194 publications mentioning mmu-mir-30d (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-30d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

miR-30s are abundant in podocytes and are downregulated by TGF-β in vitro and in vivo Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice.

B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice.

The important role of TGF-β in controlling epithelial plasticity by promoting epithelial-to-mesenchymal transition (EMT) is well-documented [34] and is dependent on the coordinated upregulation of miR-155 and the subsequent inhibition of its target, RhoA, and the downregulation of miR-30 in mouse mammary epithelial cells [35].

Together, these results suggest that among the various miRs regulated by TGF-β in kidney disease, the TGF-β -induced downregulation of miR-30 may regulate apoptosis -associated target genes and their associated apoptotic pathways.

Overexpression of miR-30 induced, while miR-30 reduction inhibited, the apoptosis of BT-ICs cells through affecting target Itgb3 expression.

In silico predictions of miR-30 targets and functionTo obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www.

Among the 190 genes that are upregulated in the glomeruli of Dicer [fl/fl]:NPSH2-Cre mice, the predicted miR-30 targets were highly enriched, suggesting a role for miR-30 in the gene expression and homeostasis of podocytes [16].

These findings demonstrate that miR-30s are abundantly expressed in the podocytes and parietal epithelial cells of glomeruli, and TGF-β downregulates miR-30 expression in podocytes both in vivo and in vitro.

Moreover, we examined the precursors of these miR-30s in these RNA samples by qPCR, and the result showed that they were also downregulated in the glomeruli of Alb-TGF-β mice (Figure S2), suggesting that TGF-β regulates miR-30 expression at the transcription level.

To obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www.

In response to TGF-β treatment, miR-30d was downregulated in the clones expressing scrambled control miRNA (Figure 3B).

Interestingly, miR-30 has recently been shown to target p53 directly in human cardiomyocytes, resulting in inhibition of Drp1 -mediated mitochondrial fission and apoptosis in response to oxidative stress [20].

Ongoing and future work will be needed to elucidate at the molecular level the mechanisms that mediate the concerted downregulation of all five miR-30 family members downstream of Smad2 and to determine how miR-30s inhibit the phosphorylation/activation of pro-apoptotic p53.

However, the reported inhibitory mechanism of a direct miR-30-p53 target pairing differs from that observed in our results.

The small decrease of miR-30d by TGF-β in the lentiviral miR-30d -expressing clones might be caused by endogenous miR-30d downregulation by TGF-β.

In the current study, we report that miR-30s are expressed selectively and abundantly in glomerular podocytes in mice and that TGF-β profoundly downregulates miR-30 members in podocytes both in vivo and in vitro.

We propose that the miR-30 family represents an attractive novel therapeutic target for the protection of podocytes in glomerular diseases, as our study demonstrated that maintenance of miR-30 levels above critical thresholds prevented podocyte apoptosis in the presence of TGF-β.

Exogenous miR-30d -expressing podocyte clones and scrambled miR -expressing control clones were treated with TGF-β for 48 hrs.

Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A typical miR is predicted to target hundreds of genes based on the presence of its recognition motif(s) in the 3’ untranslated regions (UTRs) of the genes.

Sustained expression of miR-30 inhibits TGF-β induced apoptosis of podocytes.

B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. A. Immunoblots depict cleaved caspase-3, phosphorylated p53 (p-p53), phosphorylated p38 (p-p38), or GAPDH (loading control) in podocytes expressing scrambled miR or miR-30d left untreated (-) or treated (+) with TGF-β.

Similarly, TGF-β induced caspase 3 cleavage in wildtype podocytes and pooled scramble miR -expressing clones, but not in pools of miR-30d -expressing clones (Figure 4B).

TGF-β treatment (5 ng/ml) for 48 hrs significantly increased the number of condensed nuclei and the number of TUNEL -positive nuclei in scrambled miR -expressing control podocytes, but these numbers were not highly increased in miR-30d -expressing podocytes cultured under either permissive (Figure 5B) or non-permissive conditions (Figure 5C).

Thus, because the miR-30-p53 target pairing is not evolutionarily conserved and is only observed in primate genomes, our findings provide an important, previously unknown alternative mechanism for the inhibition of p53 -mediated apoptosis by miR-30, at least in glomerular podocytes.

File S1 Table S1, 155 miR-30 targets that are commonly predicted by TargetScan, PicTar, and miRbase, and conserved among human, dog, mouse and rat.

There were 873 genes predicted to be miR-30 targets by TargetScan, 634 by PicTar, and 1,566 by miRbase.

Lentiviral expression of miR-30d abrogates the TGF-β -induced expression and activation of pro-apoptotic p53.

Immunoblots showing cleaved caspase-3 levels A. in two independent clones each of scrambled miR- or miR-30d -expressing podocytes left untreated (-) or treated with TGF-β (5 ng/ml) (+) for 48 hr; or B. in uninfected wildtype podocytes (wt) and pooled podocytes infected with scrambled miR (Scram)- or miR-30d -expressing lentivirus left untreated (-) or treated with TGF-β (+) (tubulin is shown as loading control).

0075572.g004 Figure 4Immunoblots showing cleaved caspase-3 levels A. in two independent clones each of scrambled miR- or miR-30d -expressing podocytes left untreated (-) or treated with TGF-β (5 ng/ml) (+) for 48 hr; or B. in uninfected wildtype podocytes (wt) and pooled podocytes infected with scrambled miR (Scram)- or miR-30d -expressing lentivirus left untreated (-) or treated with TGF-β (+) (tubulin is shown as loading control).

To determine whether a putative functional role of miR-30 could be predicted by in silico analysis of miR-30 target genes, we took a stringent approach and searched for potential miR-30 target genes that not only carry evolutionarily conserved miR-30 recognition motifs in their 3’-UTRs (Figure 2A) but also are consistently predicted by the three independent miR databases.

uk/enright-srv/microcosm/htdocs/targets/), and then selected the common genes as our predicted miR-30 targets.

The Smad2 -dependent pathway mediates the TGF-β -induced downregulation of miR-30d, and Smad3 is not required.

miR-30 downregulation is required for activation of pro-apoptotic p53 by TGF-β.

Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A. miR-30d transcripts were abundantly detected by in situ hybridization in podocytes (yellow arrows) and parietal epithelial cells (white arrows) in adult wildtype (wt) control mice, but not in Alb-TGF-β transgenic (Tg) mice; B. miR-30a, -30b, -30c, -30d, and -30e were significantly downregulated in cultured human podocytes after 6 and 24 hr of TGF-β treatment (5 ng/ml).

miR-30 precursors were downregulated in the glomeruli of Alb-TGF-β transgenic mice.

Similarly, our results demonstrated for the first time that the concerted downregulation of all miR-30 members was specifically required for the activation of a central mediator of apoptosis, p53, by TGF-β.

Downregulation of miR-30 members was required for TGF-β -induced apoptosis in visceral glomerular epithelial cells (podocytes).

The finding that the TGF-β -induced downregulation of miR-30 may selectively promote apoptotic outcomes by permitting the activation of p53 expands our understanding of the emerging role of miRNAs in conferring biological specificity in cell type -dependent pluripotent TGF-β signaling networks.

Mechanistic studies demonstrated a novel and selective functional role for Smad2 -dependent downregulation of miR-30 in the TGF-β -mediated activation of pro-apoptotic p53, and this pathway was required for TGF-β -induced podocyte apoptosis.

A. miR-30d transcripts were abundantly detected by in situ hybridization in podocytes (yellow arrows) and parietal epithelial cells (white arrows) in adult wildtype (wt) control mice, but not in Alb-TGF-β transgenic (Tg) mice; B. miR-30a, -30b, -30c, -30d, and -30e were significantly downregulated in cultured human podocytes after 6 and 24 hr of TGF-β treatment (5 ng/ml).

miR-30 downregulation by TGF-β is mediated by Smad2 -dependent signaling and does not require Smad3.

These results suggest that Smad2 -dependent downregulation of miR-30 by TGF-β is required to specifically activate p53 signaling during podocyte apoptosis.

TGF-β significantly downregulated levels of miR-30 members in wild-type podocytes and S3 KO podocytes (Figure 6B).

In contrast, Smad2 -dependent signaling selectively downregulates miR-30 family transcripts to permit the activation of pro-apoptotic p53, which is required for caspase-3 activation and apoptosis.

In contrast, TGF-β had no significant effect on miR-30 levels in S2 KO and D KO podocytes (Figure 6B), demonstrating that Smad2 mediates the TGF-β -induced downregulation of miR-30 in podocytes.

Lentiviral expression of miR-30d in infected podocytes sustains miR-30d levels upon TGF-β treatment.

B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. The novel findings reported in our work connect for the first time the miR-30 family with the TGF-β/Smad signaling network.

Thirty out of 116 (26%) of the annotated miR-30 target genes were associated with apoptosis (Figure 2C, Table S2 in File S1).

To validate the in silico predictions experimentally, we generated luciferase reporter vectors containing 3’-UTRs with miR-30 recognition sequences from 7 of the predicted target genes.

Together, these results demonstrated that miR-30d levels was sustained by lentiviral miR-30d expression in podocytes treated with TGF-β.

C. Quantitation of apoptosis rates under non-permissive differentiating culture conditions (37 °C, - IFN-γ); D. Bar graph demonstrating the fraction of TUNEL -positive nuclei in human podocytes infected with lentiviral vectors to express either scrambled control miR (Scram) or miR-30a (30a), miR-30d (30d), or combined miR-30a, -30c, -30d (30acd) left untreated (blue bars) or treated with TGF-β (5 ng/ml) for 48 hr (red bars).

Our results suggest that a high estimated percentage (~ 86%) of the 155 genes could be experimentally validated as genuine targets of miR-30.

Thus, we conclude that an essential miR-30 threshold exists in podocytes, above which miR-30s can suppress pro-apoptotic factors and promote cell survival.

Lentiviral expression of miR-30d prevents TGF-β -induced caspase-3 activation.

0075572.g003 Figure 3 A. Bar graph showing the mean ± S. D. of the relative abundance of miR-30d (black bars) and miR-30c (gray bars) in podocyte clones stably expressing scrambled miR (sc-1, sc-2, sc-3) or miR-30d (30d-1, -2, -3, -4, -5).

In contrast, the TGF-β -induced phosphorylation of pro-apoptotic p53 observed in control podocytes was absent in lentiviral miR-30d -expressing podocytes (Figure 7A).

0075572.g007 Figure 7 A. Immunoblots depict cleaved caspase-3, phosphorylated p53 (p-p53), phosphorylated p38 (p-p38), or GAPDH (loading control) in podocytes expressing scrambled miR or miR-30d left untreated (-) or treated (+) with TGF-β.

Among these genes, 155 were predicted to be miR-30 targets in all three databases and were conserved in human, dog, rat and mouse (Table S1 in File S1).

B. Bar graph showing the mean ± S. D. of the activity of luciferase reporter constructs carrying 3’ UTR sequence fragments of seven genes randomly chosen from the 155 predicted miR-30 target genes.

Lentiviral miR-30 expression sustains miR-30 levels in podocytes treated with TGF-β.

0075572.g005 Figure 5 A. Representative images showing TUNEL -positive nuclei (red arrows) and condensed nuclei (white arrows) in conditionally immortalized murine podocytes expressing scrambled miR (Scram) or miR-30d left untreated or treated with TGF-β for 48 hr (20X).

Five independent stable clones were examined for miR-30d expression by qRT-PCR, and all were found to have an increased level of miR-30d (Figure 3A).

In contrast, miR-30d levels remained high in the miR-30d -overexpressing clones in the presence of TGF-β (Figure 3B).

Although the precise physiological roles of miR-30s remain poorly understood, miR-30 members may promote tumor invasion and metastasis by targeting Galphai2 in liver cancer cells [19].

In contrast, TGF-β had no effect on the apoptotic rates of podocytes with lentiviral expression of either miR-30a, miR-30d, or miR-30a/30c/30d combined (Figure 5D).

In addition, p53 protein levels were increased by TGF-β in control cells, whereas the overexpression of miR-30d blocked the effect of TGF-β on p53 protein levels (Figure 7B).

Mouse podocytes were infected with a miR-30d -expressing lentivirus followed by G418 treatment to eliminate the uninfected cells.

A. Bar graph showing the mean ± S. D. of the relative abundance of miR-30d (black bars) and miR-30c (gray bars) in podocyte clones stably expressing scrambled miR (sc-1, sc-2, sc-3) or miR-30d (30d-1, -2, -3, -4, -5).

In silico predictions of miR-30 targets and function.

Table S2, List of cell death associated genes from the 155 predicted miR-30 targets according to analyses of Inguinity System.

Apoptosis associated genes are highly enriched among the predicted miR-30 targets.

Reporter constructs were cotransfected with either a scrambled miR expression construct (control) or a synthetic miR-30 precursor (pre-miR-30a).

Functional annotations were available in the Ingenuity Pathway Analysis software for 116 of the 155 predicted miR-30 targets.

Maintenance of sufficient miR-30 levels may provide a new therapeutic strategy to promote podocyte survival and prevent podocyte depletion in progressive glomerular diseases.

Lentiviral miR-30d expression also did not alter the TGF-β -induced phosphorylation of p44/42 MAP kinase or Akt.

We purchased miR-30d- and scrambled control miR -expressing lentiviruses from GeneCopoeia (Rockville, MD) and followed the company’s instructions for preparation of lentiviral stocks.

A. Representative images showing TUNEL -positive nuclei (red arrows) and condensed nuclei (white arrows) in conditionally immortalized murine podocytes expressing scrambled miR (Scram) or miR-30d left untreated or treated with TGF-β for 48 hr (20X).

We used a lentiviral system to overexpress miR-30d to maintain miR-30d levels in podocytes during TGF-β treatment.

However, Itgb3 is not expressed in podocytes (data not shown), precluding the involvement of miR-30-Itgb3 pair in podocyte apoptosis.

TGF-β induced the phosphorylation of p38 in both control scrambled miR- or exogenous miR-30d -expressing podocytes (Figure 7A).

In contrast, miR-30d expression was greatly reduced in podocytes of Alb-TGF-β mice (Figure 1A).

B. Bar graph showing the relative abundance of miR-30d levels in three control clones (sc-1, -2, and -3) and five miR-30d -expressing clones left untreated (white bars) or treated with TGF-β (5 ng/ml) (black bars) for 48 hr.

As expected, TGF-β induced the cleavage of caspase 3 in two of the control clones, but not in the miR-30d -expressing clones (Figure 4A).

Because we demonstrated that miR-30 was specifically controlled by Smad2, but not Smad3, therapeutic supplementation of miR-30 may provide an approach to target pro-apoptotic TGF-β activity without interfering with homeostatic Smad3- or Cd2ap -dependent activities.

To investigate whether miR-30 downregulation by TGF-β had any role in podocyte apoptosis, one of the miR-30 family members, miR-30d, was studied as a representative member of the family.

Finally, TGF-β treatment of human podocytes cultured under non-permissive or permissive conditions significantly reduced the levels of all five miR-30 family members beginning at 6 hrs, as determined by qRT-PCR (Figure 1B).

A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line).

The miR-30 family consists of 5 evolutionarily conserved members, miR-30a through -30e.

For example, we demonstrated for the first time that to induce apoptosis in podocytes, TGF-β signaling must decrease protective miR-30 levels specifically through the Smad2 -dependent pathway, whereas Smad3 is not required.

miR-30 quantification in the RNA samples was conducted by qRT-PCR using the Ncode miRNA Amplification System (Invitrogen, Carlsbad, CA).

In adult control mice, miR-30d was abundantly present selectively in podocytes and parietal glomerular epithelial cells, but was absent in glomerular endothelial and mesangial cells (Figure 1A).

Indeed, therapeutic maintenance of miR-30 may protect epithelial cells, including podocytes, from multiple pro-apoptotic stressors, including TGF-β (this work) and oxidative stress and hypoxia [20].

Thus, we performed in situ hybridization studies on kidney sections using a miR-30d LNA probe.

In addition, miR-30 has been implicated in the epithelial-mesenchymal transition (EMT) or mesenchymal-epithelial transition (MET) via TGF-β signaling in anaplastic thyroid carcinomas [22].

Thus, it will be interesting to examine whether restoration of homeostatic miR-30 levels by therapeutic miR-30 replacement therapy will protect the survival of podocytes exposed to a range of common mediators of glomerular injury, including metabolic, mechanic, and toxic stressors.

Moreover, we showed that sustaining miR-30 levels above this proposed threshold prevented both increases in protein and in phosphorylation of p53 in podocytes.

0075572.g002 Figure 2 A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line).

B. Bar graph showing the mean ± S. D. of the relative abundance of miR-30d after 24 hr of TGF-β treatment (black bars) normalized to untreated conditions in WT, S2 KO, S3 KO, or D KO podocytes.

Note that at the age of 2 weeks the Alb-TGF-β mice had a ~ 20% podocyte loss according to our previous studies [8], which contributed to the miR-30 reduction in the glomeruli of Alb-TGF-β mice.

Finally, we repeated these experiments using lentiviral miR-30a or a combination of miR-30a, -30c, and -30d in comparison with a scrambled miR control and miR-30d (Figure 5D).

Thus, we propose a novel pro-apoptotic TGF-β-Smad2-miR-30-p53 pathway that is necessary for caspase-3 activation and apoptosis in podocytes (Figure 8).

2

In the genes suppressed by miR-30d over -expression, most are tumor-suppressing genes that were down-regulated by miR-30d transfection.

Our findings showed that amplified copy number of the MIR30D gene and/or up-regulated expression of miR-30d were positively correlated with CSCC disease progression, indicating that miR-30d plays as a critical oncomir in CSCC progression and could be a potential biomarker and therapeutic target for CSCCs.

To explore the clinical significance of altered miR-30d expression levels, the intracellular miR-30d expression were scored as overexpression (CSCC/ANT ≧2, n = 59) and moderate or low expression (n = 77).

One hundred twenty-nine down-regulated genes were shared in Hela and SiHa cell lines, and 68 of these were TargetScan predicted targets of miR-30d.

qPCR validation of transcripts that were downregulated in both HeLa and SiHa cells after transfection with the miR-30d mimic and that were also predicted miR-30d targets by TargetScan.

Moreover, about 1/3 (n = 129) down-regulated genes were shared in both cell lines, and 68 of these were TargetScan predicted targets of miR-30d [see Additional file 3].

a Venn diagrams of transcript numbers shared by downregulated transcripts in miR-30d mimic transfections in HeLa and SiHa cells and predicted targets of miR-30d by TargetScan.

e- f Tumor growth indicates the stable inhibition of miR-30d expression in CSCC cell lines when subcutaneously injected into the right (inhibitor of miR-30d) and left (control) flanks of male nude mice (n = 15).

a Expression levels of miR-30d were examined by real-time PCR; b After treatment of miR-30d inhibitor, mimic and control strand, the expression levels of miR-30d were examined by real-time PCR.

The 2 groups were divided according to the expression levels of miR-30d (over -expression group, T/ N ≥ 2, n = 57; mid or low expression group, n = 79) and analyzed (P = 0.0009; log-rank test) to determine its association with biochemical recurrence in CSCC To further investigate the role of miR-30d abnormalities in the spread of CSCCs, we compared the expression of miR-30d between primary tumors and metastases isolated from 21 cases with qualified paired lymph node metastasis samples (≦IIa, from surgery).

Over -expression of miR-30d down-regulated 464 genes in HeLa cells.

Over -expression of miR-30d down-regulated 464 and 376 genes in HeLa and SiHa cells, respectively [see 1 & 2].

org/), 131 of 464 down-regulated genes in HeLa and 117 of 376 in SiHa were predicted as targets of miR-30d (Fig. 5a).

Over -expression of miR-30d down-regulated 376 genes in SiHa cells.

The 2 groups were divided according to the expression levels of miR-30d (over -expression group, T/ N ≥ 2, n = 57; mid or low expression group, n = 79) and analyzed (P = 0.0009; log-rank test) to determine its association with biochemical recurrence in CSCC To further investigate the role of miR-30d abnormalities in the spread of CSCCs, we compared the expression of miR-30d between primary tumors and metastases isolated from 21 cases with qualified paired lymph node metastasis samples (≦IIa, from surgery).

miR-30d expression level in each sample was analyzed using Bio-Rad CFX Manager software and normalized to the expression of U6.

As a non-coding RNA, miR-30d must mediate its tumor-promoting role through suppression of special targets.

In the in-vitro and in-vivo studies, we showed that amplification and up-regulation of miR-30d promoted CSCC growth and metastasis, which further indicated the important role of miR-30d de-regulation in the progression of CSCC.

The expression level of miR-30d was normalized to the expression state of U6.

These data suggested that about 30% of those downregulated transcripts were indeed directly repressed by miR-30d.

Taken together, these results indicate that miR-30d directly affects the expression of a number of genes in CSCC to play its oncomiric role.

Hence, to some extent DNA copy amplifications were the driving force of the up-regulation of miR-30d in CSCCs.

HeLa and SiHa showed relatively higher expression of miR-30d (Fig. 4a), and thus were selected for the following knockdown experiments.

Bioinformatics methods were used to analyze the possible direct targets of miR-30d.

Enhanced expression of miR-30d plays an oncomiric role in CSCC through the regulation of various cancer-related genes.

CSCCs with increased copy number of MIR30D also showed a positive correlation with miR-30d up-regulation.

Scatterplot illustrated the relative expression level of miR-30d as a ratio of miR-30d to U6 in the groups with or without MIR30D amplification Although miR-30d was considered as an oncomir in various kinds of epithelial cancer [24, 32, 33], it has also been reported that miR-30d suppresses cell proliferation and motility and induces apoptosis in several types of tumors [34, 35].

Positive correlation between amplifications of MIR30D gene and miR-30d up-regulation in CSCCs.

miR-30d regulates the expression of a number of genes in CSCCs.

Taken together, these results suggest that up-regulation of miR-30d may promotes CSCC cell proliferation and migration contributing to tumor progression and metastasis.

There are no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled, “Amplification and up-regulation of MIR30D was associated with progression of cervical squamous cell carcinomas”.

For instance, CpG island hyper-methylation have been reported to be involved in the regulation of miR-30d expression in somatic malignancies.

Additional file 1: Down-regulated genes in HeLa cells by mir-30d mimic transfection.

In addition, there were statistically higher expression level of miR-30d in the group of advanced CSCCs (n = 54) than early-stage CSCCs (n = 82, p = 0.0037, Fig. 1b).

As shown in Fig. 1c, paired t-test analyses showed that metastatic CSCCs had a slight but statistically significant increase of miR-30d expression, in comparison with primary tumors (p = 0.0392).

Meanwhile, SiHa and HeLa cells were transfected with miR-30d mimic, inhibitor or control strand for 24 h. Then the cells were collected by trypsin-EDTA digestion, washed once in 10% FBS/DMEM, and resuspended in 1% FBS/DMEM at 2 × 10 [5] cells/ml.

Enhanced expression of miR-30d in CSCCs was correlated with tumor progression.

To summarize, our results demonstrate that the amplification of MIR30D copy number were present in a certain proportion of CSCC cases and were positively correlated with its transcriptional expression as well as progression of tumor.

Notably, several known miR-30d targets identified by other groups, including ATG12 [25], CASP3 [32], SNAI1 [36], SOCS1 [24], FOXO3 [34] and GNAI2 [37], were consistently found in our 68 transcript list.

To evaluate the functional effects of miR-30d in vivo, we established 2 CSCC cell lines (HeLa and SiHa) that stably suppressed miR-30d expression via retroviral transduction.

Cervical squamous cell carcinoma miR-30d MIR30D Copy number variation Gene expression Invasive cervical cancer is one of the leading causes of cancer-related death in gynecological tumors [1– 4].

It showed that, increased expression level of mature miR-30d had very significant correlation with poor clinical outcomes in CSCC patients (Fig. 1d, P =0.0013).

We then tested whether the expression levels of miR-30d were correlated with gene copy alterations in several selected samples with amplified or unaltered copies of MIR30D gene.

g Expression of miR-30d extracted from xenografts using qPCR.

Although it has been thought that cell phenotype is well correlated with the genotype of CNVs [40, 41], our study on the correlation between expression of miR-30d and copy numbers of MIR30D gene showed discordant findings.

Fig. 3 MIR30D amplification leads to overexpression of miR-30d.

As in Fig. 3, in both groups with amplified or unaltered copies of MIR30D, the CSCC tissues showed significantly higher expression of miR-30d than ANTs (p < 0.005).

b Scatterplot illustrated the relative expression of miR-30d as a ratio of CSCC to paired ANT in the CSCCs at different stages.

Here we also screened several key targets of miR-30d that might be involved in this progress.

Copy number amplifications of MIR30D gene and enhanced expression of miR-30d were positively correlated with tumor progression in CSCCs, indicating miR-30d might play an oncomiric role in the progression of CSCC.

c Scatterplot illustrated the relative expression of miR-30d as a ratio of CSCC to paired ANT in the primary tumors and lymph node metastases.

Fig. 1Relative expression of miR-30d in CSCCs.

Thus, enhanced expression of miR-30d might play a role in the progression of CSCCs.

As shown in Fig. 4c, the expression of miR-30d was positively correlated with proliferation rates of the CSCC cells.

These miR-30d -suppressed cell lines were subcutaneously injected into the right side of male nude mice; control CSCC cell lines were simultaneously injected into the left side (15 mice each group).

A positive correlation between miR-30d expression and CSCC cell migration was also observed (Fig. 4d).

Thus CNVs were not the only motivating factor for over -expression of the miR-30d in CSCCs.

FISH and qPCR were performed to detect the copy number and microRNA expression of MIR30D gene in the collected samples.

miR-30d is fairly frequently overexpressed in many human epithelial cancers and functionally affects various tumor biological events such as proliferation, differentiation, metastasis, apoptosis, etc.

Inhibition of miR-30d in CSCC cells led to impaired tumor growth and migration.

The attenuation of miR-30d expression in these xenografts were also confirmed by qPCR (Fig. 4g).

Then, the cells were subcutaneously injected into the right (to inhibit miR-30d) and left (control) flanks of the same mice.

Compared to ANTs, the expression levels of miR-30d were markedly enhanced in the collected CSCC samples (p < 0.001), as shown in Fig. 1a.

Although overexpression of miR-30d in cervical cancers was reported in a previous study using a high throughput assay [28], the case number was very limited (n = 10).

The effect of altered expression of miR-30d on CSCC cell proliferation was estimated by WST-1 assay.

Next, the migration abilities of HeLa and SiHa cells transfected with miR30d mimic, inhibitor or non-sense strand were estimated by the trans-well assay.

It’s interesting that the CSCC samples of MIR30D amplified group showed a statistical difference of miR-30d expression compared to unaltered group (p = 0.019).

Compared to ANTs, the expression of miR-30d in CSCC tissues was increased in both groups with or without MIR30D amplification.

FISH detections were performed with dual-labeling hybridization using a directly labeled centromere probe for chromosome 8 (Spectrum Green-labeled) together with a probe for the MIR30D locus (8q24.22; Spectrum Orange-labeled).

At sacrifice, the mean volumes of tumor xenografts from the nude mice were measured (Table 7), which showed that the CSCC cells with suppressed expression of miR-30d formed significantly smaller tumor nodules compared with the controls.

a Scatterplot illustrated the relative expression level of miR-30d as a ratio of miR-30d to U6 in all the CSCC samples compared with ANTs.

Although the altered miRNA miR-30d expression and the amplified chromosome locus of MIR30D, 8q24, have been reported in somatic cancers, the definitive functional impact of such region especially in CSCC remains under-investigated.

In order to determine the role of miR-30d in CSCC, multiple corresponding cell lines including HeLa, C4–1, SiHa, Caski and C-33A were first evaluated for miR-30d expression.

Oncomiric role of miR-30d would be performed by transforming multiple signaling pathways rather than by disturbing one or a few cancer -associated genes.

Copy number gains of MIR30D gene were found in a portion of CSCC tissues (22.8%, 31 out of 136).

CSCC tissues and matched ANTs were collected in pairs as stated before, and ten pairs (5 with MIR30D amplification, 5 with unaltered MIR30D copy number) were selected for FISH analysis.

We next analyzed the copy number of MIR30D in the CSCCs with or without LNM.

The relative copy numbers of MIR30D were normalized to RNAse P gene (copy numbers =2) and analyzed by the comparative Ct method.

Copy number gains of MIR30D were detected in 22.8% (31 out of 136) of CSCC samples.

Amplifications of MIR30D were mainly found in advanced CSCCs, indicating that the increase of MIR30D copies might occur in the progression but not the initiation of CSCCs and may contribute to tumor aggressiveness.

CSCCs with lymph node metastases (LNM) also showed more frequencies (36.4%) of MIR30D amplification than those without LNM (18.4%, p < 0.05).

Copy number of MIR30D was positively correlated with tumor progression.

Fig. 2Gene amplification of MIR30D in CSCCs.

Gene copy number gains of MIR30D in CSCC samples.

In-vitro studies were also performed to estimate the role of miR-30d in the cell proliferation and migration of CSCCs.

miR-30d plays an oncomiric role in CSCC cells.

As shown in Table 3, distribution of MIR30D copy number in ANTs had no statistical difference in comparison to healthy normal controls (HNCs), and thus the ANTs could be used by the present study as matched controls for the CSCC tissues.

Representative figures of FISH analysis using chromosome 8q specific alpha satellite DNA probe and chromosome 8q24 specific probe for MIR30D.

Copy number variations (CNVs) of MIR30D gene as well as expression levels of miR-30d were examined, and analyzed with clinical characterization.

, * p < 0.05 The transcriptional expression of miR-30d was evaluated using qPCR.

Did the copy number gain of MIR30D take place in migrating cells at the initiation of metastasis or later in the lymph node in these 2 cases?

As shown in Table 5, 36.4% of CSCC cases with LNM showed MIR30D amplification, which was much higher than those without LNM (18.4%, p = 0.0327).

Much higher frequencies of MIR30D gene amplification were observed in the advanced CSCCs (31.6% for stage3–4) than those in early-stage CSCCs (16.5% for stage 0–2).

These results indicated that copy number gains of MIR30D gene were positively correlated with CSCCs tumor progression (p < 0.01).

The transcriptional expression of miR-30d was evaluated using qPCR.

Consistently, the chromosome locus of MIR30D gene, 8q24, is also found frequently amplified by comparative genomic hybridization (CGH) detection in various types of somatic cancers [26, 27].

After the transfection of a miR-30d mimic into HeLa and SiHa cells, microarray analyses were used to display the transcriptional changes.

Given that no statistical difference of MIR30D CNVs between HNCs and ANTs was observed, the CNVs of MIR30D were more likely to acquire aberrations in CSCC tumor tissues.

However, the frequency of MIR30D gene copy number gain was lower than previously reported proportions of chromosomes 8q24 gain as 36–57% in somatic cancers [7, 38, 39].

The amplifications of MIR30D (22.8%, 31 out of 136) were found in collected CSCC samples.

Nevertheless, MIR30D amplifications might play a role in CSCC metastasis.

This discrepancy might be due to the limited region of MIR30D gene on chromosome 8q24 which is less influenced by repeated replication during tumor progression.

We also found that CSCCs with LNM showed more frequencies of MIR30D amplification than those without LNM, which indicated the potential association between MIR30D amplification and CSCC metastasis.

Subconfluent HeLa and SiHa cells were transduced with miR-30d-blocking or control viral vectors, trypsinized, and suspended in Phosphate-buffered saline (PBS).

3

This observation also raises the intriguing possibility that miR-30 mediated regulation of the miRNA pathway is a mechanism not specific to muscle cells, but rather a mechanism in all cells expressing miR-30 to antagonize the expression of all miRNA-regulated targets.

To identify direct miR-30 family targets, we first utilized TargetScan 6.2 [20] to identify predicted targets.

To determine whether modulating miR-30 family miRNA levels affects miRNA repression, we tested the ability of muscle-specific miR-206 to repress a known target, cyclin D1 (Ccnd1)[31], during miR-30 family over -expression or inhibition.

Putative direct miR-30 family targets include epigenetic, transcriptional, and post-transcriptional regulators of gene expression.

If miR-30 directly regulates the expression of these candidates at the mRNA level, one could expect de-repression in mdx4cv muscles where miR-30 family expression is reduced.

Transcriptional, post-transcriptional and epigenetic regulation of gene expression are the most highly enriched GO terms in the set of predicted miR-30 family targets.

While no change was observed for Nfyb and Ppargc1a, we found that Runx1, Smarcd2, and Tnrc6a were increased in their expression in the gastrocnemius muscles and that Snai2 trended towards an increase (P = 0.07) (Fig. 6C), indicating that these may be direct miR-30 targets.

As expected, over -expression of miR-30a/b/c de-repressed Ccnd1 luciferase reporter activity (Fig. 7A), and miR-30 family inhibition enhanced Ccnd1 repression by miR-206 (Fig. 7B), showing that miR-30 family miRNAs can negatively regulate the activity of other miRNAs.

miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animalsIn order to identify miRNAs that are dysregulated during muscle pathogenesis, we hypothesized that, as dystrophic muscle is undergoing constant cycles of degeneration/regeneration, miRNAs differentially expressed between dystrophic and healthy muscle may represent novel biomarkers of muscle homeostasis.

Given these dynamic expression changes during adult myogenesis in vitro, changes in miR-30 family expression could also be expected during developmental myogenesis.

Note miR-206 and miR-21 (red, overexpressed in mdx4cv) and miR-30 family (green, down-regulated in mdx4cv).

When sorted for P-value, the functionally annotated biological processes that are most enriched in the list of predicted miR-30 family targets include the regulation of transcription, gene expression, and macromolecule synthesis (Fig. 6A).

To narrow the candidate target list as well as gain insight into the biological processes and pathways that may be regulated by the miR-30 family, we took the 1133 predicted targets and performed gene ontology (GO) analysis using the Database for Annotation, Visualization and Integrated Discovery (DAVID) [21].

If miR-30 family miRNAs control miRNA repression by targeting Tnrc6a, we could expect that high levels of miR-30 would repress Tnrc6a levels resulting in global de-repression of miRNA targets and increased protein synthesis.

Given our observed decrease in miR-30 family expression in a pathological setting of constant degeneration/regeneration (mdx4cv), we wanted to examine miR-30 family expression in other mo dels of skeletal muscle pathology, including regeneration after acute injury and muscle disuse atrophy.

Numerous functions have been described for the miR-30 family, including regulation of fibrosis, apoptosis, and hypertrophy in cardiomyocytes [32– 34], regulation of pronephros development in the kidneys [35], as well as the regulation of the epithelial-to-mesenchymal transition in hepatocytes [36].

Additionally, miR-30 family miRNAs provide negative feedback on the miRNA pathway by targeting TNRC6A, leading to derepressed miRNA targets and increased protein synthesis.

While smoothened is not predicted to be a conserved miR-30 family target in mice, the possibility exits that miR-30 family miRNAs play a critical role in the regulation of embryonic muscle development and fiber type specification.

While others have identified Tnrc6a as a miR-30 family target [46], we are the first to show that miR-30 expression modulates the activity of other miRNAs and levels of protein synthesis.

’ Therefore, by repressing the set of miR-30 targets present in the given cellular milieu while at the same time reducing the extent of other miRNA -mediated repression, miR-30 family can repress a current gene expression pattern and pave the way for a change in cellular state (Fig. 8).

Following withdrawal of serum from the medium, we observed increases in miR-30a-5p (∼1.5 fold), miR-30b (∼2 fold) and miR-30c (∼2 fold) expression as differentiation progressed (Fig. 4A), indicating that the miR-30 family is expressed in myoblasts.

To test if the reduction in miR-30 family miRNA expression found in dystrophic, injured and atrophic muscle correlates with expression changes in myoblasts, we measured miR-30a/b/c expression during C [2]C [12] myoblast differentiation in vitro.

0118229.g006 Fig 6 (A) GO analysis of predicted miR-30 targets (TargetScan 6.2) is shown sorted by P-value for enriched biological processes.

Interestingly, we found that inhibition of Tnrc6a expression by miR-30 family miRNAs reduces the activity of muscle-enriched miR-206, indicating that the miR-30 family constitutes a negative feedback mechanism on the miRNA pathway.

0118229.g008 Fig 8 To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis.

Tnrc6a, Smarcd2, and Snai2 are regulated by miR-30a/b/cTo validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture.

Indeed, after normalizing to protein content, we found a significant ∼2-fold increase (P ≤ 0.05) in [3]H-tyrosine incorporation in miR-30b/d over -expressing myotubes when compared to controls (Fig. 7C), indicating that miR-30 family miRNAs promote high levels of protein synthesis, likely through de-repression of miRNA targets.

To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis.

In addition, we identify the chromatin remo deling component Smarcd2, the transcriptional repressor Snai2 and the miRNA pathway component Tnrc6a as direct miR-30 targets.

The miR-30 family miRNAs belong to the same seed family and thus share identical seed sequences (S1 Fig. ) and likely regulate an overlapping set of targets.

Through in vitro experiments and bioinformatic analysis, we have proposed a novel mechanism whereby miR-30 promotes the differentiation of myoblasts by both restricting the expression of Smarcd2 and Snai2 (both negative regulators of the myogenic gene program), as well as by antagonizing the miRNA pathway through repression of Tnrc6a.

In zebrafish, Ketley et al. recently showed that the miR-30 family promotes a fast muscle phenotype during embryonic muscle development and that inhibition of the miR-30 family in zebrafish embryos increased the percentage of slow fibers [37].

After injury, miR-30 family expression is reduced and reaches a minimum on day 3 post-injury (∼4–5 fold reduction in miR-30a/b/c) (Fig. 3A) corresponding to a time point at which the muscle is largely degenerating (S3 Fig. ), indicating a correlation between low miR-30a/b/c levels and muscle degeneration.

Human miR-30 family expression.

miR-30 regulates miRNA -mediated post-transcriptional regulation and protein synthesis.

Here we show that the expression of miR-30 family miRNAs is dynamic in skeletal muscle pathologies, with low miR-30 being correlated with degeneration and muscle mass loss, and high miR-30 associated with myogenesis and protein synthesis.

Identifying the cell-type specific expression pattern of the miR-30 family in WT and mdx4cv animals will be necessary to ascertain the pathogenic role of the miR-30 family.

Notably, little has been published about the expression and role of the miR-30 family in skeletal muscle.

miR-30 family target identification and validation.

By deep sequencing small RNAs from wild-type C57Bl/6 (WT) and dystrophic mdx4cv gastrocnemius muscles, we found the miR-30 family miRNAs to be coordinately down-regulated when compared to WT.

miR-30 family miRNAs promote a myogenic program in vitro To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts.

Our results indicate that expression of the miR-30 family miRNAs is perturbed during alterations in muscle homeostasis in vivo, and that the miR-30 family miRNAs promote myoblast terminal differentiation and restrict proliferation in vitro.

To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts.

While these findings are in agreement with our observations of miR-30 family effects on proliferation and differentiation in vitro, we were unable to assess the expression pattern and function of miR-30 family members in non-muscle cell types in vivo.

Another outcome of this hypothesis would be a general increase in protein synthesis in the presence of high miR-30 family miRNA levels, mediated by the de-repression of miRNA targets.

We thus wondered whether ectopic miR-30 family miRNA expression could decrease the proportion of proliferating cells.

In comparison to a scrambled pre-miR control at equivalent concentrations, EdU incorporation was reduced dose -dependently by 10% and 15% (P ≤ 0.05) in 10nM and 50nM transfected cells, respectively (Fig. 5C), indicating that high miR-30 family expression reduces the proportion of proliferating myoblasts in vitro.

miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animals.

We also show that miR-30 family expression is reduced in acute pathological conditions including BaCl [2] -induced injury and disuse atrophy.

To test if the inverse is true, we utilized chemically modified, antisense oligonucleotides to inhibit miR-30 family function.

In agreement with this argument, the validated miR-30 targets include the epigenetic SWI/SNF component Smarcd2, the transcription factor Snai2, and the post-transcriptional miRNA pathway component Tnrc6a.

To validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture.

validation of reduced miR-30 family miRNA expression.

Given that fast twitch fiber-types are preferentially affected in DMD [38], it is tempting to speculate that the decrease in miR-30 family expression in mdx4cv muscle is a compensatory mechanism to promote an increase in slow-twitch, fatigue resistant fiber types.

To further sort these candidates, we measured the expression levels of their mRNAs in mdx4cv skeletal muscles by, including Galnt7 as a positive control miR-30 target [28].

Interestingly, we also found that the normalized read counts for the entire miR-30 family were strikingly reduced in mdx4cv animals (Fig. 1B), and that the miR-30 family is the 5th most highly expressed miRNA family in skeletal muscle (Fig. 1C).

Given the high abundance in skeletal muscle and differential expression, we decided to further investigate the expression and function of miR-30 family miRNAs in mammalian skeletal muscle.

miR-30 family expression displayed relative to 15.5 dpc miR-30a-5p levels.

In conclusion, we present a miRNA-seq dataset identifying a reduction in miR-30 family miRNA expression in dystrophic mdx4cv skeletal muscles.

In another recent publication, Soleimani et al. proposed that miR-30 -mediated regulation of the transcriptional repressor SNAI1 facilitates entry into the myogenic gene program and promotes differentiation of primary mouse myoblasts [26].

miR-30 regulates miRNA -mediated repression and protein synthesis.

Many of the studies published on various miR-30 family functions indeed report the regulation of transcription factors [26, 33, 35, 39, 40], indicating that the generalized function of miR-30 may be to control the switch from one cellular state (i. e. proliferating, differentiating, quiescent, etc. )

While the miR-30 family includes 5 mature miRNAs (miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e [NCBI: NR_029533, NR_029534, NR_029716, NR_029718, NR_029602]), for this study we have focused on miR-30a-5p, miR-30b and miR-30c (“miR-30a/b/c”) due to sequence similarity of miR-30a-5p, miR-30d and miR-30e (differing by only one nucleotide each) (S1 Fig. ).

Twenty-four hours after transfection, quantification of myogenin -positive (MYOG+) nuclei indicated a striking 65% increase (P = 5e-5)(Fig. 5A), indicating that the miR-30 family promotes terminal differentiation of myoblasts in vitro.

As indicated by the percentage of MyHC+ area, 24 hours following transfection antimiR-30 restricted the differentiation of C [2]C [12] myoblasts (Fig. 5B), again indicating that miR-30 family miRNAs promote myoblast differentiation.

miR-30 family miRNAs promote a myogenic program in vitro.

miRNA-seq reveals reduced miR-30 family miRNAs in mdx4cv muscles.

Accordingly, we first performed barium chloride injury in the gastrocnemius muscles of WT animals to test regeneration after injury in vivo and measured miR-30 family expression on 1, 3, 7 and 14 days post-injury (DPI) in comparison to uninjured contralateral controls.

This reduction was least pronounced in the slow-twitch soleus muscle, where baseline miR-30 levels are lower than in the gastrocnemius and TA muscles (S2 Fig. ).

Sequence and organization of miR-30 family miRNAs.

Mo del for miR-30 family mechanism of action.

After reaching a minimum on day 3 post-injury (DPI), miR-30 levels begin to return towards uninjured levels on days 7 and 14.

S1 Fig (A) Alignment of miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e shows conserved positions in bold and positions differing from miR-30a-5p in red.

To this end we transfected proliferating C [2]C [12] with a representative synthetic miR-30 family member, miR-30a-5p, then performed 5-ethynyl-2’-deoxyuridine (EdU) proliferation analysis.

4

Radiation downregulated Mcl-1 and enhanced Bax expression in non- or CT-miR transfected samples, whereas transfection of miR30 -inhibitor maintained Mcl-1 protein levels and suppressed Bax expression in CD34+ cells 24 and 48 h after irradiation.

The effect of miR-30 occurred only when both miR-30 and its target sequence were present; suggesting that miR-30 directly inhibits the expression of Mcl-1 through binding to its target sequence in Mcl-1gene.

shown in Fig.   6a demonstrate that transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitor suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells.

Forty-eight h after pre-miR-30 transfection, the level of Mcl-1 expression in CD34+ cells was inhibited significantly, whereas no Mcl-1 downregulation was shown in control- or miR-30 -inhibitor transfected samples compared with non-transfection control (Fig.   6c).

a Transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitors suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells.

We previously reported that radiation upregulated miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30 played a key role in radiation -induced human hematopoietic and their niche osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) and inducing apoptosis in these cells.

Furthermore, we found putative miR-30 binding sites in the 3′UTR of Mcl-1 mRNA (Fig.   5b) and demonstrated for the first time that miR-30 directly inhibits the expression of Mcl-1 by binding to its target sequences (Fig.   7c, d).

Levels of Mcl-1 expression in CD34+ cells were significantly inhibited 48 h after pre-miR-30 transfection, whereas Bcl-2 was not impacted by miR-30 overexpression in these cells.

Transfection of miR-30 inhibitor significantly protected Mcl-1 from radiation -mediated downregulation and maintained the Mcl-1 levels as in sham-irradiated CD34+ cells.

To answer this question, we analyzed potential targets of miR-30 family members using the miRNA target prediction database RNAhybrid 2.2 (http://bibiserv.

The cells were exposed to different doses of γ-radiation at 24 h after non-transfection, miR-control, or miR-30 inhibitor transfection, and Mcl-1 and Bcl-2 protein expressions were tested by western blot in samples collected at 24 h (48 h post-transfection) and 48 h (72 h post- transfection) after irradiation.

As expected, Bcl-2 expression was not changed by radiation nor miR-30 inhibition in CD34+ cells.

Thus, our data from the current study suggest an important downstream target of miR-30 in irradiated hematopoietic cells is Mcl-1, and miR-30 is responsible for radiation -induced apoptosis in mouse and human hematopoietic cells through targeting the antiapoptotic factor Mcl-1. The authors declare no conflict of interest.

However, when the mir-30 target site from the Mcl-1 3′UTR is inserted into the luciferase construct (pMIR-hMcl-1), expression of luciferase is strongly decreased when cotransfected with pre-miR-30.

In this study, expression of miR-30b and miR-30c was determined in mouse serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation, since miR-30 levels in serum were parallel to expression in BM after radiation [15].

Radioprotector delta-tocotrienol suppressed miR-30 expression in mouse serum and cells and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [14, 15].

Radiation -induced Mcl-1 downregulation was miRNA-30 dependent.

Western blot assays were used to test Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells as shown in Fig.   6b.

In addition, radiation -induced Bax expression was completely blocked by knockdown of miR-30 in CD34+ cells.

Antiapoptosis factor Bcl-2 was not impacted by miR-30 overexpression in these cells (Fig.   6b, c).

The putative miR-30 binding sites were predicted using target prediction programs RNAhybrid 2.2 [21].

b Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells were evaluated by immunoblotting 24 and 48 h after transfection.

Delta-tocotrienol (DT3), a radioprotector, suppressed miR-30 and protected mice and human CD34+ cells from radiation exposure [15].

de/rnahybrid/) [21], and found that members of the miR-30 family were predicted to target the antiapoptosis factor Mcl-1. Figure  5b shows putative binding sites for miR-30b and miR-30c in the 3′UTR of the Mcl- 1 gene.

Recently, we further reported that miR-30 expression in mouse BM, liver, jejunum and serum was initiated by radiation -induced proinflammatory factor IL-1β and NFkB activation.

irradiated We previously reported that miR-30 played a key role in radiation -induced human CD34+ and osteoblast cell damage through an apoptotic pathway [14], and a radiation countermeasure candidate, delta-tocotrienol (DT3), suppressed radiation -induced miR-30 expression in mouse BM, liver, jejunum and serum, and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [15].

However the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cell damage are not well understood.

Pre-miR30, miR30 inhibitor (si-miR30), or control miR (CT-miR) molecules were transfected into CD34+ cells.

Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression.

Pre-miR30 (PM11060), miR30 -inhibitor (AM11060) or control-miRNA were purchased from Thermo Fisher Scientific (Grand Island, NY) and transfected into CD34+ cells using the Lipofectamine RNAiMAX (Cat# 13778-075, Invitrogen) according to the manufacturer’s protocol discussed in our previous report [14].

d The firefly luciferase p-MIR-report vector (pMIR) as a control, p-MIR-report vector with Mcl-1 3′UTR (pMIR-hMcl-1), and p-MIR-report vector with mutant 3′UTR (pMIR-MUT) were transiently transfected or cotransfected with an expression plasmid for pre-mir-30 into human CD34+ cells.

As shown in Fig.   7d, cotransfection of CD34+ cells with the parental firefly luciferase reporter construct (pMIR-vector control) plus the pre-mir-30 does not significantly change the expression of the reporter.

CD34+ cells were transfected with miR-30 inhibitor, precursors (pre-miR30) or control-miR from Life Technologies Co.

However, the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cells damage are not well understood.

Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression.

In contrast, Bcl-2 expression was not affected by miR-30 in these cells.

Knockdown of miR-30 blocked radiation -induced Mcl-1 reduction in CD34+ cells.

In the current study as shown in Fig.   7a and b, we further demonstrated that knockdown of miR-30 before irradiation in human CD34+ cells blocked radiation -induced reduction of Mcl-1, and the proapoptotic factor Bax was no longer increased by radiation.

In this study, we extend our findings using human hematopoietic stem and progenitor CD34+ cells and an in vivo mouse mo del, to explore the effects and mechanisms of miR-30 on regulation of apoptotic cell death signaling in hematopoietic cells after γ-radiation.

A mutation was generated on the Mcl-1 3′-UTR sequence in the complementary site and the 5′end seed region of miR-30, as indicated.

Previously we reported that knockdown of miR-30 before irradiation significantly increased clonogenicity in irradiated human CD34+ cells [14].

Luciferase activity in CD34+ cells transfected with pMIR alone, or pre-miRNA-30 precursor cotransfected with pMIR-control, pMIR-hMcl-13′UTR, or pMIR-MUT 3′UTR is shown.

β-actin were measured in different treatment groups We next examined the effects of miR-30 on Mcl-1 expression in CD34+ cells after radiation.

c Two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329–1351 and 1584–1602 nt) and the alignment of miR-30 with the 3′UTR insert are illustrated.

NM_021960) containing two putative miR-30 binding sites (1329–1351 and 1584–1602 nt) or a corresponding multi-base mutant sequence was cloned into the SacI and HindIII sites downstream of the firefly luciferase reporter gene in pMIR-REPORT Luciferase (Ambion, Austin, TX, USA) by BioInnovatise, Inc.

There are two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329-1351 and 1584–1602 nt, with the 5′ end of the miR-30 seed sequence in the latter) and the alignment of miR-30 with the 3′UTR insert is illustrated in Fig.   7c.

The Pre-miRNA-30 Precursor was co -transfected where indicated in Fig.   7d.

The firefly luciferase -report vector plasmid (p-MIR, Ambion, Austin, TX, USA) was modified by insertion of the Mcl-1-derived mir-30 binding sites or a multi-base mutant into the 3′UTR.

b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shownWe further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells.

The Ambion pre-miR-30 precursors were co -transfected with pMIR-report, pMIR-hMcl-1-WT, or pMIR-hMcl-1-MUT plasmid.

b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shown We further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells.

Our previous studies suggested miR-30 is an apoptosis inducer in mouse and human hematopoietic cells.

Our results from both in vitro and in vivo studies suggested miR-30 is an apoptosis inducer after radiation exposure.

5

The horizontal dashed line shows p = 0.05, and vertical dashed lines indicate FC = −1.5 and 1.5. e, results of miRhub analysis to test for enrichment of predicted miR-30 target sites in significantly up-regulated (purple) and down-regulated (green) genes at each time point.

We found that both highly conserved and species-specific predicted miR-30 targets sites were significantly enriched (p < 0.05) in genes up-regulated at both 48 and 72 h post-transfection, but as expected not in down-regulated genes (Fig. 4 e).

To identify genes that might act as post-translational regulators of SOX9 protein in response to LNA30bcd treatment, we performed Gene Ontology Molecular Function enrichment analysis (40, 41) using Enrichr (42) on genes with predicted miR-30 target sites that were significantly up-regulated (FC > 1.5 and FDR < 0.05) relative to mock treated cells at each time point (see supplemental Table S2 for gene lists).

Moreover, UBE3A does have a predicted miR-30 target site and is up-regulated in LNA30bcd -treated HIECS.

Knockdown of miR-30 in Vitro in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 ProteinTo evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs).

We performed next generation high throughput RNA sequencing and found that up-regulated genes with predicted miR-30 target sites were most significantly enriched for ubiquitin ligases.

We hypothesized that the opposite effect of miR-30 inhibition on SOX9 mRNA and protein levels could be due to miR-30 -mediated regulation of factors that modify SOX9 protein stability without affecting SOX9 RNA levels, such as post-translational modifiers (Fig. 2 e).

” Ubiquitin ligase -mediated regulation of SOX9 has been shown previously in chondrocytes (43) and therefore is consistent with our hypothesis that miR-30 may regulate SOX9 protein levels indirectly through control of post-translational modifiers of SOX9.

We focused on miR-30 because it has a SOX9 target site that is broadly conserved across vertebrates, including human and rodent, and it is robustly and variably expressed among stem, progenitor, and differentiated cell types of the intestinal epithelium.

Agrawal R., Tran U., and Wessely O. (2009) The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1.

miR-30 Is Predicted to Target SOX9 and Is Robustly Expressed in the Intestinal Epithelium.

Below, we show the conservation of the predicted miR-30 target site (red text) across various species (TargetScan6.2).

FIGURE 1. miR-30 is predicted to target the 3′-UTR of SOX9 and is differentially expressed across functionally distinct cell types of the intestinal epithelium.

This suggests that miR-30 is able to regulate SOX9 protein expression through post-transcriptional regulation of ubiquitin ligases (Fig. 5 d).

To evaluate this hypothesis, we next sought to define the regulatory program that miR-30 directs in HIECs and to identify potential miR-30 targets that may be regulating SOX9 protein levels.

Knockdown of miR-30 in Vitro Results in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 Protein.

Up-regulation of miR-30 family members in myoblasts promotes differentiation (53).

Taken together, our data suggest that miR-30 normally acts to promote proliferation and inhibit enterocyte differentiation in the intestinal epithelium through a broad regulatory program that includes the proteasome pathway.

Through time course mRNA profiling following knockdown of a single miRNA family, we found that the effect of treatment with LNA30bcd on miR-30 target genes was only beginning to emerge at 24 h, evident at 48 h, and very robust at 72 h post-transfection.

d, cartoon showing mo del of miR-30 regulation of SOX9 mRNA and protein expression levels.

FIGURE 2. Knockdown of miR-30 increases SOX9 mRNA and decreases SOX9 protein expression.

We observed increased relative luciferase activity in cells transfected with 100 n m LNA30bcd (Fig. 2 d), consistent with direct targeting of SOX9 by miR-30 that has been previously shown in cartilage (35).

In Caco-2 cells we observed significant knockdown of miR-30 even 21 days following a single transfection with LNA30bcd; therefore, it would of interest to evaluate gene expression at this time point to determine whether the effects on miR-30 target genes are still robust.

Upon knockdown of miR-30 in two intestinal-relevant cell lines, we unexpectedly found inverse effects on SOX9 mRNA and protein expression.

Further analyses in vivo (mouse) or through ex vivo culture systems (mouse or human) are warranted to extend the definition of the function of miR-30 across distinct cell types of the intestinal epithelium in health and disease.

However, the predicted miR-30 target site in UBE3A is human-specific.

miR-30 Promotes IEC Proliferation and Inhibits IEC Differentiation.

Moreover, the miR-30 target site and flanking ∼15 bases are highly conserved among most mammals including human, rodent, dog, opossum, and horse, as well as distant vertebrates such as lizard.

Upon knockdown of these miR-30 family members, we observed a significant increase in SOX9 mRNA at 48 and 72 h post-transfection (Fig. 2 a), which is consistent with alleviation of negative post-transcriptional regulation of SOX9 by miR-30.

Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a).

To evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs).

In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b).

At 24 h post-transfection, predicted miR-30 target sites were not enriched.

FIGURE 6. miR-30 promotes proliferation and inhibits enterocyte differentiation.

FIGURE 5. miR-30 target genes in intestinal epithelial cells are over-represented in the ubiquitin ligase pathway.

Moreover, only miR-30 family members exhibited differential expression across functionally distinct IECs, leading us to select this miRNA family for follow-up analyses.

This finding is consistent with the relatively higher expression levels of miR-30 in proliferating subpopulations, such as the progenitors, compared with non-proliferating enterocytes (Fig. 1 b).

Therefore, given the strong regulatory effect of miR-30 on SOX9 protein, we hypothesized that treatment of HIECs with LNA30bcd would affect this balance as well.

Guess M. G., Barthel K. K., Harrison B. C., and Leinwand L. A. (2015) miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway.

f, mo del of miR-30 regulation of SOX9 in the intestinal epithelium.

Alternatively, knockdown of miR-30 in an osteoblast precursor cell line promotes differentiation (54).

To test whether miR-30 regulates enterocyte differentiation of IECs, we transfected Caco-2 cells with 100 n m LNA30bcd and allowed the cells to differentiate on Transwell membranes (see “Experimental Procedures”).

Together, these data suggest that our knockdown of miR-30 using LNA30bcd was specific and highly effective in HIECs, particularly in the later time points of our study.

Next Generation High Throughput Reveals That miR-30 Regulates Genes Enriched in the Ubiquitin Ligase Pathway.

In terms of differentiation, the miR-30 family has been shown to regulate myogenic and osteoblastic differentiation.

Although increased proliferation has been seen in many cancer cells in response to reduced miR-30 levels, a number of studies have found knockdown of miR-30 to result in decreased proliferation (52).

Knockdown of the miR-30 family in HIECs and Caco-2 cells resulted in reduced proliferation and enhanced enterocyte differentiation.

Our analyses provide new evidence that miR-30 plays a significant role in regulating proliferation and differentiation in the intestinal epithelium.

More research will be needed to identify the specific miR-30-directed ubiquitin ligase protein that acts on SOX9 protein in intestinal epithelial cells.

Wu T., Zhou H., Hong Y., Li J., Jiang X., and Huang H. (2012) miR-30 family members negatively regulate osteoblast differentiation.

To test for a direct relationship between miR-30 and the SOX9 3′-UTR, we performed a luciferase reporter assay in Caco-2 cells.

To evaluate whether miR-30 influences ubiquitin ligase -mediated degradation of SOX9 protein, we subjected Caco-2 cells to either mock or LNA30bcd transfection and then treated them with vehicle or MG132, a potent proteasome inhibitor.

Of these, miR-30 has the strongest predicted base pairing with SOX9, consisting of an 8-mer seed as well as supplementary 3′-end pairing for two of the family members.

LNAs against mouse miR-30 family members are cross-reactive with the human miR-30 family.

6

Searching 3′-UTR of putative target mRNA, targeting sequences which can make base pairing with 5′ seed sequences of miR-30 were found in the 3′-UTR of lifr, eed, pcgf5 and sirt1 utilizing TargetScan (Fig 7B).

Furthermore, mRNA expression pattern of miR-30d targets during osteogenesis of KUSA cells were quantified.

miR-30 targets were predicted using TargetScan.

In fact, runx2 as well as sox9 a master transcription factor for chondrogenesis was upregulated in mRNA level by miR-30d, indicating miR-30 could direct differentiation of MSC.

Our data also indicate that miR-30b/c represses runx2 mRNA; however, overexpression of miR-30d increased runx2 expression, through unknown mechanisms.

These data suggest that miR-30 members could be repressing targets at the MSC and osteocytic stages, while repression on target mRNA may be relieved during the intermediate osteoblastic stage.

0058796.g009 Figure 9(A) Relative expression levels of miR-30 target mRNA in proliferating/sparse KUSA cells.

These data suggested targets of miR-30d and context -dependent effect of miR-30d on RNA regulators including lin28 and hnRNPA3 and on differentiation regulators including runx2, sox9 and ccn1/2.

mRNA expression patterns of miR-30 targets in mMSC line.

Together with the data of expression patterns in Fig 9 and Fig 2, miR-30 targets were classified into several groups; immediate induction followed by rapid attenuation group (ccn1/2/3, hnrnpa3 vC, eed, hspa5/grp78), immediate reduction and rapid recovery group (runx2 and lifr), the constant induction group (lin28a and opn/spp1) and the constant reduction group (pcgf5 and hnrnpa3 vB).

As observed in Fig 11C, suppression of lifr expression by miR-30 may control osteoblast and osteocyte differentiation leading to attenuation of Lif/LifR/Jak-Stat signal.

Expression pattern of miR-30 targets.

For a better understanding of miR-30 targeting, basal mRNA expression levels of 18 gene products were quantified and compared in proliferating/sparse KUSA-A1 cells (vector transfected control cells).

miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1).

EED, named after embryonic ectoderm development, is another novel target of miR-30.

The cohort of miRNA, which was upregulated during osteoblast maturation, including miR-30d, miR-155, miR-21 and miR-16, constitutes a marker of osteocytic differentiation and these miRNA may possibly repress stemness maintenance in osteoblasts.

miR-30 controls expression of LifR and Runx2, the known regulators for osteoblasts.

One miR-30 targeting sequence in the 3′-UTR of ctgf/ccn2 has been reported.

List of predicted miR-30 targets.

A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis.

In the miRNA PCR array, miR-30d showed an increased expression level in osteocytogenesis of KUSA-A1.

These predictions appear to be specific to each of the miR-30 members; however, 11 nt of the 5′ seed sequence in miR-30 family members are common and the mature miR-30s sequences are quite homologous among miR-30a/d/e or between miR-30b/c (Fig 7A), indicating shared and distinctive targets among miR-30 members.

Analysis of miR-30 targeting.

Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2.

In addition, two putative miR-30 targeting sites on spp1/osteopontin were found.

Here we discuss about roles of these factors in bone formation as well as canonical osteogenic factors including Runx2, LifR, Opn/Spp1 and the CCN family, which are the targets of miR-30d.

miR-30 controls CCN family gene expression during MSC osteogenesis.

miR-30 targeting prediction.

As targets of miR-30, we found novel key factors in osteogenesis including Lin28, hnRNPA3, Eed, Pcgf5 and HspA5/Grp78.

0058796.g006 Figure 6(A) miR-30 family expression pattern in KUSA-A1 mMSC line with (red bars, Os+) or without (blue bars, Os−) osteoinduction.

Known target of miR-30.

In order to clarify the function of miR-30d on target mRNAs, qRT-PCR was carried out in stable miR-30d transfected KUSA-A1 and in control vector transfectant.

miR-30 targeting in mMSC line.

Matching around the 3′ part and intermediate part of miR-30 were tested to those targets.

Note the different expression levels: miR-30d>30a>30e: miR-30c>30b.

After repeated osteo-induction (2w+), miR-30d and miR-30c were induced, and the expression levels of miR-503, miR-322 and miR-125b-3p were the most powerfully repressed (Fig. 4B, E).

miR-30 controls CCN family gene expression during MSC osteogenesisPhysiological production of CCN2/CTGF is more abundant from chondrocytes in cartilage than those in other tissues, while CCN1/2/3, the prototype members of CCN family, control both chondrocytic and osteoblastic differentiation [57, 58).

miR-30 expression pattern during KUSA-A1 MSC osteocytogenesis.

Prediction of miR-30 targeting.

Since miR-30 family members are homologous (Fig 6A) and possibly share targets, we further investigated the miR-30 family expression patterns at four time points with or without osteo-induction.

These in silico analyses suggested putative shared and distinctive target mRNA recognition by miR-30 family, the groups of miR-30a/d/e and miR-30b/c.

The expression level of miR-30d was higher in the 4h+, 2w- and 2w+ condition than in the 4h− condition (Fig. 4A–F).

As a result, miR-30a, miR-30c and miR-30d were highly expressed compared with miR-30b or miR-30e (Fig. 6B).

In a result of direct analysis of ctgf/ccn2 mRNA, miR-30d reduced ctgf/ccn2 mRNA levels in confluent KUSA-A1, while not in proliferating cells (Fig 8), indicating that miR-30d attenuate basal ctgf/ccn2 level in idling MSCs.

The difference in speed or stage of differentiation may result in difference in expression signature of miRNA, e. g., mouse miR-30d was induced on 4 h or 14 days after the osteo-induction compared with the control, while human miR-30d showed waving induction and reduction during osteogenesis (Fig S2).

Hspa5/grp78, lifr, eed, opn/spp1 and pcgf5 mRNA levels in miR-30 transfected cells were 20–30% lower than those in control cells in both proliferating and confluent cells (Fig 8AB), indicating direct repression of mRNA stability.

Moreover, the miR-30 family was predicted to recognize sox9, lrp6, smad2, smad1, notch1, bdnf and a number of epigenetic factors (Table 2).

Not only 5′ seed sequences but also 3′ sequences of miR-30d matched to the lifr, eed and sirt1 3′-UTR.

0058796.g007 Figure 7(A) List of mature miR-30 family members.

In a result, hnrnpa3 variant B level in proliferating/sparse miR-30d tranfectant was around 50% lower than that in the vector transfected control (Fig 8A), while no significant change in confluent cells (Fig 8B), indicating context dependent repression of hnrnpa3 vB by miR-30d.

miR-30d and miR150 as well as other miRNAs were induced by long-term culture for 2 weeks in the absence of differentiation stimulus, while miR-503 and miR-744 were reduced by the long-term culture (Fig. 4C, F).

miRNA sequences of step loop part of pre-miR-21, pre-miR-30d, and pre-miR-322 were obtained from miRBase.

Runx2 and sox9 mRNA level in miR-30d transfectants were higher than that in the control (Fig 8AB).

0058796.g008 Figure 8(A) Effects of miR-30d on mRNA levels in proliferating/sparse KUSA-A1 cells.

These immediate early induction followed by quick attenuation patterns were shared with those of CCN gene family shown in Fig 2A, indicating these 6 kinds of transcripts are under the control of same factors and the miR-30 family.

In addition, miR-30d was induced by osteo-induction (Fig. 5J), and miR-30 family recognition sites were found in the 3′-UTR regions of the runx2 and nov/ ccn3 mRNAs (Fig. S2, S3).

Lin28a mRNA level in confluent miR-30d tranfectant was around 50% lower than that in the vector transfected control (Fig 8A, left), while around 50% higher in proliferating cells (Fig 8A, right), indicating context dependence as well.

Dev EC miR-30d GRP78/HSPA5 ref.

vec, vector transfectant; 30d, miR-30d transfectant.

Mature miR-30 quantification during osteocytogenesis.

These findings suggest that members of the miR-30 family could play an essential role in osteocytic differentiation.

Therefore, immediate induction and subsequent rapid repression of ctgf/ccn2 could be controlled by fluctuations in these miRNAs including the miR-30 family.

The infected cells were selected by puromycin (2 ug/mL) in 10 days for cloning of miR-21 and miR-30d stable transfectant and in 2 weeks for miR-322 stable cells.

Tuning mo del of canonical and novel osteogenic factors by miRNA-30 family and miR-541 during MSC osteogenesis.

WD protein associated, miR-30-specificity.

However, miR-30d was increased only by single stimulation as indicated by qRT-PCR (Fig. 5I, J).

Ccn2/ctgf and ccn1/cyr61 mRNA levels in confluent miR-30d cells were lower than those in the control (Fig 8B), while these gene product levels in proliferating miR-30d cells were higher than those in the control (Fig 8A).

All the miR-30 members once reduced during osteoblastic differentiation stage on day 2 and day 7. Among those members, miR-30a/d/e were increased on day 14 around a late osteocytic stage (Fig 6A).

Indeed, by a single stimulation for osteocytic differentiation, not only the miR-30d but also miR-155 was induced (Fig. 4A, D).

We focused on the miR-30 family and miR-541 in this study, while still further analyzing roles of OstemiR in MSC differentiation.

miRNA array analysis showed that miR-30d was induced by single stimulation (4h+), repeated stimulation (2w+) and prolonged culture in the absence of stimulation (2w−).

Together with these results and data interpretations, we propose the tuning mo del of canonical and novel osteogenic factors by the OstemiRs including miR-30 family and miR-541.

In our study, only hnrnpa3 variant C was induced upon osteo-induction, but not variant B, and context -dependent effect of miR-30d on hnRNPA3 variants was suggested.

7

To further validate that lincRNA-p21 regulates TGFβ/Smad signaling through interacting with miR-30, we co -transfected lincRNA-p21 siRNA with miR-30 antagomir, showing that lincRNA-p21 siRNA failed to reduce KLF11 expression and suppress TGFβ/Smad signaling when miR-30 was inhibited (Fig.   7G).

In our previous study, we found that miR-30 blunted TGF-β/Smad signaling in HSCs by targeting KLF11, which suppressed the transcription of inhibitory Smad7 in TGF-β/Smad pathway [31].

The luciferase activity increased in response to pCI-lincRNA-p21 in a dose -dependent manner, suggesting that ectopically expressed lincRNA-p21 sequestered endogenous miR-30 and prevented it from suppressing luciferase expression (Fig.   2E).

We reasoned that, if hepatocyte lincRNA-p21 regulates liver fibrosis by interacting with miR-30, inhibition of miR-30 would show inhibitory effects on the protective function of AdH-shlincp21 in liver fibrosis.

Here, we further revealed that the inhibition of KLF11 by miR-30 resulted in the upregulation of Smad7 in hepatocytes (Fig.   7A).

Consistent with the histology results, hepatic expression of inflammatory genes, including interleukin-6 (IL-6), chemokine ligand 2 (CCL2) and IL-1β, were suppressed in AdH-miR-30 group (Fig.   3F).

Ectopic expression of miR-30 greatly inhibited CCl [4] -induced liver fibrosis as observed by histological examination (Fig.   3A), and significantly decreased collagen deposition and hepatic hydroxyproline level (Fig.   3B).

Collectively, these results provide convincing evidence that miR-30 can suppress TGF-β/Smad signaling by targeting KLF11 in hepatocyte.

To ascertain the underlying mechanism responsible for miR-30 decrease in response to TGFβ, we determined the expression of pri-miR-30s in TGFβ -treated AML12 cells, showing that TGFβ didn’t obviously suppress the transcription of pri-miR-30s (Supplementary Figure  S4C).

Here, our results demonstrate that hepatocyte miR-30 greatly inhibits fibrotic TGF-β/Smad signaling by targeting KLF11 and consequently prevents liver fibrosis.

Figure 5Inhibition of miR-30 impairs the effects of lincRNA-p21 knockdown on CCl [4] -induced liver fibrosis.

Here, we provide the first evidence that TGF-β -induced lincRNA-p21 inhibited miR-30 by directly binding to them.

We previously found that hepatic miR-30s decreased in the fibrotic liver and HSC-specific upregulation of miR-30 prevented liver fibrosis [31].

The presence of competitive miR-30 antagomir abolished the inhibitory effects of lincRNA-p21 knockdown on TGF-β signaling and liver fibrogenesis, indicating that lincRNA-p21 functions as a ceRNA.

The expression of hepatic profibrogenic markers (α-SMA, Col1a1, TGF-β1, CTGF and TIMP-1) also significantly increased in anti-miR-30 group (Fig.   5C).

In contrast, miR-30 antagomir inhibited endogenous miR-30 and increased the luciferase activity (Fig.   2D).

The suppression of luciferase activity by lincRNA-p21 siRNA was reversed by miR-30 antagomir (Supplementary Figure  S5C).

AdH-miR-30 could significant increased miR-30b expression in AML12, but not in the cultured HSC cell line HSC-T6 (Supplementary Figure  S2B).

Basing on these results, we propose that TGF-β -induced lincRNA-p21 in turn strengthens TGF-β signaling by interacting with miR-30, thus forming a positive feedback loop to ensure lincRNA-p21 expression and mediate the role of TGF-β in promoting liver fibrosis.

Hepatocyte miR-30 inhibits liver fibrosis.

Notably, TGF-β1, Col1a1 and tissue inhibitor of metalloproteinase-1 (TIMP-1) were also greatly reduced in the AdH-miR-30 -injected mice.

Moreover, miR-30b expression increased in the hepatocytes of AdH-miR-30 -injected mice, but not in the HSCs (Fig.   3D).

To test this, we constructed adenovirus AdH-miR-30 and AdH-NC that can specifically express miR-30b or control in hepatocyte in vivo under the control of albumin promoter.

AML12 cells were transfected with lincRNA-p21 siRNA for 24 h and then treated with TGF-β1 for 2 h. (G) Inhibition of miR-30 impairs the effects of lincRNA-p21 siRNA on TGF-β/Smad signaling.

To examine the interactions between lincRNA-p21 and miR-30, the nontumorigenic mouse hepatocyte cell line AML12 were transiently transfected with the expression plasmid pCI-lincRNA-p21 that contains the murine lincRNA-p21 cDNA.

However, in anti-miR-30 group, AdH-shlincp21 failed to exert the inhibitory effects (Fig.   5A and B).

In the isolated hepatocytes from fibrotic liver injected with AdH-miR-30, ectopic expression of miR-30b led to decrease of KLF11 and increase of Smad7 in hepatocyte in vivo (Fig.   7A).

In the present study, we find that hepatocyte lincRNA-p21 can function as a ceRNA by binding miR-30, and therefore participating in the regulation of TGF-β signaling and liver fibrosis.

Hepatocyte lincRNA-p21 regulates liver fibrosis through interacting with miR-30.

To date, the mechanism of miR-30 deregulation in various states is mostly unknown.

To test our hypothesis, anti-miR-30, a phosphorothioate -modified antisense oligonucleotides specific for miR-30, and scrambled control (SCR), were intravenously injected into CCl [4] -treated mice weekly during the liver fibrosis development.

However, the injection of miR-30 antisense oligonucleotides decreased miR-30b in the hepatocyte (Fig.   5F).

Meanwhile, pCI-lincRNA-p21Mut, in which the predicted miR-30 binding site was mutated, failed to increase the luciferase activity (Fig.   2E).

Collectively, our results suggest that hepatocyte lincRNA-p21 contributes to liver fibrosis by interacting with miR-30.

miR-30 enrichment was determined by qRT-PCR and normalized to control.

Moreover, the transcribing of pri-miR-30 wasn’t affected by TGF-β, and thus strongly suggesting the underlying mechanism responsible for miR-30 decrease in response to TGF-β.

The increase of lincRNA-p21 in hepatocyte was associated with the loss of miR-30 during liver fibrosis.

Figure 2LincRNA-p21 interacts with miR-30.

de/rnahybrid/) further revealed a healthy minimum free energy of hybridization between lincRNA-p21 and miR-30 family members (Supplementary Figure  S1A).

However, at this stage, we can’t exclude the possibility that the decrease of miR-30 may be triggered by other mechanisms in liver fibrosis.

Notably, increased infiltration of macrophages was limited in AdH-miR-30 group mice (Fig.   3E).

The specific association between miR-30 and lincRNA-p21 was also validated by affinity pull-down of miR-30.

To confirm the interaction between lincRNA-p21 and miR-30, we inserted the lincRNA-p21 cDNA downstream of the firefly luciferase reporter gene.

Two days before the first injection of CCl [4], AdH-miR-30 or AdH-NC was injected into mice via tail vein.

Left, AML12 were transfected with miR-30b mimics for 24 h. Right, primary hepatocytes were isolated from fibrotic liver injected with AdH-NC or AdH-miR-30.

Thus, we hypothesized that hepatocyte lincRNA-p21 and miR-30 are inversely associated and involved in liver fibrosis.

Transfection of miR-30 greatly decreased the luciferase activity of the wild type reporter with normal binding sites for miR-30, but not that with the mutant binding sites.

Notably, we have previously reported that TGF-β1 reduced miR-30 in hepatocyte [35].

Moreover, the miR-30s in the isolated hepatocytes from AdH-shlincp21 group mice significantly increased, suggesting that AdH-shlincp21 might prevent liver fibrosis by increasing miR-30 in hepatocyte (Fig.   4F).

Figure 7LincRNA-p21 enhances TGF-β/Smad signaling in hepatocyte by interacting with miR-30.

Thus, TGFβ -induced lincRNA-p21 might be responsible for the decrease of miR-30.

These phenomena depend on the interaction between lincRNA-p21 and miR-30.

Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-shlincp21 and SCR (AdH-shlincp21 + SCR, n = 6) and CCl [4] in combination with injection of AdH-shlincp21 and anti-miR-30 (AdH-shlincp21 + anti-miR-30, n = 6).

Administration of AdH-miR-30 led to miR-30b increase in the liver tissue (Fig.   3C).

Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-NC (CCl4 + AdH-NC, n = 6) and CCl [4] in combination with injection of AdH-miR-30 (CCl4 + AdH-miR-30, n = 6).

Thus, lincRNA-p21 may be able to function as a ceRNA for miR-30.

LincRNA-p21 is physically associated with the miR-30.

8

To determine whether the radiation -induced IL-1β increase contributed to miR-30 expression and whether DT3 could inhibit the miR-30 expression induced by IL-1β, we used assays to validate the effects of IL-1β on miR-30 expression in CD34+ cells (Fig 5B).

DT3 downregulated radiation -induced miR-30 expression and secretion in mouse tissues and serum.

Finally, neutralization of IL-1β activation or knockdown of NFκBp65 gene expression in CD34+ cells resulted in complete abrogation of the radiation -induced miR-30 expression in these cells.

DT3 downregulated the expression and secretion of radiation -induced miR-30 in mouse tissues and serum.

DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in CD34+ cells.

These data suggest that radiation -induced IL-1β may be responsible for miR-30 expression and the radioprotective effects of DT3 may result from inhibition of a storm of radiation -induced inflammatory cytokines.

DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in human CD34+ cells.

In the current study, we confirmed expression of radiation -induced miR-30b and miR-30c in mouse tissues and serum, and miR-30 expression in mouse BM, jejunum, and liver within 1 h, that returned to baseline 4 or 8 h after irradiation (data not shown).

In this study, we further demonstrated the effects of DT3 and the anti-IL-1β antibody on suppression of radiation or IL-1β -induced miR-30 expression in CD34+ cells.

In this study, we confirmed our previous in vitro results and extend our findings using an in vivo mouse mo del, to explore our hypothesis that the radioprotective effects of DT3 are mediated through regulation of miR-30 expression in irradiated cells.

To further understand the interaction between miR-30 and IL-1β in response to radiation and DT3, and the mechanisms of DT3 on radiation protection, we explored the role of radiation and DT3 on regulation of miR-30 and IL-1β expression.

We further compared the effects of anti-IL-1β antibody and DT3 on miR-30 expression and survival of CD34+ cells after radiation and found that treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in these cells.

Due to the ability of miRNA to target multiple transcripts [29], miR-30 has been found in multiple cellular processes to regulate cell death through different genes such as cyclin D1 and D2 [30], integrin b3 (ITGB3) [31], B-Myb [32], and caspase-3 [33].

IL-1β (10 ng/mL) was added to CD34+ culture with the anti-IL-1β antibody (0.2 μg/mL) or the same amount of a nonspecific IgG, and miR-30 expression was tested at 15 min, 30 min, and 1 h after addition of IL-1β.

NFκB activation was responsible to radiation (and IL-1β) -induced miR-30 expression in CD34+ cells.

DT3 protected against radiation -induced apoptosis in mouse and human CD34+ cells through suppressing of IL-1β -induced NFκB/miR-30 signaling, and significantly enhanced survival after lethal doses of total-body γ-irradiation in mice.

Interestingly, IL-1β -induced miR-30 expression was completely blocked by DT3 treatment (Fig 5C).

Interestingly, radiation induced miR-30 expression in serum was observed at 4 h and remained elevated up to 24 h post-irradiation.

Treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in CD34+ cells.

Addition of the anti-IL-1β antibody for 30 min completely neutralized the expression of IL-1β -induced miR-30 in these cells.

Cells were used for quantitative real-time PCR to determine the effects of IL-1β neutralization on miR30 expression.

DT3 significantly suppressed miR-30 and protected animals from the acute radiation syndrome and increased survival from lethal doses of total-body irradiation.

We next evaluated the effects of DT3 on radiation and/or IL-1β -induced miR-30 expression in human hematopoietic CD34+ cells because DT3 had suppressed the radiation -induced IL-1β and its downstream cytokine IL-6 production in mouse spleen (Fig 3) and jejunum [4].

Vehicle, DT3, or a neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy irradiation, and miR-30 expression was examined 1 h after irradiation.

DT3 or anti-IL-1β antibody inhibited radiation -induced IL-1β production and reversed IL-1β -induced NFκB/miR-30 stress signaling.

We next sought to determine which a stress-response signal-transduction pathway may be involved in this IL-1β -induced miR-30 expression.

NFκB activation was responsible for radiation -induced miR-30 expression in CD34+ cells.

shown in Fig 5C confirmed that DT3 administration abolished expression of IL-1β -induced miR-30 in CD34+ cells.

Modulation of miR-30 expression with IL-1β neutralizing antibody.

Finally, vehicle or DT3 was added to CD34+ culture 22 h before IL-1β treatment, and miR-30 expression was examined at 24 h post-DT3 addition and 1 h after IL-1β treatment.

It was also observed that anti-IL-1β antibody-treatment blocked the radiation -induced miR-30 expression in control-siRNA transfected cells.

DT3 administration abolished IL-1β -induced miR-30 expression in CD34+ cells.

Radiation induced both miR-30 subunits between 4–24 h after 7 and 10 Gy TBI.

In conclusion, results from our current study demonstrated that an increase of miR-30 in irradiated cells results from a cascade of IL-1β -induced NFκB -dependent stress signals that are responsible for radiation damage in mouse and human cells.

This circulating miR-30 increase is specific, reproducible, and radiation dose -dependent in irradiated mouse serum.

In contrast, no miR-30 increase was observed after 2 Gy irradiation to siNFκB transfected cells.

We found that miR-30 was highly induced by radiation within 1 h in BM (Fig 4B), jejunum, and liver (Fig 4C), but not in kidney cells (data not shown).

We believe that the acute secretion of extracellular miR-30 in mouse serum after radiation is likely to derive from a variety of cell types.

These results further support our hypothesis that levels of miR-30 in irradiated mouse tissues and serum reflect the severity of radiation damage in these animals.

9

Previous studies have shown that miR-10a can target IL-12/IL-23p40 expression [32] and pro-apoptotic protein Bim [33], while miR-30d can negatively regulate apoptotic caspase CASP3 [34] and tumor suppressor p53 gene [35].

The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study.

Serving as negative regulators of cell apoptosis, miR-10a and miR-30d have been found to be upregulated in various cancer tissues, such as prostate cancer [36].

This result was further validated using a TaqMan probe -based qRT-PCR, we detected the expression of miR-10a, miR-30d and miR-192 in various mouse organs: the heart, spleen, kidney, colon and lung.

In addition, urinary miR-10a and miR-30d are highly enriched to the kidney; therefore, the elevation of these miRNAs may be directly linked to the injuries of kidney.

Because miR-10a and miR-30d are enriched in kidney tissue (Figure 1), urinary miR-10a and miR-30d are probably derived directly from the kidneys, particularly when kidney injury has occurred.

The elevation of kidney-enriched miR-10a and miR-30d in urine (Figure 2) but not serum (Figure S2) during renal I/R indicated that these miRNAs may be directly correlated with kidney injury.

Identification of miR-10a and miR-30d as kidney-specific miRNAs.

This hypothesis is supported by our observation that the elevation of miR-10a and miR-30d concentrations occurred only in urine and not in serum when mice were treated with renal I/R.

Next, we tested whether miR-10a and miR-30d are released into animal urine under normal and injury conditions.

However, it could also be true that renal cells and tissues actively release more miR-10a and miR-30d into circulation under the stress.

Note that, following renal I/R, the levels of mouse kidney miR-10a and miR-30d are decreased whereas the levels of pre-miR-10a and pre-miR-30d are not changed.

The role of tissue miR-10a and miR-30d in kidney function also strengthens our conclusion that urinary miR-10a and miR-30d can serve as indicators for kidney injury.

We used both I/R -induced acute kidney injury and STZ diabetes -induced chronic kidney injury animal mo dels and showed that changes in the levels of urinary miR-10a and miR-30d occurred as a result of renal damage.

Importantly, when kidney injury occurred, the levels of miR-10a and miR-30d in urine were strikingly elevated, while their levels in the serum were not increased.

Interestingly, we found that the miR-10a and miR-30d levels in serum were not correlated with kidney injury.

More importantly, the levels of urinary miR-10a and miR-30d were significantly increased in mice with either unilateral ischemia/reperfusion or bilateral ischemia/reperfusion.

In the present study, we observed increases in the urinary concentrations of miR-10a and miR-30d corresponding to kidney injuries.

High levels of urinary kidney-enriched miR-10a and miR-30d clearly indicate the kidney injuries in FSGS patients.

In contrast, reduction of miR-10a and miR-30d in kidney cells would cause cell apoptosis and damage, which may finally lead to renal dysfunction.

To find out whether the elevation of urinary miR-10a and miR-30d also occurs in patient with kidney injuries, we assessed the levels of urinary miR-10a and miR-30d in FSGS patients.

For mouse kidney, after rule out the miRNAs with very low total signal, we found that miR-10a and miR-30d, as well as other miRNAs in miR-1 and miR-30 families, were relatively enriched in kidney tissue.

Figure S3 The levels of miR-10a, miR-30d, pre-miR-10a and pre-miR-30d in mouse kidney tissues detected by TaqMan probe -based qRT-PCR with U6 serving as an internal control.

After bilateral renal I/R, the level of miR-30d in serum was still unchanged, while the level of miR-10a was reduced.

The results for the human urine samples further confirmed the feasibility of using the urinary miR-10a and miR-30d levels to detect kidney injury in humans.

Elevation of the urinary miR-10a and miR-30d levels can be detected in mice with unilateral I/R in which the protein levels were not changed, suggesting that the urinary miR-10a and miR-30d levels can reflect mild or early kidney injury.

Figure S2 Level of serum miR-10a and miR-30d in mice with/without renal ischemia-reperfusion injury.

Elevation of the urinary miR-10a and miR-30d levels but not serum miR-10a and miR-30d in mice with STZ diabetes -associated kidney injury.

0051140.g003 Figure 3Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered.

As shown in Figure S3A, both miR-10a and miR-30d in mouse kidney were significantly reduced during renal I/R.

Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered.

Furthermore, urinary miR-10a and miR-30d exhibited a diagnostic sensitivity that was considerably superior to that of BUN when the results were correlated to the histopathological results.

Next we determined the levels of miR-10a and miR-30d in mouse kidney tissue with or without renal I/R.

Elevation of miR-10a and miR-30d levels in the urine of FSGS patients.

A) Levels of miR-10a and miR-30d in mouse kidney with or without renal I/R.

Interestingly, although the chronic hyperglycemia caused an elevation of urinary miR-10a and miR-30d likely due to the kidney damage, a short period of high blood glucose exposure did not increase the level of these kidney-specific miRNAs in urine.

Through decreasing the levels of these apoptotic or pro-apoptotic proteins and inflammatory cytokines, miR-10a and miR-30d might provide a protection to kidney tissues/cells.

Interestingly, the levels of pre-miR-10a and pre-miR-30d in mouse kidney tissues were not changed (Figure S3B).

By comparing the levels of miRNA in sera and urine, we found that kidney-enriched miRNAs, such as miR-10a and miR-30d, were present in urine, and their concentrations were approximately 1/10 of those in sera.

In summary, our study demonstrated that miR-10 and miR-30d are stably present in human and animal urine and that the elevation of the urinary miR-10a and miR-30d levels can serve as a novel urine -based biomarker of kidney injury.

As shown in Figure S2, no alteration of miR-10a or miR-30d in mouse serum was observed after unilateral renal I/R.

Therefore, we also detected the levels of miR-10a and miR-30d in mouse serum with or without renal I/R.

As shown in Figure 4, we found that the urinary miR-10a and miR-30d levels in FSGS patients were significantly higher than those in healthy volunteers, indicating the severity of the kidney injuries in these patients.

Together, these results strongly suggest that urinary miR-10a and miR-30d could serve as sensitive and specific biomarkers for kidney injury.

As shown in Figure 1, we found that mouse kidneys contained a significantly higher level of miR-10a and miR-30d than did other tissues, confirming that these two miRNAs are kidney specific.

Moreover, pre-miR-10a and pre-miR-30d were not detected in mouse urine by qRT-PCR (data not shown).

Using different mouse renal injury mo dels, we reported that miR-10a and miR-30d were readily detected in urine and that their levels specifically correlated with mouse kidney injury induced by renal ischemia-reperfusion or STZ treatment.

Clarifying the role of miR-10a and miR-30d in the tumorigenesis processes of these cancer cells may be helpful for understanding the correlation between urinary miR-10a/miR-30d and kidney injures.

Elevation of the urinary miR-10a and miR-30d levels in mice with renal I/R -mediated injury.

These results strongly suggest that urinary miR-10a and miR-30d can serve as ideal biomarkers for kidney injury.

B, no alteration in the serum miR-30d level in mice with either SS or DS I/R treatment was observed.

Therefore, an elevation of urinary miR-10a/miR-30d levels correlates to a decrease of kidney miR-10a/miR-30d levels, which links to cell apoptosis and kidney injury/damage.

C–D, significant elevation of the urinary miR-10a (C) and miR-30d (D) levels in mice with either SS I/R or DS I/R.

These results suggest that the elevation of urinary miR-10a and miR-30d levels may specifically reflect hyperglycemia -induced kidney injury.

Urine samples from normal male C57BL/6J mice (6–8 weeks old, 22–25 g) and male C57BL/6J mice with kidney injuries were collected, and absolute levels of miR-10a and miR-30d were assessed.

B) Levels of pre-miR-10a and pre-miR-30d in mouse kidney with or without renal I/R.

These results collectively suggest that elevation of mouse urinary miR-10a and miR-30d during renal I/R is likely due to the release of mature miR-10a and miR-30d from mouse kidney tissue.

Alteration of the urinary miR-10a and miR-30d levels in FSGS patients.

Identification of miR-10a and miR-30d as mouse kidney-enriched miRNAs.

To test whether urinary miR-10a and miR-30d can be biomarkers for diabetes -induced renal injury, we employed streptozotocin (STZ) -treated diabetic mice as another kidney injury mo del.

The elevation of the urinary levels of miR-10a and miR-30d was also confirmed in urine samples from patients with focal segmental glomerulosclerosis (FSGS).

By challenging 12 h–fasting mice with an intraperitoneal injection of glucose (2 g/kg of body weight), we found no elevation of urinary miR-10a and miR-30d within 1–3 h (data not shown).

10

Among the differentially expressed miRNAs, members of miRNA-30 family (miRNA 30a, b, c, d, and e) were chosen for further studies as they have been found to be: (a) upregulated significantly (fold change ranging from 1.15–1.52) in NSCs from embryos of diabetic pregnancy (Supplementary Table 4); (b) involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015).

analysis revealed that overexpression of miRNA-30b but not miRNA-30d could significantly decrease the expression of Sirt1 protein suggesting that Sirt1 may be a target of miRNA-30b (Figures 6C,D).

In addition, miRNA-30d expression levels are found to be affected in brains of female schizophrenic patients (Mellios and Sur, 2012), thus emphasizing the importance of miRNA-30 family in brain development and disease.

In the present study, miRNA-30 family was found to be up regulated in NSCs from diabetic pregnancy when compared to control, suggesting that maternal diabetes alters the expression of miRNA-30 family and its target genes, which may perturb brain development in offspring of diabetic mothers.

In addition, we found that hyperglycemia increased the expression of miRNA-30 family, in particular miRNA-30b that altered NSC differentiation via down regulation of its target, Sirt1 in NSCs.

miRNA-30 family is found to have diverse functions in the brain during development and disease, with well-known roles in regulating epithelial-to-mesenchymal transition (EMT) (Kumarswamy et al., 2012).

NC, negative control; miRNA-30b OE, miRNA-30b over expression; miRNA-30d OE, miRNA-30d over expression.

Members of the miRNA-30 family i. e., miRNA-30a and miRNA-30d, are enriched in layer III pyramidal neurons and have been shown to target BDNF during development (Mellios and Sur, 2012).

Among the differentially expressed miRNAs in NSCs from diabetic pregnancy, the miRNA-30 family has been proposed to play critical role in maternal diabetes -induced neural tube anomalies as it has been shown to be involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015).

One of the miRNA-30 family members, miRNA-30b is found to target Sirt1 which belongs to the Sirtuin family of proteins with seven members of the family being reported to exist in mammals.

Figure 5 (A) qRT-PCR showing the expression pattern of miRNA-30 family.

2017.00237/full#supplementary-material Supplementary Figure 1 Gene targets of miR-30 family are depicted.

Gene targets of the miRNA-30 family were predicted using IPA (Supplementary Figure 1).

The NSCs from normal pregnancy were transfected with miRNA-30b or miRNA-30d mimics, in order to overexpress these miRNAs.

Further, quantitative RT-PCR analysis was performed to validate the expression levels of miRNA-30 family (miRNA-30 b, c, d, and e) in NSCs from embryos of diabetic and control pregnancy.

Following transfection, the expression of miRNA-30b and miRNA-30d increased 60-fold (Figure 6A) and 40-fold (Figure 6B), respectively, when compared to negative control.

miRNA-30 family and brain development.

The expression of miRNA-30b and miRNA-30d were quantified by RT-PCR with Exilent SYBRGreen master mix (Exiqon) and microRNA primers for miRNA-30b or miRNA-30d (Exiqon) in 96 well-FAST optical plates (7900 HT, Applied Biosystems).

While miR-30b and miR-30d were significantly up regulated in NSCs from embryos of diabetic pregnancy when compared to the control, miRNA-30c and miRNA-30e showed an increasing trend (Figure 5A).

Supplementary Table 4Fold change and p-value of miRNA-30 family.

There was significant up regulation of miR-30b and miR-30d in NSCs from diabetic pregnancy (open bars) when compared to normal (black bars).

11

Here we confirmed that Mtdh represents a target of mi-R30s in DN, and that the expression of all five miR-30 family members is downregulated in the glomeruli form streptozotocin -induced diabetic rats and HG -induced MPC5 cells.

Mtdh protein expression was shown to be increased as well after the treatment with the miR-30 inhibitors (Figure 6e), whereas miR-30 mimics significantly reduced Mtdh expression in HG -induced MPC5 cells (Figure 6f).

To assess the effects of miR-30s on the expression of Mtdh, we transiently transfected MPC5 cells with miR-30 inhibitors, synthetic miRNA mimics, or their NCs.

Furthermore, miR-30 inhibitors significantly increased the expression of Bax and cleaved caspase 3 (Figure 7c).

The obtained results demonstrated that miR-30a, -30b, -30c, -30d, and -30e mimics can significantly inhibit the luciferase activity of the wild-type Mtdh 3′-UTR reporter, but not that of the NC, and that this inhibition was reduced when the mutant reporter, with mutated miR-30 -binding site, was used (Figures 5d–h).

Transient transfections with siRNAs, Mdth overexpression vector, miR-30 inhibitors, and miR-30 mimics.

These cells were transfected with Mtdh siRNA (50 nM; GenePharma, Shanghai, China) or the overexpression (500 ng per well, GenePharma) the mixture of the mimics or inhibitors (RiboBio, Guangzhou, China) of all five miR-30 family members at the final concentrations of 50 nM, using Lipofectamine 2000 (Invitrogen) for 6 h in OPTI-MEM (Gibco BRL), according to the manufacturers' instructions.

Mtdh represents a direct target of the members of miR-30 family.

Mtdh mRNA level was shown to be significantly increased following the treatment with miR-30 inhibitors (Figure 6c), whereas miR-30s mimics led to a considerable reduction of Mtdh expression induced by HG (Figure 6d), compared with the corresponding NC treatment groups.

Therefore, we studied miR-30 expression in the DN glomeruli and HG -induced MPC5 cells.

Afterward, OPTI-MEM was replaced with the complete medium containing 1% FBS, and treated with HG for 48 h after the transfection with siRNAs or mimics, whereas the cells treated with miR-30 inhibitors were not treated with HG.

MPC5 were transfected with miR-30 inhibitors, mimics, or the respective NCs.

analysis demonstrated that the transfection of cells with miR-30 inhibitors significantly increased the percentage of apoptotic cells compared with the NC group (Figure 7a).

[44] The 3′-UTR of Mtdh containing putative miR-30 -binding sites was amplified and cloned into PmiR-RB-REPORT dual-luciferase reporter vector (RiboBio).

The treatment with miR-30 mimics considerably decreased HG -induced increase in the levels of these proteins (Figure 7d).

Conversely, miR-30 mimics considerably reduced the rate of MPC5 apoptosis induced by HG (Figure 7b).

12

Another approach to multiple siRNA expression was stimulated by report that a mouse miR30 -based shRNA expression cassette can be driven by Pol II promoters and provide higher knockdown efficiency than those driven by the Pol III U6 promoter [10].

These results suggest that although NP miRNA can be expressed from the mouse miR30 -based cassette in DF-1 cells, the level of target gene knockdown is modest following stable integration of the lentiviral vector.

Subsequently, Sun et al showed that a single Pol II promoter can drive three artificial miR30 cassettes to express siRNAs all targeting GFP, resulting in further knockdown of the GFP intensity in the cells [17].

The mouse miR30 -based miRNA expression cassette has been wi dely used to express artificial miRNA in lentiviral vectors [21].

As shown in Figure 1c, transient expression of miR30-NP inhibited Renilla luciferase activity by ∼85%.

Inhibition of luciferase activity by NP miRNA expressed from a mouse miR30 -based lentiviral vector.

To express anti-influenza artificial miRNA, we replaced the mature miR30 sequences in pLB2 with sequences that target nucleoprotein (NP) of influenza virus (Figure 1b).

As a control, Vero cells were transduced with a CPGM lentivirus that expressed miR30 -based miRNA specific for the firefly luciferase transcript.

Expression of NP miRNA from the mouse miR30 -based lentiviral vector.

Zhou et al reported that two tandem copies of the miR30 -based cassette can be expressed in a single transcript driven by a Pol II promoter [15], [16].

In addition to miR30 -based designs, mouse miR155 -based design has also been used to knockdown multiple genes [19].

In the transient transfection assay, the miR30-NP lentiviral vector and psicheck-2 dual luciferase reporter plasmid, in which the NP target sequence was cloned into the 3′ UTR of the synthetic Renilla luciferase gene, were co -transfected into DF-1 cells.

A similar miR30 -based approach was utilized by Zhu et al to knockdown multiple genes [18].

Flanking and hairpin sequences are miR30.

0022437.g001 Figure 1(a) Schematic diagram of the miR30-NP lentiviral vector.

Psicheck-2 dual luciferase reporter plasmid (50 ng) and miR30-NP lentiviral vector (450 ng) were co -transfected in DF-1 cells.

13

In summary, we have established a mouse strain that expresses a tet-regulatable, miR30 -based shRNA targeting the Cox2 transcript, and have demonstrated reversible and functional DOX -mediated suppression of Cox2 gene expression.

The targeting vector, pCol-TGM, contains a GFP open reading frame immediately downstream of the TRE promoter, followed by the miR30 -based shRNA expression cassette.

To identify appropriate shRNAs, each cloning template containing a COX-2 shRNA sequence was ligated into LMP, a retroviral miR30-shRNA expression vector in which miRNA -based shRNA (shRNAmir) expression is driven from the viral 5′LTR promoter (Fig. 1A).

Using the microRNA30 (miR30) precursor RNA as a template, they substituted miR30 stem sequences with designed shRNAs, and showed effective target gene inhibition [15].

The Cox2.2058 shRNA in the LMP shRNA expression cassette was cloned into the miR30 backbone of this targeting vector at the single XhoI /EcoRI site.

pCol-TGM contains a miR30 -based expression cassette regulated by an inducible tetracycline response element (TRE) promoter.

The LMP retroviral vector, a murine stem cell virus (MSCV) -based vector contains unique XhoI and EcoRI sites within a miR30-shRNA expression cassette, driven by the viral 5′LTR promoter ([17], [20] and Fig. 1A).

These shRNA sequences, and their corresponding sense strand predictions, were synthesized as 97 mers and cloned into the miR30 shRNA backbone as described previously [21].

Appropriate products carrying the XhoI /EcoRI restriction sites at their ends and comprising the common and Cox2-specific stem sequences and the 19 bp loop were used to create miR30-adapted shRNAs.

This vector contains an XhoI /EcoR1 cloning site for shRNAs within a miR30 backbone (shRNAmir).

These sequences comprise the common and gene-specific stem and 19 bp loop of the miR30-context to create miR30-adapted shRNAs specific for Cox2.

Using improved prediction methods for the design of miR30 -based shRNAs [20], we identified four 22-mer guide strand sequences; Cox2.284 (1), Cox2.1082 (2), Cox2.2058 (3) and Cox2.3711 (4) (Fig. 1A), complementary to the Cox2 coding region (1 and 2) or the Cox2 3′-UTR sequence (3 and 4).

14

In total, 114 miRNAs are significantly changed and can be classified into four groups (Figure 2A); 52 miRNAs, including the miR-30 family, are down-regulated during the first 8 days after infection (Figure 2B), 8 miRNAs are down-regulated before day 2 and up-regulated after day 2 after infection (Figure 2C), 2 miRNAs are up-regulated before day 2 and down-regulated after day 2 after infection (Figure 2D), and the remaining 52 miRNAs, including the miR-17 family, are up-regulated (Figure 2E).

The combined miRNA expression, miRNA target and signaling pathway assays revealed that the members of the miR-30 family may negatively regulate genes involved in MAPK signaling and adherens junctions [15], whereas the miR-29 family are involved in activating endogenous pluripotent genes such as Oct4 and Nanog by targeting DNMTs [24]– [27].

Among 41 unique miRNA expression signatures for activation of the iPS reprogramming process, we found 4/6 members of the miR-30 family, that are down-regulated.

In the activation step of iPS generation, increased expression of the miR-29 family and decreased expression of the miR-30 family are essential.

Two mean signal intensity plots are shown for this group and the miR-30 family.

15

Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ).

16

MiRNA-30c belongs to the miRNA-30 family, which consists of five members that are ubiquitously expressed, all of which are among the most highly expressed miRNAs in the heart.

Since the seed region is identical between members of the miRNA-30 family, it can be expected that there is a substantial overlap in the targets that they regulate.

Since we observed no changes in overall mitochondrial morphology in our in vivo mo del, our results contradict the in vitro studies reported by Li et al. who found impaired mitochondrial fission in cultured neonatal cardiomyocytes when overexpressing miRNA-30 [17].

Members of the miRNA-30 family also affect mitochondrial fission and apoptosis in cultured neonatal cardiomyocytes, an effect attributed to miRNA-30c targeting of p53 [17].

In addition, in zebrafish, miRNA-30 overexpression with mimic sequences leads to excessive blood vessel sprouting, showing the ability of this miRNA to induce angiogenesis in vivo.

As the miRNA-30 family has five members, of which several have genomic duplications, a genetic knock-out approach is highly impractical.

Having generated a stable and specific miRNA-30 overexpression mo del we phenotypically compared wildtype and transgenic hearts.

112.267732 12 Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, et al. (2009) miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling.

However, little is known on the role of the miRNA-30 family in the heart in vivo.

As a consequence, functional redundancy is expected between the miRNA-30 family members.

Uncovering the exact role of miR30 in vivo is highly relevant as miRNA-30c was identified as the top candidate for inducing cardiomyocyte hypertrophy in an unbiased miRNA mimic screen in neonatal rat cardiomyocytes [13].

17

The targeting of Slug mRNA by miR-30 results in downregulation of fascin and upregulation of the tight junction proteins CLDN-1, CLDN-2, and CLDN-3, which downregulates EMT and, ultimately, reduces the rate of breast cancer progression.

miR-30 family members, including miR-30a, are downregulated in estrogen receptor–negative and progesterone receptor–negative breast tumors, suggesting that these hormones are involved in de novo synthesis of miR-30 family members [26, 27].

We are currently mapping the specific region that harbors the hormone-response element(s) in the miR-30 promoter and will identify the hormonal mechanism that regulates miR-30 expression, which could help determine the clinical benefit of endocrine therapy in individuals with hormone receptor–positive breast cancer.

This supported a suppressive function for miR-30 in breast cancer invasiveness and metastasis in vivo.

According to data sorting of the mRNA sequences bound to miRNAs, miR-30 family members (miR-30a, -30b, -30c, -30d, and -30e) share the same seed sequence (Supplementary Figure S1), suggesting that other miR-30 family members may also suppress Snail or Slug.

Additional studies are needed to determine whether defects in miR-30 family members act independently or jointly to drive the progression of breast cancer.

18

To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families.

Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C).

In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7).

Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs.

The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini.

We used a pair of reporters, one of which had an inserted single miR-30 perfect binding site (1xP miR-30) while the other did not have the insertion (Figure 6B).

Furthermore, the dose-response trends were highly similar for the majority of the compounds; the pattern was the most striking for the miR-30 experiment in HeLa cells (Figure 6A).

For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E).

Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites.

Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005).

Except for the control and 1xP miR-30 reporters, which utilized the SV40 promoter and 3′ UTR, all other reporters were driven by the PGK promoter and had BGH 3′ UTR.

Remarkably, the majority of compounds yielded a comparable impact on luciferase activity regardless of the presence of the miR-30 perfect binding site.

The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010) into pGL4_SV40 using XbaI and ApoI restriction sites.

Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively.

Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing.

To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A).

Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites.

19

Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d).

As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d).

identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m).

Specifically, miR-30b and miR-30c showed more significant differences from miR-30a, miR-30d and miR-30e than from each other and vice versa.

Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference.

Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10.

Shuffling analysis of miR-30 family members revealed similar specificity, although certain preferences were more significant than others (Fig. 7d).

Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown.

An exception was G–U wobble interactions, which showed strong preferences such as miR-30 position 3 (Supplementary Fig. 3d).

Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference.

20

miR-30c was upregulated by HDI in all the three experiments, miR-30d was upregulated in two of the three experiments, while miR-30b and miR-30e were upregulated in one of the three experiments but were downregulated in the other two experiments.

All the five miR-30 miRNAs were expressed in B cells stimulated by LPS plus IL-4. The abundance of miR-30b, miR-30c, miR-30d, and miR-30e were greater than that of miR-30a (Figure 8).

org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse.

The miR-30 family consists of five miRNAs (miR-30a, miR-30b, miR-30c, miR-30d, and miR-30e) encoded by different host genes.

The miR-30 family members are similar to each other and have identical seed sequences.

Like human PRDM1 (48), the 3′ UTR of mouse Prdm1 mRNA contains three highly conserved bindings sites complementary to the seed sequence of miR-30a and other miR-30 family members (Figure 8).

21

MiR-30 family members are strongly upregulated during adipogenesis in human cells, and inhibition of miR-30 inhibits adipogenesis [12].

Overexpression of miR-30a and miR-30d stimulates adipogenesis, and it has been demonstrated that miR-30a and miR-30d target RUNX2, a major regulator of osteogenesis and a potent inhibitor of PPARγ, the master gene in adipogenesis [36].

Moreover, miR-30d has been identified as a positive regulator of insulin transcription [38].

miR-30 family members have also been demonstrated to act as positive regulators of adipocyte differentiation in a human adipose tissue-derived stem cell mo del [35].

The miR-30 family has been found to be important for adipogenesis [12].

22

Both miR30-shRNA and pX330-gFoxp1 inhibited the expression of FOXP1 in the E17.5 neurons as demonstrated by the loss of colocalization of GFP and FOXP1 immunofluorescence in the CP (Fig 2Ca–b and 2Ea–b).

Both the targeting and the scramble sequences were also cloned into pCAG-miR30 system (Addgene), which is a pri-miRNA based shRNA -expression vector contributed by Connie Cepko [30].

The miR30 -based shRNA expression system was introduced into the brain by IUE at E14.5.

Correspondingly, more neurons were stalled in the IZ when Foxp1 was inhibited (miR30-ScrRNA: 29.2%; miR30-shRNA-b: 53.5%) (Fig 2D), indicating a migratory delay.

Therefore, the targeting and scramble sequences were embedded into the murine miR-30 using pCAG-miR30 vector system.

At E17.5, a reproducible migration defect was observed in Foxp1 miR30-shRNA-b group by comparison with the control (miR30-ScrRNA) (Fig 2C).

23

Inhibiting endogenous background CSE gene expression, and direct administration of H [2]S at 100 microM induced apoptosis in HASMCs[146] Transfected with miR-30 mimics HEK293 cells and primary neonatal rat myocardial cellsOverexpression of miR-30 family members decreases the expression of CSE protein and H [2]S production.

Knockdown of miR-30 family members leads to the upregulation of CSE and H [2]S production rates[164]  Diabetes CSE adenovirus gene transfer Transfection of insulin secreting beta cell line INS-1E cellsCSE overexpression stimulates INS-1E cell apoptosis via increased endogenous production of H [2]S. Ad-CSE transfection inhibited ERK1/2 but activated p38 MAPK.

24

Thus, members of the miR-30 family were significantly down-regulated so that expression of its main target p53 could be suitably elevated to counteract the higher proliferation in recovering lung tissues, which are more prone to DNA damage and mutation in the presence of increased DNA synthesis [41].

TargetScan analyses also revealed specific miRNAs highly involved in targeting relevant gene functions in repair such as miR-290 and miR-505 at 7 dpi; and let-7, miR-21 and miR-30 at 15 dpi.

Hence, miR-30 appears to act as a tumor suppressor, with its subdued expression facilitating proliferation, but concurrently activating the negative feedback loop of p53, thus showcasing the intricate roles that miRNAs play in pulmonary damage and repair [42].

25

The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance.

Interestingly, dihydropyrimidinase-related protein 2, DPYSL2, a highly abundant protein in brain, is targeted by miR-30, 20 and 181 and has been shown to be up-regulated in proteomic studies on APP23 mice already at a very early age [63].

In addition, specific members of the miR-30 family (30c and 30b) were also significantly down-regulated in response to Aβ.

Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20.

26

Moreover, analysis of the miRNA expression profiling data and the list of target mRNAs showed that miR-100, miR-184 and miR-10a were especially expressed in human MII oocytes, while miR-29a, miR-30d, miR-21, miR-93, miR-320a, miR-125a and let7 were expressed in the human cumulus cells.

Murchison et al. first investigated the expression of miRNAs in mouse oocytes, and they demonstrated that the miR-30, miR-16 and let-7 family was overexpressed in mouse germinal vesicle (GV) oocytes, speculating, as a result, that miRNAs might play important regulatory roles in the expression of mRNAs during the process of follicular maturity [23].

Furthermore, Tang et al reported that the miR-30, miR-16, let-7 and miR-17-92 family, which was detected in mature mouse oocytes, dynamically regulated oogenesis and early embryonic development.

27

Figure 7(A) Representative images of HUVECs with miR-30b overexpression (HUVEC [miR-30b]) and their negative control (HUVEC [scrambled]); (B) The expression of miR-30b; (C) Representative images of tube-like structures and quantitative analysis of the total tube length (4× magnification microscopic fields); (D) TargetScan shows that 3′ UTR of DLL4 contains conserved miR-30 family binding sites; (E and F) The expression of DLL4 in HUVECs (mRNA and protein, respectively) (* P < 0.05 vs HUVEC [scrambled]).

Previous studies reported that DLL4, one of miR-30 family targets, modulates endothelial cell behavior during angiogenesis [31, 45].

TargetScan shows that the 3′ UTR of DLL4 contains the conserved miR-30 family binding sites (Figure 7D).

miR-30 family targeted DLL4 in endothelial cells to promote angiogenesis [31].

28

Thus, the downregulation of miR-133 and miR-30 may contribute to the development of cardiac fibrosis in DBL mice, as both regulate the profibrotic signalling factor, CTGF [30], which was correspondingly upregulated.

These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling.

Downregulated miRNAs included miR-1 and miR-133a, which are part of the same transcriptional unit, and three miR-30 family members, namely miR-30b, miR-30c and miR-30e.

29

[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21.

Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21.

There was no significant change in miR-133, miR-30, or miR-101 family members after LPS.

Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure).

The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families.

30

Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7.

Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473.

Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31.

Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690.

31

However we found deregulated at least two genes (Bglap2 and Il1f9) regulated by Runx2, a direct target of miR-30 family [7], [9].

Recent data highlighted a role of miR-30 in the inhibition of EMT in hepatocytes [13], process which is important for mammary gland involution.

miR-30 family targets validated in the literature.

The miR-30 family is also involved in the control of structural changes in the extracellular matrix of the myocardium [14], in cellular senescence [15] and in the regulation of the apoptosis [16].

These observations could corroborate to recent published data on the miR-30 family that highlighted its role in the differentiation of various cell types including adipocytes [7], B-cells [8] or osteoblasts [9].

The miR-30 family is highly conserved in Vertebrates, it is composed by 6 miRNA (miR-30a, -30b, -30c-1, -30c-2, -30d and -30e) and it is organized in 3 clusters of two miRNA localized on 3 different chromosomes.

miR-30b is a member of the miR-30 family, composed of 6 miRNA that are highly conserved in vertebrates.

32

These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22].

Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22].

Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27.

We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci.

We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326).

33

Cre-conditional expression of rAAV2/9- CAG::FLEX-rev-hrGFP:mir30(Scn9a) in Agrp [Cre] mice (AGRP [sh(Scn9a)] mice, Figures 4H and 4I) reduced EPSP duration resulting in synaptic potentials that decayed with the membrane time constant (AGRP [sh(Scn9a)]: 116% ± 8% of τ [m], n = 14; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p < 0.001), whereas expression of a scrambled Scn9a shRNA sequence maintained prolonged EPSPs (AGRP [sh(Scn9a-scram)]: 271% ± 3% of τ [m], n = 7; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p = 0.15, Figure 5A).

This method couples reporter gene expression (humanized Renilla green fluorescent protein [hrGFP]) to RNA interference with a microRNA (miR30) cassette that was modified (Stegmeier et al., 2005, Stern et al., 2008) to encode a shRNA sequence for Scn9a in the 3′-untranslated region, allowing identification of neurons transduced with the short hairpin RNA (shRNA) (Figures 4A and 4B).

Constructs for Scn9a Knockdown miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www.

php) and then chose a sequence with <76% homology to RefSeq transcripts in the mouse genome and that also obeyed gui delines for miR30 -based shRNA (Dow et al., 2012, Matveeva et al., 2012) (see the Supplemental).

To produce a negative control for this miR30 -based Scn9a shRNA construct, we used a website to produce a scrambled sequence (http://www.

miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www.

34

Importantly, we describe an shRNA prediction tool that can effectively predict high potency shRNA target sequences when imbedded in the miR30 context, and we show that more than half of the sequences tested had the ability to knockdown gene expression from single copy, Dox-inducible cassette in embryonic stem cells.

While we have not yet examined the effect of these modifications with our shRNA selection algorithm, we anticipate that this may further improve the efficiency of miR30 shRNA mediated gene knockdown.

pENTR1a-dsRed-m30c was constructed by first cloning dsRed-Express (Clonetech) into pENTR1a (Invitrogen) with SalI/NotI, then the miR30 based context was cloned into NotI/XbaI sites of pENTR1a-dsRed using the following primers: miR30 5’Arm 5’cgtaaGCGGCCGCGTCGACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGG 3, miR30 mid Arm 5’CTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTCGAGCAACCAGATATCGAATTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACT 3’, miR30 3’Arm 5’GGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTCTAGAcgtaa 3’.

Recently, site-specific insertion of inducible microRNA-30 context (miR30c) based shRNA cassettes in embryonic stem cells have enabled rapid generation of mice with inducible gene knockdown [1, 2].

Fluorescent miR30-shRNA or Flag tagged NPAS4, SIM2s and SIM2l cDNAs were recombined into pFLP-Inducer or pLVTPT vectors by LR recombination.

Recently, a number of high throughput experiments have been performed to identify potent shRNA sequences which, when embedded with the miR30 -based context, successfully produce functional siRNAs [19, 20].

Generation of a miR30 shRNA selection algorithm.

35

BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response.

36

For lentiviral -mediated knockdown of Trp53, we generated a vector (pLenti X1 Puro DEST, Addgene 17297) containing the U6 promoter (derived from pENTR/pSM2 (U6), Addgene 17387) driving expression of a previously described (Dickins et al, 2005) miR30 format shRNA against Trp53 (1224) or expressing an empty (ns) miR30 backbone.

Cells were infected with adenoviruses expressing GFP (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700), retroviruses (LMP) expressing non-silencing hairpin or miR30-shRNA against Trp53 (Dickins et al, 2005), lentiviruses (L KO.

I. Proliferation assays of Vhl [fl/fl] MEFs infected with GFP or Cre and lentiviruses expressing an empty miR30 shRNA (shRNA-ns) or miR30-format shRNA directed against Trp53 (shRNA-Trp53).

37

In fact, growing evidence of indirect p53 deregulation in MM through MDM2 overexpression, TP53 promoter hypermethylation and alterations in certain miRNAs that directly or indirectly affect p53 expression, such as miR-25, miR-30d, miR-125a-5p and miR-214, have been reported.

Two miRNAs, miR-25 and miR-30d, which directly interact with the 3′-UTR of the human TP53 mRNA [107] are downregulated in MM and their levels are inversely correlated to TP53 mRNA.

38

Studies have described miRNA binding sites for miR-30 within the extended region of Lhx1 3'UTR, where miR-30 inhibits Lhx1 expression and therefore embryonic kidney differentiation [28] (Figure 2C).

MiR-30 was abundantly detected in our miRNA-Seq dataset, where it has been previously shown to be a critical regulator of kidney development [28].

Literature evidence of microRNA association is represented for Lhx1 (miR-30) and Hoxa11 (miR-181) along with other known transcriptional regulatory relationship (dotted arrows).

Only Lhx1 has been characterized as target of miR-30 within the context of kidney development [28].

C: Riboprobes used for in situ hybridization (ISH): i) overlapping the canonical region as represented by Affymetrix probeset 1421951_at and ii) overlapping extended 3' signal captured by RNA-Seq and probeset 1450428_at, which also contains a microRNA binding site for miR-30 [28].

39

However, treatment with siADAM8-1 led to reduced levels of only eight miRNAs (miR-181a-2, miR-29c, miR-29c*, miR-98, miR-520c-3p, miR-93, miR-130b, and miR-720), whereas three miRNAs showed increased expression, including miR-30d, miR-20a and miR-106*b (Fig.   1d), suggesting these miRNAs may not be regulated specifically by ADAM8 or may have differential regulation via splice variants.

In addition to miR-720, many of the 68 miRNAs modulated by ADAM8 have been found to be upregulated in breast cancer or previously implicated in tumorigenesis (such as miR-19a, miR-106b, miR-181a-2, miR-30a, miR-93, miR-30d, and miR-10b) [37, 40, 75– 78].

For example, miR-18b, miR-20a, and miR-30d have been reported to be highly expressed in the serum of relapsing TNBC patients [88].

Li N Kaur S Greshock J Lassus H Zhong X Wang Y A combined array -based comparative genomic hybridization and functional library screening approach identifies mir-30d as an oncomir in cancerCancer Res.

40

BIM shRNA knockdown and retroviral expression of miR-17-92The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems).

The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems).

A miR-30 -based shRNA was used to knockdown BIM expression by 80% as measured by Western blot analysis [21] (Supplementary Figure 1).

41

Previous studies reported the downregulation of miR-30 family members during osteoblast differentiation from mouse preosteoblast cell lines 18, 19. miR-30a/b/c/d were demonstrated to be able to negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 [19].

In contrast, miR-30 family members were upregulated during adipogenic differentiation of adipose tissue-derived stem cells, and miR-30a and miR-30d contributed to adipocyte formation [20].

The miR-30 family is associated with cell differentiation, cellular senescence, apoptosis, and involved in the pathogenesis of tumors and other disorders of the nervous, genital, circulatory, alimentary and respiratory systems 15– 17.

The miR-30 family members include miR-30a, miR-30b, miR-30c, miR-30d and miR-30e.

42

As a group of tumour suppressors, the miR-30 family has been reported to be downregulated in many human cancers, including colorectal cancer [21], lung cancer 22, 23, thyroid cancer [24], renal cell carcinoma [25] and gastric cancer [26].

Chen D MicroRNA-30d-5p inhibits tumour cell proliferation and motility by directly targeting CCNE2 in non-small cell lung cancerCancer Lett.

MiR-30a is a member of miR-30 family, which also includes miR-30b, miR-30c, miR-30d, and miR-30e.

43

Furthermore, inhibition of PI3K expression at the time of reperfusion abrogated p-Akt expression and the anti-autophagy effect of miR-30a induced by Sal B. Taken together, these data demonstrate that Sal B can alleviate I–R-injured myocardial cells through miR-30/PI3K/Akt pathway -mediated suppression of autophagy.

Circulating miR-30 has been shown to be positively associated with left ventricular wall thickness, and regarded to be an important marker for the diagnosis of left ventricular hypertrophy due to miR-30a -induced alterations in expression of the beclin-1 gene and autophagy in cardiomyocytes [8].

44

Briefly, the ‘Flp-In' targeting vector, called pCol-TGM, was configured with a GFP ‘spacer' between a tetracycline-regulated element and the miR30 -based expression cassette.

Nine shRNA guide sequences predicted to target Rtn1 for knockdown were embedded into a miR30 -based expression cassette of a retroviral DOX-inducible shRNA vector.

45

We therefore decided to camouflage the antiviral target sequences as the cell’s own microRNA (miRNA) in similar ways, as miRNA-30-like precursors have been used for the study of gene function before [11] to circumvent a hypothetical cellular response mechanism.

Also HBsAg suppression was slightly more efficient, when a miRNA-26-like construct was used, whereby miRNA-122-like and miRNA-30-like constructs exhibited similar efficiency.

Eventually we selected a pEPI-U6-miRNA-30-like clone targeting transcripts of HBV ORF X/ORF P for further experiments.

To circumvent putative hepatocellular ‘friend or foe’ recognition, we mimicked hsa-miRNA-30-like molecules, which were compared to other miRNA-like constructs for their suppressive potency in prior experiments.

D. in HBV-Met treated with miRNA-30 L-X1 versus untreated HBV-Met.

46

This observation suggests a possible unidentified interaction between miR-30 and BDNF promoter as well as multiple layers of regulation of BDNF level by targeting both 3′-UTR and promoter regions.

Members of the miR-30 family were previously reported to target both human and mouse BDNF at the 3′-UTR (55, 56).

For example, members of the miR-30 family were good candidates given that they are predominantly nuclear-localized and were predicted to commonly target human and mouse BDNF sense promoter with strong favorable thermodynamic interaction.

Experimental evidence for the existence of nuclear miRNAs was also present for the three miRNA families, namely miR-188, miR-671 and miR-30.

47

In addition, miR-23a, miR-23b, miR-24 and miR-30d were shown to be upregulated in hypoxia [38].

Several other miRNAs also appeared as promising candidates for selective vascular expression, including miR-145, miR-30d, miR-23b and miR-24 (within the dashed lines in Figure 1b).

The miRNAs identified in the present study - miR-145, miR-30D, miR-24, miR-23a and miR-23b - are therefore possible targets in future therapeutic strategies.

Based on the above described in silico analyses, we chose to further characterize the expression of miR-126-3p (the predominant mature form of this miRNA, hereafter referred to as miR-126), miR-145, miR-30d, miR-23b, miR-24 and miR-23a; the latter being co-transcribed with miR-24 [1].

48

Therefore, expression of select miRNAs, including the miR-199 and miR-30 families, decreases during reprogramming and may allow for the upregulation of SIRT1 protein expression.

Additionally, all five members of the miR-30 family that potentially target SIRT1 were higher in MEFs than iPS and mESCs.

49

The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS).

The two shRNA sequences were placed into miR30 context downstream eGFP CDS and thereby lentiviral vectors expressing the miR-shRNAs, named as FUW-eGFP-miR-shRNA in this article, were constructed (Fig. 1).

0030560.g001 Figure 1 The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS).

To place the shRNA sequences into miR30 context, a 97-mer sequence containing the designed shRNA was retrieved through the RNAi design algorithm, which was then subcloned into the site of pri-miRNA area downstream the eGFP coding sequence (CDS) in pRIME vector as previously described [10].

50

In addition, two other members of the miR-30 family (miR-30d and miR-30e) that target BDNF (Mellios et al. 2008) were also overexpressed (Tables 1 and 2, Figure 4).

Of the 113 miRNAs with significantly aberrant expressions after RDX exposure, the expression levels of 10 miRNAs were significantly increased in both mouse liver and brain (p < 0.01): miR-99a, miR-30a, miR-30d, miR-30e, miR-22, miR-194, miR-195, miR-15a, miR-139-5p, and miR-101b.

51

miR30 is significantly down-regulated in several cancers, including breast cancer [30] and lung cancer [31] and it has been hypothesized that miR30 may play an important role in tumorigenesis and tumor development.

The results showed that CLCNs were able to transfect the cells with miR30b as well as DharmaFect did and the miR30-b expression in vitro was increased by using CLCNs or DharmaFect.

However, the function of miR30 especially in NSCLC remains unclear [32].

The tissues sections were collected 24 hours after treatment with CLCN D275/miR30 b complexes (1.5 mg/kg).

52

An shRNA is expressed under regulation of a U6 promoter and is flanked by pri-miR-30 5′ and 3′ sequences, which are 151 and 128 bp long, respectively.

The shRNA sequences (Figure 1B, Table S1) targeting human huntingtin (shHTT) and EGFP (control reagent, shCTRL) were designed using the RNAi Codex database (Olson et al., 2006) with a mir-30 loop between the passenger and guide strands.

We have assembled a silencing construct and stably integrated it into the iPSC genome; this construct is based on the piggyBac transposase system (Yusa et al., 2011) and contains anti-HTT or control shRNA in the mir-30 backbone (Paddison et al., 2004), and the gene encoding mOrange2 fluorescent protein (Shaner et al., 2008) as a reporter (Figure 1A).

We used a piggyBac transposase system (Yusa et al., 2011) and anti-HTT shRNA in the mir-30 backbone (Paddison et al., 2004) which provides additional possibility for future excision of the reagent if desired.

Constructs (Figure 1A) composed of a U6 promoter, a miR-30 5′ flank (151 bp), an shRNA sequence, a miR-30 3′ flank (128 bp), a U6 terminator (TTTTTT), an EF1alpha promoter, an mOrange2 reporter gene, and an SV40 pA site were were synthesized by Genscript (Piscataway, NJ) and cloned into a pPB-HKS-neoL vector obtained, by removing the EGFP reporter gene, from a pPB-UbC.

53

Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121].

These miRNAs (miR-15a, miR-30, miR-182, and miR-804) are involved in cell proliferation, apoptosis, inflammation, epithelial-mesenchymal transition, invasion, oncogene inhibition, and intercellular adhesion.

54

Next to miR-204, the next most highly expressed MG miRNAs (with less than 20% expression in neurons) were miR-125b, and miR-9. These two miRNAs are also highly expressed in P7 FAC-sorted astrocytes of the forebrain, along with several others of the most highly expressed mGliomiRs (miR-99a, miR-204, miR-135a) and shared miRs (miR-720, let-7b, miR-29a, and miR-30d) 40.

These include miR-720, let-7b, miR-29a, miR-30d, and miR-335-5p (Fig. 2B, Supplement Table 2).

55

Figure 1 Expression of concatenated miR30 -based shRNAs in a single transcript can promote efficient knockdown of at least three target genes.

Prom; any of the pol II promoters listed in Fig. 2a, attL1 + attL2; Gateway recombination sites, 5'miR + 3'miR; flanking sequence derived from human miR30.

Although we clone shRNAs into our entry vectors using BfuAI compatible linkers, we include Xho I and Eco RI cloning sites in the flanking miR30 sequence to allow subcloning of miR-shRNAs from popular whole genome libraries [2, 7] into our plasmids (Fig. 2b).

For shRNAs cloned as BfuAI site-compatible linkers (see methods), shRNA sequence is introduced at the junctions of the 5' and 3' miR30 sequence (light blue).

For shRNAs subcloned from commercially available whole genome libraries [2, 7], fragments can be subcloned to the XhoI/EcoRI sites (dark blue) within the 5' and 3' miR30 sequence.

56

shRNA against GOI was expressed by CAG-LSL-mir30, which is a Cre -dependent shRNA expression vector 14.

The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14 (Addgene plasmid #13786).

The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14.

Small hairpin RNA (shRNA) can be transfected into cortical neurons by the IUE -mediated transfection of CAG promotor/microRNA30 -based RNAi vector (CAG-LSL-mir30) 14.

pK225 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi)] and pK226 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi Scramble control)]: For single cell LacZ knockdown, the shRNA against the coding region of LacZ (651–671) and its scramble control were generated by PCR with the template oligonucleotide for LacZ shRNA WL090 and the template oligonucleotide for LacZ shRNA scramble control WL091, respectively, using the primers HM082/HM083.

57

Knockdown of NF-κB-p65 by small interfering RNA (siRNA) significantly suppresses radiation -induced miR-30 expression in CD34+ cells [45].

Nevertheless, suppression of miR-30 and IL-1β protects CD2F1 male mice and human CD34+ cells from radiation injury [45].

58

On the contrary, it has been shown that miR-30 can inhibit the self-renewal and induce apoptosis of breast tumor-initiating cells (BT-ICs) by silencing Ubc9 and ITGB3 [42].

Above evidences indicate that miR-30 is a multifunction gene which can inhibit or induce the apoptosis.

miR-30b is one of the miR-30 family which is associated with the development of many types of cancers.

59

To temporarily and reversibly control p53 expression in vivo, we utilized TRE-p53.1224 transgenic mice in which expression of a miR-30 -based p53.1224 shRNA is regulated by a tetracycline-responsive element (TRE) 17.

Expression of miR-30 -based p53.1224 shRNA was detected using a Custom TaqMan MicroRNA Assay (Applied Biosystems).

60

As shown in Figure 6A, mRNA targets of several miRNA families were found to be significantly upregulated in hypertrophy (false discovery rate (FDR) <0.05), including those targeted by miR-29, miR-1, miR-9, miR-30, and miR-133.

61

The miRNA control contains a luciferase shRNA cloned onto the stem of miR-30 [59], while the control shRNA targets firefly luciferase cloned as an shRNA.

Tumors and metastases derived from implanted 4T1 cells or 4TO7 cells that were unmodified or infected with retroviruses expressing a control miR-30 stem insert or the miR-141-200c miRNA cluster within the miR-30 stem were stained with PCNA.

The miR-30 stem containing an shRNA against firefly luciferase was used as a negative control.

To evaluate the effect of miR-200 and Zeb2 on tumor formation and metastasis, we next engineered retroviruses encoding the miR-141-200c cluster mature miRNAs or control virus expressing firefly luciferase shRNA or Zeb2 shRNA within the miR-30 stem.

62

We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34).

These include 5 members of the broadly conserved let-7 family (mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7e-5p, and mmu-let-7f-5p); 2 members of the miR-30 family (mmu-miR-30a-5p and mmu-miR-30c-5p), and 3 members of the miR-34 family (mmu-miR-34a-5p, mmu-miR-34b-5p and mmu-miR-34c-5p).

63

In females, O [3] exposure induced the expression of miR-301b-3p (log fold change = 1.652), miR-694 (log fold change = 0.727), miR-669 h-3p (log fold change = 0.679), miR-384-5p (log fold change = 0.455), and miR-9-5p (log fold change = 0.378) and downregulated the expression of miR-30d-5p (log fold change = − 0.204) (Fig.   3).

64

Wu et al. found that expression of the miR-30 family was downregulated in mouse preosteoblast differentiation and further found that miR-30 targeted the important transcription factors SMAD1 and RUNX2 [9].

65

In this study, we constructed multi-hairpin amiRNAs based on miR-30 to target endogenous genes of GAPDH, eIF4E and DNA pol α to knockdown their expression more effectively.

amiRNAs based on modified human microRNA 30 (miR-30) could achieve more effective gene silencing than previous short-hairpin RNA (shRNA) [11, 13, 31].

66

Two of the above mentioned miRNAs (miR-30 and miR-133) were targeted by both aspirin and naproxen.

In fact, a couple of miRNAs (miR-27a and miR-133a), targeting inflammation and cell proliferation, had been found to be modulated by the same NSAID in A/J mice aged 10 weeks, whereas other miRNAs (miR-30, miR-101 and miR-344b) affecting later stages of pulmonary carcinogenesis were able to distinguish the mice according to the yield of both microadenomas and adenomas.

Most of the other miRNAs distinguishing the mice according to the yield of microadenomas (miR-30, miR-181b, miR-183, miR-301a, miR-350, miR-466a, and miR-466i) were also able to distinguish the mice according to the yield of adenomas.

67

There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study.

68

In these mice, all A1 paralogues expressed are constitutively targeted by a single shRNA embedded in the miR30 backbone, placed in the 3′UTR of the fluorescence marker Venus and expressed under control of the hematopoiesis specific Vav-gene promoter (VV-A1 mice).

69

In the present study, we investigated the alteration of miR-30e in SNpc by qRT-PCR and the results showed that the expression of miR-30e was downregulated gradually after MPTP injection, suggesting miR-30 might also have a role in the pathogenesis of PD.

For overexpression of miR-30e in BV-2 cells, the cells were transfected with miR-30 mimics or negative control miRNA using Lipofectamine 2000 according to the manufacturer’s protocol.

70

Notably, several large miRNA families (such as the miRNA-15, miRNA-30, and let-7 families) were upregulated in P10 cardiac ventricles, and miRNA-195 (a member of the miRNA-15 family) was shown to be the most highly upregulated miRNA.

71

mRNA targets that showed inversely correlated expression with miRNAs (Additional file 3) include previously validated miRNA/target pairs such as Mef2c with miR-223 [14], Bcl2 with miR-15 or miR-16 [38], Mybl2 with miR-29 or miR-30 family members [39], and Ezh2 with miR-26a [40].

72

The other miRNAs involved in regulation of CSE are miR-30 that directly inhibits CSE [47], and miR-22 that inhibits SP1 [49].

73

We first utilised these ecotropic MuLE lentiviruses expressing combinations of shRNA or shRNA-miR30 against Cdkn2a, Trp53, Tsc2 and Pten with or without expression of oncogenic Hras [G12V], oncogenic PIK3CA [H1047R] or Myc vectors to attempt to generate panels of genetically-engineered angiosarcoma cell lines by infecting a disease-relevant cell type, namely primary murine endothelial cells from the spleen (pMSECs).

74

Bouzraki et al. (30) suggested that deletion of Map4k4 ameliorated the TNF-α -induced decrease in glucose -induced insulin secretion in vitro, and Zhao et al. (31) suggested that Map4k4 is a target of miRNA-30d, which induces insulin gene expression in β cells.

Zhao X., Mohan R., Özcan S., and Tang X. (2012) MicroRNA-30d induces insulin transcription factor MafA and insulin production by targeting mitogen-activated protein 4 kinase 4 (MAP4K4) in pancreatic beta-cells.

75

For instance, miR-125b, miR-504 and miR-30 can target p53 and down-regulate p53 protein levels and function [24– 26].

76

This resulted in an increased expression of miR-503, miR-30-c2*, miR-183* and miR-198, with miR-503 being the most upregulated (Fig. 1c).

77

miR-29 and miR-30 regulate B-Myb expression during cellular senescence.

In agreement with other studies (Grillari et al., 2010; Kato et al., 2011; Martinez et al., 2011) we found a decrease in abundance of members of the family of let-7, miR-30, miR-17-92 cluster and its paralogs miR-106a-363 and miR-106b-25 in WT and 3x-Tg-AD aged mice.

These overlapping miRNAs include family members of let-7, miR-30, miR-17-92 cluster and its paralogs.

78

This includes miRNA families miR-30 (miR-30a, miR-30d, miR-30e, miR-30b, miR-30c, miR-30e*), miR-24 (miR-24, miR-24-2*), miR-26 (miR-26a, miR-26b), miR-29 (miR-29a, miR-29c), miR-34 (miR-34b-3p, miR-34c*) in Cluster 1 which has high expression in the adulthood stage, and miR-20 (miR-20a, miR-20b) in cluster 5 which has high expression in the early stages of lung organogenesis.

For example, there are 5 miRNA members in the miR-30 family that are involved in TGF Beta signaling pathway through the gene “Tgfbr1” and 5 miRNAs (miR-17a, 18a, 20a, 20b, 92a) in miR-17-92 cluster that are involved the same pathway through the gene Smad6.

79

CCR-14-2829 25977341 4. Qi F The miR-30 family inhibits pulmonary vascular hyperpermeability in the premetastatic phase by direct targeting of Skp2Clin.

80

This class of miRNAs, poorly expressed in mdx, was upregulated in exon-skipping -treated animals and included muscle specific (miR-1 and miR-133) and more ubiquitous (miR-29 and miR-30) miRNAs.

81

Interestingly, the miR-103-2 (16,537 CPM), miR-107 (2,068 CPM), miR-181 (6,627 CPM) and miR-30 (5,740 CPM) families have not previously been associated with the development of the brain, but were found to be highly expressed in our dataset.

MiR-181 plays a crucial role in modulating haematopoietic lineage differentiation [53] whereas miR-30 has been strongly implicated with kidney development and nephropathies [54].

82

Fluorouracil induces autophagy-related gastric carcinoma cell death through Beclin-1 upregulation by miR-30 suppression.

83

The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128].

84

A number of studies have shown that miRNAs, such as miR-34, miR-125, miR-200, miR-205, miR-328, and miR-30, were down-regulated and acted as tumor suppressors in breast cancer [16– 22].

85

Perhaps more relevant to our experimental mo del of a biliary disease (biliary atresia), only miR-30b/c, -200b, -204 and −320 have been reported to change their expression levels in cholangiocarcinoma tissues or cell lines, [10, 25- 28] with miR-30 family members increasing in lipopolysaccharide -induced NFκB activation in cholangiocytes and after Cryptosporidium parvum infection, and being required for hepatobiliary development [10, 25, 26].

86

Unlike the shared program described between developing cerebellum and MB, only three terms such as activator, DNA binding, and DNA metabolism, were shared between small cell lung cancer upregulated genes and coherent targets in developing lung, involving miR-30, miR-200a, and miR-9, respectively.

87

MEL cells were transfected with miR30 -based short-hairpin vectors targeting murine Fbxo7 or empty vector as described [15], or infected using MSCV -based vectors to express human Fbxo7 as described [9].

88

miR-142-3p was overexpressed in cells by transient transfection of pADC38, a pGIPZ (GE Dharmacon-Thermofisher, Erembodegem, Belgium) derivative that drives the expression of artificial miRNAs based on the backbone of miR30, from a RNA polymerase II promoter.

89

Interestingly, both miR-301a and several members of the miR-30 family, which are also commonly longer than 24 nt in our dataset (Table S10), target the mRNA for plasminogen activator inhibitor-1, a protein involved in the pathogenesis of cardiovascular disorders [43].

90

Analysis of the miRNA cDNA (using QuantiMiR kit) indicated that miR-196b along with miR-30D was upregulated in the presence of high glucose, whereas miR-375 level did not change significantly (Fig. 5F).

We detected miR-196, miR-30d and miR-375 in βTC6 cells using QuantiMir RT-PCR kit (Fig. 5A-B).

91

B. Correctly targeted CAGs-LSL-rtTA3 ESCs (Y1), were retargeted by recombinase mediated cassette exchange (RMCE) to introduce a TRE-GFP-miR30 (TGM) construct to the col1a1 recipient locus.

92

hsa-miR-30 and hsa-miR-181 are downregulated [58], and apoptosis is a key mechanism in AD [59].

According to the p-values, we observed that hsa-miR-181a is the best cluster (p-value: 0.0276); hsa-miR-30 is the best miRNA family (p-value: 2.91 × 10 [−3]); and apoptosis having 10 miRNAs is one of the best functions (p-value: 7.97 × 10 [−3]).

93

Ouzounova et al. [22] showed that the expression of miR-30a was reduced in breast cancer via comprehensively analyzing the miR-30 family targets.

94

We used TargetScan and miRanda database queries to obtain miRNAs, which had higher targeting combined with N4bp2, namely, miR-200, miR-429, miR-29 and miR-30.

95

miR-30a knockout reduced both the expression levels of miR-30a-3p and miR-30-5p for their complementary stem-loop structure in the presence of miR-30a precursor.

miR-30a is located on human chromosome 6q13, and is an important member of the miR-30 family.

96

For analysis of clonal expansion during epidermal reconstitution, we used pGIPZ -based lentiviral vectors (GE Dharmacon) expressing miR30 embedded shRNAs silencing YAP (Clone V3LHS_306099) or a non -targeting control shRNA (#RHS4346).

97

More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79].

Zaragosi LE Wdziekonski B Brigand KL Villageois P Mari B Waldmann R Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesisGenome Biol.

98

MicroRNA-30d-5p inhibits tumour cell proliferation and motility by directly targeting CCNE2 in non-small cell lung cancer.

99

Comparison of mouse ES and iPS cells identified several miRNAs that are expressed at significantly different levels in ES and iPS cells, and members of the let-7 and miR-30 families are more highly expressed in iPSCs than in ESCs (Fig. 5A).

100

We noted a commonality between all three groups (PR+BC, PR+BC/CRIZ, and PR+BC/TOP): miR 200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), miR-183/96/182 cluster, miR-30d-5p, and miR-191-5p were up-regulated, as compared to intact controls.

The miR-200 family was associated with brain metastases [84], and miR-30d-5p was implicated in medulloblastoma development [102].