66 publications mentioning mmu-mir-196a-2

Open access articles that are associated with the species Mus musculus and mention the gene name mir-196a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

In addition, overexpression of miR-196a in MCF7 and MDA-MB-231 cells significantly suppressed SPRED1 protein expression levels, whereas anti-miR-196a inhibitor increased SPRED1 expression, demonstrating that SPRED1 is a direct target of miR-196a in BC cells (Fig. 5c).

Similarly, the independent BC gene expression data sets (GSE2669) from public database GEO showed that miR-196a expression levels were significantly up-regulated in BC tissues (Fig. 1b).

Herein we address several important questions: i) what is(are) the change(s) of miR-196a expression upon estrogen treatment in BC cells; ii) what is underlying mechanism of the estrogen-regulated miR-196a expression in ER+ BC cells; iii) what is/are functional target(s) of the miRNA-196a that may be associated with estrogen -induced BC progression.

Moreover, the tumors from miR-196a -overexpressing MCF7 cells showed increased number of CD31 positive microvessels and higher expression levels of Ki67 by IHC staining, whereas the tumors from anti-miR-196a inhibitor group showed decreased microvessel densities and Ki67 expression levels compared to controls (Fig. 7e and f; Additional file  10: Figure S10).

Finally, forced expression of miR-196a induced tumor growth of MCF7 cells, while inhibition of miR-196a significantly suppressed the tumor progress in vivo.

Furthermore, SPRED1 was a new direct target of miR-196a which participated in miR-196a-promoted BC development and was suppressed by ligand-activated ER-α signal pathway.

Besides, results of tumorigenesis in nude mice showed that E2 repressed the expression levels of SPRED1 only in ER+ BC cells, while SPRED1 was suppressed by overexpression of miR-196a in both MCF7 and MDA-MB-231 cells (Additional file 2: Figure S2G and H).

To identify the direct target(s) of miR-196a regulated by E2, we used the bioinformatic programs and verified that SPRED1 was a novel target of E2-promoted miR-196a.

The results showed that miR-196a high expression group was enriched in DOANE BREAST CANCER ESR1 UP dataset (NES = 2.03, FDR q = 0.002), whereas miR-196a low expression group was enriched in DOANE BREAST CANCER ESR1 DOWN dataset (NES = − 2.12, FDR q < 0.001), confirming the positive correlation between miR-196a and ER-α expression levels (Fig. 3e and f).

SPRED1 is considered to act as a negative regulator of the RAS/RAF/MAPK signaling [35, 36], we found that consistent with decreased SPRED1 expression, miR-196a overexpressing cells had high c-Raf and p-ERK1/2 levels, whereas anti-miR-196a inhibitor treatment significantly decreased c-Raf and p-ERK1/2 levels (Fig. 5c, Additional file  6: Figure S6).

The dataset was split into two groups (hsa-miR-196a high expression group and hsa-miR-196a low expression group) based on the expression levels of miR-196a, and the program was employed to analyze the enrichment of each group to the gene sets DOANE BREAST CANCER CLASSES UP and DOANE BREAST CANCER ESR1 DN [29, 30].

It has been reported that miR-196a is significantly up-regulated in BC to regulate cell growth by targeting UBE2C [18] as an oncomiR [19].

Notably, the up-regulation of miR-196a was mediated by a direct interaction with estrogen receptor α (ER-α) but not estrogen receptor β (ER-β) in its promoter region, and miR-196a expression levels were positively correlated to ER-α signature scores.

Finally, in order to address whether overexpression of SPRED1 inhibits miR-196a-inducing malignant phenotypes miR-196a overexpressing cells were transfected with pCMV expression vector containing SPRED1 cDNA without 3′-UTR region or vector alone as negative control and used to investigate cell proliferation, migration and invasion.

** indicated significant difference between indicated groups Previous studies have shown that estrogen is an important factor in BC by regulating gene expression including miRNAs, and our results also indicate the ER signal pathway participates in the abnormal expression of miR-196a in ER+ BC cells.

ER-α, but not ER-β knockdown significantly decreased miR-196a expression only in MCF7 cells with or without E2 treatment, indicating that ER-α, but not ER-β, is necessary for E2 -induced miR-196a expression in ER+ BC cells (Fig. 3c and d; Additional file 4: Figure S4 A and B).

These results indicate that the aberrant expression of miR-196a is correlated to ER signal pathway in BC progression, and miR-196a is potential target in hormone mediated BC development.

We further verified that SPRED1 was a direct target of miR-196 and it played pivotal roles in miR-196a promoted BC cell proliferation, migration and invasion by inhibiting c-Raf signal pathway.

These results suggest that ER-regulated miR-196a enhances tumor growth and angiogenesis which is associated with its reduced expression of target SPRED1 in vivo.

Forced expression of miR-196a did not affect the transcriptional activation of mutant SPRED1 3′-UTR reporter activity (Fig. 5b), indicating that miR-196a directly targets SPRED1 by binding to its seed sequence at 3’-UTR.

We also observed the positive correlation between miR-196a and ER-α expression levels using assay showing that miR-196a expression levels were positively correlated to ER-α signatures scores and ER-α expression levels in BC specimens.

As shown in Fig. 7b and c, miR-196a overexpression significantly increased tumor size and weight, which were inhibited by anti-miR-196a inhibitor compared to anti-miR-NC group.

The results above showed that miR-196a expression levels were induced by E2 in ER+ BC cells and SPRED1 was the direct target of miR-196a.

** indicates significant difference compared to the control at P < 0.01. c Protein expression levels of SPRED1, c-Raf, pERK1/2 and GAPDH were determined using Western blot analysis in MCF7 and MDA-MB-231 cells overexpressing miR-196a, miR-NC or anti-miR-196a inhibitor and anti-miR-NC.

After 24 h, the expression levels of some reported targets of miR-196a were analyzed by qRT-PCR.

f GEO dataset GSE22220 was used to analyze the Pearson’s correlation between miR-196a and SPRED1 levels To further identify the relationship between miR-196a and SPRED1 expression, we analyzed the expression levels of SPRED1 in human BC specimens by qRT-PCR and in the GEO dataset GSE22220.

Previous reports have demonstrated several miR-196 targets, including HOX family (A5/A7/B8/C8/D8), AnnexinA1, NME4, ZEB1 [56] and we found there were no significant changes of these miR-196 targets upon E2 treatment in MCF7 cells.

In the present study, we are interested in role and mechanism of ER–regulated miR-196a and its target in BC development.

We then analyzed the expression levels of miR-196a in the two groups, and the results showed that the expression levels of miR-196a in high ER-α signature scores group was more than those in low ER-α signature scores group (Fig. 3g).

Consequently, our results suggest that miR-196a and its target SPRED1 play an important role in estrogen -mediated BC progression, which may be helpful to provide new therapeutic target for ER+ BC in the future.

The cells were transfected with the inhibitor (Anti-miR-196a) or control anti-sense RNA inhibitor (Anti-miR-NC).

Although anti-miR-196a inhibitor reduced cell proliferation in both MCF7 and MDA-MB-231 cells without E2 stimulation, the anti-miR-196a inhibitor reversed the E2-promoted cell proliferation of only the ER+ BC cells MCF7, but not of ER- BC cells MDA-MB-231 (Fig.   2a and b).

Overexpression of miR-196a in HEK-293 T cells decreased luciferase activities of wild type reporter to 45%, suggesting that miR-196a inhibits its 3′-UTR reporter activities of SPRED1.

Next, we analyzed the expression levels of miR-196a in our ER+ and ER- BC specimens, and the results demonstrated that miR-196a expression levels were significantly higher in ER+ BC tissues than those in ER- group (Fig. 1c).

MiR-196a directly targets and inhibits SPRED1.

These results demonstrate that miR-196a expression levels are correlated with not only BC malignancy, but also ER status of tumors, indicating that miR-196a may be regulated by estrogen receptor in BC development.

** indicates significant difference at P < 0.01 To further understand molecular mechanisms by which miR-196a exhibits its biological effects on BC cells, several computational methods (TargetScan, miRWalk 2.0, miRBase) were used to identify potential miR-196a targets.

Lentiviruses carrying miR-196a, miRNA -negative control (miR-NC), miR-196a inhibitor (anti-miR-196a) or miRNA inhibitor -negative control (anti-miR-NC) were packaged using lentiviral packaging kit in HEK-293 T cells following the manufacturer’s instructions (Open Biosystems, AL, USA).

f GEO dataset GSE22220 was used to analyze the Pearson’s correlation between miR-196a and SPRED1 levelsTo further identify the relationship between miR-196a and SPRED1 expression, we analyzed the expression levels of SPRED1 in human BC specimens by qRT-PCR and in the GEO dataset GSE22220.

To evaluate the relationship between miR-196a and ER-α expression levels, we downloaded BRCA TCGA mRNAs and miRNAs expression dataset and divided the samples into miR-196a high and miR-196a low expression groups.

a The expression levels of miR-196a in 46 paired of BC and adjacent normal tissues were analyzed by qRT-PCR and normalized to U6 expression levels.

The results showed that miR-196a expression levels were positively correlated to ESR1 signature scores, and there was a positive correlation between miR-196a and ER-α expression levels (Fig. 3h; Additional file 5: Figure S5).

The lentiviral vector carrying miR-196a or miR-NC has red fluorescent protein (RFP) tag and the lentiviral vector carrying miR-196a inhibitor or miR-NC inhibitor has red fluorescent protein (RFP) tag, which can be used to check the efficiency of packaging using microscope.

Our previous studies showed that the expression levels of miR-196a were elevated upon E2 treatment in ER positive BC cells, indicating the involvement of miR-196a in estrogen -induced BC development [17].

To test whether miR-196a specifically inhibits the activity by binding its seed sequence, we also made mutant construct with the mutation of miR-196a -binding site in the 3′-UTR of SPRED1 (Mut).

Furthermore, we demonstrated that miR-196a up-regulation by estrogen was through ERα, but not ERβ.

As we expected, the enrichment of the ER-α in miR-196a upstream was only significantly upregulated upon E2 treatment in ER+ BC cells (Fig. 4c and d).

h Pearson’s correlation analysis was used to determine the correlation between the expression levels of ERα (ESR1 signature score) and miR-196a expression levels It has long been known that ER-α is considered to act as a ligand-activated transcription factor, but its function remains elusive.

Here, we identified that miR-196a was up-regulated by estrogen in ER positive BC cells and enriched in ER -positive BC tissues.

Therefore, we further analyzed whether ER-α transcriptionally regulates miR-196a expression by binding to the promoter region of miR-196a.

Thus, we demonstrated that E2 promoted the binding of ER-α to the specific ERE sites in the promoter of miR-196a to regulate its expression in ER+ BC cell.

Our results showed that ER-α, but not ER-β, was involved in mediating miR-196a expression by ER activation, which was a novel mechanism of regulation.

Moreover, estrogen -induced miR-196a was positively correlated with ER-α signature scores and promoted BC development in vitro and in vivo by targeting SPRED1.

Meanwhile, we discovered that SPRED1 was one of direct targets of miR-196a which is also responsive to ER-a signaling.

To better understand the mechanism of estrogen -induced miR-196a up-regulation, we re-analyzed the ChIP-seq data from GEO database containing MCF7 results with or without E2 treatment using ER-α antibody.

Compared with control group, the overexpression of miR-196a significantly promoted tumor growth, whereas miR-196a inhibitor markedly attenuated tumor growth (Fig.   7a).

Furthermore, the protein levels of SPRED1 in xenografts from miR-196a -expressing cells were much lower than those from miR-NC control cells, confirming the negative correlation between miR-196a and SPRED1 in vivo (Fig. 7d).

miR-196a is positively associated with ESR1 expression levels.

MiR-196a- or miR-NC -overexpressing MCF7 cells were transfected with vector or SPRED1 cDNA without 3’-UTR.

As the data shown above, miR-196a expression levels were mediated by ER-α signal pathway.

To test whether miR-196a targets SPRED1, SPRED1 3′-UTR containing this seed sequence was cloned into pmirGLO vector (WT).

Fig. 3miR-196a expression is induced by E2 and miR-196a is a gene signature associated to ER-α.

Additionally, we found that ER-α responsive miR-196a still expressed in ER- breast cancer cells, which is independent of ER signal pathway and consistent to previous studies [54, 55].

However, there is still lack of study about the differential expression of miR-196a in ER+ and ER- BC tumor tissues.

The typical targets of miR-196a shows no change with E2 treatment in ER+ BC cells.

Meanwhile, Pearson’s rank correlation analysis showed an inverse correlation between the expression levels of SPRED1 and miR-196a in human BC specimens (Pearson’s correlation r = − 0.3811, Fig. 5e).

** indicates significant difference at P < 0.01. d Different GEO dataset GSE22220 was used to analysis the expression levels of miR-196a in ER -negative or ER -positive tissues.

We also observed the expression levels of miR-196b, the other member of miR-196 family, showed no significant change (Additional file  3: Figure S3).

** indicates significant difference at P < 0.01. c The relative miR-196a expression levels of BC tumors were analyzed according to ER status (ER -negative, n = 17; ER -positive, n = 29).

## indicates significant difference between the siNC+E2 and the siERα+E2 group and at P < 0.01. e, f program were employed to analyze the ERα signal enrichment scores between miR-196a high and low expression group using the TCGA BRCA dataset.

The results showed that E2 markedly induced miR-196a expression in a time -dependent manner in MCF7 cells, but not in MDA-MB-231 cells (Fig.   3a and b).

MCF7 and MDA-MB-231 cells were transfected with anti-miR-196a inhibitor or anti-miR-NC, then treated with or without E2.

The results showed that overexpression of SPRED1 can restore the miR-196a-promoted cell proliferation, migration and invasion in BC cells (Additional file  7: Figure S7 A-H).

However, we demonstrated that there were no changes of the other reported targets of miR-196a such as HOXA5, HOXA7, HOXB8, HOXC8, HOXD8, ANXA1, NME4 and ZEB1 upon E2 treatment (Additional file  8: Figure S8 A and B).

Collectively, these results suggest that miR-196a/SPRED1 signaling was involved in regulating BC development through MAPK signaling, especially in ER -positive BC.

To further confirm whether the effect of estrogen is through its receptors ER-α and/or ER-β, we found that E2 treatment promoted miR-196a expression.

MiR-196a is up-regulated in human BC, especially in ER+ tumor tissues.

miR-196a expression is induced by E2, and miR-196a is a gene signature associated with ER-α.

In our study, we confirmed the negative correlation between miR-196a and SPRED1 expression levels in both BC cells and BC tumor tissues.

The expression levels of miR-196a and SPRED1 in BC were tested by qRT-PCR in 46 paired BC and adjacent tissues and by the GEO datasets.

g Primary human breast cancers of TCGA BRCA dataset were classified to high or low ERα signature score group, and the expression levels of miR-196a were analyzed in the two groups.

MiR-196a is up-regulated in ER+ BC tissues.

In addition, high expression levels of miR-196a indicated poor OS prognosis in ER+ BC patients, but not in ER- BC patients which implicated importance of miR-196a in ER+ BC (Fig. 1e and f).

a Putative seed-matching sites (in bold) or mutant sites (red) between miR-196a and 3’-UTR of SPRED1 were analyzed by TargetScan, miRWalk 2.0 and miRBase.

a, b ER+ BC cells MCF7 and ER- BC cells MDA-MB-231 were cultured with estrogen-free medium for 72 h, then treated with 10 nM E2 or equal amount of solvent Eth for 0, 3, 6, 12 or 24 h. The expression levels of miR-196a were analyzed by qRT-PCR and normalized to the values of the Eth control.

After 24 h, the cells were treated with 10 nM E2 or Eth, the expression levels of miR-196a were analyzed by qRT-PCR and U6 levels were used an internal control, and normalized to the value of siNC+Eth group.

In addition, we found that the expression levels of miR-196a in the ER+ tumors with the E2 treatment were higher than in the Eth group, however, there were no significant difference in ER- tumors (Additional file 2: Figure S2 E and F).

The MCF7 and MDA-MB-231 miR-NC- and miR-196a -overexpressing cells (2 × 10 [6]cells) were dispersed in 100 μl of serum-free DMEM medium, and subcutaneously injected into both sides of posterior flank of nude mice.

Overall, these results indicate that miR-196a expression levels were induced by E2 in ER+ BC cells and were closely correlated with ER-α signaling.

These results indicate that miR-196a could activate the RAS/RAF/MAPK signaling through targeting SPRED1.

Furthermore, we tested the Pearson’s correlation between miR-196a expression levels and ER-α signature scores.

** indicates significant difference at P < 0.01. b The miR-196a expression levels of normal adjacent breast tissues and BC tissues were analyzed in the BC database of the public GEO dataset (GSE40525).

The potential targets of miR-196a in BC cells were explored using the luciferase reporter assay and western blot analysis, and the correlation between miR-196a and SPRED1 was analyzed by Spearman’s correlation analysis in BC specimens and GEO dataset.

** indicates significant difference compared to the normal tissues P < 0.01. e Pearson’s correlation analysis was used to determine the correlation between the expression levels of SRED1 and miR-196a in human BC specimens (n = 46).

Overall, the identification of estrogen/miR-196a/SPRED1 cascade will shed light on new molecular mechanism of estrogen signaling in BC development and therapy.

ERα directly bound to the promotor of miR-196a.

Overall, our findings show the novel role and mechanism of estrogen/miR-196a/SPRED1 signaling in the estrogen -induced BC development.

Estrogen induces tumor growth of ER+ but ER- BC cells via the regulation of miR-196a.

Quantitative reverse-transcriptase PCR (qRT-PCR) assay showed that in 46 pairs of human breast tissue samples, the expression levels of miR-196a in BC tumor tissues were significantly higher than those in the adjacent normal tissues (Fig.   1a).

To evaluate the role of miR-196a in estrogen (E2) -mediated BC development, we first determined whether E2-regulated miR-196 affects BC development.

The expression levels of miR-196a were higher in ER -positive (ER+) breast tumors compared to ER -negative (ER-) tumor tissue samples.

Recent study also indicates that miR-196a is correlated with estrogen [20], however, the role and underlying mechanism of estrogen/miR-196a signaling in regulating BC progression remains to be further elucidated.

However, the mechanism of the miR-196a regulation in ER- BC cells remain unknown which would need further study.

Some reports have shown that miR-196a participates in the development of BC and acts as an oncogene [18, 34, 43].

Although miR-196a has been reported to be involved in various types cancers including head and neck cancer, gastric cancer, ovarian carcinoma and BC [39– 42]; there is no information about the underlying mechanisms of estrogen-regulated miR-196a in BC progression.

The answers to these questions would provide new insights into a better understanding of the role of estrogen/miR-196a signal in BC development, which is helpful to provide a potential therapeutic strategy to overcome resistance to hormonal treatment in the future.

Similarly, we demonstrated that interference of miR-196a attenuated estrogen -induced cell proliferation, migration and invasion in ER+ BC cells, demonstrating an important role of miR-196a in estrogen-promoted BC development.

We demonstrated that miR-196a expression levels were higher in the ER+ BC tissues compared to ER- tissues, which was consistent with the results from GSE22220 dataset showing the noteworthy correlation between miR-196a levels and ER status in BC.

For tumor growth assay, MCF7 cells stably expressing miR-196a, miR-NC, anti-miR-196a or anti-miR-NC were injected subcutaneously into both flanks of nude mice (8 mice each group, 5 × 10 [6] cells in 100 μl serum-free DMEM medium).

We further identified the transcriptional regulation of ER-α upon E2 treatment in the promoter region of miR-196a using and promoter reporter assay in MCF7 and MDA-MB-231 cells.

In this study, we identified miR-196a as an estrogen -induced miRNA in an ER-α dependent manner in BC.

This dataset is to analyze the change of the binding enriched binding abilities of ER-α with miR-196a in its promoter region using ER-α antibody for chromatin immunoprecipitation with E2 or Eth treatment.

c, d The MCF7 and MDA-MB-231 cells were cultured with estrogen-free medium for 72 h t, then treated with 10 nM E2 or equal amount of solvent ethyl alcohol (Eth) for 24 h. The was performed to determine the binding sites of ERα in the promoter region of miR-196a.

* and ** indicate significant difference between the miR-NC + Vector group and the miR-196a + Vector group with P < 0.05 and P < 0.01, respectively.

To validate the enrichment of ER-α in the promoter region of miR-196a induced by E2, we performed to analyze the binding enrichment of ER-α in the seed region with or without E2 treatment in MCF7 and MDA-MB-231 cells.

** indicates significant difference at P < 0.01. e, f The wild type (AATGTCAGGACGGTCTT) or mutant (ACTCTAAGGACCGCCCT) seed binding site of miR-196a promoter region was subcloned into pGL3 luciferase reporter vector and verified by sequencing.

The results showed that E2 promoted the transcriptional activity of miR-196a only in MCF7 cells, but not in MDA-MB-231 cells (Fig. 4e and f).

MCF7/miR-196a, MCF7/miR-NC, MCF7/anti-miR-196a, or MCF7/anti-miR-NC cells were dispersed in 100 μl of serum-free DMEM medium and subcutaneously injected into the sides of posterior flank of nude mice (n = 4).

Fig. 2Silence of miR-196a reverses the tumor-promoting effects of E2 in ER+ BC cells.

Silence of miR-196a reverses the tumor-promoting effects of E2 in ER+ BC cells.

Our results demonstrated that miR-196a was significantly increased with the E2 treatment in ER -positive cell line MCF7, but not in ER -negative cell line MDA-MB-231.

The pGL3-luciferase reporters were cloned as above with wild type (WT) or mutant (mut) miR-196a promoter region in the MCS.

Among the candidates, we found that seed sequence of miR-196a matched 3′-UTR region of SPRED1 (Fig.   5a).

i, j The Kaplan Meier plotter was used to detect the relapse free survival (RFS) of SPRED1 in ER+ and ER- BC patients, respectively In order to further investigate the effect of miR-196a on BC tumorigenesis, MCF7 cells were infected with lentivirus carrying miR-196a or anti-miR-196a inhibitor, followed by the selection of puromycin.

a MCF7/miR-196a, MCF7/miR-NC, MCF7/anti-miR-196a, or MCF7/anti-miR-NC cells (5 × 10 [6]cells) were dispersed in 100 μl of serum-free DMEM medium and subcutaneously injected into the both sides of posterior flank of female nude mice (n = 8).

These results demonstrate that estrogen induces miR-196a transcriptional activation by promoting the binding of ER-α in miR-196a promoter region in ER+ BC cells.

b The JASPAR program was employed to seek the seed binding sites of ERα in the promoter region of miR-196a.

Similarly, interference of miR-196a attenuated E2 -induced migration and invasion in MCF7 cells, but not in MDA-MB-231 cells (Fig. 2c- f).

SPRED1 reverses miR-196a -induced malignant phenotype of BC cells.

Next, we downloaded the sequence from the binding peak and predicted the potential seed binding sequence of ER-α by transcription factor binding profile database JASPAR, and there was indeed seed region matching the ER-α binding mo del in miR-196a promoter region (Fig. 4b).

High levels of miR-196a have been reported in various solid cancers including BC [18, 34].

** indicates significant difference between Anti-miR-NC with E2 treatment (Anti-miR-196a + Eth) group and Anti-miR-NC without E2 treatment (Anti-miR-NC + Eth) group.

After 24 h, cells were co -transfected with either wild-type (WT) or mutant-type (mut) luciferase reporter plasmid, and equal amounts of miR-196a or miR-NC using Lipofectamine 2000 (Invitrogen) according the manufacturer’s instruction.

# and ## indicate significant difference between the miR-196a + Vector group and the miR-196a + SPRED1 group with P < 0.05 and P < 0.01, respectively.

The densities of CD31 levels were analyzed in tumor tissues with changes of miR-196a.

* indicates significant difference at P < 0.05. e, f The Kaplan Meier plotter was used to detect the overall survival (OS) of miR-196a in ER+ and ER- BC patients, respectively As wi dely reported, estrogens stimulate the proliferation and metastatic potential of BC cells.

The sequence of miR-196a promoter was obtained from the UCSC Genome Database.

Estrogen promotes the binding of ER-α in the miR-196a promoter region in ER+ BC cells.

Besides, miR-196a was involved in estrogen -induced BC cell proliferation, migration and invasion.

The 3′-UTR-luciferase reporter constructs containing the 3′-UTR region of SPRED1 with the wild-type and mutant binding sites of miR-196a were amplified using PCR method.

Estrogen miR-196a SPRED1 Breast cancer Estrogen receptors Breast cancer (BC) is the most common cancer in women worldwide, and 70% of BC is estrogen receptor α (ER-α) positive [1, 2].

First, analysis of the primary ChIP-seq data (GSE25021) from GEO database using MCF7 cells with E2 and vehicle control (ethanol, Eth) treatment showed that there was significant ER-α enrichment signal in the promotor region of miR-196a upon E2 treatment, indicating that the induction of miR-196a by E2 might be through the enriched binding abilities of ER-α in the miR-196a promoter region (Fig.   4a).

These results indicate that miR-196a is required for E2 -induced ER+ BC progression such as cell proliferation, migration and invasion.

The enrichment of miR-196a in cell lysates pulled down by ERα antibody was analyzed by qRT-PCR and normalized to the value of ERα + Eth group.

## indicates significant difference between Anti-miR-196a + E2 group and Anti-miR-NC + E2 group.

a GEO dataset GSE25021 was reanalyzed to identify the binding sites and enrichment intensity of ERα in the promoter region of miR-196a, and the call peaks results were displayed by IGV.

Fig. 4Estrogen promotes the binding of ER-α in the miR-196a promoter region in ER+ BC cells.

$$ indicates significant difference between Anti-miR-196a + Eth group and Anti-miR-NC + Eth group.

2

miR-196a inhibitor (hsa-miR-196a miRIDIAN Hairpin Inhibitor, IH-300529-06) and inhibitor negative control (control, miRIDIAN microRNA Inhibitor Negative Control no.

The study showed that relative number of live cells or that of dead cells were significantly suppressed (control, 1±0.019; miR-196a inhibitor, 0.584±0.029; p = 0.0022) or enhanced (control, 1±0.025; miR-196a inhibitor, 1.692±0.059; p = 0.0015), respectively, in the miR-196a inhibitor treatment group compared with control group (Figure 7B).

Deregulated expression of HOX genes including HOXB8, HOXC8, HOXD8 and HOXA7 in esophageal squamous cell carcinoma have been reported [72], [73], and miR-196a is significantly up-regulated in pancreatic [74], breast [75], and esophageal [68] cancer.

The results showed that 5 miRNAs (miR-130b-5p (formerly designated as miR-130b*), miR-196a, miR-455-3p, miR-455-5p, and miR-801) or 2 miRNAs (miR-133b and miR-145) were significantly up-regulated or down-regulated, respectively in laryngeal cancers (Figure 1A).

Significant suppression of the tumor volume was observed at 12 weeks after inoculation in the miR-196a inhibitor treatment group compared with control (control, 3397±2885%; miR-196a inhibitor, 226±476%; p = 0.0415) (Figures 8A and B).

In cancer tissues, the expression level of miR-196a isomiRs is upregulated and the length spectrum of miR-196a isomiRs is peaked at those found at miRBase entry of miR-196a.

Significant suppression of cell proliferation was observed by miR-196a inhibitor compared with control (miR-196a inhibitor, 22.67±3.06×10 [4]/ml; control, 44.33±6.66×10 [4]/ml; p = 0.0069) (Figure 7A).

These data cumulatively suggest that expression of mature miR-196a is maintained low and with a truncated form in normal laryngeal tissues, and is up-regulated with a complete length in laryngeal cancers.

JHU-011 cells derived from clinical laryngeal cancer were transfected with either miR-196a inhibitor or control, and after culture for 5 days the cells were subjected to both cell growth and survival analysis in the presence of miR-196a inhibitor.

In vitro study revealed the significant growth suppression of JHU-011 cells by miR-196a inhibitor.

Efficacy of treatment on both tumors and their locoregional lymph node metastasis was examined in each of the following 2 groups: Group 1, miR-196a inhibitor; Group 2, inhibitor negative control (control).

Therefore, to examine whether inhibition of miR-196a expression could counteract the propagation of laryngeal cancer in vivo, orthotopic xenograft mo del in mice was employed.

Another previous report proved that miR-196a promoted cell proliferation, anchorage-independent growth and suppressed apoptosis by targeting annexin A1 [68].

Significant tumor growth suppression by miR-196a inhibitor was observed at 12 weeks after inoculation.

Suppression of cell growth by miR-196a inhibitor was also visualized by Hoechst 33258, a nuclear stain that emits blue fluorescence when bound to double-stranded DNA (Figure 7C).

0071480.g007 Figure 7(A) Laryngeal cancer-derived JHU-011 cells were transfected with either miR-196a inhibitor or Inhibitor Negative Control (control) on day 0 and cell numbers were counted up to 5 days to evaluate the effect of miR-196a inhibition on the cell proliferation.

Head and neck cancer growth suppression in an orthotopic murine mo del by miR-196a inhibition.

Altogether, our results represent the first step toward a possible use of miR-196a as molecular marker for laryngeal cancer, and set the base for the future clinical employment of miR-196a inhibitor for the suppression of laryngeal cancer growth.

Tumor Growth Suppression by miR-196a Inhibitor.

Live cell fluorescence and dead cell fluorescence revealed significant suppression of relative live cell number (left panel), while miR-196a inhibition significantly increased relative dead cell number as compared to control (right panel).

Significant up-regulation of miR-455-5p and miR-196a in multiple laryngeal cancer samples.

Although further study is necessary to examine biological significance including the downstream targets of miR-196a in laryngeal cancer, there may be a mechanism through HOX gene deregulation to promote laryngeal cancer.

miR-196a as the Most Advantageous Biomarker Up-regulated in Laryngeal Cancer.

The results demonstrated above clearly indicate that miR-196a is up-regulated in laryngeal cancer cells to support their proliferation.

For transfection assays, cells were transfected with either miR-196a inhibitor or inhibitor negative control using Lipofectamine™ 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

miR-196a showed most dramatic expression pattern in laryngeal cancer compared with other miRNAs differentially expressed in laryngeal cancer.

Furthermore, expression levels of miR-196a and miR-455-5p were significantly higher in cancer tissues when compared with neighboring controls (miR-196a, p = 0.0460; miR-455-5p, p = 0.0286) (Figure 2A), while expression level of miR-133b was significantly lower in cancer samples compared with controls (p = 0.0274) (Figure 2B).

Statistical analyses were performed using t-test to compare the therapeutic effect of miR-196a inhibitor against laryngeal cancer in vitro and in vivo.

Next, to explore the physiological significance of miR-196a expression in laryngeal cancer, we first examined whether miR-196a is beneficial to the propagation of laryngeal cancer cells.

Reduced proliferation and viability of laryngeal cancer cells by miR-196a inhibition.

According to our deep sequencing data, mir-196a-1 precursor is as well responsible for expressing unannotated miR-196a-3p sequence that is slightly different from that of mir-196a-2 precursor origin.

Effect of miR-196a Inhibition on Tumor Growth and Metastasis of Laryngeal Cancer Xenografts.

Thus, to explore the possible heterogeneity in the expression profiles of miR-196a isomiRs between laryngeal cancer and non-cancer tissues, deep sequencing analysis of small RNA was conducted by using Applied Biosystems SOLiD system (Kamimoto T et al., manuscript submitted).

The expression of miR-196a in cancers was significantly higher than their matched paired samples (p = 0.005) and was also evident in laryngeal cancer cell line JHU-011 cells (data not shown).

Effect of miR-196a Inhibition on Laryngeal Cancer Cell Viability.

Representative pictures of control group with metastatic tumor cells (left panels) together with the pictures of miR-196a inhibitor group without tumor cells (right panels) are shown.

Furthermore, we found the expression of miR-196a was significantly higher in advanced cancer than early cancer (p = 0.0045; Figure 4B, left panel ), and also in early cancer than precancerous dysplasia (p = 0.0263; Figure 4B, Right panel ).

Stable Detection of miR-196a Expression in Surgical Laryngeal Cancer Specimen.

Thus, our laryngeal cancer xenograft data demonstrate, as a whole, that miR-196a is sufficient to strongly enhance laryngeal cancer growth (even if we are not providing the precise biological mechanisms behind this dramatic effect) and, consequently, that the inhibition of miR-196a is necessary, and in fact effective, to reduce the in vivo growth of this tumor.

0071480.g008 Figure 8(A) Nude mice were injected with JHU-011 cells at the level of hyoid bone and then treated with miR-196a inhibitor or control.

Significant expressional differences between matched pairs were reproduced in miR-133b, miR-455-5p, and miR-196a, among which miR-196a being the most promising cancer biomarker as validated by qRT-PCR analyses on additional 84 tissue samples.

Together with the result that miR-196a is highly expressed in laryngeal cancer cell line JHU-011 cells (Figure 4A), these findings raised the possibility that cancer cells secrete miR-196a transferable or functional in stromal cells.

In our study, miR-196a was detected both in cancer cells and cancer-related stroma as miR-21 expression in esophageal squamous cell carcinoma [78].

Deep sequencing analysis revealed both quantitative and qualitative deviation of miR-196a isomiR expression in laryngeal cancer.

We believe that our positive data in this settlement are the most significant and interesting, as they show that miR-196a inhibition can reduce the growth of pre-established laryngeal cancer xenografts up to 12 weeks.

Furthermore, suppression of locoregional metastasis was observed in the miR-196a treatment group while clear metastatic cancer cells were observed in the control (Figure 8D).

We further assessed the impact of miR-196a inhibition in vitro and in vivo on the growth of HNSCC to evaluate the potential of miRNA as a novel therapeutic target for HNC.

Therefore, to further explore the significance of miR-196a as a promising biomarker for laryngeal cancer, qRT-PCR analysis of miR-196a was performed on 84 histologically verified samples (15 noncancerous counterparts, 24 benign diseases, 18 dysplasias, 27 laryngeal cancers) and 7 HNSCC cell lines.

Subsequently, we injected miR-196a inhibitor into pre-established JHU-011 xenografts.

In situ hybridization confirmed laryngeal cancer-specific expression of miR-196a in both cancer and cancer stroma cells.

miR-196a is located in HOX gene clusters [65] and this microRNA has been suggested to potentially target HOXB8, HOXC8, HOXD8 and HOXA7 [66].

Statistically significant differences of the expression levels of miR-196a, miR-455-5p, and miR-133b were observed between matched pairs.

Representative mice were photographed on 9 weeks after inoculation of JHU-011 cells, showing the obvious treatment effect of miR-196a inhibitor.

The result showed that the expression of miR-196a was evident in laryngeal cancer, but was under detection levels in the adjacent normal counterpart (Figure 6).

It has been suggested that there are tissue -dependent preference of isomiR [76], and our data revealed that miR-196a isomiRs are differentially expressed between cancer and non-cancer samples in terms of both quantitative and qualitative manner.

While squamous cell cancer cells (white arrowhead) with central necrosis (filled arrowhead) were observed in control (left panels), tumor cells were replaced with histiocytes after miR-196a inhibition (right panels).

Interestingly, the expression of miR-196a was slightly detected in the stromal area next to cancer in the FFPE sample.

In contrast, non-cancer tissues revealed low expression level of miR-196a in a form shorter than miRBase information.

miR-196a Detection and Localization in Laryngeal Cancer by in situ HybridizationTo verify the expression of miR-196a in laryngeal cancer tissue, we conducted in situ hybridization for mature miR-196a on paraffin-embedded tissue slices of both advanced T3 laryngeal cancer and normal mucosa obtained from unaffected side of the same clinical specimen.

On the other hand, cancer cells were replaced with histiocytes with no residual cancer cells in the miR-196a inhibitor treatment group (Figure 8C).

Finally, inhibition of miR-196a counteracted cancer cell proliferation in both laryngeal cancer-derived cells and mouse xenograft mo del.

To verify the expression of miR-196a in laryngeal cancer tissue, we conducted in situ hybridization for mature miR-196a on paraffin-embedded tissue slices of both advanced T3 laryngeal cancer and normal mucosa obtained from unaffected side of the same clinical specimen.

Furthermore, expression level of miR-196a was clearly higher in cancer tissues compared with noncancerous other tissues (adjacent noncancerous counterparts and benign laryngeal tissues, p = 0.0003; dysplasias, p = 0.0040) (Figure 3A).

Thus, of these 4 miRNAs, 3 miRNAs (i. e., miR-196a, miR-455-5p and miR-133b) showed significantly different expression levels in cancer tissues when compared with their matched control tissues and further quantification of miRNAs was performed using 48 laryngeal samples.

Expression levels of miR-196a were significantly higher in cancer tissues when compared with either NCs and benign samples or precancerous dysplasia samples.

0071480.g005 Figure 5(A) Expressions of miR-196a isomiRs were compared between 2 laryngeal cancer (T416 and T506; left panels) and 3 non-cancer (T421, T484 and T502; right panels) samples.

The study showed that increasing tendency of miR-196a expression level was observed when cancer samples were compared with noncancerous counterparts, benign tissues, or dysplasias (Figure 4A).

Notably, compared with pre-cancerous dysplasias, miR-196a expression was significantly higher in early T1a cancer in our study, suggesting the potential of miR-196a to be a very supportive or crucial tumor marker especially for early laryngeal cancer with frequent difficulty with pathological diagnosis [64].

Furthermore, significantly higher level of miR-196a expression was observed in early T1a cancer samples compared with precancerous dysplasia samples (right panel).

Furthermore, the role of miR-196a as one of the regulators of the ETS transcription factor ERG known as an adverse prognostic factor for acute leukemia has been also reported [71].

In situ localization of miR-196a in laryngeal tissues.

0071480.g006 Figure 6 In situ localization of miR-196a in laryngeal tissues.

In the current release of miRBase, both miR-196a-5p and-3p arm sequences are annotated in mir-196a-2 precursor, while miR-196a-5p but not-3p sequence is annotated in mir-196a-1 precursor.

There are two distinct genes for miR-196a, namely mir-196a-1 at chr17 and mir-196a-2 at chr12, and their transcribed mature miRNAs share the same 5′ arm sequence (miR-196a-5p, referred shortly as miR-196a) with their 3′ arm sequences slightly different.

Furthermore, high levels of miR-196a activates the AKT signaling pathway and promotes cancer cell detachment, migration, invasion, but does not impact on proliferation or apoptosis in the colorectal cancer cell line [69].

After one week, tumors were measured in three dimensions using calipers, and then either miR-196a inhibitor or control combined with AteloGene™ (KOKEN, Tokyo, Japan) (1 nmol/200 µl) was injected into the subcutaneous spaces around the tumors.

The repertoire of miR-196a isomiRs in laryngeal cancer and non-cancer tissues.

0071480.g004 Figure 4(A) The significance of miR-196a as a promising biomarker for laryngeal cancer was confirmed by TaqMan® qRT-PCR using 84 tissue samples.

+23) is in relative to the start site of the mature miR-196a miRBase entry as +0.

Negative control without miR-196a-specific probe is shown (right panel).

Our findings suggested that miR-196a could be a potential tumor marker in the FFPE tissue sample of laryngeal cancer.

miR-196a Detection and Localization in Laryngeal Cancer by in situ Hybridization.

By employing deep sequencing technique, the multiplicity and other frequent repertoire of isomiRs could be detected with miR-196a, including those are not annotated in the current release of miRBase.

Mean relative fluorescence unit of live cells or dead cells treated with control was set at 1 and the effect of miR-196a inhibition was evaluated.

There are 2 genomic loci that produce the same mature miR-196a-5p sequence, namely mir-196a-1 in chromosome 17 and mir-196a-2 in chromosome 12.

Thus, qRT-PCR analysis was performed on residual 4 miRNAs (i. e., miR-130b-5p, miR-196a, miR-455-5p, and miR-133b).

Short read alignments are shown against both mir-196a-1 precursor at chr17∶46709852-46709921[-] (GRCh37.p5 coordinates) (upper panels) and mir-196a-2 precursor at chr12∶54385522-54385631[+] (lower panels).

Our study provided the possibilities that miR-196a might be very useful in diagnosing and treating laryngeal cancer.

For in situ hybridization (ISH) of miR-196a, the 3′-DIG-labeled locked nucleic acid-incorporated miRNA probe (miRCURY LNA™ microRNA Detection Probe, Exiqon, Vedbaek, Denmark) was used in this study.

Actually, our preliminary data revealed that miR-196a could be detected in a serum sample obtained from advanced cancer patients (data not shown).

Heterogeneity of miR-196a isomiRs in Deep Sequencing Data.

After proteinase K digestion, the sections were fixed in 4% paraformaldehyde, and the slides were then hybridized with 4 pmol Exiqon’s miRCURY LNA detection probe complementary to miR-196a in hybridization buffer (50% formamide, 5×SSC, 0.1% Tween, 9.2 mM citric acid (pH 6), 50 µg/ml heparin, and 500 µg/ml yeast RNA) overnight at 50°C.

Boxed fields are presented with higher magnification in panel B. (B) miR-196a was detected both in cancer cells (right panel; filled arrowheads) and stroma (right panel; grey arrowheads), while not detected in normal squamous cell epithelium (left panel; white arrowheads).

To determine whether miR-196a mediates tumorigenesis in laryngeal cancer, we first evaluated the miR-196a inhibition in JHU-011 cell line primary derived from laryngeal cancer.

Together with these findings, miR-196a could be a favorable marker for laryngeal cancer.

Qualitative Difference of miR-196a isomiRs Revealed by Deep Sequencing.

Recently, it has been reported that miR-196a has a role in differentiation and proliferation of human adipose tissue-derived mesenchymal stem cells [70].

As mentioned in cardiac miRNAs in a recent report [79],miR-196a could be produced by stromal cells with a paracrine function.

Future studies on the detection of miR-196a on a higher number of patients are warranted.

miR-196a as a potential diagnostic marker for laryngeal cancer.

0071480.g003 Figure 3(A) Expression levels of miR-455-5p and miR-196a were measured by TaqMan® qRT-PCR using 48 tissue samples.

In situ Hybridization for miR-196a.

Among a series of miR-196a isomiRs detected in each sample, the most abundant ones in cancer samples were nearly equal to the canonical sequence deposited in miRBase entry (MIMAT0000226, 5′- uagguaguuucauguuguuggg −3′), while those in non-cancer samples were shorter at both ends with 1–2 nucleotides (Figure 5B).

3

Characteristically, a number of Hox genes are regulated by miRNAs [14], [27]– [29] and the Hoxc8 expression can be down-regulated by evolutionally conserved miR-196a via translational inhibition during vertebrate development [28].

The ASO against miR-196a suppressed the expression of Ucp1 (Figure 4G and 4H) and other brown-fat genes (Figure 4H), but not the leptin expression, indicating that miR-196a is necessary for the brown fat gene expression.

The miR-196a expression was suppressed in the transfected cells (Figure 4E) and the Hoxc8 expression was recovered in the transfected adipocytes (Figure 4F), indicating that Hoxc8 suppression was mediated by miR-196a.

After the adipogenic induction, the protein expression of Hoxc8 was suppressed in the Hoxc8-wt3′UTR-transduced cells than in Hoxc8-ΔmiR-196-BS- or Hoxc8-transduced cells (Figure S6B), suggesting that the suppression of Hoxc8 was dependent on the miR-196a -binding site in the Hoxc8 3′UTR.

miR-196a Regulates Hoxc8 Expression in Brown Adipogenesis of WAT-Progenitor CellsWe next sought to identify the mechanism underlying the down-regulation of Hoxc8 during brown adipogenesis.

The target gene of miR-196a is white-fat gene Hoxc8, which directly represses the expression of C/EBPβ, a master regulator of brown adipogenesis.

Thus, the upregulation of miR-196a is required for the induction of brown fat gene expression during the differentiation of WAT-progenitor cells.

In summary, during the brown adipogenesis induced by cold exposure or β3-adrenergic stimulations, miR-196a is induced in WAT-progenitor cells and suppresses Hoxc8, which targets C/EBPβ, an essential regulator of brown adipogenesis.

Taken together, miR-196a is upregulated in the WAT-progenitor cells during the inducible brown adipogenesis in mice and is required for the induction of brown fat gene expression.

Mechanistically, we observe that miR-196a acts by inhibiting the expression of the homeotic gene Hoxc8, a repressor of brown adipogenesis.

The SVF cells isolated from the miR-196a mice were EGFP -negative immediately upon isolation, but they became EGFP -positive while they were kept in culture (Figure S8A) and expressed miR-196a (Figure S8B), resulting in Hoxc8 suppression (Figure S8C and S8D).

miR-196a Induces Brown-Fat Genes Through Hoxc8 SuppressionWe next asked whether Hoxc8 was an essential target of miR-196a for the induction of brown-fat genes.

The miR-196a expression is required for the brown-fat gene expression and sufficient to induce metabolically functional brown adipocyte-like cells in WAT in mice.

Our findings imply the therapeutic potential of targeting the miR-196a- Hoxc8- C/EBPβ signaling pathway that induces metabolically functional brown adipocytes in WAT to treat obesity and its associated diseases.

miR-196a Regulates Hoxc8 Expression in Brown Adipogenesis of WAT-Progenitor Cells.

miR-196a is upregulated in WAT-progenitor cells during brown adipogenesis induced by cold or β-adrenergic stimulations.

The brown fat gene expression was specifically high in the Hoxc8-wt3′UTR-tranduced cells (Figure S6C), indicating that the induction of brown-fat genes was regulated in a manner dependent on the miR-196a -binding site of Hoxc8 mRNA.

These results suggest that miR-196a regulates brown-fat genes through suppression of Hoxc8.

More detailed analyses showed that miR-196a was induced by forskolin, an adenylyl cyclase activator, implying the significant role of cyclic AMP pathway to regulate miR-196a expression (Figure S4B).

Our findings suggest that the miR-196a- Hoxc8- C/EBPβ pathway may constitute a promising strategy for addressing the social and health problems caused by obesity and its associated diseases.

The concept that miR-196a induces brown adipogenesis through the suppression of Hoxc8, which might function as a gatekeeper of brown adipogenesis in WAT, facilitated us to investigate the target gene of Hoxc8 transcription factor.

For acute cold-exposure studies, 3- to 4-mo-old male mice were housed at 4°C for 5 h. For β3-adrenaline receptor stimulation, CL-316,243 (Sigma), at 0.5 mg/kg, was injected intraperitoneally once daily for 7 d. Transgenic mice with fat-specific forced expression of miR-196a were generated using a transgene encoding miR-196a driven by the enhancer/promoter of the aP2 gene [30], and littermates were used as the wild-type controls.

Thus, miR-196a expression is induced in the SVF cells in mice exposed to β3-adrenergic stimulation or cold exposure.

Antisense oligonucleotide against miR-196a (Anti-miR miRNA inhibitor, AM10068, Ambion) was transfected according to the manufacturer's instruction.

miR-196a is required for the brown fat gene expression and is sufficient to induce metabolically functional brown adipocyte-like cells in mice.

The endogenous expression of Hoxc8 and miR-196a was much lower in iBAT than in ingWAT and epiWAT.

We show that forced expression of miR-196a in mouse adipose tissue increases BAT content and energy expenditure, thereby rendering the animals resistant to obesity and diabetes.

miR-196a is induced in SVF cells during brown adipogenesis and is required for UCP1 expression.

Figure S8Gene expression analysis in the WAT-progenitor cells derived from the miR-196a mice.

The miR-196a expression levels were comparable among the different fat depots in the miR-196a mice (Figures 5C and S10).

Based on the finding that the miR-196a expression is induced during the brown adipogenesis in WAT in mice, we next investigated whether the miR-196a induction is required for the induction of brown adipogenesis and Hoxc8 suppression.

miR-196a post-transcriptionally suppress Hoxc8, which is one of the white-fat genes.

The SVF cells isolated from the miR-196a mice expressed brown-fat genes more highly than the cells from wild-type (WT) mice after differentiation in vitro (Figure S8F), indicating that miR-196a promotes brown adipocyte differentiation of the WAT-progenitor cells.

We next asked whether Hoxc8 was an essential target of miR-196a for the induction of brown-fat genes.

Figure S3 The expression of miR-196a and Hoxc8 in SVF and adipocyte fraction.

It is known that different WAT depots respond to brown fat-inducing stimulations to different extents [31], and we therefore addressed the responses to the miR-196a expression in different fat depots.

We elucidated that miR-196a is induced in the WAT-progenitor cells after the induction of brown adipogenesis, is required for the induction of brown fat gene expression, and is sufficient to induce the metabolically functional brown adipocyte-like cells in WAT.

We find that the expression levels of a microRNA, miR-196a, positively correlate with the conversion of WAT to BAT under cold exposure conditions.

The miR-196a expression is induced in the WAT-progenitor cells in mice exposed to cold or β3-adrenergic stimulation.

The miR-196a expression level was significantly lower in iBAT than WAT (Figure S4C) and was not altered during the differentiation of the iBAT-SVF cells (Figure S4D), suggesting that miR-196a might not be involved in conventional brown adipogenesis in iBAT.

The induction of miR-196a is required for the brown fat gene expression and is sufficient to generate the metabolically functional brown adipocyte-like cells in WAT in mice.

As a result, miR-196a enhanced the brown fat gene expression during differentiation, indicating the cell-autonomous function of miR-196a (Figure S9).

miR-196a has been implicated in the in vitro osteoblast differentiation of human fat progenitor cells, where miR-196a suppresses Hoxc8 [47], but the in vivo relevance remains unknown.

Figure S10 The miR-196a expression levels in tissues of the miR-196a mice.

For lentivirus -mediated shRNA expression, pLenti6-miR-196a, -shHoxc8, and -shLacZ were generated from pcDNA6.2 constructs by Gateway reactions.

The forced expression of miR-196a in mice did not yield appreciable effects in iBAT.

Thus, the miR-196a- Hoxc8- C/EBPβ pathway underlies the brown adipogenesis in WAT (Figure 8) and might be a therapeutic target for the treatment of obesity and type 2 diabetes.

In vitro, the miR-196a expression is induced during the differentiation of WAT-progenitor cells derived from both mice (Figure 4D) and humans (Figures S4A).

To ask whether the miR-196a function is cell-autonomous, the human WAT-progenitor cells were transduced with lentivirus expressing miR-196a.

We created transgenic mice in which miR-196a and EGFP were expressed under the control of the aP2 promoter/enhancer, which is exclusively active in adipose tissues [30].

miR-196a Induces Brown-Fat Genes Through Hoxc8 Suppression.

We found that the miR-196a expression was induced in WAT depots of mice exposed to cold environment or β3-adrenergic stimulations (Figure 4A).

The target gene of miR-196a is Hoxc8, which is categorized as a white-fat gene with a previously undermined role in adipogenesis.

We found that miR-196a suppresses Hoxc8, thereby derepressing C/EBPβ, which leads to the activation of the brown fat gene program.

Figure S4The expression analysis for miR-196a.

A schematic of miR-196a-regulated brown adipogenesis of WAT-progenitor cells.

Based on the hypothesis that Hoxc8 might be regulated by miR-196a, we investigated the miR-196a expression during the brown adipogenesis in mice.

To interrogate the mechanism behind the obesity resistance of the miR-196a mice, indirect calorimetry was performed.

The miR-196a binding site (CCCAACAACTGAGACTGCCTA) was deleted to generate Hoxc8-ΔmiR-196a-BS.

The core body temperature was higher in the miR-196a mice than in the WT mice (Figure 6F).

The in situ hybridization analysis of miR-196a showed the induction of miR-196a in WAT after CL-316,243 administration (Figure 4C).

More specifically, miR-196a was more highly induced in the SVF cells (Figure 4B) than in mature adipocytes (Figure S3).

1001314.g008 Figure 8Cold temperatures or β3-adrenergic stimulations induce miR-196a in the WAT-resident progenitor cells in mice.

To address the necessity of miR-196a in the brown adipogenesis, antisense oligonucleotide (ASO) against mR-196a was transfected to the mouse SVF cells.

These results imply that miR-196a prevented the mice from developing insulin resistance, the premorbid condition of type 2 diabetes.

1001314.g006 Figure 6(A) The appearance of the WT and miR-196a mice fed a high-fat diet for 16 wk.

The transgenic mice (hereafter, the miR-196a mice) were born in a Men delian ratio and were viable.

Cold temperatures or β3-adrenergic stimulations induce miR-196a in the WAT-resident progenitor cells in mice.

In this work, we elucidated that miR-196a induces functional brown adipocytes in WAT in mice.

The sections were hybridized with 3′-digoxygenated probes (18 pmol/ml, miR-196a-AS-LNA1: cCcaAcaAcaTgaAacTacCta, Control (Ctrl)-LNA1: cGacTacAcaAatCagCgaTtt, capitals denote LNA) in Probe Diluent-1 (Genostaff) at 50°C for 16 h and washed in 5× HybriWash (Genostaff) at 50°C for 20 min, 50% formamide in 2× HybriWash at 50°C for 20 min, twice in 2× HybriWash at 50°C for 20 min, and twice in 0.2× HybriWash at 50°C for 20 min.

The miR-196a complementary site was deleted to generate pCX4-HOXC8-ΔmiR-196-BS (binding site).

Thus, miR-196a induces the brown adipocyte-like cells with characteristic appearance and gene expression profile of brown adipocytes in WAT.

The sections were probed with a miR-196a-antisense (AS) probe or control (Ctrl) probe.

miR-196a induces brown adipocyte-like cells in WAT.

Figure S11The weight reduction in the miR-196a mice is attributable to a reduced fat accumulation.

Figure S12Oxygen consumption rates and energy expenditure in the WT and miR-196a mice fed a high-fat diet.

In the glucose tolerance tests, the miR-196a mice showed lower blood glucose (Figure 6G) and insulin levels (Figure 6H).

The miR-196a Show Resistance to Obesity and Improved Glucose Metabolism.

These findings suggest that miR-196a boosted the cellular energy combustion through the induction of brown adipocyte-like cells.

We cloned the wild-type (Hoxc8-wt3′UTR) and miR-196a -binding site- deleted (Hoxc8-ΔmiR-196-BS) Hoxc8-3′UTR into a pCX4 retroviral vector and transduced these constructs into human WAT-progenitor cells (Figure S6A).

1001314.g005 Figure 5 Based on the finding that miR-196a is capable of inducing the brown adipocyte-like cells, we next addressed whether they were metabolically functional.

The WT mice exhibit more severe fatty livers than the miR-196a mice.

There are two genes encoding miR-196a (miR-196a-1 and miR-196a-2) located within the Hox gene clusters [28].

The weight of the inguinal fat, epididymal WAT and liver is significantly lower in the miR-196a mice than in the WT mice.

We next analyzed impacts of miR-196a on glucose metabolism in the miR-196a mice.

The miR-196a mice show resistance to obesity and improved glucose metabolism.

Taken together, these findings suggest that the miR-196a -induced brown adipocyte-like cells are metabolically functional and have favorable impacts on glucose metabolism in mice.

The qRT-PCR analysis of miR-196a in tissues of the miR-196a mice.

Our observations indicate that miR-196a has only a modest, if any, effect on iBAT.

miR-196a Induces Brown Adipocyte-Like Cells in WAT.

We here show that single miRNA miR-196a is capable of recruiting the metabolically functional brown adipocytes in WAT in mice.

Based on the finding that miR-196a is required for the inducible brown adipogenesis, we next addressed whether miR-196a is capable of inducing brown adipogenesis in mice.

In the iBAT, no appreciable influence of miR-196a was observed (Figure 5D and 5E).

4

In this study we identified a miRNA (miR-196a) targeting bovine NOBOX, examined the temporal expression of miR-196a during bovine early embryonic development and determined the effect and specificity of miR-196a in regulating bovine NOBOX expression both exogenously (HeLa cells) and endogenously in early embryos.

Since we determined in heterologous systems that miR-196a is capable of regulating NOBOX expression through direct binding to the 3' UTR of its mRNA, the ability of miR-196a to regulate endogenous NOBOX expression in early embryos was determined.

In order to examine if miR-196a expression is inversely correlated to bovine NOBOX expression during early embryonic development, we analyzed miR-196 expression during oocyte maturation and early embryogenesis.

Moreover, when the spatio-temporal expression pattern of miR-196a is compared with the expression pattern of bovine NOBOX during early embryogenesis, miR-196a expression increases steadily from two-cell to eight-cell stage of embryogenesis, while NOBOX expression decreases gradually during the same period [29].

A significant inhibition of NOBOX expression was observed in HeLa cells ectopically expressing both NOBOX and miR-196a (Figure 3A) relative to cells transfected with NOBOX alone.

Furthermore, miR-196a regulates mammalian development via targeting homoeobox clusters [22] and misexpression of miR-196a leads to specific eye anomalies in a dose -dependent manner in Xenopus laevis [23].

Similarly, the activity of a luciferase construct containing the entire 3' UTR of bovine NOBOX was suppressed, and the regulation was abolished by mutations in the miR-196a binding site indicating that the predicted MRE is critical for the direct and specific binding of miR-196a to the NOBOX mRNA.

Collectively, our results demonstrate the ability of miR-196a to negatively regulate NOBOX expression in a sequence specific fashion and the ability of miR-196a to suppress NOBOX mRNA and protein in early embryos.

Expression analysis of miR-196a in bovine oocytes and during early embryonic development indicated that it is expressed both in oocytes and embryos and tends to increase at the four-cell and eight-cell stages.

Ectopic expression of NOBOX and miR-196a in HeLa cells inhibited the expression of NOBOX protein compared to the control cells without miR-196a.

Semi-quantitative analysis of western blot data showed a significant inhibition of NOBOX expression in the miR-196a -transfected cells (Figure 3B).

Ectopic expression of miR-196a by transfection of miR-196a duplex into the HeLa cells suppressed activity of a chimeric luciferase construct containing the miR-196a MRE of NOBOX at its 3' end (Figure 4B).

miR-196a specifically suppresses the expression of bovine NOBOX.

The involvement of miR-196a in regulating the expression of NOBOX supports a new role of this miRNA in early embryonic development during MET.

Furthermore, ectopic expression of miR-196a mimic in bovine early embryos significantly reduced the NOBOX expression at the both mRNA and protein levels.

Figure 3Regulation of bovine NOBOX expression by miR-196a in vitro in HeLa cells.

In addition, when the NOBOX sequence was analyzed with other miRNA target prediction algorithms, miR-196a always was listed as a top candidate miRNA, further indicating that miRNA-196a might be a potential post-transcriptional regulator of NOBOX in early embryos.

Recent studies showed that 75% of tumors express high levels of miR-196a and miR-196a is involved in regulating key pathways such as AKT signaling, p53 and WNT signaling pathways [49, 50].

It has also been reported that miR-196a is differently regulated during polycystic kidney disease suggesting that miR-196 is important for normal functioning of kidney [51].

Thus, the inverse relationship between miR-196a and NOBOX expression/activity supports the proposed role of miR-196a as a physiological regulator of NOBOX during early embryogenesis.

Figure 4 miR-196a specifically binds to the 3' UTR of bovine NOBOX and regulates its expression.

Ectopic expression of miR-196a mimic in bovine embryos effectively reduced NOBOX protein expression in eight-cell embryos compared to uninjected and the negative control miRNA -injected embryos (Figure 5A).

Thus, a similar mechanism is likely to be involved in the miR-196a negative regulation of NOBOX expression in bovine embryos during MET.

Moreover, recent studies support a functional role for this specific miRNA as miR-196a targets specific homeobox genes (HoxB8, HoxC8, HoxD8 and HoxA7) in mouse embryos and mammalian cells and plays a major role in animal development [22].

Mutation of the mir-196a miRNA recognition element (MRE) in the NOBOX 3' UTR was performed using the QuickChange site-directed mutagenesis kit (Stratagene, Santaclara, CA) according to the manufacturer's instructions.

These results unequivocally show that bovine NOBOX is regulated at the post-transcriptional level by miR-196a and further supports the hypothesis that miR-196a is responsible for the negative regulation of NOBOX.

Expression analysis indicates that bovine miR-196a is increased in four-cell and eight-cell stage embryos relative to germinal vesicle stage oocytes and declines at morula and blastocyst stages (Figure 2B).

The increased expression level of miR-196a near the eight-cell stage of embryogenesis potentially indicates miR-196a involvement in maternal transcript degradation during the maternal-to-zygotic transition, as was observed for miR-430 in zebrafish [10] miR-427 in Xenopus [38] and miR-290 in mouse [20].

Figure 2 Spatial and temporal expression profile of miR-196a.

As shown in Figure 2A, miR-196a is expressed predominantly in kidney; it is also detected significantly in fetal and adult ovary, brain and hypothalamus.

miR-196a is spatio-temporally regulated during development.

A similar expression pattern was observed in mice where miR-196a is enriched in the kidney and adult reproductive tissues [37].

The relative amount of miR-196a was expressed as relative fold change using the sample with the lowest value as the calibrator (n = 4, mean ± SEM).

Nucleotides changed to generate the target site mutant 3' UTR are underlined (B) Repression of luciferase activity due to specific interaction between miR-196a and the predicted MRE in the luciferase-NOBOX-3' UTR constructs.

Figure 5 Microinjection of miR-196a mimic represses endogenous NOBOX expression in bovine early embryos.

Quantity of miRNA-196a was normalized to abundance of RPS18 mRNA and abundance expressed as relative fold change using the sample with the lowest value as the calibrator (n = 4 per tissue; mean ± SEM depicted).

To determine the tissue specific expression pattern of miR-196a, quantitative real-time PCR was performed.

Mature miRNA-196a mimic (MIMAT0000226) and negative control cel-miR-67 (CN-001000-01-05) were obtained from Dharmacon Technologies (Dharmacon Inc, Lafayette, CO), and diluted with RNase free water to a final concentration of 10 μM and 20 μM before microinjection (The final concentration used for microinjection was 20 μM based on initial experiments showing this concentration is more effective in repressing Nobox expression).

The efficiency of NOBOX mRNA/protein knockdown in miRNA-196a mimic injected and control embryos was determined by quantitative real-time PCR analysis and immunocytochemistry in eight-cell stage embryos as described previously [30].

Collectively, our results demonstrate that miR-196a is a bona fide negative regulator of NOBOX during bovine early embryogenesis.

Luciferase activity was restored when a four-base mismatch mutation was introduced into the seed region of the miRNA-196a recognition sequence in the NOBOX 3' UTR (Figure 4B).

Mutations in the predicted MRE in the 3' UTR of the NOBOX for miR-196a were created such that interaction between miR-196a and NOBOX is compromised (Figure 4A).

These data indicate the predicted MRE is critical for the direct and specific binding of miR-196a to NOBOX transcript.

Future studies of interest will investigate whether loss of miR-196a has any effect on the early embryonic development and identify putative miR-196a targets by next generation sequencing analysis of miR-196a depleted and wild type embryos.

To confirm the binding of miR-196a to bovine NOBOX in vitro, HeLa cell transfection studies were conducted.

miR-196a is an evolutionary conserved miRNA that has been identified in a wide range of vertebrate species.

RNA secondary structure prediction analysis using Mfold [34] revealed that the apparent miR-196a binding site was positioned on a hairpin-loop structure, in an exposed position, which might facilitate miRNA accessibility.

Figure 1 Prediction of a miR-196a binding site in the 3' UTR of bovine NOBOX mRNA.

miR-196a binds to the 3' UTR of bovine NOBOX.

miR-196a was chosen for further studies, because the predicted MRE in the bovine NOBOX 3' UTR had a low predicted free energy of hybridization with the cognate miRNA (-19.8 kcal/mol), suggesting a stable miRNA: mRNA duplex within the 9 nucleotide (nt) seed region at the 5' end of the miRNA (Figure 1).

Repression of luciferase reporter gene activity by miR-196a was abolished when the MRE was mutated.

The predicted miR-196a binding site is underlined.

miR-196a represses endogenous NOBOX in bovine early embryos.

Microinjection of miR-196a mimic in bovine embryos significantly reduced NOBOX mRNA levels in eight-cell embryos by more than 80% relative to uninjected and negative control miRNA -injected embryos (Figure 5B).

Using an algorithm "MicroInspector", a potential microRNA recognition element (MRE) for miR-196a was identified in the 3' UTR of the bovine NOBOX mRNA.

The lack of conservation of miR-196a recognition sequence in bovine NOBOX might be due to the rapid drifting of 3' UTR during evolution [31, 35].

Furthermore, luciferase reporter assays were performed to validate specificity of the miR-196a regulation of NOBOX through the predicted miR-196a recognition sequence in the 3' UTR of NOBOX.

5

Additionally, TargetScan was used to identify the potential targets of miR-196a, and was used to mine the potential pathways further correlating with the miR-196a target genes acquired from TargetScan.

The predicted target genes of miR-196a were obtained via TargetScan 6.2 (http://www.

0137637.g001 Fig 1 Microarray data (GSE47500) was used to compare the expression profiling between HD transgenic mice (GHD) and HD transgenic mice overexpressing miR-196a (D-Tg).

Microarray data (GSE47500) was used to compare the expression profiling between HD transgenic mice (GHD) and HD transgenic mice overexpressing miR-196a (D-Tg).

In sum, we analyzed the microarray data to compare the differential profiling of gene expression in HD transgenic mice with or without miR-196a overexpression via three different bioinformatics tools.

In order to compare the expression profiling between HD transgenic mice (GHD) and HD transgenic mice overexpressing miR-196a (D-Tg), we analyzed our previously published microarray data (GSE47500) [14].

The orange bar stands for significant genes (P < 0.05) acquired from microarray data, while the blue bar is the expected gene directly interacting with miR-196 from TargetScan.

The top six pathway maps are presented in Fig 1. In brief, the downstream targets of miR-196a not only predominantly affect “tissue remo deling and wound repair” but also influence “vascular development”, “mitogenic signaling”, “DNA-damage response”, “cell differentiation” and “apoptosis”.

Since several studies have addressed the effects of miR-196a on neuronal diseases [41, 42], it is anticipated that the results of this analysis based on high throughput screening will provide insights that can aid in the development for therapeutic strategies for treating HD.

The biological processes highly correlated with miR196a-regulated genes are listed in Fig 1. In short, the first process is “ATP -binding cassette (ABC) transporters” with the most significance, and the 2 [nd] is “retinoic acid-inducible gene 1 (RIG-I)-like receptor signaling pathway” while the 3 [rd] enriched pathway is “prion diseases”.

Two HD transgenic mice and three HD transgenic mice overexpressing miR-196a at approximately 12 months of age were used for this microarray analysis.

At this stage, HD transgenic mice showed severe motor dysfunctions, whereas HD transgenic mice overexpressing miR-196a displayed mild motor dysfunctions[14].

Using analyses of, and, we organized the possible regulatory pathways, such as those of “ABC transporters”, “RIG-I-like receptor signaling”, “immune system”, “issue remo deling and wound repair”, and so on, controlled by miR-196a in HD, as shown in Fig 1. These results show the possible effects of miR-196a on HD, and it is anticipated that they will help in the development of therapeutic strategies to treating HD.

In particular, most neuronal diseases are highly related to the functions of the cytoskeleton, suggesting one potential direction for investigating the working mechanisms of miR-196a.

Since both the ubiquitin-proteasome system and MAPK signaling are highly involved during HD pathogenesis, this suggests that RIG-I may be an important upstream regulator contributing to the effects of miR-196a in HD.

GO term analysis was performed to identify biological processes enriched among miR-196a regulated genes (P < 0.05).

The results showed that miR-196a has the potential to provide neuroprotective functions through regulation of the cytoskeleton in HD.

We thus chose 4.0 as another approach to identify the possible biological pathways regulated by miR-196a in HD.

Based on the analyses of altered genes via and systems, the specific regulatory pathways affected by miR-196a in HD were predicted.

According to our previous study, a specific miRNA, miR-196a, could ameliorate the HD phenotypes in cell, transgenic mouse and induced pluripotent stem cell mo dels [14], suggesting that it regulates endogenous pathways to improve HD.

Moreover, RIG-I associates with actin, a fundamental component of the cytoskeleton [29], suggesting miR-196a may also regulate the neuronal structure through not only ABC transporters, but also RIG-I-like receptor signaling pathways.

These results strongly suggest that miR-196a not only improves the pathological and behavioral phenotypes, but also works through these well-defined pathways of gene regulation in HD.

To further comprehensively investigate the affected pathways of gene regulation, we performed high-throughput mRNA microarray (GSE47500) by using striatal tissues from HD transgenic mice and HD transgenic mice overexpressing miR-196a.

The miR-196a contains the precursor hsa-miR-196a-2 (accession number: MI0000279) under control of a human ubiquitin promoter and a red fluorescence protein (RFP) gene for observation.

N2a cell were transfected with different constructs, including HTT19Q (A), HTT84Q (B), miR-non relative control (NC; D), miR-196a (E), HTT84Q+miR-196a (G) or HTT84Q+miR-NC (H), and neurite outgrowth was analyzed though the Neurite Outgrowth Application Module of the MetaMorph software.

These constructs include HTT19Q (a construct for the control of HD), HTT84Q (a construct for the control of HD), miR-196a and miR-NC.

0137637.g004 Fig 4 N2a cell were transfected with different constructs, including HTT19Q (A), HTT84Q (B), miR-non relative control (NC; D), miR-196a (E), HTT84Q+miR-196a (G) or HTT84Q+miR-NC (H), and neurite outgrowth was analyzed though the Neurite Outgrowth Application Module of the MetaMorph software.

The effects of miR-196a on HD related pathways.

In particular, cytoskeleton remo deling related to HD is involved in the effects of miR-196a as described above (Table 3).

Putting these results together also suggests that miR-196a might affect the cytoskeleton, and thus have beneficial effects in HD.

The phenotypes of HD were alleviated by miR-196a in our previous study[14], and in current work we showed that several genes and critical pathways related to HD were also altered in our microarray data (Tables 2 and 3; Fig 3).

Fluorescent images(A, B, D, E, G and H) show the morphology of neurite outgrowth in different groups as indicated, and statistically quantitated data between HTT19Q and HTT84Q (C), Control and miR-196a (F) and HTT84Q + miR-196a and HTT84Q + miR-NC (I) are shown.

These results help to validate some of the bioinformatic analyses, and suggest that miR-196a might provide protective effects with regard to HD through enhancement of the cytoskeleton.

These results suggest miR-196a does alter several critical pathways related to HD.

was first used to survey categorical data for Gene Ontology (GO), and then the data was imported into to narrow down the miR-196a related biological processes.

In addition, our examination of neurite outgrowth revealed that this was also enhanced after an increase in miR-196a (Fig 4).

Based on above results of the above analyses, we speculate that miR-196a might enhance the neuronal cytoskeleton to improve pathological phenotypes in HD.

The results of GO term analyses using thus strongly suggest that miR-196a might enhance the neuronal skeleton to improve pathological phenotypes in HD.

These results are not only consistent with the analyses of and, but also show the important role of the cytoskeleton with regard to the beneficial functions that miR-196a has in HD.

Since the phenotypes of HD were alleviated by miR-196a in our previous study[14], in the current work we are attempting to comprehensively analyze the effects of miR-196a on HD-related pathways.

In our previous studies, we showed that miR-196a could improve the neuropathological phenotypes in different mo dels of HD [14].

The effects of miR-196a on neurite outgrowth in N2a mouse neuroblastoma cells.

GO term analyses using showed “ABC transporters” and “RIG-I-like receptor signaling pathway” are the top two clustered biological processes which may be involved in the beneficial effects of miR-196a on HD.

We have now identified several critical pathways influenced by miR-196a in HD using a bioinformatic approach, and provided new insights with regard to the protective mechanisms of miR-196a in HD.

6

In contrast, although miR-196a is elevated in Crohn's disease [27], changes in its level of expression during mouse aging is not yet reported.

Panel (A) shows composite graphs for expression of miR-34a, while panel (B) shows the levels of expression of miR-196a in brain, PBMCs, and plasma.

Parallel study of miR-196a shows that the level of this microRNA remains stable with age in all three specimens examined, and therefore serves as a control for age-independent regulation of its expression.

S-Figure 2Panels (A-B-C) present box plot graphs of miR-196a expression in PBMCs, plasma and brain samples, along with graphs of the 1/ delta CT trend.

Thus, our study of microRNA expression over a life span from neonatal to old age was performed with miR-34a as our focus of interest, and miR-196a as a control.

Age -dependent expression levels of miRNA-196a in various tissues of C57/B6 mice.

Panels (A-B-C) present box plot graphs of miR-196a expression in PBMCs, plasma and brain samples, along with graphs of the 1/ delta CT trend.

Statistical analysis of miR-34a and miR-196a expression in blood and tissue samples of C57/B6 mice.

In contrast to the increased miR-34a expression with age, levels of miR-196a remain stable throughout all age groups studied here, from 2 days till 25 months of age.

The 1/ΔCT values of qPCR results for the expression levels of miR-34a, miR-196, and controls among different age groups were analyzed by Student's t tests, with p values < 0.05 as statistically significant difference between any two groups presented in all the graphs for this assay.

Total RNA samples extracted from PBMCs, plasma and brain specimens from age groups from 2 days to 25 months were reverse transcribed for quantitative PCR (qPCR) to determine their levels of mmu-miR-34a and mmu-miR-196a.

7

Endogenous miR-125b expression was the most significantly up-regulated in type II EC samples compared with type I. QRT-PCR was performed to validate the expression of endogenous miRNAs (n = 6, miR-125b, miR-196b, miR-625, miR-196a*, miR-29a, and miR-140-5P), which were significantly up-regulated in our microRNAs microarray, in type I (endometrioid) and type II (papillary serous) EC samples.

Click here for file Endogenous miR-125b expression was the most significantly up-regulated in type II EC samples compared with type I. QRT-PCR was performed to validate the expression of endogenous miRNAs (n = 6, miR-125b, miR-196b, miR-625, miR-196a*, miR-29a, and miR-140-5P), which were significantly up-regulated in our microRNAs microarray, in type I (endometrioid) and type II (papillary serous) EC samples.

Meanwhile, we selected significantly up-regulated miRNAs (n = 6, miR-125b, miR-196b, miR-625, miR-196a*, miR-29a, and miR-140-5P) in our microRNAs microarray (unpublished data) and validated their expression in type I and type II (each 10 cases) EC samples by qRT-PCR.

8

The competition between HuD and miR-196 for binding to insulin2 mRNA may explain the mechanism of translation upregulation by miR-196b.

As miR-196b also targets the 5′UTR of insulin2 mRNA, we sought to determine if there is any interplay between HuD and miR-196 in controlling Insulin2 translation.

miR-196b inhibitor blocks the miR-196 mediated activation of insulin2-5′UTR-Luciferase translation (Fig. 2B).

We assessed the specificity of the miR-196b -mediated translation regulation by using a miR-196 antagonist, antisense miR-196b.

We detected miR-196, miR-30d and miR-375 in βTC6 cells using QuantiMir RT-PCR kit (Fig. 5A-B).

Myc-HuD plasmid (500 ng) was transfected to HEK29T cells before the transfection of insulin2 reporter and miR-196.

miR-196 or control duplexes were transfected at 40 nM concentration for 4 hr in the presence of Opti-MEM without serum and then substituted with complete medium with serum for further 2 hr before transfecting with the reporter plasmids.

0101084.g004 Figure 4(A) Lysates prepared from βTC6 cells transfected with Ctrl miRNA or mature miR-196 were fractionated through sucrose gradients to generate polysome profiles.

9

Literature mining revealed that the differentially expressed microRNAs miR-196a-5p, miR-127-3p and miR-206-3p are found to be expressed in hair follicles of mice skin [21].

Importantly, the “transcriptional misregulation in cancer” pathway is affected by most of our differentially expressed miRNAs (miR-136-5p, miR-196a-5p, miR-196b-5p, miR-376a-3p, miR-335-5p, and miR-206-3p) significantly (p<0.001) (Figure 3A).

The B. is showing the expression pattern of miRNAs miR-31-5p, miR-196-5p, miR-127-3p, miR-206-3p, miR-411-5p, miR-709-5p, and miR-322-5p in UVR -induced SCC samples from wild type FVB mice.

Some of the miRNAs were significantly down-regulated [miR-196a-5p (p=0.05), miR-709-5p (p=0.003), miR-206-3p (0.001), miR-411-5p (p=0.03)] along with others miR-127-3p, miR-322-5p in UVR -induced SCC samples (n=3) compared to the uninvolved skin (n=3) (Figure 2B).

We also determined the expression pattern of miRNAs such as miR-196a-5p, miR-127-3p, miR-411-5p, and miR-206-3p in UVR -induced SCC samples from wild type FVB mice.

We also observed the differential expression of miR-196a-5p, miR-127-3p, and miR-206-3p in our samples.

There were two highly suppressed miRNAs (log fold change =2) miR-196a-5p and miR-196b-5p following acute UVR exposure compared to untreated WT mice.

10

Of these miRNAs, the down-regulation of miR-196a-5p, -196b-5p, -10b-3p, -10a-5p, -615-3p, and -505-5p and the up-regulation of miR-144-5p, -542-3p, -200a-3p, -182-5p and -451a were further confirmed in the CSF of PD patients.

The miR-196a-5p, -196b-5p, -10b-3p, -10a-5p, -615-3p, and -505-5p were down-regulated, whereas miR-144-5p, -542-3p, -200a-3p, -182-5p and -451a were up-regulated.

In the miRNA signatures of PD, we found the miRNAs with dramatic change of expression, included miR-196a-5p, -196b-5p, -10b-3p, -10a-5p, -615-3p, -505-5p, -144-5p, -542-3p, -200a-3p, -182-5p and -451a that expressed in the body fluids and associated with mutant α-synuclein aggregation.

11

miR-196a did not regulate Exp-Htt levels directly, but rather indirectly, probably through the regulation of the ubiquitin-proteasome system, gliosis, and the CREB pathway.

The down-regulation of Exp-HTT by miR-196a is of prime importance, since it forms the bases of new strategies for allele-specific silencing in HD.

One important finding in this regard was that Exp-HTT itself was down-regulated by miR-196a.

Very recently, miR-196a was shown to reduce the expression of Exp-HTT in vitro, and to improve molecular, pathological, and behavioral phenotypes in a HD transgenic mouse mo del (107).

An elegant demonstration of this assumption was recently made both in vitro and in vivo, using miR-196a, including in IPSC from HD patients.

Of importance, miR-196a ameliorated the formation of aggregates in iPSC (inducible Pluripotent Stem Cells) from HD patients, when differentiated in the neuronal stage.

12

We then chose to validate the expression of five miRNA, including miR-196a, a miRNA involved in proliferation and apoptosis and one previously shown by us to be regulated by the AhR in lung fibroblasts 12.

These analyses revealed that there were no significant change in the expression of miR-34c (Fig. 6A), miR-196a (Fig. 6B) or miR-146a (Fig. 6C) in mice exposed to cigarette smoke for 4 weeks.

There was no change in the expression of (A) miR-34c, (B) miR-196a or (C) miR-146a in response to cigarette smoke.

miRNA expression was assessed by two-step TaqMan [®] RT-PCR (Applied Biosystems, Carlsbad, CA) for miR-196, miR-146a, miR-135b, miR-96, miR-34c, and U6 snRNA, a small nuclear RNA (snRNA) used as an internal control for miRNA analysis.

The reason for this difference is not clear, but suggests that there is some cell-specific regulation of miR-196a by the AhR (i. e. in lung fibroblasts but not other pulmonary cell types).

There was no significant change in the levels of miR-196a in response to cigarette smoke in either Ahr [−/−] and Ahr [+/−] mice, consistent with our in vitro experiments where cigarette smoke extract (CSE) also did not increase miR-196a 12.

These miRNA included miR-196a, miR-96 and miR-34c (Fig. 3, green circles).

We also selected for validation by miRNA that were not altered by smoke exposure, including miR-196a (data not shown).

13

To confirm the consistent pattern and involvement of UVR -induced selected miRNAs in cutaneous SCC samples, the expression of miR-31-5p, miR-196a-5p, miR-206-3p, miR-127-3p, and miR-411-5p were checked in cSCC samples collected from SKH1 mice induced by repeated UVR exposure.

These results support the consistent reproducible expression pattern of miR-31-5p, miR-196a-5p, miR-206-3p, miR-127-3p, and miR-411-5p in UVR -induced cSCC samples from SKH1 mice.

Figure 3 A-E. is showing the expression pattern of miR-31-5p, miR-196-5p, miR-127-3p, miR-206-3p, and miR-411-5p in UVR -induced skin cSCC samples from SKH1 mice.

However, other miRNAs, miR-196a-5p (p<0.0001); miR-206-3p (p<0.0001); miR-127-3p (p<0.0001); and miR-411-5p (p=0.0002) were significantly down-regulated in three to six UVR -induced cSCC samples from SKH1 mice compared to the uninvolved skin (Figure 3).

A-E. is showing the expression pattern of miR-31-5p, miR-196-5p, miR-127-3p, miR-206-3p, and miR-411-5p in UVR -induced skin cSCC samples from SKH1 mice.

The suppression of miR-196a-5p, miR-206-3p, miR-127-3p, and miR-411-5p was observed in UVR -induced cSCC samples from SKH1 mice compared to uninvolved SCC free skin.

14

Further studies need to be performed on a larger cohort to establish that miR-196a is a potential therapeutic target and can impact multiple downstream targets in canine osteosarcoma.

They observed that miR-196a is downregulated in many of the canine osteosarcoma tumors compared to the normal bone, which is in contradiction with some earlier studies [66, 81].

Pazzaglia L. Leonardi L. Conti A. Novello C. Quattrini I. Montanini L. Roperto F. del Piero F. di Guardo G. Piro F. miR-196a expression in human and canine osteosarcomas: A comparative study Res.

A recent study investigated the role of miR-196a and its target Annexin V in human (143B, MG63) and canine (DAN) osteosarcoma cell lines to identify potential targets for new therapeutic agents in both the species [80].

Zhang W. Zhang C. Chen H. Li L. Tu Y. Liu C. Shi S. Zen K. Liu Z. Evaluation of microRNAs miR-196a, miR-30a-5P, and miR-490 as biomarkers of disease activity among patients with FSGS Clin.

15

There was a strikingly high level of conservation of HOX gene sequence and structure and non-protein coding genes including the microRNAs miR-196a, miR-196b, miR-10a and miR-10b and the long non-coding RNAs HOTAIR, HOTAIRM1 and HOXA11AS that play critical roles in regulating gene expression and controlling development.

Non-coding RNAs known to be involved in regulation of HOX gene expression [16, 17], include the highly conserved microRNAs [18], such as miR-196[19] and miR-10[20].

In silico analysis as well in vitro and in vivo experiments have shown that the miRNAs miR-10 and miR-196 target several HOX genes, such as HOXA5/7/9, HOXB1/6/7/8, HOXC8, HOXD8, HOXA1/3/7, HOXB3 and HOXD10 [18- 20, 50, 51].

Using the tammar as a reference and searching the microRNA database we were able to identify four known HOX microRNAs (miR-196a miR-196b miR-10a and miR-10b), and most significantly, we uncovered one new potential microRNA, meu-miR-6313 in the tammar which was expressed in testis and fibroblasts.

16

To link a novel mechanism by which expression is potentially dysregulated in CD, Brest et al. analyzed the expression and localization of and miR-196 in the colonic mucosa (93).

Expression of within the colonic epithelium is high under normal conditions, but is reduced during inflammation while epithelial miR-196 expression increases.

As a result, binding of regulatory miR-196 is significantly impaired.

In those patients with CD possessing the risk allele, no similar reduction of occurred during active inflammation, presumably due to inability of miR-196 to bind transcript.

17

The levels of miR-196-5p and klotho in the serum and renal tubular epithelial cells of the DN mice were detected with real-time PCR and a. The results showed that the expression of miR-196-5p was up-regulated, whereas that of klotho was down-regulated.

Atrasentan reversed the alterations in the expression of miR-196-5p and klotho (Fig. 1D,E).

18

Three microRNA (miR-196a, miR-196b and miR- 744-3p) were significantly upregulated in the LSCC tissue (P < 0.05).

Clinical findings and expression of miR-196a, miR-196b and miR-744-3p in LSCC.

MiR-196a, miR-196b and miR-744-3p were significantly overexpressed in LSCC compared with their paired normal counterparts (P < 0.05).

MiR-7-1-3p, miR-196a, miR-196b and miR-744-3p were detected in LSCC but not normal epithelial cultures.

19

G. Accumulation of the Hmga2 and Btg2 mRNAs, respectively targeted by mmu-miR-196a and mmu-let-7a/mmu-miR-132, analyzed by qRT-PCR before and after deletion of h Ago2.

C. Accumulation of the Hmga2 and Btg2 mRNAs, respectively known targets for mmu-miR-196a and mmu-let-7a/mmu-miR-132, analyzed by qRT-PCR before and after Dcr deletion.

qRT-PCR analysis of L1_ORF2 mRNA levels (C), miR-295 and miR-16 levels (D), and Hmga2 and Btg2 mRNA levels (established targets of mmu-miR-196a and mmu-let-7a and mmu-miR-132, respectively) in the various cell lines depicted in (E).

20

Downregulation of HOXA5 gene in NSCLC can occur due to aberrant promoter methylation or following HOXA5 suppression by the microRNA-196a, which directly binds the 3′ untranslated region (UTR) of the HOXA5 transcript [55, 91].

21

Increased expression of miR-196a has also been shown to decrease proliferation of adipose-derived stem cells and enhance their osteogenic potential without affecting adipogenesis [83].

It will be important to establish how altered expression of miR-196 affects the chondrogenic potential of precursor stem cells in vitro.

In fact, miR-196 sub-types (including both miR-196a and miR-196b, which are almost identical in sequence but located on different chromosomes) have been reported to regulate skeletal patterning in zebrafish, chicken and salamander [75]– [77].

22

The validated miRs that were significantly upregulated among the DIO mice included miR-425, miR-196, and miR-155.

Furthermore, increased miR-196 has been associated with increased colon metastases and phosphorylation of Akt [52].

The microRNAs that were validated included: hsa-miR-16; mmu-let-7f; mmu-miR-351; has-miR-150; has-miR-425; hsa-miR-196a; hsa-miR-138; and mmu-miR-155 (Applied Biosystems, Foster City, CA).

They included miR-425, miR-196a, miR-155, miR-150, miR-351, miR-16, let-7f, miR-34c, miR-138a, and miR-21.

23

However, previous studies on hMSCs-Ad undergoing adipogenesis reported that miR-21 13, miR-22 14, miR-196 15, miR-27b 20, and miR-138 31 were either upregulated or downregulated, and miR-148a was not reported in hMSCs-Ad.

24

The profile of cluster 7, including miR-196a/b and miR-203, showed an inverse pattern to cluster 4, with high expression in early development and gestation followed by low expression in lactation and involution stages.

25

It has also been demonstrated that the expression of miRNA-196a (miR-196a) is high in pancreatic ductal adenocarcinoma (PDAC) but low in CP and normal tissues, whereas miR-217 exhibits the opposite expression pattern [8].

The ratio of miR-196a to miR-217 has been found to indicate whether tissue samples contain PDAC [9].

26

Strikingly, many of these synergistically regulated miRNAs were also found to be regulated in hESCs derived DE [18] such as mir-196a, mir-196b, and miR-24-2*, suggesting that the roles of miRNAs on DE differentiation might be conserved between human and mouse.

We compared our results with previously published miRNAs data about human DE differentiation [18], [19], and found that there are many miRNAs over-lapping between mouse and human data, such as mir-196a/b, let-7e and so on, suggesting the molecular conservativeness between human and mouse DE differentiation in terms of miRNA expression.

Red: mir-338-5p binding site; Yellow: mir-181c binding site; Blue: mir-196 a/mir-196b binding site.

27

Based on these findings, upregulation of miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214 may have therapeutic potential against mutant HTT, REST, HDAC4, apoptosis, and other pathobiological factors in HD.

The effects of psychotropics on the other miRNAs listed in Table 2, particularly miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214, as well as on REST, deserve study in HD mo dels.

In vitro, in HD transgenic mice, and in induced pluripotent stem cells derived from a patient with HD, miR-196a reduced mutant huntingtin and its aggregation, reducing neuropathological progression and phenotypic behavior [102].

28

Liu et al. [17] found that down-regulated ING5 expression was detected in cells transfected with miR-196a precursor, and accompanied by less apoptosis, higher invasion and proliferation of pancreatic cancer cells.

29

For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9].

30

To further assess the alterations of mitochondria-related miRNAs in obesity, we examined the expression levels of miR-126a-3p, miR-141-3p, miR-196a-5p, miR-210-3p, miR-378a-3p, miR-484 and miR-499a-5p in mice livers.

As shown in Fig. 2G, the expression of mitochondria-related miR-141-3p was strikingly increased and miR-196a-5p, miR-210-3p, miR-378a-3p were reduced in the HFD mice.

31

For example, overexpression of miR-196a predicts poor outcome in pancreatic carcinoma [48]; miR-210 is an independent prognostic factor for breast cancer and inversely correlated with disease-free and overall survivals [49].

32

For example, miR-196 expression affected limb development [8], miR-1 and miR-133 cardiogenesis [9, 10] and skeletal muscle development [11], and miR-181 enhanced myoblast differentiation [12].

33

As summarized in Table 2, we noticed that most of the miRNAs (miR-10a-5p, miR-193a-3p, miR-200b-5p, miR-222-3p) that are actively sorted into exosomes have tumour suppressive effects involving cell growth suppression, whereas miRNAs (miR-196a/b, miR-181d-5p, miR-155-5p) that have oncogenic effects are retained in the tumour cells even though the levels of the oncogenic miRNAs are higher in their donor cells than in the exosomes.

34

The last microRNA (miR-196a-5p) did not pass the quality test applied to all raw data prior to the LIMMA analysis, but interestingly it was detected in HFD fed fathers sperm but not in CD fed fathers (using a 35 Ct cut-off limit of detection), consistent with a large up-regulation as previously reported.

35

Our previous study 35 has demonstrated that miR-196a acts as an important molecular regulator in high glucose -induced MC hypertrophy by targeting p27 [kip1].

36

Furthermore, expression of several miRs, including miR-10b and miR-196, was detected in the developing limb and found to be involved in the specification of limb development [13, 14].

37

Brest P. Lapaquette P. Souidi M. Lebrigand K. Cesaro A. Vouret-Craviari V. Mari B. Barbry P. Mosnier J. F. Hebuterne X. A Synonymous Variant in IRGM Alters a Binding Site for miR-196 and Causes Deregulation of IRGM-Dependent Xenophagy in Crohn's Disease Nat.

38

In addition, the expression of miR-196a encoded in HOXC did not follow the strict anterior–posterior pattern in mouse (Supplementary Fig. 3) as seen in human SFs (Supplementary Fig. 1).

Transcripts encoded in the 5′ end of HOXC locus (miR-196a, HOXC-AS1, HOXC-AS2, HOXC-AS3, HOTAIR and HOXC13) distinguished knee from upper extremity SFs.

39

The mir-196 family regulates Hox8 and Hox7 genes, the function of mir10 is unknown.

The mir10 and the mir196 precursors are located at specific positions in the Hox gene clusters [4- 7].

A few microRNAs are apparently linked to protein coding genes, most notably mir-10 and mir-196 which are located in the (short) intergenic regions in the Hox gene clusters of vertebrates [4- 7].

40

Moreover, miR-200b and miR-196a have been implicated in the control of HF development as potential targets for the Wnt signalling pathway [14].

41

In lung cancer, multiple miRNAs, such as let-7 family, miR-200, miR-486 and miR-146a have been identified as tumor suppressors [10– 14]; on the other hand, miR-31, miR-212 and miR-196a were found to promote NSCLC carcinogenesis [15– 17].

42

The 10 most inhibited miRNAs are miR-1a, miR-133a/b, miR-196a, miR-206, miR-208b, miR-211, miR-592, miR-653, and miR-1963.

43

Our results are also mostly in agreement with those of Esau et al. [25] who identified a similar expression pattern regarding miR-130b, miR-30c, miR-30a*, miR-191, miR-30d, miR-196, miR-30b, miR-19b, miR-92, miR-138 and miR-100 during differentiation of cultured human adipocytes.

44

To determine whether ETS2 directly binds to the promoter region of miR-196 for inhibiting its transcription, a ChIP assay was performed by using anti-ETS2 antibody in UMUC3 cells.

45

Moreover, miR-196a mediates the browning of white adipocytes through targeting Hoxc8, a repressor of brown adipogenic marker C/EBPβ [9].

46

G. Accumulation of the Hmga2 and Btg2 mRNAs, respectively targeted by mmu-miR-196a and mmu-let-7a/mmu-miR-132, analyzed by qRT-PCR before and after deletion of h Ago2.

47

We have previously demonstrated that ANXA1 can associate with NF-κB and increase c-Myc activity leading to the inhibition of miR196a transcription, inducing a negative feedback loop to promote breast cancer migration and metastasis 21, 22.

48

Segment-specific expression of transcripts (e. g. members of the Defensin family) and miRNAs (e. g. miR-204-5p and miR-196) along the epididymis of control and Dicer1-c KO mice validated the purity of the tissue analysed (S4 Fig).

49

Amongst the 1735 CPC pairs, 18 were expressed from the same genomic locus (including the well documented hsa-miR-10a-HOXB5 and hsa-miR-196a-HOXB7 pairs [43], [44].

50

Like let-7, homologues of some microRNA families can be found in deuterostomes and protostomes, while some are more specific, such as Mir196, which is limited to vertebrate species, having no close orthologues in invertebrates, although it is related distantly to let-7 [6].

miR-196a cleaves the transcript of the homeobox gene Hoxb8 in mouse embryos, important in specifying regional identity in the embryo [8–10].

51

Recently we demonstrated that miR-196a and miR-181a function as negative regulators for two key oocyte-specific maternal effect genes (NOBOX and NPM2) essential for early embryogenesis [33] [29].

52

MiR-196a induces functional brown adipogenesis in WAT through the suppression of Hoxc8 [31].

53

Our previous study found that miR-196a, miR-486-5p, miR-664-star, and miR-378-star were significantly increased whereas miR-10a, miR-708, and miR-3197 were decreased in old hBM-MSCs.

54

There are three known microRNAs or miRNA families embedded in vertebrate Hox clusters: miR-10, miR-615 and miR-196 (Fig. 1A).

55

Sixty miRNA were significantly less loaded (or depleted) in AGO2-RISC (p-value<0.05), including seven that were loaded at less than 10% (miR-674-5p, miR-34c-5p, miR-196a-5p, let-7j-5p, miR-34a-5p, let-7d-5p and miR-185-5p).

56

Viral delivery of miR-196a ameliorates the SBMA phenotype via the silencing of CELF2.

57

microRNA precursors: Pre-miR™ microRNA Precursor Molecules for Negative Control#1, Hsa-miR-223 (PM12301) or Hsa-miR-203 (PM10152) and Hsa-miR-196 (PM10068) used as unrelated microRNAs (controls for some experiments).

58

Consistent with our finding, impaired energy expenditure was observed in mice lacking miR-378/378* [11] and in miR-196 transgenic mice [32].

59

These include miR-196a/b and miR-29a/c.

60

However, there was an inconsistent report describing that the gene polymorphisms of miR-27a, miR-146a, miR-196a-2, miR-492, miR-492a and miR-608 were not associated with the presence of colon cancer in European subjects [20].

61

Essential role for miR-196a in brown adipogenesis of white fat progenitor cells.

62

For example, miR-122 is indispensable to replication of the hepatitis C virus (HCV), whereas miR-196 and miR-296 substantially attenuate viral replication [12, 13].

63

These include mir-24-2, mir-30c-2, mir-125a, mir-130a, mir-196, mir-215, mir-218-2, and mir-367.

64

Also, a CNS identified downstream of hoxc10 (28 kb) corresponds to human miRNA-196a, and a canonical miR-196a seed-pairing site is predicted 268 bp from the end of newt hoxd8[28].

65

41 mmu-miR-33 −59.71 mmu-miR-222 1.23 mmu-miR-93 −1.52 mmu-miR-124 −97.01 mmu-miR-429 1.07 mmu-miR-192 −1.52 mmu-miR-129-5p −111.43 mmu-miR-100 −1.74 mmu-miR-210 −157.59 mmu-miR-20a −2 mmu-miR-134 −194.01 mmu-miR-137 −2 mmu-miR-215 −222.86 mmu-miR-194 −2.14 mmu-miR-452 −675.59 mmu-miR-196a −2.64 mmu-miR-223 −955.43 Differentiated sample versus control sample [DIF EBs d8/CONTROL EBs d8].

66

Note that miR-196 was not affected by Si-EZH2 treatment.