sort by

43 publications mentioning mmu-mir-322

Open access articles that are associated with the species Mus musculus and mention the gene name mir-322. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 283
miR-322 directly targeted NF-κB1 (p50) through 3′-UTR interactionTo further elucidate the mechanisms of miR-322 regulating LPS -induced inflammatory response, Targetscan and miRanda were used to predict miR-322 targets that are related to NF-κB signalling. [score:9]
miR-322 inhibits LPS-stimulated inflammatory cytokine mRNA expressionTo assess the involvement of miR-322 on inflammatory cytokine expression, miR-322 was overexpressed in RAW264.7 cells by transfection of miR-322 mimics. [score:9]
We also showed that miR-322 mimic transfection resulted in an inhibition in pro-inflammatory cytokines mRNA expression, such as IL-1β, IL-6, TNF-α and increased anti-inflammatory cytokines IL-4 and IL-10 expression. [score:7]
miR-322 down-regulated NF-κB1 (p50) expression through direct 3′-UTR interaction in RAW264.7 cells. [score:7]
Figure 8 miR-322 down-regulated NF-κB1 (p50) expression through direct 3′-UTR interaction in RAW264.7 cellsSchematic diagram of miR-322 -binding site in NF-κB1 3′-UTR region by bioinformatics analyses. [score:7]
Inflammatory cytokines (IL-1β, IL-6 and TNF-α) were suppressed after LPS exposure compared with control while overexpression of miR-322 (Figure 4B–4D) and anti-inflammatory (IL-4 and IL-10 ) were significantly up-regulated (Figure 4E and 4F). [score:7]
Subsequent finding suggested that miR-322 targets 3′-UTR of NF-κB1 (p50) and negatively regulates LPS-modulated inflammatory cytokine expression. [score:6]
To further elucidate the mechanisms of miR-322 regulating LPS -induced inflammatory response, Targetscan and miRanda were used to predict miR-322 targets that are related to NF-κB signalling. [score:6]
These data suggested that miR-322 repressed NF-κB1 (p50) expression by directly targeting 3′-UTR of NF-κB1 (p50) mRNA. [score:6]
Meanwhile, the expression level of miR-322 was down-regulated and was opposite to the inflammatory cytokine mRNA level. [score:6]
Expression of miR-322 is down-regulated in LPS -treated RAW264.7 cells. [score:6]
These results suggest that LPS could down-regulate miR-322 expression. [score:6]
Our findings demonstrate that the level of miR-322 is down-regulated by LPS-stimulation and miR-322 is a negative regulator of the immune response. [score:5]
Here, we found that miR-322 expression is markedly suppressed in LPS -treated RAW264.7 cells. [score:5]
miR-322 expression level was dramatically suppressed upon LPS-stimulation and showed a time -dependent manner (Figure 3A). [score:5]
miR-322 inhibits LPS-stimulated inflammatory cytokine mRNA expression. [score:5]
Meanwhile, the expression level of inflammatory cytokines was inhibited by miR-322 following LPS-stimulation. [score:5]
To assess the involvement of miR-322 on inflammatory cytokine expression, miR-322 was overexpressed in RAW264.7 cells by transfection of miR-322 mimics. [score:5]
The NF-κB1 (p50) protein expression levels are expressed as a percentage of the miR-322 group in its control or anti- miR-322 group in its control (G and H). [score:5]
miR-322 is the homologue of human miR-424, which is differentially expressed in a variety of disease conditions and is highly conserved in different cells [15]. [score:5]
Taken together, these results indicated that miR-322 negatively regulated LPS -mediated inflammatory response by directly targeting NF-κB1 (p50). [score:5]
Furthermore, we found that overexpression of miR-322 reduced expression of NF-κB1 (p50) mRNA and protein. [score:5]
These results indicated that miR-322 could directly target NF-κB1 (p50)-3′-UTR (Figure 8B and 8C). [score:4]
Besides, NF-κB1 (p50) was identified as a functional target, through which miR-322 acted as a negative regulator in macrophage inflammatory response. [score:4]
Here, we found that the level of miR-322 was down-regulated in RAW264.7 cells by administration of LPS. [score:4]
miR-322 is down-regulated in LPS -treated RAW264.7 cellsmiR- 322 plays an important role in cell proliferation, cell differentiation, diabetes and male infertility [18– 20]. [score:4]
Our data provided evidence that LPS -induced down-regulation of miR-322 and its subsequent effects on NF-κB -mediated transcriptional activity are responsible for fine-tuning inflammatory responses in RAW264.7 cells. [score:4]
miR-322 is down-regulated in LPS -treated RAW264.7 cells. [score:4]
These findings indicated that miR-322 appeared to promote cell-cycle procession by regulating expression of cell cycle-related genes. [score:4]
miR-322, a member of an evolutionarily conserved miR-16 family, contributes to promoting osteoblast and muscle cells proliferation, differentiation by directly targeting Tob2 and Cdc25A [18, 25]. [score:4]
miR-322 directly targeted NF-κB1 (p50) through 3′-UTR interaction. [score:4]
These data demonstrated that miR-322 may negatively regulate LPS-stimulated inflammatory cytokine expression. [score:4]
In order to further confirm the regulatory function of miR-322 to NF-κB1 (p50), we used qPCR and to detect mRNA and protein levels of NF-κB1 (p50) in cells transfected with miR-322 mimics or inhibitors. [score:4]
NF-κB1 (p50) mRNA and protein levels were significantly decreased in cells transfected with miR-322 mimics, not with miR-322 inhibitors (Figure 8D–8G). [score:3]
miR-322 mimics and miR-322 inhibitors were purchased from GenePharma (China). [score:3]
After growing to 70% confluence, 50 nM miR-322 mimics, inhibitors or negative controls were transfected by lipofectamine 2000. [score:3]
In summary, we had proved for the first time that NF-κB1 (p50) was a novel target of miR-322. [score:3]
To explore the function of miR-322 in LPS -induced inflammatory response, the expression level of miR-322 in LPS -treated RAW 264.7 cells was tested. [score:3]
RAW264.7 cells were seeded into six-well plates for 12 h. The cells were replaced with fresh medium (DMEM + 10% FBS) and transfected with 50 nM miR-322 mimics and miR-322 inhibitors using Lipofectaime 2000 (Invitrogen TM, U. S. A. ) according to the manufacturer’s instructions. [score:3]
Overall, miR-322 may provide a new perspective for the treatment of inflammatory diseases. [score:3]
Luciferase expression level was significantly reduced when cotransfected with miR-322 and WT-3′-UTR plasmid, whereas no significant modulation was observed with Mut-3′-UTR. [score:3]
We found that the expression of miR-322 increased after transfection of miR-322 mimics (Figure 4A). [score:3]
We also found a decrease in miR-322 expression level in LPS -treated RAW264.7 cells. [score:3]
miR-322 can target 3′-UTR of NF-κB1 (p50), which indicated that TLR4 receptor and its signalling pathway may be involved in the process. [score:3]
org/miRDB/), to predict the targets of miR-322 in the TLR signalling pathways. [score:3]
miR-322 mimics transfection miR-322 mimics and miR-322 inhibitors were purchased from GenePharma (China). [score:3]
Surveying the predicted targets associated with inflammatory response of miR-322, one conserved 7-nt site in the NF-κB1 (p50) 3′-UTR is complementary to the miR-322 ‘seed’ region. [score:3]
In the subsequent research, overexpression of miR-322 increased cell cycle arrest at G [2]/M-phase and the number of cells in G [0]/G [1] was significantly decreased. [score:3]
miR-322 inhibited macrophage inflammatory response. [score:3]
Two hundred and ninety three T-cells were cotransfected with a psiChecK-2 vector, the luciferase-wild-type NF-κB1 (p50)-3′-UTR (WT-3′-UTR) or the luciferase mutant (MUT-3′-UTR) report vector, as well as miR-322 mimics or inhibitors. [score:3]
In our preliminary study, miR-322 was predicted to target several sites of inflammatory factors using the software programs. [score:3]
To quantify mature miR-322 expression, a commercial Bulge-Loop™ miRNA quantitative reverse transcription detection method was used with miR-322-specific RT primer (Table 1). [score:2]
miR-322 may be involved in the regulation of LPS -mediated inflammatory response. [score:2]
To test whether miR-322 can directly bind to NF-κB1 (p50) 3′-UTR, we generated a luciferase construct containing the NF-κB1 (p50) 3′-UTR with the predictive miR-322 -binding site. [score:2]
However, the specific mechanisms of miR-322 regulation of cell-cycle procession and cell proliferation remain to be further elucidated. [score:2]
The data revealed that miR-322 may be involved in the regulation of LPS -mediated inflammatory response. [score:2]
Mutant NF-κB1 (p50) 3′-UTR included several mutations in miR-322 -binding sites. [score:2]
In addition, a luciferase construct containing the NF-κB1 (p50) 3′-UTR with a mutation at the putative miR-322 seed sequence was generated as the control construct (Figure 8A). [score:2]
To investigate the involvement of miR-322 on cell-cycle procession in RAW264.7 cells, miR-322 was overexpressed in RAW264.7 cells for 24 h following LPS-stimulation. [score:1]
miR-322 mimics transfection. [score:1]
miR-322 also plays a crucial role in diabetes, male infertility and other biological processes [19, 20]. [score:1]
miR-322 rescues cell-cycle procession in RAW264.7 cells. [score:1]
RAW264.7 cells were transfected with miR-322 mimics or negative control for 24 h and stimulated with LPS for 24 h. Cells were harvested, washed twice in PBS and fixed in 75% ethanol at 4°C overnight. [score:1]
All these findings suggested that miR-322 could promote procession of cell cycle and cell proliferation. [score:1]
As inflammatory response may lead to cell lesions and affect cell proliferation, we wished to further elucidate the effect of miR-322 on RAW264.7 cells proliferation. [score:1]
Figure 5 miR-322 promotes cell cycle process of RAW264.7 cellsRAW264.7 cells were transfected with miR-322 mimics or the negative control for 24 h and then incubated with or without LPS (1 μg/ml) for another 24 h. Cyclin D, cyclin E, P21 and P27 mRNA levels were detected with qPCR. [score:1]
miR-322 levels were detected with qPCR and normalized to endogenous U6. [score:1]
Moreover, the decrease in miR-322 exhibited a dose -dependent manner with LPS stimulation (Figure 3B). [score:1]
miR-322/424 is a member of miR-15/107 family, also known as miR-16 family [16, 17]. [score:1]
miR-322 rescues cell-cycle procession and promotes cell proliferation in RAW264.7 cells. [score:1]
Schematic diagram of miR-322 -binding site in NF-κB1 3′-UTR region by bioinformatics analyses. [score:1]
RAW264.7 cells were transfected with miR-322 mimics or negative control for 24 h and then incubated with LPS at a dose gradient of 0, 0.5, 1.0, 1.5 and 2.0 μg/ml. [score:1]
Figure 4 miR-322 inhibited macrophage inflammatory responseRAW264.7 cells were transfected with miR-322 mimics or the negative control for 24 h and then incubated with LPS (1 μg/ml) for 8 h. (A) miR-322 was measured by qPCR and normalized to endogenous U6. [score:1]
However, until now, the role of miR-322 in inflammatory response remains to be further studied. [score:1]
Figure 7 miR-322 promotes RAW264.7 cells proliferationRAW264.7 cells were transfected with miR-322 mimics or negative control for 24 h and then incubated with LPS at a dose gradient of 0, 0.5, 1.0, 1.5 and 2.0 μg/ml. [score:1]
RAW264.7 cells were transfected with miR-322 mimics or the negative control for 24 h and then incubated with or without LPS (1 μg/ml) for another 24 h. Cyclin D, cyclin E, P21 and P27 mRNA levels were detected with qPCR. [score:1]
Figure 6 miR-322 rescues cell-cycle procession in RAW264.7 cellsRAW264.7 cells were transfected with miR-322 mimics for 24 h, cell-cycle analysis was performed at 24 h after LPS-stimulation. [score:1]
RAW264.7 cells were transfected with miR-322 mimics for 24 h, cell-cycle analysis was performed at 24 h after LPS-stimulation. [score:1]
RAW264.7 cells were cotransfected with psiChecK-NF-κB1 (p50) 3′-UTR (WT–3′-UTR) or psiChecK-NF-κB1 (p50) 3′-UTR mutant (Mut-3′-UTR) along with miR-322 mimics or mimics control, anti- miR-322 or anti- miR-322 control. [score:1]
Besides, LPS -induced cell proliferation repression was rescued by miR-322. [score:1]
miR-322 could promote RAW264.7 cells proliferation (Figure 7). [score:1]
It indicated that LPS -induced cell-cycle repression can be rescued by miR-322. [score:1]
Little is known about the involvement of miR-322 during inflammatory response. [score:1]
Transfection of miR-322 increased S and G [2]/M and decreased the population of cells in G [0]/G [1] (Figure 6). [score:1]
Besides, miR-322 plays a significant role in RAW264.7 cell proliferation. [score:1]
The analysis results revealed that an miR-322 seed sequence was predicted in the NF-κB1 3′-UTR. [score:1]
miR-322 reduced the WT-3′-UTR but not MUT-3′-UTR luciferase levels. [score:1]
These data suggested that miR-322 could promote cell proliferation and arrest cell cycle following LPS-stimulation. [score:1]
miR-322 rescues cell-cycle procession and promotes cell proliferation in RAW264.7 cellsTo investigate the involvement of miR-322 on cell-cycle procession in RAW264.7 cells, miR-322 was overexpressed in RAW264.7 cells for 24 h following LPS-stimulation. [score:1]
miR-322 promotes cell cycle process of RAW264.7 cells. [score:1]
Cells were treated with 1 μg/ml LPS for 8 h. miR-322 levels and the mRNA expression levels of inflammatory cytokines including IL-1β, IL-6, TNF-α and anti-inflammatory cytokines including IL-4 and IL-10 were measured by qPCR. [score:1]
It indicated that miR-322 is involved in RAW264.7 cell proliferation. [score:1]
To further confirm the impact of miR-322 on cell-cycle procession, flow cytometry was applied. [score:1]
miR-322 promotes RAW264.7 cells proliferation. [score:1]
NF-κB1 (p50) and GAPDH were detected by at 48 h after RAW264.7 cells were transfected with miR-322 mimics or mimics control, anti- miR-322 or anti- miR-322 control respectively (E and F). [score:1]
Moreover, miR-322 may promote cell-cycle procession and cell proliferation. [score:1]
Figure 3(A) RAW264.7 cells were incubated with different doses of LPS for 24 h. Total RNA was extracted and miR-322 levels were detected with qPCR and normalized to endogenous U6. [score:1]
[1 to 20 of 97 sentences]
2
[+] score: 207
Our results show that in rat PASMCs all the BMP signaling factors are downregulated in response to hypoxia and miR-322 can affect the proliferation and migration of PASMCs by directly targeting BMPR1a and Smad5. [score:7]
Hypoxia-sensing via HIF-1 upregulates the transcription of miR-322, which then exerts positive feedback by facilitating stabilization of HIF-1α by targeting the molecules involved in its degradation for ubiquitination and degradation 23. [score:6]
Hypoxia upregulates expression of miR-322 in rat PASMC and A7r5 cells. [score:6]
In addition, the reduction or increase of other BMP -associated proteins caused by either overexpression or inhibition of miR-322 is perhaps achieved through an indirect pathway. [score:6]
Hypoxia upregulates expression of miR-322 in lungs and PASMCs. [score:6]
To further assess whether HIF-1α affects the transcription of miR-322, we transfected A7r5 cells with an adenoviral vector expressing modified oxygen dependent degradation domains (ODDD-wt) that express a HIF-1α ODDD domain from amino acids 531 to 575. [score:5]
For miRNA overexpression experiments in rat PASMCs, lentiviral vectors based on pLVX-Puro backbone (Clontech, Mountain View, CA) were used to express miR-322 as described before 22. [score:5]
As shown in Fig. 2c, the expression of miR-322 was upregulated 1.6-fold in hypoxia compared to normoxia. [score:5]
Upper panel: conserved miR-322 binding sites in the 3′-UTR of Smad5 and BMPR1a along with the mutation site; Bottom panel: 3′-UTR luciferase reporter assay with targets and their mutant along with miR-322/miR-Con overexpressing vectors. [score:5]
More importantly, we found that HIF-1α upregulates the transcription of miR-322 by directly binding to the HRE site on its promoter. [score:5]
Among these, miR-322 was found to be significantly upregulated during the course of development of PH 18. [score:5]
As shown in Fig. 4b, cells with miR-322 inhibition (anti-322) exhibited significantly reduced expression in miR-322 compared to its control cells (anti-Con). [score:4]
To confirm that the regulation of miR-322 on cell proliferation and migration is achieved by targeting BMPR1a and Smad5, we carried out the following rescue experiments. [score:4]
This indicates that the HRE site within the miR-322 promoter is required for HIF-1α -induced upregulation in hypoxia. [score:4]
In this study, we have elucidated a possible mechanism by which miR-322 is upregulated in PASMCs during hypoxia. [score:4]
As shown in Fig. 7d, the proliferation and migration of rat PASMCs, which were blocked by miR-322 inhibition (anti-322 and si-Con), were significantly increased by either BMPR1a or Smad5 knockdown (si-BMPR1a or si-Smad5 together with anti-Con). [score:4]
Luciferase reporter assays with transfected 3′-UTR sequences along with miR-322 or miR-Con overexpressing vectors showed that only BMPR1a and Smad5 were repressed by miR-322 overexpression (Fig. 7b). [score:4]
Knockdown of miR-322 was achieved by using dTuD constructs against mature rno-miR-322, which was modified from TuD vector 39 with one more TuD expression cassette. [score:4]
Additional 3′-UTR mutation assays validated that miR-322 can directly target the predicted binding sites on the 3′-UTR of BMPR1a and Smad5 (Fig. 7c). [score:4]
Left: representative western blot for hypoxia -dependent decrease of BMP signaling factors; Middle and right: Overexpression/ knockdown of miR-322 altered the protein level of factors in BMP signaling. [score:4]
The results showed that the expression of miR-322 and miR-351 was increased significantly with the duration of hypoxia exposure (Fig. 1b). [score:3]
Next we determined whether hypoxia -induced expression of miR-322 in rat lung and in vitro cultured PASMCs parallels the mouse lung miRNA profile. [score:3]
Here, we confirmed the hypoxia -induced increase in expression of miR-322 in rat PASMCs, highlighting miR-322 as the functional hypoxamirs in PASMCs. [score:3]
Since HIF-1 and -2 mediate most of the cellular responses to hypoxia, we hypothesized that the hypoxia -induced increase in expression of miR-322 is HIF-related. [score:3]
Therefore, we determined whether manipulating miR-322 expression could affect the levels of HIF-1α in rat PASMCs. [score:3]
were transfected with recombinant lentiviral particles expressing miR-322 (miR-322) or control lentiviral vector (miR-Con), or with lentivirus of dTud construct against mature miR-322 (anti-322) or scramble control vector (anti-Con). [score:3]
While, together transfection with si-BMPR1a or si-Smad5 almost completely rescued the proliferative and migratory repression caused by miR-322 inhibition. [score:3]
We further tested the roles of HIF-1α and -2α in regulation of miR-322 promoter activity using a gene knockdown approach. [score:3]
Western blot showed that the accumulation of HIF-1α increased in the nucleus when overexpressing miR-322 in normoxia (Fig. 4c). [score:3]
As shown in Fig. 3c, shRNA targeting of HIF-1α almost completely abolished the activation of miR-322 promoter reporter induced by CoCl [2], but HIF-2α silencing had no effect. [score:3]
How to cite this article: Zeng, Y. et al. Hypoxia inducible factor-1 mediates expression of miR-322: potential role in proliferation and migration of pulmonary arterial smooth muscle cells. [score:3]
Notably, the protein levels of BMPR1a, BMPR2, Smad5 and ID2 were decreased in miR-322 overexpressing cells under normoxia (Fig. 7a, middle panel). [score:3]
As shown in Fig. 3e,f, qRT–PCR and western blotting revealed that the endogenous expression levels of miR-322 also dramatically increased with HIF-1α accumulation. [score:3]
In these cells miR-322 expression was increased about 2.2-fold in hypoxia. [score:3]
The influence on the miR-322 promoter reporter activity (d) and the endogenous expression levels (e) of miR-322 were determined by real-time PCR. [score:3]
were transfected with recombinant lentivirus expressing miR-322 (miR-322), or no miRNA sequence as a negative control (miR-Con). [score:3]
These results suggest that hypoxia -induced miR-322 may play a regulatory role in PASMC proliferation and migration via the BMP signaling pathway. [score:2]
This indicates a positive feedback loop regulation between HIF-1α and miR-322 in pulmonary arterial smooth muscle cell, as shown in Fig. 8. However, HIF-2α seems not to be participating in this network. [score:2]
miR-322 is transcriptionally regulated by HIF-1α. [score:2]
qRT-PCR revealed an over 12-fold increase in miR-322 in the cells overexpressing miR-322 compared with control cells (Fig. 4b). [score:2]
Altogether, the results above demonstrated that miR-322 is transcriptionally regulated by the hypoxia-responsive factor HIF-1α in hypoxia. [score:2]
miR-322 regulates BMP mediated signaling. [score:2]
To understand if the effect of miR-322 on BMP signaling is direct, we searched for potential binding sites on the 3′-UTR of the above proteins. [score:2]
Taken together these results indicate that hypoxia -induced miR-322 is involved in regulating the stability of HIF-1α in PASMCs. [score:2]
Dysregulation of BMP signaling by increased miR-322 promotes the proliferation and migration of PASMCs. [score:2]
Validation of miR-322 targets was carried out using a 3′ UTR activity assay with a similar firefly/renilla luciferase reporter system (Promega, Madison, WI). [score:2]
were also transfected with dTud constructs for miR-322 knockdown studies. [score:2]
And they were all increased by miR-322 knockdown (Fig. 7a, right panel). [score:2]
To understand the consequences of increased miR-322 in hypoxia, we investigated the effects of miR-322 overexpression and knockdown on the proliferation and migration in rat PASMCs. [score:2]
were transduced with shRNA targeting HIF-1α (shHIF-1α) or HIF-2α (shHIF-2α) and miR-322 promoter activity was determined in the luciferase reporter assay after transfection of wild type and mutant constructs and CoCl [2] treatment (left panel) as described under Methods; Control (sh-Con) or HIF-1α/-2α shRNA -transfected cells were harvested for protein analysis by western blot to determine knockdown specificity (right panel); *p < 0.05 compared with sh-Con. [score:2]
Taken together these results confirm that the positive role of miR-322 on PASMCs proliferation and migration could be fulfiled by post-transcriptionally regulating BMPR1a and Smad5. [score:2]
Using chromatin immunoprecipitation (ChIP) assay, we determined the binding of HIF-1α to the miR-322 promoter with and without CoCl [2] treatment or with ODDD-wt/-mut overexpression. [score:2]
Mo del depicting the regulation of miR-322 in PASMCs response to hypoxia. [score:2]
Knockdown of miR-322 abolished the stabilization of HIF-1α in PASMCs under hypoxic condition (Fig. 4c). [score:2]
The ChIP assays indicated that HIF-1α directly binds to the HRE site on the miR-322 promoter in vitro. [score:1]
As shown in Fig. 2a, miR-322 level in rat lungs was increased about 2-fold after 3-weeks hypoxic treatment. [score:1]
We constructed both wild and HRE-mutant promoter -driven luciferase reporter plasmids (pGL4-P1k and pGL4-P1km, respectively) and transfected A7r5 cells to determine whether HIF-1/2α influences the miR-322 promoter activity. [score:1]
miR-322 facilitates stabilization of HIF-1α. [score:1]
miR-322 promotes migration of PASMCs. [score:1]
Hypoxia induces miR-322 promoter activity in a HIF-1α -dependent manner. [score:1]
Ghosh et al. have demonstrated that the human homolog of miR-322, has-miR-424, specifically increased in endothelial and vascular smooth muscle cells, but not in tumor cell lines, in response to hypoxia 23. [score:1]
We also measured protein levels of these molecules involved in BMP signaling after overexpressing or silencing miR-322. [score:1]
Taken together these data demonstrate that hypoxia -induced miR-322 can promote migration of PASMCs. [score:1]
We searched for hypoxia-responsive elements (HRE) in the putative promoter sequence, 1000 bp upstream from the rat pre-miR-322. [score:1]
As shown in Fig. 5a, stable overexpression of miR-322 significantly accelerated the proliferation rate of PASMCs compared to its control cells both under normoxia and hypoxia by MTS assay. [score:1]
As shown in Fig. 6, the decrease in the width of the scratched wound was larger (~ 60%) in miR-322 transfected cells than in control cells after 24 h (Fig. 6a,b), and knockdown of miR-322 led to a slower decrease in wound healing compared with anti-Con transfection (~ 40%) after 24 h (Fig. 6c,d). [score:1]
All these data emphasize that miR-322 may affect the BMP signaling pathway to exert their pro-proliferation and pro-migratory activities in PASMCs. [score:1]
Luciferase activities were measured at 48 h after cotransfecting with the 3′-UTR constructs and the miR-322 overexpressing vectors or its vector control. [score:1]
In this study, we found that miR-322 can also stimulate the accumulation of HIF-1α in PASMCs. [score:1]
org), putative seed match of miR-322 was predicted within the 3′- UTR of BMPR-2, BMPR1a, Smad5, and Smad4. [score:1]
miR-322 stimulates the accumulation of HIF-1α. [score:1]
miR-322 is induced by hypoxia in mouse lung. [score:1]
These data indicate that miR-322 can significantly accelerate the proliferation of PASMCs. [score:1]
The results show that the native promoter but not the mutant promoter of miR-322 was activated by CoCl [2] (Fig. 3b). [score:1]
The relative levels of miR-322 was estimated by real-time PCR. [score:1]
Our data show that miR-322 promotes the proliferation and migration of rat PASMCs both under normoxia and hypoxia. [score:1]
miR-322 promotes proliferation of PASMCs. [score:1]
Ghosh et al. have reported that human miR-424, the homolog of rodent miR-322, stabilizes HIF-1α leading to its accumulation in the nucleus in human umbilical vein endothelial cells (HUVEC) 23. [score:1]
miR-322 promotes hypoxia -induced proliferation and migration in PASMCs. [score:1]
miR-322 participates in hypoxia -mediated BMP signaling. [score:1]
[1 to 20 of 80 sentences]
3
[+] score: 99
The data -driven integration of target prediction and paired mRNA/miRNA expression profiling data revealed that i) the quantity of predicted miRNA-mRNA relations was reduced, ii) miRNA targets with a function in cell cycle and axon guidance were enriched, iii) differential regulation of anti-differentiation miR-155-5p and miR-29b-3p as well as pro-differentiation miR-335-3p, miR-335-5p, miR-322-3p, and miR-322-5p seemed to be of primary importance during skeletal myoblast differentiation compared to the other miRNAs, iv) the abundance of targets and affected biological processes was miRNA specific, and v) subsets of miRNAs may collectively regulate gene expression. [score:12]
In addition, we corroborated the expression of myoblast differentiation promoting miRNAs, such as miR-322-3p, miR-322-5p, miR-335-3p, and miR-335-5p, which were among the miRNAs showing the highest number of inversely associated targets and transcription factors as well as the highest degree of cooperative target regulation. [score:8]
In contrary, it has been reported that miR-322-5p and miR-503 were induced during myogenesis and promoted cdk2 inhibition by down -regulating Cdc25A, the phosphatase responsible for removing inhibitory phosphorylation of cdk2 [60]. [score:6]
Latter could be explained by studies showing that miR-322-5p expression was inhibited by NF kappa B activity [66]. [score:5]
All of the twelve selected miRNAs had at least more than 10 targets involved in cell cycle regulation but miR-322-5p and miR-322-3p appeared to be the dominating miRNAs involved in regulation of this pathway. [score:5]
A study by Dmitriev et al. [37], which used integrative analysis of mRNA and miRNA expression data during human myoblast differentiation, did not identify differential regulation of miR-335 or miR-322 (miR-424 in human). [score:4]
Furthermore, our data showed that inversely associated miR-322-3p targets were involved in the regulation of, for example, cell cycle, cancer or ataxia telangiectasia. [score:4]
Consistent with our findings, miR-322-5p was upregulated in anti-inflammatory drug treated myotubes in a mo del of dexamethasone induced muscle atrophy [68]. [score:4]
In contrast to anti-myogenic miR-155-5p and miR-29b-3p, the pro-myogenic miR-322-3p, miR-322-5p, miR-335-3p, and miR-335-5p were involved in down-regulation of, for example, cell cycle or growth related pathways. [score:4]
However, in other inflammatory contexts, such as TWEAK treatment of myotubes, miR-322-5p was upregulated [67]. [score:4]
In addition to that, some genes such as Wee1, Chek1, Cdc6, Ccna2, and Ccnd1 were associated with several enriched pathways (S2A Table) and were predicted to be targeted by several inversely regulated miRNAs including foremost miR-322-5p, miR-206, and miR-503. [score:4]
Moreover, we confirmed targets of miR-322-5p in myoblast differentiation which have been published in other tissues and cell types including Chk1 [61], Wee1 [62], cyclin D1 [64], and cyclin E1 [65]. [score:3]
MiR-335-3p, miR-322-5p, and miR-322-3p had the highest number of targeted and inversely associated genes and transcription factors (Fig 4A and 4B). [score:3]
Moreover, miR-322-5p showed a remarkable overrepresentation of targets involved in cell division -associated pathways such as cyclins A2, B1, and D1 as well as cyclin dependent kinase, as well as cell division cycle 2 and 25c (S6C Table). [score:3]
MiRNAs which mainly participated in collective gene targeting were miR-335-3p, miR-322-5p, and miR-322-3p (Fig 5C). [score:3]
Furthermore, kinase activity was predominantly targeted by miR-322-5p. [score:3]
Thus, miR-322-3p and miR-503-5p targeted a similar spectrum of pathways in skeletal muscle differentiation. [score:3]
Thereby, we enlarged the list of highly potential targets of miRNAs implicated in skeletal myoblast differentiation foremost miR-155, miR-206, miR-322-3p/-5p, miR-335-3p/-5p, miR-351, and miR-532-3p/-5p. [score:3]
In addition, our data revealed a negative impact of TNF-α exposure on the expression of pro-differentiative miR-322-3p. [score:3]
Particularly, miR-335-3p, miR-322-5p, and miR-322-3p predominated collective regulation of genes including transcription factors. [score:2]
MiR-322-5p, miR-335-3p, and miR-322-3p were primarily involved in the concerted regulation of transcription factors (Figs 5D and 6A). [score:2]
MiR-322-3p targets had a function, for example, in cancer-related pathways, cell division cycle, ataxia telangiectasia and Rad3 related, and tumor protein p53 (Tp53) (S6B Table). [score:2]
We showed that Cdc25A was associated with cyclin signaling, cell division cycle, and cyclin dependent kinase pathways which is in harmony with studies in other cell types describing a role of miR-322-5p in the regulation of the cell cycle and cell growth [61– 63]. [score:2]
In summary, we presented several new inversely associated genes of for example miR-335-3p, miR-335-5p, miR-322-3p, and miR-322-5p with emphasis on the regulation of the cell cycle-related pathways. [score:2]
However, inverse association of miR-322-5p and protein level but not mRNA abundance of cyclin E1 was observed [65]. [score:1]
S6 TableEnrichment analysis of signal transduction pathway associations of (A) miR-206-3p, (B) miR-322-3p, (C) miR-322-5p, (D) miR-335-3p, (E) miR-335-5p, (F) miR-351-5p, (G) miR-503-5p, (H) miR-133a-3p/miR-133b-3p, (I) miR-155-5p. [score:1]
We corroborated inverse association of Cdc25A and miR-322-5p. [score:1]
Thus, our data affirmed that miR-322-5p was sensitive to pro-inflammatory stimuli in the context of skeletal muscle. [score:1]
These findings provide new indications into the biological function of miR-322-3p as there have been no explicit functional studies on miR-322-3p in muscle cells yet. [score:1]
[1 to 20 of 29 sentences]
4
[+] score: 95
Therefore, we explored if the STAT1 over -expression was linked to the downregulation of miR-29a/b or upregulation of miR-322. [score:9]
Integrating changes in mRNA and miRNA expression, we found that interferon signaling is critical to the downregulation of miR-29a/b and upregulation of miR-322. [score:9]
We had noticed that the mRNA and miRNA dysregulation, be it induction of STAT1 or miR-322 and downregulation of miR-29a/b, were all reverted to normal levels following a change of media, suggesting that a secreted factor is responsible for the mRNA and miRNA expression changes. [score:7]
Besides the downregulation of miR-29a/b, we have also shown that miR-322 was upregulated concomitantly [13]. [score:7]
Stat1 knockdown (by Control or Stat1 siRNA) and over -expression (by Vector or Stat1-pEGFP-N3) has no significant effect on expression of miR-322 (d) Next we sought to identify events upstream to STAT1 induction in polyglutamine-TBP mediated miRNA dysregulation. [score:7]
c Stat1 over -expression leads to decrease in miR-29a/b expression (n = 3; ** p value ≤0.01) We have previously reported that miR-322 was induced in polyglutamine-TBP expressing cells [13]. [score:7]
We found that mmu-miR-29a/b was downregulated following IFN-γ treatment while mmu-miR-322 was upregulated (Fig. 4a). [score:7]
Although polyglutamine-TBP and IFN-γ treatment independently led to the induction of miR-322 (Fig. 5c), over -expression and knockdown of STAT1 had no effect on miR-322 expression (Fig. 5d) in the cells, even when done in the background of TBP-59Q and TBP-16Q (Average fold change = 1.01 ± 0.18; p value = 0.9). [score:6]
The interferon signaling also leads to the upregulation of miR-322, another dysregulated miRNA in polyglutamine-TBP cells, but this is independent of STAT1. [score:5]
Over -expression and knockdown of Stat1, miR-322. [score:4]
Interferon-gamma also led to upregulation of miR-322 although this effect is not mediated through STAT1. [score:4]
Besides miR-29a/b, we show that the IFN-γ mediated signaling also resulted in upregulation of miRNA, miR-322 through a STAT1 independent mechanism. [score:4]
We found that the over -expression of miR-322 resulted in elevated caspase 3 activity and cytochrome c release indicating increased apoptosis (Fig. 5a, b). [score:3]
Fig. 5miR-322 over -expression can induce apoptosis in Neuro-2a cells: (a) The caspase-3 activity in Neuro-2a cells transfected with vector (control) or miR-322 clone (miR-322) was monitored at the time indicated (24, 36, 60 h post transfection). [score:3]
a Neuro-2a cells treated with IFN-γ (100 units/ml) induced mmu-miR-322 and repressed mmu-miR-29a/b expression. [score:3]
To test if miR-322 affects apoptotic cell death triggered by polyglutamine toxicity, we cloned and over-expressed the pre-miR-322. [score:3]
On the other hand, interferon -mediated upregulation of miR-322 did not require STAT1, implying that further investigation will lead to identification of other key players in pathways connecting polyglutamine toxicity and the role of miRNAs in neuronal apoptosis. [score:2]
BB participated in the molecular genetic studies on miR-322. [score:1]
AB participated in the molecular genetic studies on miR-322 and helped to draft the manuscript. [score:1]
We reasoned that IFN -mediated induction of miR-322 was not mediated through STAT1. [score:1]
This was also corroborated by the absence of GAS sites upstream to miR-322. [score:1]
AC carried out molecular genetic studies on miR-322. [score:1]
[1 to 20 of 22 sentences]
5
[+] score: 55
Other miRNAs from this paper: mmu-mir-144, mmu-mir-451a, mmu-mir-503, mmu-mir-451b
As the KO allele carries a LacZ expression cassette upstream of the coding sequence of miR-322 and miR-503 (“knockout first”), β-galactosidase serves as the reporter of miR-322 and miR-503 expression. [score:6]
In our study of miR-322/503’s function in embryo development [9– 11], we used β-galactosidase as a reporter in a “knockout first” mouse strain in which the LacZ expression cassette is inserted upstream of the miR-322/503-encoding sequence [12]. [score:5]
In order to appreciate the expression patterns of miR-322/503 during embryogenesis, we employed a “knockout first” allele in which the LacZ reporter cassette was inserted upstream of the miR-322 stemloop. [score:4]
In our study of miR-322/503 expression pattern in E8.5 embryos, X-gal/FeCN showed extremely weak signals, while S-gal/TNBT displayed diffuse staining. [score:3]
Since miR-322/503 was highly enriched in Mesp1+ cardiac mesoderm cells, we expected specific expression in cardiac related structures, such as the crescent. [score:3]
Chiefly, miR-322/503 is enriched in Mesp1+ early mesoderm cells, suggesting that it is expressed as early as E6.25 [13– 15]. [score:3]
Half of the embryos are expected to be heterozygous knockout female mice (miR-322/503 [-/+]) and also LacZ positive. [score:2]
Heterozygous female knockout embryos (miR-322/503 [-/+]) were generated by mating the miR-322/503 [-/Y] mice with wildtype female Swiss (SW) mice. [score:2]
As neither miR-322/503 [-/Y] nor miR-322/503 [-/+] animals showed developmental defects, we bred miR-322/503 [-/Y] male with wildtype female SW mice, and predicted that the genotypes of E8.5 embryos obey the Men delian ratio, which is 50% LacZ positive. [score:2]
0176915.g001 Fig 1Schematic diagram of the miR-322/503 knockout locus and the mating schedule. [score:2]
Mirc24 [tm1Mtm]/ Mmjax, the “knockout first” mouse strain of miR-322 and miR-503, was obtained from the Jackson Laboratory (Stock No: 017513) [12]. [score:2]
With the X-gal/FeCN assay, we could not detect any signals in E8.5 embryos, although RT-PCR results support that miR-322/503 was expressed (Fig 2A and not shown). [score:2]
Next, miR-322/503 [-/+] mice were mated with wildtype male B6;129 mice to generate hemizygous male knockout mice (miR-322/503 [-/Y]). [score:2]
The male Mirc24 [tm1Mtm]/ Mmjax mice were mated with the female Tg(Sox2-Cre) mice to generate female heterozygous knockout mice (miR-322/503 [-/+]) of miR-322 and miR-503 (Fig 1). [score:2]
Schematic diagram of the miR-322/503 knockout locus and the mating schedule. [score:2]
Comparing the X-gal/FeCN and S-gal/TNBT methods in staining miR-322/503- LacZ positive E8.5 embryos. [score:1]
Our previous work established that miR-322/503 specifically drove the cardiomyocyte and skeletal muscle lineages [9], therefore, we chose to test E10.5 embryos in which both the heart and somites are readily distinguishable. [score:1]
In summary, a new procedure comprising sequential X-gal/FeCN and S-gal/TNBT chromogenic staining had high specificity and low background in miR-322/503- LacZ staining in E8.5 embryos. [score:1]
Verification of the improved method in E10.5 miR-322/503- LacZ embryos. [score:1]
We have established that the miR-322/503 cluster plays an important role in early cardiac fate specification [9]. [score:1]
0176915.g004 Fig 4Verification of the improved method in E10.5 miR-322/503- LacZ embryos. [score:1]
Our previous work has showed that miR-322/503 was the most enriched miRNAs in Mesp1-lineage marked cells; and Mesp1-lineage marked cells populate the craniofacial mesoderm and arches. [score:1]
S1 FigNegative controls of optimization in E8.5 miR-322/503- LacZ embryos. [score:1]
We selected the one (dotted-box) with the miR-322/503 stemloop ablated to carry out further mating and named it “ miR-322/503 KO”. [score:1]
Optimization of β-galactosidase staining in E8.5 miR-322/503- LacZ embryos. [score:1]
0176915.g003 Fig 3Optimization of in E8.5 miR-322/503- LacZ embryos. [score:1]
0176915.g002 Fig 2Comparing the X-gal/FeCN and S-gal/TNBT methods in staining miR-322/503- LacZ positive E8.5 embryos. [score:1]
Negative controls of β-galactosidase staining optimization in E8.5 miR-322/503- LacZ embryos. [score:1]
[1 to 20 of 28 sentences]
6
[+] score: 47
Mmu-miR-322-5p was downregulated in Sca-1 [+]CD31 [−] cells compared to Sca-1 [+]CD31 [+] cells with overrepresentation of targets involved in cell division -associated pathways such as cyclins A2, B1, and D1, cyclin -dependent kinase, and cell division cycle 2. MiR-322-5p is reported to be induced during myogenesis and to promote cdk2 inhibition by downregulating Cdc25A, the phosphatase responsible for removing inhibitory phosphorylation of cdk2 [27]. [score:12]
Dclk1 was the target of mmu-miR-15a-5p, Slit2 was the target of mmu-miR-322-5p, Ctgf and Notch2 were targets of mmu-miR-18a-5p, and Mgp was the target of mmu-miR-155-5p. [score:9]
Mmu-miR-322-5p was overrepresented for targets involved in cell division -associated pathways such as cyclins A2, B1, and D1, cyclin -dependent kinase, and cell division cycle 2. Analysis of the inversely associated interaction relationship pairs showed that mmu-miR-322-5p was decreased with targets that increased Adamts5, Adamtsl3, Arhgap20, Cacna2d1, Cdon, Dclk1, Fgfr1, Has2, Islr, Slit2, and Sobp; of these, Cacna2d1 was involved in the MAPK signaling and hypertrophic cardiomyopathy pathways and Fgfr1 was involved in p53, PI3K-Akt, and Ras signaling. [score:5]
Studies have confirmed targets of miR-322-5p in myoblast differentiation including Chk1, Wee1, cyclin D1, and cyclin E1 in other tissues and cell types [32]. [score:3]
Mmu-miR-322-5p had more targeted and inversely associated genes and transcription factors and might have higher potential for involvement in CSC/CPCs differentiation. [score:3]
Mmu-miR-322-5p and mmu-miR-505-5p had more targeted and inversely associated genes and transcription factors (Table 3). [score:3]
Mmu-miR-322-5p, mmu-miR-20a-5p, mmu-miR-15a-5p, mmu-miR-503-3p, and mmu-miR-204-5p were decreased in expression in Sca1 [+]CD31 [−] cells. [score:3]
In addition, we corroborated the expression in Sca-1 [+]CD31 [−] cells of differentiation promoting-miRNAs mmu-miR-322-5p, mmu-miR-505-5p, mmu-miR-18a-5p, and mmu-miR-139-5p. [score:3]
This finding indicates that miR-322-5p participates in the regulation of the cell cycle, cell growth, and differentiation. [score:2]
Mmu-miR-322-3p/5p, mmu-miR-155-5p, mmu-miR-204-5p, mmu-miR-10a-5p, and mmu-miR-125b-5p participated in cell differentiation, cell cycle, and stem cell differentiation (Figure 3). [score:1]
Mmu-miR-322-5p had decreased regulation in Sca-1 [+]CD31 [−] compared to Sca-1 [+]CD31 [+] cells. [score:1]
We corroborated inverse association of Adamts5, Adamtsl3, Cdon, Dclk1, Fgfr1, Has2, Islr, Slit2, Sobp, and Arhgap20 with miR-322-5p. [score:1]
The miRNAs were mmu-miR-125b-5p, mmu-miR-34c-5p, mmu-miR-199b-5p, mmu-miR-379-5p, mmu-miR-127-3p, mmu-miR-322-5p, mmu-miR-20a-5p, mmu-miR-15a-5p, mmu-miR-503-3p, and mmu-miR-204-5p. [score:1]
[1 to 20 of 13 sentences]
7
[+] score: 40
miR-21 was also reported to be up-regulated in squamous cell carcinoma [55] while miR-127, miR-322 and miR-146b are up-regulated during fetal lung development [56], [57]. [score:8]
Moreover, miR-96, miR-183, miR-322 were significantly up-regulated in male c-Raf mice. [score:4]
Differential miRNA expression was examined by quantitative real time PCR (qRT-PCR) of the eight regulated miRNAs (miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322, miR-433). [score:4]
The gender bias for miR-183 and miR-322 was not confirmed, but the two miRs were up-regulated in all transgenic animals. [score:4]
0078870.g002 Figure 2 Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
0078870.g005 Figure 5The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
miR-322, miR-127, and miR-433 are regulated similarly in organ and tumor development. [score:3]
Specifically, with the Agilent platform a significant regulation of miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322 was observed whereas for the Affymetrix platform significant regulation of miR-127 and miR-433 could only be evidenced. [score:3]
Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
3) 55.6 AACCCATGGAATTCAGTTCTCA −26.0 59.5 −20 54.0 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU 40 AGCCTATGGAATTCAGTT(C) (−21.5) 41.5 AGCCTATGGAATTCAGTTCTCA −26.2 47.4 −20.2 39.2 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG 48 CGGTGTGAGTTCTAC(C) (−19.9) 62.9 CGGTGTGAGTTCTACCATTGCCAAA −31.9 62.9 −17 58.8 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU 40 AGTGAATTCTACCAGTGC(C) (−23.2) 44.7 AGTGAATTCTACCAGTGCCATA −26.3 46.3 −20.3 40.0 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU 50 ACCCTTATCAGTTCTCCGTCC(A) (−31.9) 57.0 ACCCTTATCAGTTCTCCGTCCA −31.9 57.0 −30.3 56.2 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA 40 TCCAAAACATGAATTGCTGCTG −23.1 37.7 TCCAAAACATGAATTGCTGCTG −23.1 37.7 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU 54 ACACCGAGGAGCC(C) (−20. [score:1]
[1 to 20 of 12 sentences]
8
[+] score: 25
The vast increase in abundance of adenylated mir322 5′ leader sequences in mMtr4KD relative to the mControlKD, along with a modest 6-fold increase in transcripts adenylated at the annotated 3′ end of the full length RIKEN cDNA, might reflect increased expression of mir322. [score:3]
To determine whether the mMtr4KD causes differential expression or accumulation of mir322, we employed a TaqMan miRNA assay to quantify the relative levels of the mature mir322-5p microRNA in mMtr4KD and mControlKD RNAs. [score:2]
Analyses in three biological replicates suggest that mature mir322 levels may fluctuate in either direction by as much as two fold in the mMtr4KD and mControlKD, but that no consistent trend exists (Table S2). [score:2]
Abundant PA-seq reads map near mir322. [score:1]
Consistent with the existence of two RIKEN cDNAs at this locus, our data also indicate there are two outcomes of transcription starting at the 5′ end of this genomic locus; one transcription unit which includes the miRNA322, 503 and 351 cluster and a shorter one that does not include the miRNAs. [score:1]
Similar to mir322, mir106b is the 5′ most microRNA within the mir106b-mir93-mir25 cluster, which is located within intron 13 of the Mcm7 gene. [score:1]
Consistent with this observation, miR322 is the 5′ most member of its microRNA cluster. [score:1]
Although we cannot completely rule out that the mir322-mir503-mir351 cluster is more actively transcribed upon mMTR4 depletion, even a 2-fold increase would seem too small to explain the large, 67-fold increase in adenylated mir322 5′ leader by a mechanism of increased transcription alone. [score:1]
In a related experiment, detected a modest increase in the mir322 5′leader and annotated 3′ end of RIKEN-C43009B03RIK cDNA in N2A cells depleted for the exonuclease mRrp6 (data not shown/unpublished). [score:1]
The above analyses identified two significant peaks of adenylation on chromosome X corresponding to a full length non-coding cDNA (RIKEN-C43009B03RIK) containing a miRNA cluster (mir322-mir503-mir351). [score:1]
The top diagram shows the mir322 - mir503 – mir351 cluster and associated RIKEN transcripts on chromosome X. Note that the chromosomal orientation has been reversed such that the mm9 chromosomal coordinates are in decreasing order from left to right because the transcripts are on the minus strand. [score:1]
0099430.g005 Figure 5 Abundant reads map near mir322. [score:1]
Both mir322 and let7 are relatively ubiquitous across a wide range of tissues, and among the most abundant microRNAs detected [84]– [86]. [score:1]
Strikingly, the substantial cluster of adenylated RNAs around the 5′ end of mir322 is notably absent in the mControlKD (Fig. 5 ). [score:1]
Adenylated transcripts associated with the mir322 host gene accumulate in the mMtr4KD. [score:1]
We used the same RNA samples used to generate the data, and focused on mir322, mir503, let7b, let7c2 and mir138-1. qRT-PCR analysis of miRNA 5′ leader sequences was analyzed relative to qRT-PCR that spans the junction between the 5′ leader and the pre-miRNA (as depicted by representative amplicons 1 and 2 in Fig. 6A ). [score:1]
qRT-PCR results support accumulation of the miRNA 5′ leader relative to the pri-miRNA for mir322, let7b and mir138-1 (Figure 6B ). [score:1]
Table S2 Mature mir322 levels exhibit no consistent fluctuations in mMtr4 depleted cells. [score:1]
Adenylated transcripts associated with the mir322 host gene accumulate in the mMtr4KDThe above analyses identified two significant peaks of adenylation on chromosome X corresponding to a full length non-coding cDNA (RIKEN-C43009B03RIK) containing a miRNA cluster (mir322-mir503-mir351). [score:1]
In the case of mir322, the 3′ fragment will contain two additional microRNAs, mir503 and mir351, which may subsequently influence the fate of that fragment (discussed below). [score:1]
Distribution of the mMtr4KD peaks reveal three prominent areas of adenylation in this region of chromosome X: 1) at the 3′ annotated end of cDNA C43009B03RIK, 2) a loose clustering near the 3′ annotated end of a shorter RIKEN cDNA AK021262 that encodes a hypothetical 92aa protein but does not include the miRNA cluster, and 3) at mir322 (Fig. 5 ). [score:1]
[1 to 20 of 21 sentences]
9
[+] score: 20
The B. is showing the expression pattern of miRNAs miR-31-5p, miR-196-5p, miR-127-3p, miR-206-3p, miR-411-5p, miR-709-5p, and miR-322-5p in UVR -induced SCC samples from wild type FVB mice. [score:3]
Some of the miRNAs were significantly down-regulated [miR-196a-5p (p=0.05), miR-709-5p (p=0.003), miR-206-3p (0.001), miR-411-5p (p=0.03)] along with others miR-127-3p, miR-322-5p in UVR -induced SCC samples (n=3) compared to the uninvolved skin (n=3) (Figure 2B). [score:3]
The expression patterns of miR-31-5p, miR-127-3p, miR-411-5p, miR-322-5p, miR-709, and miR-379-5p were similar to the microarray results in our profiling study among four mice groups namely WT, WT + UVR, TNFα KO, and TNFα KO+UVR following acute UVR treatment (Figure 2A). [score:3]
We found that a minimum of 12 to a maximum of 613 genes were targeted by miRNAs namely miR-127-3p and miR-322-5p respectively (Tables 1, 2, 3, 4). [score:3]
A. is showing the real time expression pattern of miR-31-5p, miR-127-3p, miR-411-5p, miR-322-5p, miR-709, and miR-379 in WT, WT + UVR, TNFα KO and TNFα KO + UVR mice. [score:3]
Figure 2 A. is showing the real time expression pattern of miR-31-5p, miR-127-3p, miR-411-5p, miR-322-5p, miR-709, and miR-379 in WT, WT + UVR, TNFα KO and TNFα KO + UVR mice. [score:3]
We also observed the suppression of miRNAs in SCC samples compared to uninvolved mice skin for miR-195-5p, miR-127-3p, miR-206-3p, miR-411-5p, miR-709-5p, and miR-322-5p. [score:2]
[1 to 20 of 7 sentences]
10
[+] score: 18
In our data, VEGF, ECAM1 and numerous genes involved in angiogenesis were down-regulated, as well as angiogenic signaling mediators PI3K, p85 and Akt-1. Among these genes, our data suggest that the expression of PECAM1 was regulated by let-7i, miR-322 and miR-497, and the expression of VE-cadherin and β-cadherin regulated by miR-27a. [score:10]
When relative expression levels are known, an asterisk following the name indicates a miRNA expressed at low levels relative to the miRNA in the opposite arm of a hairpin, for example, miR-322 and miR-322* would share a pre-miRNA hairpin, but more miR-322 would be found in the cell [24]. [score:5]
In Group A, the expression values of four miRNA were decreased (Pattern 1; miR-322*, miR-411, miR-431, miR-609) and three were increased (Pattern 2; miR-146b, miR-29a, miR-29c). [score:3]
[1 to 20 of 3 sentences]
11
[+] score: 18
In our study, the expression of miR-322-5p and miR-378b was down-regulated at a field intensity of 3 mT, and this might upregulate the expression of Ccnd2, Whose aberrant expression could lead to abnormal cell proliferation. [score:13]
Ccnd2, a cell-cycle associated gene, is a potential target of miR-322-5p, miR-328-5p, miR-378b, miR-669b-5p and miR–206, whose expression are altered by exposure to ELF-EMFs [40, 41]. [score:5]
[1 to 20 of 2 sentences]
12
[+] score: 14
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 In order to understand the interaction between different genes, we generated common networks using Ingenuity Pathway Analysis (IPA) software. [score:4]
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 A) C2C12 myotubes were treated with 10ng/ml of TWEAK for 18h following isolation of total RNA enriched with small RNAs. [score:4]
TWEAK increased the expression of miR-715, miR-146a, miR-455, miR-322, mir-98, and miR-470 in C2C12 myotubes. [score:3]
Moreover, TWEAK also significantly increased the expression of miR-715, miR- 146a, miR-455, miR-322, mir-98, and miR-470 in TWEAK -treated C2C12 myotubes (Figure 3B). [score:3]
[1 to 20 of 4 sentences]
13
[+] score: 14
According to previous studies in cancer (MCF-7) cells EGCG up-regulates the expression of miR-16, a member of the miR-15b family (family of miR-16/miR-15a/miR-497/miR-322/miR-195) and consequently, EGCG down-regulates Bcl-2 expression level and thus counteracts cancer progression [25]. [score:11]
A. Cartoon showing the murine mmu-miR-15b (family of miR-16/miR-15a/miR-497/miR-322/miR-195) with STIM2 3’-untranslated region (3’-UTR) with seed sequence. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
15
[+] score: 13
The KEGG pathway annotation of all the target genes of the miRNAs is shown in Table 3. Among the targets for differentially expressed miRNAs in liver of M. fortis, miR-705 and miR-322 had important roles in the immune reaction (involved in the neurotrophin signaling pathway, chemokine signaling pathway and B cell receptor signaling pathway in miR-705) and metabolism (associated with inositol phosphate metabolism and the phosphatidylinositol signaling system in miR-322). [score:7]
Among the targets for differentially expressed miRNAs in lung of M. fortis, miR-466j, miR-322, miR-34c and miR-497 had important roles in immune function (involved in the Toll-like receptor signaling pathway in miR-497), signal pathway induction (involved in the calcium signaling pathway in miR-466j), and nutrition metabolism (involved in inositol phosphate metabolism in miR-322 and the insulin signaling pathway in miR-34c ). [score:5]
MiR-122, miR-451 and miR-494 were detected in liver, miR-494, miR-691 and miR-143 in spleen, and miR-223, miR-200a and miR-322 in lung. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 11
Analysis of predicted targets of miR-322 and miR-322* showed that they are significantly enriched for genes functioning in organ development and gene expression (Table S6), suggesting that both species are likely to play important roles in cardiac development and remo deling. [score:7]
J Cell Physiol (May 26, 2011) [Epub ahead of print] 35 Sarkar S Dey BK Dutta A 2010 MiR-322/424 and -503 are induced during muscle differentiation and promote cell cycle quiescence and differentiation by down-regulation of Cdc25A. [score:3]
Another likely cardiac-specific abundant miR* is derived from miR-322 (58%; Figure 2C), whose mature form is involved in myocyte differentiation [35], post-ischemic vascular remo deling and angiogenesis [36]. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
After repeated osteo-induction (2w+), miR-30d and miR-30c were induced, and the expression levels of miR-503, miR-322 and miR-125b-3p were the most powerfully repressed (Fig. 4B, E). [score:3]
*miR-16 and miR-322/424 share targets. [score:3]
The infected cells were selected by puromycin (2 ug/mL) in 10 days for cloning of miR-21 and miR-30d stable transfectant and in 2 weeks for miR-322 stable cells. [score:1]
miRNA sequences of step loop part of pre-miR-21, pre-miR-30d, and pre-miR-322 were obtained from miRBase. [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 10
We built regression mo dels for these two miRNAs and found that these two loci accounted for 44 % and 37 % of variation in miR-322 and miR-503 expression, respectively. [score:3]
The trans-eQTL locus shared by miR-322 and miR-503 was also weakly associated with the expression of miR-351 and miR-497 (p [adjusted] < 0.1). [score:3]
The predicted structure of pre-miR-342 with the addition of the in del (rs261236356) is shown at rightSeven other miRNAs had local eQTL: miR-146b, miR-181d, miR-187, miR-203, miR-221, miR-322, and miR-503. [score:1]
The predicted structure of pre-miR-342 with the addition of the in del (rs261236356) is shown at right Seven other miRNAs had local eQTL: miR-146b, miR-181d, miR-187, miR-203, miR-221, miR-322, and miR-503. [score:1]
For example, miR-322 and miR-503 each had one local eQTL (on Chr X) and one trans-eQTL on Chr 11. [score:1]
Pairwise Pearson Correlation Values Among miR-322, miR-252, miR-497, and miR-503. [score:1]
[1 to 20 of 6 sentences]
19
[+] score: 9
miR-322 that upregulated in leptin -deficient obese (ob/ob) mice has a cardioprotective effect by modulating the insulin pathway [21]. [score:4]
We found that miR-322-5p was one of these up-regulated miRNAs (greater than 2-fold changes) (Fig.   4a,b). [score:4]
The arrow indicates miR-322-5p. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 9
At 4 months of high-fat diet feeding, 3 miRNAs were upregulated: let7f-5p (FC: 2.3), miR-140-5p (FC: 3.8) and miR-199-3p (FC: 2.1), but two miRNAs were down regulated in obese mice with respect to normal mice: miR-155 (FC: 1.7) and miR-322 (FC: 1.5). [score:5]
At 16 months, all 15 miRNAs were significantly downregulated in heart tissue of obese mice compared to heart tissue of normal mice: let-7f-5p (FC: 3.3), miR-10a-5p (FC: 2.6), miRNA-19b-3p (FC: 5.0), miR-25-3p (FC: 2.6), miR30e-5p (FC: 5.6), miR-140-5p (FC: 5.0), miR-155-5p (FC: 1.7), miR-146a-5p (FC: 4.0), miR-181b-5p (3.0), miR-199a-3p (FC: 3.6), miR-322 (FC: 1.5), miR-451 (FC: 1.9), miR-499-5p (FC: 5.4), miR-669m-5p (FC: 1.7) and miR-3473b (FC: 3.4). [score:3]
Based on previous pre-clinic studies, the miRNAs validated by RT-qPCR in our study are involved in alteration of glucose and lipid metabolism via insulin pathways (let-7f-5p, miR-10a-5p, miR-322) 20– 22, in cardiomyocytes apoptosis (miR-19b-3p, miR-25-3p, miR-30e-5p, miR-140-5p, miR-199a-3p, miR-499) 23– 28, in mitochondrial function (miR-181a/b) [29], in pro-inflammatory signalling (miR-146a-5p, miR-155, miR-181b-3p, miR-3473b) 30– 33, and in cardiac hypertrophy (miR-451) [34] and myocardial fibrosis process (miR-19b) 35, 36. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Another study showed that miR-322/424 and miR-503 are upregulated during myogenesis and these miRNAs promote cell cycle arrest at G1 phase by down -regulating Cdc25A [144]. [score:5]
Sarkar S. Dey B. K. Dutta A. Mir-322/424 and -503 are induced during muscle differentiation and promote cell cycle quiescence and differentiation by down-regulation of cdc25a Mol. [score:3]
[1 to 20 of 2 sentences]
22
[+] score: 8
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
Both ACTH and 17α-E2 up-regulated the expression of miRNA-212, miRNA-132, miRNA-154, miRNA-494, miRNA-872, miRNA-194, and miRNA-24-1, but reduced the expression of miRNA-322, miRNA-20b, miRNA-339, miRNA-27a, miRNA-551b, and miRNA-1224. [score:8]
[1 to 20 of 1 sentences]
23
[+] score: 7
From the significantly down-regulated miRNAs following 4 weeks of CS exposure in lung, only miR-322* was still significantly decreased after 24 weeks of CS exposure (Fig.   1e). [score:4]
By focusing on the overlap between subacute and chronic CS exposure within the same compartment, or the overlap between miRNAs with altered expression levels in BAL and lung, we narrowed the pool of interesting miRNAs down to 18: let-7b, let-7c, miR-135b, miR-138, miR-146a, miR-148a, miR-152, miR-155, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-322*, miR-342-3p, miR-376b* and miR-449. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 5
According to the miRNA profiles, mmu-let-7b, mmu-let-7c, mmu-miR-27a and mmu-miR-322 were significantly downregulated in the granulosa cells of mouse MII oocytes compared with those of MI oocytes. [score:3]
Oocytes matured more slowly by injecting mmu-miR-27a mimic into granulosa cells, but faster by injecting mmu-let-7c-, mmu-miR-27a- and mmu-miR-322 -inhibitor, compared with the negative control group. [score:2]
[1 to 20 of 2 sentences]
25
[+] score: 5
Using qPCR, we found that miR16-5p and miR17-5p significantly inhibited VEGFR2 mRNA expression but that miR322-5p and miR497-5p had no significant effect. [score:5]
[1 to 20 of 1 sentences]
26
[+] score: 5
A previous study showed that miR-322/424 and miR-503 can promote cell differentiation by enhancing cell cycle arrest through the inhibition of cell cycle regulator Cdc25A [32]. [score:4]
MiR-148a, miR-206 and miR-214 have been shown to be similar to miR-322/424 and miR-503 [12, 33, 34]. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 4
Comparing to the solvent control, in cells treated with VPA we observed a strong upregulation of myogenic miRNAs (myo- mirs: mir-206, mir-133a,b), or miRNAs shown to be involved in muscle differentiation and specification (mir-10a, mir-143/ mir-145 cluster, mir-214, mir-322, mir-199a). [score:4]
[1 to 20 of 1 sentences]
28
[+] score: 4
However, the particular cluster on the X chromosome highly expressed in ovaries (miR-450b to miR-322) is centromeric to a similar cluster in testes (miR-743a to miR-465a). [score:3]
Furthermore, the majority of the ovarian cluster is conserved with human, with the exception of mir-322, nearest to the male cluster, whereas, the male cluster is almost entirely rodent-specific miRNAs. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 1 sentences]
30
[+] score: 4
High expression of mmu-mir-322 shows its involvement in cell differentiation, folliculogenesis and overall ovarian development [51]. [score:4]
[1 to 20 of 1 sentences]
31
[+] score: 4
MiR-27b, miR-214, miR-199a-3p, miR-182, miR-183, miR-200a, and miR-322 were found to be downregulated, whereas miR-705 and miR-1224 were increased after 4 weeks of alcohol feeding in mice [26]. [score:4]
[1 to 20 of 1 sentences]
32
[+] score: 4
Mmu-miR-31, mmu-miR-351, mmu-miR-672, mmu-miR-339-3p, mmu-miR-138, mmu-miR-210, mmu-miR-25, and mmu-miR-322 were found to be more prominent and may play crucial roles in the regulatory network for their degree were more than 5. 10.1371/journal. [score:2]
Mmu-miR-31, mmu-miR-351, mmu-miR-672, mmu-miR-339-3p, mmu-miR-138, mmu-miR-210, mmu-miR-25, and mmu-miR-322 were found to be more prominent and may play crucial roles in the regulatory network for their degree were more than 5. 10.1371/journal. [score:2]
[1 to 20 of 2 sentences]
33
[+] score: 4
Several other miRNAs, such as miR-150, miR-504 and miR-322 have all been shown to regulate VEGFA expression (Figure 4). [score:4]
[1 to 20 of 1 sentences]
34
[+] score: 3
Mice with endothelial-specific deletion of miR-322 and miR-503 demonstrate increased angiogenesis in response to LPS. [score:1]
Mice with loxP sites surrounding the microRNA cluster 24 (which includes miR-322, miR-503, and miR-351) were crossed to mice with a tamoxifen inducible Cdh5 Cre driver (Cdh5-CreERT2) (Sup. [score:1]
Moreover, we demonstrate enhanced angiogenic response to inflammatory stimuli in mice with endothelial specific deletion of miR-322 (miR-424 ortholog) and miR-503. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 3
When comparing young versus aged TEC (a mix of cTEC and mTEC) a decrease in miR-148b, miR-19b, miR-24, and miR-322 expression was seen in aging (45). [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
A number of further targets were identified through miRNA/protein correlations, such as the mir-200 family (miR-200a, miR-200b and miR-200c), miR-191, miR-195, miR-301, and miR-322 (Figure 4D). [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
Expression levels of five miRNAs [miR-23a (−1.52), miR-23b (−1.58), miR-34 (−1.78), miR-214 (−2.31), and miR-322 (−2.31)] were shown to be significantly decreased in Cmah -null mouse-derived livers by Liver miFinder microRNA PCR array analysis (Figure 3(d)). [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 2
The miR-16 microRNA family, including miR-15a, miR-15b, miR-16, miR-1907, miR-497, miR-322 and miR-185, were predicted to bind the Wnt4 3′-UTR region. [score:1]
Real-time PCR was performed to investigate the expression of mmu-miR-1907, mmu-miR-15a, mmu-miR-15b, mmu-miR-497, mmu-miR-16, mmu-miR-322 and mmu-miR-195 in the brain tissue of F1 mice from the two groups. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 2
Among the miRNAs that undergo the greatest dynamic regulation at early time points were miR-219 and miR-140 (Figure S1A) and at the later time point were miR-322 and miR-128a (Figure S2B, 3 and 24 h). [score:2]
[1 to 20 of 1 sentences]
40
[+] score: 1
mir-351 is potentially part of a miRNA cluster with mir-503 and mir-322 lying within 2 kb upstream, with numerous ESTs mapped in this region supporting this possibility. [score:1]
[1 to 20 of 1 sentences]
41
[+] score: 1
As an example, miR-322 and miR-431, that were mapped on chromosome 1 (51–59 Mb), are clustered in the ‘red’ module. [score:1]
[1 to 20 of 1 sentences]
42
[+] score: 1
EVs contained miRNAs that specifically modulate VEGF/VEGFRs signaling [21] including miR-16.1, miR-23a, miR-27a, miR-93, miR-221, miR-145 and miR-322 [Suppl. [score:1]
[1 to 20 of 1 sentences]
43
[+] score: 1
[#]The mouse homologue of miR-424 sequence from human is miR-322-5p. [score:1]
[1 to 20 of 1 sentences]