91 publications mentioning mmu-mir-192

Open access articles that are associated with the species Mus musculus and mention the gene name mir-192. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Ectopic expression of miR-192/-204 or HOTTIP siRNA significantly suppresses glutaminase (GLS1) expression, thereby inhibiting HCC growth in vitro and in vivo.

MiR-192 and miR-204 inhibit HCC growth in vivo We found that the growth of tumors from both miR-192 and miR-204 up-regulated HepG2 xenografts or xenografts with stable transfection of HOTTIP siRNA constructs was significantly inhibited compared with that of tumors formed from control xenografts after 9 days (Fig 6A and 6B).

In view of our present results showing attenuated miR-192/-204 expression and enhanced HOTTIP expression in human HCC clinical specimens and their association with patient survival, we hypothesize that the miR-192/-204-HOTTIP axis may be an attractive target for prognostic and therapeutic interventions in HCC.

In HepG2 cells, miR-192, miR-204, miR-18, miR-19 and miR-211 could down-regulate HOTTIP expression (all P<0.05).

Interestingly, down-regulated GLS1expression was observed after HCC cells transfected with miR-192, miR-204 or HOTTIP siRNA.

In line with previous studies, significantly down-regulated HOXA13 mRNA expression in both HCC cell lines after silencing HOTTIP by either siRNAs or miR-192/-204(all P<0.05) (Fig 4B).

qRT-PCR data showed that miR-192 and miR-204 or HOTTIP siRNA could significantly inhibit HOTTIP expression in xenografts (Fig 6D).

Spearman’s correlation was used to test the significance of association between miR-192 or miR-204 expression and HOTTIP expression.

To the best of our knowledge, we here for the first time revealed that two miRNAs (miR-192 and miR-204) can suppress oncogene HOTTIP expression and HCC viability via the AGO2 -mediated RNAi pathway.

20 nmol/L miR-192 inhibitors, miR-204 inhibitors and NC RNA were transfected into SMMC7721,HepG2 and Hep3BHCC cells.

MiR-192 and miR-204 inhibit HCC proliferation via suppressing lncRNA HOTTIP.

Considering the exclusive localization of HOTTIP in the nuclei and AGO2 generally interacts with RNAs exported to cytoplasm, we examined if expression of 'nuclear' HOTTIP-lncRNA could be inhibited by miRNA-192/-204 via qRT-PCR using nuclear and cytoplasmic RNAs isolated from cells treated with miRNAs.

We identified miR-192 and miR-204 as two miRNAs suppressing HOTTIP expression via the Argonaute 2 -mediated RNA interference pathway.

When the pCMV-HOTTIP plasmid was transfected into HCC cells with miR-192, miR-204 or both miRNAs over -expression, suppressed HCC cell proliferation could be rescued(S1 Fig).

Besides one of the known target gene HOXA13, glutaminase was identified as a potential downstream target of the miR-192/-204-HOTTIP axis in HCC.

Since miR-192 and miR-204 showed similar regulatory behaviors as HOTTIP siRNAs, we speculated that miR-192/-204 may regulate HOTTIP expression via the RNAi pathway at the post-transcriptional level.

To further disclose the potential molecular mechanism how miRNAs influence HCC viability via suppressing lncRNA HOTTIP, we profiled whole genome mRNA expression of HepG2 cells transfected with NC RNA, miR-192, miR-204 or siHOTTIP-1 (Fig 4).

We found that the growth of tumors from both miR-192 and miR-204 up-regulated HepG2 xenografts or xenografts with stable transfection of HOTTIP siRNA constructs was significantly inhibited compared with that of tumors formed from control xenografts after 9 days (Fig 6A and 6B).

1005726.g001 Fig 1(A) MiR-192 and miR-204 inhibit HOTTIP expression.

In SMMC7721 cells, miR-192 and miR-204 can significantly inhibit HOTTIP expression (both P<0.05).

As shown in Supplementary Figure 4, we found that miRNA-192/-204 could directly silence HOTTIP expression in either nucleus or cytoplasm.

As one of the P53-inducable miRNAs [30, 31], miR-192 takes part in cancer development and progression through targeting DHFR, TYMS, RB1, ZEB2, BCL2 and VEGFA [32– 36].

MiR-192 and miR-204 regulate HOTTIP expression in a posttranscriptional manner.

Significantly inhibited cell proliferation might be largely due to apoptosis after delivery of miR-192 or miR-204 into HCC cells.

Interestingly, there was a combined effect on inhibition of cell proliferation when miR-192 and miR-204 mimics were co -transfected into HCC cells (SMMC7721: 35.9%, HepG2: 54.5%, Hep3B: 60.9%; all P<0.01).

After G418 (Geneticin) selection, we isolated a stable cell clone with relative high expression of miR-192 and miR-204 and another stable cell clone with significant silencing of lncRNA HOTTIP.

We found that suppressing HOTTIP by miR-192 and miR-204 can significantly reduce viability of SMMC7721,HepG2 and Hep3B cells (Fig 3A).

To determine relationship between HOTTIP and miR-192/-204 in vivo, we detected expression of miR-192, miR-204 and HOTTIP in 48 tumor-normal pairs (S3 Table).

Fold increase was calculated by defining the activity of the pGL3-Control vector as 1. SMMC7721, HepG2 and Hep3B cells (1×10 [5]) were seeded in 12-well plates and transfected with 20 nmol/L miR-192 mimics, miR-204 mimics, HOTTIP siRNAs (siHOTTIP-1 and siHOTTIP-2), miR-192 inhibitors, miR-204 inhibitors or NC RNA (Genepharma), respectively.

MiRNA-192/-204 could directly silence HOTTIP expression in either nucleus or cytoplasm in SMMC7721 cells (A) or HepG2 cells (B).

In summary, we identified lncRNA HOTTIP as a novel target of miR-192 and miR-204.

All miRNA mimics (miR-138, miR-18, miR-192, miR-215, miR-19, miR-204 and miR-211), miRNA inhibitors(miR-192 and miR-204) and small interfering RNA (siRNA) duplexes (siHOTTIP-1 and siHOTTIP-2) were products of Genepharma (Shanghai, China).

MiR-192 and miR-204 inhibit HCC growth in vivo.

MiR-192 and miR-204 modulate GLS1 expression and GLS1 -mediated cell growth control.

The suppressive effects of both miRNAs on HCC cell proliferation were also validated in Hep3B cell line (miR-192: 45.1%, miR-204: 37.8%, siHOTTIP-1: 43.9%, siHOTTIP-2: 51.2%; all P<0.01).

MiR-192 and miR-204 modulate expression of multiple HOTTIP downstream genes.

Inhibition effects of miR-192 mimics or miR-204 mimics on pGL3-HOTTIP, pGL3-Mut192 or pGL3-Mut204 were showed.

One possible explanation is that HOTTIP inhibition by miR-192 or miR-204 may lead to abnormal glutaminolysis and then apoptosis.

An analogous reporter with point substitutions disrupting the target sites of miR-192 or miR-204(named as pGL3-Mut192 or pGL3-Mut204) (Fig 2A) was also co -transfected with two miRNA mimics or NC RNA.

MiR-192 and miR-204 inhibit HCC growth in vivo.

The posttranscriptional silencing of HOTTIP by miR-192, miR-204 or HOTTIP siRNAs could significantly suppress viability of HCC cells in vitro and in vivo.

It has been found that miR-192 and miR-204 function as tumor suppressors in multiple cancers including HCC.

MiR-192 and miR-204 are negatively correlated with HOTTIP expression in HCC tissue specimens.

Either miRNAs or HOTTIP siRNAs showed similar inhibition impact on SMMC7721 cell growth at 72h after RNA delivery (miR-192: 17.9%, miR-204: 20.5%, siHOTTIP-1: 23.1%, siHOTTIP-2: 23.1%; all P<0.05).

Compared to NC RNA, there were 152, 114 or 207 differentially expressed genes caused by miR-192, miR-204 or siHOTTIP-1. Among these genes, a total of 19 genes were consistently de-regulated by any of these three small RNAs (Fig 4C and 4D).

MiR-192 and miR-204 additively inhibits cell proliferation ofSMMC7721, HepG2 orHep3B cells.

Differential expressed genes between the NC RNA group and the miR-192 group, the NC RNA group and the miR-204 group, or the NC RNA group and the siHOTTIP-1 group were identified separately.

Therefore, we speculate that the miR-192/-204-HOTTIP axis may interrupt glutaminolysis of HCC and, thus, suppress cell viability.

In the current study, we for the first time identified the negative regulation of lncRNA HOTTIP by miR-192 and miR-204 via the Argonaute 2 (AGO2) -mediated RNAi pathway.

The HOTTIP reporter gene plasmid with mutant miR-192 binding site or mutant miR-204 binding site was constructed with QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA).

Consistent with cell viability assays, miR-192 and miR-204, alone and in combination, are able to inhibit colony formation significantly (all P<0.05).

However, individuals with high miR-192 or miR-204 level showed better prognosis compared to ones with low expression of each miRNA on multivariate survival analysis (miR-192: median, 26.5 versus 14.0 months; P = 0.013; miR-204: 26.0 versus 15.0 months; P = 0.017)(Fig 5D).

Gene Ontology analyses indicate that most genes are involved in positive or negative regulation of cell proliferation as well as cell death control (S2 Table), which is in agreement with the role of miR-192 and miR-204 on HCC cell proliferation.

Clinical significance of negative regulation of HOTTIP by miR-192 and miR-204.

To evaluate the tumor suppressor role of miR-192 and miR-204 in vivo, we firstly cloned miR-192andmiR-204 mature sequence or siHOTTIP sequence after the CMV promoter in a tandem manner into pcDNA3.1 vector.

10 nmol/L miR-192 mimics and 10 nmol/L miR-204 mimics were co -transfected into HCC cells.

Detection of AGO2 and IgG using western blot (up), and detection of miR-192, miR-204 or HOTTIP using qRT-PCR (low).

20 nmol/L miR-192 mimics, miR-204 mimics, siHOTTIP-1, siHOTTIP-2 or NC RNA were transfected into SMMC7721 and HepG2 cells.

The identification of GLS1 as a potential downstream gene of the miR-192/-204-HOTTIP axis highlights the involvement of glutaminolysis in HCC.

We also found significant negative correlation between HOTTIP and miR-192 or miR-204 in tissues (Spearman’s correlation: HOTTIP versus miR-192: r = -0.2, P<0.05; HOTTIP versus miR-204: r = -0.2, P<0.05)(Fig 5C).

This is in line with our observations that miR-192/-204 did not influence HCC migration.

SMMC7721 and HepG2 cells (6×10 [4]) were seeded in 24-well plates and transfected with both 50 ng of reporter constructs (pGL3-Control, pGL3-HOTTIP, pGL3-Mut192 or pGL3-Mut204) plus 20 nmol/L small RNAs (miR-192 mimics, miR-204 mimics or NC RNAs) using Lipofectamine 2000 (Invitrogen) when grown to 50% confluence.

We then evaluate the impacts of miR-192, miR-204 and HOTTIP expression on HCC prognosis.

MiR-192 and miR-204 modulate GLS1 expression and GLS1 -mediated cell growth controlWe firstly evaluated cellular localization of lncRNA HOTTIP in HCC cells.

1005726.g003 Fig 320 nmol/L miR-192, miR-204, NC RNA or HOTTIPsiRNAs was transfected into HCC cells, respectively.

Similar results were observed in HepG2 at 72h after transfection (miR-192: 36.4%, miR-204: 31.8%, siHOTTIP-1: 47.7%, siHOTTIP-2: 43.1%; all P<0.01).

A total of 1,500 SMMC7721 or HepG2 cells were seeded into a 6-well cell culture plate and transfected with 20 nmol/L miR-192 mimics, miR-204 mimics, siHOTTIP-1, or NC RNA, respectively.

Total RNA from HepG2 cells transfected with 20 nmol/L NC RNA, miR-192 mimics, miR-204 mimics or siHOTTIP-1 was extracted.

This would suggest that both miR-192/-204 and HOTTIP exist in the RISC complex(RNA -induced silencing complex).

At 72h after transfection, HOTTIP siRNAs, miR-192 or miR-204 could induce significantly apoptosis (all P<0.05) (Fig 3E).

As shown in Fig 3C, combined effects of miR-192/-204 with SAHA (suberoylanilidehydroxamic acid, also known as Vorinostat) on HCC viability were also observed.

1×10 [8]HepG2 cells with stable transfection of pcDNA3.1-miR-192-miR-204, pcDNA3.1-siHOTTIPor pcDNA3.1 vector were inoculated subcutaneously into fossa axillaris of 6 nude mice (n = 3 per group).

* MicroRNAs Seed position Conservation Primates Mammals Other Vertebrates miR-138 chr7:27245289 89% 30% 0% miR-18 chr7:27238346 89% 30% 0% miR-192/215 chr7:27241747 89% 91% 77% miR-19 chr7:27245115 100% 0% 0% miR-204/211 chr7:27245995 89% 43% 0%*Data from miRcode (http://www.

Additionally, miR-192 is one of plasma miRNAs that provided a high diagnostic accuracy of early-stage HCC, indicating its clinical relevance [37].

20 nmol/L mimics of miR-138, miR-18, miR-192, miR-215, miR-19, miR-204, and miR-211, two HOTTIP siRNAs (siHOTTIP-1 and siHOTTIP-2)or NC RNA were transfected into SMMC7721,HepG2 and Hep3B HCC cells.

Interaction of miR-192/-204 and lncRNA HOTTIP.

The plasmids were named as pcDNA3.1-miR-192-miR-204 or pcDNA3.1-siHOTTIP and transfected into HepG2 cells.

Cells were transfected with 20nmol/L miR-192 mimics, miR-204 mimics, or NC and harvested 48h after transfection.

20 nmol/L miR-192, miR-204, NC RNA or HOTTIPsiRNAs was transfected into HCC cells, respectively.

2

We propose a mo del of autophagy regulation in MMCs under diabetic conditions in which upregulation of TGF-β and miR-192 cascade and subsequently increased Akt activation could lead to inhibition of autophagy mediated either directly by miR-192, miR-217 and other downstream miRNAs targeting some of the autophagy genes, or via transcriptional regulation of these genes due to phosphorylation and inhibition of FoxO3a activity by Akt activation (Fig.   7).

Interestingly, another miRNA, miR-216a, that is also downstream of TGF-β signaling and miR-192, has been shown to target BECN1 and ATG5 expression in endothelial cells and Becn1 in pancreatic cancer cells 40, 53, 54. miR-216a also plays a pathogenic role in DN by up -regulating collagen genes through TFE3 by targeting YBX-1 [55].

Responses of Becn1 were different between LNA-anti-miR-192 and miR-192 KO mice (Figs  2 and 3) suggesting that the regulation of Becn1 by miR-192 inhibition with a miR-192 inhibitor may be different from that in mice in which miR-192 expression is genetically reduced from the birth.

Since Atg5 gene expression decreased in miR-192- KO STZ-diabetic glomeruli but immunostaining did not show a parallel decrease in Atg5 protein expression in these mice, some other unknown post-transcriptional regulation may be involved in the Atg5 regulation (Figs  3 and 4).

Next, in order to test whether miR-192 directly regulates expression of some of these genes, we transfected MMCs with miR-192 mimic oligoneucleotides (192-M) or negative control oligonucleotides (NC) and found that miR-192 significantly decreased the expression of Atg1 and LC3 in these cells (Fig.   5B).

These results indicate that the expression of certain autophagy genes is also decreased in vivo in the kidneys of a type 1 diabetes (STZ) mouse mo del and that inhibition of miR-192 in vivo can reverse this effect.

Loss of miR-192 and hence decreased Akt activation with subsequent reduction in mTOR activity could also contribute to reversal of autophagy suppression observed in the diabetic miR-192- KO mice 15, 40. miR-217 targets the 3′UTR of FoxO3A in endothelial cells [52].

Since inhibition of miR-192 with LNA-anti-miR-192 oligonucleotides showed a reversal of the reduced expression of certain autophagy genes in a type 1 diabetes mouse mo del, we next examined whether miR-192 deletion in vivo (using miR-192 KO mice) can have similar effects on autophagy genes under diabetic conditions.

Taken together, these results indicate that miR-192 decreases autophagy in MMC under both type-1 and type-2 diabetic conditions and that inhibition of miR-192 with LNA-anti-miR-192 oligonucleotides or deletion of miR-192 can lead to reversal of autophagic suppression along with decreased glomerular hypertrophy (Fig.   7).

p62 expression was increased significantly in glomeruli from STZ-NC mice compared to Control-NC mice (indicating a decrease in autophagy), whereas p62 expression was significantly decreased in glomeruli from STZ-LNA-anti-miR-192 mice compared to STZ-NC mice indicating a reversal in autophagy repression by miR-192 inhibition (Fig.   2C).

Since miR-192 plays a role in the pathogenesis of DN downstream of TGF- β, we wanted to test whether TGF-β regulates autophagy gene expression via miR-192 in MMCs.

In this study, we show for the first time that TGF-β and miRNA-192 regulate autophagy gene expression in vitro in MMCs as well as in vivo in kidneys of diabetic mice.

Decreased autophagy gene expression in kidneys of WT STZ-diabetic mice is rescued by genetic knock-out of miR-192.

Interestingly, upon inhibition of miR-192 in vivo using LNA-anti-miR-192 oligonucleotides, as well as in miR-192- KO mice, p62 accumulation was significantly decreased in glomeruli under diabetic conditions compared to control mice indicating a reversal of autophagic suppression in these mice.

We have previously shown that miRNA circuits downstream of TGF-ß, which include miR-192 and miR-217, induce MC hypertrophy as a consequence of Akt activation and downregulation of PTEN [40].

Overall, these results indicate that autophagy gene expression is regulated by the TGF-β pathway in MMCs and one of the mechanisms involved could be through downstream miRNAs, namely miR-192 and miR-217.

We have previously shown that inhibition or knock down of miR-192 plays a protective role in DN by lowering kidney fibrosis and proteinuria 38, 42.

However, Becn1 expression was significantly increased under diabetic conditions in both WT and miR-192- KO mice (Fig.   3B), indicating involvement of other mechanisms for Becn1 regulation.

Furthermore, some of these genes are down-regulated by oligonucleotide mimics of miRNAs downstream of TGF-β namely miR-192 and miR-217.

These results suggest that miR-192 is involved, at least in part, in the regulation of expression of these genes under diabetic conditions.

In this study we demonstrate for the first time that TGF-ß and miR-192 regulate the expression of key genes associated with autophagy in MC in vitro as well as in renal glomeruli in vivo under diabetic conditions.

Hence inhibition of miR-192 and subsequent decreased Akt activity and activation of downstream regulators of autophagy could be one of the mechanisms by which autophagy is increased following treatment of diabetic mice with LNA-anti-miR-192 oligonucleotides or in miR-192- KO mice (Fig.   7).

In the current study our results demonstrate that downregulation of autophagy by miR-192 and subsequent increase of glomerular hypertrophy could be one mechanism that leads to complications associated with DN.

Next we examined the protein expression of well-known markers of autophagy in WT and miR-192- KO, control and STZ-diabetic mice by performing immunostaining for Atg5 and p62 using kidney cortical sections from these mice.

However, notably, this increase in pFoxO3a was significantly inhibited in glomeruli from miR-192- KO STZ-diabetic mice (Fig.   4C,D).

We previously showed miR-192 promotes MC hypertrophy and renal fibrosis under diabetic conditions and that injection of a locked nucleic acid modified anti-miR-192 oligonucleotide (LNA-anti-miR-192) in STZ-diabetic mice has a renoprotective effect as depicted by decreases in profibrotic gene expression, renal fibrosis, hypertrophy and proteinurea [42].

Decreased autophagy gene expression in kidneys of STZ injected diabetic mice and selective reversal of this effect with LNA-anti-miR-192.

We analyzed expression of autophagy genes from cortical and glomerular lysates from either WT or miR-192- KO mice (control and STZ- induced diabetes) at 22 weeks post diabetes induction.

However this decrease in Atg5 expression was not observed in miR-192- KO STZ-diabetic relative to miR-192- KO controls (Fig.   4A,B).

Atg5 expression was decreased significantly in glomeruli from STZ-NC mice compared to Control-NC mice, while Atg5 expression was significantly increased in glomeruli from STZ-LNA-anti-miR-192 mice compared to STZ-NC mice (Fig.   2C).

Overall, it is likely that the inhibitory effect of miR-192 on autophagy genes is mediated by these miRNAs (miR-216a, 217 and 200) which are induced by miR-192 (Fig.   7) 39, 40.

Hence inhibition of miR-192 leading to the activation of autophagy and reduction in glomerular mesangial hypertrophy in early stages of DN could be a useful therapeutic strategy.

Figure 5Autophagy gene expression in MMCs treated with TGF-β or with miR-192-M and miR-217M.

Figure 2Decreased expression of autophagy genes in kidneys of STZ -injected diabetic mice relative to control mice and reversal of this effect on some genes with LNA-anti-miR-192 oligonucleotides.

Autophagy gene expression is decreased in MMC treated with TGF-β and certain genes are decreased with miR-192 and miR-217 mimic oligonucleotides.

Inhibition of miR-192 may enhance autophagy in MMC under diabetic conditions.

We previously reported that miR-217 is another miRNA induced by TGF-ß, miR-192 and diabetic conditions that are involved in the signaling cascade downstream of TGF-ß and miR-192 in MMCs and also regulates the pathogenesis of DN [40].

Notably as observed in our previous study [38] as well as in the current study, increases in glomerular hypertrophy (as measured by glomerular area) under diabetic conditions was attenuated in kidneys of diabetic mice in which miR-192 was inhibited (with anti-miRNAs) or genetically knocked out (miR-192- KO mice).

The effect of diabetes on autophagy gene expression was ameliorated in kidneys of STZ-diabetic miR-192- KO mice as well as in kidneys of WT STZ-diabetic mice treated with LNA-anti-miR-192 oligonucleotides, compared to respective controls (Figs  2– 4).

Figure 7 Proposed mo del showing the regulation of autophagy by miR-192 -mediated cascade under diabetic conditions leading to the pathogenesis of DN.

However, expression of these genes was not decreased in cortical lysates from diabetic miR-192- KO diabetic mice (miR-192- KO STZ) compared to respective non-diabetic controls (miR-192- KO) (Fig.   3A).

These results show that certain autophagy genes are decreased in kidneys of diabetic mice also at 22 weeks post diabetes induction and that this decrease is not observed in kidneys of miR-192- KO diabetic mice, indicating again that miR-192 could play a role, at least in part, in regulating the process of autophagy under diabetic conditions.

Atg5 expression was decreased in glomerular lysates from both WT-STZ mice and miR-192- KO STZ compared to respective controls.

Figure 6Autophagosome formation is inhibited to a greater extent in WT-MMCs compared to miR-192- KO MMCs following TGF-β treatment.

However, this increase in p62 expression was not seen in glomeruli from miR-192- KO STZ-diabetic mice compared to respective control mice (Fig.   4A,B ).

Because miR-192 has been implicated in the pathogenesis of DN, we next wanted to determine whether it also regulates autophagy under diabetic conditions.

These results verify that FoxO3a is a critical downstream autophagy regulating factor controlled by miR-192 -mediated signal cascade in the diabetic kidney.

We have previously shown that miR-192 can mediate fibrotic effects of TGF-ß and plays a key role in the pathogenesis of DN in MC 37, 38. miR-192 is also part of a cascade of downstream miRNAs (including miR-200, miR-216a, miR-217) that also regulate fibrotic genes and contribute to the pathogenesis of DN 39, 40.

In glomerular lysates Atg9, Atg12 and LC3 gene expression were significantly decreased in WT-STZ mice but not in miR-192- KO STZ mice compared to respective controls.

miR-192 mimics (192-M), miR-217 mimics (217-M), negative control oligonucleotides (NC) were obtained from Dharmacon (Lafayette, CO).

We therefore examined autophagy factors in kidney cortical lysates from control and STZ-diabetic mice (at 2 and 16 weeks post diabetes induction) that were injected with negative control (NC) or LNA-anti-miR-192 oligonucleotides.

These results also suggest that Becn1 may not be a major effecter of autophagy-related hypertrophy in miR-192 mediated signal cascade in these mouse mo dels of DN.

Next we analyzed the effect of TGF-β treatment on the formation of GFP-RFP-LC3 puncta in MMCs derived from WT mice and miR-192- KO mice.

qRT-PCR analysis of autophagy genes in (A) kidney cortex lysates and (B) kidney glomerular lysates; from WT control (n = 6) and WT-STZ (n = 5) mice and miR-192- KO control (n = 3) and miR-192- KO-STZ (n = 6) mice 22 weeks after induction of diabetes.

These results provide further experimental evidence supporting FoxO3a as a critical downstream factor (also related to autophagy) in the miR-192 -mediated signaling cascade.

These results indicate that autophagy is decreased in glomeruli under diabetic conditions and this is reversed by deletion of miR-192.

Figure 3Decreased expression of key autophagy genes in kidneys of WT-STZ mice compared to WT controls is not observed for majority of genes in miR-192- KO-STZ mice compared to miR-192- KO control mice.

Wild type and miR-192- KO mice were obtained as described previously [38].

In the current study we used MMCs derived from WT mice and miR-192- KO mice to analyze the effect of TGF-β on autophagy genes in vitro.

These results indicate that autophagy in MMC is reduced by TGF-ß and also by its downstream effector miR-192 in MMCs under diabetic conditions.

Primary mouse MC (MMCs) were isolated and cultured using renal glomeruli from wild type mice and miR-192- KO mice as described before 13, 38.

qRT-PCR analysis of autophagy genes in (A) WT-MMCs treated with TGF-β (n = 3) (B) WT-MMCs transfected with either negative control (NC) or miR-192 mimic oligonucleotides (192-M) (n = 3).

Markers of autophagy are decreased in kidneys of WT STZ-diabetic mice but not in kidneys of miR-192- KO STZ-diabetic mice.

Phosphorylated FoxO3a (pFoxO3a) is increased in kidneys of WT STZ-diabetic mice but not in kidneys of miR-192- KO STZ-diabetic mice.

Renal cortical sections from db+ and db/db mice, 16 week STZ -injected diabetic mice injected with LNA-anti-miR-192 or control LNA-anti-miR-239b oligonucleotides, and from wild type and miR-192- KO mice were obtained as described previously 38, 42.

We observed that the number of RFP-LC3 puncta, indicative of autolysosomes [10] were decreased following TGF-β treatment in both WT as well as miR-192- KO MMCs.

3

The diagram shows the reduction of the potential mRNA targets for miR-192 achieved by integrating miRNA and gene expression data: first, miR-192 is connected with its targets predicted by the Microcosm database; second, miR-192 is connected with its targets predicted by Microcosm and also found deregulated during activation of human HSCs (p < 0.01) and finally, the functionally relevant miR-192 targets based on significant negative correlation between miR-192 and its predicted targets and the MicroCosm prediction value is shown (B) Histogram representing differentially expressed miRNAs according to the number of deregulated target genes assigned by miRNA-gene integration analysis (p < 0.01).

MiR-21 and miR-100 inhibition causes an increase of the expression levels of their target genes while miR-192 overexpression decreases target gene expression levels (B) In vitro modulation of miR-21, miR-100 and miR-192 expression result in a reduction of HSC activation.

In the present study, we also provide evidence for the role of miR-192 in the regulation of HSC activation by showing that overexpression of miR-192 suppresses TGFβ1 -induced up-regulation of classical activation genes, i. e.

As expected, by increasing the expression levels of miR-192 we observed a significant reduction in the expression of its target genes, PLAU and COL5A1, as well as a modest but significant reduction of the activation marker LOX and an increase in SPARCL1, a novel quiescence marker identified in the gene expression array.

Primer sequences used are listed in Supplementary Table 3. In vitro modulation of miRNA expression in human HSCs (LX2)In order to validate relevant miRNA-mRNA interactions resulting from the integrative analysis, miR-21 and miR-100 expression were knocked down and miR-192 was over-expressed in a human HSC cell line (LX2) (kindly provided by Dr.

Importantly, miR-192 overexpression clearly inhibited the TGFβ1 -induced activation of qHSCs as measured by the suppression of Acta2, Col1a1 and Lox expression, three key early activation markers in HSCs (Fig. 6C).

Among all miRNAs included in this panel we have shown that miR-192 is down-regulated both during in vivo and in vitro activation of qHSCs and that overexpression of miR-192 exerts a functional role during the activation program by reducing activation, migration and proliferation of HSCs.

Reduction of miR-21 and miR-100 expression and up-regulation of miR-192 in LX2 cells was achieved by transfecting miR-21 antagomir (50 nM), miR-100 antagomir (50 nM) or miR-192 mimic (50 nM), respectively (n = 3).

Interestingly, miR-192 expression in HSCs was clearly reduced during fibrogenesis at very early time points in both animal mo dels indicating that down-regulation of miR-192 in HSCs might be an early event during HSC activation and fibrogenesis (Fig. 6A).

In vitro modulation of miR-192 in activated human HSCsMiR-192 has a high number of predicted target genes (n = 28) in qHSCs, displays a significant reduction in expression between healthy and cirrhotic human liver tissue and it has not been previously reported to be associated with HSC or liver fibrosis.

Our results indicate that qHSCs are the major source of miR-192 expression in the healthy liver and that the expression of this miRNA in HSCs is lost upon culture -induced and in vivo activation (Fig. 6B).

Primer sequences used are listed in Supplementary Table 3. In order to validate relevant miRNA-mRNA interactions resulting from the integrative analysis, miR-21 and miR-100 expression were knocked down and miR-192 was over-expressed in a human HSC cell line (LX2) (kindly provided by Dr.

MiR-192 was found significantly down regulated (relative expression of 0.68, fold change = −1.47) in cirrhotic livers compared to healthy livers indicating that this miRNA, which we have identified as highly expressed in qHSC by the miRNA array, could also be detected in healthy tissue (Fig. 4A).

Mir-192 expression is shown relative to whole liver (C) Effect of miR-192 over -expression on cell activation, migration and proliferation in primary mouse HSCs.

The selection was based on its enrichment in quiescent HSC and healthy liver tissue, the high number of predicted targets, the loss of expression in cirrhotic patients as well as the novelty of miR-192 in the context of liver fibrosis.

MiR-192 is highly expressed in qHSCs and might play a functional role in suppressing HSC activation.

MiR-192 has a high number of predicted target genes (n = 28) in qHSCs, displays a significant reduction in expression between healthy and cirrhotic human liver tissue and it has not been previously reported to be associated with HSC or liver fibrosis.

Expression and function of miR-192 in primary mouse HSCs.

In order to identify other cells producing miR-192 in the healthy liver, miR-192 expression was assessed in freshly isolated hepatic cell populations (i. e. hepatocytes, KCs, LSECs and qHSC) from healthy mouse livers.

Next, to understand the dynamics of miR-192 expression during HSC activation, we used HSCs isolated from mouse livers.

Particularly, these findings indicate that miR-192 can actively promote a quiescent phenotype in fibrogenic conditions and suggest potential therapeutic value for the modulation of miR-192 expression.

Additionally, we find that miR-192 overexpression significantly repressed the proliferation and migratory potential of primary mouse HSCs, both key functional properties acquired during HSC activation.

In vitro modulation of miRNA-21, miRNA-100 and miRNA-192 expression in LX2 cells.

LX2 cells were transfected with 50 nM of mirVana [TM] miRNA Inhibitor for miR-21 and miR-100 and mirVana [TM] miRNA mimic for miR-192 (Life Technologies) using JetPRIME® (PolyPlus, Illkirch, France) according to the manufacturer’s recommendations.

Other miRNAs such as miR-192, miR-139-5p, miR-483-5p, miR-142-3p, miR-142-5p, or miR-375 have not been previously described to be expressed in HSCs.

Moreover, miR-192 mimics reduced the expression of key activation markers in a human HSC cell line.

Mir-192 expression levels were assessed in HSCs isolated from control mice, mice treated with CCl [4] and from mice after BDL- or sham-operation at indicated time points after treatment or surgery.

As found in human, HSCs derived from healthy mice presented significant higher levels of miR-192 compared to the HSCs isolated from fibrotic mice and its expression was rapidly reduced upon induction of fibrosis in vivo.

Consistent with this result, PDGF -induced migration of mouse HSCs was reduced by miR-192 transfection (Fig. 6C).

Additionally, we aimed to explore whether the level of miR-192 functionally contributed to the reduction of HSC activation (Fig. 6C).

For those reasons, we selected miR-192 for further functional characterization by modulating its expression in human and mouse HSCs (Figs 5 and 6).

Freshly isolated, primary mouse HSCs were seeded at a density of 15.000 cells/cm2 and transfected with miR-192 or control mimic 24 h after plating.

Cell proliferation was assessed in mouse HSCs after 24 hours mimic miR-192 transfection (Life Technologies).

Finally, the effect of overexpressing miR-192 on cell activation was evaluated by exposing freshly isolated mice HSCs to TGFβ1 (10 ng/mL) or solvent for 48 hours.

In vitro modulation of miR-192 in activated human HSCs.

Although the modulation of individual activation markers by miR-192 mimic may be modest, we provide evidence that miR-192 has a functional effect on HSCs.

Next we tested if miR-192 was able to repress functional activation features.

Taken together these results suggest that miR-192 is a qHSC enriched miRNA in the liver with a functional role during HSC activation.

4

New findings revealed that the miR-192/215 family regulates E-cadherin expression and mediates the TGF-β1/CTGF -induced epithelial to mesenchymal transition (EMT) in proximal tubular epithelial cells by downregulating ZEB2 expression.

Our previous study profiled miRNA expression in MCs that were exposed to hyperglycemic conditions; we observed significant upregulation of miR-192/215, which is exclusively expressed in human and mouse kidneys.

A parallel decrease in CTNNBIP1 mRNA (Fig. 2C) and protein (Figs. 2D and E) expression in db/db mouse glomeruli was observed compared with the expression in db/m mice, suggesting that miR-192/215 expression negatively correlates with CTNNBIP1 levels in vitro and in vivo.

However, miR-192/215 expression in MCs did not affect matrix protein expression in the absence or presence of TGF-β1 [21].

MiR-192/215 expression is upregulated under diabetic conditions both in vitro and in vivo.

Interestingly, transfection with miR-192 mimic or miR-192 inhibitor did not alter TGF-β1 -induced α-SMA expression in MMCs (Figs. 4C and D).

Taken together, our findings strongly indicate that miR-192 and miR-215 were upregulated under diabetic conditions both in vitro and in vivo and that miR-192 and miR-215 may be critical regulators of TGF-β1 signaling, which accelerates the MC phenotypic transition.

Magnification, ×400 in E. To validate that CTNNBIP1 is indeed an miR-192/215 target, we first examined whether miRNA mimic or inhibitor transfection would affect CTNNBIP1 protein production.

Interestingly, we did not observe TGF-β1 -induced changes in α-SMA expression in miR-192 mimic- or inhibitor -treated cells, consistent with a recent report by Wang et al. [21].

Because TGF-β1 treatment increased miR-192/215 expression, CTNNBIP1 was likely to be suppressed after TGF-β1 treatment.

Recently, miRNA expression profiles [19] revealed that several miRNAs (miR-192, miR-194, miR-204, miR-215, and miR-216) are highly and nearly exclusively expressed in the kidney.

In this study, we further observed that TGF-β1 treatment upregulates miR-192/215 in a time -dependent manner from 0-48 h in MMCs.

Target gene annotations that were available in the Gene Ontology (GO), Universal Protein Resource (UniProt), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases were utilized to illustrate which functional pathways may be regulated by miR-192/215.

Furthermore, TGF-β1 induced miR-192/215 expression increases in DN.

As shown in Figs. A and B, there was a significant increase in both miR-192 and miR-215 expression in MMCs that were treated with 30 mM glucose for 48 hours.

These data convincingly show that miR-192/215 is highly expressed under diabetic conditions.

To examine the role of miR-192/215 in DN, we focused our attention on elucidating the miR-192/215 target mRNA.

0058622.g001 Figure 1(A and B) MMCs were treated with high glucose (30 mM) for 48 hours, and miR-192/215 expression was determined by qRT-PCR, normalized to U6 snRNA.

To determine the potential functions of miR-192/215 in DN pathogenesis, we first analyzed changes in miR-192/215 expression by qRT-PCR and northern blotting.

However, miR-192 mimics could not inhibit this same CTNNBIP1 3’-UTR luciferase reporter construct activity.

CTNNBIP1 is a bona fide miR-215, but not miR-192 target.

0058622.g003 Figure 3MMCs were treated with an miR-192 mimic (100 nM), an miR-192 inhibitor (100 nM) or the miR-control (100 nM) for 24 hours, miR-192 levels were determined by qRT-PCR (A), and subsequently analyzed for the level of CTNNBIP1 protein byting (C).

Thus, we also assessed the effect of TGF-β1 on miR-192/215 expression in cultured MMCs.

The differences in these time points may explain the discrepancy in TGF-β1 -mediated changes in miR-192/215 expression [54].

Emerging evidence suggests that altered Wnt/beta-catenin signaling is linked to renal fibrosis pathogenesis [27], [46], [47] Thus, we hypothesized that CTNNBIP1 may be the most statistically significant miR-192/215 target gene.

TGF-β1 positively regulates miR-192 [20] and miR-216a [22] but negatively regulates the miR-200 family [52], resulting in enhanced ECM protein accumulation, which contributes to DN pathogenesis.

However, the miR-192 inhibitor could not reverse these effects (Fig. 3H).

CTNNBIP1 is a potential miR-192/215 target.

Cultured MMCs were transfected with an miR-192 mimic (100 nM), an miR-192 inhibitor (100 nM) or an miR-control (100 nM), followed by treatment with TGF-β1 (10 ng/ml) for 48 hours.

These results indicated that miR-215, but not miR-192, recognizes the CTNNBIP1 gene 3’-UTR sequence and thereby decreases CTNNBIP1 expression.

Computational analysis indicated that CTNNBIP1 is a potential miR-192/215 target because its 3’-UTR is perfectly matched to the miR-192/215 seed region (Fig. 2A).

MMCs were treated with an miR-192 mimic (100 nM), an miR-192 inhibitor (100 nM) or the miR-control (100 nM) for 24 hours, miR-192 levels were determined by qRT-PCR (A), and subsequently analyzed for the level of CTNNBIP1 protein byting (C).

Magnification, ×400 in H. To determine the potential functions of miR-192/215 in DN pathogenesis, we first analyzed changes in miR-192/215 expression by qRT-PCR and northern blotting.

These results indicate that miR-215, but not miR-192, targets endogenous CTNNBIP1 in MMCs.

Importantly, computational analysis predicted that CTNNBIP1 is an miR-192/215 family target gene.

miR-192/215 expression upon treatment with high glucose and TGF-β1.

Another pMIR-REPORT luciferase construct containing the CTNNBIP1 mRNA 3′-UTR with a mutation in the putative miR-192/215 seed region (UAGGUCA to UACCGCA) was generated as a negative control and named Mut-CTNNBIP1 3′-UTR.

Thus far, the complex roles and regulation of the miR-192/215 family in MMCs remain unclear; thus, more studies are needed to clarify these aspects.

Interestingly, CTNNBIP1 protein was not altered in the miR-192 mimic- or inhibitor -treated MMCs compared with the control group (Figs. 3C and D).

Mutagenesis primers for the miR-192/215 target site in the CTNNBIP1 3′-UTR were as follows: forward 5′-GCGCACTAGTTCTTGACCAACGGAAAC-3′; reverse 5′-GCGCAAGCTTCACATTCCTAAAAATGCGGTA-3′.

org) were used to assess potential miR-192/215 targets sites, and the results were compared.

Subsequently, northern blotting analysis confirmed that miR-192/215 expression was markedly higher in db/db mouse kidney glomeruli compared with db/m control mice.

Thus, further functional studies of miR-192/215 are essential to unravel the molecular mechanisms underpinning DN -associated renal fibrosis.

0058622.g002 Figure 2(A) Sequence alignment of miR-192/215 and predicted binding sites in the 3’-UTR of CTNNBIP1 (http://www.

This was in contrast to a previous study [21] in which miR-192/215 was decreased by the same dose of TGF-β1 treatment in MMCs after 3 days.

We observed a striking induction of miR-192 6 hours after stimulation; the levels gradually increased and peaked 48 hours after stimulation.

Northern blots were performed as described previously [29] using an miR-192 probe (5’-CTGACCTATGAATTGACAGCC-3’) and an miR-215 probe (5’-GTCTGTCAAATCATAGGTCAT-3’).

Magnification, ×400 in E. (A) Sequence alignment of miR-192/215 and predicted binding sites in the 3’-UTR of CTNNBIP1 (http://www.

s were performed as described previously [29] using an miR-192 probe (5’-CTGACCTATGAATTGACAGCC-3’) and an miR-215 probe (5’-GTCTGTCAAATCATAGGTCAT-3’).

Cells were then co -transfected with a reporter construct (pMIR -null REPORT plasmid, pMIR-CTNNBIP1 3′-UTR, pMIR-CTNNBIP1 3′-UTR-Mut) and miR-215 mimic, miR-192 mimic or miR-control.

To investigate the involvement of the miR-192/215 family in TGF-β1 -induced MC phenotypic transition, MMCs were transfected with an miR-192 or an miR-215 inhibitor.

Conversely, the miR-192 mimic did not decrease luciferase activity of this same CTNNBIP1 3’-UTR construct.

5

Furthermore, inhibition of miR-192-5p also suppressed VAN induced AKI, the cell cycle arrest was also reversed by miR-192-5p inhibitors, which was supported by the finding that miR-192 can enhance cell cycle arrest 41.

However, the role of miR-192-5p in apoptosis is dependent on the cell types/stress factors, miR192-5p as a potential new therapeutic target for other diseases could be further explored.

Although miR-192-5p might suppress apoptosis in A549 cells, inhibition of it did not alleviate apoptosis in the miR-192-5p non-responsive H1299 cells 23.

MiR-192-5p expression was further confirmed by Northern blot analyses, at day 3 and 7 after VAN treatment, it was markedly downregulated in p53- KO mice than in p53-WT mice (Fig. 4C and D).

In current study, we also demonstrated that inhibition of p53 significantly suppressed miR-192-5p in vitro and vivo.

Real time PCR showed that VAN significantly induced miR-192-5p expression that was suppressed by pifithrin-α treatment (Fig. 7A).

To the date, we identified p53 promoted apoptosis by upregulation of miR-192-5p in HK-2 cells, revealing the involvement of this mechanism not only in HK-2 cells, but also in p53 knockout mice.

However, miR-192-5p suppresses apoptosis by targeting Bim in esophageal aquamous cell caicinoma 40.

In HK-2 cells and the mouse mo del, inhibition of p53 ameliorated VAN induced AKI through miR192-5p regulation.

MiR192-5p expression is suppressed in p53 KO mice.

Moreover, we have identified that miR-192-5p was regulated through p53 in vivo and vitro, and further revealed that p53 induced renal cell apoptosis via directly up regulation of miR-192-5p.

To further confirm whether p53 induce the expression of miR-192-5p, pifithrin-α was used in current study.

Jin et al. reported that miR-192-5p provoked apoptosis by suppression of XIAP in tumor cell lines 23 39.

Inhibition of miR-192-5p ameliorated renal dysfunction, renal injury in VAN nephrotoxic AKI mice.

As shown in Fig. 7C and D, VAN induced more apoptosis rate and caspase activity in HK-2 cells were inhibited by anti-miR-192-5p.

In our study, we demonstrated that antagonizing VAN induced miR-192-5p by miRNA inhibitors decreased apoptosis in HK-2 cells.

These data suggest that miR192-5p may act as an apoptosis promoter, and thus may be considered as a potential therapeutic target for VAN induced AKI.

To further reveal the in depth molecular mechanism of p53 for regulation of apoptosis, we focus on the miR-192-5p.

To further investigate the mechanisms how inhibition of p53 ameliorates VAN induced AKI, we focused on the miR-192-5p.

VAN induced miR-192-5p was blocked in p53- KO mice.

In scrambled mice, the tubular damage score was 3.7 after vancomycin AKI, whereas the score was markedly decreased to 1.5 after vancomycin AKI for anti–miR-192-5p tissues (Fig. 8D).

To assess the role of miR-192-5p in the pathogenesis of VAN nephrotoxic AKI, male C57BL/6 mice were injected with LNA -modified antisense oligonucleotide of miR-192-5p (anti–miR-192-5p) or LNA -modified oligonucleotide of the scrambled sequence (scrambled), levels of BUN and serum creatinine were similarly low in these mice, indicating normal renal function.

p53 induced miR-192-5p for apoptosis during VAN treatment.

In addition, the experiment on role of miR-192-5p, male C57BL/6 mice were injected by tail vein with or without 20 mg/kg LNA -modified antisense oligonucleotide of miR-192-5p (anti–miR-192-5p) or LNA -modified oligonucleotide of scrambled sequence (scrambled) for 7 days.

HK-2 cells were treated with 4 mm/L VAN in presence or absence of 20 μM pifithrin-α for 24 h, or transfected with 100 nmol/L LNA -modified antisense oligonucleotide of miR-192-5p (anti–miR-192-5p) or LNA -modified oligonucleotide of the scrambled sequence (scrambled).

Recent studies demonstrated that miR-192-5p mediated apoptosis in a few of tumor cell line 23.

Male C57BL/6 mice were (A–D) injected with 400 mg/kg (n = 8) with or without 20 mg/kg LNA -modified antisense oligonucleotide of miR-192-5p (anti–miR-192-5p) or LNA -modified oligonucleotide of scrambled sequence (scrambled) for 7days of examination.

How to cite this article: Chen, J. et al. p53 activates miR-192-5p to mediate vancomycin induced AKI.

Blockade of miR-192-5p reduces VAN induced apoptosis in HK-2 cells.

Whole tissue lysate was analyzed for miR192–5p and U6 by Real-time PCR or Northern blot.

Recent study reported that p53 could physically interact with the promoter region of miR-192-5p 42.

At day 7 of VAN treatment, scrambled mice developed moderate renal failure, with 102.5 mg/dl BUN and 0.43 mg/dl serum creatinine, whereas anti–miR-192-5p mice had 65.9 mg/dl BUN and 0.22 mg/dl serum creatinine (Fig. 8A and B).

For Pifithrin-a treatment, HK-2 cells were treated with or without Pifithrin-a (20 μM) or vancomycin (4 mm/L) for 24 h. For transfection experiment, transfection of miR-192-5p analog (100 nM) or negative control (miR-neg; Sigma) were used.

Blockade of miR-192-5p reduced VAN induced AKI.

As shown in Supplemental Figure 4, VAN induced the cell cycle arrest, which was reduced in anti–miR-192-5p tissues.

Histologic analysis confirmed the VAN induced kidney tissue damage, which was significantly ameliorated in anti–miR-192-5p mice (Fig. 8C).

6

Furthermore, miR-145, miR-192, and miR-378 also showed inhibitory role in the expression of B7-DC, CTLA4 and PD-1. Taken together, our present study provides the first evidence that under-regulated miRNAs play significant roles in inhibiting translation of B7 co -inhibitory molecules, especially miR-143 in B7-H3 and B7-H4.

We found that TGF-β1 upregulated the expression of miR-155, while downregulating the expression of miR-143, miR-145, miR-192, and miR-378 (Figure 4A).

In addition, our results showed that miR-145, miR-192, and miR-378 suppressed the expression of co -inhibitory molecules B7-H3, B7-DC, CTLA4, and/or PD-1 (Supplementary Figure S3).

MiR-143 inhibited the growth of CRC cells in vitro and in vivoGiven the important role of down-regulated miRNAs in cancer immune escaping, we assessed the impact of miR-143, miR-145, miR-192, and miR-378 on the growth of HCT-116 cancer cells.

Interestingly, we found that the expression of miR-155 was inversely proportional to those of miR-143, miR-145, miR-192, and miR-378 in normal tissues (Figure 3D and 3E; Supplementary Table S3), conversely to the expression in adenoma and carcinoma tissues (Figure 3F and 3G).

Down-regulation of miR-143, miR-145, miR-192, and miR-378 has also been well documented in many types of human tumors including colorectal cancer [38– 40].

was used to determine the effect of the down-regulated miRNAs, including miR-143, miR-145, miR-192, and miR-378, on the proliferation of HCT-116 cells.

In the adenoma tissues, we found that the expression of miR-155, miR-143, miR-145, miR-192, and miR-378 were initially deregulated (Figure 3H).

Given the important role of down-regulated miRNAs in cancer immune escaping, we assessed the impact of miR-143, miR-145, miR-192, and miR-378 on the growth of HCT-116 cancer cells.

Figure 4(A) Impact of TGF-β1 on the expression of miR-143, miR-145, miR-155, miR-192, and miR-378 in HCT-116 cells.

We found that the miR-155 node was close to those of miR-143, miR-145, and miR-192, etc.

Figure 8(A) Impact of miR-143, miR-145, miR-192, and miR-378 mimics on the growth of HCT-116 cells in vitro.

7

The miRNA content of these vesicles displayed overlap with their cellular expression, as miRNA-21 was stable, miRNA-192 was significantly down-regulated, and miRNA-92a, and -200b show clear trends of being down-regulated during HSC activation (Figure 4E).

Change of expression in human aHSC (Fold Change) Expression in plasma of liver disease-compared to healthy individuals Source Expression trend Etiology miRNA-150-5p ↓ (870) ↑ HBV Li et al., 2010; Venugopal et al., 2010 miRNA-192-5p ↓ (8.53) ↑ HBV, NASH, NAFLD Tryndyak et al., 2012; Winther et al., 2013; Becker et al., 2015; Pirola et al., 2015 miRNA-200b-3p ↑ (22.55) ↑ NAFLD, HBV/HCV -associated HCC Murakami et al., 2011; Tryndyak et al., 2012 miRNA-122-5p N. D. ↑ HCV, HBV, NASH, NAFLD Arataki et al., 2013; Shrivastava et al., 2013; Tan et al., 2014; Pirola et al., 2015 miRNA-21-5p N. D. = /↑ HBV, NAFLD Yamada et al., 2006; Cermelli et al., 2011; Becker et al., 2015 miRNA-92a-3p N. D. ↑ HBV -associated HCC, HCV Li et al., 2010; Ji et al., 2011; Shrivastava et al., 2013 N. D., non-determined.

MiRNA-21 shows a relatively stable expression, while levels of miRNA-192, -92a, and -200b are all down-regulated in activated HSCs.

A significant down-regulation in vesicle -associated miRNA expression in both patient groups could be seen for miRNA-192, -150, -92a, and -200b.

Over -expression of miRNA-192 leads to less cell proliferation and less PDGF -induced migration (Coll et al., 2015), suggesting that miRNA-192 might play a role in suppressing HSC activation.

MiRNA-192 was significantly up-regulated in total plasma of early stage HBV patients (Figure 1), but it shows significant down-regulation in the ECVs extracted from both HBV- and HCV-infected patient populations when compared to healthy subjects (Figure 3A).

In previous work, we showed that also in vivo activated mouse HSCs and total liver samples of cirrhotic patients with superimposed alcoholic hepatitis show such significant down-regulation of cellular miRNA-192.

Expression Patterns of miRNA-192, -92a, and -200b Show an Overlap in Circulating Vesicles and Activating HSCs.

MiRNA-192 was significantly up-regulated in HBV-patients, but not in HCV patients, when compared with the control group.

Additionally, analysis of cell lysates and ECVs extracted from the CM of in vitro activating HSCs show the same significant decreasing levels of miRNA-192 (Figures 4D,E).

miRNA Mature miRNA primer miR-92a-3p TATTGCACTTGTCCCGGCCTGT miR-122-5p TGGAGTGTGACAATGGTGTTTG miR-150-5p TCTCCCAACCCTTGTACCAGTG miR-192-5p CTGACCTATGAATTGACAGCC miR-200b-3p TAATACTGCCTGGTAATGATGA miR-21-5p TAGCTTATCAGACTGATGTTGA cel-miR-39-3p AGCTGATTTCGTCTTGGTAATA All primers were ordered from Integrated DNA Technologies (IDT, Leuven, Belgium), and are specific for detection of both human and murine miRNA -expression.

Especially miRNA-192 (HBV AUC: 0.9802; HCV AUC: 0.9762) and miRNA-200b (HBV AUC: 0.9699; HCV AUC: 0.9841) have an inherent potential to be used as biomarker for the identification of early fibrosis by chronic HBV and HCV infection.

Early Stage Fibrotic Patients Have an Increased Circulating ECV-Content With Low Levels of miRNA-192, -92a, -200b, and -150.

8

Another target of miRNA-192 that showed overlap with known pathways of alcoholic hepatitis is Jak2/Arhgef1 signaling pathway, which is correlated with severity of liver disease [44].

The targets of miRNA-192 and miRNA-30a target were visualized using Cytoscape V2.7.

Using target prediction algorithms, we identified the predicted target protein networks of human miRNA-192 and miRNA-30a (Fig.   6a, b).

By performing microarray screening on exosomes, we found nine inflammatory miRNAs which were deregulated in sera of chronic alcohol-fed mice compared to controls including upregulated miRNAs: miRNA-192, miRNA-122, miRNA-30a, miRNA-744, miRNA-1246, miRNA 30b and miRNA-130a.

Predicted targets of miRNA-192.

Based on ROC curve analysis, exosome -associated miRNA-192 can act as an accurate diagnostic test for discrimination of liver disease in the population (AUC = 0.95; p < 0.001) (Fig.   5e, f; Table  3).

b Potential targets of miRNA-192.

Fig.  6Target prediction for miRNA-30a and miRNA-192.

Comparing the miRNA signature of exosomes from alcohol-fed mice with pair-fed mice showed deregulation of nine inflammatory miRNAs including miRNA-122, miRNA-192 and miRNA-30a.

However, more data regarding specificity of miRNA-192 and miRNA-30a for alcoholic hepatitis compared to the other types of liver disease, and side by side comparison of those miRNA markers with other markers of liver injury such as ALT should be gathered in future studies.

Interactome analysis of miRNA-192 revealed activation of Smad signaling and ZEB proteins, which are related to alcoholic hepatitis pathobiology through regulation of TGFβ/Smad signaling [43].

We showed that miRNA-192 levels can be used to differentiate plasma from alcoholic hepatitis patients and plasma from controls.

Curve of receiver operating characteristic (ROC) analysis constructed using differentially expressed d miRNA-122, e miRNA-192, and f miRNA-30a for discriminating alcohol-fed mice versus control mice.

Importantly, of these miRNAs in the cohort of patients with alcoholic hepatitis, we found a significantly elevated level of miRNA-30a and miRNA-192 in the EV-fraction of plasma.

Both miRNA-192 and miRNA-30a were significantly increased in the circulation of subjects with AH.

Consistent with the highly significant increase of miRNA-122, miRNA-30a, and miRNA-192 (Fig.   4a–c), those miRNAs showed promising diagnostic values.

Particularly, miRNA-122, miRNA-30a, and miRNA-192 showed the most substantial increases and revealed an excellent diagnostic value for differentiating alcohol-fed mice versus pair-fed mice.

miRNA-192 showed consistently elevated levels in both alcohol-fed mice samples and in patient- derived alcoholic hepatitis samples.

e, f Curve of receiver operating characteristic (ROC) analysis constructed for differentially expressed miRNA-30a, miRNA-192, and for discriminating patients with alcoholic hepatitis versus controls (*p < 0.05).

Consistently, miRNA-30a and miRNA-192 were increased significantly in exosomes isolated from plasma of alcoholic hepatitis patients.

Although we found significant discriminatory ability of exosomal miRNA-192 for alcoholic hepatitis, our study is in the discovery phase and has limited sample size.

miRNA-192 showed promising value for the diagnosis of AH.

The ROC analyses indicated excellent diagnostic value of miRNA-192, miRNA-122, and miRNA-30a to identify alcohol -induced liver injury.

miRNA-192, miRNA-122 and miRNA-30a accurately discriminate the alcohol-fed and control mice.

9

Conversely, there are several reports that miR-200 family members and miR-192 can be down-regulated by TGF-beta, and this promotes EMT in cancer and other cell lines via subsequent up-regulation of targets ZEB1 and ZEB2 to repress E-cadherin [1]– [4].

These results suggested that the increase in TGF-beta in vivo in diabetic glomeruli and in vitro in MCs could induce miR-192 expression, which could target and down-regulate Zeb2 thereby to increase Col 1a2.

Thus, TGF-beta -induced increase in the expression of microRNAs (miR-192 and miR-200 family members) might coordinately down-regulate E-box repressors Zeb1 and Zeb2 to inhibit EMT and fibrosis of kidneys.

They also showed that the expression of miR-192 was increased by TGF-beta in mouse mesangial cells (MCs), whereas, conversely, the expression of its target, Zeb2, was decreased.

Conversely, the down-regulation of ZEB1 and ZEB2 by TGF-beta via miR-200 family and miR-192 can affect upstream E-box regions [14].

Kato et al. demonstrated that the expression miR-192 is increased in renal glomeruli obtained from mouse mo dels of type 1 and type 2 diabetes relative to corresponding control mice [14].

10

To further understand whether decrease in microRNA signature expression predicts disease regression, scatter plots on miR-192 expression against histological scores were generated (Fig.   3b).

Time -dependent expression of miR-122, miR-192, miR-21, miR-29a, miR-34a, and miR-505 in study 1. Data were expressed as minus delta Ct with reference to spike-in control miRNA.

MicroRNA profiling in two independent cohorts of animals validated the up-regulation of 6 microRNAs (miR-122, miR-192, miR-21, miR-29a, miR-34a and miR-505) in NASH mice, which was designated as the circulating microRNA signature for NASH.

Since miR-192 had the highest association with other microRNAs and disease pathologies (NAS, r = 0.78), it was chosen to build the new composite biomarker.

b Scatter plots of miR-192 expression (reference to spike-in control) against histopathological scores: inflammation, macrovesicular vacuolation, perisinusoidal fibrosis and portal fibrosis Clinical diagnosis of NASH requires the histological examination of liver biopsies [23].

Similarly, we observed slightly decrease in the liver miR-122 and miR-192 expression (not statistically significant) in NASH mice compared to lean mice.

The right panel depicted the expression level of miR-192 and miR-505 in mice having NAS > 3 compared with mice having NAS ≤ 3. c ROC curves of the microRNA signature in predicting mice having NAS > 3 (AUC = 0.897, 95% confidence interval: 0.75 - 1) in study 1. The confusion matrix was depicted in the inset (numbers in rows are actual classification, numbers in columns are predicted classification).

To further improve the performance of microRNA -based biomarker, a new composite biomarker was proposed, which consists of miR-192, miR-21, miR-505 and ALT.

MiR-192 and miR-122 fell into the same category, and both were implicated in liver injury and hepatocyte death [28, 29].

In view of the biological function of each feature, the new composite biomarker could potentially reflect the status of the liver from the following perspectives: miR-192 and ALT serve as independent indicator of hepatocyte function, miR-21 suggests of stellate cell activation and liver fibrosis, miR-505 implies for pathological manifestations.

a, b Univariate ROC analysis of miR-192 and miR-505, which was created by plotting the true positive rate (sensitivity) against false positive rate (1-specificity).

b, c ROC curves of the miR-192, miR-21, miR-505 and ALT in predicting mice having NAS > 3 in study 1 (AUC = 0.948, 95% confidence interval: 0.827 - 1) and study 3 (AUC = 0.931, 95% confidence interval: 0.845 - 1).

Univariate ROC curve analysis showed that miR-192 and miR-505 achieved the greatest AUROC of 0.923 and 0.919 respectively in discriminating mice had NAS > 3, while miR-122, miR-29a, miR-34a and miR-21 had an AUROC of 0.88, 0.84, 0.80 and 0.79 (Fig.   4a and b).

Based on these findings, a microRNA -based composite biomarker consisting of miR-192, miR-21, miR-505 and ALT was proposed, which demonstrated great performance in distinguishing between lean and NASH mice (NAS > 3).

We then tested the performance of the new composite biomarker consisting of miR-192, miR-505, miR-21 and ALT in discriminating NASH animals (NAS > 3) from healthy mice (NAS ≤ 3) in study 1 and 3. As shown in Fig.   5b, the new biomarker outperformed the microRNA signature plus ALT mo del, and achieved AUROC of 0.958 with further reduction of one misclassified animal in study one.

c Principle component analysis (PCA) of miR-192, miR-122, miR-21, miR-29a, miR-34a, and miR-505 in study 2. Red dots represented NASH mice (mice on 3H diet for 7 months), and green dots represented lean mice.

The top six common microRNAs including miR-21, miR-122, miR-192, miR-29a, miR-34a and miR-505, were designated as the circulating microRNA signature for NASH (Fig.   2b).

It was clear that diet-switching group animals had lower level of circulating miR-192 accompanied with improved liver histological lesions.

11

As illustrated in Figure 2, TGF-β1 up-regulates miR-21, miR192, miR-377, miR-382, and miR-491-5p, but down-regulates miR-29 and miR-200 families during renal fibrosis (Kantharidis et al., 2011; Kriegel et al., 2012; Lan and Chung, 2012; Chung et al., 2013a, b).

Moreover, recent studies also revealed that overexpression of miR-29, miR-200 or inhibition of miR-21 and miR-192 can effectively decelerate the progression of renal fibrosis (Oba et al., 2010; Chung et al., 2010a; Qin et al., 2011; Zhong et al., 2011, 2013; Chen et al., 2014) (Figure 3).

E-cadherin expression is regulated by miR-192/215 by a mechanism that is independent of the profibrotic effects of transforming growth factor-beta.

MicroRNA-192 in diabetic kidney glomeruli and its function in TGF-beta -induced collagen expression via inhibition of E-box repressors.

Inhibiting microRNA-192 ameliorates renal fibrosis in diabetic nephropathy.

Knockout or knockdown of miR-192 largely attenuated renal fibrosis possibly through induction of ZEB1/2 in vivo and in vitro.

However, a recent study indicated that TGF-β1 reduces miR-192 expression in human TECs and deficiency of miR-192 accelerates renal fibrosis in diabetic nephropathy (Krupa et al., 2010), which is further evident by the results from the renal biopsy of diabetic patients with lower level of miR-192 (Wang et al., 2010).

It is reported that miR-192 is elevated in fibrotic mouse mo dels and TGF-β1 -treated murine cells (Kato et al., 2007; Chung et al., 2010a; Putta et al., 2012).

The discrepancy in these studies suggests the complexity of miR-192 in renal fibrogenesis.

Role of miR-192 in fibrosis is still controversial.

miR-192 mediates TGF-beta/Smad3 -driven renal fibrosis.

12

Therefore, we selected five DEMs, three upregulated (mmu-miR-192-5p, mmu-miR-291a-3p and mmu-miR-320-3p), and two downregulated (mmu-miR-139-5p and mmu-miR-378a-3p), construct miRNA-mRNA network to explore the regulatory mechanisms of miRNAs.

In this study, we selected five DEMs, three upregulated (mmu-miR-192-5p, mmu-miR-291a-3p and mmu-miR-320-3p), and two downregulated (mmu-miR-139-5p and mmu-miR-378a-3p), to construct the miRNA-mRNA network (Figure 6).

Red (mmu-miR-192-5p, mmu-miR-291a-3p and mmu-miR-320-3p) and Green (mmu-miR-139-5p and mmu-miR-378a-3p) are square nodes represent up-regulated and down-regulated miRNAs, respectively.

The Expression of miR-192 and its significance in diabetic nephropathy patients with different urine albumin creatinine ratio.

It has been found that miR-192-5p related to apoptosis and tyrosine kinase signaling pathway (Wu et al., 2015), and the reduction of miR-192-5p expression usually occurs in the more severe stages of diabetes (Ma et al., 2016).

In this study, JTXK granule increased the expression of miR-192-5p in pancreatic tissue of KKAy diabetic mice, which may be a mechanism for its anti-diabetic effect.

According to the network we can intuitive to see that, mmu-miR-192-5p was associated with 18 mRNAs, mmu-miR-291a-3p was associated with 66 mRNAs and mmu-miR-320-3p was associated with 44 mRNAs.

13

In experimental diabetic nephropathy mo dels, TGF-β and miR-192 upregulate miR-216 and 217, which in turn inhibit their target molecule, Pten, resulting in Akt activation, survival and hypertrophy of glomerular mesangial cells [14].

For example, extensive work has demonstrated that the upregulation of miR-192 [12] and miR-216a/miR-217 [14] by TGF-β in mesenchymal glomerular mesangial cells can switch off E-Box transcriptional repressors, resulting in increased collagen synthesis [12], and turn on Akt by repressing its inhibitor, PTEN, promoting mesangial cell survival and hypertrophy [14].

In addition, the frequencies of apoptosis -associated target genes of miR-192, miR-216a, and miR-217, all previously reported to be regulated by TGF-β in kidney disease [12- 14, 31], were not significantly different from random control miRNAs (Figure 2C).

C. Bar graph shows the fraction of genes annotated with the biological process, ‘apoptosis’ (Ingenuity Systems), among all the predicted target genes of TGF-β-regulated miR-30s, miR-192, miR-216a, and miR-217 or the mean ± S. D. of 20 randomly chosen miRs that are not known to be regulated by TGF-β (control).

In addition, miR-192 promotes collagen production in glomerular mesangial cells in experimental diabetic nephropathy by targeting E-box repressors that control collagen expression [12].

miR-192 also mediates TGF-β/Smad3 -induced tubulointerstitial fibrosis [13].

14

From the miRNA database, we also observed that TWEAK down-regulates miRNAs that are targeting proliferation and remo deling of muscles (miR-107), matrix metalloprotease such as aggrecanase-2 (miR-192), adamtsl-3 (miR-199-3p), and genes involved in increasing cell growth and proliferation, and microtubule -associated proteins (miR-23b) (Table 3).

Some of the important miRs with known/putative targets and differentially regulated by TWEAK are presented in Figure 3. Our results showed that TWEAK reduced the expression of muscle-specific miR-1, miR-133a, miR-133b and miR-206 in addition to several other miRs including miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192 (Figure 3A).

Low-density miRNA array of TWEAK -treated C2C12 myotubes showed down-regulation of miR-1, miR-133a, miR-133b, miR-206, miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192.

miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 A) C2C12 myotubes were treated with 10ng/ml of TWEAK for 18h following isolation of total RNA enriched with small RNAs.

In addition to MyomiRs, TWEAK also down-regulated a few more miRNAs such as miR-27a and b, miR-93, miR-199a-3p, miR-107, miR-192, and miR-23b (Fig. 5A).

miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 In order to understand the interaction between different genes, we generated common networks using Ingenuity Pathway Analysis (IPA) software.

15

These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203.

The down-regulation of mmu-miR-203 and mmu-miR-192 is described for the first time and warrants further elucidation.

Mmu-miR-200b and mmu-miR-200c(members of the mmu-miR-200 family), mmu-miR-203 and mmu-miR-192 target Zeb1 and Zeb2 that regulate epithelial to mesenchymal transition [41] and have recently been implicated in adipogenesis and obesity [42].

On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*.

The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379.

16

Furthermore, the decreased expression of miR-192 seems to correlate directly with tubulointerstitial fibrosis and a low glomerular filtration rate, and TGF-β suppresses miR-192 expression in cultured proximal tubular cells [26].

On the other hand, miR-192 and miR-194 were highly expressed in the kidney and small intestine, and miR-449a was highly expressed in the lung (Figures 3(d) and 3(e)).

miR-192 and miR-194 were highly expressed in the kidney and in the small intestine.

The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure.

Consistently, the plasma concentrations of the miR-200 family members and miR-192 and miR-194 increased significantly.

A significant increase in plasma miR-200a/b/c, miR-192, and miR-194 levels was observed in the AKI mo del.

17

As shown in Fig. 2, the levels of miR-192, miR-194 and miR-122 in serum do not change between 4–12 weeks post infection, whereas five of the miRNAs that are up-regulated in the liver are also significantly elevated in serum at 12 weeks post infection (p<0.05), ranging from 2.6 fold (miR-21) to 4.7 fold (miR-214) (Table S2).

Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45].

However, according to our analysis, although miR-192, miR-122 and miR-194 were down-regulated in the liver during infection, their levels in serum did not change significantly (Fig. 1– 2).

A number of reports have demonstrated an increase in miR-122 and miR-192 in plasma or serum upon viral infection as well as chemically induced liver disease [54], [56].

Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection.

Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1).

18

We previously suggested that of the miRs analyzed, nine (miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194) stand out as being differentially expressed in C57BL/6 mice undergoing IRI compared to the expression observed in mice undergoing a sham procedure [14].

Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on expression data for miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) (Movie S3).

Movie showing the rotation of a three-dimensional plot of the first three PCs obtained by performing PCA on all expression data obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) in which we eliminated miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 from the analysis.

Panel C, Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on all expression data obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) in which we eliminated miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 from the analysis.

Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on expression data for miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines).

Our previous work showed that in C57BL/6 mice, expression of miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 is significantly different between IRI and sham control groups at all times analyzed [14].

19

Further, p53 appears to regulate the expression of Dicer through its transcriptional target miRs, such as miR-192, 215, miR29a/b/c, miR-148, miR-15/16a, miR-206, and miR-103 [Table 2], suggesting that p53/p63/p73 could regulate the expression of dicer both at the transcriptional and the post-transcriptional level.

Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45].

However, this does not explain how stress related miRNAs, such as miR-34, miR-192, and miR215, are produced in a p53 -dependent manner in response to DNA damage.

20

Nevertheless, controversial results have been reported, as Zarjou et al. [27] also observed a down-regulation of this miRNA whereas Chung et al. [34] found an up-regulation of miR-192 using the same experimental mouse mo del.

Most notable, among the up-regulated miRNAs were miR-205, miR-342 and miR-21, while miR-29c, miR-192, miR-30b and miR-200a were significantly down-regulated.

We also observed a down-regulation of miR-192, a miRNA exhibiting both pro- and anti-fibrotic properties depending of cell phenotype [33].

21

As shown in Figure 6, qualitative qPCR validated that ssc-miR-146a-5p, ssc-miR-221-5p and ssc-miR-148b-3p were significantly upregulated by LPS, and ssc-miR-215 and ssc-miR-192 were downregulated.

Similarly, five miRNAs (ssc-miR-192, 4_16129, 13_5595, ssc-miR-215 and ssc-miR-429) were significantly downregulated (Table 3).

Differential expressions of five selected miRNAs (ssc-miR-146a-5p, ssc-miR-221-5p, ssc-miR-148b-3p, ssc-miR-215 and ssc-miR-192) were validated by quantitative polymerase chain reaction (qPCR).

22

However, Wu et al. identified HOXB9 as a direct target of miR-192, a miRNA from the same family and with a high homology to miR-215-5p [43].

The most prominent regulatory effect of miR-215-1p on HOXB9 was observed under p53-wild-type conditions, in cell line HCT-116 [+/+], which could be partly explained by the fact that miR-192 13, 44 and miR-215 [44] have been shown to be p53-responsive miRNAs.

Song B miR-192 Regulates dihydrofolate reductase and cellular proliferation through the p53 microRNA circuitClin.

Boni V miR-192/miR-215 influence 5-fluorouracil resistance through cell cycle -mediated mechanisms complementary to its post-transcriptional thymidilate synthase regulationMol.

Wu SY A miR-192-EGR1-HOXB9 regulatory network controls the angiogenic switch in cancerNat.

Ye M Curcumin promotes apoptosis by activating the p53-miR-192-5p/215-XIAP pathway in non-small cell lung cancerCancer Lett.

23

The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2).

We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b).

24

In a mouse mo del of diabetic nephropathy, inhibition of miR-21 improved kidney function and alleviated the progression of renal injury [42], whereas inhibition of renal miR-192 suppressed the expression of fibrotic markers, such as collagen, TGF-β1, and fibronectin in a mouse mo del of type I diabetes nephropathy [43].

Putta S Lanting L Sun G Lawson G Kato M Natarajan R Inhibiting microRNA-192 ameliorates renal fibrosis in diabetic nephropathyJ Am Soc Nephrol.

25

It should be noted that other microRNAs potentially regulating CCNE1 protein expression were also significantly changed, including down-regulation of miR-141, miR-16, miR-15a, miR-352, miR-15b and up-regulation of miR-518e, miR-29a, miR-192, and miR-29b, implicating a regulatory network fine-tuning the cell cycle checkpoints.

26

As expected, general inflammation -associated miRNAs are differentially expressed in active disease, such as miR-146a (involved in innate Toll-like receptor (TLR) responses[15]), miR-192 (highly expressed in colonic tissues with active UC[16]), and miR-21 (upregulated in intestinal tissues of IBD patients[17]).

27

Among these, miR-192 showed reduced expression in UC and was demonstrated to target macrophage-inflammatory peptide-2α and downregulate its expression.

28

Kato and co-workers [10] reported on the expression and function of miR-192 in diabetic kidney glomeruli.

This result was further validated using a TaqMan probe -based qRT-PCR, we detected the expression of miR-10a, miR-30d and miR-192 in various mouse organs: the heart, spleen, kidney, colon and lung.

Although miR-192 was detected at a high level in the kidney, it was also strongly expressed in the liver and colon.

When studying the serum and urinary levels of the miR-200 family, miR-205 and miR-192 in patients with systemic lupus erythematosus (SLE), Wang et al. [20] found that the levels of most of those miRNAs from patients were lower than the levels of controls, suggesting that miRNA may take part in the pathogenesis of SLE and that miRNAs in the urine and serum could be biomarkers for SLE.

29

Hepatic expression of tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22 and miR-125b, and tumor promoting miRNAs, miR-10b and miR-99b in NASH-HCC mo del male and female mice.

As shown in Fig. 4, the tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were lower, whereas the tumor-promoting miRNAs, miR-10b and miR-99b were higher in males than in females in both the STZ-HFD group and the control group.

We also observed that tumor-suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were significantly decreased in STZ-HFD mice compared to controls with significantly lower levels in males than in females.

30

Recently, several miRNAs, including miR-143/145, miR-192/194, miR-339–5p and miR-509-5p have been identified to regulate p53 levels and function through directly targeting MDM2 [27, 29, 30, 48, 49].

miR-192/194 are down-regulated in multiple myeloma [48].

31

Also, several microRNAs, such as miR-130, miR-192 and miR-200, have been reported to have a regulatory role in kidney diseases [16, 17].

Among the differentially expressed miRNAs, we observed the miR-21, miR-192, miR-29, miR-30 which have been associated with the kidney fibrosis by several independent studies.

In addition, let-7d-3p [20], miR-21[21], miR-29 [22], miR-30 [23], miR-130 [16], miR-192 [24], miR-200 [25, 26] have been reported to be related to kidney fibrosis.

miR-192 mediates TGF-beta/Smad3 -driven renal fibrosis.

32

The TaqMan® Array Human MicroRNA Card contained all 13 possible miRs predicted to target IRAK-1, and 24 h HG-stimulation caused the downregulation of seven endothelial miRs: miR-146a-5p, miR-339-5p, miR-874-3p, miR-125-3p, miR-431-5p, miR-192-5p, and miR-215-5p (Figure 2A).

HG stimulation for 24 h revealed that seven miRs, miR-146a-5p, miR-339-5p, miR-874-3p, miR-125-3p, miR-431-5p, miR-192-5p, and miR-215-5p, were downregulated by HG, as compared with unstimulated control.

33

Previously, it was reported that p53, another well-known tumor suppressor, upregulates the transcription of tumor-suppressor miRNAs such as miR-34a/b/c/, miR-107, miR-145, miR-192, and miR-215, which regulate cell proliferation, apoptosis, and angiogenesis [29].

34

Mouse miR-192 showed the highest expression level in plasma of NTBC -treated mice (P0), whereas miR-21a was highest in the plasma of mice after disease onset (P4) (Table 1).

Among these, several miRNAs including let-7/miR-98 family, miR-21, miR-34a/c, miR-142, miR148a, and miR-192 predominantly expressed in liver, exhibited elevated changes in plasma samples 20.

Interestingly, among the 16 miRNAs having >1000 normalized reads in at least one plasma sample (Table 2), several miRNAs (e. g. let-7/miR98 family members, miR-200b, miR-21a, miR-142, miR-192, miR-148a) have already been reported for their implication in liver carcinogenesis and other pathological conditions 13 20.

35

As shown in the CDAA mo del, the EVs isolated from HF mice displayed markedly up-regulated levels of miR-122 and miR-192 compared to EVs isolated from chow mice (Fig. 6F).

The U6 snRNA was used as an internal control and to normalize miR-122 and miR-192 expression.

For isolation and quantification of miR-122 and miR-192, platelet-free plasma was isolated from CDAA-fed, high fat or control mice and incubated with 10 µg/mL of RNase (Roche, Indianapolis, IN, USA) for 30 min at 37°C to remove any RNAs adhering to the external leaflet of circulating EVs.

Moreover, the circulating EVs from mice on the CDAA diet were enriched in miR-122 and miR-192, two abundant microRNAs in hepatocytes.

36

Pichiorri et al. observed that the ectopic expression of miRNA-192, -194 and -215 induced significant down-regulation of MDM2 that was accompanied by p53 overexpression and p21 activation [97].

37

By impairing the expression of Mdm2, overexpression of miR-192/194 has been reported to potentiate the efficacy of the Mdm2 inhibitor MI219 [86].

Other miRNAs may act more subtly by establishing positive feedbacks, e. g., the loop connecting miR-34a, SIRT1 and p53, or miR-192/194, Mdm2 and p53 [83].

38

The highest dysregulated miRNAs identified in the cMyBP-C related HCM mo del were the miR-192 and miR-429 for the upregulated, and the miR-451 and miR-301a for the downregulated.

39

Furthermore, Vasilescu et al. revealed circulating miR-150 as a new prognostic marker of patients with sepsis and Wang et al. described prominent upregulation of serum miR-122 and miR-192 after acute hepatic intoxication by paracetamol in mice (Wang et al., 2009).

Although miR-122, miR-192, miR-21, and miR-34a are shown by most reports to be increased after experimental or human liver injury (Table 1), high variance and conflicting data exist about miRNA incidence in the blood stream upon different liver diseases.

In addition to miR-122 and miR-192, Zhou et al. identified miR-21, miR-223, miR-26a, miR-27a, and miR-801 in serum of patients with hepatocellular carcinoma (HCC) and proposed this miRNA panel as predictive markers of HCC.

40

IsomiRs of miR-192-5p display more expanded or restricted expression with respect to tissues.

IsomiRs in other tissues such as isomiRs of miR-215 in the intestine (Additional file 11: Figure S3), miR-192-5p in the liver (Additional file 12: Figure S4) and miR-3473f-pre in the testis (Additional file 13: Figure S5 and Additional file 14: Figure S6) display similar isomiR expression.

IsomiRs of miR-192-5p in the liver.

Additionally, miR-122 and liver enriched miR-192 were increased in the serum of patients who had acetaminophen induced hepatotoxicity demonstrating the potential for these miRNAs to be used as both preclinical and clinical biomarkers for liver injury [24].

41

In line with a key role of Dgcr8 in miRNA processing, the kidney epithelial cell enriched miRNAs miR-192, miR-200b and miR-204 are strongly downregulated.

The expression of miR-192, miR-200b and miR-204 was significantly decreased in kidneys of Dgcr8 knockout mice (Fig.   5).

42

Finally, miR-192 was observed in different studies to be up-regulated in tissue in animal mo del of fibrosis, but down-regulated in human tissue samples and increased in human urine samples [66– 69].

43

Direct targets of p53 include the already mentioned miR-34 and also miR-192, miR-194 and miR215, which then modulate MDM2 expression [15].

One of the most elegant works provided evidence that miR-192, miR-194 and miR-215 can be transcriptionally activated by p53 [15].

44

Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies.

Bta-miR-320a and bta-miR-192 had the greatest number of copies during fall, 2013, while spring, 2014, had the fewest (P< 0.02).

45

For example, miR-192-5p+1 was 22-fold more highly expressed in human beta cells than in MIN6, miR-10a-5p+1 was 23-fold more highly expressed in human islets than in MIN6, and miR-183-5p+1 was nearly 3-fold more highly expressed in MIN6 than in human beta cells or islets (Fig. 3B).

46

Both expression of miR-192 and miR-200b were greatly reduced in the conditional Dgcr8 knockout mouse line (Figure  2).

Both expression of miR-192 and miR-200b is strongly reduced in Dgcr8 knockout kidneys when compared to WT littermates (4-7 week old animals; ** = p < 0.01; error bars represent SEM).

47

VEGF suppresses epithelial-mesenchymal transition by inhibiting the expression of Smad3 and miR192, a Smad3 -dependent microRNA.

48

Two were upregulated (miR-492 and miR-224) and six were downregulated (miR-191, miR-122, miR-192, miR-101, miR-302b, miR-148a) (Figure  1A).

49

Of the 20 miRNAs downregulated in crypts, 8 showed a >4.0 fold difference (miR-142-5p, miR-16-5p, miR-22-3p, miR-194-3p, miR-33-5p, miR-223-3p, miR-32-5p, miR-140-5p; Fig. 4a1, blue spots), whereas, of the 15 miRNAs upregulated in crypts, 2 showed a >3.0 fold difference (miR-192-5p, miR-98-5p) (Fig. 4a2, blue spots).

50

The quantitative PCR results revealed that the relatively expression level of miR-192-5p was 25- and 200-fold higher than that of miR-351-5p and miR-802-5p, respectively (Figure 4D).

MiR-192 is one of the most abundant miRNAs in the liver [25], and miR-143 is highly expressed in smooth muscle cells (SMCs), fibroblasts [26] and intestinal and lung cells [24].

The average read counts of miR-192-5p, miR-351-5p and miR-802-5p were 14,281, 219 and 12, respectively, and representing the high, middle and low abundance levels for the identified miRNAs (Supplementary Table 2).

51

Mdm2 is negatively regulated by several miRNAs including miR-192 (Pichiorri et al., 2010), miR-194 (Pichiorri et al., 2010), miR-215 (Pichiorri et al., 2010), miR-221 (Kim et al., 2010), and miR-17 (Li and Yang, 2012) in different cellular contexts; however, whether these or other miRNAs regulate Mdm2 expression during the CNS development must be determined.

52

For example, miR-192/194 down-regulate Per gene expression in vitro leading to a shortening of the circadian period length [20].

53

Reduced expression of miR-709 (a highly expressed miRNA), miR-122, miR-192, miR-194, miR-26a, let-7a, let7b and let-7c, miR-494 and miR-483* (reduced by ~4.9 fold) was validated by qPCR.

We found that ZSWIM3 (zinc finger, SWIM domain containing 3), a protein whose function was yet to be characterised [56], was targeted by 5 miRNAs namely miR-122, miR-192, miR-194, miR-709 and miR-483*.

54

Besides the metabolic pathways, recent studies have shown that micro RNAs, such as miR-122, miR-192, miR-21, miR-29a, miR-34a, and miR-505, are up or down regulated at disease state of NASH and may play a role in the disease progression (Liu et al., 2018).

55

Among these differentially expressed miRNAs, let-7b, miR-26b, miR-182, miR-192, let-7d, miR-15b, miR-16, let-7a and miR-378, were confirmed by RT-qPCR to exhibit marked decreases in expression in the intestinal mucosa following intestinal I/R (Table 2).

Second, because several miRNAs responded rapidly to intestinal I/R, this study only investigated the function of miR-378 in ischemic intestine; whether other differentially expressed miRNAs (miR-182, miR-192, let-7a, etc. )

56

Kim et al. [64] found that p53 up-regulated miR-200 and miR-192 family members and described the role of p53 in regulating epithelial-mesenchymal transition (EMT) in HCC through the induction of specific effector microRNAs including miR-141, miR-192, miR-194, miR-200b, miR-200c, and miR-215.

57

There was no significant change in the expression of miR-192 (t [(5.5)]=1.15, P=0.335).

An independent cohort of CORT -treated animals was generated to validate the five top miRNA candidates, miR-190b, miR-192, miR-449a, miR-98 and miR-144, using SNORD95 as a reference gene (Figure 5d).

miR-192, miR-449a and miR-98 have predicted binding to Igf2 (Figure 5c).

58

Expression was quantified using ΔCt for miR-221 or standard curve for miR-133a, miR-192, and miR-205.

However, when mice were fed a high fat diet, miR-192-5p and miR-205-5p showed no sex or sex chromosome differences.

Values for miR-192 and miR-205 were log [10]-transformed before statistical analysis.

59

In addition to the 43 liver-specific miRNAs, five miRNAs (miR-148a, miR-192, miR-194, miR-122, and miR-21) were highly expressed in the liver but at low levels in the brain; four of them (miR-148a, miR-192, miR-194, miR-122) were expressed at levels at least 10-fold greater in the liver than in the brain.

60

The mir-192/194 cluster was identified as a potent inhibitor of the Per gene family, the enforced expression of which leads to an altered circadian rhythm [14].

61

Hepatocyte -associated miRNAs, such as miR-122, miR-145, miR-192, and miR-194, were also upregulated (Figure 3B).

62

In addition, miR-106a, miR-146, miR-155, miR-150, miR-17-3p, miR-191, miR-197, miR-192, miR-21, miR-203, miR-205, miR-210, miR-212, and miR-214 have been reported to be up-regulated in lung cancer [12].

63

In NIH/3T3 fibroblasts, overexpression of the miR-192/194 cluster represses the 3′ UTRs of Per1, Per2 and Per3 and shortens the circadian period of the Bmal1 mRNA rhythm [25].

In mammals, the miR-192/194 cluster has been identified as a potent repressor of the 3′ UTRs of all Per genes [25].

64

Although the p53 transcription factor is known to regulate a number of miRNAs, including miR-34a, miR-23b, miR-26, miR-30, miR-107 and miR-192 [40]– [45], there was very little difference in miRNA expression patterns between tumors derived from p53 wild-type TH- MYCN versus p53 mutant TH- MYCN mice, despite significant differences in tumor phenotype when MYCN drives neuroblastoma in a p53 deficient background [25].

65

Pichiorri et al. [11] demonstrated miR-192, 194 and 215 downregulation in a subset of newly diagnosed MMs and on this basis suggested a new potential therapeutic strategy.

66

Three probesets aligned to regions that contain structural variants among CC founder strains (miR-148b, miR-192, and miR-194), but the observed patterns of expression were not correlated with the strain distribution of structural variants.

67

Among the known ~2,500 miRNA by deep sequencing of human genome [12], miR-192, miR-194, miR-204, miR-215 and miR-216 are highly expressed in kidney than other human tissues [13].

68

Another eight constitutive miRNAs (let-7d-5p, let-7f-5p, miR-23a-3p, miR-26a-5p, miR-30a-3p, miR-3od-5p, miR-191-5p, and miR-192-5p), which showed homogeneous expression in the microarray analysis were used for normalization.

69

All data were analyzed using the Comparative ΔΔCT method to generate relative expression data using miR-192-5p as the internal control for all samples.

70

Analysis of miR-706 knockdown in MPRO cells showed a ~1.5-fold increase in miR-192 levels, however this increase was not statistically significant (Figure 7C).

Of these 7 miRNAs, miR-142 and miR-192 possessed putative binding sites in their primary transcripts that demonstrated near perfect binding to mature miR-706 (Figure 6B).

71

In this rodent mo del, the expression of 27 miRNAs is significantly (>6-fold) increased (e. g., miR-1, miR-34a, 132, 223, and 224), while that of 19 miRNAs is reduced (<0.49-fold; e. g., miR-192, 194, 215, and 375) in the colon tumors (Davidson et al., 2009).

72

miRNA nameIL10 [−/−] mice mo del Intestinal Inflammation Inflammation mmu-miR-29b-3p x mmu-miR-122-5p x x x mmu-miR-148a-3p x mmu-miR-150-5p x x mmu-miR-192-5p x mmu-miR-194-5p x mmu-miR-146a-5p x mmu-miR-375-3p x x x mmu-miR-199a-3p x We showed that our nine-miRNA signature could discriminate between the different forms of colitis and arthritis, as well as between non-colitic mice with and without a genetic predisposition to develop the disease (WT mice versus non-colitic IL10 [−/−] mice).

73

For example, miR-192 and miR-194 are abundantly expressed in normal human kidneys, and their levels in rats are higher in the renal cortex than in the medulla [1], [2].

74

Several miRNAs were found to be highly expressed in particular tissues: miR-204, -218, and -129-2-3p in brain tissues, miR-30a, -30e, -30d, -200a and -200b in kidney, miR-192 in liver, miR-451 in spleen, miR-21 in spleen and thymus, miR-193b, -378 in LDM muscle.

75

MiR-192 and miR-21 were the most highly expressed miRNAs associated with active UC in human colon tissues.

76

In our experiment, we chose livers as the source of miRNAs while these two biomarkers (miR-122 and miR-192) were proved to be useful in circulating miRNA (Starkey et al., 2011).

Interestingly, miR-122 and miR-192 did not show any differences between these two groups in our experiment though they are the biomarkers for liver injury (Su et al., 2012).

Wang et al (Wang et al., 2009) showed that some specific miRNA species in blood, such as miR-122 and miR-192, have detectable dose- and exposure duration -dependent changes in APAP -induced liver injury in mice using miRNA microarray.

77

MicroRNAs targeting MDM2: miR-192, miR-194, miR-215, miR-221, miR-605, miR-17-3p, miR-193a, miR-25, miR-32, miR-143, miR-145, miR-18b, miR-661 [reviewed in Ref.

78

Five additional miRNAs (miR-664-3p, miR-592-5p, miR-484, miR-687 and miR-192-5p) showed expression differences which were close to significance (significance cut-off: p < 0.002).

79

Int J Cancer 30 Boni V Bitarte N Cristobal I Zarate R Rodriguez J 2010 miR-192/miR-215 Influence 5-Fluorouracil Resistance through Cell Cycle-Mediated Mechanisms Complementary to its Posttranscriptional Thymidilate Synthase Regulation.

80

Braun et al. studied miR-192 and miR-215, which have the same "seed sequences", and showed they can both act as effectors as well as regulators of p53 [52].

81

Interestingly, one miRNA cluster (composed by miR-192 and miR-194a) appears to be regulated by the same lincRNA (lincRNA 555, ENSSSCT00000033052).

82

Previous studies have also shown that circulating miRNA-146a and miR-223 were significantly reduced in septic patients [19], while serum miRNA-122 and miRNA-192 were elevated in a mouse mo del of drug -induced liver injury [20].

83

Plasma miR-22, miR-101b, miR-122, miR -133a, miR135a*, miR-192, miR193 and miR486 have been shown to be affected by liver damage [39].

84

Wang Y. Jia L. S. Yuan W. Wu Z. Wang H. B. Xu T. Sun J. C. Cheng K. F. Shi J. G. Low miR-34a and miR-192 are associated with unfavorable prognosis in patients suffering from osteosarcoma Am.

85

For example, Kato et al reported a role for miR-192 in diabetic nephropathy [16].

86

In addition, we found that liver-enriched miR-122 and miR-192/194 as well as erythrocyte-enriched miR-451 levels were also detected in the plasma of these mice (miR-122, 34.69 ± 0.07 Ct; miR-192, 27.06 ± 0.17 Ct; miR-194, 30.48 ± 0.10 Ct; miR-451, 21.42 ± −0.16 Ct).

87

miR-192 and miR-200a/b have antifibrotic roles in tubular epithelial cells, but they are profibrotic to the mesangial cells of the glomerulus in the kidney [10].

88

Curcumin promotes apoptosis by activating the p53-miR-192-5p/215-XIAP pathway in non-small cell lung cancer.

89

41 mmu-miR-33 −59.71 mmu-miR-222 1.23 mmu-miR-93 −1.52 mmu-miR-124 −97.01 mmu-miR-429 1.07 mmu-miR-192 −1.52 mmu-miR-129-5p −111.43 mmu-miR-100 −1.74 mmu-miR-210 −157.59 mmu-miR-20a −2 mmu-miR-134 −194.01 mmu-miR-137 −2 mmu-miR-215 −222.86 mmu-miR-194 −2.14 mmu-miR-452 −675.59 mmu-miR-196a −2.64 mmu-miR-223 −955.43 Differentiated sample versus control sample [DIF EBs d8/CONTROL EBs d8].

90

ER stress and mitochondrial dysfunction are downstream of the PKCα-miR-192-PGC-1α pathway.

91

Based on these principles, we identified eight candidate miRNAs (bbe-miR-21, bbe-miR-122, bbe-miR-192, and so on).