sort by

285 publications mentioning hsa-mir-132 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-132. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 312
In agreement with these findings and the effect of miR-132 on AGO2 expression (Fig. 6B), we observed an increase in miR-221 and miR-146a expression in response to miR-132 inhibition in PMA-activated HDLECs (Fig. 7D), while miR-126 expression was unaffected. [score:9]
To verify that the effect of miR-132 on AGO2 expression in HDLECs was indeed through direct targeting of the AGO2 3′UTR region, we utilised a lentiviral construct expressing FLAG-tagged AGO2 but lacking its 3′UTR region (AGO2 [−UTR]). [score:8]
Interestingly, during endothelial cell activation, minimal over -expression of AGO2 or inhibition of miR-132 result in increased miR-221 and miR-146a expression, in agreement with the proposed miR-132 -mediated AGO2 regulation. [score:8]
Inhibition of miR-132 induction (Fig. 6A) resulted in statistically significant induction of AGO2 expression in PMA -treated HDLECs (24 h), an effect that was not observed in HDLECs transfected with control miRNA inhibitors (Fig. 6B and C). [score:7]
Transfection of synthetic miR-132 mimics into HDLECs suppressed AGO2 protein expression to the same extent as the known miR-132 targets EP300 and RASA1 (Fig. 3B), and also resulted in a drop in AGO2 mRNA (Fig. 3C). [score:7]
Here we demonstrate that miR-132 can suppress expression of AGO2 through a canonical miRNA -mediated silencing mechanism, and that this interaction fine-tunes AGO2 expression in activated primary endothelial cells. [score:7]
To test the functional significance of miR-132 -mediated suppression of AGO2 in HDLECs, we took advantage of the fact that loss of AGO2 expression results in decreased miRNA expression (Schmitter et al., 2006, Morita et al., 2007). [score:7]
miR-132 over -expression suppresses AGO2 expression. [score:7]
The decrease in mature miR-126 levels was due to a reduction in the mature to primary miRNA ratio (Fig. 4D), suggesting that post-transcriptional regulation of miR-126 contributes to the reduction in its levels in miR-132-over -expressing HDLECs, being consistent with the effect of miR-132 on AGO2 expression. [score:6]
Over -expression of miR-132 in HDLECs transduced with control lentivirus (pSIN) resulted in statistically significant down-regulation of miR-126 and miR-221. [score:6]
Although the expression of miR-132 is low under basal conditions in HDLECs (approximately 50–100 copies per cell), endothelial activation leads to an early upregulation of miR-132 required for endothelial cell proliferation and angiogenesis (Anand et al., 2010, Lagos et al., 2010). [score:6]
Similarly, miR-132 -mediated AGO2 suppression resulted in down-regulation of miR-126 and miR-221 (Fig. 4C). [score:6]
In endothelial cells, upregulation of miR-132 positively controls proliferation, angiogenesis and tumour growth in response to vascular endothelial growth factor A (VEGF-A) by suppressing p120RasGap (RASA1) (Anand et al., 2010). [score:6]
Having shown that miR-132 can directly interact with the predicted miR-132 -binding site in the AGO2 3′UTR, we studied the effect of miR-132 over -expression on AGO2 expression. [score:6]
3.2Having shown that miR-132 can directly interact with the predicted miR-132 -binding site in the AGO2 3′UTR, we studied the effect of miR-132 over -expression on AGO2 expression. [score:6]
We speculate that the propensity of miR-132 to form negative feedback loops with its mRNA targets is essential for its activity -dependent expression and function both outside and within the brain. [score:5]
3.1Gene ontology analysis of predicted miR-132 targets, using the EIMMO prediction analysis tool (Hausser et al., 2009), indicated that RNA -binding proteins (RBPs) were over-represented amongst miR-132 predicted targets (Supplementary Table 1). [score:5]
Therefore, we exploited the PMA-inducible miR-132 expression in vitro system in HDLECs to determine the effect of endogenous miR-132 on AGO2 expression. [score:5]
This was further supported by the fact that physiologically relevant over -expression of AGO2 [−UTR] in HDLECs transfected with control or miR-132 mimics partially restored miR-126 and miR-221 expression. [score:5]
This level of over -expression of AGO2 [−UTR] in HDLECs resulted in a modest increase in expression of miR-126, miR-132, miR-146a, and miR-221, the effect being more prominent for the latter two miRNAs (Fig. 7B). [score:5]
The suppression of AGO2 in HDLECs was miR-132-dose -dependent with maximum suppression observed when using 15–25 nM concentration (Fig. 3D; Supplementary Fig. 2). [score:5]
We over-expressed AGO2 [−UTR] during PMA-activation of HDLECs to a similar level (Fig. 7A) as observed during miR-132 inhibition. [score:5]
Gene ontology analysis of predicted miR-132 targets, using the EIMMO prediction analysis tool (Hausser et al., 2009), indicated that RNA -binding proteins (RBPs) were over-represented amongst miR-132 predicted targets (Supplementary Table 1). [score:5]
miR-132 and miR-212 have the same seed sequence and potential targets, although miR-132 is the preferentially expressed miRNA from the cluster (Lagos et al., 2010). [score:5]
Of note, miR-132 has been previously shown to participate in similar negative feedback loops maintaining homeostatic levels of EP300 in endothelial and immune cells (Lagos et al., 2010) and MeCP2 expression in neurons, where the baseline expression of miR-132 is higher but also inducible (Klein et al., 2007). [score:5]
The siRNAs (OnTargetPlus SmartPool from Thermo Scientific), miRNA mimics (miRIDIAN from Thermo Scientific) were prepared at 25 nM concentration and Locked Nucleic Acid (LNA) -inhibitors of miR-132 (Exiqon) were prepared at 50 nM concentration. [score:5]
Interestingly, EP300 is a co-transcriptional activator that is required for miR-132 expression, which may contribute to the transient expression of this miRNA, as seen in endothelial cells. [score:5]
Validated miR-132 targets are involved in chromatin modifications (e. g. MeCP2, EP300, Jarid1a, SIRT1) (Alvarez-Saavedra et al., 2011, Yamakuchi, 2012) transcription (e. g. EP300) (Hasan et al., 2001), and mRNA splicing (e. g. PTBP2) (Smith et al., 2011), indicating a functional clustering of miR-132 targets around modulators of the lifecycle of a mammalian mRNA. [score:5]
As the changes in AGO2 expression following and miR-132 inhibition were modest, we tested whether such effects could affect AGO2 function. [score:5]
Although basal miR-132 expression is low in non-neuronal cells, during cellular activation its expression increases to functionally relevant levels as demonstrated by its role in modulating the innate immune response (Lagos et al., 2010) and angiogenesis (Anand et al., 2010). [score:5]
Inhibition of endogenous miR-132 leads to increased AGO2 expression. [score:5]
This provides support for a mo del according to which post-transcriptional regulation of miR-132 by AGO2 is coupled to miR-132 mediated regulation of AGO2, maintaining optimal miR-132 and AGO2 expression during haematopoietic or endothelial cell activation. [score:5]
Consistent with CREB -mediated transcriptional activation, pri-miR-132 was up regulated during the first few hours post-PMA treatment and returned to near-baseline expression level by 24 h. However, mature miR-132 levels showed only a modest decrease over the time-course following the initial induction, suggesting it was more stable than pri-miR-132 in these conditions. [score:4]
A triple consecutive base pair mutation introduced at the start of the seed site of the miR-132 binding in the AGO2 3′UTR reversed the suppression of luciferase activity by miR-132 mimic. [score:4]
Overall, our findings reveal a novel mechanism regulating AGO2 expression and provide mechanistic insight into the function of miR-132 in human primary endothelial cells. [score:4]
Overall, these results further supported that endogenous miR-132 can regulate AGO2 expression in activated HDLECs. [score:4]
Here, we identify an autoregulatory feedback mechanism that involves AGO2 suppression by miR-132. [score:4]
However, our results suggest that regulation of AGO2 due to miR-132 induction is a failsafe mechanism that ensures maintained suppression of miR-221, and limits the extent of the anti-inflammatory activity miR-146a (Fig. 7E). [score:4]
We should note that the magnitude of the effect of miR-132 inhibition on miR-221 and miR-146a indicates that other factors also contribute to the regulation of these miRNAs in activated HDLECs. [score:4]
Alvarez-Saavedra M. Antoun G. Yanagiya A. Oliva-Hernandez R. Cornejo-Palma D. Perez-Iratxeta C. Sonenberg N. Cheng H. -Y. M. miRNA-132 orchestrates chromatin remo deling and translational control of the circadian clockHum. [score:3]
PMA induces miR-132 expression in HDLECs. [score:3]
Our findings indicate that in PMA -treated HDLECs mature miR-132 is substantially longer-lived than its primary transcript, which might provide one possible explanation for the need for multiple negative feedback loops controlling miR-132 expression and function. [score:3]
These findings show that miR-132 -mediated regulation of AGO2 is sufficient to negatively impact AGO2 siRNA and miRNA -mediated silencing functions, thus further defining the importance of this regulatory feedback mechanism. [score:3]
miR-132 over -expression affects AGO2 function. [score:3]
We found that AGO2 [−UTR] expression in HDLECs was not affected by miR-132 mimics (indicated by anti-FLAG M2, Fig. 3E). [score:3]
miR-132 expression is transcriptionally controlled by CREB activation (Lagos et al., 2010, Remenyi et al., 2010, Vo et al., 2005). [score:3]
We substantially expand this concept to cover mRNA silencing, by revealing that miR-132 can suppress AGO2. [score:3]
Importantly, we find that miR-132 is involved in modulating the availability of AGO2 to perform its function in siRNA and miRNA -mediated silencing and in stabilising miRNA expression (Winter and Diederichs, 2011). [score:3]
We should note that endogenous miR-132 expression in HeLa cells is at similarly low levels to those observed in HDLEC. [score:3]
We propose that the potential of miR-132 in coordinating multiple molecular processes that determine gene expression can provide crucial clues towards understanding the complex and context-specific role of this miRNA in neurons and haematopoietic and vascular cells. [score:3]
The expression of primary and mature miR-132 was measured at 6 h and 24 h post-PMA treatment (Fig. 5B) and a more detailed time-course of expression was performed over 48 h (Fig. 5C). [score:3]
We show that treatment of HDLECs with PMA results in an induction of the pro-angiogenic miR-132, and a decrease in the anti-angiogenic miR-221 expression, in agreement with the previously reported pro-angiogenic activity of PMA (Montesano and Orci, 1985). [score:3]
3.5We have previously shown that miR-132 expression in HDLECs becomes functionally relevant only when induced (Lagos et al., 2010). [score:3]
Over -expression of miR-132 and miR-212 in HDLECs resulted in a drop in AGO2 mRNA (Fig. 1A). [score:3]
The effect of miR-132 on the AGO2 3′UTR was similar to that on the EP300 3′UTR, a known miR-132 target (Lagos et al., 2010). [score:3]
Similarly, in HDLECs the observed decrease in AGO2 mRNA levels following over -expression of the miR-132/miR-212 cluster (Fig. 1A) correlated with decreased AGO2 protein levels (Fig. 3A). [score:3]
We utilised a lentiviral construct containing the miR-132/miR-212 locus (Lagos et al., 2010) to screen for the effect of miR-132 on mRNA levels of 13 RBPs that were predicted miR-132 targets by multiple algorithms (Supplementary Table 2). [score:3]
As expected, miR-132 mimics in AGO2 [−UTR] over -expressing HDLECs resulted in a drop in endogenous AGO2, shown by a decrease in total AGO2 levels. [score:3]
or miR-132 inhibition did not affect AGO2 mRNA levels (Fig. 6D). [score:3]
The activation of CREB led to an induction of mature miR-132 expression over a range of PMA concentrations (Supplementary Fig. 3B). [score:3]
We have previously shown that miR-132 expression in HDLECs becomes functionally relevant only when induced (Lagos et al., 2010). [score:3]
miR-132 has been implicated in neuronal function and development (Remenyi et al., 2010, Wayman et al., 2008), circadian rhythm control (Alvarez-Saavedra et al., 2011), angiogenesis (Anand et al., 2010), and regulation of innate immune responses (Lagos et al., 2010, Shaked et al., 2009). [score:3]
The major implication of these findings is that a miR-132 can potentially act as a concurrent regulator of transcription, splicing, and silencing in the cell. [score:2]
Next, we tested whether the observed level of AGO2 regulation by miR-132 was functionally relevant. [score:2]
Mutations were introduced at the AGO2 3′UTR at the miR-132 binding site (WT: 5′-GUACAAUCCUUUUU CACUGUUU-3′; Mut: 5′-GUACAAUCCUUUUU CACUAAAU-3′). [score:2]
3.3Next, we tested whether the observed level of AGO2 regulation by miR-132 was functionally relevant. [score:2]
In our study, we focussed on endothelial cells as miR-132 has been shown to regulate angiogenic and inflammatory responses in these cells. [score:2]
During viral infection of human cells in vitro, miR-132 acts as a negative regulator of inflammation in endothelial cells and macrophages by modulating EP300 (Lagos et al., 2010). [score:2]
The introduction of miR-132 mimic into HeLa cells led to a drop in luciferase signal for a reporter containing the AGO2 3′UTR (Fig. 2A), compared to the non -targeting control (NTC). [score:2]
We identified a potential miR-132 binding site in the AGO2 3′UTR. [score:1]
miR-132 interacts with the AGO2 3′UTR. [score:1]
Transfection of miR-132 synthetic mimics into HeLa cells resulted in a decrease in AGO2 protein and mRNA levels (Fig. 2B and C). [score:1]
GAPDH was used as a loading control for AGO2, pri-miR-126 and pri-miR-132. [score:1]
The effect was abolished when using a construct where the seed sequence of both miR-132 and miR-212 is mutated (Fig. 1A). [score:1]
Lymphatic endothelial cells microRNA RNA -binding proteins AGO2 miR-132 The mature miR-132 (miR-132-3p) is derived from the primary miR-132/miR-212 cluster, found in the intergenic region of chromosome 17p13.3. [score:1]
In contrast, transfection of miR-132 mimics in HDLECs transduced with AGO2 lentivirus did not significantly affect miR-126 and miR-221 levels (Fig. 4E). [score:1]
We observed that the introduction of miR-132 mimics or siAGO2 resulted in derepression of both siRNA and miRNA reporter constructs, as indicated by derepression of the Rluc activity (Fig. 4A). [score:1]
It would be interesting to further investigate the relevance of this intricate miRNA network in in vivo mo dels of angiogenesis and in cells with high basal miR-132 expression, such as neurons. [score:1]
The miR-132/miR-212 cluster or AGO2-UTR were amplified from genomic DNA or cDNA respectively and subcloned into the pSIN lentiviral vector using the NotI and BamHI restriction enzymes. [score:1]
2.3The miR-132/miR-212 cluster or AGO2-UTR were amplified from genomic DNA or cDNA respectively and subcloned into the pSIN lentiviral vector using the NotI and BamHI restriction enzymes. [score:1]
AGO2 and EP300 UTR constructs were transfected for 24 h after the 24 h miR-132 mimics (20 nM) or NTC transfection. [score:1]
The most potent and sustained induction of miR-132 was obtained following treatment with 25 nM PMA and this concentration was used for all further experiments. [score:1]
The transcription of miR-132/miR-212 cluster is dependent on cAMP response element -binding (CREB) protein phosphorylation (Vo et al., 2005), which is inducible in an ERK-1/2 and MSK-1/2 dependent manner (Remenyi et al., 2010). [score:1]
[1 to 20 of 83 sentences]
2
[+] score: 274
In both mice and humans, fully conserved miRNAs, such as miR-132, might regulate different targets, or present differential preference for suppressing shared targets, for several reasons: first, alternative transcript variants of a given gene may contain different 3′-untranslated regions (3′-UTR domains), which could either include or exclude MREs (Zhu et al. 2007) or be differently susceptible to miRNA regulation (Mishra et al. 2017). [score:11]
This analysis revealed a complex pattern of reciprocal interactions between the targets themselves; for example, the EP300 and RB1, validated targets of miR-132, and its FoxO3 putative target emerged as interacting with SIRT1, another validated target (Fig.   4). [score:9]
Specifically, transgenic overexpression of miR-132 increases dendritic spine density while causing significant deficits in novel object recognition (Hansen et al. 2010) via suppression of a specific miR-132 target, the p250 GTPase-activating protein (P250GAP) (Wayman et al. 2008); also, miR-132 controls dendritic plasticity by modulating the expression of the stress-sensitive transcription factor methyl CpG -binding protein 2 (MECP2) (Fyffe et al. 2008; Klein et al. 2007) known for its role in the Rett syndrome (Amir et al. 1999). [score:9]
We found that the validated target RASA1 and the putative target Paip2 were significantly downregulated upon increase in miR-132-3p levels (n = 3, fold change = 0.62, 0.74, 724 respectively; Student’s t test: p < 0.05). [score:8]
Worth mentioning is the case of hsa-miR-132-3p and hsa-miR-212-3p that exhibit similar mature sequences and share the same seed region, yet only few targets were demonstrated to be targeted by both of them, and each of these miRNAs may also repress specific targets (Wanet et al. 2012). [score:7]
To find its predicted targets, we uploaded the human miR-132-3p to Diana microT-CDS (Paraskevopoulou et al. 2013; Reczko et al. 2012), with a default threshold of 0.7; and identified those targets that were co-predicted with both Diana microT-CDS and TargetScan (Agarwal et al. 2015). [score:7]
”To further support the expected effect of miR-132-3p on its validated and putative targets, we overexpressed miR-132 in the HEK 293T human cell line and examined selected transcripts for their expression level. [score:7]
” To further support the expected effect of miR-132-3p on its validated and putative targets, we overexpressed miR-132 in the HEK 293T human cell line and examined selected transcripts for their expression level. [score:7]
Interactions between the targets and putative targets themselves are indicated with dashed-lines (Color figure online) We examined the pathways affected by miR-132-3p both in human and mouse through its targets and the proteins they interact with. [score:7]
These interactions further suggest that miR-132-3p targets may be regulated both in a direct and indirect fashion, and that this regulation could be stress-affected. [score:7]
MiR-132 is overexpressed in bacterial lipopolysaccharide (LPS)-stimulated primary human macrophages as well as in LPS -treated mice, where it attenuates inflammation by suppressing its stress-related target AChE (Shaked et al. 2009). [score:6]
Consequently, mice expressing an AChE transgene devoid of the miR-132 binding site develops high basal miR-132 expression levels, yet are incapable of controlling stress (Shaltiel et al. 2013) or inflammation (Shaked et al. 2009) via ACh. [score:5]
Further, human patients with inflammatory bowel disease exhibit increased levels of miR-132-3p in intestinal tissue biopsies, with corresponding decreases in circulatory AChE activity, relative to healthy controls (Maharshak et al. 2013), suggesting miR-132 involvement in IBD alongside with its stress-related target AChE. [score:5]
Surprisingly, the fraction of shared validated targets of miR-132-3p in the two species is less than a half, although miR-132 is fully conserved and 56–88% of the targets present a conserved MRE (validated and predicted MREs, respectively). [score:5]
Compatible with the overlapping elevation of miR-132 in anxiety and metabolic impairments, our enrichment analysis revealed several metabolic disorders, such as non-alcoholic fatty liver disease (NAFLD, FDR = 2.8E−04), inflammatory bowel disease (IBD, FDR = 1.4E−02), and Type II diabetes mellitus (FDR = 8.5E−05), alongside with metabolic-related pathways, such as the Insulin signaling pathway (FDR = 5.3E−09). [score:5]
This figure was designed using the Vienna RNAfold webserver based on minimum free energy prediction (Color figure online) To gain an insight into potentially shared targets of murine and human miR-132-3p, we searched for its validated human and murine targets in published data and in online bioinformatics tools such as miRTarBase (Chou et al. 2015) and explored the literature for their method of validation. [score:5]
miRNA-132 Stress miRNA Pathway analysis Cholinergic system MicroRNAs (miRNAs) are short, approximately 20–25 nucleotides long single-stranded RNA molecules that bind to complementary sequences in the 3′-untranslated regions (3′-UTR) of target mRNAs (Lai 2002), referred to as miRNA response elements (MREs). [score:5]
Validated and putative miR-132-3p targets in human were then submitted to String (Szklarczyk et al. 2014) with the following parameters: organism—Homo sapiens; prediction methods—Neighborhood, Gene Fusion, Co-occurrence, Co -expression, Experiments, Databases (text mining was excluded); required confidence (score)—highest (0.900). [score:5]
Validating the functional relevance of this interaction, we have recently shown that mouse mo dels of hepatic steatosis or non-alcoholic steatohepatitis (NASH) display dramatic increases in liver miR-132 levels and corresponding reduction in selected miR-132 targets, whereas antisense oligonucleotide -mediated miR-132 silencing increases the levels of its targets and consequently reduces the steatotic phenotype (Hanin et al. 2017). [score:5]
This analysis yielded 19 mRNA transcripts as validated targets of human miR-132-3p (TJAP1, CRK, TLN2, RFX4, RB1, SOX5, ZEB2, CDKN1A, SIRT1, IRAK4, FoxO1, STAT4, SOX4, NR4A2, AChE, EP300, RASA1, HBEGF, and MECP2) (Fig.   2a; Table  1), and 17 as validated targets of murine miR-132-3p (FoxO3, Pten, Paip2, Lrrfip1, Btg2, Cacnb2, Ptbp2, P250GAP, Kdm5a, Mmp9, Cyp2e1, NR4A2, AChE, EP300, RASA1, HBEGF, and MECP2) (Fig.   2a; Table  2), 6 of which were shared between both species. [score:5]
Those non-validated transcripts were further included in the analysis, as they have a high potential for being viable targets of miR-132-3p, and were hence referred to as “putative targets. [score:5]
To compare the impact of miR-132 regulation in mice and humans, and to explore its implications in stressful situations, we examined both the conservation levels of miR-132-3p targets, and the potential of their interaction with other proteins and the pathways involved in mice and humans. [score:4]
Notably, the expression of miR-132 is impaired in Alzheimer’s disease (AD) brains (Lau et al. 2013; Soreq 2015), while Mmp9 levels were shown to be elevated in the plasma of AD patients as compared to controls (Lorenzl et al. 2003). [score:4]
The miR-132 predicted binding sites in its target transcripts show consistently lower conservational levels compared to miR-132-3p itself, corresponding to the global phenomenon in which mammalian, and especially primate brain-expressed miRNA genes are evolutionarily more conserved than their predicted binding sites (Barbash et al. 2014). [score:4]
Predictably, some of the targets do not contain an MRE for miR-132-3p in one or more of their 3′-transcript variants, indicating alternative splicing -dependent regulation. [score:4]
Two transcription factors control the miR-132 locus: the cAMP-response element binding protein (CREB), indicating up-regulation under elevated Ca [++]; and the Repressor Element 1 silencing transcription factor/neuron-restrictive silencer factor (REST/NRSF), known to be modulated under aging (Lu et al. 2014) and in AD (González-Castañeda et al. 2013; Lu et al. 2014; Orta-Salazar et al. 2014). [score:4]
This finding is supported by experimental evidence, where introduction of miR-132 into primary cortical neurons decreased MECP2 protein levels, while its introduction into L6 muscle cells, which express the shorter MECP2 transcript, did not reduce MECP2 levels (Klein et al. 2007), presenting heterogeneous susceptibility of MECP2 to miR-132 regulation as a result of alternative polyadenylation, similarly to the case of AChE (Mishra et al. 2017). [score:4]
Further, miR-132 is required for the dendritic growth and arborization of newborn neurons in the adult mouse hippocampus (Magill et al. 2010) and regulates structural plasticity of dendritic spines in the mouse through its target matrix metalloproteinase 9 (Mmp9) (Jasińska et al. 2015). [score:4]
Moreover, some proteins, such as Tumor Protein P53 (TP53) and Ubiquitin C (UBC), interact with more than one target of miR-132-3p (Fig.   4). [score:3]
One subtype of neurotrophin, BDNF (brain-derived neurotrophic factor), increases miR-132 expression upon its administration to cultured primary cortical mouse neurons (Remenyi et al. 2010). [score:3]
UBC, a stress-inducible gene (Figueiredo-Pereira et al. 1997; Tsirigotis et al. 2001), binds the miR-132-3p targets SIRT1, FoxO3, PTEN, PAIP2, RB1, and CDKN1A. [score:3]
miR-132 Overexpression. [score:3]
a Venn diagram of validated miR-132-3p targets in mice and humans. [score:3]
Identifying the Genomic Location and Structure of miR-132 and Its Predicted Targets. [score:3]
Network presentation of miR-132, its targets, and their interactors was modified from Cytoscape tool (Shannon et al. 2003). [score:3]
AChE, a shared validated target of miR-132-3p in human and mouse, is responsible, together with the homologous enzyme butyrylcholinesterase (BChE), for terminating cholinergic signaling by rapid hydrolysis of ACh in the synaptic cleft (Soreq 2015). [score:3]
Fig.  2Validated and predicted miR-132-3p targets in mice and humans. [score:3]
Human and Murine miR-132-3p Share 6 Validated Targets. [score:3]
GnRH is known to induce the expression of miR-132 in mouse pituitary gonadotroph cells. [score:3]
Interestingly, one REST and several CREB binding site controllers of miR-132 transcription appear in all mammals, suggesting an evolutionarily conserved involvement of CREB and REST as controllers of miR-132 expression (Remenyi et al. 2010; Wanet et al. 2012; Wei et al. 2013). [score:3]
We found that the MRE for miR-132-3p is present only in the long variant, which is expressed predominantly in the brain. [score:3]
Fig.  3Human MECP2 3′-UTR The MREs for miR-483-5p (green) and miR-132-3p (red) and their locations in the 3′-UTR of MECP2 are marked (Color figure online) To predict miR-132-3p-regulated pathways, we extended our dataset to include proteins which could potentially be affected by miR-132-3p in an indirect manner. [score:3]
b Venn diagram of validated and predicted targets of miR-132-3p in human (not to scale). [score:3]
We found that human and murine share 6 validated targets, and that 9 additional transcripts contain a conserved MRE for miR-132-3p. [score:3]
Both validated and putative miR-132-3p targets in human and mouse, and the proteins they interact with were pursued. [score:3]
Targets without miR-132-3p MRE are marked in black. [score:3]
Predicting that other targets have not yet been validated, we further searched for transcripts which are validated in murine but not in human; yet share MREs for miR-132-3p in their 3′-compete with each other. [score:3]
MiR-132 is also a major regulator of cholinergic signaling (Meerson et al. 2010; Ponomarev et al. 2011; Shaltiel et al. 2013), which is both modulated under stressful insults and subject to complex miRNA regulation (Soreq 2015). [score:3]
A schematic representation of the interactions between miR-132-3p (pink), its validated (yellow), or putative (green) target genes and the proteins they interact with (blue). [score:3]
At the transcript level, surface plasmon resonance analysis showed that miR-132 selectively targets the soluble splice variant of the acetylcholine hydrolyzing enzyme AChE-R (Mishra et al. 2017). [score:3]
Thus, both direct and secondary processes may jointly lead to miR-132-3p network interactions. [score:2]
Specifically, exposing mice to predator scent induces long-lasting hippocampal elevation of miR-132, accompanied by reduced AChE activity (Shaltiel et al. 2013; Zimmerman et al. 2012) as well as by epigenetic regulation via histone deacetylase 4 (Sailaja et al. 2012). [score:2]
We selected for our current study to focus on miR-132, the stress regulatory capacities of which have been studied for over a decade, especially in the brain, and its many roles were extensively explored using transgenic in vivo mo dels, among other research systems (Edbauer et al. 2010; Jimenez-Mateos et al. 2011; Luikart et al. 2011; Mellios et al. 2011; Nu delman et al. 2010). [score:2]
Taken together, these studies demonstrate inter-related stress/inflammation/neurodevelopment links for miR-132 but failed to identify any evolutionary modifications in any of those, excluding an option of primate and/or human-specific roles for this context. [score:2]
The role of miR-132 in the cholinergic system was demonstrated in numerous studies (Meerson et al. 2010; Ponomarev et al. 2011; Shaked et al. 2009; Shaltiel et al. 2013), compatible with its regulatory effect on synaptic transmission (Remenyi et al. 2013). [score:2]
To examine a possible interaction between miR-132-3p and miR-483-5p regulation on MECP2, we checked the MREs of both miR-132-3p and miR-483-5p in the MECP2 3′-UTR, and found that they are distant enough to ensure that they are unlikely to compete with each other (the 3′-UTR sequence and MREs are presented in Fig.   3). [score:2]
Searching for differences between the regulation of miR-132-3p in man and mice failed to identify any significant differences. [score:2]
Likewise, 16 of the tested genes in the GnRH (Gonadotropin-Releasing Hormone) signaling pathway were found to be related to miR-132-3p regulation (Online Resource 1, FDR = 3.9E−05). [score:2]
For each selected pathway, the numbers (out of 247 genes), percentage of involved genes, and FDR are shown Yet more specifically, our analysis re-confirmed miR-132′s involvement in cholinergic synapses (FDR = 9.6E−05). [score:1]
Repressive effects of miR-132 on the 3′-UTR of SIRT1 were observed in HEK293T cells (Zhou et al. 2012) and in the liver (Hanin et al. 2017). [score:1]
Murine and Human miR-132 Genes Share Key Properties. [score:1]
miR-132 3p and 5p are indicated in bold. [score:1]
Another well-studied context of miR-132 is its activity in the immune system, known to be functionally involved in psychological stress responses (Mehta et al. 2015; Molnár et al. 2012; Taganov et al. 2006). [score:1]
A prominent example is the immune system, demonstrated by the predicted involvement of miR-132-3p in T cell and B cell receptor signaling pathways, chemokine signaling pathway, Leukocyte transendothelial migration, and natural killer cell -mediated cytotoxicity (FDR = 4.8E−14, 5.4E−09, 5.2E−12, 5.6E−06, 3.7E−04, respectively), which is compatible with the potentiation by miR-132 of the cholinergic blockade of inflammation (Mishra et al. 2017; Shaked et al. 2009). [score:1]
We performed numerous tests in search for potential primate- and/or human-specific interactions of miR-132-3p. [score:1]
The metabolic and stress links of miR-132-3p thus point at multiple ailments as stress -associated. [score:1]
Figure  1a-d presents these shared features for the genomic origin and structure of miR-132 in mice and humans. [score:1]
Those studies showed involvement of miR-132 in neuronal functions, including process extension and neuronal activity. [score:1]
MiR-132 Presents a Complex Regulation Network. [score:1]
Fig.  4Human miR-132 interaction network. [score:1]
In this context, miR-132 is especially suitable, as its interaction with AChE had been shown to control anxiety. [score:1]
Overall, these studies present miR-132′s involvement in overcoming stress -induced damage to protect cognitive function via its cholinergic control. [score:1]
We extracted the mature and pre-miRNA sequences of miR-132 in different organisms from miRBase (Kozomara and Griffiths-Jones 2014), and used the Vertebrate Multiz Alignment & Conservation (100 Species) track in the UCSC genome browser (Kent et al. 2002) and the T-Coffee multiple alignment tool (Notredame et al. 2000) to test for miR-132 conservation. [score:1]
b Stem-loop sequence of miR-132 in different organisms. [score:1]
For each selected pathway, the numbers (out of 247 genes), percentage of involved genes, and FDR are shown Yet more specifically, our analysis re-confirmed miR-132′s involvement in cholinergic synapses (FDR = 9.6E−05). [score:1]
Furthermore, the genomic site harboring miR-132 displays high conservation levels across vertebrates, mammals, and primates (Wanet et al. 2012). [score:1]
c, d Sequence and predicted stem-loop structure of human (c) and mouse (d) pre-miR-132. [score:1]
Thus, miR-132 serves as a most appropriate test case for exploring rodent-primate links of the stress-related mode of miRNA functioning. [score:1]
We found that 32 of our tested genes were enriched in the neurotrophin signaling pathway (FDR = 7.7E−19), indicating a potential involvement of miR-132 in both murine and human neurotrophin signaling. [score:1]
Inversely, mice treated with anti-miR-132 oligonucleotide showed elevated activity of the synaptic variant AChE-S, which may suppress the stress-characteristic hyper-activation of synaptic neurotransmission (Mishra et al. 2017). [score:1]
MiR-132 is a highly conserved miRNA that originates from intergenic regions on human chromosome 17 and mouse chromosome 11. [score:1]
In a mouse mo del of psychological stress, miR-132 was elevated in the hippocampus, accompanied by and associated with reduced AChE activity, which predictably potentiates ACh signaling, and exacerbates anxiety (Meshorer and Soreq 2006; Shaltiel et al. 2013; Soreq 2015). [score:1]
a Human miR-132′s genomic location, conservation, and promoter-related H3K4Me3 histone modification, adapted from the UCSC genome browser. [score:1]
A related cell specific example was shown for miR-132 and SIRT1 interaction. [score:1]
Also, contextual fear conditioning increases pri-miR-132 levels in the hippocampus of chronically stressed rats (Meerson et al. 2010), as well as in the murine hippocampus (Ponomarev et al. 2011). [score:1]
Taken together, these findings could indicate miR-132 involvement in several fundamental processes in the cell by affecting key proteins, such as TP53 and UBC. [score:1]
In addition, intriguing non-cancerous pathways were found to be enriched with genes of interest (Table  3), and some of those pathways showed experimentally validated relation to miR-132 in mouse. [score:1]
[1 to 20 of 87 sentences]
3
[+] score: 239
While the correlations identified here by us further support prior miR-132/212 target studies, they do not firmly establish causality between miR-132/212 induction and target repression in bladder outlet obstruction. [score:5]
0116784.g007 Figure 7An initial dosing experiment performed in duplicate using human detrusor smooth muscle cells from one individual shows a reciprocal effect of miR-132 mimic and inhibitor on MeCP2 expression (A). [score:5]
An initial dosing experiment performed in duplicate using human detrusor smooth muscle cells from one individual shows a reciprocal effect of miR-132 mimic and inhibitor on MeCP2 expression (A). [score:5]
Transfection of miR-132/212 mimics and inhibitors affect MeCP2 expression and cell number in vitro. [score:5]
In fact, when expression levels on microrrays are compared, miR-132 is the most highly upregulated miRNA in this urological condition. [score:5]
In view of the weaknesses with target prediction we focused our analyses on miR-132/212 targets that have been previously validated. [score:5]
The availability of a comprehensive survey of miRNA and mRNA expression in bladder outlet obstruction ([4], GEO: GSE47080) allowed us to correlate miR-132/212 levels with target mRNAs. [score:5]
In order to examine in which tissue compartment miR-132 and miR-212 are expressed, we used control and smooth muscle-specific Dicer knockout (KO) mice. [score:4]
Others have demonstrated modest NFAT activation following partial bladder outlet obstruction [33], further arguing that it may be worthwhile to examine the effect of miR-132/212 knockout and overexpression on the response of the urinary bladder to outlet obstruction. [score:4]
One target of miR-132/212 is MeCP2 [10], a methyl CpG -binding protein that controls transcription and that is mutated in the developmental disorder Rett syndrome [11]. [score:4]
Prior work has shown that miR-132 and miR-212 regulate cardiomyocyte hypertrophy by targeting FoxO3 and calcineurin-A/NFAT signaling [14]. [score:4]
MiR-132 and miR-212 are expressed in neurons where they regulate excitability [6], and a body of literature has demonstrated roles of these miRNAs in synaptic plasticity [7], [8], [9]. [score:4]
Intriguingly, expression of miR-132/212 is also regulated by DNA methylation and MeCP2 [17]. [score:4]
In a dosing experiment we found reciprocal changes in expression of the transcriptional regulator MeCP2 following transfection of miR-132 mimic and antimir (Fig. 7A). [score:4]
It was shown that angiotensin II upregulates miR-132/212 in arterial smooth muscle leading to reduction of phosphatase and tensin homolog (PTEN) [19]. [score:4]
It is therefore reasonable to conclude that smooth muscle cells contribute to the increase in miR-132/212 in outlet obstruction even if basal expression in these cells may be low as suggested by our experiments on Dicer knockout mice. [score:4]
Successful transfection of miR-132/212 mimics and inhibitors was confirmed using real-time quantitative PCR. [score:3]
Correlations between miR-132/212 and target mRNAs. [score:3]
Reduced levels of the miR-132/212 targets Ache, MeCp2 and Pnkd in the bladder following outlet obstruction. [score:3]
For example, induction of miR-132 in lipopolysaccharide-challenged splenocytes was shown to repress acetylcholine esterase (Ache) leading to cholinergic suppression of inflammation [12]. [score:3]
MiR-132 was also upregulated by arterial balloon injury [21], and this was replicated by PDGF in cell culture. [score:3]
Together, these findings argue that miR-132/212 in the control bladder is expressed primarily by cells other than smooth muscle cells, or, alternatively, that these miRNAs are comparatively stable. [score:3]
Recent experiments have established an impact of the dioxin receptor (Ahr) on miR-132/212 expression in T cells [18]. [score:3]
Prior evidence, in other cell types, for involvement of Creb1 and Ahr in miR-132/212 expression exists so we initially focused on these. [score:3]
Here, we demonstrate induction of these miRNAs in growth-stimulated human detrusor cells and find that previously validated targets of miR-132/212 change in the predicted manner on miR-132/212 induction. [score:3]
MiR-132 and miR-212 have identical seed sequences and are therefore predicted to target an overlapping set of mRNAs. [score:3]
To the best of our knowledge, our studies are the first to document induction of miR-132/212 and attendant changes in target mRNA levels in the detrusor following outlet obstruction. [score:3]
Thus, while the targets studied here have binding sites for miR-132/212 and, in the majority of cases, have been stringently validated, three of them meet only basic validation criteria. [score:3]
The effect of 100 nM miR-132 mimic on MeCP2 expression was confirmed using cells from three different patients (Fig. 7B). [score:3]
Control mice and mice with smooth muscle-specific deletion of Dicer (KO) were used to examine the contribution of smooth muscle cells to miR-132 and miR-212 expression in the bladder (panels A through C). [score:3]
Basal expression of miR-132/212 in detrusor smooth muscle is low yet induction following outlet obstruction occurs only in the detrusor layer. [score:3]
Serum stimulation (FCS) and phorbol ester (PMA) on the other hand increased miR-132 expression (Fig. 3G). [score:3]
Panels E through G show miR-132 expression in human bladder smooth muscle cells stimulated with vehicle (control) and various pharmacological substances in vitro. [score:3]
Panel C shows the detrusor to mucosa expression ratio of miR-132 and miR-212 in control and KO bladders. [score:3]
0116784.g002 Figure 2Control mice and mice with smooth muscle-specific deletion of Dicer (KO) were used to examine the contribution of smooth muscle cells to miR-132 and miR-212 expression in the bladder (panels A through C). [score:3]
Time-courses of miR-132/212 expression in detrusor following partial bladder outlet obstruction in the rat are shown in panel D. N = 4–10 throughout. [score:3]
The expression of miR-132 in the bladder is higher than that of miR-212, making the contribution of miR-212 to the observed correlations modest. [score:3]
Validated targets of miR-132/212 were examined at the protein level using western blotting at various times after surgical obstruction of the urethra (A). [score:3]
It has also been demonstrated that miR-132 promotes proliferation and tube-formation in endothelial cells by targeting p120RasGAP (Rasa1, [13]). [score:3]
0116784.g005 Figure 5Validated targets of miR-132/212 were examined at the protein level using western blotting at various times after surgical obstruction of the urethra (A). [score:3]
We also detect inducible expression of miR-132/212 in primary smooth muscle cells from the human urinary bladder. [score:3]
ACREB, which inhibits DNA binding of endogenous CREB, moreover blocked CREB -driven transcription of the miR-132 gene [6]. [score:3]
Partial infravesical outlet obstruction increases expression of miR-132/212 in the urinary bladder. [score:3]
We next searched the literature for validated miR-132/212 targets and selected nine for which correlations with miR-132 and miR-212 were examined. [score:3]
Ache was previously validated as a target of miR-132 using multiple approaches [12] and induction of miR-132/212 seemingly correlated with repression of Ache in our obstruction mo del. [score:3]
MiR-132 and miR-212 inhibitors (AM10166, AM10340, Ambion, Thermo Scientific, Pittsburgh, PA, USA; 10 nM and 100 nM), mimics (Mission miRNA: Sigma-Aldrich, St. [score:3]
It is important to note, however, that the effects of miR-132/212 mimics and blockers on detrusor cell number may be mediated by miRNA targets other than those studied here. [score:3]
MiR-132/212 induction in the bladder correlates inversely with previously validated miR-132/212 targets. [score:3]
Finally, using a tetracycline-inducible miR-132 transgenic mouse strain, the authors demonstrated that Jarid1a, Mecp2 and Ep300 are regulated by miR-132 in vivo. [score:2]
Experiments to firmly establish cause and effect relationships in outlet obstruction would, in our view, require use of miR-132/212 knockout mice. [score:2]
We hypothesized that miR-132/212 may regulate Ache in the bladder and that loss of miR-132/212 -dependent repression of Ache might underlie the reported [3] impairment of cholinergic neuroeffector transmission 10 weeks after deletion of Dicer in the bladder. [score:2]
MiR-132 inhibitor increased cell viability (+6.7±1.36%, p<0.01 vs. [score:2]
N = 6. The lack of support for a role of miR-132/212 in regulation of Ache in the bladder led us to consider alternative roles. [score:2]
The lack of support for a role of miR-132/212 in regulation of Ache in the bladder led us to consider alternative roles. [score:2]
In view of the cholinergic neuro-effector transmission defect that we have reported for the bladder following smooth muscle-specific deletion of Dicer [3], we also tested if miR-132/212 regulates cholinergic activation of the bladder via effects on acetylcholine esterase (Ache). [score:2]
Together, these prior studies provide compelling evidence that the miR-132/212 cluster is regulated by Ahr/Creb. [score:2]
Forskolin, which activates Creb, induced miR-132 effectively in bladder smooth muscle cells (Fig. 3E). [score:1]
These latter studies showed that transfection of miR-132 mimic led to reduced smooth muscle cell viability, proliferation and migration [21], suggesting the existence of a negative feedback loop in which growth-promoting stimuli increase miR-132 and miR-212 which in turn limit cell proliferation. [score:1]
We cross-referenced these against putative binding sites in the miR-132/212 promoter (Fig. 3A red circle). [score:1]
Our demonstration that serum stimulation, which induces growth of detrusor myocytes similar to outlet obstruction, increases miR-132/212, establishes a pattern between growth and miR-132/212 induction. [score:1]
The normalized sum of miR-132 and miR-212 in bladders from sham-operated, obstructed (10 days and 6 weeks) and de-obstructed rats was correlated with the mRNA levels for Mecp2 (A), Ep300 (B), Pnkd (C), Jarid1a (D), Sh3bp5 (E), Ripk2 (F), Foxo3 (G), Pten (H) and Rasa1 (I). [score:1]
The corresponding star sequences (5p) were similarly induced (rno-miR-132-5p: 3.2-fold, p = 0.0005; rno-miR-212-5p: 4.0-fold, p = 0.0001). [score:1]
Creb1 phosphorylation was not increased at 4 days when miR-132/212 peaked (Fig. 3C, compare with Fig. 2D). [score:1]
These findings supported a cause and effect relationship between miR-132/212 induction and repression of MeCP2 and Pnkd and possibly also of Ache. [score:1]
Taken together, our analysis suggests involvement of Ahr and, possibly, Creb in miR-132/212 induction, but we cannot rule out additional critical influences. [score:1]
This is concordant with the results of Choe et al. [21] on miR-132 mimic and antimir transfection in vascular smooth muscle cells. [score:1]
Despite the fact that miR-132 and miR-212 are Dicer -dependent miRNAs, only small (≈24%) reductions in miR-212 (p = 0.03, Fig. 2A) and miR-132 (p = 0.08, not shown) were observed in Dicer KO detrusor. [score:1]
Bioinformatics analysis points to the involvement of Ahr in miR-132/212 induction following outlet obstruction. [score:1]
We found that the detrusor:mucosa ratios of both miR-132 and miR-212 were reduced in Dicer KO bladders (Fig. 2C). [score:1]
Our bioinformatics analysis of upstream mechanisms of miR-132/212 induction in outlet obstruction argues for involvement of Ahr. [score:1]
Experiments have also shown that the miR-132/212 cluster is induced by the dioxin receptor (Ahr) agonist TCDD in wild type but not in Ahr -deficient T-cells [18]. [score:1]
negative control), while miR-132 mimic was without effect (−0.7±1.6%, p = 0.75). [score:1]
This resulted in a modest but significant induction of miR-132 (Fig. 3E). [score:1]
It is however unlikely that that miR-132 and miR-212 are responsible for the neuro-effector transmission defect that we have previously reported in Dicer KO bladders [3]. [score:1]
Contribution by some other cell type to miR-132/212 induction, including inflammatory cells, cannot be ruled out. [score:1]
We used the normalized sum of miR-132 and miR-212 because these miRNAs have the same seed sequences, but one may raise arguments against this approach. [score:1]
Early work established that the transcription factors REST and CREB are involved in the transcriptional control of the miR-132/212 cluster [6], [15], [16]. [score:1]
0116784.g004 Figure 4The normalized sum of miR-132 and miR-212 in bladders from sham-operated, obstructed (10 days and 6 weeks) and de-obstructed rats was correlated with the mRNA levels for Mecp2 (A), Ep300 (B), Pnkd (C), Jarid1a (D), Sh3bp5 (E), Ripk2 (F), Foxo3 (G), Pten (H) and Rasa1 (I). [score:1]
In all, these findings argued that relief of miR-132/212 -dependent repression of Ache does not underlie the reported cholinergic neuro-effector transmission defect in Dicer KO bladders. [score:1]
Creb binding to two CRE motifs upstream of miR-212 and one CRE motif upstream of miR-132 has been demonstrated by chromatin immunoprecipitation in rat neurons [6]. [score:1]
Dicer KO affects many miRNAs and the reductions of miR-132 and miR-212 were small, so we cannot rule out a modulating influence of miR-132/212 on Ache in the bladder. [score:1]
A role for Ahr in miR-132/212 induction. [score:1]
Work in the heart, finally, has shown that miR-132 and miR-212 are involved in hypertrophy [14]. [score:1]
Here, we aimed to document and confirm these changes and to explore possible downstream consequences of miR-132/212 induction. [score:1]
Our work suggests that outlet obstruction increases miR-132/212 via the transcription factors Ahr and Creb and that these miRNAs repress MecCP2 and limit cell growth. [score:1]
Despite these advances, the transcriptional control of the miR-132/212 cluster probably remains incompletely elucidated [5]. [score:1]
In conclusion, our work has demonstrated induction of miR-132/212 in bladder outlet obstruction. [score:1]
We reasoned that variable mRNA breakdown during dissection could play a role for the lack of a small effect of Dicer deletion on miR-132. [score:1]
Induction of miR-132/212 in outlet obstruction is probably not unique for rats because preliminary miRNA profiling indicates similar changes in hypertrophic bladders from humans [34]. [score:1]
We detected increased nuclear staining for Ahr at 2 and 4 days of obstruction, and the dioxin receptor agonist TCDD was found to induce miR132/212 in cultured smooth muscle cells. [score:1]
MiR-132 and miR-212 are increased in the detrusor and not in the mucosa following outlet obstruction. [score:1]
Microarrays using bladders obstructed for 10 days and at 6 weeks as well as de-obstructed and sham-operated bladders (GEO: GSE47080) demonstrated induction of miR-132 (rno-miR-132-3p) and of miR-212 (rno-miR-212-3p) in bladder outlet obstruction and a return towards control level on de-obstruction (Fig. 1A, B). [score:1]
We document sizeable induction of miR-132/212 in rat bladder outlet obstruction. [score:1]
In summary, this analysis suggested involvement of Ahr in miR-132/212 induction in the obstructed bladder. [score:1]
Since bladder outlet obstruction is associated with considerable hypertrophy of detrusor myocytes [32] it is conceivable that miR-132/212 may play a similar role in the obstructed bladder. [score:1]
Recent work has highlighted roles of miR-132 and miR-212 in non-neural tissues. [score:1]
ATF6 is activated by endoplasmic reticulum (ER) stress, but we did not see induction of miR-132 following stimulation with the ER stressors brefeldin A or tunicamycin (Fig. 3F). [score:1]
The present study therefore sketches a signaling pathway elicited by obstruction that involves Ahr/Creb -mediated induction of miR-132/212, miR-132/212 -dependent repression of MeCP2, Ep300 and Jarid1a and reduced cell proliferation. [score:1]
Using cultured human detrusor myocytes we transfected miR-132/212 mimics and antimirs. [score:1]
The effect of 100 nM miR-132 mimic was confirmed using cells from three individuals (B). [score:1]
Induction of miR-132 and miR-212 following bladder outlet obstruction. [score:1]
We also note that the original study on miR-132/ Rasa1 only reported an effect on the Rasa1 protein [13]. [score:1]
We moreover demonstrate that induction of miR-132/212 is specific for the detrusor layer and does not occur in the mucosa. [score:1]
These were cross-referenced against putative transcription factor binding sites in the miR-132/212 promoter (red circle in A), yielding a list of putative mediators of miR-132/212 induction in outlet obstruction (B). [score:1]
In humans, miR-132 and miR-212 are derived from a bicistronic precursor transcribed from chromosome 17 [5]. [score:1]
Recent studies have indicated roles of miR-132/212 in smooth muscle. [score:1]
We first found that contraction in response to neostigmine was reduced rather than increased in KO bladders where miR-132/212 were clearly, albeit modestly, reduced. [score:1]
This demonstrates that miR-132/212 induction in outlet obstruction is specific for the detrusor layer. [score:1]
Using the same micro-dissection approach we next determined if miR-132/212 induction occurred in the detrusor or in the mucosa in obstructed rat bladders. [score:1]
In support of this possibility we found a significant correlation between miR-132/212 and FoxO3, consistent with the findings by Ucar et al. [14]. [score:1]
When surveying miRNA arrays from the obstructed urinary bladder [4] we noted changes in miR-132/212. [score:1]
Pten and Rasa1 did not correlate with the miR-132/212 level (Fig. 4H-I). [score:1]
[1 to 20 of 112 sentences]
4
[+] score: 223
Other miRNAs from this paper: hsa-mir-212, hsa-mir-1-2, hsa-mir-122, hsa-mir-206, hsa-mir-1-1
When miR-212-3P and miR-132-3P determined as discussion objects, we firstly analyze the expression of miRNA and its target genes across human tissues, the result provide a sound basis for its involvement in neurological diseases such as epilepsy that miR-132/212 presents brain tissue-specific and elevated expression, there are far more similar example like miR-1/133a and miR-206/133b cluster, known as myomiRs, that suppress key genes in muscle development [15]; the liver-specific miRNA-122* and miR-122 participates extensively in human hepatocellular carcinoma [38, 39]. [score:12]
Then, a great deal of studies have demonstrated that marked increase in transcription from the miR-132/212 locus can be caused by neuronal stimulation, and the expression of miR-132 and miR-212 is necessary for the proper development, maturation, morphogenesis and function of neurons and whose dysregulation has more to do with a large amount of neurodegenerative disorders, such as tauopathies, schizophrenia, Alzheimer's disease, Huntington's disease, autism and the theme of this article, epilepsy. [score:9]
Previous study coming from our and others have found miR-132 presented tumor-promoting but miR-212 served as tumor-suppressing feature in stomach adenocarcinoma (STAD) [27, 28], in here, the genes, i. e., SIRT1 and MECP2 with such similar reverse feature were shown to be down-regulated and up-regulated in STAD [29, 30], have conspicuously negative connection with miR-132-3p and miR-212-3p in STAD, which partially confirms the fact that both miRs have reverse functions in some tumors. [score:9]
TargetScanhuman7.1 was used to predicts biological targets of miR-212-3P/miR-132-3P, all remaining gene (refer to the gene that have ruled out the experimentally validated target gene from all predicted target gene) performed enrichment analysis of gene-GO term, bio-pathways as described above. [score:9]
Given all that, survival analysis sourced from TCGA data was performed and the result showed that miR-132-3p and miR-212-3p were presented to be up-regulated or down-regulated in different cancer types, and Kaplan-Meier analysis curves demonstrated that aberrantly expression of both miRs was conspicuously associated with poor overall survival (Figure 4A). [score:9]
So we want to make clear whether the expression of miR-132-3p and miR-212-3p have got relatively nerve tissue specifity, the data coming from the Human miRNA tissue atlas showed that miR-132-3p and miR-212-3p have a high concordance of brain tissue-specific expression in human, which indicated these miRs play a pivotal role in brain tissue development and impaired expression of them may result in disorders of the nervous system. [score:8]
Although their role in neuronal functions is the most studied, more evidences point towards an involvement of these miRNAs in human cancer have been found such as miR-212 may improve the current prognostic risk stratification of mixed acute myeloid leukemia [9], epigenetic regulation of miR-212 expression in lung cancer [10] and down-regulation of microRNA-132 is associated with poor prognosis of colorectal cancer [11]. [score:7]
IRAK4 clearly relevant to epilepsy assigned to further study, Figure 4B and Figure 4D show IRAK4 is negatively with the miR-132/212 in kidney chromophobe and aberrantly expression of IRAK4 are significantly related to poor survival of several cancers, certainly, somatic mutations of IRAK4 itself in cancer is another main reason in cancer (Figure 4C), but on the whole all of which suggest that miR-132/212 may be involved differently disease though single gene. [score:6]
Fascinating thing is 31.1% DEGs may be directly target by both miRs, and further mechanism study indicated miR-132-3p and miR-212-3p may be participated in brain tumor -induced epilepsy through direct intervention, ceRNA network and indirect adjustment. [score:6]
In addition to Pubmed search, the MalaCards disease database [26] with high credibility and having been used wi dely was also used for further analysis of research potential that miR-132/212 can cause epilepsy, the MalaCards provides 43 affiliated genes found to be associated with the epilepsy, what has specific value in this article is that 32.6% of genes related to epilepsy may be directly targeted by miR-132-3p and miR-212-3p. [score:6]
Firstly, we want to know whether the 570(2 gens in Original article significantly associated epilepsy were include) DEGs can directly target by miR-132-3p and miR-212-3p, the intersections between DEGs and target genes derived from different source were calculated, Surprisingly and fascinating, venn diagram shown that 31.1%(177/570) DEGs may be target by both miRs and 7.4%(42/570) DEGs have been experimentally validated. [score:6]
MiR-132/212 both were highly expressed in experimental and human epilepsy [3], CREB-regulated microRNA miR-132 can be rapidly induced by activation of neurons in vivo [18] and the p-CREB and miR-132 were highly expressed in both rats and patients with temporal lobe epilepsy (TLE)[19]. [score:6]
Certainly, epilepsy is also belong to CNS disorder and results from a variety of CNS insults, theoretically, all disease caused by dysregulated expression of miR-132/212 can become the trigger factors for epileptic seizures. [score:6]
Table 1 and Supplementary Table 1 presented experimentally validated target gene of miR-212-3p/miR-132-3p, there are 951 genes have been validated and all of them have been discussed in various human diseases. [score:5]
Experimentally validated target genes of miR-212-3p/miR-132-3p have highly expression in brain. [score:5]
Certainly, two things are worth mentioning when considering further discussion, firstly, miR-132 and miR-212 also presented different expression and miR-132 may be play a major role, each of these miRNAs respectively repress specific targets(diverging nucleotides between miR-132 and miR-212 sequences (see Figure 1A) and have a nonsynchronous status [16, 34]. [score:5]
All the analyze result above, especially the fact that IRAK4 targeted by miR-132/212 can participate in cancer and epilepsy and the survival of brain lower grade glioma (LGG) is significantly affected by both miRs (P=0.002) and its target genes like IRAK4 (p=8.76e-05) (Figure 4B and Figure 4D) remind us whether miR-132-3p and miR-212-3p is the core molecular underlying brain tumor -induced epileptogenesis, To illustrate this hypothesis, GEO (access #: GSE32534), which was the first study of to use formalin-fixed paraffin embedded peritumoral tissues (5-seizure vs. [score:5]
Though the co -expression analysis of miR-132/212 with selected core validated target genes, the double role of miRs functioned in caner been further validated. [score:5]
miR-132 play a negative feedback regulator of IL-1β and IL-6 by targeting IRAK4 in astrocyte-related inflammation induced by MRP8 [23] and promotes epileptogenesis by modulating BDNF/TrkB and p250GAP/Cdc42 signaling in the hippocampal neuronal culture mo del [24, 25]. [score:4]
Some genes did not appear in statistically enriched pathway and GO-term can sever as ceRNAs to compete for miR-132/212 and indirectly inhibit core gene such as NF1B, FAT3 and EML4. [score:4]
Other evidence like KEGG and STRING network consist of all the possible transcription factor compiled from Genecards and DEGs showed in Supplementary Table 8. Figure 6 (A) the biological network of 177 DEGs may be directly target by miR-132/212, the network consists of top 7 statistically enriched KEGG pathways (big cycle with different color) and corresponding genes (red) and whose STRING protein interaction (between the gene, the specific interactive mode will not discussed in here). [score:4]
Other evidence like KEGG and STRING network consist of all the possible transcription factor compiled from Genecards and DEGs showed in Supplementary Table 8. Figure 6 (A) the biological network of 177 DEGs may be directly target by miR-132/212, the network consists of top 7 statistically enriched KEGG pathways (big cycle with different color) and corresponding genes (red) and whose STRING protein interaction (between the gene, the specific interactive mode will not discussed in here). [score:4]
Figure 1A/ 1B presented the mature and precursor sequences of miR-132 and miR-212 in human and one example about common target gene of both miRs. [score:3]
Meanwhile, the fact that the survival of brain tumors such as LGG can be determined by miR-132 and the validated target gene IRAK4 and the incidence of epilepsy is much higher in low-grade gliomas than in high-grade gliomas [31] remind us whether miR-132/212 get involved in brain tumor -induced epilepsy. [score:3]
MiR-132 is important regulators of seizure -induced neuronal death [20] and whose silencing inhibit the spontaneous seizures through the MFs-CA3 pathway [21]. [score:3]
The second one is that miR-132-3p/5p and miR-212-3p/5p, originating from opposite arms of the same pre-miRNA and with different seed sequence, may be involve in another unique role in CNS (figure 1C have showed 5p also have a high concordance of brain tissue-specific expression in human) [35– 37]. [score:3]
Analysis of all the target gene of miR-212-3P/miR-132-3P. [score:3]
The gene sequence of miR-132/212 and its expression in human tissues. [score:3]
miRNA research revealed different sets of miRNAs expressed in different cell types and tissue and have its specificity and heterogeneity, so Human miRNA tissue atlas [39] was adopted to certify the organ specificity of miR-132 /212. [score:3]
Furthermore, miR-132-3p and miR-212-3p share similar mature sequences and common target gene, which is important for further analysis. [score:3]
miR-212-3p and miR-132-3p work synergistically to control Sox11 expression in the setting of epilepsy [22]. [score:3]
Previous research have found that miR-212/132 have bilateral function depending on cancer types [7], which is in line with the our analytic result, such as high miR-132-3p and low miR-132-3p expression are significantly associated with poor survival in bladder urothelial carcinoma (BLCA) and pancreatic adenocarcinoma (PAAD), respectively. [score:3]
In this article, we want to assure whether these genes significantly associated with epilepsy can be directly and indirectly affected by miR-132-3p and miR-212-3p. [score:3]
The core target genes of miR-132/212 were involved in human cancer. [score:3]
The biomolecular information of remaining genes targeted by miR-132-3p and miR-212-3p. [score:3]
MiR-132 and miR-212 were first discovered in mice and display brain and testes tissue-specific patterns of expression [5]. [score:3]
Analysis of experimentally validated target gene of miR-212-3P/miR-132-3P. [score:3]
The fact showed in Table 2 and Supplementary Table 2 that most of these genes were highly expressed in brain make the role of miR-212-3p/miR-132-3p as “neurimmiRs” becomes even more prominent. [score:3]
Analysis of biological networks for validated target gene of miR-212-3P/miR-132-3P. [score:3]
More details about analysis result can be found in Supplementary Table 5. All target genes and whose biological process had been enumerate above, in order to better understand the mechanism specific to epilepsy, literature searches (pubmed) was employed and the mechanism that miR-132/212 was involved in epilepsy are briefly summarized in here. [score:3]
Computational analysis result of miR-132-3p and miR-212-3p-regulated biomolecular network. [score:2]
Experimental validated Gene-enrichment analysis result of miR-132-3p and miR-212-3p-regulated biomolecular network. [score:2]
Survival analysis reveals that dysregulation of miR-132-3p and miR-212-3p is conspicuously related with poor survival in several human cancer including BLCA, PAAD, KICH and LGG. [score:2]
Although in the beginning we did not take cancer as the main research object, as data are accumulated and analysis continues, the result demonstrated miR-132-3p and miR-212-3p may participates extensively in human cancer, For experimental validated genes and predicted genes with conservative sites, 34.9 % (15/43) and 38.2% (13/34) pathway are statistically enriched in cancer directly, respectively. [score:2]
Has-miR-132 and has-212, similarly to their rodent orthologues, share the same primary transcript and first identified in neuronal cells from a screen designed to discern genes mediated by the cAMP-response element binding (CREB) protein transcription factor which is important for neuronal development and function [6]. [score:2]
miR-132-3p and miR-212-3p may play a critical role in human cancer. [score:1]
“miR-132” and “miR-212” are the most frequently used name in the vast majority of researches, but two mature microRNAs (miR-132-3p/5p and miR-212-3p/5p, respectively) originate from opposite arms of the same pre-miRNA have been found in human genome, so first we need to clarify which one is usually much more abundant in cell and on behalf of the “miR-132/212”, eventually, although there is also a small study miR-132-5p/212-5p oriented, miR-132-3p and miR-212-3p was determined as the predominant by miRbase and sequences alignments in published literature. [score:1]
Mature sequence hsa-miR-132-3p and has-miR-212-3p may have a predominant role in nervous tissues. [score:1]
Since so many biological mechanism are related to epilepsy, we are interested in the current research status that miR-132/212 had been involved in epilepsy, Pubmed search found 15 papers about these neurimmiRs participated in epilepsy, such as BDNF/TrkB pathway and p250GAP/Cdc42 signaling have been researched, BDNF/Trkb can be adjusted by PI3K and MAPK pathways, which is accorded with the above analysis. [score:1]
Literature search (pubmed) show that 26.1 % (95/364) (“miR-132”/“miR-132” and“cancer”) and 37.2 %(45/145) (“miR-212”/“miR-212” and“cancer”) studies are related to cancer for miR-132 and miR-212, respectively. [score:1]
The emerging role of miR-132 and miR-212 participate in epilepsy. [score:1]
miR-132/212 may be the core molecular underlying tumor -induced epileptogenesis. [score:1]
In addition, more evidence derived from GO term and other feature for these DEGs can be found in Supplementary Table 7. (2) Because identical seed sequences, the relative redundancy of miR-132 and miR-212 functions is still an incompletely addressed question. [score:1]
Analysis of gene structure and tissue specificity and heterogeneity of miR-212/miR-132. [score:1]
Such as pathways in cancer, MicroRNAs in cancer and Proteoglycans in cancer, which is consistent with previous literatures about the emerging role of miR-132/212 involved in cancer. [score:1]
Given this, miR-132/212 sometimes classified as ‘neurimmiR’ [8]. [score:1]
The biomolecular information of remaining genes and the role of miR-132, miR-212 and genes participate in epilepsy. [score:1]
Several Web based tools for “The Cancer Genome Atlas” (TCGA) have been used to visualize, analyze and interpret all the data types whether miR-132-3p and miR-212-3p may be involve in human cancer. [score:1]
Stem-loop sequence has-miR-132 /212 generated two mature sequences, respectively. [score:1]
It is clear now that miR-132-3p/212-3p and whose biomolecular networks are markedly implicated in human cancer. [score:1]
5-non-seizure low grade brain tumor patients [31] was used for validated this hypothesis- miR-132/212 get involved in brain tumor -induced epilepsy. [score:1]
The molecular mechanism underlying miR-132/212 implicated in tumor -induced epileptogenesis. [score:1]
Analysis of the emerging role of miR-132-3p and miR-212-3p involved in human cancer. [score:1]
Besides, oriented to this article focused on epilepsy, literature search (PubMed) was carried out to analyze the exiting role of miR-132 and miR-212 involving in epilepsy. [score:1]
[1 to 20 of 64 sentences]
5
[+] score: 210
Based on these 275 genes, we showed that 36 of 209 genes down-regulated by miR-132 carried potential binding sites for miR-132, whereas only 1 of 252 genes up-regulated by miR-132 was predicted to be targeted by miR-132 (Fig.   2A). [score:9]
Interestingly, GSEA of microarray data showed that most positive regulators of cell migration were up-regulated by miR-132, whereas the expression of most negative regulators of cell migration was decreased by miR-132 in HDFs (Fig.   2E,F and Supplementary Fig.   S3). [score:8]
One of the top-down-regulated genes by miR-132 (fold change = −2.04, P = 7.4E-06, Supplementary Table  S2) was RAS p21 protein activator 1 (RASA1), which was previously identified as a direct target of miR-132 28, 29. [score:7]
Our study reveals the important role of miR-132 in dermal fibroblasts during skin wound healing: it is upregulated by TGF-β1 and promotes fibroblast migration by regulating RASA1 expression (Fig.   5D). [score:7]
Out of the top 500 miR-132 targets predicted by the TargetScan algorithm [22], 275 genes were found to be expressed in HDFs. [score:7]
Among genes related to the RAS-signalling, we focused on RASA1, which was previously identified as a direct target of miR-132 [28], and we found that it was significantly down-regulated by miR-132 in dermal fibroblasts. [score:7]
To study the functions of miR-132 in HDF, HDFs at 60–70% confluence were transfected with 20 nM mirVana [™] miRNA mimic for has-miR-132–3p (miR-132 mimics) or miR mimic negative control 1 (Ctrl mimic) (ThermoFisher Scientific); 20 nM miR-132 miRCURY LNA Power inhibitor (miR-132 inhibitor) or negative control A (Ctrl inhibitor) (Exiqon) using Lipofectamine 2000 (ThermoFisher Scientific). [score:7]
To determine the role of miR-132 in fibroblast migration, we overexpressed or inhibited miR-132 by transfecting HDFs with miR-132 mimics or inhibitors, respectively (Supplementary Fig.   S1). [score:7]
Silencing of RASA1 expression phenocopied the miR-132 overexpression in HDFs, suggesting that RASA1 is an important target mediating the pro-migratory function of miR-132. [score:7]
In line with this, gene set enrichment analysis (GSEA) showed that miR-132 target genes were significantly enriched among the genes down-regulated by miR-132, and a negative enrichment score curve was generated (P < 0.001) (Fig.   2C) [23]. [score:6]
Upregulated miR-132 expression during skin wound healing may be due to the increased TGF-β1 production in the wound. [score:6]
We have previously shown that TGF-β1 is up-regulated during normal skin wound healing and that it induces miR-132 expression in epidermal keratinocytes [20]. [score:6]
Together, our data suggest that the expression of miR-132 is upregulated in HDFs during wound healing, which may be due to the increased TGF-β signalling. [score:6]
Inhibition of the TGF-β type I activin receptor-like kinase (ALK) receptor by a chemical inhibitor, SB431542, completely abolished TGF-β1 -mediated induction of miR-132 (Fig.   1G). [score:5]
We found that among the top 10 cell components enriched in the genes regulated by miR-132, most were related to cell motility, e. g. cell leading edge, lamellipodium, cell projection, focal adhesion, adherence junction and filopodium (Fig.   2D), which was further supported by GSEA showing that multiple migration-related processes were significantly (P < 0.001) enriched among the genes down-regulated by miR-132 (Supplementary Fig.   S2). [score:5]
Interestingly, compared to the HDFs from the intact skin, miR-132 expression was significantly upregulated (1.76-fold change, P = 0.0074) in the wound HDFs (Fig.   1D). [score:5]
To study the role of miR-132 in HDFs, we performed a global transcriptomic analysis of HDFs upon miR-132 overexpression (Supplementary Fig.   S1) using Affymetrix arrays, which identified 461 genes significantly regulated (fold change ≥ 1.5 or ≤ −1.5, P < 0.05) by miR-132 (Fig.   2A, Supplementary Table  S2). [score:4]
Figure 1Expression and regulation of miR-132 in wounds. [score:4]
We confirmed the miR-132 -mediated downregulation of RASA1 in HDFs by qRT-PCR (0.27-fold change, P = 0.000024, Fig.   4D). [score:4]
To explore the underlying molecular mechanism, we analysed the transcriptome of fibroblasts overexpressing miR-132, which identified RAS signaling as a major pathway regulated by miR-132 in HDFs. [score:4]
We found that during wound healing miR-132 was not only up-regulated in the epidermis as shown previously [20], but also significantly increased in the dermis (Fig.   1B). [score:4]
Moreover, we showed that TGF-β1 induced (5.75-fold change, P = 0.0071) the expression of miR-132 primary precursor (pri-miR-132), suggesting that TGF-β1 regulates transcription of the miR-132 gene (Fig.   1F). [score:4]
MiR-132 downregulates RASA1, which contributes to the pro-migratory function of miR-132 in fibroblasts. [score:4]
By scratch wound healing assay, we showed that the overexpression of miR-132 significantly promoted (P = 0.0006, Fig.   3A), whereas its inhibition significantly reduced the motility of HDFs (P = 0.006, Fig.   3B). [score:4]
In epidermal keratinocytes, we found that miR-132 inhibits inflammation but promotes cell proliferation [20]. [score:3]
The successful modulation of miR-132 expression level was confirmed by qRT-PCR (Supplementary Fig.   S1). [score:3]
Figure 2Transcriptome analysis of fibroblasts overexpressing miR-132. [score:3]
Inhibition of miR-132 delays wound healing in mouse in vivo and human ex vivo wound mo dels [20]. [score:3]
We found that miR-132 was highly expressed in human dermal fibroblasts (HDFs) in wounds (Fig.   1C). [score:3]
To reveal the expression pattern of miR-132 during human skin wound healing, we made surgical wounds in 10 healthy donors and collected intact skin and wound-edge tissues at the inflammatory phase (one day after wounding) and at the proliferative phase (6 or 7 days after wounding) (Fig.   1A, Supplementary Table  S1). [score:3]
Vertical bars along the χ axis denote the positions of miR-132 target genes within the ranked list. [score:3]
Transcriptome analysis of dermal fibroblasts overexpressing miR-132. [score:3]
HDFs were transfected with 20 nM miR-132 mimics or miR-132 inhibitors or si-RASA1 for 48 hours. [score:3]
We next analysed the correlation between the presence of miR-132–binding sites and the degree of regulation and found that mRNAs containing miR-132–binding sites displayed greater reduction in expression levels compared with other genes in this array (Fig.   2B). [score:3]
In line with this, we showed that silencing of RASA1 expression increased the motility of HDFs, which phenocopied the pro-migratory effects of miR-132, suggesting that the RASA1-RAS signal axis plays a key role in mediating the biological functions of miR-132 in fibroblasts. [score:3]
Here we found that TGF-β1 also significantly increased (1.53-fold change, P = 0.0072) the expression of miR-132 in HDFs (Fig.   1E). [score:3]
Expression profiling of HDFs transfected with 20 nM miR-132 mimics or Ctrl mimics for 48 hours (in triplicates) was performed using Affymetrix Genechip system at the microarray core facility of Karolinska Institute. [score:3]
Together with our previous study [20], we showed that TGF-β1 induced miR-132 expression in both epidermal keratinocytes and dermal fibroblasts. [score:3]
Transwell migration assay were performed to assess the motility of fibroblasts transfected with 20 nM miR-132 mimics (C) or miR-132 inhibitors (D). [score:2]
The mature miR-132 expression was quantified using the TaqMan miRNA assay (TM000457, ThermoFisher Scientific). [score:2]
The data are presented as mean ± s. d. The GO analysis and GSEA of microarray data highlighted that several biological processes related to the RAS and small GTPase signalling pathways, which are important for cell migration, growth, apoptosis and differentiation [27], were regulated by miR-132 in HDFs (Fig.   4A,B). [score:2]
Considering the central role of fibroblasts in wound healing, and to get a more complete understanding of the role of miR-132 in wound repair, herein we clarified the regulation and function of miR-132 in dermal fibroblasts. [score:2]
Next, we performed gene ontological (GO) analysis to classify the genes regulated by miR-132 using the database for annotation, visualization and integrated discovery (DAVID) v6.7 24, 25. [score:2]
The genes related to the RAS signal (GO: 0007265) and significantly regulated (fold change ≥ 1.2, P < 0.05) by miR-132 in HDFs were listed in Fig.   4C. [score:2]
For scratch assay, HDFs transfected with 20 nM miR-132 mimics or miR-132 inhibitors or si-RASA1 were grown to full confluence at collagen-coated 6-well plate and a scratch was made with a 10 μL pipette tip. [score:2]
These results suggest that the microarray analysis was specific and sensitive for detection of miR-132 -mediated gene regulation. [score:2]
Moreover, by using transwell migration assay, we found that miR-132 mimics accelerated (1.66-fold change, P = 0.011, Fig.   3C), while miR-132 inhibitors decreased (0.64-fold change, P = 0.0019, Fig.   3D) the migration of HDFs towards fetal bovine serum (FBS). [score:2]
Scratch assays were performed to assess the migration rate of HDFs transfected with 20 nM miR-132 mimics (A) or miR-132 inhibitors (B) for 48 hours. [score:2]
MiR-132 expression is induced by TGF-β1 in dermal fibroblasts. [score:2]
Together, the results of the transcriptome analysis prompted us to further explore the potential role of miR-132 in motility of HDFs. [score:1]
We have previously shown that miR-132 facilitates inflammation-proliferation transition in epidermal keratinocytes [20], and here we further demonstrate that miR-132 promotes dermal fibroblasts migration, both of which processes are impaired in chronic non-healing wounds (Fig.   5D). [score:1]
The data are presented as mean ± s. d. (D) Schematic summary of the role of miR-132 in dermal fibroblasts during skin wound healing. [score:1]
Thus, we concluded that miR-132 promoted the motility of dermal fibroblasts. [score:1]
GSEA evaluated enrichment within the profile data for the predicted target genes of miR-132. [score:1]
Thus, it would be interesting to further investigate whether the impaired TGF-β signalling leads to reduced miR-132 expression in chronic wounds. [score:1]
Thus, we propose that miR-132 holds great promise for treating chronic wounds. [score:1]
QRT-PCR analysis of miR-132 (E) or its primary precursor pri-miR-132 (F) in HDFs treated with 10 nM TGF-β1 for 48 hours (n = 3). [score:1]
In this study, we found that miR-132 enhanced migration of dermal fibroblasts. [score:1]
[1 to 20 of 58 sentences]
6
[+] score: 191
As shown in Figure 3E and 3F, the EMT maker E-cadherin or vimentin was dramatically up-regulated or down-regulated upon the overexpression of miR-132 in both L9981 and 95D cells. [score:9]
Taken together, these data indicate that miR-132 directly inhibits ZEB2 expression via targeting its 3′ UTR and induces EMT of NSCLC cells. [score:8]
The small interfering RNAs (siRNA) targeting human ZEB2 mRNA, negative control siRNA (siControl), miR-132 inhibitor (anti-miR-132), and inhibitor negative control (anti-miR-NC) were purchased from Ruibobio (Guangzhou, China). [score:7]
Notably, we observed that E-cadherin or vimentin, the downstream effector of ZEB2, was also down-regulated or up-regulated by miR-132, indicating that miR-132 may exert functions in migration and invasion of NSCLC cells through modulating EMT. [score:7]
The migratory A549 cells in lower chambers from one experiment were shown in B. To detect the molecular mechanism by which miR-132 suppresses the metastasis of lung cancer cells, we predicted the putative target genes of miR-132 in human cells using the tool miRanda, PicTar and TargetScans. [score:7]
MiR-132 Directly Inhibits the Expression of ZEB2 through its 3′UTR and Regulates the EMT of NSCLC Cells. [score:6]
For the mechanism involving miR-132 down-regulation, Shuyu Zhang, et al. reported that the hyper-methylation in the promoter region was responsible for the reduced expression of miR-132 [13]. [score:6]
We found that miR-132 is down-regulated in metastatic lung cancer cell lines and clinical tissue samples, suggesting that miR-132 might act as a tumor suppressor. [score:6]
MiR-132 directly inhibits the expression of ZEB2 through its 3′UTR and regulates the EMT of NSCLC cells. [score:6]
We identified that the EMT regulator ZEB2 is one of direct target genes of miR-132. [score:5]
Cells were transfected with pcDNA3.1 (NC) or pcDNA3.1-miR-132 (miR-132) constructs, and miR-132 inhibitor (anti-miR-132) or inhibitor control (anti-miR-NC). [score:5]
The miR-132 expression was detected by qRT-PCR analysis and normalized to U6 expression. [score:5]
In the tumorigenesis, it is reported that downregulation of miR-132 contributes to pancreatic cancer development [13]. [score:5]
In this study, we found that miR-132 was frequently down-regulated in highly metastatic NSCLC cell lines and tissue specimens. [score:4]
Besides, in the initial tumorigenesis, Shuyu Zhang and his colleague found that miR-132 exerted the low expression levels in primary pancreatic tumors and may be associated with the early development of human pancreatic cancer [13]. [score:4]
Collectively, these results suggested that ZEB2 functions as a target of miR-132, responsible for miR-132 -mediated regulation of the migration and invasion of NSCLC cells. [score:4]
To test whether miR-132 directly targets ZEB2 (Figure 3A), the wild type or mutant 3′ UTR sequence of ZEB2 was cloned into pMIR reporter vector, respectively, as shown in Figure 3B. [score:4]
Thus, we supposed that miR-132 may be a novel tumor suppressor miRNA and its dyregulation may involve the advanced progress of human cancer. [score:4]
Therefore, our data suggested that the decreased expression of miR-132 may contribute to the metastasis of cancer cells and consequently facilitate the advanced development of human cancers like NSCLC. [score:4]
Our finding suggests that miR-132 may be a novel tumor suppressor miRNA. [score:3]
Accordingly, we speculated that this DNA modification might cause the alteration of miR-132 expression in human NSCLC. [score:3]
Taken together, the data strongly suggest that miR-132 is able to suppress the migration and invasion of NSCLC cells in vitro. [score:3]
MiR-132 is frequently down-regulated in highly metastatic lung cancer cells and tissue specimens. [score:3]
Wound healing assay showed that the ectopic expression of miR-132 in L9981 or A549 lung cancer cells significantly inhibited cell migration, compared to the control group (Figure 2A). [score:3]
The luciferase activity of pMIR- ZEB2 3′ UTR-wt construct was significantly decreased upon the over -expression of miR-132 in NL9980 cells, whereas its mutant counterpart was not (Figure 3C). [score:3]
Of note, the expression of ZEB2 displayed a reverse correlation with miR-132 level in NSCLC tissues (Figure 4C). [score:3]
Notably, the expression of miR-132 in highly metastatic L9981 and 95D cells was dramatically diminished, relative to that in the corresponding poorly metastatic NL9980 or 95C cell lines, respectively (Figure 1A). [score:3]
Further, we detected miR-132 expression in 45 paired clinical primary lung cancer tissue and metastatic lymph node cancer tissue samples. [score:3]
However, the cells showed an increased invasion upon the treatment of miR-132 inhibitor (Figure 2B, 2C). [score:3]
ZEB2 Contributes to miR-132- Suppressed Migration and Invasion of NSCLC Cells. [score:3]
ZEB2 contributes to miR-132- suppressed migration and invasion of NSCLC cells. [score:3]
These data indicate that the reduced expression of miR-132 is a frequent event in highly metastatic NSCLC cells and tissues, which may be involved in the metastasis of human lung cancer cells. [score:3]
MiR-132 blocks the migration and invasion of NSCLC cells through targeting the EMT regulator ZEB2. [score:3]
MiR-132 is Frequently Down-regulated in Highly Metastatic Lung Cancer Cells and Tissue Specimens. [score:3]
To further confirm that ZEB2 acts as a target of miR-132, we examine the effect of miR-132 on those two downstream effectors of ZEB2 by Western blot. [score:3]
Mutations of miR-132 binding sites were introduced by site-directed mutagenesis and the resulted vector was named pMIR-ZEB2-Mut. [score:3]
Also, the analysis on clinicopathological features of patients with NSCLC showed that expression of miR-132 had a significant correlation with lymph node status (Table 1, P = 0.011). [score:3]
Previous studies have documented the roles of miR-132 in regulating the differentiation of dopamine neurons [11] and activating the endothelium to facilitate pathological angiogenesis [12]. [score:2]
MiR-132 is able to inhibit the migration and invasion of NSCLC cells in vitro. [score:2]
MiR-132 is Able to Inhibit the Migration and Invasion of NSCLC Cells in vitro. [score:2]
MiR-132 is able to inhibit EMT and metastasis of NSCLC cells through paralyzing the function of ZEB2. [score:2]
MiR-132, arising from the miR-212/132 cluster [30], has documented roles in the promotion of pancreatic cancer development via activating AKT signaling pathway [31]. [score:2]
Then, we accessed whether the functional effect of miR-132 on NSCLC cells was dependent on ZEB2. [score:1]
Cells were transfected with 1 µg of pcDNA3.1 or pcDNA3.1-miR-132 vector. [score:1]
0091827.g003 Figure 3(A) The miR-132 binding site predicted in the 3′UTR of ZEB2 mRNA. [score:1]
These in vitro data implied the necessary contribution of attenuated miR-132 in promoting cell metastasis in cancers. [score:1]
The association of miR-132 with clinicopathological features of 90 patients with non-small cell lung cancer. [score:1]
Reverse transcription of miR-132 and internal control U6 was performed using Reverse Transcriptase M-MLV (Takara, Japan). [score:1]
We found that miR-132 levels exhibited a varying pattern in these cell lines. [score:1]
Next, we tested the functional significance of miR-132 in NSCLC cells. [score:1]
A 3′ UTR fragment of ZEB2 mRNA containing wild-type or mutant of the miR-132 binding sequence was cloned into the downstream of the luciferase gene in pMIR vector. [score:1]
We evaluated the expression of miR-132 by qRT-PCR in several NSCLC cell lines with distinct metastatic capacities. [score:1]
However, the potential role of miR-132 in lung cancer progression has still not been documented. [score:1]
And ZEB2 was responsible for miR-132-modulated migration and invasion of NSCLC cells. [score:1]
Genomic sequence of human miR-132, including ∼200 bp flanking sequence, was amplified from human genome, then inserted into the BamHI/EcoRI site of the pcDNA3.1 vector (Invitrogen), named as pcDNA3.1-miR-132. [score:1]
MiR-132 expression in those two types of tissues was compared by way of Wilcoxon signed-rank test (*** P<0.001, Student’s t- test). [score:1]
Additionally, miR-132 may serve as a potential therapeutic candidate in the treatment of NSCLC. [score:1]
As shown in Figure 4G and 4H, introduction of anti-miR-132 into NL9980 cells led to an increase of cell migration and invasion, whereas silence of ZEB2 by siRNAs partially abolished the enhancement. [score:1]
However, the potential role of miR-132 in this process still need to be further illustrated. [score:1]
In the present study, we are interested in the potential role of miR-132 in the metastasis of NSCLC cells. [score:1]
Of note, the mRNA or protein levels of ZEB2 in L9981 or 95D cells were dramatically reduced by miR-132, respectively (Figure 3D, 3E, and 3F). [score:1]
0091827.g001 Figure 1(A) The relative mRNA levels of miR-132 were detected by qRT-PCR and normalized against an endogenous control (U6 RNA) in several lung cancer cell lines with distinct metastatic ability. [score:1]
Adherent cells were seeded into 24-well plates and co -transfected with 200 ng of pMIR-ZEB2 or pMIR-ZEB2-Mut vector and 80 ng of pcDNA3.1-miR-132 vector or pcDNA 3.1 empty vectors, and the pRL-TK plasmid (Promega, Madison, WI) which is used as internal normalization. [score:1]
[1 to 20 of 63 sentences]
7
[+] score: 181
Other miRNAs from this paper: hsa-mir-22, hsa-mir-212
Expression levels of miR-132 and miR-212 are downregulated in AD postmortem olfactory bulb and hippocampus. [score:6]
To further understand SIRT1 regulation we tested (in the same LCL RNA preparations) the expression levels of miR-212 [36], miR-132 [35] and miR-22 [37] reported to regulate SIRT1, and observed opposite expression patterns compared with SIRT1 (Fig.   1, Supplementary Fig.   1). [score:6]
miR-132 was involved in olfactory memory formation, as such, miR-132 expression was upregulated by odor exposure. [score:6]
The expression levels of both miR-132 and miR-212 showed a mirror-image of the SIRT1 expression levels in the same LCL cohorts: levels were upregulated in AD LCLs compared with healthy age-matched control LCLs (FD = 1.7; P = 0.014, FD = 2.1; P = 0.036) and, more dramatically, were extremely low in centenarian compared with AD LCLs (FD = 12.9; P = 2.1E-07, FD = 8.6; P = 7.7E-07; Fig.   1b,c). [score:6]
Figure 1Expression levels and correlations of SIRT1, miR-132 and miR-212 in LCLs from female Alzheimer’s disease patients, female healthy controls (in two age groups) and female centenarians. [score:5]
The hypothesis that higher miR-212 and miR-132 levels are protective in AD shares common features with our recent suggestion that low peripheral RGS2 expression may serve as an early AD biomarker, while lower RGS2 expression levels were associated with better cognitive scores in AD patients [18]. [score:5]
Figure 3Expression levels of miR-132 (a, c) and miR-212 (b, d) in postmortem olfactory bulb (a, b) and hippocampus (c, d) tissues from sporadic Alzheimer’s disease patients and age-matched non-demented controls and their correlations with MMSE scores. [score:5]
Note the negative correlation of SIRT1 expression with MMSE but not with ADAS; the negative MMSE correlation agrees with the positive MMSE correlations for miR-132 and miR-212, two miRNAs known to target SIRT1 (see). [score:5]
The expression levels of miR-212 and miR-132 in the hippocampus and olfactory bulb, two brain regions where neurogenesis takes place throughout human life, were downregulated in AD patient postmortem tissues compared with controls (Fig.   3a-d) and were correlated with worse cognitive MMSE scores (Fig.   3e–g). [score:5]
In addition, higher miR-132 expression levels correlated with lower age of AD onset (Fig.   1f): the higher expression levels of miR-132 possibly allow improved defense against the ongoing neurodegeneration. [score:5]
Patients ADAS score exhibited lack of correlation with SIRT1 expression (Fig.   2d), albeit negative correlations were observed with expression levels of miR-132 (R = −0.67; P = 0.0006) or miR-212 (R = −0.72; P = 0.00014) (Fig.   2e,f). [score:5]
The expression levels of both miR-132 and miR-212 were downregulated in postmortem olfactory bulb (FD = −1.32; P = 0.037 and FD = −1.46; P = 0.025, respectively) and hippocampus tissues (FD = −1.8; P = 0.029 and FD = −2.1; P = 0.004, respectively) from late-onset AD patients (N = 14) compared to non-demented controls (N = 20) (Fig.   3a–d). [score:5]
Figure 2Pearson correlation plots for female Alzheimer’s disease MMSE and ADAS cognitive scores and expression levels (2 [−Δct]) of SIRT1, miR-132 and miR-212 in their LCLs. [score:5]
AD LCLs expression levels of SIRT1, miR-132 and miR-212 correlate with patient cognitive scoresThe expression levels of SIRT1, miR-132 and miR-212 in LCLs from female AD patients (N = 22) were examined for correlations with their Mini Mental State Examination (MMSE) scores and AD Assessment Scale (ADAS) scores (Supplementary Table  1). [score:5]
In AD patients, lower SIRT1 expression levels and higher miR-212 and miR-132 LCL expression levels correlated with better cognitive scores (higher MMSE and lower ADAS scores; Fig.   2), suggestive of earlier AD stage. [score:5]
These observations, which differ from those we observed in AD and control LCLs (Fig.   1 and Supplementary Fig.   3), may imply that the regulation of SIRT1 expression by these miRNAs is tissue specific 51, 52. miR-132 is required for normal dendrite maturation in newborn mouse hippocampal neurons [53]. [score:4]
Additionally miR-132 was upregulated in U251 human astrocytoma cells exposed to the inflammatory protein myeloid related protein-8 [62]. [score:4]
We propose that high levels of inflammation, known to take part in AD pathogenesis, may thus lead to higher levels of miR-132 in immune cells, as also reflected by AD LCLs in this study, allowing better cognitive status in AD patients through a pathway potentially involving SIRT1 transcriptional down-regulation, as observed here (Fig.   4). [score:4]
Our results confirm previous findings that miR-212 and miR-132 were downregulated in postmortem hippocampus brain tissues from AD patients [49]. [score:4]
Hansen, K. F. et al. Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptome. [score:3]
Deletion of miR-132 and miR-212 was shown to induce tau aggregation in mice expressing endogenous or human mutant tau [38], and impair mouse cognitive skills [39]. [score:3]
Corresponding positive correlations were found when comparing MMSE scores and miR-132 (R = 0.47; P = 0.026) and miR-212 LCL expression (R = 0.43; P = 0.046; Fig.   2b,c). [score:3]
Thus, the higher miR-132 expression we observed in AD LCLs (Fig.   1) is suggestive of an inflammatory-like state. [score:3]
Interestingly, AGTR2 activation increases the expression of miR-212 and miR-132 in cardiovascular tissues [58]. [score:3]
SIRT1, miR-132 and miR-212 expression levels in the olfactory bulb and hippocampus are correlated with MMSE scores. [score:3]
The expression levels of miR-212 and miR-132 exhibited negative Pearson correlations with SIRT1 in the olfactory bulb tissues (Supplementary Fig.   4a,b). [score:3]
In addition, both miR-132 and miR-212 expression levels were negatively correlated with Braak stage scores and BrainNet Europe (BNE) Aβ phase score in AD olfactory bulb tissues (Supplementary Fig.   6). [score:3]
As observed in human LCLs, miR-132 expression levels correlated with those of miR-212 also in the olfactory bulb and hippocampus postmortem tissues (Supplementary Fig.   5a,b). [score:3]
miR-132, miR-212 and miR-22 were shown to target SIRT1 35– 37. [score:3]
AD LCLs expression levels of SIRT1, miR-132 and miR-212 correlate with patient cognitive scores. [score:3]
In the current study, we therefore studied SIRT1, RGS2, miR-132, miR-212 and miR-22 expression levels in LCLs from healthy donors of various age groups, including centenarians, and in LCLs from AD patients. [score:3]
SIRT1, miR-132 and miR-212 expression levels in the olfactory bulb and hippocampus are correlated with MMSE scoresThe AD postmortem brain tissue MMSE cognitive scores were explored for detecting correlations with the measured expression levels of the above genes and miRNAs. [score:3]
Of note, the LCL expression levels of miR-212 and miR-132 exhibited a robust positive Pearson correlation (R = 0.893; P = 6.12E-25; Supplementary Fig.   1c; combined cohorts, N = 69). [score:3]
We observed that miR-212 and miR-132 were upregulated in LCLs from AD patients compared to controls, and were extremely low in centenarian LCLs. [score:3]
SIRT1 expression levels were decreased in miR-132 transfected human umbilical vein endothelial cells. [score:3]
Lower LCL miR-132 expression levels were associated with later AD age of onset. [score:3]
The expression levels of SIRT1, miR-132 and miR-212 in LCLs from female AD patients (N = 22) were examined for correlations with their Mini Mental State Examination (MMSE) scores and AD Assessment Scale (ADAS) scores (Supplementary Table  1). [score:3]
Expression levels (2 [−Δct]) are shown for the different LCL groups for: (a) SIRT1 (b) miR-132 (c) miR-212. [score:3]
A negative correlation was observed for the AD postmortem olfactory bulb expression levels of SIRT1 with the patients MMSE cognitive scores (R = −0.54; P = 0.015); while in the hippocampus, both miR-132 and miR-212 showed positive correlations with MMSE scores (R = 0.41; P = 0.037, R = 0.44; P = 0.028; Fig.   3e–g). [score:3]
In addition, the expression levels of both miR-132 and miR-212 negatively correlated with those of SIRT1 (R = −0.60 P = 4.5E-08; R = −0.49 P = 0.00002; Fig.   1d,e; data were combined for all cohorts, N = 69). [score:3]
Notably, miR-132 LCL expression levels, which negatively correlated with the respective SIRT1 levels (Fig.   1d), negatively correlated also with AD age of onset (R = −0.45, P = 0.029) (Fig.   1f). [score:3]
SIRT1 expression levels were much higher in centenarian compared with AD LCLs, while the opposite was observed for miR-132 and miR-212 in the same cells. [score:2]
Our studies of miR-212 and miR-132 expression levels in AD and control LCLs yielded different findings compared with those obtained in postmortem brain tissues; this may reflect cross-talk between the immune system and the brain. [score:2]
TaqMan® MicroRNA Assay IDs are listed below: MicroRNA Symbol TaqMan™ MicroRNA Assay ID U6 snRNA (Control miRNA Assay) 001973 hsa-miR-22-3p 000398 hsa-miR-132-3p 000457 hsa-miR-212-3p 000515Comparative critical threshold (Ct) values were determined in duplicates for analyzing relative gene and miRNA expression in selected sample groups according to 2 [−ΔCт] (ΔCт = Ct target Gene − Ct reference gene). [score:2]
TaqMan® MicroRNA Assay IDs are listed below: MicroRNA Symbol TaqMan™ MicroRNA Assay ID U6 snRNA (Control miRNA Assay) 001973 hsa-miR-22-3p 000398 hsa-miR-132-3p 000457 hsa-miR-212-3p 000515 Comparative critical threshold (Ct) values were determined in duplicates for analyzing relative gene and miRNA expression in selected sample groups according to 2 [−ΔCт] (ΔCт = Ct target Gene − Ct reference gene). [score:2]
Transfection with miR-132 in normal B lymphocytes led to enhanced inflammation, as evidenced by increased production of lymphotoxin and tumor necrosis factor α [60]. [score:1]
For example, miR-132 contributes to dendritic outgrowth of newborn neurons in the adult mouse hippocampus [34]. [score:1]
Indeed, higher serum miR-132 levels were recently suggested as biomarkers for mild cognitive impairment, a stage often preceding AD [48]. [score:1]
miR-132 expression (measured by in situ hybridization) increases at the onset of synaptic integration in the mouse olfactory bulb. [score:1]
Furthermore sequestration of miR-132 in newborn neurons led to reduced dendritic complexity, spine density and increased survival of newborn neurons [54]. [score:1]
Furthermore, higher miR-132 and miR-212 levels were associated with improved AD patient cognitive scores. [score:1]
Our current observations of higher miR-212 and miR-132 in AD LCLs may thus represent yet another facet of the hypertension/AD link. [score:1]
We applied real-time PCR reactions for measuring the expression levels of SIRT1, RGS2, miR-22, miR-132 and miR-212 in postmortem olfactory bulb and hippocampus tissues from AD patients and non-demented age-matched controls. [score:1]
This finding is not surprising given the proximal location of miR-212 and miR-132 on human chromosome 17p13.3 (separated by only 263 nucleotides) and was previously reported for chronic lymphocytic leukemia cells [41]. [score:1]
Additionally, miR-132 and miR-212 were reduced in medial frontal gyrus [49], temporal cortex, and gray matter from prefrontal cortex AD postmortem samples [50]. [score:1]
Interestingly, a local infusion of miR-132 antisense into the olfactory bulb prior to training impaired olfactory learning in C. sphinx [55]. [score:1]
Additionally, mouse hippocampus miR-132 improves the integration of newborn neurons into synaptic circuitry [34]. [score:1]
[1 to 20 of 57 sentences]
8
[+] score: 155
Other miRNAs from this paper: mmu-mir-132, hsa-mir-212, mmu-mir-212
We found a significant enrichment of miR-132 targets in the set of upregulated (but not downregulated) genes in 3xTg-AD [KO] mice (Fig. 2c). [score:9]
We first confirmed Sirt1 downregulation upon miR-132 overexpression in Neuro2a-APPSwe and HEK293-APPSwe cells (Fig. 3c). [score:6]
As expected, we observed a strong enrichment of miR-132 targets in the set of downregulated genes in Neuro2a [132] cells. [score:6]
Accordingly, all genes were downregulated upon miR-132 overexpression in Neuro2a cells (Fig. 2f). [score:6]
To this end, we introduced miR-132 mimics in Neuro2a and HEK293 cells stably expressing human APPSwe (Neuro2a-APPSwe, HEK293-APPSwe) 7. In both cell lines, miR-132 caused a significant downregulation of (soluble) human Aβ40 and Aβ42 levels as determined by (Fig. 3a). [score:6]
Another interesting observation is a physiological “switch” between miR-132 and Sirt1 expression levels during aging 40, which could be affected is disease conditions. [score:5]
This task is even more challenging as miR-132 targets likely change according to age, gender, cell type, species, and/or disease state. [score:5]
Note that the prediction tools (PITA, TargetScan, Pictar) made no distinction between miR-132 and miR-212 targets, as both miRs share the same seed sequence 20. [score:5]
At this moment, the physiological meaning of this correlation is uncertain, as miR-132 could be implicated in various steps of Aβ deposition (including propagation) by targeting various genes during disease progression. [score:5]
Strikingly, 3 out of 5 validated miR-132 targets have previously documented roles in the regulation of Aβ metabolism and/or pathology, including Sirt1, MAPK/ERK, and Tau (see). [score:4]
In Neuro2a cells overexpressing miR-132, we identified 4996 genes (5772 transcripts) that were misregulated using the same criteria. [score:4]
Gene ontology (GO) terms related to miR-132 networks included neuron projection development (GO: 0031175), negative regulation of transcription (GO: 0000122), and regulation of protein phosphorylation (GO: 0001932), all of which are important for brain function and maintenance (see Supplementary Table S4). [score:4]
Importantly, we identified a number of miR-132 targets with documented roles in the regulation of Aβ metabolism, providing a potential mechanism for the effects observed in cells, mice and humans. [score:4]
Consistent with this hypothesis, Sirt1 is downregulated in human AD samples, alongside of miR-132. [score:4]
Regulation of Aβ by miR-132 and its target Sirt1. [score:4]
Positive miR:target correlations in vivo have been documented before 61, including between miR-132 and Sirt1 in adults 40. [score:3]
How to cite this article: Hernandez-Rapp, J. et al. microRNA-132/212 deficiency enhances Aβ production and senile plaque deposition in Alzheimer’s disease triple transgenic mice. [score:3]
Identification of miR-132/212 targets in vivo. [score:3]
Right panel: overlap of transcripts (targets) between miR-132/212 networks in mice and cells. [score:3]
The fact that Sirt1 inhibition does not totally reproduce the effects of miR-132 on Aβ40 and Aβ42 (88.4% vs. [score:3]
It is clear that a combination of approaches [e. g., HITS-CLIP 59 and RISC-trap 60] will help determine the precise number of miR-132 targets in vivo. [score:3]
The miR-132 network comprised a total of 74 genes (as defined by PITA, TargetScan and Pictar) in 3xTg-AD mice and 143 genes in Neuro2a cells (Fig. 2b and Supplementary Table S3). [score:3]
We next asked if miR-132 can directly regulate Aβ production in cells. [score:3]
Using GeneMANIA 36, we found that most of miR-132 targets were highly interconnected (see Supplementary Fig. S2). [score:3]
Clinical association between miR-132 and Aβ in Alzheimer’s disease. [score:3]
Another interesting miR-132 target is Mapk1/ERK2. [score:3]
Interestingly, close to 40% (1057/2847) of affected genes in the 3xTg-AD [KO] mice were also changed in forebrain-specific miR-132/212 adult knockout mice 43. [score:2]
Regulation of Aβ production by miR-132. [score:2]
In this study, we used miR-132/212 knockout mice 28 that we crossed with triple transgenic AD (3xTg-AD) mice 23. [score:2]
This is a direct follow-up of our previous work linking miR-132 function to Tau pathology in AD. [score:2]
At first glance, this may seem contradictory to our results in mice and cells; however, we anticipate many compensatory mechanisms in the human AD brain that would compromise the delicate balance between miR-132 and Sirt1 regulation. [score:2]
We have shown that CREB (and BDNF) is indeed affected in miR-132/212 knockout mice 19, consistent with our RNA-Seq results. [score:2]
In AD mice, we identified a total of 2847 genes (3311 transcripts) that were misregulated in the absence of miR-132/212 (Fig. 2b and Supplementary Table S2). [score:2]
The fact that Tau is hyperphosphorylated in miR-132/212 knockout mice 16 is consistent with this hypothesis. [score:2]
Cortical and hippocampal tissues were isolated from 3xTg-AD mice with (3xTg-AD [WT]) or without (3xTg-AD [KO]) the miR-132/212 cluster (see). [score:1]
Thus, additional studies with a higher number of patients are necessary to draw definitive conclusions with regard to the clinical link between miR-132/212 and Aβ. [score:1]
Notably, no correlation was found between miR-132 (or miR-212), Sirt1 and Aβ in individual groups (controls, MCI, AD) (see Supplementary Table S5). [score:1]
Nearly 25% (32/144) of genes in the miR-132 networks were found in common between 3xTg-AD [KO] mice and Neuro2a [132] cells. [score:1]
We have previously shown that miR-132/212 deficiency in mice promoted Tau hyperphosphorylation and aggregation 16. [score:1]
In conclusion, we provide strong evidence that the miR-132/212 network controls various aspects of AD pathologies in mice, including Aβ pathology (herein), Tau pathology, and memory impairments. [score:1]
In an independent cohort (Douglas Bell Canada brain bank) 16, we confirmed a decrease of Sirt1 in AD brains (Fig. 4h), and also correlated with miR-132 (Fig. 4i). [score:1]
We have recently shown that miR-132/212 deficiency in 3xTg-AD mice leads to enhanced Tau pathology and memory impairment, which can be rescued in part by the reintroduction of miR-132 mimics 16. [score:1]
For comparative purposes, we also included RNA from Neuro2a cells treated with miR-132 mimics (Neuro2a [132]) or a scrambled control (Neuro2a [Scr]). [score:1]
Next steps include to identify key miR-132/212 target genes and to evaluate the precise role of miR-132/212 networks in various physiological and pathological contexts. [score:1]
It is interesting to note that miR-132/212 loss has a particularly strong impact on (mouse and human) Aβ42 production and aggregation, an effect related to yet unknown mechanisms. [score:1]
We also found a significant correlation between miR-132 and Aβ suggesting a clinical relationship between miR-132 levels and AD progression. [score:1]
In attempt to provide clinical support for our observations, we first observed a good correlation between miR-132 and Sirt1 (protein) in humans. [score:1]
In these latter conditions ectopic miR-132 levels reached ~600 fold over endogenous levels (see Supplementary Fig. S3). [score:1]
Identification of miR-132 gene networks in vivo. [score:1]
51.9%, respectively) supports a cooperative mode of action of the miR-132 network. [score:1]
Correlation between miR-132 and Aβ in humans. [score:1]
Thus, loss of miR-132/212 in mice promotes Aβ production, aggregation and deposition. [score:1]
One example is a feedback loop between miR-132, BDNF and CREB 20 57, a pleiotropic transcription factor involved in cell proliferation and survival. [score:1]
Lastly, neither miR-132/212 levels nor the other settings (insoluble Aβ42, amyloid plaques, Sirt1) correlated with age of death of patients (see Supplementary Fig. S5). [score:1]
It is notable that most (~97%) genes affected in our mouse or cell systems do not harbor miR-132/212 binding sites. [score:1]
To uncover miR-132 networks, we performed genome-wide transcriptomics using (RNA-Seq). [score:1]
The goal of this study was to determine the impact of miR-132/212 loss on Aβ metabolism. [score:1]
We found a significant correlation between miR-132, insoluble Aβ42 levels (Fig. 4a), and amyloid plaque count in all cases (Fig. 4b). [score:1]
We finally asked if miR-132 could be clinically related to Aβ. [score:1]
Sirt1 correlated with miR-132 (Fig. 4c) as well as insoluble Aβ42 (Fig. 4g). [score:1]
The generation of 3xTg-AD mice lacking the miR-132/212 cluster has been described previously 16. [score:1]
miR-132/212 deficiency in mice promotes Aβ pathology. [score:1]
Analysis of Aβ metabolism in miR-132/212 -deficient AD mice. [score:1]
[1 to 20 of 63 sentences]
9
[+] score: 124
Interestingly, we did not find any attenuation or downregulation of miR-132/-212 expression in IMA patients receiving β-blockers, as compared to non-β-blocker -treated patients (Figure 5D), indicating that not all blood pressure-reducing agents can downregulate miR-132/-212 expression, which further supports the notion that AngII mediates a global upregulation of miR-132/-212 in humans. [score:13]
Furthermore, by inhibition of the Gαq subunit in cardiac fibroblasts, we demonstrated significant decreases in miR-132 and -212 expressions, pointing to Gαq protein activation as the responsible pathway for AngII -induced miRNA regulation in vitro [19]. [score:6]
Importantly, our results show that functional inhibition of the AT [1]R reversed the miR-132 and -212 expression levels, demonstrating that AngII is responsible for the regulation, possibly via the Gαq -dependent pathway. [score:6]
In conclusion, we found that miR-132 and -212 are increased in AngII -induced hypertension in vivo, in organs associated with blood pressure control, which partly mimics the “five miRNA” expression signature obtained by AT [1]R overexpression [19]. [score:5]
In line with the previous findings by Jeppesen et al. [19], this suggests that the upregulation of miR-132/-212 is a direct consequence of Gαq vasopressor stimulation pathways and not a result of secondary heart hypertrophy and fibrosis. [score:5]
ARB treated patients (n = 16) revealed a significant attenuation of miR-132 expression (0.55-fold), as well as a tendency for miR-212 downregulation (0.64-fold), as compared to non-ARB -treated patients (miR-132; 0.93 and miR-212; 1.01) (n = 16) (Figure 5B). [score:5]
Chronic AngII-Mediated Hypertension in Rats Increases miR-132/-212 Cluster Expression in Blood Pressure Regulating Organs: Heart, Aorta and Kidney. [score:4]
Interestingly, even though the ET-1 -induced hypertension had a much shorter duration than the sustained hypertension induced by AngII, both miR-132 and miR-212 were upregulated at a point in time when blood pressure was not (Figure 4). [score:4]
In contrast to our rat infusion mo del, only a modest blood pressure increase was observed in this mice strain, and miR-132/-212 was not significantly upregulated in mouse hearts (Figure 3). [score:4]
However, the levels of miR-132/-212 were not downregulated in patients treated with β-blockers. [score:4]
Even though miR-132 and miR-212 are expressed from the same precursor, we observed independent regulation in the different tissues in response to the same AngII infusion. [score:4]
Furthermore, miR-132 was found to be significantly upregulated in the plasma of AngII -induced hypertensive animals, whereas no regulation was observed for plasma miR-212 levels compared to the control rats (Figure 2B). [score:4]
Despite these limitations, we observed a significant downregulation of miR-132, as well as a robust attenuation of miR-212 in the ARB -treated patients. [score:4]
Interestingly, miR-132/-212 was upregulated in the aortas of mice stimulated with AngII from osmotic pumps for 14 days, but this study did not report blood pressure values [28]. [score:4]
In summary, these data indicate that upregulation of the miR-132/-212 cluster likely is part of a general response to Gαq-vasopressor stimulation of the ERK1/2 pathway and may be involved in a common AngII- and ET-1 -mediated signaling pathway leading to hypertension. [score:4]
In one study, miR-132 was reported to be constitutively expressed and released by pericyte progenitor cells, and transplantation of these cells into mice with myocardial infarction improves cardiac function through proangiogenic activities [25]. [score:3]
Since the miR-132 gene is clustered with the miR-212 gene and they are likely expressed together [21], we included miR-212 in further analyses. [score:3]
We found increased expression of miR-132 and -212 in the left ventricle, aorta and kidney, as well as in the plasma (Figure 2) after 10 days of sustained AngII -induced hypertension in rats, which is compatible with our pervious published in vitro study [19]. [score:3]
Interestingly, among the many dysregulated miRNAs, the second most significantly regulated miRNA was miR-132. [score:3]
For example, miR-132 and miR-212 are clustered closely in the genome and are transcribed together under the regulation of cAMP response element binding protein [8], which is a known AngII regulated gene [9, 10]. [score:3]
Treatment with Angiotensin II Receptor Blocker Attenuates the Expression of the miR-132/-212 Cluster in Human Hypertension. [score:3]
We previously demonstrated that AT [1]R signaling regulates miR-132 and -212 in HEK293N cells and in primary cultures of cardiac fibroblasts through the Gαq dependent pathway [19]. [score:2]
From a mechanistic point of view, these findings indicate that miR-132/-212, also in vivo, may be regulated through Gαq-ERK1/2 activation, which is one of the mutual steps in the AngII and ET-1 signaling pathways leading to hypertension [30– 32]. [score:2]
Since no anti-miR experiments have been conducted, it has not been possible to deduce the specific cause and effect relationship; however, the regulation of miR-132 and miR-212 is likely biological important, because although rats and humans share biological features in blood pressure control, they have multiple differences in the molecular subtypes of ion channels, receptors and signaling pathways in blood vessel cells. [score:2]
2.3. miR-132 and -212 Regulation in Response to AngII in Mice. [score:2]
2.4. miR-132 and -212 Regulations in Response to ET-1, Vasopressor-Induced Hypertension. [score:2]
These results thus showed that continuous AngII infusion for seven days in mice resulted in a modest increase in blood pressure without hypertrophic changes of the heart and no regulation of the miR-132/-212 cluster. [score:2]
Likewise, we observed a significant regulation of miR-132 (1.4-fold) and -212 (1.5-fold) in the kidneys of AngII-infused rats versus controls (Figure 2A). [score:2]
Further studies are necessary to assess the relative biological and pharmacological impact of individual miR-132 and miR-212 levels on systemic blood pressure, in the heart, arterial wall and kidney. [score:1]
Cleary, the in vivo mo del adds to our understanding, as we can narrow down the miRNA changes after AngII, to miR-132 and -212. [score:1]
We next asked whether treatment with β-blockers, often a first choice antihypertensive drug, would also decrease miR-132 and -212, following the notion that it could be reduction in blood pressure per se, which may alter the miRNA levels. [score:1]
miR-132/-212 has been described in both the central nervous and cardiovascular systems. [score:1]
Our results suggest that miR-132 and miR-212 are involved in AngII -induced Gαq-signaling pathway leading to hypertension. [score:1]
Several studies identify miR-132/-212 involvement in the central nervous system, i. e., in neuronal function and plasticity [8, 21, 26]. [score:1]
To further investigate whether this miR-132 and -212 regulation is specific to AngII or related to putative direct influences from blood pressure, we examined patients treated with β-blockers (Figure 5C). [score:1]
These results suggest that the miR-132/-212 cluster in humans may also be part of the response to Gαq-vasopressors, such as AngII. [score:1]
Additionally, we investigated the regulation of the miR-132/-212 cluster in endothelial cell lines and in primary cultures of vascular smooth muscle cells (VSMCs) and leukocytes and found no regulation in either of the cell types (data not shown). [score:1]
By contrast, no changes in miR-132/-212 levels were found in any of the three tissues in the acutely hypertensive rats (Figure 2A). [score:1]
In addition, miR-132/-212 has also been found to be involved in neovascularization, inflammation and adipocyte differentiation in the peripheral tissues [21, 23, 27]. [score:1]
Thus, AT [1]R activation in rats increases miR-132 and miR-212, while blocking the AT [1]R decreases miRNA levels in humans. [score:1]
In order to test whether the miR-132/-212 cluster response is specific for AT [1]R induction, we examined the effect of continuous infusion of a second vasopressor (ET-1) [22]. [score:1]
Altogether, these results strongly suggest that the miR-132/-212 cluster may be a general and novel mediator of AngII -induced hypertension. [score:1]
Besides the heart, the arterial wall and kidneys are involved in systemic blood pressure homeostasis, and we, therefore, examined whether the miR-132/-212 levels were affected also in these tissues. [score:1]
Moreover, the degree of miR-132/-212 increase shows a tendency to correlate with blood pressure suggesting that these miRNAs could play a novel role in AT1 receptor pharmacology, both in vitro and in vivo. [score:1]
[1 to 20 of 44 sentences]
10
[+] score: 100
Among the upregulated miRNAs, miR-132 is expressed in RGCs 26 and regulates neuron development and neurite morphology 17 18. [score:8]
Compared to the empty vector control (pCMVMIR), downregulation of Pax6 gene (1.5 folds, p < 0.001) and upregulation of Brn3a and Brn3b genes (4.2 folds, p < 0.01 and 5.1 folds, p < 0.001, respectively) were observed in retinal progenitor cells transfected with miR-132 expression plasmid (Fig. 8A). [score:8]
In this study, we, for the first time, showed that miR-132 could be involved in the RGC differentiation from retinal progenitor cells as its overexpression in retinal progenitor cells upregulates mature RGC markers (Brn3a and Brn3b) expression (Fig. 8A). [score:8]
When human PDLSCs were transfected with miR-132 expression plasmid, the expression of CUX1 (cut-like homeobox 1) protein was reduced by 33% (p < 0.001; Fig. 8C), suggesting that CUX1 gene could be a downstream target gene of miR-132. [score:7]
Furthermore, BDNF and bFGF were suggested to induce miR-132 expression 28 29, indicating that BDNF and bFGF in our treatment medium might be responsible for the upregulation of miR-132 in the induced PDLSCs. [score:6]
Moreover, we also demonstrated that miR-132 could downregulate CUX1 protein expression in human PDLSCs (Fig. 8C). [score:6]
In order to delineate the biological roles of the differentially expressed miRNAs in retinal differentiation process, retinal progenitor cells from embryonic day 18 rats were transfected with an expression plasmid inserted with miR-132 precursor sequence and treated with differentiation medium. [score:5]
Based on expression levels, the predicted miRNA target genes and reported neuron-related miRNA 17 18, 5 miRNAs from microarray results (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were selected for validation. [score:5]
Meanwhile, we performed the gene ontology analysis on the TargetScan-predicted miR-132 target genes (407 genes), and compared the gene lists related to neuron differentiation (62 genes) and negative regulation of cell differentiation (38 genes; Fig. 8B). [score:5]
We chose the 5 miRNAs (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) for validation not just based on the previous reports or the expression levels, but also the predicted target genes. [score:5]
Based on expression levels, the predicted miRNA target genes and reported neuron-related miRNA 17 18, 5 miRNAs (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were selected for validation. [score:5]
In contrast, hsa-miR-132 and hsa-miR-630 were upregulated along the retinal induction treatment. [score:4]
The miR-132 expression plasmid based on the PCMVMIR cloning vector was purchased from the commercially available source (OriGene). [score:3]
microRNA-132 in retinal progenitor cell differentiation and its target gene analysis in human PDLSCs. [score:3]
Since reduction in Cux1 expression has been shown to promote neurite outgrowth in cortical neurons 27, the morphology of human PDLSC-derived neurons could be related to the interactive functions of miR-132 and CUX1 in our trans-differentiation process. [score:3]
The miR-132 expression plasmid was transfected into human PDLSCs through the TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison, WI) according to the manufacturer’s protocol. [score:3]
In addition, the properties of miR-132 are consistent with the gene ontology analysis of the predicted miRNA target genes (Table 3). [score:3]
Neurospheres were collected, transfected with miR-132 expression plasmid (OriGene, Rockville, MD) and cultured in the differentiation medium (Neurobasal A medium with 1x B27) for 7 days. [score:3]
In summary, this study, for the first time, demonstrated transdifferentiation of human PDLSCs into functional retinal ganglion-like cells, and identified miR-132, VEGF and PTEN as key regulators in the retinal fate determination of human adult stem cells. [score:2]
The expression level of the miR-132 -transfected cells was compared to that of pCMVmiR -transfected cells. [score:2]
The retinal progenitor cell differentiation analysis suggested that miR-132 could direct retinal progenitor cells towards RGC lineage. [score:2]
Five significant miRNAs from the microarray profile (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were validated using TaqMan PCR approach. [score:1]
This further confirms that miR-132 contributes to the differentiation of human PDLSCs into retinal ganglion-like cells. [score:1]
Rho and Gfap genes showed no significant difference between empty vector control and miR-132 -transfected cells. [score:1]
microRNA-132 transfection analysis. [score:1]
[1 to 20 of 25 sentences]
11
[+] score: 89
Other miRNAs from this paper: hsa-mir-210, hsa-mir-142
In summary, our findings indicate that the abnormally elevated levels of miR-132 which we discovered in B cells of MS patients, contribute to their aberrant expression of pro-inflammatory cytokines (LT and TNFα) and that the molecular mechanism involved in this B cell effector cytokine dysregulation in patients with MS involves miR-132 -mediated suppression of SIRT1, which could provide an attractive therapeutic target for patients with MS. [score:8]
The screen (Table S2) suggested that expression levels of miR-132 (p = 0.0079) and miR-210 (p = 0.0362) were higher in MS B cells compared to HS B cells upon ‘dual BCR+CD40 stimulation’, and that miR-142-5p expression was more highly expressed in MS B cells upon ‘CD40 stimulation’ (p = 0.0317). [score:6]
We first used HEK293 cells and observed that transfection with the miR-132 mimic resulted in suppressed SIRT1 expression, both at the protein and mRNA levels (Figure S3). [score:5]
In contrast, activation with ‘CD40 stimulation’ (which did not reveal differences in miR-132 expression between MS and HS B cells; Figure 1B), resulted in no differences in SIRT1 expression between MS and HS B cells. [score:5]
Increasing miR-132 expression results in enhanced B cell production of LT and TNFα, and in reduced expression of SIRT1. [score:5]
LT and TNFα were not predicted to be direct targets of miR-132 based on bioinformatics analyses, suggesting an indirect mechanism. [score:5]
We next confirmed that miR-132 down regulates SIRT1 in primary human B cells through a similar over -expression approach (Figure 2B for protein; Figure 2C for mRNA). [score:4]
We further identify SIRT1 as a negative regulator of LT and TNFα, and implicate SIRT1 as the miR target responsible for the miR-132 -mediated aberrant pro-inflammatory B cell cytokine responses observed in patients with MS. [score:4]
Expression of miR-132 was normalized to the level of RNU6B. [score:3]
Our results both extend the known list of normal miR-132 functions and implicate abnormally increased miR-132 expression in the exaggerated pro-inflammatory responses of MS patient B cells. [score:3]
Our observation that the higher secretion of LT and TNFα by MS B cells was associated with increased expression of miR-132 by the same B cells led us to hypothesize that these processes were mechanistically linked. [score:3]
Figure S2 Expression level of miR-132 in activated B cells quantified by TaqMan quantitative PCR. [score:3]
B: Expression level of miR-132 in B cells either immediately after isolation (Fresh), or following 48 hours in culture when left unstimulated (US), stimulated through CD40 alone (CD40), or stimulated through both the B-cell antigen receptor and CD40 (BCR+CD40). [score:3]
MS B cells express increased levels of miR-132, in association with an abnormal cytokine profile. [score:3]
Abnormally increased effector cytokine responses are associated with elevated miR-132 expression in activated B cells of MS patients. [score:3]
Furthermore, our results indicate that suppression of SIRT1 by miR-132 contributes to the abnormally enhanced production of LT and TNFα by MS B cells. [score:3]
We chose to focus on miR-132 as it was most strongly implicated in the screen and using the same PCR platform confirmed in a total cohort of 14 MS patients and 13 HS, that miR-132 expression was abnormally increased in ‘dual BCR+CD40 activated’ MS B cells (Figure 1B; p = 0.0143). [score:3]
miR-132 enhances LT and TNFα production in association with SIRT1 suppression in B cells. [score:3]
We demonstrate that, under certain contexts of activation, miR-132 expression is abnormally induced in B cells of MS patients and that such miR-132 induction results in over-production of the pro-inflammatory cytokines LT and TNFα. [score:3]
To identify the molecular link between the abnormally elevated miR-132 levels in MS patient B cells and their enhanced LT and TNFα production, we considered molecules known to be suppressed by miR-132 [32]. [score:2]
miR-132 was initially described as an important regulator of neuronal survival, maturation and differentiation and, more recently, implicated in several immune responses [32], [34]. [score:2]
Dose-titration experiments were carried out to define optimal concentrations of the miR-132 mimic and the negative control. [score:1]
To test this hypothesis, we overexpressed miR-132 (or a control miRNA) in HS B cells, and measured the impact of this manipulation on their cytokine production. [score:1]
C: Level of SIRT1 mRNA in B cells from HS transfected with miR-132 mimic or NC (n = 5) (Paired t-test). [score:1]
A: Levels of lymphotoxin (LT), tumor necrosis factor (TNF)α, and interleukin (IL)-10 in B cells from healthy subjects (HS: n = 7) transfected with miR-132 mimic or negative control (NC), and stimulated through the B-cell antigen receptor (BCR) and CD40 (Wilcoxon test). [score:1]
Figure S3 Levels of SIRT1 protein and mRNA in HEK293 cells after miR-132 transfection. [score:1]
0105421.g002 Figure 2 A: Levels of lymphotoxin (LT), tumor necrosis factor (TNF)α, and interleukin (IL)-10 in B cells from healthy subjects (HS: n = 7) transfected with miR-132 mimic or negative control (NC), and stimulated through the B-cell antigen receptor (BCR) and CD40 (Wilcoxon test). [score:1]
B cells (1×10 [6]) were transfected with 200 nM of miR-132 mimic, or negative control RNA (NC: cel-miR-67) which has minimum sequence identity with human miRNAs (both from Dharmacon), using the Amaxa Human B cell Nucleofector Kit (Lonza) and Nucleofector I device (Lonza), according to their standard instructions. [score:1]
B: Protein level of sirtuin (SIRT)-1 in B cells from HS transfected with miR-132 mimic or NC. [score:1]
Indeed, transfection of the miR-132 mimic into HS B cells resulted in significantly increased production of B cell LT and TNFα, without impacting IL-10 production (Figure 2A). [score:1]
HEK293 cells (American Type Culture Collection) were transfected with 37.5 nM of miR-132 mimic or negative control RNA (NC: cel-miR-67 which has minimum sequence identity with miRNAs in human) (both from Dharmacon) using Lipofectamin RNAiMAX (Invitrogen). [score:1]
[1 to 20 of 31 sentences]
12
[+] score: 81
While expression of miR132-5p did significantly change in NK cells stimulated with A. fumigatus, expression of miR212-5p was significantly increased after 6 h of co-cultivation (p = 0.036). [score:5]
It has been reported that miR-132-3p and miR-212-3p are involved into the neuron morphogenesis, are down-regulated in several brain-related disorders, and also play a role in regulating immune processes (Wanet et al., 2012). [score:5]
6 h miR-132-3p miR-132-5p miR-212-5p SAP30L −0.750 FKBP1B −0.866 KLF4 −0.832 ATP10D −0.881 DHTKD1 −0.801 ABCG1 −0.813 DNPEP −0.790 BARD1 −0.556 TRIM22 −0.531 TTC39C −0.859 Table 3 Correlation coefficients between the expression of fungal DEMs for 12 h and their high-confidence targets. [score:5]
6 h miR-132-3p miR-132-5p miR-212-5p SAP30L −0.750 FKBP1B −0.866 KLF4 −0.832 ATP10D −0.881 DHTKD1 −0.801 ABCG1 −0.813 DNPEP −0.790 BARD1 −0.556 TRIM22 −0.531 TTC39C −0.859 Table 3 Correlation coefficients between the expression of fungal DEMs for 12 h and their high-confidence targets. [score:5]
We performed validation experiments of microRNAs and their predicted target genes revealing fine-tuning regulations by miR-132-5p and miR-212-5p in anti-fungal immune response. [score:4]
Moreover, Das Gupta et al. (2014) showed an up-regulation of miR-132-3p in DCs in response to A. fumigatus stimulation, whereas a stimulation with LPS had no effect on miR-132-3p. [score:4]
The analysis of differential expression revealed similar regulatory patterns for the 3p and the 5p mature microRNA of both mir-132 and mir-212 after 12 h of stimulation. [score:4]
12 h miR-132-3p miR-132-5p miR-129-5p miR-212-3p miR-212-5p MTMR1 −0.788 BTN3A2 −0.663 FAM46A −0.545 SP110 −0.778 KLF4 −0.748 SP110 −0.799 FKBP1B −0.934 ADD3 −0.588 MTMR1 −0.863 DHTKD1 −0.865 TTC39C −0.773 CASP6 −0.606 DNPEP −0.828 CCDC170 −0.516 SPN −0.772 TRIM22 −0.690 IFITM2 −0.795The resulting set of target genes includes genes playing a role in immune response. [score:3]
In addition, miR-132-3p and miR-212-3p share the same seed sequence and thus may have many common target genes. [score:3]
12 h miR-132-3p miR-132-5p miR-129-5p miR-212-3p miR-212-5p MTMR1 −0.788 BTN3A2 −0.663 FAM46A −0.545 SP110 −0.778 KLF4 −0.748 SP110 −0.799 FKBP1B −0.934 ADD3 −0.588 MTMR1 −0.863 DHTKD1 −0.865 TTC39C −0.773 CASP6 −0.606 DNPEP −0.828 CCDC170 −0.516 SPN −0.772 TRIM22 −0.690 IFITM2 −0.795 The resulting set of target genes includes genes playing a role in immune response. [score:3]
Figure 4 Further indication for microRNA-target-interactions were collected via western blots and silencing of the microRNAs (A) miR-132-5p and (B–D) miR-212-5p. [score:3]
In addition, our previous work shows that in human primary monocytes miR-132 (and also miR-155) was differentially expressed after stimulation with A. fumigatus. [score:3]
We silenced miR-132-5p and miR-212-5p in separate experiments in DCs generated under identical conditions and in accordance to the co-incubation settings using microRNA inhibitors. [score:3]
In the presented results, the most immunological relevant target genes were identified for the microRNAs miR-132-5p and miR-212-5p. [score:3]
L. Fischer) with either short interfering single-stranded RNA inhibiting miR-132-5p, miR-212-5p or non-silencing, random RNA (ThermoFisher) at 340 V for 10 ms on day 5 after isolation and then incubated at 37°C and 5% CO [2] for 24 h in culture medium. [score:3]
Figure 3 Experimental analysis of predicted microRNA-target-interactions by silencing of the microRNAs (A,B) miR-132-5p and (C–F) miR-212-5p using siRNA. [score:3]
Furthermore, Wanet et al. (2012) reported that miR-212 and miR-132 are expressed in various immune cells, like macrophages, mast cells and lymphatic endothelial cells. [score:3]
To demonstrate the relevance of miR132-5p and miR212-5p in additional immune cell populations, experiments stimulating human primary natural killer (NK) cells with A. fumigatus, followed by subsequent microRNA extraction and qPCR -based quantification of miR132-5p and miR212-5p expression were performed. [score:3]
Das Gupta et al. (2014) examined the expression of miR-155 and miR-132 in human DCs and their in vitro precursors using A. fumigatus and lipopolysaccharides (LPS) as stimuli. [score:3]
The regulatory patterns of the miR-132/212 cluster suggest a strong involvement of these microRNAs in the anti-fungal response. [score:2]
In contrast, this is the first study which identified miR-132-5p and miR-212-5p to play major roles in the immune regulation. [score:2]
Although our validation experiments are limited in their extent, we could identify and verify miR-132-5p and miR-212-5p as regulators in DCs during fungal infections. [score:2]
In this way, we found three DEMs (miR-132-3p, miR-132-5p, miR-212-5p) for the 6 h and five DEMs (miR-129-5p, miR-132-3p, miR-132-5p, miR-212-3p, miR-212-5p) for the 12 h samples (Figure 1). [score:1]
While miR-132-3p has been linked to A. fumigatus infections before (Das Gupta et al., 2014), it is also involved in different immune processes together with miR-212-3p (Wanet et al., 2012). [score:1]
For example, for miR-132-5p, these genes are BTN3A2, which is associated to the stimulation of the adaptive immune response in DCs Simone et al. (2010), and FKBP1B that is associated to T cell proliferation in mice (Dubois et al., 2003) and is connected to the response to viral infections (Krishnan et al., 2008; Carbajo-Lozoya et al., 2012). [score:1]
Aspergillus fumigatus induces microRNA-132 in human monocytes and dendritic cells. [score:1]
We decided to concentrate on the microRNAs miR-132-5p and miR-212-5p for two reasons: First, only little is known about the roles of these two mircoRNAs in the anti-fungal response. [score:1]
These two microRNAs are relatively closely located in the genome and member of the miR-132/212 cluster. [score:1]
Interestingly, miR-132 was induced by the fungus but not by LPS in this cell type (Das Gupta et al., 2014). [score:1]
[1 to 20 of 29 sentences]
13
[+] score: 73
Likewise, a similar mechanism has been identified between BDNF and miR-132, BDNF can dramatically up-regulate neuronal expression of miR-132 [41], while suppression of miR-132 by 2′-O-methyl oligoribonucleotide can increase BDNF transcript levels [27]. [score:8]
miR-132 expression in the murine prefrontal cortex can regulate neuro-developmental processes, but its dysregulation contributes to the neuro-developmental pathologies in schizophrenia [43]. [score:7]
We identified miR-132 and miR-182 as BDNF regulatory miRNAs by bioinformatics, and functionally validated their role in the negative regulation of the BDNF expression using a human neuronal cell mo del. [score:5]
MiR-132 is important for enhancing neuronal survival and its expression is up-regulated in transplanted neurons [42]. [score:5]
miR-132/182 regulating BDNF expression. [score:4]
First, in a neuronal cell -based mo del, we used miR-132 as a positive control and confirmed that it regulated the expression of BDNF as previous report [27]. [score:4]
Thus, our results supported the roles of both miR-182 and miR-132 in regulating the BDNF expression. [score:4]
Thus, these studies indicate that there may be a feedback loop between the expression of miR-132 and BDNF. [score:3]
Similarly, our results demonstrated that miR-132 treatment in human neuronal cells significantly decreased the BDNF expression. [score:3]
SH-SY5Y cells were treated with miR-182 or miR-132, the results showed that BDNF expression in the miR-182- or miR-132 -treated cultures was much lower than that of negative control miRNA cultures. [score:3]
During acute or chronic stress, the expression of miR-134, miR-183, miR-132, Let-7a-1, miR-9-1, and miR-124a-1 is altered in a hippocampal region responsible for mood [38]. [score:3]
The serum levels of miRNAs (miR-132 and miR-182) were found to be increased and BDNF levels were reduced in depressed patients compared with healthy controls, which supported that miR-132 and miR-182 could negatively regulate BDNF expression. [score:3]
After chemical synthesis of miRNAs, the human neuroblastoma SH-SY5Y cells were transfected with miR-132 or miR-182, and the BDNF expression was detected by western blotting analysis. [score:3]
Davis et al. reported that spontaneous cortical levels of miR-132 were lower at the end of the sleep-dominant light period than those at the end of the dark period in rats, suggesting that miR-132 played a regulatory role in sleep [44]. [score:2]
As a positive control, miR-132 was also investigated in this study, which has been reported to regulate BDNF expression [27]. [score:2]
Serum miR-132 and miR-182 levels detected by real-time PCR. [score:1]
Our results showed a significant negative correlation (Spearman r [s] = −0.307, P = 0.006) between the serum BDNF levels and the miR-132 levels in patients with depression (n = 40) and controls (n = 40, Fig. 4A). [score:1]
A negative relationship between BDNF and miR-132 was found in serum of both patients and controls. [score:1]
MiR-132 and miR-182 were chemically synthesized in the form of small interfering RNA (siRNA) duplexes according to Park’s study [51] (Table 2). [score:1]
Moreover, significant positive correlations were found not only between the serum miR-132 level and SDS score, but also between the serum miR-182 levels and the SDS scores in depressed patients and healthy controls. [score:1]
In this study, our results showed that the serum miR-132 levels were increased in patients with depression than those in controls, which might contribute to the lower serum BDNF levels. [score:1]
Since miR-132, miR-182 did not showed normal distribution, nonparametric tests were applied. [score:1]
0063648.g004 Figure 4(A) A significant negative correlation (Spearman r [s] = −0.307, P = 0.006) between the serum BDNF and miR-132 levels in depressed patients (n = 40) and controls (n = 40). [score:1]
showed that serum miR-132 (or miR-182) levels in depressed patients (n = 40) were much higher than those in healthy controls (n = 40, P<0.01). [score:1]
Therefore, we found that a negative correlation between the serum BDNF levels and the miR-132 levels in depressed patients and healthy controls, but we did not found a significant negative correlation between the serum BDNF levels and the miR-182 levels in patients and controls. [score:1]
In addition, there was a significant positive correlation (Spearman r [s = ]0.347, P = 0.002) between the serum miR-132 levels and the SDS scores in all subjects (n = 80), including 40 patients with depression and 40 controls (Fig. 5B). [score:1]
0063648.g003 Figure 3(A, B) Serum miR-132 or miR-182 levels in patients with depression and their controls, respectively. [score:1]
Our study further studied the neurobiological role of miR-132. [score:1]
We found that the serum miR-132 levels in patients with depression were 0.58×10 [3] copies/ml (n = 40), which were significantly higher than those in the serum of healthy controls (0.13×10 [3] copies/ml, P<0.01, n = 40, Table 1, Fig. 3A). [score:1]
[1 to 20 of 29 sentences]
14
[+] score: 71
Other miRNAs from this paper: hsa-mir-212, hsa-mir-146a, hsa-mir-155, hsa-mir-330, hsa-mir-505
We believe that micro -RNA -based suppression mechanism is unlikely, as inhibition of miR-132/212 (only microRNAs that can inhibit both IL-1α and IL-1β based on target prediction) had no effect on astrocyte IL-1 production. [score:9]
These target sequences are localized in the IL-1 coding sequences and are also present in the plasmid used in the overexpression experiments in Figure 5. miR-132 and miR-212 have similar mature sequences, share the same seed region, apparently target the same mRNAs, and are involved in the development and function of neurons and immune cells [53]. [score:8]
Of the several microRNAs implicated in translational suppression of human cells, we chose miR-132/212 based on our target prediction search (http://www. [score:7]
miR-132, miR-212 or the proteasome inhibitor lactacystin do not affect the expression of IL-1 in human astrocytes. [score:5]
These results exclude a role for miR-132/121 in the suppression of IL-1 expression in human astrocytes. [score:5]
We tested the effects of miR-132 and miR-212 inhibitors to determine whether the IL-1 translational block in astrocytes can be released by them. [score:5]
But despite the effective suppression of miR-132 by both inhibitors (A), there was no change in the amount of IL-1β produced human astrocytes following transfection with the anti-miRs (B). [score:5]
Specific anti-miRs but not control anti-miR suppress miR-132 expression. [score:5]
Human astrocytes were transfected with specific or control anti-miR inhibitors (10 nM) for 48 h, and then stimulated with IL-1α for 24 h. (A) The expression of miR-132 was quantified by TaqMan real-time RT-PCR. [score:5]
0103432.g006 Figure 6 Human astrocytes were transfected with specific or control anti-miR inhibitors (10 nM) for 48 h, and then stimulated with IL-1α for 24 h. (A) The expression of miR-132 was quantified by TaqMan real-time RT-PCR. [score:5]
do) which identified miR-132/212 being able to target both IL-1α and IL-1β [IL-1α: miR-330-5p, 326, 211, 204, 488, 185, 328, 149, 299-3p, 495, 590-5p, 21, 132, 212, 340 and 144; IL-1β: miR-505, 200a, 141, 30e, a, d, c, b, 543, 181d, b, c, a, 212, 132, 24, 543, 448, 203, 136, 205, 410, 340, 374a, b, 365, 874, 150, 149, 125a-3p, 590-3p, 140-5p, 494, 194 and 653]. [score:3]
Role of miR-132/121 in human astrocyte IL-1 synthesis (Figure 6)We next asked whether microRNAs play a role in the translational block of IL-1 in human astrocytes. [score:3]
Anti-miR-132, anti-miR-212 and control miR inhibitor (Negative Control #1) were purchased from Applied Biosystems. [score:3]
Table S2 Alignment of sequences (miR-212, miR-132, IL-1α and IL-1β). [score:1]
Alignment of miR-212, miR-132 and IL-1α, IL-1β sequences is provided in Table S2. [score:1]
Role of miR-132/121 in human astrocyte IL-1 synthesis (Figure 6). [score:1]
[1 to 20 of 16 sentences]
15
[+] score: 62
Interestingly, inhibition of miR-212, miR-132, miR-23a, or miR-23b individually had no effect on sirt1 expression, but we found that concurrent inhibition of miR-212 and miR-23a resulted in a significant ~100% increase in sirt1 (Figure 4), whereas co -inhibition of miR-132 and miR-23a resulted in a ~40% increase in sirt1 (p < 0.05, data not shown). [score:9]
In particular, Wong and colleagues have previously shown that the miR-212/132 cluster is down-regulated in temporal cortex in AD, and that inhibition of miR-212 and/or miR-132 expression can induce apoptosis in primary neurons after 1 week in culture via activation of a foxo3a -mediated cell death pathway (Wong et al., 2013). [score:8]
hNT cultures were transfected with small miRNA inhibitors (miRCURY LNA inhibitors, Exiqon) specific for miR-212, miR-132, miR-23a, miR-23b, or an inhibitor negative control sequence (Exiqon) (n = 8/treatment group in three independent experiments). [score:7]
Here, we show that mir-132/212 and miR-23a/b are selectively down-regulated in the frontal cortex in subjects clinically diagnosed with aMCI and that these alterations appear to be functionally linked to an up-regulation of sirt-1 and sirt-1 mediated protective responses. [score:7]
By contrast, miR-23b co -inhibition with miR-212 or miR-132 had no effect on sirt1 expression (data not shown). [score:5]
The miR-132/212 cluster has been implicated in several neuronal pathways, including dendritic elaboration (Magill et al., 2010) and learning and memory (Wang et al., 2013), and is downregulated in AD neocortex (Cogswell et al., 2008; Hébert et al., 2013; Lau et al., 2013; Wong et al., 2013). [score:4]
In vivo knockdown of hippocampal miR-132 expression impairs memory acquisition of trace fear conditioning. [score:4]
Several miRNAs were also significantly down-regulated in AD frontal cortex, including miR-886-3p, miR-132, miR-21, miR-23a, miR-140-3p, miR-212, miR-23b, let-7d, and miR-181a (Table 3). [score:4]
De-repression of FOXO3a death axis by microRNA-132 and -212 causes neuronal apoptosis in Alzheimer's disease. [score:3]
By contrast, qPCR analysis of temporal cortex revealed that miR-212 and miR-132 expression levels were decreased only in the AD group, whereas miR-23a and miR-23b were unchanged across the clinical diagnostic groups (Table 4). [score:3]
However, co -inhibition of either miR-212 or miR-132 with miR-23a conferred neuroprotection against Aβ [1−42] in a sirt1 -dependent manner. [score:3]
In addition, in our hands experimental inhibition of miR-212 and/or miR-132 had no effect on cell survival of hNT neurons after 48 h in the absence of Aβ [1−42]. [score:3]
microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus. [score:2]
[1 to 20 of 13 sentences]
16
[+] score: 57
When stimulated with LPS, human macrophages have been shown to up-regulate miR-132 [46] and both miR-132 and miR-212 can regulate the expression of proteins involved in the inflammatory response [47]. [score:7]
miR-132 is the only miRNA differentially expressed both during granulopoiesis and in skin window PMNs, with a cluster 6 expression pattern and an additional increase in expression in activated neutrophils. [score:7]
In addition, miR-132 has been shown to be up-regulated in the monocyte/macrophage population from patients suffering from rheumatoid arthritis [48], [48,49] and miR-297 has been found to be up-regulated in serum from patients that died from sepsis compared to survivors [49], [50]. [score:6]
We chose miR-132* and miR-212 among the seven miRNAs up-regulated in exudated neutrophils for validation of the expression pattern between PMNs isolated from blood and the PMNs from skin window (Fig. 5B). [score:6]
3′ UTR analysis of the mRNAs encoding the pro-apoptotic proteins APAF1, CASP8 and FADD reveals possible targets for miR-212, miR-132, and miR-760, which are all up-regulated in exudated neutrophils compared to peripheral blood PMNs (table 4). [score:5]
hsa-miR-132* Targetscan: Hsa-miR-132* or hsa-miR-132-3p is not accessible on Targetscan. [score:5]
Of special interest is the pattern of miR-132 as it increases from a low expression in MB/PMs to peak expression in neutrophils from skin windows (Fig. 5C). [score:5]
When comparing the array data from PMNs and skin window PMNs, we found seven differentially regulated miRNAs (miR-297, miR-212, miR-132, miR-132*, miR-1915*, miR-760, and miR-27a*) that were all up-regulated in the extravasated neutrophils. [score:5]
Interestingly, all seven miRNAs (miR-297, miR-212, miR-1915*, miR-132, miR-27a*, miR-760 and miR-132*) were up-regulated in the skin window neutrophils (Fig. 4 and Table S2). [score:4]
C, Bar graph showing the schematic miR-132 expression during granulopoiesis and extravasation of PMNs based on array data. [score:3]
hsa-miR-132 Both Targetscan and miRanda: E2F5, IL1A, E2F7, IL1B, IL1BR1, IRAK4, MAP2K4,MAPK1, MAPK3, MAP3K8, MAP3K3, MMP8, MYB, MYD88, RNASEN, RUNX1, SMAD4, TGFBR1, TGFBR2. [score:3]
Interestingly, miR-212 and miR-132 are part of the same primary transcript and have the same seed region. [score:1]
[1 to 20 of 12 sentences]
17
[+] score: 56
A significant downregulation was observed for miR-132-5p, -132-3p and −143-3p while miR-143-5p and −574-5p were significantly upregulated. [score:7]
Additionally, downregulation of miR-132 has been detected in brains of patients suffering from Huntington’s and Alzheimer’s disease as well as from schizophrenia and bipolar disorders (summarized in [36]). [score:6]
Moreover, even though very speculative, miR-132 downregulation may underline neurodegenerative facets of the psychiatric diseases schizophrenia and bipolar disorder. [score:6]
Both strands of miR-132, which was the miRNA most robustly downregulated in our study in serum, CSF and LCLs, have been shown to exert multiple functions in neuronal development and morphogenesis. [score:5]
The latter possibility is suggested by the downregulation of both strands of serum miR-132, which has repeatedly been implicated in neuronal development and synaptogenesis [36]. [score:5]
While dysregulation of miR-143-5p/3p seems to be a common feature of ALS pathology, downregulation of miR-132-5p/3p and miR-574-5p/3p was evident in sporadic, TARDBP, FUS and C9ORF72, but not SOD1 mutant patients. [score:5]
Conversely, robust downregulation of both strands of miR-132 and miR-574 are found only in LCLs derived from patients with likely TDP-43 pathology, but not in LCLs carrying a mutation in SOD1. [score:5]
Thus downregulation of miR-132 seems to be a common feature of several degenerative nervous system conditions. [score:4]
Most interestingly, during this study FUS has been implicated in the biogenesis of several miRNAs that overlap with the TDP-43 binding miRNAs found to be downregulated in our study including FUS mutant LCLs, e. g. miR-132 and miR-143. [score:4]
Also in agreement with the results from ALS patient serum and CSF, both strands of miR-132 showed a similar decrease in LCLs of genetic ALS patients except for those carrying a mutation in the gene coding for SOD1 (Figure  4B). [score:2]
The most robustly regulated miRNAs in our study were miR-132-5p, miR-132-3p and miR-143-3p which were reduced to ~70% relative to healthy controls in both CSF and serum samples. [score:2]
Importantly, reduced levels of miR-132 have also been found in brains of patients with frontotemporal lobar degeneration with TDP-43 inclusions, a condition closely related to ALS with regard to the molecular pathogenesis and TDP-43 pathology [31]. [score:1]
Furthermore, by comparing the miRNA levels in CSF and serum of healthy controls we could show that some miRNAs, like miR-9-5p, miR-132-5p and miR-558-3p are more abundant in the CSF, while others are higher concentrated in serum. [score:1]
Hence, while a decrease of both strands of miR-143 seems to be a common feature of ALS patient derived LCLs, reduced levels of both strands of miR-132 and miR-574 accompany ALS cases with TDP-43 and/or FUS pathology. [score:1]
Moreover, the majority of miRNAs showed an up to approximately 50-fold higher concentration in the serum, while miR-9-5p, miR-132-5p and miR-558-3p were 2–3 times more abundant in the CSF (Figure  3; Table  3). [score:1]
While most miRNAs are up to 50-fold less concentrated in CSF samples, miR-9-5p, miR-132-5p and miR-558-3p are 2–3 times more abundant than in serum samples. [score:1]
[1 to 20 of 16 sentences]
18
[+] score: 56
Recently, Lei et al. identified YAP (Yes -associated protein) as a target of miR-132, showing that miR-132 alters the expression of YAP at the mRNA and protein level in hepatocellular carcinomas [48]. [score:5]
Notably, in lung cancer, a cancer also associated with asbestos exposure; miR-132-3p was shown to be downregulated as well [44]. [score:4]
Comparable results were obtained for ovarian cancer, showing significant downregulation of circulating miR-132-3p in serum of cancer patients [42]. [score:4]
Thus, it might be reasonable that miR-132-3p also regulates the expression of YAP in malignant mesothelioma. [score:4]
The elucidation of a possible regulatory function of miR-132-3p could offer additional insights in the pathogenesis of mesothelioma and might lead to new candidate targets for therapy. [score:4]
In patients with diagnosed mesothelioma, miR-132-3p was significantly downregulated in comparison to cancer-free subjects. [score:4]
We identified miR-132-3p as a new candidate biomarker for malignant mesothelioma, showing significantly different expression levels between mesothelioma patients and cancer-free controls formerly exposed to asbestos. [score:3]
The impact of two potential influencing factors on the levels of miR-132-3p was analyzed in subjects without malignant disease. [score:3]
Thus, the circulating miR-132-3p might be useful for diagnosis of mesothelioma utilizing human plasma samples. [score:1]
Thus, it was indicated that the and algorithm of miR-132-3p/miR-126 might be the best strategy to improve the diagnostic performance. [score:1]
ROC analysis revealed a similar AUC for miR-132-3p (0.76; 95% CI = 0.62–0.89) as seen in the entire verification group. [score:1]
Despite the slightly higher AUC for the sequential algorithm, it was indicated that the and algorithm of miR-132-3p/miR-126 might be the best strategy to improve the diagnostic performance due to higher sensitivities at applicable high specificities of 89% and 95% and the easy implementation of the and algorithm in clinical routine (the two-marker combination is defined as positive if both markers are positive). [score:1]
Unfortunately, a possible effect of miR-132-3p on YAP expression could not be investigated because YAP mRNA was not detectable in the plasma samples in this study. [score:1]
Combination of miR-132-3p with miR-126 improved diagnostic performance, resulting in enhanced sensitivity and specificity. [score:1]
The AUCs of miR-132-3p/miR-126 were 0.88 (95% CI = 0.80–0.95) for the sequential algorithm, 0.84 (95% CI = 0.71–0.95) for and algorithm, and 0.77 (95% CI = 0.64–0.89) for or algorithm (Figure 5). [score:1]
Regarding partial pleurectomy and therefore at least a substantial reduction in tumor burden, no influence of the miR-132-3p performance was observable between the study groups, also implicating that the biomarkers might be robust. [score:1]
Median level of miR-132-3p was 0.08 (IQR: 0.05–0.10) in mesothelioma patients and 0.11 (IQR: 0.09–0.14) in cancer-free controls. [score:1]
Thus, miR-132-3p fulfills the first key feature to be minimally invasive. [score:1]
However, using miR-132-3p and miR-126 within a panel, two different references for normalization are needed, implicating a less robust method. [score:1]
Therefore, appropriate studies (preferably in tumor tissues) are needed to follow up on the possible interaction between miR-132-3p and YAP in mesothelioma. [score:1]
Regarding the usual influencing factors age and smoking status, miR-132-3p seems to be relatively independent, further indicating the robustness of the candidate biomarker. [score:1]
Overall, the 40 combinations consisted of 15 different miRNAs (miR-20b, miR-24, miR-28-3p, miR-132-3p, miR-140-3p, miR-146b-5p, miR-155, miR-191, miR-193a-5p, miR-328, miR-331, miR-381, miR-532, miR-628-5p, and miR-660) that were used for further analysis. [score:1]
In contrast, the results indicate that miR-132-3p and the corresponding reference miR-146b-5p are not affected by low-grade hemolysis and thus are sufficiently robust. [score:1]
No significant fold changes > 2.0 could be observed for miR-24, miR-28-3p, miR-132-3p, and miR-146b-5p at low hemolysis grades < 0.5% (Figure 2 and Additional File 3). [score:1]
Overall, the miR-132-3p/miR-126 combination improved the diagnostic performance. [score:1]
Thus, it might be interesting in future studies to analyze miR-132-3p in lung cancers, especially with regard to the differential diagnosis of mesothelioma and adenocarcinomas of the lung. [score:1]
In order to ascertain the best combination of miR-132-3p and miR-126, three different approaches were tested, namely, sequential algorithm, and algorithm, and or algorithm. [score:1]
Plasma levels of miR-132-3p are not altered by hemolysis, the most problematic influencing factor for circulating miRNAs. [score:1]
Additionally, to assess the feasibility of miR-132-3p and miR-126 to detect the cancer at early stages, studies with a prospective design are urgently needed [7]. [score:1]
To the best of our knowledge, this is the first time to show miR-132-3p as a biomarker for malignant mesothelioma. [score:1]
Assigning fixed specificities, sensitivities were enhanced by the factor 1.8 for the and combination of miR-132-3p/miR-126 in comparison to miR-132-3p alone. [score:1]
Accordingly, the combination of miR-132-3p and miR-126 was assessed, showing an improved diagnostic performance. [score:1]
Neither age nor the smoking status influenced the miR-132-3p levels in human plasma (Table 4). [score:1]
[1 to 20 of 33 sentences]
19
[+] score: 54
Other miRNAs from this paper: mmu-mir-132, hsa-mir-212, mmu-mir-212
Klein et al. have proposed a homeostatic feedback mechanism that as a target of MeCP2, BDNF induces miR-132 synthesis through CREB pathway, miR-132 in turn silence MeCP2 expression [21]. [score:5]
miR-132 that is induced by p-CREB was also downregulated (Figure  4B). [score:4]
Interestingly, miR-132 was downregulated by 3d to 7d after SNI (Figure  4B). [score:4]
B, miR-132 was downregulated by 3d to 7d after SNI. [score:4]
Primers used in quantitative real-time PCR assays were as follows: miR-132 forward, 50-ACCGTGGCTTTCGATTGTTA-30 miR-132 reverse, 50-GGCGACCATGGCTGTAGACT-30 MeCP2 forward, ACAGCGGCGCTCCATTATC MeCP2 reverse, CCCAGTTACCGTGAAGTCAAAA For western blot analysis, total proteins were extracted from mice L4-L6 DRG and spinal cord using FDTMRIPA Buffer add protease inhibitors and phosphatase inhibitors (Roche). [score:3]
Primers used in quantitative real-time PCR assays were as follows: miR-132 forward, 50-ACCGTGGCTTTCGATTGTTA-30 miR-132 reverse, 50-GGCGACCATGGCTGTAGACT-30 MeCP2 forward, ACAGCGGCGCTCCATTATC MeCP2 reverse, CCCAGTTACCGTGAAGTCAAAA For western blot analysis, total proteins were extracted from mice L4-L6 DRG and spinal cord using FDTMRIPA Buffer add protease inhibitors and phosphatase inhibitors (Roche). [score:3]
Primers used in quantitative real-time PCR assays were as follows: miR-132 forward, 50-ACCGTGGCTTTCGATTGTTA-30 miR-132 reverse, 50-GGCGACCATGGCTGTAGACT-30 MeCP2 forward, ACAGCGGCGCTCCATTATC MeCP2 reverse, CCCAGTTACCGTGAAGTCAAAA For western blot analysis, total proteins were extracted from mice L4-L6 DRG and spinal cord using FDTMRIPA Buffer add protease inhibitors and phosphatase inhibitors (Roche). [score:3]
MeCP2 was released to express when miR-132 decrease and provided injury body a protective response. [score:3]
miR-132 forms complementary pairing with 3′UTR of MeCP2 and prevent its expression at post-transcriptional level. [score:3]
We found that expression of miR-132 were detected in Spinal cord after SNI (Figure  4B). [score:3]
MeCP2 Acute pain SNI mo del Spinal cord p-CREB/miR-132 Mutations of methyl-CpG binding protein 2 (MeCP2) lead to Rett syndrome, a severe neurodevelopmental disorder [1]. [score:3]
Thereby, the neuroprotective response of MeCP2 induced by getting rid of miR-132 inhibition is speculated and demonstrated. [score:3]
Several studies have found that MeCP2 can be regulated by miRNAs especially miR-132 in specific areas of the brain. [score:2]
Our study shows that MeCP2 plays an analgesic role in both acute pain transduction and chronic pain formation through regulating CREB-miR-132 pathway. [score:2]
Levels of MeCP2 transcript and miR-132 were analyzed by qPCR. [score:1]
MeCP2 alleviated acute pain and neuropathic pain through P-CREB/miR-132 pathway in spinal cord. [score:1]
Studies showed that miR-132 can be induced by p-CREB [20]and take part in restricting MeCP2 level within a narrow range [21, 22]. [score:1]
Thus we would like to examine levels of miR-132 in SNI experiments. [score:1]
Figure 4Change of MeCP2 transcript, miR-132 and p-CREB after SNI. [score:1]
Transgenic miR-132 alters neuronal spine density and impairs novel object recognition memory. [score:1]
We found that through p-CREB/miR-132 signaling cascade is involved in MeCP2 -mediated pain transduction. [score:1]
The mechanism is through CREB/miR-132 signaling pathway in spinal cord. [score:1]
CREB/miR-132 pathway is involved in the protective response of MeCP2. [score:1]
[1 to 20 of 23 sentences]
20
[+] score: 53
In addition to the upregulated expression of miR-132 in solid tumors, it is present in embryonic stem cells, and normal brain [78, 79]. [score:6]
The expression of miR-132 in mammalian brain appears to be regulated by eight coexpressed, redox sensitive TFs. [score:6]
In addition to its known function of regulation of neuronal morphogenesis [80], miR-132 is predicted to downregulate more than 200 genes [19, 26]. [score:5]
Our results suggest that the expression of miR-132 is fine-tuned by the combinatorial interactions of several coexpressed TFs. [score:5]
For example, miR-132, previously shown to be differentially upregulated in six solid cancer types (breast, colon, lung, pancreas, prostate, and stomach carcinomas) [77], is predicted to be combinatorially regulated by 24 CRMs. [score:5]
In mammals, miR-132 is expressed in embryonic stem cells, cortical neurons, and is aberrantly regulated in several types of cancer. [score:4]
We have identified 24 CRMs that may regulate the expression of miR-132. [score:4]
The complex interlinks between expression patterns of miRNAs, their CRMs, and their TFs are apparent in the transcriptional control of miR-132. [score:3]
In zebrafish, miR-132 is expressed in adult female, caudal fin, and liver epithelium [88]. [score:3]
Taken together, it appears that miR-132 is a functionally important gene whose expression must be activated or repressed in several cell types. [score:3]
In cortical neurons, miR-132 was identified through a genome-wide screen as a transcriptional target of the redox sensitive TF, cAMP-response element binding protein (CREB) [80]. [score:3]
Taken together, our results suggest that in addition to CREB, miR-132 is regulated by coordinated interactions of other redox sensitive TFs. [score:2]
Why does such a large number of CRMs regulate miR-132? [score:2]
We have predicted the redox sensitive TFs AP-1, AP-2, c-Myb, EGR-1, EGR-2, MTF-1, and Sp-1 as potential TFs of miR-132 (Table S3). [score:1]
Sequence similarity searches indicate that miR-132 is well-conserved across several vertebrate genomes [87]. [score:1]
[1 to 20 of 15 sentences]
21
[+] score: 52
Here, we not only refine earlier observations by showing that the effect of miR-132 is mediated by the accumulation of amyloid pathology but also expand prior targeted studies of downstream effects by organizing the target genes in pathways to highlight cellular functions, such as protein acetylation that appear to be targeted by alterations in miR-132. [score:7]
All five of these protein acetylation genes lie within the top 20 predicted miR-132 target genes whose expression is inversely associated with miR-132 abundance in our cortical samples (p-values <0.00018, Table 4). [score:5]
Interestingly, both miR-132 and miR-129-5p target EP300, which encodes the histone acetyltransferase protein E1A -associated cellular p300 transcriptional co-activator, and each miRNA explains some of the variation in EP300 expression (adjusted R-squared 0.039 and 0.033 respectively). [score:5]
a This diagram presents an overview of (1) how the miR-132:Protein acetylation miR-pathway was constructed from the KEGG pathways database and Targetscan miRNA binding target prediction database and (2) how a score was derived to assess the association of this miR-pathway combination with pathological AD diagnosis. [score:5]
b This heatmap illustrates the relation of miR-132 with the outcome measures (AD, NP, and NFT) and the mRNA expression levels of five of its target genes that are member of a protein acetylation miR-pathway. [score:3]
Finally, by performing analyses integrating both miRNA and RNA sequence data from the same individuals (525 samples), we characterize the impact of AD associated miRNA on human brain expression: we show that the effects of miR-132 and miR-129-5b converge on certain genes such as EP300 and find a role for miR200 and its target genes in AD using an integrated miRNA/mRNA analysis. [score:3]
While miR-132 may thus be influencing AD, in part, through histone acetylation and chromatin remo deling, miR-129-5p appears to be regulating genes related to the regulation of transcription. [score:3]
Specifically, miR-132 (P = 2 × 10 [−8]) and miR-129-5p (P = 3.9 × 10 [−6]) were found to be diminished in expression in subjects with AD, consistent with prior studies [12, 13]. [score:3]
c The relationship between miR-132 and one of its targets, EP300, is demonstrated in a scatterplot. [score:3]
The miR-132 association with EP300 expression confirms earlier reports and in vitro studies [12, 14, 36, 37], illustrating the robustness of our results and the relevance of earlier studies. [score:3]
The robustness of these results is nicely demonstrated by our lead miRNA, miR-132, which has been validated to be associated with AD in prior targeted studies [12, 13, 39] and for which selected putative target genes have been evaluated in brain samples, including EP300 and SIRT1 [12, 14]. [score:3]
Recently, certain miRNA, such as miR-132 have been associated with pathologic AD [12– 16]. [score:1]
This is visualized by the edge linking miR-132 and NP in the network mo del. [score:1]
Salta E, Sierksma A, Vanden Eynden E, De Strooper B. miR-132 loss de-represses ITPKB and aggravates amyloid and TAU pathology in Alzheimer's brain. [score:1]
Ni B, Rajaram MV, Lafuse WP, Landes MB, Schlesinger LS: Mycobacterium tuberculosis decreases human macrophage IFN-γ responsiveness through miR-132 and miR-26a. [score:1]
As shown in Fig. 3b-d, miR-132 explains approximately a third of the association of each gene to AD, and therefore it does not appear to be the sole driver of the role of these protein acetylation genes in AD. [score:1]
These traits are all correlated with one another (Fig. 2b, Additional file 1: Table S3), making it difficult to understand where an miRNA’s primary effect may be exerted simply by looking at the univariate results: for example, while miR-132 is significantly associated with both NP and NFT in separate analyses (Table 1), it appears, in the joint network mo del, that its effect may be driven predominantly through NP. [score:1]
The pathologic AD -associated miRNA, miR-132 and miR-129-5p, were associated with both NP and NFT (Table 1). [score:1]
Of the 11 miRNA previously reported to be associated with AD in the prefrontal cortex, only miR-132 and miR-129-5p replicated. [score:1]
To provide perspective on effect size, miR-132 explains 6.7% of the variance in AD, which is similar to the 6.1% variance explained by APOE ε4 in our data and 6% in previous literature [35]. [score:1]
[1 to 20 of 20 sentences]
22
[+] score: 49
Other miRNAs from this paper: hsa-mir-134
LTP of synaptic transmission in the dentate gyrus of rodents is accompanied by an upregulation of miRNA-132 [114], while its overexpression in cortical neurons regulates short-term plasticity [115]. [score:7]
Remarkably, reducing miRNA-132 neonatal expression by lentiviral infection [116] or counteracting the miRNA-132 downregulation in response to monocular deprivation [117] effectively prevents ocular dominance plasticity in the developing visual system. [score:6]
Interestingly, neonatal blockade of miRNA-132 expression in early life results in an immature state of dendritic spines [116], whereas counteracting the miRNA-132 downregulation after monocular occlusion increases the percentage of mushroom-stubby dendritic spines that represent the more stable state of spines [117]. [score:6]
Interestingly, downstream target genes regulated by miRNA-132 mediate phenomena of chromatin remo deling and protein translation in the suprachiasmatic nucleus of rodents [113], these two molecular processes being critically involved in the occurrence of neuronal plasticity. [score:6]
This is consistent with the observation that overexpression of miRNA-132 in neuronal cultures promotes neuronal morphogenesis [111] and is in line with the fact that transgenic mice overexpressing miRNA-132 in forebrain regions display an increased spine density [112]. [score:5]
The effect of miRNA-132 on dendrite morphology seems to be mediated by the activation of the Rac1-PAK actin-remo deling pathway that is due to the miRNA-132 translational inhibition of the mRNA that encodes the protein p250GAP, which is a Rho family GTPase activating protein [110]. [score:5]
It has been reported that miRNA-132 is rapidly upregulated after eye opening in normally reared animals. [score:4]
It has been reported that synaptic activity promotes a CREB -dependent miRNA-132 expression and that miRNA-132 induction is necessary for the activity -dependent dendritic growth [109]. [score:3]
This phenomenon is delayed by dark rearing, whereas monocular deprivation in early life results in a decrease of miRNA-132 expression. [score:3]
More recently, evidence for the role of miRNA-132 as a mediator of visual cortical plasticity has been obtained in vivo by using the experience -dependent monocular deprivation paradigm. [score:1]
These findings suggest that miRNA-132 is a molecular transducer of the action of visual experience on developing visual circuitries, possibly acting through modulation of dendritic spines plasticity [118]. [score:1]
These data highlight the notion that optimal physiological levels of miRNA-132 are critical for plasticity to occur during the critical period. [score:1]
Recent experimental evidence points toward a key role for another microRNA, miRNA-132, as a molecular transducer of neuronal plasticity. [score:1]
[1 to 20 of 13 sentences]
23
[+] score: 46
The pathway of PGRN or PGRN itself is influenced by several miRNA including miRNA-132, miRNA-659-3p, miRNA-107 and miRNA-9. The majority of miRNA with links to various diseases, as e. g., miRNA-132, have been found through profiling miRNA that are either up- or down-regulated after certain traumatic events (status epilepticus, traumatic brain injury) or in certain neurodegenerative disorders such as FTD and Alzheimer’s Disease (AD). [score:8]
One of the effects of the low expression of miRNA-132/212 is that it leads to an up-regulation of a transmembrane protein (TMEM106B), which disturbs the PGRN pathway and therefore has a part in increasing the likelihood of FTD. [score:6]
MiRNA-132 is one the best researched miRNA as it is the most consistently up-regulated miRNA following a SE [46]. [score:4]
Thus far no studies have examined possible long-term effects, but considering the role of miRNA-132 in FTD blocking miRNA-132 and consecutive down-regulation of PGRN may also have a harmful effect on the brain after status epilepticus. [score:4]
On the other hand, and similarly to miRNA-132, in epilepsy (animal mo del and human) miRNA-9 has shown to be elevated, possibly being proepiletogenic through inhibiting the NFkB1-transcript and therefore increasing inflammation [58] as well as increasing migration [59]. [score:3]
Over -expression of miRNA-132 has also shown to contribute to epileptogenesis through neuronal and dendritic sprouting as well as increased migration [53]. [score:3]
What we know so far about the PGRN pathway in relation to the miRNA-132-cluster and the role of miRNA-132 in neurodegenerative diseases also hints at important neuroprotective effects of miRNA-132. [score:3]
For example, a reduced expression of the miRNA-132-cluster has been verified for two forms of dementia, FTD and AD [54]. [score:3]
Inhibition of miRNA-132 resulted in a reduction of the number of seizures in mice after pilocarpine -induced SE [49]. [score:3]
Chen-Plotkin A. S. Unger T. L. Gallagher M. D. Bill E. Kwong L. K. Volpicelli-Daley L. Busch J. I. Akle S. Grossman M. van Deerlin V. TMEM106B, the risk gene for frontotemporal dementia, is regulated by the microRNA-132/212 cluster and affects progranulin pathways J. Neurosci. [score:2]
For FTD, Chen-Plotkin et al. (2012) have demonstrated that all three members of the miRNA-132-cluster have shown <50% expression in FTD-brains compared to normal controls [55]. [score:2]
As reported above, blocking miRNA-132 following a SE has shown to cause short-term positive effects. [score:1]
This may have negative effects after a SE since it could increase the size of epileptogenic lesions, but on the other hand suggests a rather important role of miRNA-132 in the nervous system. [score:1]
3.4. miRNA-132. [score:1]
The miRNA-132 cluster consists of miRNA-132a, miRNA-132* and miRNA-212. [score:1]
This research also indicates a more general role of miRNA-132, one that is not specific to SE. [score:1]
[1 to 20 of 16 sentences]
24
[+] score: 44
While mir-132 itself had significantly downregulated expression in RC disease muscle, the average expression of its target genes was significantly upregulated in RC disease, both of which were again reversed in RC disease FCLs (Fig. S2 in File S3). [score:19]
On average, the miR132 target genes were significantly upregulated by an average of 6.5% in RC disease muscle (p = 2.8E [−12]) and downregulated by an average of 1.8% in RC disease FCLs (p = 0.04). [score:13]
Differential expression of miR132 target genes in RC disease. [score:7]
145 genes predicted as miR132 targets by starBase (http://starbase. [score:3]
A particularly noticeable gene at the downstream end of this network was mir-132, which is a microRNA that regulates cytokine production and is induced by nutritional stress [15]. [score:2]
[1 to 20 of 5 sentences]
25
[+] score: 43
With respect to the miR-212/132 cluster, inhibition of miR-132 and miR-212 gave rise to the upregulation of PTGS2 and the inhibition of miR-212 resulted in the upregulation of IL15 (Figure  3E). [score:11]
To perform the miRNA inhibitor experiments, we used unlabeled miRCURY LNA™ microRNA Power inhibitors to inhibit miR-99b (reference 4101513), miR-let-7e (reference 4103550), miR-125a (reference 4103094), miR-132 (reference 4103093), miR-212 (reference 4104787) or a control (Negative Control A, reference 199006) Exiqon, Vedbaek, Denmark. [score:7]
In the case of the miRNAs in the miR-212/132 cluster, miR-212 was found to target CX3CR1 and HBEGF, and miR-132 targeted IRF1 and NR4A2. [score:5]
On the other hand, miR-132 targets PTGS2, and miR-212 also targets PTGS2 and IL15 (Figure  3D). [score:5]
This suggests that the functions of miR-132 and miR-212 are involved in the early events of osteoclastogenesis, since their expression levels are tightly regulated and constrained to the first four days of differentiation. [score:4]
The raw expression data are listed in full in Additional file 1. The array expression data were validated in the samples used (validation set), and in a larger cohort of samples obtained from independent donors (replication set) using Exiqon microRNA LNA™ PCR primer sets (hsa-miR-99b-5p, reference 204367; hsa-miR-125a-5p, reference 204339; hsa-miR-132-3p, reference 204129; hsa-miR-212-3p, reference 204170; hsa-miR-103a-3p, reference 204063). [score:4]
Figure 4 Comparison of changes in the expression levels of the miRNAs within the miR-99b/125a/let7e and miR-132/212 clusters during osteoclast differentiation, and changes during monocyte-to-macrophage and monocyte-to-dendritic cell differentiation. [score:3]
Additional file 2: (A) Heatmaps corresponding to putative targets for all miRNAs within the miR-99b/125a/let7e and miR-132/212 clusters using miRWalk. [score:3]
In contrast, miR-212/132 cluster miRNAs peaked at day 3, displaying an increase of around 50-fold (miR132) to 170-fold (miR-212), followed by an approximately 5-fold drop (Figure  1F, bottom). [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 39
Of particular interest are a set of cellular miRNAs, such as Let-7i, miR-199a-3p, and miR-132 that are downregulated after infection, resulting in an upregulation of cellular proteins that are known to be recruited and utilized by the HTLV-1 promoter. [score:7]
AntagomiRs used include anti-hsa-Let-7i to target p50 and p65 miRNA, anti-hsa-miR-132 to target GSK-3β miRNA, and anti-hsa-miR199a-3p to target IKK-β and BRM miRNA. [score:7]
Based on three recent studies which examined expression changes of cellular miRNAs in HTLV-1 infected cell lines, we selected the downregulated miRNAs, miR-199a, miR-132, and miR-Let7i for further analysis [67], [89]– [90], [92]. [score:6]
Upon KSHV (Kaposi’s sarcoma -associated herpesvirus) infection, as well as HSV-1 (herpes simplex virus-1) and HCMV (human cytomegalovirus) infection, miR-132 is upregulated and regulates the transcriptional co-activator p300 [95]. [score:5]
HTLV-1 infection results in a dramatic up (i. e. miR-130b, miR-18a, miR-20b) and downregulation (i. e. Let-7i, miR-132, miR-199a) of many host cellular miRNAs [67]. [score:4]
Here the rationale was that Tax would decrease Drosha levels, resulting in downregulation of miRNA, such as Let7i, miR-199a-3p and miR-132. [score:4]
AntagomiRs were obtained from Qiagen as follows: miScript miRNA inhibitor Anti-hsa-let-7i (Catalog # MIN0000415), Anti-hsa-miR-199a-3p (Catalog # MIN0000232), and Anti-hsa-miR-132 (Catalog #MIN0000426). [score:3]
B) 293T cells were transfected with Tax (5 µg) or antagomiRs (100 nM) targeting miR-199a-3p, miR-132, or Let7i. [score:3]
[1 to 20 of 8 sentences]
27
[+] score: 38
Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-30a, hsa-mir-204, hsa-mir-155
Similar mechanism was also reported elsewhere that miR-132 inhibited colorectal cancer cell invasion and metastasis via directly targeting ZEB2 [51]. [score:6]
For example, Tian et al. revealed in vitro that miR-132 inhibited cell proliferation, invasion, and migration in ovarian cancer by targeting the transcription factor E2F5 [49]. [score:5]
You et al. showed that miR-132 suppressed the migration and invasion of human non-small-cell lung cancer cells via targeting the EMT- (epithelial-to-mesenchymal transition-) related transcription factor ZEB2 [50]. [score:5]
In the present study, we identified 4 significantly downregulated miRs, hsa-miR-204-5p, hsa-miR-155-5p, hsa-miR-132-3p, and hsa-miR-19b-3p, in human GC tissues by a combination of the high-throughput miR sequencing approach as well as subsequent qRT-PCR validation. [score:4]
Consistently, these studies agreed that the alteration of miR-132 showed a downregulated pattern. [score:4]
Taken together, our data demonstrated a downregulated miR profiling in human GC tissue, which was further agreed by in vitro results for hsa-miR-204-5p, hsa-miR-155-5p, and hsa-miR-132-3p. [score:4]
This approach allowed us to identify 5 differentially expressed miRs, hsa-miR-132-3p (A, p = 0.013), hsa-miR-155-5p (B, p = 0.031), hsa-miR-19b-3p (C, p = 0.002), hsa-miR-204-5p (D, p = 0.016), and hsa-miR-30a-3p (E, p = 0.019), that were significantly modulated between tumoral and peritumoral tissues (Figure 1). [score:3]
Together with our study, these results indicate that miR-132 might act as a tumor suppressor. [score:3]
Moreover, several research groups tentatively explored the underlying mechanisms of miR-132 in cancer development. [score:2]
Similar results were also observed for hsa-miR-155-5p (MGC-803: t = 20.281, p = 0.000; BGC-823: t = 5.286, p = 0.006; and GTL-16: t = 3.196, p = 0.033) as well as for has-miR-132-3p (MGC-803: t = 7.755, p = 0.001; BGC-823: t = 4.707, p = 0.009; and GTL-16: t = 3.314, p = 0.032), as shown in Figure 3. However, we failed to replicate the in vivo findings of hsa-miR-19b-3p or has-miR-30a-3p in the present three GC cell lines (data not shown). [score:1]
As shown above, the miR sequencing and qRT-PCR results agreed with each other for the modulation pattern of hsa-miR-132-3p, hsa-miR-155-5p, hsa-miR-19b-3p, and hsa-miR-204-5p in human GC. [score:1]
[1 to 20 of 11 sentences]
28
[+] score: 38
Analysing miR expression in PTen [wt] prostate cells treated with PI3K/PTEN modifying drugs showed that the mTORC1 inhibitor (Tem) decreased miR-155, miR-150 and miR-132 expression, while inhibition of the ectopically expressed wild type PTEN with the highly selective PTen inhibitors SF1670 [N-(9,10-Dihydro-9,10-dioxo-2-phenanthrenyl)-2,2-dimethyl-propanamide] and bpV(HOpic) [Dipotassium bisperoxo (5-hydroxypyridine-2-carboxyl) oxovanadate] increased miR expression (Fig.   6a). [score:15]
MiR-155 inhibitor treatment increased the expression of Nkx3-1, Nkd, and Wee1, while the miR-132 inhibitor increased the expression of Hhip, Fox2p, and Eif4a2. [score:9]
Left hand side = miR155 inhibitor, right hand side = miR132 inhibitor. [score:5]
The microRNAs mmu-miR-155 and mmu-miR-132 were validated by qPCR of the whole cohort of mouse tissues (ko = 8, wt = 11) (see Fig.   2d, upper panel) and were found to be overexpressed by over 3-fold in Pten [−/−] prostates. [score:3]
b Crystal violet cell growth assay of Pten [−/−] tissue-derived cells transfected with a mir-155 or mir-132 inhibitor (or scrambled control) for 48 h. Data are plotted as % cell survival normalised to mock transfected cells. [score:2]
MiR-132 expression is associated with inflammation, inducing proliferation of endothelial cells in the tumour environment [35]. [score:2]
c Crystal violet cell growth assay of Pten [−/−] cells transfected with a mir-155 or mir-132 inhibitor (or scrambled control) and treated with increasing doses of temsirolimus. [score:2]
[1 to 20 of 7 sentences]
29
[+] score: 37
For the latent stage, 18 consistently differentially expressed mature miRNA sequences were identified: 8 were up-regulated (miR-212-3p, miR-21-5p, miR-132-3p, miR-20a-5p, miR-17-5p, miR-27a-3p, miR-23a-3p, miR-146a-5p) and 10 were down-regulated (miR-139-5p, miR-551b-3p, miR-33-5p, miR-708-5p, miR-7a-5p, miR-935, miR-138-5p, miR-187-3p, miR-30e-3p, miR-222-3p) (Table  2). [score:9]
For the acute stage, 9 mature miRNA sequences were identified as consistently differentially expressed: 8 were up-regulated (miR-132-3p, miR-21-5p, miR-21-3p, miR-212-3p, 2137, miR-711, miR-882 and miR-142-5p) and one was down-regulated (miR-302b-5p) (Table  2). [score:9]
For the chronic stage, 9 mature miRNA sequences were identified: 8 were up-regulated (miR-146a-5p, miR-23a-3p, miR-135b-5p, miR-21-5p, miR-132-5p, miR-132-3p, miR-210-3p, and miR-212-5p) and one was down-regulated (miR-551b-3p) (Table  2). [score:7]
The most common up-regulated miRNAs across the analyzed set of expression profiles were miR-21-5p (15 profiles), followed by miR-132-3p, miR-23a-3p, miR-212-3p, miR-146a-5p, miR-27a-3p, miR-129-5p, miR-203a-3p, miR-17-5p, miR-19a-3p (Supplementary Table  S4). [score:6]
Neither of TLE-HS profiles included in the meta-analysis has reported significant up-regulation of miR-21 or miR-132. [score:4]
The role in inflammation has also been attributed to both miR-21 [56] and miR-132 [57]. [score:1]
The only 3 common miRNAs that were found between all 3 stages of epileptogenesis were miR-21–5p, miR-132–3p and miR-212–3p. [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 37
Other miRNAs from this paper: mmu-mir-132
However, miR-132 was found to be upregulated during acute infection regardless of the parasite genotype, a phenomenon related to its effects on infection and inflammation [19]. [score:4]
Given miR-132 was upregulated before entering the chronic phase, this might be a potential cause for the observed deficit. [score:4]
Similar to our previous result [24], we found miR-132 was downregulated during chronic infection in mice with high MAG1 antibody level. [score:4]
Employing qPCR analysis, we found a decrease in the expression of miR-132 in mice with high MAG1 level (F(4,28) = 6.403, p = 0.0009; Ps < 0.05 between IgG+/MAG1+high vs all other groups, Fig 7A). [score:3]
0004674.g007 Fig 7 (B) MAG1 antibody level showed a trend towards negative correlation with miR-132 expression (Spearman’s correlation analysis). [score:3]
The expression of miR-132 showed a trend towards a negative correlation with MAG1 antibody level (r = -0.61, p = 0.0667, Fig 7B) 10.1371/journal. [score:3]
It is worth noting that transgenic mice overexpressing miR-132 exhibited increased neuronal spine density but impaired novel object recognition memory [38, 39]. [score:3]
The expression of miR-132 showed a trend towards a negative correlation with MAG1 antibody level (r = -0.61, p = 0.0667, Fig 7B) 10.1371/journal. [score:3]
Gene expression of miR-132. [score:3]
Another possible reason for cognitive deficit in T. gondii IgG seropositive mice might include miR-132 dysregulation during infection. [score:2]
Lately, miR-132 has been demonstrated to affect multiple neuronal functions and its dysregulation is linked to several neurological disorders [25]. [score:2]
The selection of striatum is based on previous finding where significant change of miR-132 was noticed [19, 24]. [score:1]
For the mouse striatum, gene expression of miR-132 was measured. [score:1]
, et al (2014) MicroRNA-132 dysregulation in Toxoplasma gondii infection has implications for dopamine signaling pathway. [score:1]
[1 to 20 of 14 sentences]
31
[+] score: 35
Finally, linking differentially expressed miRNAs to their potential differentially expressed target using the algorithm published by Kertesz et al [25] identified a total of 11 potential miRNA-mRNA pairs: COL21A1 (collagen, type XXI, alpha 1; targeted by hsa-miR-155), CYP46A1 (cytochrome P450, family 46, subfamily A, polypeptide 1; targeted by hsa-miR-342-3p), KCNJ1 (potassium inwardly-rectifying channel, subfamily J, member 1; targeted by hsa-miR-155), MADCAM1 (mucosal vascular addressin cell adhesion molecule 1; targeted by hsa-let-7i), MRPS26 (mitochondrial ribosomal protein S26; targeted by hsa-miR-15a), OR2T29 (olfactory receptor, family 2, subfamily T, member 29; targeted by hsa-miR-143), RPS9 (ribosomal protein S9; targeted by hsa-miR-132), SLC10A1 (solute carrier family 10 (sodium/bile acid cotransporter family), member 1; targeted by hsa-miR-31), SLC16A8 (solute carrier family 16, member 8 (monocarboxylic acid transporter 3); targeted by hsa-miR-31), SNTG1 (syntrophin, gamma 1; targeted by hsa-miR-21) and TRPC5 (transient receptor potential cation channel, subfamily C, member 5; targeted by hsa-miR-335). [score:29]
MiR-132, which targets the retinoblastoma tumor suppressor gene and leads to enhanced cell proliferation [48], has been shown to be over-expressed in tongue carcinomas [49], which was also found in our study. [score:6]
[1 to 20 of 2 sentences]
32
[+] score: 34
Transition between gestational week-6 to week-7 brought about a marked reciprocal change in the expression of those targets, with a robust increase in LIN28B mRNA expression and a significant decrease of Let-7a, and to a lesser extent mir-132 and mir-145 levels. [score:7]
In turn, Let-7 miRNAs participate in the regulation of LIN28 expression, which is controlled also by other upstream elements, such as myc, and, according to bioinformatics predictions, other miRNAs, as mir-132 and mir-145, thus forming a complex regulatory hub that is involved in different processes [19]. [score:5]
Expression profiles of mir-132, mir-145 and mir-323-3p in embryonic tissue from early ectopic pregnancies. [score:3]
Targets analyzed were: LIN28B (A), Let-7a (B), mir-132 (C), mir-145 (D) and mir-323-3p (E). [score:3]
Expression levels of mir-132 and mir-145 declined between ≤6-week and later stages of early gestation, and these profiles were not substantially altered in ectopic gestation (Figure 3A–B ), although a non-significant trend for higher levels of mir-145 in ≤6-week ectopic embryonic tissue was detected. [score:3]
A similar profile was observed for mir-132 and mir-145, although the decline in expression was more gradual and less pronounced (e. g., on week-7, mean Let-7 levels were reduced in >80%, while mir-132 and mir-145 levels were nearly halved), and in the case of mir-145 only reached statistical significance on week-8 (Figure 1C–D ). [score:3]
Our analyses unveiled that very early (≤6-week) normal embryonic tissue expresses virtually negligible levels of LIN28B but maximal levels of Let-7a, as well as mir-132 and mir-145. [score:3]
Our comparative analyses revealed that, in contrast to Let-7a, mir-132 and mir-145, the embryonic expression of mir-323-3p increased during early pregnancy, with minimal levels being detected in ≤6-week embryonic tissue that raised thereafter. [score:3]
For miRNA analyses, expression levels of Let-7a, mir-145, mir-132 and mir-323-3p were assayed, following a previously published procedure [19]. [score:2]
The regulatory roles in early placentation of mir-132 and mir-145, whose levels also decline during this time-window and are predicted to participate in the regulation of LIN28B synthesis [19], merit further investigation. [score:1]
In this context, the aim of this work is to evaluate the expression patterns of LIN28B mRNA, as well as the related Let-7, mir-132 and mir-145, in human embryonic tissue from early gestation, between weeks 5 and 9 of amenorrhea. [score:1]
[1 to 20 of 11 sentences]
33
[+] score: 34
Other miRNAs from this paper: hsa-mir-137
Thus, knockdown PTEN leads to increased phosphorylation level of CREB Ser-133 site, which in turn promotes expression of miR-132 and then decreases expression of MeCP2 (Fig. 4D). [score:6]
PTEN regulates MeCP2 via CREB -mediated miR-132 expression. [score:4]
MeCP2 translation has also been reportedly regulated by miR-132, and blocking miR-132 -mediated repression increased MeCP2 levels in cultured neurons, and loss of MeCP2 reduced miR-132 levels in vivo 25. [score:4]
As PTEN has been found to regulate the de-phosphorylation of CREB, which plays a critical role in regulating microRNA-132 23. [score:3]
Previous studies found that CREB acted as a protein substrate of PTEN phosphatase in the nucleus 23, and miR-132 inhibitors largely blocked the effects of CREB on dendrite maturation 24. [score:3]
Conversely, PTEN can indirectly regulate MeCP2 via CREB and miR-132. [score:3]
PTEN regulated CREB phosphorylation and miR-132. [score:2]
MeCP2 is reportedly regulated by the CREB -induced miRNA, miR-132 24 25. [score:2]
These results suggest that CREB and miR-132 may be involved in the regulation of MeCP2 by PTEN. [score:2]
We also demonstrated that PTEN regulated MeCP2 via the transcription factor CREB, and another specific miRNA, miR-132. [score:2]
Taken together, we therefore proposed that PTEN dephosphorylated CREB at Ser133 and repressed miR-132, resulting in the reciprocal regulation of MeCP2. [score:2]
In addition, pri-miR-132 levels were increased by KCl stimulation in PTEN RNAi neurons. [score:1]
[1 to 20 of 12 sentences]
34
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
[1 to 20 of 2 sentences]
35
[+] score: 33
Upon KSHV infection, miR-132 targets the transcriptional co-activator EP300 and downregulates the interferon response, increasing viral gene expression. [score:8]
KSHV infection of human LECs induces an early antiviral miRNA response from miR-132 and miR-146a and inhibition of these miRNAs suppressed viral gene expression (82). [score:7]
Overexpression of miR-132 negatively regulates inflammation by impairing the expression of IFN-β and interferon-stimulated gene 15. [score:6]
Anti-miR-132 was shown to inhibit angiogenesis and decrease tumor burden in a mouse mo del of human breast carcinoma (41). [score:3]
Inhibition of miR-132 in activated LECs results in increased AGO2 and the anti-angiogenic miR-221, providing further support for the function of miR-132 in endothelium. [score:3]
Additionally, VEGF can induce miR-132 and promote angiogenesis by suppressing p120RasGAP in human vascular endothelial cells (41). [score:3]
Studies have demonstrated miRNAs in the regulation of inflammation including miR-146a/b, miR-155, and miR-132 in both immune and non-immune cell types (79– 82). [score:2]
AGO2 levels are controlled by miR-132 in human LECs (42). [score:1]
[1 to 20 of 8 sentences]
36
[+] score: 32
Consistent with other glioma miRNA profiling studies [9], [14], [15], [31], we also observed down-regulation of miR-124, miR-128, miR-132, and miR-7, and up-regulation of miR-10b, amongst others, demonstrating that high-throughput sequencing can be an effective method for profiling miRNA expression. [score:9]
Similarly, CREB -induced miR-132 and miR-212, which share seed sequence homology, promote dendritic outgrowth from newborn neurons [55] and can target methyl CpG binding protein 2 (MeCP2), a regulator of neuroplasticity [56], [57]. [score:4]
To validate results from our deep sequencing experiments, we selected four differentially expressed miRNAs for further analysis: miR-21, miR-128, miR-124, and miR-132. [score:3]
Congruent with previous studies [42], [43], ATRA treatment of SH-SY5Y cells induced expression of the brain-enriched miRNAs miR-128 and miR-124 (Fig. 5A) as well as miR-132 and miR-7 (not shown). [score:3]
miR-7, miR-124, miR-128, miR-132, and miR-212 are amongst the most highly down-regulated miRNAs found in glioblastomas compared to non-transformed cells (Fig. 1, Table S4, S6). [score:3]
Additionally, we could not detect expression of miR-128, miR-124, or miR-132 in three glioblastoma cell lines (A172, U373, and U87). [score:3]
Primer extension analysis confirmed enhanced expression of miR-21 (Fig. 2A) and decreased expression of miR-128, miR-124, and miR-132 (Fig. 2B) in glioblastomas compared to non-tumor brain tissue samples. [score:3]
At least 20 cellular miRNAs were differentially expressed in the six glioblastomas assayed here compared to non-tumor brain tissue, many of which (miR-128, miR-124, miR-7, miR-132, miR-139) are consistently dysregulated in not only gliomas but also other brain cancers including medulloblastomas and neuroblastomas [33]. [score:2]
B. miR-128, miR-124, and miR-132 expression levels detected by primer extension. [score:2]
[1 to 20 of 9 sentences]
37
[+] score: 32
It needs to be tested, whether these correlations are due to altered expression of miR17-5p and miR-132 target genes, related to determination of visceral fat mass. [score:5]
0004699.g001 Figure 1(A) Typical example of omental adipose tissue morphology demonstrating lower macrophage infiltration in a patient with high miRNA-132 expression (miR-132 high) compared to a patient with low miRNA-132 expression (miR-132 low). [score:4]
In this context, there is recent evidence that miRNA-132 regulates expression of the cAMP response element -binding (CREB) protein, which plays a role in glucose homeostasis [21], [22]. [score:4]
Our data suggest that expression of miR-17-5p, miR-132, miR-134, miR-181a, miR-27a, miR-30e, miR-140, miR-147, miR-155, miR-197, and miR-210 play a role in the link between adipose tissue dysfunction and the development of obesity associated disorders including type 2 diabetes. [score:4]
However, it is unlikely that increased macrophage infiltration itself causes a negative relationship with the expression of miR-132, -26b, and -155. [score:3]
Visceral fat area was negatively associated with the expression of miR-17-5p and miR-132 (Table 3). [score:3]
Omental miRNA-132 (Figure 1A) and SC miRNA-26b and miRNA-155 expression are significantly related to the number of macrophages infiltrating the respective fat depot (Table 4). [score:3]
Relationships between miRNA (miR-132 and miR-198) expression and morphology of adipose tissue. [score:3]
In addition, we found significantly higher expression of miR-17-5p, miR-132, miR-134 in omental fat of NGT compared to T2D, whereas the opposite pattern was found for miR-181a. [score:2]
A causal role of miR17-5p and miR-132 in obesity related impaired insulin sensitivity is suggested by the result that both miRNAs are significantly related to lower visceral fat mass, lower circulating parameters of chronic glycemia as well as improved insulin sensitivity. [score:1]
[1 to 20 of 10 sentences]
38
[+] score: 32
In order to check if the mRNA expression of these chemokines was negatively correlated with the up-regulation of all the corresponding targeting miRNAs (i. e., let-7a, miR-25, miR-23b, miR-26a, miR-132, miR-140, miR-146a, miR-146b, miR-155 and miR-210) identified in Table S2, we measured their levels using qRT-PCR. [score:6]
Figure 3 shows the relative expression levels of let-7a, miR-25, miR-26a, miR-132, miR-140, miR-146a and miR-155 at 3 and 6 h (panel A), and of five chemokines of their predicted targets at 12 and 24 h (panel B). [score:5]
Several molecules that were differentially up-regulated at 3 and 6 h post- L. major infection, i. e., miR9, miR132, miR-146a, miR-155 and miR-187, are well known to control TLR-receptor signaling in monocytes [27], [50], [51]. [score:4]
Inflammatory cytokines and/or TLR-responsive miRNA also include miR-132 [57] and miR-9; the latter directly targets the NF-κB1 providing a rapid and efficient negative feedback loop on NF-κB dependent pathways [50]. [score:4]
Based on the observation that five chemokines (CCL2, CCL5, CXCL10, CXCL11 and CXCL12) are targeted by L. major-regulated miRNAs i. e., Let-7a, miR-25, miR-26a, miR-132, miR-140, miR-146a and miR-155, we show a negative correlation of transcript abundance with their corresponding miRNAs. [score:4]
Expression means of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3; panel A) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA mean levels at 12 and 24 h post-infection (panel B) in L. major-infected human macrophages. [score:3]
Expression of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA levels at 12 and 24 h post-infection in L. major-infected human macrophages. [score:3]
0002478.g003 Figure 3Expression means of let-7a, miR-25, miR-26a, miR-140, miR-146a and miR-155 at 3 h and miR-23b and miR-132 at 6 h post-infection of three healthy donors (D1, D2 and D3; panel A) is negatively correlated with CCL2, CCL5, CXCL10, CXCL11 and CXCL12 mRNA mean levels at 12 and 24 h post-infection (panel B) in L. major-infected human macrophages. [score:3]
[1 to 20 of 8 sentences]
39
[+] score: 28
In breast cancer, miR-132 suppresses cell proliferation, invasion, migration and metastasis of different breast cancer cells through direct suppression of hematological and neurological expressed 1 (HN1) [17]. [score:8]
Activation of Ahr by TCDD and DIM decreased the luciferase activities significantly, and these effects were reversed by co-transfection with as-miR-132 (Fig.   4c) and as-miR-212 (Fig.   4d), suggesting a regulatory role of the miRNA cluster on SOX4 gene expression. [score:4]
Over -expression of miR-132 and miR-212 showed inhibitory effects on migration of MDA-MB-231 and expansion of T47D cells in wound healing assay, and invasion in Boyden chamber in both cell lines compared with siNS -transfected controls (Fig.   3a and b). [score:3]
c and d Co-transfection of 3′UTR-SOX4-luc and miRNA antisense, as-miR-132 or as-miR-212, mitigated the inhibitory effects of TCDD and DIM on the luciferase activity in MDA-MB-231 and T47D. [score:3]
Moreover, miR-132 causes expression changes of genes involved in metabolism, DNA damage and cell motility in immortalized fibroblasts co-cultured with epithelial columnar cell hyperplasia (CCH) cells [19]. [score:3]
f Co-transfection of 3′UTR-SOX4-luc and miRNA mimics, miR-132 or miR-212, suppressed the luciferase activity in MDA-MB-231 and T47D. [score:3]
MiR-212 and miR-132 are tandem miRNAs at the same location on chromosome 17 in humans, called miR-212/132 cluster, and they share the same seed sequence and the transcriptional regulatory elements. [score:2]
The role of miR-212/132 cluster on migration of MDA-MB-231, expansion of T47D and invasion of breast cancer cells were examined by the transfection of miRNA mimics, miR-132 and miR-212, or antisense, as-miR-132, as-miR-212. [score:1]
MiR-212 and miR-132 are tandem miRNAs located in an intergenic region on chromosome 17 in humans, and they share the same seed sequence AACAGUCU. [score:1]
[1 to 20 of 9 sentences]
40
[+] score: 27
MiR-29a and miR-30b expression were down-regulated by almost all the tested polyphenols; miR-222 was down-regulated by caffeic acid (300 mg/d for 2 weeks) and hesperidin (30 mg/d for 2 weeks); miR-181a was down-regulated by curcumin (30 mg/d for 2 weeks) and hesperidin and up-regulated by naringin (30 mg/d for 2 weeks), quercetin (30 mg/d for 2 weeks) and proanthocyanidin (300 mg/d for 2 weeks); miR-132 was up-regulated by naringin [(] [88] [)]. [score:18]
MiR-132 expression is up-regulated in pancreatic islets of pre-diabetic (6 weeks old) and diabetic db/db mice (14–20 weeks) [(] [75] [)]; this increase improved glucose-stimulated insulin release and increased cell proliferation, which suggests that the modification of miR-132 levels might contribute to compensatory β-cell mass expansion elicited in response to IR [(] [75] [)]. [score:6]
However, hyperglycemic non-pregnant rodents have shown opposite expression of mir-29 and mir-132 families. [score:3]
[1 to 20 of 3 sentences]
41
[+] score: 26
One of the lately expressed miRNAs, the highly upregulated miR-132, has been shown to negatively affect the expression of interferon-stimulated genes through suppression of the p300 transcriptional co-activator, facilitating viral gene expression and replication [48]. [score:12]
In addition, Lagos et al. reported two groups of cellular miRNAs induced during primary KSHV infection of LECs: the “early” group reached its peak of expression at six hours post-infection, and included miR-146a, miR-31 and miR-132; the “late” group, which included miR-193a and Let-7i, steadily increased its expression during the next 72 hours [48]. [score:5]
Lagos D. Pollara G. Henderson S. Gratrix F. Fabani M. Milne R. S. Gotch F. Boshoff C. miR-132 regulates antiviral innate immunity through suppression of the p300 transcriptional co-activator Nat. [score:4]
Human miRNAs Validated Targets Regulated by Viral Proteins Functions References miR-21 - K15M Cell mobility[22] miR-31 FAT4 K15M Cell mobility[22, 23] miR-221/222 ETS2/ETS1 LANA and Kaposin B Cell migration[23] miR-30b/c DLL4 - Angiogenesis[25] miR-557/766/1227/1258/1301 RTA - Viral replication[39] miR-146a CXCR4 vFLIP Immune response[41] miR-1293 vIL-6 ORF57 Immune response[46, 47] miR-608 hIL-6 ORF57 Immune response[46, 47] miR-132 p300 - Immune escape[48] This work was supported by grants from a Center for Biomedical Research Excellence P20-GM103501 subaward (RR021970), the Ladies Leukemia League Grant (2014-2015), and the National Natural Science Foundation (NNSF) of China (81101791, 81272191, 81472547 and 81400164). [score:4]
Interestingly, a similar induction of functional miR-132 was also observed during infection of monocytes with herpes simplex virus-1 (HSV-1) and cytomegalovirus (CMV) [48], which indicated that this kind of miRNA -mediated antiviral immune response could be triggered by several viruses. [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 25
MicroRNAs (miRNAs), short (20–24 nt) non-coding RNAs, are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs 2, 3. Emerging evidence indicated that miRNAs are aberrantly expressed in different types of tumours 4, 5 and participate in human tumourigenesis and/or metastasis by directly targeting oncogenes or tumour suppressor genes 6, 7. Altered miRNA expressions, have been identified as modulators of tumour proliferation, apoptosis, and therapy resistance in BC 8. Indeed, specific miRNA dysregulation has been shown to correlate with BC 9. For instance, miR-21 is high expressed in BC tissue 10 while miR-132 is down-regulated in ductal carcinoma in situ of breast and acts as a tumour suppressor by inhibiting cell proliferation 11. [score:25]
[1 to 20 of 1 sentences]
43
[+] score: 25
Expression of miR-132 has been previously described as required for neuron morphogenesis and function, whereas significant down-regulation in miR-132 expression has been associated with -synuclein accumulation and neuronal malfunction in -synuclein (A30P)-transgenic mice [68], [69]. [score:8]
Additionally, Yang et al. showed that inhibition of endogenous miR-132 significantly increases differentiation of dopamine neurons, whereas prolific expression of miR-132 in embryonic stem cells dramatically represses dopamine neuron differentiation with no effect on the total number of neurons [70]. [score:5]
Yang et al. demonstrated through bioinformatics prediction, luciferase-reporter assay, and Western blot analysis that miR-132 could directly regulate expression of Nurr1, a critical transcription factor for midbrain dopamine neuron development and differentiation [70]. [score:5]
Interestingly, our OLR results indicate that miR-132 expression monotonically decreases in CSF as Lewy body pathology advances- findings concurrent with decreased expression levels of miR-132 in PD samples compared to controls (Table1; Table 7 ). [score:4]
As a potential regulator of methyl-CpG -binding protein, an important component of neurodevelopment and neurodegeneration, miR-132 is a prospective molecule of interest in PD diagnosis and treatment [70]. [score:3]
[1 to 20 of 5 sentences]
44
[+] score: 25
Interestingly, miR-132 has previously been reported to target and down-regulate a cellular transcriptional regulatory protein called Methyl-CpG -binding protein 2 (MeCP2) [184, 185]. [score:7]
In accordance with the miR-132 overexpression data, MeCP2 knockdown augmented HIV-1 production. [score:4]
The seed sequences of two of these miRNAs, SFVagm-miR-S4-3p and SFVagm-miR-S6-3p, are homologous to the cellular miR-155 and innate immunity suppressor miR-132, respectively. [score:3]
Conversely, overexpression of exogenous miR-132 promoted HIV-1 replication in Jurkat T cells and reactivated HIV-1 in a latently infected Jurkat cells. [score:3]
Accordingly, when compared to the resting cells, miR-132 levels were significantly upregulated in phytohaemagglutinin (PHA)-activated CD4 [+] T-cells isolated from healthy donors and peripheral blood mononuclear cells (PBMC) from HIV-1 patients. [score:3]
Alvarez-Saavedra M. Antoun G. Yanagiya A. Oliva-Hernandez R. Cornejo-Palma D. Perez-Iratxeta C. Sonenberg N. Cheng H. Y. miRNA-132 orchestrates chromatin remo deling and translational control of the circadian clockHum. [score:3]
However, MeCP2 knockdown did not reactivate latent HIV-1, which suggests that miR-132 modulates the biogenesis of HIV-1 and reactivation of latent HIV-1 via two mechanistically different routes. [score:2]
[1 to 20 of 7 sentences]
45
[+] score: 24
The third category had a high expression level on day 1 and down-regulated expression on day 7, and included miR-132, miR-186, miR-199, miR-338, and miR-219. [score:8]
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG (A) Schematic of the Tip110 3′UTR region with predicted miRNA binding sites (Tip110 miRNA). [score:1]
| | | | | | |3' UGACCCUGAAACAUCCGGUCAAPosition 633–639 of Tip110 3′UTRHsa-miR-132-3p5′. [score:1]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 23
Differential expression of the miR-132/212 family following infection with the extended MTBC panel. [score:3]
Transformation of BCG with RD1 from MTB resulted in a significant increase in miR-132-3p expression, not significantly different to that induced by MTB-Rv. [score:3]
Both MTB-Ra and MTB-Hk showed significantly lower miR-132-3p expression than virulent mycobacteria. [score:3]
Overall, these results indicate that the altered expression of the miR-132/miR-212 family is dependent on mycobacterial virulence and, more specifically, that the presence of the virulence -associated RD1 locus is sufficient to account for the stronger induction of the miR-132/212 family among virulent mycobacteria. [score:3]
For example, in light of the role of miR-132 in the negative regulation of the inflammatory response [65, 74, 80], it is tempting to speculate that the stronger miR-132 induction we observe contributes to the dampening of the early inflammatory response to infection by virulent mycobacteria. [score:2]
To quantify miRNA expression levels, cDNA was synthesized and quantitative real-time PCR (qPCR) performed using the Qiagen miScript PCR system and primers (miScript II RT Kit: 218161; miScript SYBR Green PCR kit: 218073; miR-92b-3p MS00032144; miR-132-3p MS00003458; miR-155–5p MS00031486; miR-212-3p MS00003815; miR-361-5p MS00004032; miR-361-3p MS00009555; U6 MS00033740) in a 7900 Real-time PCR system (Applied Biosystem). [score:2]
Moreover, the reduced induction of miR-132/212 after infection with an attenuated strain that secretes lower levels of the RD1-encoded virulence effector protein ESAT-6 [79] indicates that such an induction is associated with the secretion of this virulence factor. [score:1]
Of the 20 miRNAs that showed a vMTBC-specific response, it is worth noting the presence of miR-132-3p, the only miRNA that was significant at all time points. [score:1]
Additionally, both arms of miR-212—the other member of the miR-132/212 family due to their sequence homology and co-localisation on chromosome 17p13.3—also showed a vMTBC-specific response at 18h or 48h. [score:1]
To further investigate the role of virulence in the altered expression of the miR-132/212 family, we studied their response to an extended set of mycobacterial strains that differ in their virulence (Methods). [score:1]
Though the difference between the induction of this miRNA upon infection with virulent or avirulent MTB strains was not significant, the tendencies observed were consistent with miR-132-3p. [score:1]
Conversely, the detected differences between bacteria may reflect more subtle variations in magnitude and tempo that could, nonetheless, impact on bacterial pathogenesis, such as the case of the induction miR-132-3p. [score:1]
Furthermore, infection with BCG::RD1 – a recombinant strain of BCG containing the RD1 locus, the absence of which accounts, to a large extent, for the attenuation of BCG [66] – significantly increased the induction of miR-132-3p and miR-212-3p, with respect to BCG, attaining a level that was not significantly different from cells infected with the virulent strains (Fig. 2C,D and S6 Table). [score:1]
[1 to 20 of 13 sentences]
47
[+] score: 23
In breast cancer, miR-132, but not miR-212, inhibited cell proliferation and metastasis mediated by the NH1 gene (Hematological and Neurological expressed gene-1) (Zhang et al., 2014). [score:5]
In contrast, AhR activation by TCDD and 3.3′-diindolylmethane (DIM) regulated miR-132/212 expression in MDA-MB-231 and T47D breast cancer cells. [score:4]
The results show that AhR has specific functions in different immune cell populations: the AhR-inducible miR-132/212 cluster promoted inflammatory responses by inducing Th17 cells and suppressing the development of IL-10-producing T cells (Chinen et al., 2015). [score:4]
These data indicate that the miR-132/212 cluster participates in AhR -mediated development of Th17, but not Treg cells (Nakahama et al., 2013). [score:2]
In particular, it was shown that whereas Th17 differentiation via AhR depends on the miR132/212 cluster, Treg differentiation from naïve T cells by Transforming growth factor-β (TGF-β), with or without AhR ligands TCDD or 6-formylindolo[3,2-b]carbazole (FICZ), did not show significant differences in control and miR-132/212 double knock-out (D KO) mice. [score:2]
MiR-132 prohibits proliferation, invasion, migration, and metastasis in breast cancer by targeting HN1. [score:2]
Chromatin immunoprecipitation (ChIP) assays demonstrated AhR binding to the two xenobiotic responsive elements (XRE) located within 1 kbp of the upstream promoter of the miR-132/212 genes, thus supporting a direct transcriptional regulatory mechanism. [score:2]
Aryl hydrocarbon receptor -mediated induction of the microRNA-132/212 cluster promotes interleukin-17-producing T-helper cell differentiation. [score:1]
Additional work has addressed the role of the AhR-inducible miR-132/212 cluster in inflammatory and ulcerative colitis in mice. [score:1]
[1 to 20 of 9 sentences]
48
[+] score: 23
Counterregulatory efforts upon injury in IgA nephropathy of one or even all-glomerular cell types (endothelium, mesangial cells and podocytes) could explain the dramatic up-regulation of miR-132-3p. [score:5]
This is in line with miR-132-3p upregulation during transition between acute and fibrotic injury in a mouse mo del of folic acid -induced kidney injury and fibrosis 55. [score:4]
miR-132-3p was up-regulated 3-fold in crescentic IgA-GN compared to both controls and IgA-GN. [score:3]
One interesting target of miR-132-3p is Sirt1, which protected endothelial cells and enhances mesangial cell survival 57. [score:3]
In particular miR-132-3p, miR-30b-5p and miR-30c-5p were strongly expressed compared to reference miRNAs. [score:2]
Four miRNAs (miR-132-3p, miR-146-5p, miR-184, miR-708-5p) demonstrated high consistency throughout different normalization methods. [score:1]
Four miRNAs (miR-132-3p, miR-146-5p, miR-184, miR-708-5p) demonstrated high persistence throughout different normalization methods (at least 3 out of 5 normalization methods with similar significant results). [score:1]
Furthermore, miR-132-3p was highly increased in rat kidneys with hypertension and cardiac hypertrophy and seems to play a role in the Renin-Angiotensin-II-system 56. [score:1]
Specifically, miR-132-3p, miR-146-5p and miR-27a-5p were elevated in crescentic IgA-GN vs. [score:1]
In addition, miR-132-3p, miR-125b-5p and miR-21-5p were significantly elevated in crescentic IgA-GN vs. [score:1]
IgA-GN, whereas miR-132-3p and miR-184 demonstrated highest persistency throughout different normalization methods. [score:1]
[1 to 20 of 11 sentences]
49
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
During the preclinical phase of prion disease, a cluster of genes and miRNAs are dysregulated, such as miRNA-132-3p, miRNA-124a-3p, miRNA-16-5p, miRNA-26a-5p, miRNa-29a-3p, and miRNA-140-5p, and they follow associated patterns of expression (Majer et al., 2012). [score:6]
Downregulation of miR-132/212 impairs S-nitrosylation balance and induces tau phosphorylation in Alzheimer’s disease. [score:6]
Similarly, Lau et al. (2013) studied 90 samples of human brain affected with the AD, and found that miRNA-132-3p was strongly downregulated. [score:4]
In addition, the transcription factor FOXO1a was the target of miRNA-132-3p, which plays a crucial role in tau network (Lau et al., 2013). [score:3]
Interestingly, REST is the target of many brain-derived miRNAs such as miR-124a, miR-9, and miR-132 (Wu and Xie, 2006). [score:3]
Recently Wang Y. et al. (2017) showed that miRNA-132/212 impaired S-nitrosylation and induced tau phosphorylation via NOS1 pathway. [score:1]
[1 to 20 of 6 sentences]
50
[+] score: 22
We also found an age -associated increase of the median expression of miR-96 (p = 0.002), miR-145 (p = 0.024) and miR-9 (p = 0.026), decrease of the expression of miR-99a (p = 0.037), and no changes regarding miR-132 and miR-182. [score:5]
The expression of miR-132 and miR-182 remained stable (Table  2). [score:3]
pmirGLO: “empty” reporter vector; pmirGLO_FOXO1_5’: reporter vector containing DNA corresponding to the 5’ end of 3’UTR of FOXO1 mRNA; pmirGLO_FOXO1_3’: reporter vector containing DNA corresponding to the 3’ end of 3’UTR of FOXO1 mRNA; pre-miR-neg, pre-miR-145, pre-miR-132: miRNA precursors The median expression of any of the tested miRNAs did not differ between men and women, or between low-dose acetylsalicylic acid users and non-users, and all study subjects were analyzed together. [score:3]
The expression of IGF-1R, FOXO1, FOXO3a, as well as of miR-9, miR-96, miR-99a, miR-132, miR-145, and miR-182 was examined in PBMC of young (27.8 ± 3.7 years), elderly (65.6 ± 3.4 years), and long-lived (94.0 ± 3.7 years) Polish Caucasians using real-time PCR. [score:3]
Functional studies revealed that miR-96 and miR-182 interacted with human IGF-1R mRNA, and that miR-145 and miR-132 interacted with human FOXO1 mRNA. [score:1]
Using this approach, we selected miR-96, miR-99a, miR-145, and miR-182 for IGF-1R mRNA, and miR-9, miR-96, miR-132, miR-145, and miR-182 for FOXO1 mRNA. [score:1]
miR-145 and miR-132.3’UTR of IGF-1R mRNA contains two putative miR-96 and two putative miR-182 binding sites; therefore, each site was analyzed separately. [score:1]
miR-145 and miR-132. [score:1]
Fig. 2miR-145 and miR-132 interact with the 3’UTR of FOXO1 mRNA. [score:1]
Eighty ng of pmirGLO with or without cloned 3’UTR-encoding DNA and 5 pmol of pre-miRNA (pre-miR-96, pre-miR-182 or pre-miR miRNA Precursor Negative Control #2 for IGF-1R, and pre-miR-145, pre-miR-132 or pre-miR miRNA Precursor Negative Control #2 for FOXO1, Ambion, Life Technologies, Carlsbad, CA USA) were used. [score:1]
Co-transfection of pmirGLO_FOXO1_3’ with pre-miR-132 (Fig.   2b) decreased luminescence by 42.4% (p < 0.000001) suggesting that in silico-designated single binding sites for these miRNAs were functional. [score:1]
Both miR-145 (a) and miR-132 (b) interact with in silico indicated binding sites. [score:1]
[1 to 20 of 12 sentences]
51
[+] score: 22
Induction of miR-132/-212 leads to inhibition of IRAK4 mRNA expression. [score:5]
Interestingly, upregulation of miR-132/-212 was also observed with cross-tolerance when cells were primed with PGN and subsequently challenged with TLR5-ligand, flagellin. [score:4]
miR-132/-212 then inhibits IRAK4 leading to tolerance to PGN. [score:3]
Regulation of TLR2 -mediated tolerance and cross-tolerance through IRAK4 modulation by miR-132 and miR-212. [score:2]
It should be noted that in an earlier study using miR-132/-212 knockout mice, loss of the miRNA cluster did not apparently impact LPS-induction of specific plasma cytokine levels, including TNF-α (14). [score:2]
However, PGN -mediated tolerance occurs through binding of PGN to TLR2, transcriptional activation of CREB, and a subsequent rapid induction of miR-132/-212. [score:1]
This is not inconsistent with our findings in THP-1 monocytes that the role of miR-132/-212 in tolerance and cross-tolerance was primarily induced from TLR2 ligand PGN or PAM (13). [score:1]
A statistically significant increase in miR-146a, miR-132, miR-155, and miR-16 mRNA levels was seen in PBMCs from RA patients. [score:1]
TLR2/TLR5-Induced miR-132/-212 Functions in Tolerance and Cross-Tolerance. [score:1]
About the same time, it was shown that LPS could stimulate the production of miR-146a, miR-132, and miR-155 in THP-1 cells. [score:1]
We determined that unlike LPS -induced tolerance, PGN -induced tolerance occurs through rapid induction of miR-132/-212 via CREB transcription factor. [score:1]
[1 to 20 of 11 sentences]
52
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Tumor-suppressor miR-16 (downregulated in some cancers) and miR-132 (which is methylation-silenced in prostate cancer) have been identified as putative endogenous modulators of neuronal tau phosphorylation and tau exon 10 splicing, respectively (Bottoni et al., 2005; Hébert et al., 2010; Formosa et al., 2012; Rivas et al., 2012). [score:6]
MiR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. [score:5]
Downregulation of miR-132 by promoter methylation contributes to pancreatic cancer development. [score:5]
miR-132 is implicated in prostate and pancreatic tumorigenesis (Park et al., 2011; Zhang et al., 2011; Formosa et al., 2012) and downregulated in progressive supranuclear palsy, a neurodegenerative tauopathy related to the atypical parkinsonism of ALS-PDC (Smith et al., 2011). [score:4]
DNA methylation silences miR-132 in prostate cancer. [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 21
Expression of the miR-132 target, p250GAP, is inversely correlated with miR-132 levels and spinogenesis. [score:5]
Inhibition of miR-132 decreases both mEPSC frequency and the number of GluR1 -positive spines, while knockdown of p250GAP has the opposite effect. [score:4]
Expression of miR-132 enhances neurite outgrowth, dendritic morphogenesis, and spine formation (34– 37), and is induced by BDNF via CREB. [score:3]
Additionally, miR-132/p250GAP circuit regulates Rac1 activity and spine formation by modulating synapse-specific Kalirin7–Rac1 signaling. [score:2]
Furthermore, knockdown of p250GAP increases spine formation while introduction of a p250GAP mutant unresponsive to miR-132 attenuates this activity. [score:2]
It has been shown that CREB- and activity-regulated miR-132 is necessary and sufficient for hippocampal spine formation. [score:2]
These results suggest that neuronal activity regulates spine formation, in part, by increasing miR-132 transcription, which in turn activates a Rac1–Pak actin remo deling pathway. [score:2]
These include: let-7a, miR-124, miR-125a-5p, and miR-132. [score:1]
[1 to 20 of 8 sentences]
54
[+] score: 21
In particular, induced levels of miR-26a and miR-132 suppress signaling via direct targeting of p300 (32). [score:6]
miR-132 and miR-26a, which were upregulated upon infection, were found to be negative regulators of transcription coactivator p300. [score:5]
miR-132 and miR-26a were among 31 miRNAs identified by Ni et al. as differentially expressed in primary human MΦs infected with M. tuberculosis (32). [score:3]
For instance, the intracellular pathogen Mycobacterium tuberculosis can modulate expression of miRNAs (e. g., miR-26a and miR-132) to block signaling in M1 MΦ. [score:3]
p300 is part of the signaling cascade, which means that miR-132 and miR-26a are inhibitors of induced signaling. [score:3]
However, the following miRNAs are known to be involved in the MΦ response to mycobacterial infection: miR-144 (40), miR-132 (32), miR-26a (32), miR-155 (41), miR-146a (41), miR-145 (41), miR-222 (41), miR-27a (41), miR-27b (41), and miR-125b (42). [score:1]
[1 to 20 of 6 sentences]
55
[+] score: 20
Other miRNAs from this paper: mmu-mir-132
If T. gondii increases MiR-132 in dopamine neurons resulting in repression of Nurr1 expression, then the +/- mice would be more vulnerable to attenuated Nurr1 expression, which would likely have a greater effect on dopamine neuron gene expression and dopamine neurotransmission. [score:6]
MiR-132 was also recently found to negatively regulate Nurr1 expression and inhibit the differentiation of embryonic stem cells into dopamine neurons [110]. [score:5]
Since Nurr1 is also expressed in neurons in other brain regions, the effect of the +/- genotype combined with a possible direct effect of T. gondii on Nurr1 expression via MiR-132 could result in abnormal function of other brains regions, such as the ventral subiculum or prefrontal cortex. [score:5]
A recent finding by Xiao et al. reported that acute infection with T. gondii resulted in an increase in expression of MiR-132, a cyclic AMP-responsive element binding regulated microRNA [109]. [score:3]
, Dawson VL, et al MicroRNA-132 dysregulation in Toxoplasma gondii infection has implications for dopamine signaling pathway. [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 20
We validated the expression of these five selected miRNAs by qRT-PCR in the 10 cell lines and found that miR-146a was higher expressed in 3 triple -negative breast cancer cell lines: MDA-MB-231, MDA-MB-436 and SUM1315-BRCA1 (Fig. 1c), that miR-153 was higher expressed in 4 triple -negative breast cancer cell lines: MDA-MB-436, SUM1315MO2, SUM149PT and HCC1937 (Fig. 1d), and that miR-146b-5p, miR-132 and miR-212 were expressed in all 10 cell lines at different levels (Fig. S1) without a significant difference between the triple -negative, luminal or benign cell lines. [score:9]
From the selected miRNAs (listed in Table S4), we chose five miRNAs, i. e., two miRNAs (miR-146a and miR-146b-5p) that were previously found to be over-expressed in breast tumors and to down-regulate BRCA1 expression [18] and three miRNAs (miR-132, miR-212, miR-153) that were most frequently predicted to interact with the 3′-UTR of BRCA1. [score:8]
Expression level of miR-146b-5p, miR-132 and miR-212 in mammary cell lines. [score:3]
[1 to 20 of 3 sentences]
57
[+] score: 19
MicroRNA-132 is frequently down-regulated in ductal carcinoma in situ (DCIS) of breast and acts as a tumor suppressor by inhibiting cell proliferation. [score:7]
miRNAExpression change [a] miRbase accession numberExpression change [b] miR-132-5p Down MIMAT0004594 DownLi et al., 2013 miR-125b-1-3p Down MIMAT0004592 DownLi et al., 2013; Mar-Aguilar et al., 2013a miR-34c-5p Down MIMAT0000686 DownYang et al., 2013 miR-382-3p Down MIMAT0022697 DownLi et al., 2013; Mar-Aguilar et al., 2013b miR-485-5p Down MIMAT0002175 DownAnaya-Ruiz et al., 2013 miR-323b-3p Down MIMAT0015050 NA NA miR-598-3p Down MIMAT0003266 NA NA miR-224-5p Up MIMAT0000281 UpHuang et al., 2012 miR-1246 Up MIMAT0005898 UpPigati et al., 2010 miR-184 Up MIMAT0000454 NA NA a Expression change in this study. [score:7]
For example, the previous studies showed that miR-132 (Li et al., 2013), miR-125b (Zhang et al., 2011), miR-34c (Yang et al., 2013), and miR-485 (Anaya-Ruiz et al., 2013), functioning as suppressors, played an important role in breast cancer by suppressing cell proliferation and migration. [score:5]
[1 to 20 of 3 sentences]
58
[+] score: 18
Other miRNAs from this paper: hsa-mir-122, mml-mir-122a, mml-mir-132
Shukla U Tumma N Gratsch T Dombkowski A Novak RF Insights into insulin -mediated regulation of CYP2E1: miR-132/-212 targeting of CYP2E1 and role of phosphatidylinositol 3-kinase, Akt (protein kinase B), mammalian target of rapamycin signaling in regulating miR-132/-212 and miR-122/-181a expression in primary cultured rat hepatocytesDrug Metab Dispos. [score:9]
Furthermore, one of the overlapping miRNAs, miR-132-3p, has been suggested to contribute to Alzheimer’s disease progression through aberrant regulation [81, 82]. [score:4]
Wong HK Veremeyko T Patel N Lemere CA Walsh DM Esau C De-repression of FOXO3a death axis by microRNA-132 and −212 causes neuronal apoptosis in Alzheimer’s diseaseHum Mol Genet. [score:3]
Interestingly, mir-132-3p has been shown to be regulated by insulin signaling through the PI3K-Akt-mTORC1 cascade [83]. [score:2]
[1 to 20 of 4 sentences]
59
[+] score: 18
miRNA Tested cellsChange inexpression Target genes Putative functions Reference miR-17 CD4+ T lymphocytes ↑TGFBR2, PTEN,BCL2L11, CDKN1A Proliferation and activation of T cells[73]miR-34amiR-155miR-346Demyelinatingplaques ↑ CD47 Stimulation of myelin phagocytosis[72] miR-132 B lymphocytes ↑ SIRT1Increased production ofpro-inflammatory cytokines[74] miR-320a B lymphocytes ↓ MMP9 Disturbance of HEB permeability[75] miR-340 CD4+ T lymphocytes ↑ IL4Shift of the balance of Th2/Th1cytokines towards Th1 cytokines[67] Target genes of some miRNAs, whose expression is changed during MS development, were identified in B and CD4+ T cells. [score:10]
An increase in the expression level of miRNA genes (except miR-20b and miR-132/212) was mostly observed in CD4+ T cells; in nervous system cells, expression of the three miRNAs was reduced, and that of two miRNAs was enhanced. [score:5]
In response to lipopolysaccharides, monocytic cell lines and macrophages also significantly increase expression of miR-132, -125b, -21, and -9, which indicates involvement of miRNAs in controlling the Toll signaling pathway, with some miRNAs (according to the effect pattern) acting at the stage when the organism returns to normal homeostasis after a response to an infection. [score:3]
[1 to 20 of 3 sentences]
60
[+] score: 17
Recently, Mokutani et al. [32] demonstrates that ANO1 (TMEM16A) is a direct target of miR-132, and miR-132 overexpression markedly suppresses ANO1 expression level in colorectal cancer, suggesting that microRNAs may be involved in modulating TMEM16A expression. [score:12]
Recent study revealed that TMEM16A (ANO1) was a direct target gene of miR-132, and was negatively regulated by miR-132 in colorectal cancer [32]. [score:5]
[1 to 20 of 2 sentences]
61
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
MiR-132, 5-fold down-regulation in DHT -treated group compared to control in this study, has previously been shown to be related to luteinizing hormones [12], raising the possibility that elevated LH in PCOS could involve the expression and action of miR-132. [score:5]
Thus, it is possible that the down-regulation of miRNAs (rno-miR-770, rno-miR-466c, rno-miR-31, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184) observed in this study could be associated with promoted thecal hyperandrogenesis [37, 38]. [score:4]
MiRNAs found to be primarily down-regulated in DHT -treated rats includes rno-miR-770, rno-miR-466c, rno-miR-21, rno-miR-31, rno-miR-182, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184. [score:4]
Among the fourteen miRNAs mapped to the ingenuity databases, twelve (rno-let-7d, rno-miR-132, rno-miR-182, rno-miR-183, rno-miR-184, rno-miR-21, rno-miR-221, rno-miR-24, rno-miR-25, rno-miR-26b, rno-miR-31 and rno-miR-96) had 171 experimentally validated targets. [score:3]
[1 to 20 of 4 sentences]
62
[+] score: 16
GnRH -induced expression of miR-132/212 was observed to regulate the decrease of SIRT1 deacetylase content, thus lead to an enhanced acetylation of FOXO1 [124]. [score:4]
Cancer-related SIRT1 overexpression is owing to the evasion of related miRNAs including miR-34a, miR-146b, miR-132/212 and miR-217 (Figure 2H) [120]. [score:3]
Similar with miR-34a and miR-146b, miR-132 and miR-212, two tandemly expressed miRNAs, play vital roles in SIRT1-FOXO1 pathway. [score:3]
Recently, Clovis et al reported that miR-9 and miR-132 repress FOXP2 expression in mouse embryonic brain [139]. [score:3]
Interestingly, substantial miRNAs (miR-9, miR-132, let-7a and miR-140-5p) are found to be lost in the striatum of mammals which is a region important for speech and language, where FOXP2 is expressed [142, 143]. [score:3]
[1 to 20 of 5 sentences]
63
[+] score: 16
A miRNA profile of Alzheimer's Disease patients showed significant overlap with our findings; 11/19 miRNAs found to be dysregulated in the FC in AD [28] were dysregulated in our study in the same direction, including miR125a, miR132, which have CNS developmental roles [14], and were highly significant in our target bias analysis (Figure 3). [score:9]
In the FC of Huntington's Disease patients, miR-132 was found to be significantly downregulated possibly resulting in increased levels of RE1-silencing transcription factor (REST), a protein with potential implications in neuropathogenesis [18]. [score:6]
RNA was isolated on two separate occasions following the miRVana protocol from the frontal cortex tissue and subjected to RT-PCR for miR122 (diamond), miR125a-3p (square), miR132 (triangle), and miR134 (X), and miR495 (asterisk). [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 16
The upregulated miRNAs included miR-132-3p, miR-604, miR-186-5p, miR-29b-3p, miR-125b-5p, miR-376c-3p, and miR-30b-5p, where the only downregulated miRNA was miR-423-3p (Table 1). [score:7]
Influential miRNAs altered in different disease mo dels, such as miR-132, functions to maintain a normal hematopoietic output during an immune response and regulates genes at the beginning of an immune response to regain homeostasis of the immune system. [score:4]
Regulation of TLR2 -mediated tolerance and cross-tolerance through IRAK4 modulation by miR-132 and miR-212. [score:2]
miR-132 Is Induced by A. fumigatus Exposure Aspergillus fumigatus is a commonly encountered pathogenic fungal species and is often found in the soil, occupational environments [i. e., biowaste containment facilities (122, 123)] or indoor environments [i. e., hospitals (124, 125)]. [score:1]
miR-132 Is Induced by A. fumigatus Exposure. [score:1]
For example, miR-132 and miR-212-5p were specific to fungal exposure at 6 h time point, whereas miR-132, miR-212, and miR-129-5p were specific to fungal exposure at 12 h time point. [score:1]
[1 to 20 of 6 sentences]
65
[+] score: 16
More recently, our data show that activation of Ahr by FICZ enhances the Th17 differentiation via upregulating microRNA (miR)-212 that targets B-cell lymphoma (Bcl)-6, a negative regulator of Th17, and that miR-132/212 -deficient mice have an impaired differentiation of this T cell subset [47]. [score:7]
More recently, we found that activation of Ahr by TCDD in vitro and in vivo induces cholinergic anti-inflammatory system by upregulating acetylcholinesterase -targeting miR-132 [14]. [score:6]
In addition to promoting the differentiation of Tregs, TCDD ameliorates EAE, UC, and EAU by suppressing Th17, IL-17, and IFN- γ. Along with these observations, we have found that miR-132 mediates the effect of TCDD on the course of EAE by potentiating cholinergic anti-inflammatory system [14]. [score:3]
[1 to 20 of 3 sentences]
66
[+] score: 16
When we compared the relative expressions between OCCC and HGSC, the former expressed significantly higher levels of miR-9, miR-126, and miR-34a (Fig 2); of these, the most significant difference was observed for miR-9. In addition, miR-132 expressions were clearly elevated in OCCC compared with HGSC, although this difference was only marginally significant (Fig 2). [score:5]
Individual Taqman [®] MicroRNA assays for miR-9, miR-132, miR-126, and miR-34a were used to validate the expression signatures that were determined via microRNA PCR plate analysis in the original 27 and additional 23 cases (Table 1). [score:2]
Individual Taqman MicroRNA assays were used to analyze the relative expression of miR-9 (A), miR-132 (B), miR-126 (C), and miR-34a (D) in the original 27 and additional 23 cases. [score:2]
0162584.g002 Fig 2Individual Taqman MicroRNA assays were used to analyze the relative expression of miR-9 (A), miR-132 (B), miR-126 (C), and miR-34a (D) in the original 27 and additional 23 cases. [score:2]
In addition, miR-132, miR-9, miR-126, and miR-34a expression profiles were analyzed using TaqMan [®] MicroRNA Assays (Applied Biosystems, Foster City, CA, USA). [score:2]
An unsupervised hierarchical clustering analysis of 87 miRNA expression in 27 patients with ovarian cancer, including the calculated centered correlation distances and average linkages, identified two main clusters, A and B. Individual Taqman [®] MicroRNA assays for miR-9, miR-132, miR-126, and miR-34a were used to validate the expression signatures that were determined via microRNA PCR plate analysis in the original 27 and additional 23 cases (Table 1). [score:2]
Of note, only approximately 80 cancer-related miRNAs from among >2500 human miRNAs could significantly differentiate the ovarian histological subtypes of OCCC and HGSC; of these, miR-132, miR-9, miR-126, miR-34a, and miR-21 were the strongest classifiers. [score:1]
[1 to 20 of 7 sentences]
67
[+] score: 16
Differential expression of RNAseq data identified 12 miR with changes in relative expression during follicular trachoma, of which 9 were confirmed as differentially expressed by qPCR (miR-155, miR-150, miR-142, miR-181b, miR-181a, miR-342, miR-132, miR-4728 and miR-184). [score:7]
MiR-155-5p, miR-142-5p, miR-142-3p, miR-132-3p and miR-147-3p amongst others were up-regulated during Cm infection of the murine cervix in response to an attenuated strain of Cm, relative to a virulent strain of Cm [16]. [score:4]
MiR-155, miR-150, miR-142, miR-181b, miR-181a, miR-342 and miR-132 were differentially expressed during current Ct infection. [score:3]
MiR-181b, miR-132, miR-10a and miR-146b negatively regulate inflammation following TLR or NFκB stimulation in order to prevent excessive inflammation and pathology. [score:2]
[1 to 20 of 4 sentences]
68
[+] score: 16
Other common, but not universal, expression changes have included upregulation of miR-146a and/or miR-146b in most mo dels (but not in B-cells or PBMCs), upregulation of miR-9, miR-18a and miR-132, and downregulation of miR-125b [4, 7, 44– 46, 63]. [score:12]
A number of miRNAs clustered together with miR-155 on the hierarchical clustering analysis (Fig 2), including miRNAs such as miR-146a, miR-146b and miR-132 that had significant increases in expression with time. [score:3]
For example, the increase in IFNγ in LPS-stimulated cells in this mo del, probably in part from T-lymphocytes [55], could have blunted the effects of LPS on miR-146a, miR-146b and miR-132, as observed in human cord blood CD14+ cells [46]. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 15
miR-9, miR-132, and miR-124a expression is inhibited in nonneural cells by the transcriptional repressor REST that helps to preserve the identity of nervous tissue by silencing neuronal genes in nonneural tissues [46]. [score:5]
miR-132 is an inhibitor of p250GAP translation that plays a role in neurite extension and neurogenesis [43]. [score:5]
In the mammalian brain, miR-9 and miR-132 are expressed in hippocampus and medal frontal gyrus [26]. [score:3]
In addition, miR-132 has been linked to BDNF, a member of the nerve growth factor family that is necessary for survival of striatal neurons in the brain, and MeCP2 methyl-CpG DNA binding protein that plays an essential role in mammalian development [44]. [score:2]
[1 to 20 of 4 sentences]
70
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Gonadotropin-releasing hormone regulates multiple miRNA expression in gonadotrope cell lines, producing downregulation of miR-99b and miR-125b, and upregulation of miR-132, miR-151, miR-212, miR-222, miR-350, and miR-424 (Godoy et al. 2011). [score:10]
Intronic miR-132 and miR-212 target p250RhoGAP, thereby guide morphological change and increase the motility of gonadotropes (Godoy et al. 2011). [score:3]
Ason et al. (2006) miR-7, miR-9, miR-34b, miR-96, miR-124a, miR-125b, miR-132, miR-181b, miR-182, miR-183, miR-184, and miR-204, miR-215, miR-216, miR-217 Zebrafish Microarray, ISH ? [score:1]
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 15
The up-regulation of miR-10a and miR-132 confirmed the data from a previous cervical carcinoma study where these miRNAs were also up-regulated [18]. [score:7]
Several miRNAs, namely miR-148a, miR-302b, miR-10a, miR-196a and miR-132 were up-regulated in CINI samples. [score:4]
Five miRNAs displayed relative increased expression in the transition from normal cervix to atypical dysplasia to cancer, these were miR-148a, miR-302b, miR-10a, miR-196a and miR-132 (Figure 4 D). [score:3]
Regarding the canonical pathways, there was less consistency, with Wnt/β-catenin signaling found three times (miR-145, miR-199a and miR-132). [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 14
Using PSP as a mo del disease, we identified miR-132 to be selectively downregulated in pathological conditions. [score:6]
Interestingly, PTBP2 protein (but not mRNA) levels were increased in PSP patients and correlated significantly with miR-132 expression [26]. [score:3]
), we identified miR-132 and the neuronal splicing regulator PTBP2 as potential regulators of endogenous tau exon 10 splicing in neurons. [score:3]
3. Tau Alternative Splicing Regulation by miR-132. [score:2]
[1 to 20 of 4 sentences]
73
[+] score: 14
In addition, S-NSC cells infected with T. gondii PRU tachyzoites had more than a two-fold reduction in the expression of mir-29a and mir-107, found to be down-regulated in patients with AD 58– 61. mir-132, that is under-regulated in post-mortem Huntington’s disease patients and in a mouse mo del for this disease [62], showed a ~four-fold down-regulation in GT1 and PRU-infected S-NSC cells. [score:14]
[1 to 20 of 1 sentences]
74
[+] score: 14
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein. [score:4]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 3 sentences]
75
[+] score: 14
miRNA-132 induces hepatic steatosis and hyperlipidaemia by synergistic multitarget suppression. [score:5]
miR-132 regulates antiviral innate immunity through suppression of the p300 transcriptional co-activator. [score:4]
Examples include miR-132, with established roles both in MetS and in the cellular response to viral infections (Lagos et al., 2010; Meydan et al., 2016), and miR-197, dysregulated in adipose tissue dysfunction, and in pulmonary and enteroviral infections (Tang et al., 2015). [score:2]
Several cholinergic-related miRs (“CholinomiRs”), including miR-132, miR-608 and miR-211, are functionally involved in inflammatory regulation (Meydan et al., 2016; Bekenstein et al., 2017). [score:2]
miR-132 loss de-represses ITPKB and aggravates amyloid and TAU pathology in Alzheimer’s brain. [score:1]
[1 to 20 of 5 sentences]
76
[+] score: 13
Lagos D. Pollara G. Henderson S. Gratrix F. Fabani M. Milne R. S. Gotch F. Boshoff C. miR-132 regulates antiviral innate immunity through suppression of the p300 transcriptional co-activator Nat. [score:4]
This cut-off point allows inclusion of lowly expressed (50–100 copies per cell) but detectable miRNAs (e. g. miR-132 (24)). [score:3]
Depletion of S6K2 resulted in a significant reduction in expression of miRNAs that were induced by ANG1 (miR-126, miR-16, miR-210, miR-21, miR-221 and miR-132, see Figure 7B) in ANG1 -treated HDLECs (Figure 7E). [score:3]
Seven of these miRNAs (miR-126, miR-21, miR-16, miR-29a, miR-221, miR-210 and miR-132) showed statistically significantly higher expression in ANG1 -treated HDLECs (Figure 7B, and Supplementary Figure S7B). [score:3]
[1 to 20 of 4 sentences]
77
[+] score: 13
There are also a number of miRNAs such as miR-132, miR-212, miR-130a and miR-152 shown to be upregulated in the pancreatic islets of the wi dely-studied T2D mo del Goto-Kakizaki rats (Esguerra et al., 2011) with active roles in beta cell stimulus-secretion coupling (Malm et al., 2016; Ofori et al., 2017). [score:4]
Among the other miRNAs included in this study, we observed significantly higher expression levels of miR-132 and miR-212 at higher confluences in INS-1 832/13 cells (Figs. 3A– 3B) but only an increasing trend in the human EndoC-βH1 cells (Figs. 3C– 3D). [score:3]
miR-132 and miR-212 expression in INS-1 832/13 cells (A–B) or in EndoC-βH1 cells (C–D) at different confluences. [score:3]
Although we showed that miR-375, which is one of the most enriched beta cell miRNA was not significantly influenced by confluence level in cultured rat and human beta cell lines, we clearly demonstrated that miR-132 and miR-212 are more dependent on cellular densities, as was shown for some miRNAs in other cells types (Hwang, Wentzel & Men dell, 2009; Van Rooij, 2011). [score:1]
We also investigated the influence of confluence on the expression levels of miR-200a, miR-130a, miR-152, miR-132 and miR-212. [score:1]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
[1 to 20 of 6 sentences]
78
[+] score: 13
Also, miR-132 was up-regulated in inflamed IBD tissues and suggested to play an inflammation -dependent homeostatic role on cholinergic signaling [15]. [score:4]
Although many IBD -associated miRNAs did not appear to be dysregulated in preterm NEC tissues, several miRNAs, including miR-223, miR-132, miR-146b-3p, miR-215, miR-375, miR-31 and miR-141, were regulated in both IBD and NEC. [score:3]
In our study, miR-132 exhibited inverse correlation with putative targets HBEGF, CD44 and MMP9 in NEC tissues. [score:3]
Our results showed that levels of miRNA/mRNA pairs: miR-451/ TLR4, miR-4793-3p/ TLR4, miR-132/ HBEGF, miR-1290/ THBS1, miR-132/ CD44, miR-223/ ICAM1, miR-132/ MMP9, miR-146-3p/ GNA11 and miR-146-3p/ MYLK were significantly correlated in an inverse manner in NEC tissues, whereas miR-410/ FLT-1 was directly correlated (Fig 2). [score:2]
Yet, their levels were inversely correlated within same NEC samples such as miR-451/ TLR4 (receptor), miR-4793-3p/ TLR4 (receptor), miR-132/ HBEGF (angiogenesis), miR-1290/ THBS1 (angiogenesis), miR-132/ CD44 (adhesion/chemotaxis) and miR-132/ MMP9 (ECM remo deling). [score:1]
[1 to 20 of 5 sentences]
79
[+] score: 13
Moreover, hsa-miR-132, one of the upregulated cellular miRNAs, has been shown to repress interferon-stimulated genes by targeting p300 transcriptional co-activator [193]. [score:6]
Lagos D. Pollara G. Henderson S. Gratrix F. Fabani M. Milne R. S. B. Gotch F. Boshoff C. miR-132 regulates antiviral innate immunity through suppression of the p300 transcriptional co-activator Nat. [score:4]
The expression pattern of cellular miRNAs upon KSHV infection revealed that hsa-miR-146a, hsa-miR-31, and hsa-miR-132 peaked at 6 hours post-infection, while hsa-miR-193a and hsa-miR-let-7i steadily increased over 72 h post-infection [193]. [score:3]
[1 to 20 of 3 sentences]
80
[+] score: 13
Two other miRNAs found in this study to be downregulated by exposure to the HNSCC patient serum, namely miR-212-5p and miR-132-5p, also target proteins involved in cell cycle regulation. [score:7]
MiR-212-5p targets CCND1 and miR-132-5p targets Bcl2. [score:5]
MiR-132 and miR-212 are formed by differential processing of the same primary miRNA. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 13
There are upregulation of miR-155, miR-146, miR-132, miR-147, miR-9, miR-21, miR-223, miR-125b, miR-27b, let-7e and down-regulation of miR-125, let-7i, miR-98 following TLR4 stimulation [22, 23, 28– 35]. [score:7]
The up-regulated expression of miR-155 and miR-132 by TLR9 activation [22, 28], miR-9 by TLR7 activation [28], respectively. [score:6]
[1 to 20 of 2 sentences]
82
[+] score: 13
As the infection causes damage in CNS the inflammation in astrocytes is related with higher expression of miR-146a and miR-132, these miRs have been previously reported to be associated with chronic inflammation in neurological disorders, innate immunity regulation and inflammation regulation (Shaked et al., 2009; Iyer et al., 2012; Xie et al., 2013). [score:5]
These studies had shown that the activation of TIRs and TNF-α receptor results in rapid expression of a host of miRNAs including let-7, miR-9, miR-99b, let-7e, miR-125a, miR-132, miR- 146a, miR-146b, miR-155, miR-187, and miR-223 (Taganov et al., 2006; Tili et al., 2007; Bazzoni et al., 2009; Ceppi et al., 2009). [score:3]
Dynamic expression of miR-132, miR-212, and miR-146 in the brain of different hosts infected with Angiostrongylus cantonensis. [score:3]
MicroRNA-132 potentiates cholinergic anti-inflammatory signaling by targeting acetylcholinesterase. [score:2]
[1 to 20 of 4 sentences]
83
[+] score: 12
Different colors represent different experimental groups as indicated and the numbers 1, 2, 4, 5, 7 and 26 show the differentially expressed miRNAs that were significantly changed during infection with DENV-3 and ADE To further confirm our sequencing data, six significantly differentially expressed miRNAs, including hsa-miR-184, hsa-let-7e-5p, hsa-miR-132-3p, hsa-miR-155-5p, and hsa-miR-1246, were chosen for RT-qPCR analysis. [score:5]
Different colors represent different experimental groups as indicated and the numbers 1, 2, 4, 5, 7 and 26 show the differentially expressed miRNAs that were significantly changed during infection with DENV-3 and ADETo further confirm our sequencing data, six significantly differentially expressed miRNAs, including hsa-miR-184, hsa-let-7e-5p, hsa-miR-132-3p, hsa-miR-155-5p, and hsa-miR-1246, were chosen for RT-qPCR analysis. [score:5]
b. Quantitative real-time PCR verify of hsa-miR-132-3p among III-8, III-24 and ADE-24. [score:1]
The levels of hsa-miR-132-3p is the comparison of PBMC infected with DENV to PBMC infected with DENV-ADE. [score:1]
[1 to 20 of 4 sentences]
84
[+] score: 12
Disease Origin References of iPSC lines Phenotype of iPSC-derived neurons miRNAs of interest Fragile X syndrome Loss of function of FMRP (FMR1 gene) Urbach et al. (2010), Sheridan et al. (2011) Hyper-excitability of glutamatergic synapses DICER and AGO-1 complexes Rett’s syndrome Loss of function of MeCP2 transcriptional repressor Marchetto et al. (2010), Kim et al. (2011c), Cheung et al. (2012) Decreased soma size, neurite atrophy, decreased efficiency of glutamatergic synapses miR-132, miR-184, miR-483-5p, miR-212 Schizophrenia Multifactorial Urbach et al. (2010); Brennand et al. (2011), Paulsen Bda et al. (2012), Robicsek et al. (2013) Diminished neuronal connectivity miR-17-5p, miR-34a, miR-107, miR-122, miR-132, miR-134, miR-137 Down’s syndrome Additional copy of chromosome 21 Briggs et al. (2013), Weick et al. (2013) Reduced synaptic activity, increased sensitivity to oxidative stress miR-99a, miR-125b, miR-155, miR-802, Ret 7c Micro -RNAs, as fine regulators of protein translation, influence directly the level of gene expression. [score:9]
Disruption of MeCP2 gene in mice leads to the dysregulation of a set of miRNA potentially of influence in neurogenesis including miR-132, miR-184, miR-483-5p, and miR-212 (Nomura et al., 2008; Im et al., 2010; Urdinguio et al., 2010; Han et al., 2013). [score:2]
These include miR-17-5p, miR-34a, miR-107, miR-122, the brain-specific miR-132, the synaptic miR-134, miR-185, miR-382, and miR-652. [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 12
Despite this information, there are several limitations that need to be fully clarified before miRNAs are used as biomarkers in RA; first, we have conflicting information in miRNA patterns of expressions in different tissues; for example, miR-132 and miR-155 can be found upregulated in PBMC but downregulated in plasma, making evident the dynamics of miRNAs through different compartments [3]. [score:9]
Since 2008, increased levels of some miRNAs, miR-146a, miR-155, miR-132, and miR-16, have been reported in peripheral blood mononuclear cells (PMBCs) of patients with RA, and even some of these have been associated with disease activity, specially miR-146a and miR-16 [19, 26]. [score:3]
[1 to 20 of 2 sentences]
86
[+] score: 12
The transitional week between weeks six to seven demonstrated a reciprocal change in the expression of the previous targets with a robust increase in Lin28B mRNA expression and a significant decrease of Let7a, and lesser extent of mir-132 and mir-145 levels. [score:7]
The expression of Lin28B for the early stage of gestation (≤6 weeks) was negligible, but maximum levels of Let7a, as well as mir-132, mir-145 were reported. [score:3]
Levels of mir-132, and mir-145 were not altered. [score:1]
The aim of the research was to evaluate the expressions patterns of Lin28B messenger RNA (mRNA) and the related Let-7, mir-132, mir-145 in human embryonic tissue from early gestation between five to nine weeks of amenorrhea. [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 12
Ectopic expression of Foxp2 in the developing cortex was counteracted by increased endogenous expression of miR-9 and miR-132 (127). [score:5]
Interestingly, miR-132 is downregulated in schizophrenic patients and has also been shown to contribute to the depolarization of the NMDA receptor (151, 152), suggesting that miR-132 may be a candidate for potential therapeutics. [score:4]
miR-9, along with miR-132, represses Foxp2 to regulate radial migration in the developing mouse cortex. [score:2]
These miRNAs include miR-134 (125, 131) and miR-132 (132– 134). [score:1]
[1 to 20 of 4 sentences]
88
[+] score: 12
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, hsa-mir-146a, hsa-mir-185
Moreover, miR-132 is known to downregulate MeCP2, a key gene in neurodevelopment [188]; thus, the finding that PCB 95 upregulates miR-132 suggests a possible epigenetic mechanism behind PCBs neurotoxicity. [score:8]
In rat primary hippocampal neurons, treatment with PCB 95 upregulated miR-132 and increased spine density [186]. [score:4]
[1 to 20 of 2 sentences]
89
[+] score: 11
FMRP knockdown is shown to ameliorate the effect of overexpressed miR-125b and miR-132 on spine morphology. [score:4]
For example, miR-125b and miR-132 regulate dendritic spine development. [score:3]
The mammalian TRBP homologue also acts together with Dicer to cleave pre-miR-132 generating a longer miRNA and consequently targets different mRNA molecules [34]. [score:3]
More specifically, miR-125b and miR-132 (as well as several other miRNA) are associated with fragile X mental retardation protein (FMRP) in mouse brain. [score:1]
[1 to 20 of 4 sentences]
90
[+] score: 11
In rat neurons homeostatic mechanisms regulate MeCP2 levels through the stimulation of BDNF expression, which in turn induces miR132, thereby silencing MeCP2 expression (Klein et al., 2007). [score:6]
Later, it was shown that miR-212, located in the same cluster of miR-132, also targets MeCP2 and that MeCP2 silences the expression of both miRNAs, confirming the existence of a similar negative homeostatic feed-back loop between MeCP2 and mir-212, (Im et al., 2010). [score:5]
[1 to 20 of 2 sentences]
91
[+] score: 11
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34c, hsa-mir-485
The Tau 3′ UTR sequence has two possible miR-485-5p binding sites [158] and contains a target sequence for miR-132-3p, which is strongly downregulated in the brains of AD patients [149]. [score:6]
However, a mutation in the binding site does not completely abolish miR-132 activity, suggesting that other indirect mechanisms exist by which miR-132 affects Tau expression. [score:5]
[1 to 20 of 2 sentences]
92
[+] score: 11
TUG1 activates Hh signalling by competing with miR-132, which can directly bind to the 3′-UTR of Shh, leading to downregulation of miR-132 levels in HCC [54]. [score:5]
Interference with TUG1 suppresses the proliferation of HCC via a miR-132- and Shh-related mechanism. [score:3]
Thus, targeting the TUG1-miRNA132-Hh pathway could be a new strategy for the clinical treatment of human cancers. [score:3]
[1 to 20 of 3 sentences]
93
[+] score: 11
Besides, some targets encoded proteins involved in stress responses, for example, heat shock protein 70 as target of miR6425a-3p; WRKY transcription factor as target of miR5380c, miR5298b and val-miR799; SNF7 family protein as target of miR477g, miR838-3p and val-miR953; E3 ubiquitin-protein ligase COP1 as target of val-miR132. [score:11]
[1 to 20 of 1 sentences]
94
[+] score: 10
The p250RhoGAP protein is a downstream target of miR132/212 and its downregulation is involved in the morphological change and migration altered by GnRH [60]. [score:6]
GnRH induces expressions of miR-132 and miR-212 in L βT2 pituitary gonadotrope cells to regulate cellular morphology and migration. [score:4]
[1 to 20 of 2 sentences]
95
[+] score: 10
Mechanistically, overexpression of miR-132 suppressed EMT process via inhibiting ZEB2-E-cadherin signaling [49]. [score:7]
The expression of miR-132 was significantly decreased in NSCLC cell lines and clinical NSCLC cancer tissues. [score:3]
[1 to 20 of 2 sentences]
96
[+] score: 10
It should be noted that the activity -dependent regulation of gene expression is essential for synaptic plasticity and memory formation and similar neuronal activity was shown to regulate miR-132 expression in a CREB signaling pathway -dependent manner [177, 178]. [score:7]
Studies involving individual genetic deletion of miRNA have suggested that miR-124, miR-125b, miR-132, miR-134, miR-137, and miR-138 in neurons regulate synaptic development and dendritic branching (for references see [174]). [score:3]
[1 to 20 of 2 sentences]
97
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The mechanism for increased expression of brain miR-132 and -155 was through activation of TLR-4 [103]. [score:3]
MiR-132 targets NAD -dependent deacetylase, SIRT1 and p65 subunit of NFkB which can result in decreased NFkB activity [71]. [score:2]
Further, miR-132 and miR-155 were elevated in the isolated hepatocytes and Kupffer cells from alcohol fed animals [70]. [score:1]
MiR-132 and miR-212 are encoded by a single gene [103] and the role of miR-212 in the intestine barrier dysfunction is discussed in “microRNAs and intestinal tight junctions in ALD” section. [score:1]
MiR-132 and miR-155 levels were elevated in the brain and livers of mice administered an ethanol-containing diet [103]. [score:1]
For example, miR-132 and miR-155 were elevated in liver, intestine and brain for a similar function to induce pro-inflammatory cytokines. [score:1]
[1 to 20 of 6 sentences]
98
[+] score: 9
miR-132 Regulates Dendritic Spine Structure by Direct Targeting of Matrix Metalloproteinase 9 mRNA. [score:5]
Moreover, it was shown that synaptic Mmp-9 mRNA can be directly regulated by miR-132 (Jasinska et al., 2016). [score:3]
Moreover, it has been suggested that miR-132 can be involved in this process (Jasinska et al., 2016). [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 9
REST directly down-regulates a large number of genes at the transcriptional level, but also probably indirectly activates the expression of other genes at the post-transcriptional level via the repression of many noncoding targets (Conaco et al., 2006; Mortazavi et al., 2006; Wu and Xie, 2006; Visvanathan et al., 2007; Singh et al., 2008; Johnson et al., 2009), including several micro RNAs (miRNAs) considered to be brain-specific (such as miR9, miR124, miR132, miR135, miR139, and miR153; Figure 1). [score:9]
[1 to 20 of 1 sentences]
100
[+] score: 9
MiR-132 promotes neovascularization by directly suppressing endothelial RASA1 expression, leading to the RAS-MAPK pathway activation in endothelial cells [113]. [score:5]
MiR-132 was highly expressed in many human cancer types but its overexpression would be restricted to the tumor vascular endothelium. [score:4]
[1 to 20 of 2 sentences]