes with 5 µg of either an expression plasmid for microRNA-222 (Origene; SC400931) or pCDNA (control) using 40 µl Lipofectamine 2000. [score:4]
In C, coverslips were fixed at 48 h and stained for EdU; results are plotted relative to the FBS -treated control; n = 3. In D-E, total RNA was extracted at 24 h, and miR-221 or miR-222 expression levels were determined by RT-qPCR. [score:3]
RT-qPCR was performed for miRNA221, miRNA222 and Skp2 expression. [score:3]
For the analysis of miR-221 and miR-222 expression, total RNA was isolated from cells or isolated aortae with TRIZOL and reverse transcribed using ∼50 ng of RNA in a 15-µl reaction with TaqMan microRNA reverse transcription kit (Applied Biosystems). [score:3]
show mean ± SD, n = 3. (B–C) Early passage wild-type VSMCs were transiently transfected with an expression plasmid for pCDNA (control) or miRNA-222. [score:3]
Directed analysis by RT-qPCR confirmed the induction of miR-221 and also revealed induction of its bicistronic partner, miR-222, in the injured arteries of 5 of 6 additional SMA-GFP mice (Table 1). [score:2]
Figure S2 Effect of anti-miR222 on miR221 and miR222. [score:1]
Early passage VSMCs from wild-type mice were transfected with control anti-miR (Cntl) or anti-miR222, serum-starved (G0) and then stimulated with 10% FBS for 24 h. Cells were collected, lysed and analyzed by RT-qPCR for miRNA221 and miR222. [score:1]
Still other studies describe a mitogen-stimulated induction of miR-221 [18] or both miR-221 and miR-222 [32] in VSMCs, and these effects inversely correlate with p27 levels. [score:1]
0056140.g002 Figure 2(A) Early passage VSMCs from wild-type or p27T187A mice were transiently transfected with control or anti-miR-222. [score:1]
show mean ± SD, n = 2. (A) Early passage VSMCs from wild-type or p27T187A mice were transiently transfected with control or anti-miR-222. [score:1]
Mouse VSMCs were transfected in serum-free conditions with control (Applied Biosystems; AM17010) or anti-miR-222 (Applied Biosystems; AM11376) oligonucleotides at a final concentration of 100 nM using Lipofectamine 2000 (Invitrogen) in 100-mm dishes. [score:1]
Quiescent early passage VSMCs from wild-type and p27T187A mice were stimulated with 10% FBS in the absence (control) or presence of 200 nM cicaprost for 24 h. Cells were analyzed by RTqPCR for miR221 and miR222. [score:1]
[1 to 20 of 16 sentences]
17
[+] score: 44
The pAPM/pAGM vectors were used to overexpress miR-221 or miR-222; as control, we used a mutant version of miR-221 (miR-221m), containing mutations in the seed region to abrogate target recognition, as well as a vector expressing an irrelevant hairpin (shLuc) (Figure 1B). [score:8]
Along the line of a possible role of these miRNAs in mast cell-related diseases, we showed that miR-221 and miR-222 regulate levels of KIT expression in mast cells. [score:6]
To assess whether miR-221/-222 may have a direct role in regulating the differentiation process in mast cells, we transduced bone marrow-derived hematopoietic progenitors with lentiviruses to either overexpress (pAPM) or ablate (miRT) miR-221 and/or miR-222 early during mast cell differentiation (Supplementary Figure S1). [score:5]
Strikingly, not only miR-221 -overexpressing cells showed increased numbers of adherent cells (as shown also in Figure 2D), but while the actin ring underneath the plasma membrane was barely visible in control cells, cells overexpressing miR-221 (or miR-222, not shown) showed the presence of a much thicker ring (Figure 5A). [score:5]
MiR-221 and -222 share the same seed sequence (Figure 1B), and should recognize the same targets [9]; although most of the experiments shown here were performed primarily with miR-221, we also performed experiments using miR-222 -expressing vectors, which always gave results similar to miR-221, both in mast cells and in fibroblasts (not shown). [score:5]
The miRNA target (miRT) vectors containing four sequences fully complementary to miR-221 and/or miR-222, were provided by Bernhard Gentner and Luigi Naldini [12]. [score:3]
Our lab identified miR-221/-222 as a family of miRNAs that is transcriptionally induced upon mast cell activation, and we showed that expression of miR-221 and/or miR-222 to levels similar to the endogenous of activated mast cells, led to reduced mast cell proliferation [8]. [score:3]
B) Schematic representation of the lentiviral vectors used to stably overexpress or functionally ablate miR-221 and miR-222 in BMMCs. [score:3]
MiR-221 and miR-222 derive from the same primary transcript and share the same seed sequence, implying that they should recognize the same targets [9]. [score:3]
The miRT vectors contain 4 sequences fully complementary to miR-221 and/or miR-222 cloned downstream the reporter gene. [score:1]
Sequences corresponding to the mature murine miR-221, miR-222 and miR-221m are also shown. [score:1]
About 400bp of the mouse miR-221 or miR-222 genomic sequences were cloned into the pAPM lentiviral vector [11]. [score:1]
[1 to 20 of 12 sentences]
18
[+] score: 37
For the first time, we report depot specific differences in ER stress related miRNAs including; downregulation of miR-125b-5p and upregulation of miR-143-3p, and miR-222-3p in VAT following HFD and upregulation of miR-30c-2-3p only in BAT following a HFD in mice. [score:10]
Additionally, upregulated miR-222 in VAT-HF than BAT-HF in our study is known to increase ER stress -mediated apoptosis in liver cells via inhibition of CDKN1B (p27Kip1) [35]. [score:6]
MiR-143-3p and miR-222-3p were significantly upregulated (p < 0.05), while miR-125b-5p was significantly down regulated (p < 0.05) in VAT-HF than VAT-LF (Figure 6A). [score:5]
Also, miR-143-3p and miR-222-3p were upregulated in VAT of HFD than LFD mice in our study. [score:4]
Thus, upregulation of miR-222-3p may cause Cdkn1b: miR-222-3p mediated apoptosis in VAT in obesity. [score:4]
However, depot specific differences in expression of ER stress related miR-30c-2-3p, miR-125b-5p, miR-143-3p and miR-222-3p in HFD induced obesity are novel findings, but these are yet to be confirmed in clonal adipocytes. [score:3]
Same direction of fold change was observed for seven miRNAs including miR-455-3p, miR-30c-2-3p, miR-222-3p, miR-99b-5p, miR-199a-3p, miR-143-3p, and let-7a-5p. [score:2]
The miRNAs we tested were let-7a-5p, miR-30a-5p, miR-30c-2-3p, miR- 99b-5p, miR-143-3p, miR-199a-3p, miR-221-3p, miR-222-3p, miR-455-3p, and miR-708-5p. [score:1]
We also performed qPCR for selected miRNAs that were related to ER stress (miR-125b-5p, miR-143-3p and miR-222-3p, miR-30c-2-3p, and miR-455-3p), in BAT and VAT of LFD and HFD fed mice (Figure 6). [score:1]
Mir-143-3p and miR-222-3p showed an increasing trend due to HFD in BAT similar to VAT, but were not statistically significant (p value = 0.077 and 0.118) (Figure 6B). [score:1]
[1 to 20 of 10 sentences]
19
[+] score: 35
The results showed that miR-134, miR-155 and miR-222 were down-regulated while miR-34 was up-regulated in the HIFU group (Figure 3). [score:7]
In contrast, HIFU -suppressed miR-222 and enhanced ICAM-1 expression appear to be coincidences, and HIFU modulates ICAM-1 expression is likely through an undetermined mechanism that warrants further studies. [score:7]
Collectively, these results suggest that miR-134 directly binds to the 3′UTR of CD86 to suppress CD86 expression in B16F10 cells, and miR-222 is unlikely involved in ICAM-1 regulation. [score:7]
E. B16F10 cells were transfected with miR-222 mimics for 48 h and the mRNA (upper panel) and protein (lower panel) expression of ICAM-1 was detected. [score:3]
To determine whether miR-134 directly binds to the 3′UTR of CD86 mRNA and miR-222 binds to ICAM-1 mRNA, luciferase reporters that carry either the wild-type (WT) 3′UTR sequences or the mutant (MUT) 3′UTR sequences of the CD86 (for miR-134) or ICAM-1 (for miR-222) were constructed (Figure 5A), and co -transfected into B16F10 cells with or without miRNAs mimics. [score:2]
Construction of p [MIR-REPORT] luciferaseTo construct p [MIR-LUC-3′UTR-CD86] and p [MIR-LUC-3′UTR-ICAM-1], CD86 3′UTRs containing miR-134 binding sites and ICAM-1 3′UTR containing miR-222 binding site were generated by Chemical synthesis, and then cloned into downstream of luciferase of pMIR-REPORT™ System (Applied Biosystems/Ambion, Austin TX), respectively. [score:1]
To construct p [MIR-LUC-3′UTR-CD86] and p [MIR-LUC-3′UTR-ICAM-1], CD86 3′UTRs containing miR-134 binding sites and ICAM-1 3′UTR containing miR-222 binding site were generated by Chemical synthesis, and then cloned into downstream of luciferase of pMIR-REPORT™ System (Applied Biosystems/Ambion, Austin TX), respectively. [score:1]
B16F10 cells were evenly seeded in a 24-well plate and transfected with pMIR-REPORT constructs (200 ng per well) and Renilla luciferase (pRL-TK Vector, 200 ng per well; Promega, Madison, Wis), plus miR-134, or miR-222 mimics, or miRNA negative control (25 nmol/L, GenePharma, Shanghai, China). [score:1]
As shown in Figure 4A, there were three miR-134 binding sites in CD86 3′UTR and one miR-222 binding site in ICAM-1 3′UTR. [score:1]
C. B16F10 cells were transfected with miR-134 mimics or miR-222 mimics for 48 h and the miRNA levels of miR-134 and miR-222 were determined by qPCR. [score:1]
There was no obvious change in the levels of ICAM-1 mRNA and protein in miR-222 mimic transfected cells (Figure 5E). [score:1]
Transfection efficiency of miR-134 and miR-222 was confirmed by qPCR (Figure 5C). [score:1]
In contrast, the luciferase reporter activity of the reporters bearing either WT or mutated 3′UTR of ICAM-1 was not affected by miR-222 (Figure 5B). [score:1]
These included miR-34, miR-106a, miR-126a, miR-134, miR-155, miR-181a, miR-221, and miR-222. [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 30
Key findings of the present study were that expression of the DNMT1, DNMT3A and DNMT3B genes are abundantly expressed only in GE of cancerous ovaries as compared to normal ovaries of laying hens, and that expression of DNMT3A and DNMT3B genes are post-transcriptionally regulated by miR-1741, miR-16c, miR-222, or miR-1632, respectively. [score:7]
These results indicate that miR-1741, miR-16c, miR-222, or miR-1632 directly bind to the DNMT3A or DNMT3B transcript, respectively, and post-transcriptionally regulate expression of those genes. [score:5]
These results indicate that miR-1741, miR-16c, miR-222, or miR-1632 directly bind to DNMT3A or DNMT3B transcripts, respectively, and post-transcriptionally regulate expression of the DNMT3A and DNMT3B genes. [score:5]
Similarly, the presence of miR-16c, miR-222, or miR-1632 for DNMT3B, the percentage of GFP -expressing cells was decreased (P<0.01). [score:3]
In addition, as shown in Figure 4, in the presence of miR-16c, miR-222, or miR-1632 for DNMT3B, there was a decrease (P<0.01) in the percentage of GFP -expressing cells (100% in control vs. [score:3]
For the dual fluorescence reporter assay, the fusion contained the DsRed gene and either miR-148a or miR-1612 for DNMT1; miR-1596, miR-1687, miR-1741, or miR-1749 for DNMT3A; and miR-16c, miR-222, or miR-1632 for DNMT3B, and each was designed to be co-expressed under control of the CMV promoter (pcDNA-DsRed-miRNA). [score:2]
0061658.g004 Figure 4[A] Diagram of miR-16c, miR-222, and miR-1632 binding sites in the DNMT3B 3′-UTR. [score:1]
85.3% in miR-16c, 40.3% in miR-222, and 25.9% in miR-1632). [score:1]
[C and D] After co-transfection of pcDNA-eGFP-3′-UTR for the DNMT3B transcript and pcDNA-DsRed-miRNA for the miR-16c, miR-222, and miR-1632, the fluorescence signals of GFP and DsRed were detected using FACS [C] and fluorescent microscopy [D]. [score:1]
org/miRDB/) revealed putative binding sites for miR-148a and miR-1612 (for DNMT1) ; miR-1596, miR-1687, miR-1741, and miR-1749 (for DNMT3A) ; and miR-16c, miR-222, and miR-1632 (for DNMT3B). [score:1]
[A] Diagram of miR-16c, miR-222, and miR-1632 binding sites in the DNMT3B 3′-UTR. [score:1]
[1 to 20 of 11 sentences]
21
[+] score: 30
Other miRNAs from this paper: mmu-mir-143, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-107, mmu-mir-221
Moreover, changes in miRNAs expression correlated with several adipocyte gene expressions: miR-103 and -107 correlated with genes involved in fatty acid metabolism whereas miR-221 and miR-222 correlated with the expression of adipocytokines. [score:7]
Concerning miR-222 expression, a tendency to increase expression with the dose was seen in Exp1, although only the 75% increase produced in CLA2 group was statistically significant compared to the control group (P<0.01). [score:4]
Conversely, another set of miRNAs follows the opposite response pattern, for example miR-222 and miR-221, which are decreased during adipogenesis but upregulated in obese adipocytes [11]. [score:4]
In fact, expression of all miRNAs tested was significant and highly correlated within themselves, except for the case of miR-222 which was only correlated with miR-103 and miR-221. [score:3]
In Exp2, miR-222 expression increased with the highest dose (CLA4 group) but did not reach statistical significance. [score:3]
As potential targets of the action of CLA, we focused the study on five selected miRNAs (miR-143, miR-103, miR-107, miR-221 and miR-222) which, to a certain extent, have been shown to be involved in adipocyte differentiation and/or associated with obesity. [score:3]
Consequently, expression levels of selected miRNAs (miR-143, miR-103, miR-107, miR-221 and miR-222) which seem to be related to adipose biology were studied in adipose tissue of mice treated with CLA. [score:3]
miR-222 showed significant correlations with an array of genes related to adipocyte metabolism including Glut4 (r = −0.400, P<0.05); genes related to lypolisis such as hormone sensitive lipase (HSL, r = −0.379, P<0.05) and patatin-like phospolipase domain containing 2 (Pnpla2, r = −0.346, P<0.05); lipogenesis such as PPARγ2 (r = −0.396, P<0.05), Fasn (r = −0.416, P<0.05), stearoyl-Coenzyme A desaturase 1 (Scd1, r = −0.392, P<0.05); fatty acid oxidation such as Ucp2 (r = 0.525, P<0.01); and adipocytokines: adiponectin (r = −0.385, P<0.05) and tumor necrosis factor alpha (TNFα, r = 0.644, P<0.01) (Table 3). [score:1]
This strong association was partially lost in Exp2, with CLA treatment under high-fat feeding, in which the only correlations maintained were between miR-103 and miR-143; mir103 and miR-107; and miR-221 and miR-222 (Table 1). [score:1]
The high number of correlations with miR-222 was not found in Exp2. [score:1]
[1 to 20 of 10 sentences]
22
[+] score: 30
Both miR-221 (highly expressed in the proestrus stage of females exposed to O [3]) and miR-222 (upregulated in males exposed to O [3]) are involved in the development and progression of lung cancer by targeting the tumor suppressor genes PTEN and TIMP3 [70]. [score:11]
MicroRNA-222-3p and miR-466k were upregulated (log fold change = 0.459) and downregulated (log fold change = − 0.614), respectively, in males vs. [score:7]
Of the eight differentially expressed miRNAs found in both males and females exposed to O [3], a total of six miRNAs were upregulated exclusively in males: miR-338-5p (log fold change = 1.636), miR-222-3p (log fold change = 0.699), miR-130b-3p (log fold change = 0.646), let-7i-5p (log fold change = 0.552), miR-195a-5p (log fold change = 0.543), and miR-144-3p (log fold change = 0.427) (Fig.   2). [score:6]
Two miRNAs, miR-222-3p and miR-466 k, were differentially expressed. [score:3]
females revealed two miRNAs that were differentially expressed, miR-222-3p and miR-466k. [score:3]
[1 to 20 of 5 sentences]
23
[+] score: 29
We initially focused on promoter hypermethylation to explain downregulation of this gene in our sample series of T-LBL, but despite a substantial reduction in the levels of mRNA in almost all samples in the exploratory cohort (7/8), only two samples (840 and 521) (2/8) exhibited significant hypermethylation density (Fig. 4), and six out of eight (including tumor 840 with promoter hypermethylation) exhibited upregulation of one or two miRNAs selected for CDKN1C regulation (miR-211–3p and miR-222-3p). [score:8]
reported here are in line with those reported in the literature describing miR-25, miR-221 and miR-222 as direct regulators of CDKN1C expression in a wide variety of solid tumours, showing a new mechanism responsible for CDKN1C downregulation in carcinogenesis [43– 45]. [score:8]
There were only two significant deregulated miRNAs controlling CDKN1C expression, which are up-regulated in practically all the samples (miR-221–3p and miR-222-3p). [score:7]
In this context, our findings suggest that aberrant expression of miR-221 and miR-222 may have an oncogenic function in T-LBL development by targeting CDKN1C. [score:6]
[1 to 20 of 4 sentences]
24
[+] score: 26
MiR-222 was found to be downregulated among 90 miRNAs studied in striatal STHdhQ111/HdhQ111 mouse cells expressing the full-length Htt gene with 111 glutamate repeats [95] and also in both 10 week-old R6/2 and 12 month-old YAC128 HD transgenic mice [96]. [score:6]
Obviously, more work is needed to replicate these positive findings at therapeutic doses before definite conclusions can be formulated regarding neuroprotective actions of antipsychotics (haloperidol, trifluoperazine, loxapine), mood stabilizers (lithium, valproate), antidepressants (imipramine, desipramine, nortiptyline, maprotiline, trazodone, sertraline, venlafaxine), and hypnotics (cyproheptadine, melatonin) in regard to huntingtin aggregation and autophagy, AP-1 binding, histone acetylation, p53 downregulation, miR-222, mitochondrial protection, apoptosis, and BDNF. [score:4]
The only study addressing psychotropics and miR-222 employed combined pre-treatment with 3 mM lithium-plus-0.8 mM valproate (about 3 and 1.5 times human therapeutic lithium and valproate levels, respectively) for 6 days in glutamate-exposed rat cerebellar granule cells, resulting in neuroprotection from excitotoxicity and miR-222 upregulation that was confirmed by RT-PCR [146]. [score:4]
Putatively neuroprotective miR-222 upregulation with combined lithium-valproate treatment should be replicated within the glutamate neuronal mo del, and each drug should be studied individually in this same mo del and then in neurons exposed to mutant huntingtin. [score:4]
MiR-222 Upregulation. [score:3]
A single study demonstrated miR-222 upregulation with a combination of lithium and valproate at near-therapeutic concentrations in a glutamate-exposed neuronal culture, but each drug awaits individual investigation. [score:2]
Of all the miRNA targets in HD considered in Table 2, only miR-222 has thus far been demonstrated to be affected by psychotropics in HD or HD mo dels. [score:2]
These two drugs now need to be studied individually to determine effects upon miR-222 in this and other HD mo dels. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 25
Interestingly, a recent paper demonstrated that cardiac miR-222 expression increased after endurance exercise training, an activity required for physiological cardiomyocyte growth in adult hearts, and that miR-222 expression protected against adverse cardiac remo delling 44. miR-221 and miR-222 target the identical RNA sequence, and miR-221/222 overexpression in mice antagonized pressure overload -induced pathological cardiac remo delling 45. [score:9]
Relative luciferase activity in NRCMs harbouring the reporter and transfected with control pcDNA3.1 vector or miR-221, miR-222, miR-211, miR-204 or miR-135a expression vectors. [score:3]
Deletion of the miR-221/222 binding site in the Angptl2-3′UTR reporter (Fluc-Angptl2-3'UTR-Δ 221/222) was performed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer's instructions miR-221, miR-222, miR-211, miR-204 or miR-135a overexpression vectors were constructed by inserting sequences including the full-length mature microRNA sequences into pBApo-CMV (Takara Bio). [score:3]
Here, we found that expression of both miR-221 and miR-222 markedly increased in pressure overload -induced cardiac stress following TAC (Supplementary Fig. 5b). [score:3]
We observed that miR-221 or miR-222 overexpression in NRCMs significantly attenuated activity of a luciferase reporter fused to the Angptl2-3′UTR (Fig. 4b), an activity blocked by deletion of miR-221/222 binding sequences from the UTR (Fig. 4c). [score:3]
We confirmed that miR-221 and miR-222 expression levels in heart of these were significantly decreased relative to control miR-221/222 [Flox/y] mice (Supplementary Fig. 5a). [score:3]
org database identified five candidates, including miR-135a, miR-204, miR-211, miR-221 and miR-222, predicted to bind to the Angptl2 mRNA 3′UTR. [score:1]
[1 to 20 of 7 sentences]
26
[+] score: 22
As such, the translational regulation of ESR1 represents another remarkable functional cross-talk between miRNAs, which we show to be expressed in a mutually exclusive manner between the cerebellum (miR-206) and the hippocampus/amygdaloid regions (miR-221/miR-222). [score:6]
Our data provides a detailed map of miRNA brain expression in rats and shows that there are some differences in the expression in the cerebellum of a subset of the detectable transcripts, which are either highly enriched (miR-206 and miR-497) or nearly depleted (miR-132, miR-212, miR-221 and miR-222). [score:5]
Accumulations of miR-497 in the cerebellum, of miR-7 in the hypothalamus, and of miR-221 and miR-222 in the hippocampus have also been described in mice [39] and zebrafish (larval and adult brain), where miR-222 is expressed in specific groups of differentiating cells in the rostral parts of the brain [42]. [score:3]
Notably, we found reciprocal expression profiles for a subset of the miRNAs predominantly found (> ten times) in either the cerebellum (miR-206 and miR-497) or the forebrain regions (miR-132, miR-212, miR-221 and miR-222). [score:3]
Indeed, the overlapping expression patterns of miR-222 in zebrafish, mice and rats suggest that this miRNA is important for some specialized hippocampal functions. [score:3]
The most pronounced differences in expression patterns among these nine miRNAs were seen for the miR-221 family members (miR-221 and miR-222), which showed a cerebellar reduction of more than 60-fold compared to the hippocampus and the amygdaloid region. [score:2]
[1 to 20 of 6 sentences]
27
[+] score: 22
Using 1.5-fold cut-off, the analysis identified seven differentially expressed miRNAs: in F28-7-A (apoptosis-fated cell), four mature miRNAs (miR-700, miR-743a, miR-140*, miR-351) were expressed at higher levels, and three mature miRNAs (miR-222, miR-34c*, miR-132) were expressed at lower levels than in F28-7 (necrosis-fated cell). [score:7]
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 To test whether inhibition/overexpression of these candidate miRNAs in the F28-7 cells modulate FUdR -induced cell death, we have done transfections of the miRNA inhibitors and/or the synthetic miRNA mimics. [score:7]
In addition, miR-222 and miR-132 were expressed at lower levels in F28-7-A than in F28-7 cells (Fig 1E and 1G). [score:3]
Expression of (A) miR-700, (B) miR-743a, (C) miR-140*, (D) miR-351, (E) miR-222, (F) miR-34c*, (G) miR-132, and RNU6B were analyzed by quantitative real-time PCR using primers for miR-700-3p, miR-743a-3p, miR-140-3p, miR-351-5p, miR-222-3p, miR-34c-3p, miR-132-3p, and RNU6B (see ). [score:2]
Therefore, we assumed that the miR-700, miR-743a, miR-140*, miR-351, miR-222, and miR-132 were candidate miRNAs as cell-death regulators in necrosis and apoptosis. [score:2]
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 Total small RNA fractions were prepared from F28-7 and F28-7-A cells (no drug, no incubation). [score:1]
[1 to 20 of 6 sentences]
28
[+] score: 21
Although we did not predict all miRNAs that were upregulated in PTC, we did identify the four mostly highly upregulated, based on their analysis, miR-146, miR-221, miR-222, miR-21 (upregulated 19.3 fold, 12.3 fold, 10.9 fold and 4.3 fold respectively) (Table 1). [score:10]
Those miRNAs highlighted in blue (miR-221, miR-222, and miR-146) are predicted to be upregulated in PTC, from visual inspection of the plots. [score:4]
MiR-146, miR-221 and miR-222, are an order of magnitude more upregulated than any of the other miRNAs. [score:4]
Performing a supervised analysis on this dataset using BGA confirms that miR-221 and miR-222 are the miRNAs most highly associated with PTC. [score:1]
To the right of the figure, along the horizontal axis, we can see miR-221 and miR-222 highlighted in blue. [score:1]
Highlighted in blue are miR-221 and miR-222, which are associated with PTC. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 21
We did not observe significant change in miR-222 and miR-223 expression in mdx nor mdx/mIGF-1 mice (Figures 4A,B), suggesting that these two specific miRNAs were not modulated in the diaphragm of 4-week-old dystrophic mice and by the expression of mIGF-1. Figure 4 mIGF-1 modulates factors associated with the inflammatory response in dystrophic muscle. [score:5]
We did not observe significant change in miR-222 and miR-223 expression in mdx nor mdx/mIGF-1 mice (Figures 4A,B), suggesting that these two specific miRNAs were not modulated in the diaphragm of 4-week-old dystrophic mice and by the expression of mIGF-1. Figure 4 mIGF-1 modulates factors associated with the inflammatory response in dystrophic muscle. [score:5]
It has been reported that miR-222 and miR-223, classified as inflammatory miRNAs (Greco et al., 2009) were highly expressed in damaged areas of the ischemic muscle and adult mdx mice, whereas they were not induced in muscles of newborn mdx mice (Greco et al., 2009). [score:3]
The inflammatory miRNAs (miR-222 miR-223) had a similar level of expression between mdx and wild type mice. [score:3]
Moreover, miR-221 and miR-222 might regulate skeletal muscle differentiation (Fasanaro et al., 2010). [score:2]
miR-221 and miR-222 have antiangiogenic properties and play important role in the regulation of vascular inflammation (Poliseno et al., 2006). [score:2]
Dystrophic-signature miRNAs has been divided into three main classes: degenerative miRNAs (miR-1, miR-29c, and miR-135a), regeneration miRNAs (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), and inflammatory miRNAs (miR-222 and miR-223) (Greco et al., 2009). [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 19
Since it has been demonstrated that miR-222 can target p27 [kip1], a critical regulator of cell cycle (49), and the phosphatase 2A subunit B (PPP2R2A), which inhibits Akt phosphorylation (48), we can assess that HMGA overexpression contributes to NSCLC progression by dysregulating cell cycle and Akt signaling (48) (Figure 1B). [score:9]
Indeed, it has been reported that at least HMGA1 is able to directly regulate the expression of miR-222 in NSCLC cells (48). [score:5]
HMGA1 is able to induce the expression of miR-222, which in turn can target p27 [kip1] and PPP2R2A, then activating the AKT signaling. [score:5]
[1 to 20 of 3 sentences]
31
[+] score: 19
Some of the results are in accordance with previous studies, such as the up-regulation of mmu-miR-221 and mmu-miR222 cluster and the down-regulation of the mmu-miR-200 family, as well as of mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e*. [score:7]
The following miRNAs were found to be up-regulated in WAT after HFD feeding: mmu-miR-342-3p, mmu-miR-222, mmu-miR-221, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-647* and mmu-miR-379. [score:4]
Hif-1α and TNF-α are two potential mmu-miR-222 targets participating in the regulation of cell differentiation. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
Mmu-miR-222 also belongs to the miRNA group being highly enriched during adipogenesis. [score:1]
[1 to 20 of 5 sentences]
32
[+] score: 18
Other miRNAs from this paper: mmu-mir-221
To test whether miR-221 and miR-222 target the ICAM-1 3′UTR, we used TargetScan. [score:5]
The reporter assay showed that miR-221 and miR-222 could significantly inhibit the expression of the luciferase. [score:4]
Recent reports indicate that ICAM-1 expression is controlled by many miRNA species, such as miR-221 and miR-222 33 34. [score:3]
HUVECs were transfected with miR-221 or miR-222 precursors for 48 h and then exposed to TNF-α for 4 h, followed by Western blot analysis for ICAM-1, p-p38, and p-p65 expression. [score:3]
miR-221 and miR-222 are tandemly encoded on the X chromosome, are highly conserved and share significant homology. [score:1]
In addition, HUVECs were co -transfected with this plasmid and either miR-221 or miR-222. [score:1]
We found that miR-221 and miR-222 are complementary to a region in the ICAM-1 3′UTR that is located between positions 413 and 419 (Fig. 5B). [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 17
In addition, our results indicate that several microRNAs (miRs), specifically miR-222, miR-223, miR-1626, miR-1699, miR-1744, miR-1787, miR-1798 and miR-1812 interact with sites in the 3′-UTR of the cell cycle genes and regulatory factors affecting cell cycle genes including CCND1, CCNE2, CDK1, CDK3, CDKN1A and CDKN1B to influence post-transcriptional regulation of its expression in laying hens. [score:5]
In addition, our miR target validation assay demonstrated that miR-1626 regulates CDKN1A expression and miR-222, miR-1787 and miR-1812 influence post-transcriptional modification of transcripts of the CDKN1B gene. [score:5]
In addition, for CDKN1B, in the presence of miR-222, miR-1787 and miR-1812, the intensity and percentage of GFP-CDKN1B -expressing cells (29.0% in control vs. [score:3]
[C and D] After co-transfection of pcDNA-eGFP-3′UTR for the CDKN1B transcript and pcDNA-DsRed-miRNA for the miR-222, miR-1787 and miR-1812, the fluorescence signals of GFP and DsRed were detected using FACS [C] and fluorescent microscopy [D]. [score:1]
[A] Diagram of miR-222, miR-1787 and miR-1812 binding sites in the 3′-UTR of the CDKN1Bgene. [score:1]
This analysis revealed putative binding sites for several chicken miRNAs (miR-1798 for CCND1; miR-1699 for CCNE2; miR-223 for CDK1; miR-1744 for CDK3; miR-1626 for CDKN1A; and miR-222, miR-1787 and miR-1812 for CDKN1B), but not for the other four genes of interest. [score:1]
15.6% in miR-1787, 12.6% in miR-1812, 9.8% in miR-222) were decreased (P<0.01) (Figure 8). [score:1]
[1 to 20 of 7 sentences]
34
[+] score: 15
Changes in miRNA expression at 3 h ranged from 11-fold down-regulation (miR-224) to 3.8-fold up-regulation (miR-367), and at 24 h from 7-fold down-regulation (miR-222) to 20.6-fold up-regulation (miR-135a*; Figure 2). [score:15]
[1 to 20 of 1 sentences]
35
[+] score: 15
In this context, mmu-miR-222 represents a potential candidate, which was also found to be up-regulated in the present study and directly regulates the expression of PCNA. [score:8]
The ten most up-regulated miRNAs included mmu-miR-205-5p, mmu-miR-222-3p, mmu-miR-205-3p, mmu-miR-146b-5p, mmu-miR-21-5p, mmu-miR-21-3p, mmu-miR-221-3p, mmu-miR-140-3p, mmu-miR-142-5p, and mmu-miR-140-5p and the ten most down-regulated miRNAs comprised mmu-miR-211-5p, mmu-miR-3096-5p, mmu-miR-711, mmu-miR-466h-5p, mmu-miR-130b-3p, mmu-miR-3082-5p, mmu-miR-1199-5p, mmu-miR-669b-5p, mmu-miR-1187, and mmu-miR-1224-5p (Table 1). [score:7]
[1 to 20 of 2 sentences]
36
[+] score: 15
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
For example, Lee EJ 2007 et al. [44] showed that the miRNAs miR155, miR21, miR222, Let7, miR376a, miR301, miR100, miR125, miR142 and others are overexpressed significantly in human PC. [score:3]
[1 to 20 of 2 sentences]
37
[+] score: 13
In addition to our results that identify miR-22 as a negative regulator of the DC transcription factor IRF8 by controlling Irf8 mRNA abundance, recent studies by others have shown that miR21, miR34a, miR-221 and miR-222 are differentially expressed in pDCs and cDCs, and play a role in DC differentiation via inhibitory functions on Jag1, Wnt1, and possibly the pDC master regulator Tcf4 (E2–2), respectively [62]– [66]. [score:7]
By contrast, our miRNA array profiling data revealed that miR-222 is expressed at lower levels in freshly isolated splenic cDCs in comparison to bone marrow DC progenitors or pDCs (Fig. 1A). [score:3]
Among these, Kuipers et al. reported that miR-222 is expressed at 2.5-fold higher levels in cDCs versus pDCs purified from bone marrow cell cultures supplemented with Flt3L and SCF [62]. [score:3]
[1 to 20 of 3 sentences]
38
[+] score: 11
Gas5 exerts tumor-suppressive functions in human glioma cells by directly targeting miR-222 and regulating the expression of its targets BMF and Plexin C1 [16]. [score:11]
[1 to 20 of 1 sentences]
39
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
40
[+] score: 11
Increasing evidences have suggested that miRNAs are deregulated or upregulated in all types of cancers, acting either as tumor suppressors (e. g. miR-34, miR-15/16, let-7, miR 200 family) or as oncogenes (e. g. miR-155, miR-222/221, miR-17-5p, miR-21) [1], [3], [8], in which the miRNAs play key roles in important aspects of tumorigenesis, such as cancer initiation, differentiation, growth and progression [3], [5], [8], mainly by interfering with the expression of target genes involved in cell cycle, apoptosis, cell migration and invasion, angiogenesis. [score:11]
[1 to 20 of 1 sentences]
41
[+] score: 11
Subsequently, we found that the miR-222/221 gene cluster, involved in the regulation of the KIT receptor by targeting KIT-3'UTR [16], is also a direct RUNX1-target, whose transcription is repressed by the dominant negative t(8;21) RUNX1-MTG8 fusion protein [17]. [score:7]
We also reported that both t(8;21) and inv(16) CBF-AML display lower levels of miR-221 and miR-222 relative to non-CBF-AML, in association with increased expression of the KIT receptor (CD117 antigen) [17]. [score:3]
Yoram Groner (Weizmann Institute, Israel) kindly provided the pGL4.13-RUNX1-3′UTR plasmid, Carlo Croce (Ohio State University) kindly provided the (-1600) MIR-222/221-Luc plasmid, and Paul Liu (NIH, Bethesda, MD) kindly provided the pGEM-CMV-CBFB and pGEM-CMV-CBFB-MYH11 plasmids. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 10
Other miRNAs from this paper: mmu-mir-193a, hsa-mir-221, hsa-mir-222, hsa-mir-193a, mmu-mir-221
Upon further analysis, Pandhare-Dash et al. found that LNCaP cells infected with XMRV upregulated miR-221 and miR-222 (which inhibit p27 [Kipl] expression) compared to uninfected cells, presenting a mechanism by which infected cells could be downregulating p27 [Kipl] and thus promoting progression through the G [1]-S transition of the cell cycle. [score:10]
[1 to 20 of 1 sentences]
43
[+] score: 10
On the basis of the opposite functions of CBX7, as oncogene and oncosuppressor, it was not surprising to find that CBX7 was able to regulate in opposite sense miRNAs that have recognized to have oncogenic functions, such as miR-199 (negatively regulated) and miR-155, miR-221 and miR-222 (positively regulated). [score:6]
It is likely that this anti-apoptotic activity may be important for the growth of MEFs, also associated to the increased mR-221 and miR-222 levels that are able to target p27 [37], a critical negative regulator of the cell cycle. [score:4]
[1 to 20 of 2 sentences]
44
[+] score: 10
miR-221 and miR-222 are downregulated upon differentiation of proliferating myoblasts, then upregulated in terminally differentiated myotubes [41]. [score:7]
Ectopic expression of miR-221 and miR-222 are capable of disrupting early myogenesis and terminal myotube differentiation [41]. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 9
Overlapping targeting and functions are also observed for predicted targets of miR-222* and its -1 5′ isomiR (81% and 31% of HL-1 and heart biopsy tags, respectively), while little overlap was observed in the targets of miR-140* and its +1 5′ isomiR (86% and 79% HL-1 and heart biopsy tags, respectively), though the enriched functions of their targets is remarkably similar (Gene function analysis in Table S8). [score:9]
[1 to 20 of 1 sentences]
46
[+] score: 9
Other miRNAs from this paper: mmu-mir-205, mmu-mir-10a, mmu-mir-221
To further explore how PTEN was up-regulated in lung cancer cells by SFE, we detected multiple known PTEN -targeting miRNAs including miR-10a, miR-205, miR-221, and miR-222. [score:6]
In the rescue assays, we observed that the anti-cancer effects of SFE were significantly inhibited by miR-10a, miR-205, miR-221, or miR-222 (Figure 3F). [score:2]
Moreover, to validate the biological function of these miRNAs in lung cancer cells, we transfected A549 and H1299 cells with mimics of miR-10a, miR-205, miR-221, or miR-222 with or without treatment of SFE. [score:1]
[1 to 20 of 3 sentences]
47
[+] score: 9
miR222 targets the PPP2R2Asubunit of PP2A in HCC to disrupt cell motility and miR-190 inhibits PHLPP expression and promotes carcinogenic transformation of bronchial cells suggesting that the AKT pathway is a prominent target of miRNA activity [148, 149]. [score:9]
[1 to 20 of 1 sentences]
48
[+] score: 9
Although miR-204 is expressed in MG, RPE cells and ciliary epithelial cells, it is unlikely that the MG in our study was contaminated by RPE or ciliary epithelial cells, since (1) the FACS-sorted tdTomato [+] cells in our samples were Sox2 [+] and this is not expressed in either the RPE or ciliary epithelium and (2) miRNAs miR-211, miR-222, and miR-221, are highly expressed in the RPE 39, but were not highly expressed in the MG-fraction in our study. [score:9]
[1 to 20 of 1 sentences]
49
[+] score: 8
For example, miR-221 and miR-222, whose expression levels are up-regulated in CAD-EPCs [41], [42], also modulate angiogenesis by targeting cKit [43]. [score:8]
[1 to 20 of 1 sentences]
50
[+] score: 8
In another study, miR-222 promoted cell proliferation during nickel -induced tumorigenesis in part by regulating the expression levels of its target genes, CDKN1B and CDKN1C [8]. [score:6]
In an animal mo del, the expression of miR-222 significantly increased in nickel -induced tumor group when compared with normal group. [score:2]
[1 to 20 of 2 sentences]
51
[+] score: 8
A recent study reported that miR-221 and miR-222 inhibit PTEN expression by binding to the 3’UTR, while knockdown of these miRNAs causes induction of PTEN expression [42]. [score:8]
[1 to 20 of 1 sentences]
52
[+] score: 8
We also demonstrated that miR-221 inhibitors were more active than miR-222 inhibitors. [score:5]
We also demonstrated that silencing of miR-221 resulted in higher anti-tumor activity as compared to miR-222, when inhibitors were injected directly into the tumors. [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 8
Nevertheless mir-222 was downregulated in KSHV-infected, tumorigenic samples, compared to EC. [score:3]
The pattern of mir-222 parallels that of mir-221, which is expected because of their known co-regulation [55], [56]. [score:2]
Mir-222 was co-regulated with mir-221, but did not change as dramatically (data not shown). [score:2]
For example, mir-222 clusters in group II because it was more highly transcribed in all samples relative to 50% of all other pre-miRNAs. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 7
We recently reported that miR-222 and -339 in cancer cells down-regulate the expression of an intercellular cell adhesion molecule (ICAM)-1, thereby regulating the susceptibility of cancer cells to cytotoxic T lymphocytes (CTLs) [23]. [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 7
Down-regulation of Dicer1, predicted by miR-152, miR-203 and miR-222, could be a part of a complex regulation related to the global abundance of miRNAs and their requirements for processes such as cell-cycle exit control and onset of cell differentiation. [score:5]
Similar analysis of “late” group, including c-Maf, Ets1, N-Myc, Nfat5, and Nfib, yielded 10 miRNAs: miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351, with multiple connections. [score:1]
Ten miRNAs, miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 7
Those miRNAs, we call them the epi-miRNAs, includes, for example, miR-148a, miR152, miR222 that targets mRNA of DNMTs and leads to re -expression of hyper-methylated tumor suppressors [32]. [score:7]
[1 to 20 of 1 sentences]
57
[+] score: 7
In order to assess the function of miRNA clusters, which are polycistronic primary miRNA transcripts that give rise to two or more mature miRNAs, we constructed two artificial miRNA cluster expression constructs (miR-15b and miR-16; miR-221 and miR-222) by sequence concatenation, as outlined in material and methods. [score:3]
The transcript levels of mature miRNA were analysed by RT-qPCR for each of the miRNAs of the two clusters (miR-15b-5p, miR-16-5p, mir-221-3p and mir-222-3p) and normalized against miR-185-5p as a stably expressed control [32]. [score:3]
Artificial mir-221 and mir-222 were synthesized individually and cloned into the pcDNA 6.2 vector using restriction sites as indicated by black arrows. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 7
For example, in a glioma mo del, miR-222 and miR-339 were demonstrated to target and inhibit ICAM-1 expression, thus diminishing tumor sensitivity to lysis by cytotoxic T cells [27]. [score:7]
[1 to 20 of 1 sentences]
59
[+] score: 7
Inhibition of function of either of these two miRNAs in BM cells by using their agonist oligo increased pDC/cDC ratio, which suggests that mir-221/mir222 may promote pDC development [23]. [score:4]
miR-221 and miR-222 are more highly expressed in cDCs than in pDCs. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 7
Other miRNAs from this paper: mmu-mir-155, mmu-mir-221
During the adipogenic program of both immortalized and primary hMSCs, the expression of miR-155, miR-221, and miR-222 decreased, however, ectopic expression of these miRNAs significantly inhibited adipogenesis [7]. [score:7]
[1 to 20 of 1 sentences]
61
[+] score: 7
Other miRNAs from this paper: mmu-mir-188, mmu-mir-539
For instance, forced expression of GAS5 suppresses the activation of primary HSCs in vitro and alleviates the accumulation of collagen in fibrotic liver tissues in vivo by increasing p27 expression as a ceRNA for microRNA-222 [15]. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 6
Profiling of miRNAs expression was also performed in the YAC128 and R6/2 mice, showing that nine miRNAs (miR-22, miR-29c, miR-128, miR-132, miR-138, miR-218, miR-222, miR-344, and miR-674*) are commonly down-regulated in 12-month-old YAC128 mice and 10-week-old R6/2 mice (100). [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
Their conclusions were based on correlational evidence and did not include direct experimental proof for regulation of ATGL by miR-222. [score:3]
Parra et al., presented evidence that miR-222 might target ATGL along with Peroxisome proliferator-activated receptor γ2 (PPARγ2), Fatty acid synthase (FASN), Stearoyl-CoA desaturase-1 (SCD1), HSL, and a few other genes involved in both adipogenesis and lipolysis [15]. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 6
Similarly, TargetScan analysis identified the following miRNAs that are conserved in humans and are predicted to influence the NT3 gene: miR-21-5p, miR-222-3p, and miR-221-3p. [score:3]
Both miR-222-3p and miR-221-3p share the same seed sequence (AUGUAGCA). [score:1]
MicroRNAs predicted to influence neurotrophins: a BDNF (miR-206-3p, miR-10a-5p, miR-1b, miR-195-5p and miR-497-5p), b NT3 (miR-21-5p, miR-222-3p and miR-221-3p), and c NGF (let-7b-5p and miR-98-5p) were quantified by qPCR analysis in YA (n = 8) vs VO (n = 10) rat vastus lateralis muscle and WT (n = 8) vs Sarco (n = 7) gastrocnemius muscle. [score:1]
In contrast to the aforementioned studies in aging muscle, most of the miRNAs studied herein have been examined in the context of experimental denervation, including miR-206 (increases after reinnervation), miR-10a-5p (increases four- to seven-fold with denervation), miR-1 (increases up to 10-fold following denervation and remains elevated after reinnervation), miR-195 (increases up to 10-fold with denervation), miR-21 (increases with denervation), miR-221 (no consistent change), miR-222 (no consistent change), and miR-98 (increases up to 10-fold with denervation) [43, 47, 48]. [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 6
miR-221 and miR-222 and miR-503 were also found to inhibit EC morphogenesis [8, 13]. [score:3]
miRNAs including the mir-let-7 family, as well as mir-21, mir-126, mir-221, and mir-222 are highly expressed in endothelial cells [9, 10]. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 5
Notably, cardiac-specific miR-1, miR-133, miR-208 and miR-499 were all suppressed by two or more orders of magnitude [34], [35], as were the stemness and cell cycle repressors miR-141 and miR-137 [36]; in contrast, the proliferative miRNAs, miR-222 [37], increased dramatically in MDCs, and miR-221 was undetectable in myocytes but highly expressed in MDCs (Figure 5D). [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Others, including let-7f, miR-27b [6], miR-221, and miR-222 [12], have been shown to modulate angiogenesis in vitro and overexpression or inhibition of miR-378 [13], the miR-17-92 cluster [14] and miR-296 [15] affects angiogenesis in mouse engrafted tumors. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
The down-regulation of eNOS (an angiogenesis regulator) protein should be predominantly carried out by using RNA interference induced by miR-222 following “Argonaute/RISK” of high polymer DDMC/PTX [49]. [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
Other miRNAs from this paper: mmu-mir-221
Whilst this could be a direct result of HOX/PBX binding to its regulatory sequences, a recent study showed that it could also be due to the increased transcription of the oncogenic microRNAs miR221 and mir222, which in turn repress cFos expression [16]. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Further, Rieu et al. have shown that expression of miR-21, miR-221, miR-222, and Let-7a increases with PanIN grade, with the strongest expression in the hyperplastic ducts with PanIN 2/3 lesions [69]. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
It has been reported that miR-146, miR-221, miR-222 and miR-383 regulate gene expression during this process[18– 20]. [score:4]
As previously described, many novel miRNA molecules are required for spermatogenesis, and in fact some pivotal steps of spermatogenesis rely on a single miRNA molecule (e. g. miR-146, miR-221, miR-222 and miR-383). [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 5
As summarized in Table 2, we noticed that most of the miRNAs (miR-10a-5p, miR-193a-3p, miR-200b-5p, miR-222-3p) that are actively sorted into exosomes have tumour suppressive effects involving cell growth suppression, whereas miRNAs (miR-196a/b, miR-181d-5p, miR-155-5p) that have oncogenic effects are retained in the tumour cells even though the levels of the oncogenic miRNAs are higher in their donor cells than in the exosomes. [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 4
Other studies support that H. pylori promote proliferation through upregulating miR-222 [58]. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
A droplet digital PCR assay was used to analyze the expression of miR-1A, miR-181a-5p-A, and miR-222 in serum obtained at baseline, 6, and 24 hours after partial hepatectomy. [score:2]
In contrast, digital PCR analysis did not detect any miR-222, a miRNA that is increased in tissue samples at six hours after partial hepatectomy but was not detected in the circulation in our RNA sequencing studies. [score:1]
No copies of miR-222 were detected. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 4
miR-222 + +miR-222 was up-regulated in atypical teratoid-rhabdoid tumors [51]. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
STAT5s are transcription factors whose activation needs to be tightly controlled for mammary gland development, lactation and involution [79] and some microRNAs (i. e. miR-222) have been recently found to control STAT5 expression [80]. [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
Other miRNAs from this paper: mmu-mir-146a
Lee JY et al. found that expression of DNMT3A and DNMT3B genes were post-transcriptionally regulated by several microRNAs, specifically miR-1741, miR-16c, and miR-222, and miR-1632 via their 3’-UTR in cancerous ovaries of laying hens [33]. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Five depressing-adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326) target 217 lncRNAs. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 4
We found that compared to medium, moDCs stimulated with B0213 showed significantly increased expression of hsa-miR-132-3p, hsa-miR-144-3p, hsa-miR-147a, hsa-miR-155-5p, hsa-miR-503-3p, and hsa-miR-99b-5p and a decreased expression hsa-miR-222-3p (Fig.   3c). [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
For example, several RNA -binding proteins have been recently shown to control the accessibility and regulation of a given mRNA by a specific miRNA such as PUM2 that is involved in p27 mRNA regulation by miR-221 and miR-222 [48] or RPL11 involved in the control of Myc mRNA regulation by miR-24 [49]. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
The C [qs] (C [q] = quantification cycle) obtained for each miRNA were used to directly infer the abundance of each miRNA relative to that of the most abundant miRNA (miR-222). [score:2]
This was achieved by subtracting individual C [q] values from that obtained for miR-222 (e. g. Δ C [q] = C [q] miR-21 – C [q] miR-222). [score:1]
The relative level of each miRNA to miR-222 was then inferred using 2(-Δ Cq). [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 4
In cultured VSMCs, miR-221 and miR-222 expression can be transcriptionally induced by PDGF, and both miRNAs play a role in VSMCs phenotypic switch [21]. [score:3]
miR-221 and miR-222 were also implicated in modulation of VSMCs differentiation. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
From these, 29 miRNAs increased their expression levels by Nkx2-1 knock-down including miR-200c (16.7 fold), miR-200b (1.7 fold), miR-221 (4.2 fold), and miR-222 (3.7 fold) (Figure  2A and Table  1). [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
To verify the Solexa sequencing data, we randomly selected five differentially expressed miRNAs (miR-1, miR-206, miR-122, miR-222, and miR-133), and conducted quantitative RT-PCR. [score:3]
The abundance of miR-1, miR-206, miR-122, miR-222, and miR-133 were normalised relative to the abundance of U6 small nuclear RNA (snRNA). [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 4
miR-222 was detectably expressed in BMMC, Pu. [score:3]
Table 1 summarizes the results from Northern analysis of the miRNAs shown in Figures 2 and 3, as well as showing data for two additional miRNAs, let7d (let7 family) and miR-222. [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 3
Recent studies also indicate that some miRNAs contribute to gastric carcinoma, including activated miRNAs (such as miR-21, miR-107, miR-222, and miR-106b) and suppressed miRNAs (such as miR-143, miR145, miR-622, and miR-148a) [16]. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Coskun E. Neumann M. Schlee C. Liebertz F. Heesch S. Goekbuget N. Hoelzer D. Baldus C. D. MicroRNA profiling reveals aberrant microRNA expression in adult ETP-ALL and functional studies implicate a role for miR-222 in acute leukemia Leuk. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Five miRNAs (miR-146b, miR-221, miR-155, miR-214 and miR-222) were consistently regulated in almost all samples that were examined [15], suggesting a possible involvement of common miRNA -mediated regulatory mechanisms in muscle disorders. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Although a number of the RDX-responsive miRNAs (let-7, miR-34, miR-146, and miR-222) found in this study have been reported previously to have aberrant expressions in response to different chemical exposures in human cell lines, most of the RDX-responsive miRNAs reported in this study have not been shown to respond to chemical treatment previously (Blower et al. 2008; Marsit et al. 2006; Moffat et al. 2007; Pogribny et al. 2007; Rossi et al. 2007; Saito et al. 2006; Sun et al. 2008). [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
Finally, PRMT5 loss did not consistently regulate MITF or p27 [Kip1] at the transcriptional level, or alter specific microRNAs that are key regulators of these proteins including miR-221, miR-222, miR-181b or miR-148a [36]– [39] (Table 4 and data not shown). [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Other miRNAs from this paper: mmu-mir-137, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-16-1, mmu-mir-16-2
MiR-222 is expressed at significantly higher levels in cell lines of microglial origin over those of neuroblastoma origin, and vice versa for miR-137. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Karakatsanis A Papaconstantinou I Gazouli M Lyberopoulou A Polymeneas G Voros D Expression of MicroRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significanceMol Carcinog. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Murakami et al. [48] showed a correlation between miR-222, miR-106a, miR-92, miR-17-5p, miR-20 and miR-18 and the degree of differentiation suggesting an involvement of specific miRNAs in the progression of the disease. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
Two miR-221 and miR-222 seed elements were identified in the 3’UTR of ERα and transfection of miR-221 and miR-222 suppressed ERα protein, but not mRNA in ERα positive MCF-7 and T47D cells. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
In addition, a causal relationship between miR-221 and miR-222 expression and resistance to the anti-estrogen drug tamoxifen has been identified in breast cancer [47, 48]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
MiR-21, miR-221 and miR-222 contribute to the proliferation and metastasis of HCC cells by targeting phosphatase and tensin homolog (PTEN) [6], [7]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
microRNA-222 targeting PTEN promotes neurite outgrowth from adult dorsal root ganglion neurons following sciatic nerve transection. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
In addition to its primary function, GAS5 RNA binds oncogenic miR-21, miR-222, and miR-103, thereby serving as a siRNA-sponge and preventing them from impacting gene expression [74, 78]. [score:3]
[1 to 20 of 1 sentences]