sort by

18 publications mentioning rno-mir-328a

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-328a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 277
Other miRNAs from this paper: rno-mir-17-1, rno-mir-378a, rno-mir-17-2, rno-mir-328b, rno-mir-378b
To confirm that the repression of CD44 expression was a consequence of miR-328 expression, we generated a construct expressing an antisense RNA against miR-328. [score:7]
A number of proteins were detected to be down-regulated (A) and up-regulated (B) by miR-328-transfection. [score:7]
When hyaluronan reached a concentration of 100 µg/ml, cells expressing GFP alone formed branching-like structures and this was inhibited by miR-328 expression (Figure S5B). [score:7]
To directly demonstrate repression of CD44 expression by miR-328, we integrated fragments of the CD44 3′-UTR containing the miR-328 target sequences into a luciferase report vector (pMIR-Report, Ambion; for structures and sequence see Figure S8). [score:6]
It appeared that miR-328 expression might have suppressed some adhesion molecules on the cell surface. [score:5]
To test whether CD44 expression was correlated with miR-328 levels, a number of human cell lines were analyzed for CD44 expression by Western blots (Fig 3E) and miR-328 levels by real-time PCR (Fig 3F). [score:5]
This suggests that miR-328 represses CD44 expression at the translational level. [score:5]
To assure that processing of the expressed miR-328 did not interfere with the RNAi/miRNA pathways, we analyzed a few endogenous microRNAs and observed that transfection with miR-328 did not affect expression of endogenous microRNAs (Figure S1B). [score:5]
Targeting of CD44 by miR-328 We then examined protein expression affected by miR-328 transfection. [score:5]
In brief, the pre-microRNA of miR-328 was ligated into a mammalian expression vector BluGFP that contains a Bluescript backbone, a CMV promoter driving expression of either green fluorescent protein (GFP) or the red fluorescence protein (RFP), and a H1 promoter driving miR-328. [score:5]
Capillary formation affected by miR-328 targeting CD44To have a better insight of cell behaviour while CD44 expression was repressed by miR-328, Matrigel cultures of the mixture containing both the miR-328- and the GFP -transfected cells were subjected to confocal microscopic examination. [score:5]
Luciferase activity assays indicated that mutation of the essential target site abolished the effect of miR-328, while mutation of the non-essential site produced little effect of miR-328's repression activity (Fig 4D). [score:4]
Targeting of CD44 by miR-328. [score:3]
This result suggests that the third sequence (CD44d, 5′ttggaagctgaggagcttcag) is essential for miR-328 repression of CD44 expression. [score:3]
The potential mir-328 target sequences were labelled in blue. [score:3]
We then examined protein expression affected by miR-328 transfection. [score:3]
To have a better insight of cell behaviour while CD44 expression was repressed by miR-328, Matrigel cultures of the mixture containing both the miR-328- and the GFP -transfected cells were subjected to confocal microscopic examination. [score:3]
In the case of miR-328 -expressing cells, the levels of CD44 were low and some were negative. [score:3]
The effects of miR-328 expression on cell activities were analyzed. [score:3]
When the transfected cells were enriched by sorting, inhibition of cell aggregation appeared in Matrigel culture, mimicking an effect of miR-328, suggesting that the CD44-pathway is essential for miR-328 -mediated cell activities. [score:3]
Zonating morphogenesis affected by miR-328 targeting CD44 in vivo We then used an in vivo mo del to test the effects of CD44 on cell-cell interaction. [score:3]
A microRNA construct expressing miR-328 was designed by our lab and the DNA synthesized by a biotech company (Top Gene Technologies, Montreal). [score:3]
This means that every fluorescent cell expresses mature miR-328. [score:3]
Targeting of CD44 by miR-328. [score:3]
Confirmation of miR-328 targeting CD44. [score:3]
Construction and expression of miR-328. [score:3]
With this approach, we have demonstrated that cells expressing miR-328 exhibited reduced adhesion and formed small complexes in Matrigel. [score:3]
Nevertheless, the miR-328 -transfected cells were able to interact with the vector/GFP cells because both groups of cells expressed equal levels of E-cadherin and, perhaps, some other adhesion molecules. [score:3]
Zonating morphogenesis affected by miR-328 targeting CD44 in vivo. [score:3]
Using the software available [52], [53], [54], we have found that miR-328 potentially targets a number of cell adhesion molecules including CD44. [score:3]
miR-328 was found to have several potential target sites in CD44 3′-UTR. [score:3]
This study was designed to investigate the role of miR-328 in affecting cell activities by targeting CD44 expression. [score:3]
Cells transfected with miR-328/GFP were mixed with cells transfected with miR-328/RFP, both of which expressed equally low levels of CD44 (data not shown), followed by Matrigel culturing. [score:3]
It showed that although addition of hyaluronan promoted aggregation of the GFP -transfected cells, expression of miR-328 was able to reduce hyaluronan's effect on cell aggregation (Figure S5A). [score:3]
In these cell lines, miR-328 may not be the major regulator of CD44 since CD44 can also be regulated by many other miRNAs. [score:3]
To confirm expression of different constructs, control vector or miR-328 with GFP or RFP was transfected into A431 cells by lipofatamine 2000, and selected by G418 or hygromycin for getting stable cell lines. [score:3]
Western blot analysis confirmed that CD44 expression was repressed in the cells stably transfected with miR-328 (Fig 3B, left panel). [score:3]
We also found that CD44 is the target of miR-328 in mediating a variety of cell activities. [score:3]
The control cells, which expressed GFP alone (vector/GFP), always stayed in the middle of the tube-like structures, while the miR-328 -transfected cells (328/RFP) always surrounded the tube-like structures (Figure 6A). [score:3]
0002420.g001 Figure 1Construction and expression of miR-328. [score:3]
These results further confirmed that the third sequence is essential for miR-328 repression of CD44 expression. [score:3]
Using similar approach, an antisense sequence to miR-328 was inserted in the expression vector producing an anti- miR-328 construct. [score:3]
Figure S4 A, Expression of miR-328 reduces cell adhesion. [score:3]
0002420.g007 Figure 7Zonating morphogenesis affected by miR-328 targeting CD44 in nude mice. [score:3]
We then analyzed 3′-UTR sequence of CD44 and found three potential targets for miR-328 (Figure 4A, GeneBank access number NM_001001390). [score:3]
Zonating morphogenesis affected by miR-328 targeting CD44 in nude mice. [score:3]
0002420.g004 Figure 4Confirmation of miR-328 targeting CD44. [score:3]
Expression of miR-328 reduces cell adhesion, aggregation, and capillary formation. [score:3]
0002420.g003 Figure 3Targeting of CD44 by miR-328. [score:3]
Transfection of CD44 into the miR-328 -expressing cells reversed the effect of miR-328 in reducing cell adhesion. [score:3]
No significant differences were detected between the cells transfected with miR-328 and cells expressing GFP alone (Figure S6A). [score:3]
Increased expression of mir-328 was confirmed by real-time PCR (Figure 1C and Figure S2). [score:3]
Transfection with miR-328 repressed CD44 expression. [score:3]
Using this technique, we have successfully expressed a number of miRNAs in mammalian cells including miR-328. [score:3]
Capillary formation affected by miR-328 targeting CD44. [score:3]
Transfection of CD44 into the miR-328 -expressing cells reversed the effect of miR-328 in reducing cell aggregation (Figure 5D). [score:3]
Transfection with miR-328 reduced CD44 expression. [score:3]
To confirm the repression of CD44 by miR-328 expression, both miR-328- and GFP -transfected cells were immunolabeled and analyzed by flow cytometry. [score:3]
0002420.g006 Figure 6Capillary formation affected by miR-328 targeting CD44. [score:3]
A431 cells transfected with miR-328 (pooled cell line) or a control vector expressing GFP alone were cultured on tissue culture plates to confluence. [score:3]
We have detected the expression of pre-miR-328 by RT-PCR using RNA prepared from A431 cells stably transfected with miR-328 (Figure 1B). [score:3]
In this study, we have demonstrated that a construct harbouring a duplicate of pre-microRNA miR-328 can be successfully expressed and processed to mature microRNA. [score:3]
Repression of CD44 expression was observed in cells transfected with miR-328 (left). [score:3]
Immunocytochemical staining further confirmed the repression of CD44 expression in cells transfected with miR-328 (Fig 3D). [score:3]
Transfection of the antisense construct enhanced CD44 expression (Fig S6B), which did not affect the level of mature miR-328 (Fig S6C). [score:3]
A great reduction in CD44 expression was detected in the cells stably transfected with miR-328 as compared with the cells transfected with GFP (Figure 3C). [score:2]
We have generated a construct that can express the pre-microRNA of miR-328 and GFP, with an antibiotic selection marker (Figure 1A, all primers used in this study are listed as Supplementary Table S1). [score:2]
A large number of proteins were down regulated by miR-328 transfection (Figure S7). [score:2]
Confocal analysis indicated that the cells mixed with each other randomly and formed small complexes (Figure 6C, miR-328/GFP:miR-328/RFP). [score:1]
0002420.g005 Figure 5Rescue of miR-328 -mediated cell activities. [score:1]
Reduction of cell aggregation was observed in the miR-328 -transfected cells (Figure 2B). [score:1]
Twenty min after the incubation, miR-328 -transfected cells started to detach, while vector -transfected cells remained undetached after 25 min of incubation (Figure 2A). [score:1]
Formation of tube-like structures could only be seen when vector/GFP -transfected cells were mixed with miR-328/RFP -transfected cells, in which the green cells stayed in the middle while the red cells covered the surface of the tube-like structures. [score:1]
Due to the repression of CD44, the miR-328 -transfected cells could not form large complexes mediated by CD44-hyaluronan interaction. [score:1]
In the group injected with miR-328 -transfected cells, layers of CD44 -negative cells (blue nuclei) were detected between tumor tissues and stroma tissues, while the CD44 -positive cells were largely detected in the internal locations of the tumors (Fig 7A). [score:1]
C, RNA samples were also prepared for RT-PCR amplifying pre-miR-328 and mature miR-328. [score:1]
Little difference was observed when manganese was present, suggesting that miR-328-promoted cell detachment was manganese-independent but calcium-involved (Figure S3B). [score:1]
RT-PCR of mature miR-328 using RNA prepared from A431 cells stably transfected with miR-328 and a control vector, confirming proper processing of miR-328. [score:1]
Reduction of cell aggregation was observed in the miR-328 -transfected cells. [score:1]
Figure S1 A, Diagram of the procedure of RT-PCR of mature microRNA miR-328. [score:1]
B, GFP- and miR-328 -transfected cells were incubated in Petri dishes in the presence of HBSS with manganese (Mn) or calcium (Ca) for 6 hours. [score:1]
To test how hyaluronan affected the formation of the tube-like structures, the mix containing cells transfected with vector/GFP and cells transfected with miR-328/RFP was incubated with hyaluronidase. [score:1]
GFP- and miR-328 -transfected cells were incubated in tissue culture plates in the presence or absence of anti-CD44 antibody at 37°C for 3 hours followed by counting of the adherent cells. [score:1]
Rescue of miR-328 -mediated cell activities. [score:1]
The experiments showed that the miR-328 -transfected cells had a lower activity of migration (Figure S3A). [score:1]
As a result, the miR-328 -transfected cells were able to form relatively larger tumor nodules than the GFP -transfected cells did. [score:1]
The cultures were changed for serum-free medium prior to transfection with different combinations of DNA (e. g. 10 ng luciferase reporter construct mixed with 10 ng β-Gal plasmid and 300 ng miR-328 construct). [score:1]
B, RT-PCR of mature miR-328, miR-378, miR-17-3p, and miR-17-5p using RNA prepared from A431 cells stably transfected with miR-328 and a control vector, confirming that processing of other microRNAs was not affected by miR-328 transfection. [score:1]
In the miR-328 group, layers of CD44 -negative cells (blue nuclei) were detected between tumor tissues and stroma tissues. [score:1]
miR-328 -transfected cells exhibited lower rates of adhesion than the GFP -transfected cells. [score:1]
Cell Activities Affected by miR-328. [score:1]
A431 cells stably transfected with miR-328 or the vector were subjected to Western blot probed with a number of antibodies against different adhesion molecules including E-cadherin, P-cadherin, α-catenin, β-catenin, P-120, integrin α2, integrin α5, and integrin β1. [score:1]
To examine whether repression of CD44 levels was essential for miR-328 -induced changes in cell activities, we used anti-CD44 antibody to block CD44's function in the miR-328 -transfected cells. [score:1]
B, GFP-, miR-328-, and anti-miR-328 (antisense against miR-328) -transfected cells were cultured on tissue culture plates to confluence. [score:1]
GFP- and miR-328 -transfected cells were incubated in Petri dishes precoated without (Ctrl) or with fibronectin (FN, 50 mg/ml), hyaluronan (HA, 5 mg/ml), and laminin (LN, 50 mg/ml). [score:1]
Although this sequence does not contain a “seed” sequence perfectly matched by miR-328, it receives a high score using the criteria we described recently [57]. [score:1]
C, GFP- and miR-328 -transfected cells were incubated on Petri dishes in the presence of 0.2, 0.5, and 1.0 mM CaCl2 for 6 hours. [score:1]
0002420.g002 Figure 2 (A) A431 cells transfected with miR-328 or a control vector were cultured in tissue culture plates to confluence. [score:1]
C, GFP- and miR-328 -transfected cells were mixed in a 1:1 ratio. [score:1]
A few lower case letters represent changes of nucleotides that are not part of the mature miR-328 but are useful for PCR purpose. [score:1]
For immunocytochemistry, control cells with GFP and miR-328 transfected cells with RFP were mixed together in a ratio of 1∶1 and seeded into 12-well plates with cover slices in a concentration of 5×10 [4] cells/well. [score:1]
B, FP- and miR-328 -transfected cells were incubated in Matrigel with or without growth factors. [score:1]
The miR-328- and GFP -transfected A431cells were injected subcutaneously into nude mice. [score:1]
Figure S5 A, GFP- and miR-328 -transfected cells were incubated in Matrigel without (Ctrl) or with hyaluronan (HA, 50 ng/ml), fibronectin (FN, 50 ng/ml), and laminin (LN, 50 ng/ml). [score:1]
In brief, six-week-old nude mice strain Balb/c were injected with miR-328- and GFP -transfected U87 cell lines (5×10 [6] cells in 100 PBS). [score:1]
To confirm the function of CD44 in the formation of tube-like structures, the mix containing cells transfected with vector/GFP and cells transfected with miR-328/RFP was incubated with anti-CD44 antibody. [score:1]
A431 cells stably transfected with miR-328 or GFP vector were transfected with CD44 or a control vector. [score:1]
To examine how cell adhesion was affected, both GFP- and miR-328 -transfected cells were incubated in the presence of manganese or calcium for 6 hours. [score:1]
GFP- and miR-328 -transfected cells were cultured on tissue culture plates to confluence. [score:1]
Figure S3 A, GFP- and miR-328 -transfected cells were cultured on tissue culture plates to confluence. [score:1]
Reduction of cell adhesion was observed in the miR-328 -transfected cells. [score:1]
GFP- and miR-328 -transfected cells with or without mix (in 1∶1 ratio) were also cultured in Matrigel in the presence or absence of hyaluronidase or anti-CD44 antibody at 37°C for 24 hours followed by microscopic examination and photographed. [score:1]
Figure S6 A, GFP- and miR-328 -transfected cells were cultured on tissue culture plates to confluence. [score:1]
B, Real-time PCR curves of mature miR-328 from RNAs isolated from miR-328- and GFP vector -transfected cells. [score:1]
[1 to 20 of 114 sentences]
2
[+] score: 260
Fig. 3A shows that the expression of CD44 in NRK-52E cells transiently increased after 30 min under 60 mmHg pressure, peaked at 1 h, and persisted through 2 h. The time -dependent changes of CD44 protein levels were inversely correlated with miR-328 under 60 mmHg pressure from 0 to 4 h. To further determine whether miR-328 negatively regulates CD44 expression in NRK-52E cells with pressurization, we transfected NRK-52E cells with the miR-328 precursor, the miR-328 inhibitor or control miRNAs, and detected CD44 by Western blot. [score:8]
NRK-52E cells were transfected with miR-328 or miR-328 inhibitor, and then pressurized for 1 h. (C) Expression of EMT markers in miR-328 and miR-328 inhibitor transfected cells. [score:7]
Pressure -mediated transient downregulation of miR-328 promotes EMT in tubular epithelial cells by upregulating CD44. [score:7]
In colorectal cancer, the expression of miR-328 was downregulated in side population cells [37]. [score:6]
These results suggest that miR-328 downregulates CD44 expression in NRK-52E cells. [score:6]
CD44 is one the proteins downregulated by miR-328 in human cells [20], and its expression is reported to be associated with EMT in nasopharyngeal carcinoma [40]. [score:6]
Our study provides a new miR-328 target sequence in rat CD44 3′-UTR by which miR-328 negatively regulates the expression of CD44 in rat renal tubular cells. [score:6]
Both overexpression of miR-328 and knockdown of CD44 inhibited the pressure -induced TGF-β and EMT markers (Fig. 2 and 5). [score:6]
The over -expression of miR-328 inhibited cell invasion of side population cells. [score:5]
The inhibitory effect of miR-328 on EMT also supports its role as a tumor suppressor. [score:5]
These results suggest that miR-328 and CD44 are upstream regulators of TGF-β, and miR-328 -mediated CD44 transient upregulation is an important trigger of pressure -induced EMT. [score:5]
CD44 has been shown to be a potential target of miR-328 in human cells, but the miR-328 -targeting sequences found in 3′-UTR of human CD44 do not exist in 3′-UTR of rat CD44. [score:5]
Many studies show that miR-328 is expressed at low levels in many cancers, and acts as a tumor suppressor. [score:5]
This result suggests that the highly complementary sequence of miR-328 in CD44 3′-UTR (5′-atgaaagtgtggacagagagcag) is a target of miR-328 and essential for miR-328 repression of CD44 expression. [score:5]
the group at 0 h. (B) The expression levels of CD44 in miR-328 and miR-328 inhibitor transfected cells. [score:5]
The luciferase activity expression pattern of the CD44L construct was inversely correlated with miR-328 expression. [score:5]
Our data showed that miR-328 over -expression suppressed pressure -induced tubular epithelial cell EMT. [score:5]
MiR-328 has been reported to regulate zonation morphogenesis by targeting CD44 expression in human cells [20]. [score:5]
The transfection of miR-328 inhibitor dramatically increased the basal level of CD44 and promoted the pressure -induced expression of CD44. [score:5]
This potential target sequence was further proved to be the miR-328 target sequence in rat CD44 3′-UTR (Fig. 4B). [score:5]
But transfection with the miR-328 inhibitor did not influence the pressure -induced expression of CTGF (Fig. 2C). [score:5]
After 2 h of pressurization, the miR-328 precursor dramatically inhibited the pressure -induced expression of CD44 (Fig. 3B). [score:5]
the group at 0 h. (B) The expression levels of miR-328 in miR-328 and miR-328 inhibitor transfected cells. [score:5]
The expression pattern and 3′-UTR analysis revealed that CD44 was the target of miR-328 in pressurized NRK-52E cells (Fig. 3 and 4). [score:5]
Pressure -induced miR-328 downregulation in NRK-52E cells. [score:4]
CD44 Induced by Pressure, Downregulated by miR-328. [score:4]
miR-328 Directly Targets CD44. [score:4]
To reveal direct repression of CD44 expression by miR-328, we integrated fragments of the CD44 3′-UTR with the complementary sequence of miR-328 into a luciferase report vector. [score:4]
Here, we presented the first data showing that the transient downregulation of miR-328 by pressure could increase CD44 to induce renal tubular cell EMT, a major contributor to the pathogenesis of renal fibrosis, in tubular epithelial cells (Fig. 8). [score:4]
0099802.g007 Figure 7(A) Expression analysis of miR-328 in renal tissue from UUO rats by quantitative real time PCR. [score:3]
0099802.g004 Figure 4 (A) A potential miR-328 target sequence in rat CD44 3′-UTR and luciferase reporter construct design. [score:3]
We also found that miR328 expression in UUO kidneys was less than that in normal kidneys, and CD44 increased in renal tubular cells in slightly dilated tubules (Fig. 7). [score:3]
In human cells, miR-328 has been reported to target the 3′-UTR of CD44 mRNA [38]. [score:3]
0099802.g008 Figure 8 The pressure transiently decreases miR-328, and then increases CD44 expression in renal tubular cells. [score:3]
We validated the miR-328 expression by qRT-PCR. [score:3]
MiR-328 was shown to be transiently downregulated under 60 mmHg pressure; the decrease started at 30 min and reached the lowest level at 1 h, persisting through 2 h (Fig. 2A). [score:3]
Our data clarify the mechanisms of pressure -induced EMT, establishing a rationale for developing miR-328 and CD44 as therapeutic targets for pressure -induced renal fibrosis. [score:3]
To investigate the influence of miR-328 expression pressure -induced EMT, the expression of E-cadherin, TGF-β, CTGF, fibronectin, α-SMA and Snail was detected by Western blot. [score:3]
org), suggest no potential miR-328 target sequence in rat CD44 3′-UTR. [score:3]
The expression level of miR-328 in pressurized cells significantly decreased at 1–2 h and influenced pressure -induced EMT (Fig. 2). [score:3]
NRK-52E cells were transfected with luciferase reporter constructs, which has been engineered with different fragments of the CD44 3′-UTR with or without the target sequence of miR-328 (CD44L and CD44S). [score:3]
Expression of miR-328 reduced cell adhesion, aggregation, and migration in a human epidermal carcinoma cell line [20]. [score:3]
Confirmation of miR-328 targeting CD44. [score:3]
NRK-52E cells were pressurized for 0.5, 1, 2, 4, 8, 16 and 24 h, and the expression levels of miR-328 were analyzed by quantitative real time PCR. [score:3]
CD44 and miR-328 may serve as biomarkers and potential therapeutic targets for pressure -associated renal fibrosis. [score:3]
The relative expression values of miR-328 were normalized to U6. [score:3]
NRK-52E cells were transfected with miR-328 or miR-328 inhibitor and then pressurized for 2 h. Cellular CD44 was detected by Western blotting. [score:3]
To reveal the relationship between miR-328 and CD44, we detected the expression of CD44 protein with pressurization. [score:3]
0099802.g002 Figure 2(A) The expression levels of miR-328 in pressurized NRK-52E cells. [score:3]
miR-328 and CD44 Expression in UUO Rat Renal Tissues. [score:3]
We monitored the expression of miR-328 in tubular epithelial cells in renal tissues of UUO rats. [score:3]
4427975) or inhibitors of rat miR-328 (cat. [score:3]
We used the BLAST to screen antisense matches of rat CD44 3′-UTR against miR-328, and then found a potential target sequence (Fig. 4A). [score:3]
The miR-328 target sequence in human CD44 3′-UTR does not exist in rat CD44 3′-UTR. [score:3]
The pressure transiently decreases miR-328, and then increases CD44 expression in renal tubular cells. [score:3]
In miR-328 inhibitor -transfected cells, the basal level of E-cadherin significantly decreased and that of fibronectin increased. [score:3]
anti-miR328, miR-328 inhibitor transfection. [score:3]
Expression of miR-328 in renal tissue from rats with unilateral ureteral obstruction (UUO). [score:3]
MiR-328 expression was decreased in high-grade gliomas and was associated with poor survival in primary glioblastoma patients [36]. [score:2]
The direct effects of miR-328 have been studied in a wide range of cancer cells. [score:2]
MiR-328 also influenced drug efflux by repressing breast cancer resistance protein mRNA expression in breast cancer cells [38]. [score:2]
Compared to control cells, miR-328 levels significantly increased in miR-328 precursor -transfected cells and decreased in miR-328 inhibitor -transfected cells (Fig. 2B). [score:2]
4427975, miRBase ID: rno-miR-328a-3p) according to the manufacturer’s instructions (Life Technologies). [score:1]
In miR-328 precursor -transfected cells, the basal level of E-cadherin significantly increased (Fig. 2C). [score:1]
Schematic representation of miR-328/CD44 -mediated epithelial-to-mesenchymal transition in renal tubular cells. [score:1]
We demonstrated for the first time that miR-328 plays a role in renal fibrosis in ureteric obstruction. [score:1]
The relative amount of miR-328 was normalized to U6 snRNA. [score:1]
Relatively few studies regarding miR-328 in other cellular functions have been reported. [score:1]
miR-328 Mediated EMT. [score:1]
These data further support the findings that miR-328 and CD44 are involved in renal EMT as observed in NRK-52E cells. [score:1]
To investigate whether miR-328 plays a role in pressure -induced EMT, we transfected the miR-328 precursor, the miR-328 inhibitor or miRNA control into NRK-52E cells and processed under 60 mmHg pressure. [score:1]
Relative amounts of the miR-328 were quantitated using the comparative Ct method. [score:1]
miR328, miR-328 transfection. [score:1]
In our system the time point of TGF-β induction in pressurized NRK-52E cells is later than those of miR-328 reduction and CD44 induction (Fig. 1 and 3). [score:1]
We then used the basic local alignment search tool (BLAST) to analyze antisense matches of rat CD44 3′-UTR (GeneBank access number NM_012924.2) against miR-328 and found a highly complementary sequence of miR-328 (Fig. 4A). [score:1]
[1 to 20 of 75 sentences]
3
[+] score: 66
Other miRNAs from this paper: rno-mir-186, rno-mir-328b
We subsequently proposed the possible involvement of CACNb1 via the suppression of miR-328 expression to down-regulate myogenin gene expression in rat cardio-myocytes. [score:10]
Using the TargetScan website to predict human miR-328 targets, human myogenin was identified as a potential target; however, rat myogenin is not its target because of its distinctive 3′-UTR sequences, GGGCCAA and GGGCAA (data not shown). [score:9]
Combined with these findings, the suppression of myogenin by TNF-αis either independent of the miR-328-CACNb1 signaling in myocytes or the selectivity of the miR-328 target depends on the cell-type. [score:5]
Yang demonstrated that CACNB1 was a target for miR-328, but there was no supporting data from the TargetScan analysis. [score:5]
Baba's laboratory demonstrated that miR-328 expression was markedly suppressed in gastric cancer cells treated with H [2]O [2], but not TNF-α [38]. [score:5]
Since the decreased micro RNA-328 (miR-328) expression may play a role in DXR -induced cardio-toxicity, a potential mo del for the protection of DXR -induced cardio-toxicity via repression of miR-328 mediated CACNb1 (voltage-gated calcium channel β1) -dependent myogenin gene expression was proposed. [score:5]
Yang's laboratory revealed that CACNb1 was the target of miR-328, which was suppressed by DXR [32], and Dr. [score:5]
There are many factors involved in the regulation of myogenin gene expression, such as HuR, Twist, CACNb1, miR-186 and miR-328 [25– 28, 32]. [score:4]
It is important to elucidate the detailed regulatory mechanism of miR-328 and its targets under various pathophysiological conditions, such as atrial fibrillation. [score:4]
Here, we propose that the DXR -induced decrease of myogenin is mediated through transcriptional repression by CACNb1, which is induced by the downregulation of miR-328 by DXR in rat cardiomyocytes. [score:4]
Yang's laboratory showed that CACNb1 is the target of miR-328, and Dr. [score:3]
However, the suppression of miR-328 by ROS is not the primary mechanism because NAC did not affect the abundance of myogenin in this study. [score:3]
Furthermore, HuR and miR-328 -dependent CACNB1 signaling are potentially involved in the depletion of the myogenin gene and protein by DXR in rat cardiomyocytes. [score:1]
Therefore, we will have the chance to correlate the linkage of miR-328 -dependent CACNB1 signaling with the depletion of myogenin proteins to determine the mechanism of DXR -induced cardio-toxicity in the future. [score:1]
DXR Doxorubicin Top 2β topoisomerase 2β ROS reactive oxidative species miR-328 micro RNA-328 CACNb1 voltage-gated calcium channel β1 atRA all-trans retinoic acid Act D actinomycin D CHX cycloheximide ISO isoproterenol PE phenylephrine NAC N-acetyl cysteine RLU relative light units ACTN α-actinin HA hemagglutinin FACS fluorescence-activated cell sorting PI propidium iodide. [score:1]
In addition, several miRs were also modulated by DXR based on our miRNA analysis profile (Table 1), such as miR-328. [score:1]
[1 to 20 of 16 sentences]
4
[+] score: 51
According to the PCR results, the miR-34c expression levels were up-regulated, whereas the miR-1188a, miR-328a and miR-331 expression levels were down-regulated (*p<0.05) (Fig 4 A–4 C, left), and miR-1188a presented the most pronounced changes in expression in the hippocampus, which is consistent with the microarray findings. [score:13]
Among the 11 significantly dysregulated miRNAs, 4 miRNAs were up-regulated (miR-34c, miR-374, miR-181a, and miR-let-7c-1), and 7 miRNAs were down-regulated (miR-1188, miR-770-5p, miR-127-5p, miR-375, miR-331, miR-873-5p, and miR-328a) (differentially expressed miRNAs were defined by a fold-change >1.5, up or down-regulated; p <0.05). [score:13]
As observed in our data, the peripheral blood expression levels of miR-1188a, miR-328, and miR-331 decreased in TLE-MI rats (Fig 4 A–4 C, right), whereas the expression level of miR-34c increased (Fig 4 D, right) in TLE-MI rats, suggesting that the expression pattern trends were identical to those of their counterparts in the hippocampus. [score:7]
Some of the up-regulated (miR-34c, miR-374, miR-181a, and miR-let-7c-1) and down-regulated (miR-1188, miR-770-5p, miR-127-5p, miR-375, miR-331, miR-873-5p, and miR-328a) miRNAs we detected using miRNA microarray were suggested to be closely connected with memory function. [score:7]
The expression of miR-328, which is a translational regulator of ß-amyloid (Aß) precursor protein (APP)-converting enzyme (BACE), was found to be decreased in the hippocampi of aging APPSwe/PS1 mice[45]. [score:6]
2014.00002 45 Boissonneault V, Plante I, Rivest S, Provost P. MicroRNA-298 and MicroRNA-328 Regulate Expression of Mouse beta-Amyloid Precursor Protein-converting Enzyme 1. J Biol Chem. [score:3]
The dysregulated miRNAs (miR-34c, miR-1188a, miR-328a, and miR-331) were confirmed using qRT-PCR and the results were consistent with the microarray analysis. [score:2]
[1 to 20 of 7 sentences]
5
[+] score: 43
In addition, CD44 was another experimentally validated target gene of miR-328-3p 44 and its deficiency significantly inhibited osteoclast activity 45. [score:5]
Interesting, miR-328-3p showed significant down-regulation in the serum of OVX rats and postmenopausal osteoporotic patients, but no significant change in bedrest monkeys. [score:4]
Three serum miRNA (miR-103-3p, miR-142-3p and miR-328-3p) were markedly down-regulated only in osteoporotic patients and miR-30b-5p decreased in both osteopenic and osteoporotic patients. [score:4]
In addition, miR-328-3p also showed a notable decrease in osteoporotic patients in our study by normalizing to miR-25-3p (Fig. 4a), which was reported down-regulation in the serum of postmenopausal osteoporotic fracture and involved in bone formation by Weilner et al. 13. [score:4]
Only miR-328-3p was significantly down-regulated in OVX rat (Fig. 3b). [score:4]
As shown in Fig. 4c, miR-30b-5p, miR-103-3p and miR-142-3p were significantly down-regulated after bedrest, while miR-328-3p had no significant change. [score:4]
14 of these down-regulated miRNAs and miR-328-3p reported previously were verified by qPCR. [score:4]
Weilner et al. reported that miR-328-3p was down-regulated in the serum of postmenopausal osteoporotic fracture patients 13, which was consistent with our results. [score:4]
It had been shown that miR-328-3p potentially activated WNT signaling by repression of the WNT -inhibitor SFRP-1 (secreted Frizzled-related protein 1) 41, which also played an important role in both osteoblast and osteoclast differentiation 42 43. [score:3]
However, the regulation mechanisms of miR-328-3p on bone metabolism remain unclear, we speculated miR-328-3p may involve in the different mechanisms between postmenopausal osteoporosis and mechanical unloading induced osteoporosis. [score:2]
The knockdown of miR-328-3p in adipose-derived mesenchymal stem cells significantly reduced ALP activity during osteogenic differentiation 13. [score:2]
As shown in Fig. 4b, the AUC of miR-30b-5p was 0.793 (95% CI = 0.625–0.909, p = 0.0001), and 0.800 for miR-103-3p (95% CI = 0.607–0.926, p = 0.0004), 0.789 for miR-142-3p (95% CI = 0.599–0.918, p = 0.0023), and 0.874 for miR-328-3p (95% CI = 0.698–0.967, p < 0.0001). [score:1]
After adjusting for age, weight and height, miR-30b-5p, miR-103-3p, miR-142-3p and miR-328-3p were significantly positively correlated with H-BMD (total hip BMD) (r = 0.541, p = 0.001; r = 0.355, p = 0.039; r = 0.650, p < 0.001; r = 0.355, p = 0.039 respectively). [score:1]
To access the potential diagnostic value of miR-30b-5p for bone loss (osteopenia and osteoporosis), and the value of miR-103-3p, miR-142-3p, miR-328-3p for osteoporosis, ROC analysis was conducted and the associated area under the curve (AUC) was used to confirm the diagnostic value of each miRNA. [score:1]
[1 to 20 of 14 sentences]
6
[+] score: 41
Dysregulation of IGF1R expression is a feature of the chronic hypoxia mo del of PAH, in which downregulation of miR-328 correlates with upregulation of IGF1R [14]. [score:10]
Consistent with upregulation of miR-223, levels of IGF1R mRNA were downregulated in PA of MCT PAH rats, whereas the decreased miR-328 expression would have been expected to increase IGF1R mRNA levels. [score:9]
Overexpression of miR-328 in transgenic mice suppressed IGF1R expression levels and attenuated hypoxic PH. [score:7]
In the current study, miR-328 expression was modestly reduced in lung, but not PA, of MCT PAH rats, whereas miR-223 was consistently upregulated in all tissues and plasma. [score:6]
Inhibition of miR-145 [12], enhancement of miR-328 expression [14], and enhancement of the miR424/503-FGF axis also attenuated experimental pulmonary hypertension [19, 20]. [score:5]
Although expression of miR-204 and miR-328 was variable in lung and PA of the current study, our findings were generally congruent with published data in human PAH specimens [13, 14]. [score:3]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 34
The findings illustrated that fish oil may restore the expression of circadian clock-related Per3 via inhibiting the WD -induced overexpression of rno-miR-29c and that FOH upregulated the expression of rno-miR-328, possibly resulting in the inhibition of Pcsk9. [score:14]
Our findings indicated that fish oil feeding reduced the expression of rno-miR-29c and increased the expression of rno-miR-328 and rno-miR-30d in FOH group, and target regulated the expression of Per3, Pcsk9, and Socs1, respectively. [score:10]
The results showed that fish oil feeding inhibited the expression of rno-miR-29c and stimulated the expression of miR-30d and miR-328, where all were consistent with our miRNA transcriptomic results. [score:7]
The expression of rno-miR-29c, rno-miR-328, and rno-miR-30d in WD, FOH, and CON groups was further examined using qRT-PCR to validate the findings of comparative miRNA sequencing. [score:3]
[1 to 20 of 4 sentences]
8
[+] score: 13
By both the computational methods (Miranda and Targetscan) we demonstrated that in the enriched set, miR-328a-star_st was found to control maximum number of targets (381) followed by miR-3562 controlling 341 putative targets. [score:7]
We examined miR-328a as it also targets many genes that regulate cellular response to extracellular stimulus, extracellular matrix regulation, apoptosis, positive regulation of cell proliferation, and peptide hormone processing. [score:6]
[1 to 20 of 2 sentences]
9
[+] score: 9
We then used a screening system based on the luciferase reporter plasmid carrying the full-length 3′UTR of the FSHb mRNA and found that 18 miRNAs, specifically miR-433-3p, miR-323-3p, miR-328a-3p, miR-3573-3p, miR-204-5p, miR-206-5p, miR-31a-5p, miR-7a-5p, miR-880-3p, miR-186-5p, miR-503-5p, miR-383-5p, miR-324-5p, miR-505-5p, miR-27b-3p, miR-221-5p, miR-320-3p and miR-21-3p, could suppress the expression of the reporter by more than 30% (Figure 1). [score:5]
Interestingly, we identified 12 other miRNAs (miR-323-3p, miR-328a-3p, miR-3573-3p, miR-204-5p, miR-206-5p, miR-31a-5p, miR-7a-5p, miR-880-3p, miR-186-5p, miR-503-5p, miR-383-5p and miR-320-3p) that might also regulate FSHb expression, and then affected FSH secretion, but their specific effects need to be verified through further experiments. [score:4]
[1 to 20 of 2 sentences]
10
[+] score: 7
Among the targets for differentially expressed miRNAs in the spleen of Wistar rats, miR-3584-5p, miR-328*, miR-3095-3p and miR-3072* have important roles in signal pathway induction (involved in the Wnt, MAPK, mTOR, and neurotrophin signaling pathways) and immune regulation (involved in the chemokine signaling pathway in miR-1895). [score:6]
33rno-miR-19b−1.590.33rno-miR-451−4.370.05rno-miR-196c*−1.660.32Tissue/LungLog2(infected/control)Fold changemmu-miR-32*−2.170.22rno-miR-2062.234.69mmu-miR-328*−2.630.16rno-miR-2231.823.53rno-miR-32*−2.850.14rno-miR-981.22.3mmu-miR-468−3.490.09mmu-miR-4681.192.28mmu-miR-691−4.040.06mmu-miR-669d1.112.16mmu-miR-297a−4.620.04rno-miR-328a*1.12.14mmu-miR-467h−4.960. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 5
miR-328 functions as an RNA decoy to modulate hnRNP E2 regulation of mRNA translation in leukemic blasts. [score:4]
For example, the RNA -binding protein, hnRNP E2, has been shown to reversibly sequester miR-328 away from Ago, Dicer, and other proteins of the RISC loading complex (Eiring et al., 2010). [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 5
Other miRNAs from this paper: rno-mir-27b, rno-mir-122
Quantitative Real-Time RT-PCR Analyses of miR-27b, miR-122, and miR-328a Expression. [score:3]
miR-27b, miR-122, and miR328a have been recently reported to be associated with the regulation of CYP enzymes [48– 50]. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 5
Studies also showed that miR-21 [26], miR-26 [27], miR-328 [28], miR-133 and miR-590 [29] participated in the process of AF by controlling the expression of their specific gene targets. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 3
MicroRNA profiling in K-562 cells under imatinib treatment: influence of miR-212 and miR-328 on ABCG2 expression. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 2
sham rat) Peers' studies hsa-miR-34a-3p 2.63 upUp, Jess Morhayim[15] hsa-miR-433-3p 1.24 up This study hsa-miR-106b 2.24 up This study hsa-miR-23a 0.48 downDown, Sylvia Weilner[27] hsa-miR-328-3p 0.38 down Down, Sylvia Weilner hsa-miR-29b-3p 2.1 up Up, Jess Morhayim hsa-miR-146a-5p 2.68 up Up, Jess Morhayim hsa-miR-148a-3p 1.85 upUp, Cheng[28] We noted that DKK1 played important role in the development of osteoporosis. [score:2]
[1 to 20 of 1 sentences]
16
[+] score: 2
Name Primers U6F: 5′-GCTTCGGCAGCACATATACTAAAAT-3′ R: 5′-CGCTTCACGAATTTGCGTGTCAT-3′ rno-miR-500-3pGSP: 5′-GGAAGGCACCTGGGCAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-499-3pGSP: 5′-GGGGAACATCACAGCAAGTC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-214-3pGSP: 5′-GGGGACAGCAGGCACAGAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-20b-5pGSP: 5′-GGGGCAAAGTGCTCATAGTG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-877GSP: 5′-GGGGAAGTAGAGGAGATGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-451-5pGSP: 5′-GGGGGAAACCGTTACCATTAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-3577GSP: 5′-GGGTTCTGTCCCTCTTGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-370-3pGSP: 5′-AGCCTGCTGGGGTGGAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-181d-5pGSP: 5′-GGGGCATTCATTGTTGTCG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-23b-3pGSP: 5′-GGGATCACATTGCCAGGG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-191a-5pGSP: 5′-GGCAACGGAATCCCAAAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-200c-3pGSP: 5′-GGGGTAATACTGCCGGGTAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-328a-3pGSP: 5′-AACTCGCCCTCTCTGCCC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ nutrients-07-01333-t002_Table 2 Table 2 Primers of mRNA targets. [score:1]
Name Primers U6F: 5′-GCTTCGGCAGCACATATACTAAAAT-3′ R: 5′-CGCTTCACGAATTTGCGTGTCAT-3′ rno-miR-500-3pGSP: 5′-GGAAGGCACCTGGGCAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-499-3pGSP: 5′-GGGGAACATCACAGCAAGTC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-214-3pGSP: 5′-GGGGACAGCAGGCACAGAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-20b-5pGSP: 5′-GGGGCAAAGTGCTCATAGTG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-877GSP: 5′-GGGGAAGTAGAGGAGATGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-451-5pGSP: 5′-GGGGGAAACCGTTACCATTAC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-3577GSP: 5′-GGGTTCTGTCCCTCTTGGC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-370-3pGSP: 5′-AGCCTGCTGGGGTGGAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-181d-5pGSP: 5′-GGGGCATTCATTGTTGTCG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-23b-3pGSP: 5′-GGGATCACATTGCCAGGG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-191a-5pGSP: 5′-GGCAACGGAATCCCAAAAG-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-200c-3pGSP: 5′-GGGGTAATACTGCCGGGTAA-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ rno-miR-328a-3pGSP: 5′-AACTCGCCCTCTCTGCCC-3′ R: 5′-GTGCGTGTCGTGGAGTCG-3′ nutrients-07-01333-t002_Table 2 Table 2 Primers of mRNA targets. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 2
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 1
MiR-26 and miR-328 control vulnerability of atrial fibrillation [15]. [score:1]
[1 to 20 of 1 sentences]