sort by

428 publications mentioning hsa-mir-124-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-124-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 607
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-124-1, hsa-mir-124-3
Three major conclusions emerged from our studies: (i) miR-124 reduces translation and abundance of its mRNA targets over a broad range; changes in mRNA abundance accounted for ∼75% of the estimated effect on protein production; (ii) miR-124 predominantly targets translation at the initiation stage or stimulates ribosome drop-off preferentially near the translation start site; and (iii) miR-124–mediated regulation of translation and mRNA decay are correlated, indicating that most mRNAs are not differentially targeted for translational repression versus mRNA decay. [score:18]
In line with what we observed for changes in mRNA abundance, miR-124 IP targets with at least one 7mer seed match in their 3′-UTR were more likely to decrease in translation rate than miR-124 IP targets that lacked a 7mer 3′-UTR seed match (56% percent of miR-124 IP targets with a 7mer 3′-UTR seed match decreased at least 10% in translation versus 27% of IP targets that lacked a 7mer 3′-UTR seed match). [score:13]
The overall effects on translation, while highly significant, were very modest; on average, the estimated translation rates of miR-124 Ago IP targets decreased by 12% relative to nontargets (15% for miR-124 IP targets with a 7mer 3′-UTR seed match and 5% for miR-124 IP targets without a 7mer 3′-UTR seed match) (Figure 4C, right). [score:13]
Thus, the effects we observed for miR-124 targets after ectopically expressing the microRNA in Hek293T cells may not capture the full scope of regulation by miRNAs in their endogenous context; miR-124 is endogenously expressed in neuronal cells, and the regulatory effects of miR-124 interactions may be modulated by the physiological demands of the cell and the specific suite of specific RNA -binding proteins and regulatory RNAs that also associate with miR-124 target mRNAs. [score:12]
This analysis compares miR-124 Ago IP targets (1% local FDR) with at least one 3′-UTR 7mer seed match, but no coding sequence or 5′-UTR 7mer seed matches (red), IP targets with at least one 3′-UTR 6mer seed match (green), but no 7mer seed matches in the 3′-UTR, coding sequence, or 5′-UTR, IP targets with at least one coding sequence 7mer seed match, but no 7mer seed match in the 3′-UTR or 5′-UTR (blue), IP targets that lacked a 6mer seed match in the 3′-UTR, coding sequence, or 5′-UTR (orange), and nontargets (black). [score:11]
However, our observation that miR-124 had only modest effects on the translation of hundreds of targets contrasts dramatically with several previous studies in which miRNAs reduced protein expression by 5–25-fold while only modestly decreasing mRNA levels (1.1–2-fold), suggesting substantial inhibitory effects on translation [37], [44], [61], [69], [91]. [score:11]
This analysis compares miR-124 Ago IP targets (1% local FDR) with at least one 3′-UTR 7mer seed match, but no coding sequence or 5′-UTR 7mer seed matches (red, 244), IP targets with at least one 3′-UTR 6mer seed match (green, 47), but no 3′-UTR, coding sequence, or 5′-UTR 7mer seed matches, IP targets with at least one coding sequence 7mer seed match, but no 3′-UTR or 5′-UTR 7mer seed matches (blue, 70), IP targets that lacked a 6mer seed match in the 3′-UTR, coding sequence, or 5′-UTR (orange,23), and nontargets (7385, black). [score:11]
The observation that many miR-124 targets decreased in both ribosome occupancy and ribosome density after transfection with miR-124 is consistent with regulation of translation initiation (mechanisms (i) or (ii)) or ribosome drop-off preferentially near the translation start site (mechanism (iii)) by miR-124 and suggests that slowed elongation (mo del (iv)) is not the predominant mode of regulation of translation by miR-124 under these conditions. [score:11]
It is possible that some mRNA targets are degraded without any appreciable effect on translation (e. g., the mRNAs are degraded while still associated with ribosomes) or that translation of these mRNAs is indirectly stimulated in response to miR-124, resulting in no apparent effect on translation at the time we performed translation assays. [score:11]
This analysis compares miR-124 Ago IP targets (1% local FDR) with at least one 3′-UTR 7mer seed match, but no coding sequence or 5′-UTR 7mer seed matches, IP targets with at least one 3′-UTR 6mer seed match, but no 7mer seed matches in the 3′-UTR, coding sequence, or 5′-UTR, IP targets with at least one coding sequence 7mer seed match, but no 7mer seed match in the 3′-UTR or 5′-UTR, IP targets with at least one 7mer seed match in the 5′-UTR, but no 7mer seed match in the 3′-UTR or coding sequence, and IP targets that lacked a 6mer seed match in the 3′-UTR, coding sequence, or 5′-UTR. [score:11]
This analysis compares miR-124 Ago IP targets (1% local FDR) (green), IP targets with at least one 3′-UTR 7 mer seed match (red), IP targets that lacked a 3′-UTR 7mer seed match (blue), and nontargets (black). [score:9]
This analysis compares miR-124 Ago IP targets (1% local FDR) (560, green), IP targets with at least one 3′-UTR 7mer seed match (379, red), IP targets that lacked a 3′-UTR 7 mer seed match (181, blue), and nontargets (7,825, black). [score:9]
This analysis compares miR-124 Ago IP targets (1% local FDR) (green), IP targets with at least one 3′-UTR 7 mer seed match (red), IP targets that lacked a 3′-UTR 7 mer seed match (blue), and nontargets (black). [score:9]
These parallel effects, combined with the close match between changes in protein synthesis predicted from miRNA -induced effects on mRNA abundance and translation and changes in protein levels for 11 of 12 proteins, suggest that the step in translation principally targeted by miR-124 and presumably other miRNAs is initiation or elongation processivity near the translation start site. [score:9]
Transfection of miR-124 consistently reduced the translation and abundance of most of its several hundred high-confidence targets; the resulting decrease in translation averaged 12% and the decrease in target mRNA abundance averaged 35% (Figure 4). [score:9]
To test the importance of 3′-UTR seed matches on the expression of miR-124 targets, we plotted the cumulative distributions of miR-124 IP targets with at least one 7mer 3′-UTR seed match (379, Figure 4A, red curve) and miR-124 IP targets that lacked a 7mer 3′-UTR seed match (181, Figure 4A, blue curve). [score:9]
We found that mRNA targets with 7mer 3′-UTR seed matches were more likely than targets that lacked a 7mer 3′-UTR seed match to decrease in abundance in the presence of miR-124 (90% of miR-124 IP targets with a 3′-UTR seed match decreased at least 15%, compared to 49% of targets that lacked a 7mer 3′-UTR seed match). [score:8]
If, however, miRNA–mRNA interactions act through a single dominant regulatory pathway that affects both translation and decay, we would expect a strong correlation between the changes in abundance and translation of mRNA targets of miR-124. [score:8]
To study the effects of miR-124 on the expression of its mRNA targets, we first compared the changes in mRNA abundance of Ago IP targets of miR-124 (560 mRNAs; 1% local FDR) and nontargets (7,825 mRNAs) between cells transfected with miR-124 and cells that were mock transfected. [score:8]
To study the effects of miR-124 on expression of mRNA targets, we first had to identify those targets. [score:7]
The observation that there were several mRNAs (CD164, VAMP3, and DNAJC1) that had about 10-fold reductions in mRNA levels (Figure S7), and the fact that 90% of control -transfected cells expressed the transfected GFP marker, suggests that more than 90% cells were transfected with functionally significant quantities of miR-124; thus the small magnitude of the effects on translation and abundance of most of the mRNA targets of miR-124 identified by Ago IP was not likely a result of poor transfection efficiency. [score:7]
Translation rates of miR-124 Ago IP targets were more likely than nontargets to decrease following transfection with miR-124 (p<10 [−61]). [score:7]
miR-124 targets (Figure 4B, green curve) were much more likely to decrease in translation rate than nontarget mRNAs (Figure 4B, black curve) (p<10 [−62], one-sided Kolmogorov-Smirnov test). [score:7]
If the balance between effects on translation and effects on decay were influenced in a gene-specific way by features of the mRNA, we would expect that some targets of miR-124 would have relatively large changes in translation with little change in mRNA abundance or vice versa. [score:7]
Figure S8 Concordant changes in mRNA abundance and translation of miR-124 Ago IP targets with 7mer 3′-UTR seed matches and miR-124 Ago IP targets that lack a 7mer 3′-UTR seed match. [score:7]
The apparent translation rate of 47% of miR-124 Ago IP targets, but only 10% of nontargets, decreased by at least 10%. [score:7]
The effects on ribosome occupancy and ribosome density were significantly larger for miR-124 Ago IP targets that contain at least one 3′-UTR 7mer seed match (45% and 65% decreased at least 5% in ribosome occupancy and ribosome density, respectively), compared to miR-124 Ago IP targets that lack a 3′-UTR 7mer seed match (26% and 34% decreased at least 5% in ribosome occupancy and ribosome density, respectively), providing direct evidence for the general importance of 3′-UTR seed matches for miRNA -mediated translational repression of endogenous mRNAs [16], [17]. [score:7]
Thirty-nine percent of miR-124 Ago IP targets decreased at least 5% in ribosome occupancy, compared to 13% of nontargets; 55% of miR-124 Ago IP targets decreased at least 5% in ribosome density, compared to 18% of nontargets. [score:7]
The small apparent magnitude of the effects on translation initiation, combined with the strong correlation between changes in translation and mRNA abundance, can be explained by a mo del in which repression of translational by miR-124 rapidly leads to mRNA decay. [score:7]
For instance, 60% of miR-124 Ago IP targets contain a perfect match to positions 2–8 of miR-124 (called 7mer-m8) in their 3′-UTRs, compared to 10% of nontargets (p<10 [−185], hypergeometric distribution), and 23% of miR-124 Ago IP targets contain a perfect match to positions 2–8 of miR-124 in their coding sequence, compared to 10% of nontargets (p<10 [−21]). [score:7]
Indeed, 77% of miR-124 IP targets that decreased at least 5% in ribosome occupancy also decreased at least 5% in ribosome density (30% of all miR-124 IP targets decreased at least 5% in both ribosome occupancy and ribosome density compared to 2% of nontargets), which is significantly more than expected by chance (p<10 [−18], hypergeometric distribution). [score:6]
IP targets that did not contain any 6mer seed matches were also significantly more likely to decrease in mRNA abundance than nontargets (Figure S9), which suggests that many of these mRNAs are specifically recruited to Agos by miR-124 and regulated by miR-124, even though they do not appear to have canonical recognition elements. [score:6]
miR-124 negatively regulates the abundance and translation of mRNA targets. [score:6]
We found that both the abundance and translation rate of IP targets, regardless of the location of seed matches, decreased relative to nontarget mRNAs in miR-124 transfected cells compared to mock -transfected cells (Figure S9). [score:6]
This method allowed us to address the effects of miR-124 on translation of endogenous mRNAs; it is also more broadly applicable to the study of translational regulation. [score:6]
Concordant Changes in Abundance and Translation of mRNAs Targeted by miR-124 Suggests That These Two Regulatory Outcomes Are Functionally Linked. [score:6]
Although the overall effect on predicted protein production was on average quite modest (∼2-fold decrease compared to nontargets), for a small fraction of miR-124 targets, the predicted changes in protein production were fairly large; 45 of the 560 identified miR-124 targets were predicted to have a decrease of at least 4-fold in protein production 12 h after miR-124 transfection. [score:6]
Although there was a measurable decrease in mRNA abundance for almost all miR-124 targets that significantly decreased in translation, only about half of the targets that decreased in mRNA abundance registered a measurable reduction in translation. [score:5]
These results show that miR-124 has modest effects on the abundance, translation rate, or both for most its targets. [score:5]
Changes in ribosome occupancy of miR-124 Ago IP targets were greater than those for nontargets (p<10 [−31]). [score:5]
To measure the effects of miR-124 on mRNA expression levels, we profiled mRNA expression in the same cell cultures that we used for the Ago IPs and translation profiling. [score:5]
mRNA levels of miR-124 Ago IP targets were more likely than nontargets to decrease following transfection with miR-124 (p<10 [−173]). [score:5]
mRNA expression profiling then allowed us to recognize the specific effects of miR-124 on the abundance of these targets. [score:5]
Without measurements of the actual effects on protein synthesis, these results, however, do not rule out the possibility that miR-124 also induces cotranslational proteolysis (v) or coordinately represses translation initiation and translation elongation (vi), resulting in modest decreases in ribosome occupancy and ribosome density, but large effects on protein synthesis. [score:5]
We devised a simple, economical method to systematically measure mRNA translation profiles, then applied this method, in combination with gene expression analysis, to measure the effects of the human microRNA miR-124 on the abundance and apparent translation rate of its mRNA targets. [score:5]
There was also a modest, but highly significant, correlation between changes in ribosome occupancy and ribosome density of miR-124 Ago IP targets (Spearman r = 0.45, p<10 [−25]) (Figure S6A), although many mRNAs appeared to differentially change in either ribosome occupancy or ribosome density (some miR-124 mRNA targets even appeared to increase appreciably in ribosome occupancy; Figure S6 and Text S3). [score:5]
To address these effects and relationships, we determined the effect of a human miRNA, miR-124, on translation and abundance of hundreds of endogenous mRNAs that were recruited to Argonaute proteins in response to ectopic expression of miR-124 in HEK293T cells. [score:5]
The average change in mRNA abundance and translation of targets was calculated by subtracting the average change of nontargets for the mRNA abundance and translation rate measurements following transfection with miR-124. [score:5]
We plotted the cumulative distribution of Tr for miR-124 Ago IP targets and nontargets (Figure 4B). [score:5]
miR-124 target mRNAs were much more likely to decrease in abundance after miR-124 transfection than nontargets (p<10 [−173], one-sided Kolmogorov-Smirnov test). [score:5]
Figure S7 Significance of the correlation between changes in mRNA abundance and translation of miR-124 Ago IP targets. [score:5]
We plotted the cumulative distributions of miR-124–dependent Ago IP targets (Figure 4A, green curve) and nontarget mRNAs (Figure 4A, black curve) as a function of the differences in their mRNA abundance between miR-124 and mock -transfected cells. [score:5]
Moreover, the magnitude of the effects we observed on translation of the mRNAs targeted by miR-124 were in agreement with two recent studies that inferred the repressive effect of miRNAs on translation by measuring miRNA -mediated effects on mRNA and protein abundance [16], [17]. [score:5]
Changes in Abundance and Translation of miR-124 Ago IP Targets with Seed Matches in 3′-UTRs, Coding Sequences, and 5′-UTRs. [score:5]
Concordant changes in mRNA abundance and translation of miR-124 Ago IP targets. [score:5]
The high correlation and the fact that the slope of the best-fit line excluding RNF128 is close to one, suggests that miR-124–induced changes in transcript abundance and translation rate can almost completely account for the changes in abundance of the targeted proteins. [score:5]
To investigate how miRNAs regulate gene expression, we systematically identified direct targets of the miRNA miR-124 by measuring the recruitment of target mRNAs to Argonaute (Ago) proteins, the core components of the miRNA effector complex, as previously described [70]– [72]. [score:5]
Figure S9 Changes in abundance and translation of miR-124 Ago IP targets with seed matches in 3′-UTRs, coding sequences and 5′-UTRs. [score:5]
We found that miR-124 Ago IP targets were much more likely than nontarget mRNAs to exhibit both reduced ribosome occupancy (Figure 5A) (p<10 [−31], one-sided Kolmogorov-Smirnov test) and reduced ribosome density (Figure 5B) (p<10 [−51], one-sided Kolmogorov-Smirnov test) following miR-124 transfection. [score:5]
To measure the effects of miR-124 on translation, we performed translation profiling on cell extracts generated from the same miR-124–transfected, or mock -transfected cell cultures that were used for Ago IPs and mRNA expression profiling (see below). [score:5]
The 560 high-confidence miR-124 Ago IP targets for which we obtained high-quality measurements in expression and translation analyses were strongly enriched for mRNAs that contained miR-124 seed matches in 3′-UTRs and coding sequences (Figure 1B), but they were also significantly, albeit weakly, enriched, for seed matches in 5′-UTRs (16, p = 0.009). [score:5]
These results underscore the importance of 3′-UTR seed matches for regulation at the mRNA level, but also demonstrate that a large fraction of miR-124 IP targets that lack 7mer seed matches to miR-124 in their 3′-UTR are nevertheless regulated at the mRNA level by miR-124. [score:5]
Direct identification of the mRNAs specifically recruited by miR-124 to Ago proteins, core components of miRNA-effector complexes, defined functional targets of this miRNA in this mo del system, providing a starting point for dissecting miRNA regulation [70]– [72], [96], [97]. [score:5]
We obtained similar results when we analyzed miR-124 Ago IP targets with 7mer 3′-UTR seed matches and those that lacked a 7mer 3′-UTR seed match (Figure S8), although the correlation was stronger for targets with 7mer 3′-UTR seed matches (r = 0.60 versus 0.42). [score:5]
Changes in ribosome density of miR-124 Ago IP targets were greater than those for nontargets (p<10 [−51]). [score:5]
Changes in mRNA abundance were significantly greater than changes in translation for miR-124 Ago IP targets with 3′-UTR and coding sequence seed matches (Figure S9). [score:5]
To study the effects of miR-124 on translation of targeted mRNAs, we estimated the change in the translation rates between miR-124 -transfected and mock -transfected cells (Tr) for each mRNA as: (1)where multiplying O, the fraction of the mRNA that is ribosome-bound (ribosome occupancy), by D, the average number of ribosomes per 100 nts for bound mRNAs (ribosome density) provides the weighted ribosome density for each mRNA; Er is an unmeasured value for the elongation rate of any given mRNA and was assumed not to change (discussed further below). [score:5]
We reasoned that if the mRNAs specifically recruited to Agos by miR-124 transfection were physically associated with miR-124, seed match sequences would be significantly enriched in miR-124–specific IP targets compared to nontargets. [score:4]
Thus, if ribosome drop-off is the predominant mode of miR-124 regulation, it occurs preferentially near the translation start site. [score:4]
1000238.g007 Figure 7Scatterplot between changes in mRNA abundance (x-axis) and the estimated translation rate (y-axis) for miR-124 Ago IP targets following transfection with miR-124 compared to mock. [score:4]
For example, 74% of miR-124 IP targets decreased at least 15% at the mRNA level, compared to 13% of nontargets. [score:4]
Scatterplot between changes in mRNA abundance (x-axis) and the estimated translation rate (y-axis) for miR-124 Ago IP targets following transfection with miR-124 compared to mock. [score:4]
We compared the changes in mRNA abundance (Figure 7, x-axis) to apparent changes in translation rate (Figure 7, y-axis) for miR-124 Ago IP targets following miR-124 transfection. [score:4]
The average abundance of miR-124 Ago IP targets decreased by 35% compared to nontargets (Figure 4C, green bar on the left). [score:4]
Thus, cotranslation proteolysis (proposal (v)) and coordinate repression of initiation and elongation (proposal (vi)) are unlikely to play more than a minor role in miR-124 regulation under these conditions. [score:4]
These data argue that most miR-124 Ago IP targets were recruited to Agos by direct association with miR-124, via seed matches in their 3′-UTRs or coding sequences. [score:4]
After removing mRNAs with 7mer seed matches in their 3′-UTRs, the remaining miR-124 IP targets were still significantly, albeit weakly, enriched for 3′-UTR 6mer matches to miR-124 (6mer 2–7, p = 0.008, 6mer 3–8, p<10 [−5]). [score:3]
Indeed, we found strong enrichment of 6–8 base seed matches to miR-124 in the 3′-UTRs of miR-124 Ago IP targets (Figure 1B). [score:3]
Text S4 Evaluation of the significance of the correlation between changes in mRNA abundance and translation of miR-124 Ago IP targets following transfection with miR-124. [score:3]
Figure S4 miR-124 Ago IP targets are likely destroyed, rather than deadenylated and stored. [score:3]
miR-124 negatively affected both the ribosome occupancy and ribosome density of hundreds of its targets (Figure 5). [score:3]
The Effects of miR-124 Transfection on Protein Products of miR-124 Targets. [score:3]
miR-124 Ago IP targets decrease in ribosome occupancy and ribosome density due to the presence of miR-124. [score:3]
Figure S10 Efficiency of recruitment to Argonautes by miR-124 seed matches correlates with effects on both mRNA abundance and translation. [score:3]
On average, the ribosome occupancy of miR-124 Ago IP targets decreased by 4%, and their ribosome density decreased by 8% (Figure 5C, green bars). [score:3]
These data suggest that the apparent decrease in abundance of miR-124 target mRNAs results primarily from degradation rather than deadenylation alone. [score:3]
Table S1 Summary of miR-124 targets for Western blot analysis. [score:3]
mRNA Recruitment to Argonautes by miR-124 Leads to Modest Decreases in Abundance and Translation Rate. [score:3]
The effect of miR-124 transfection on protein production of miR-124 targets. [score:3]
1000238.g001 Figure 1 (A) Supervised hierarchical clustering of the enrichment profiles of putative miR-124 Ago IP targets (1% local FDR) in Ago IPs from miR-124–transfected cells (blue) and mock -transfected cells (black). [score:3]
Figure S5 Relationship between the coding sequence length and changes in ribosome occupancy and ribosome density of miR-124 Ago IP targets following transfection of miR-124. [score:3]
In support of this hypothesis, on average, all ten miR-124 target mRNAs with ribosome occupancy changes greater than 20% had significantly shorter coding sequences and fewer bound ribosomes than mRNAs that changed less than 20% (p = 0.0003, one-sided Mann-Whitney test) (Figure S5A). [score:3]
Figure S2 Streptavidin-coated Dynal beads weakly enrich miR-124 targets after miR-124 transfection. [score:3]
We found that for the ∼600 mRNA targets of miR-124 that were identified by their association with microRNA effector complexes, around three quarters of the reduction in estimated protein synthesis was explained by changes in mRNA abundance. [score:3]
The red arrow shows the Pearson correlation of miR-124 IP targets that change less than 40% in mRNA abundance (r = 0.30, p<10 [−5]). [score:3]
To test this, we plotted the change in ribosome density as a function of mRNA length for miR-124 IP targets and found that although they are correlated (Spearman r = 0.30), it is highly unlikely there is a first-order exponential relationship between the change in density and the length of the mRNA's coding sequence (p<10 [−211], F-test with the null hypothesis that the observed change in density fits the predicted change in density from an exponential least-squares fit) (Figure S5B). [score:3]
We also found enrichment within the coding sequences of miR-124 Ago IP targets, as previously reported (Figure 1B) [11], [16], [17], [70], [71], [78], [79]. [score:3]
miR-124 Affects Both the Ribosome Occupancy and Ribosome Density of Hundreds of Targets. [score:3]
Efficiency of Recruitment to Argonautes by miR-124 Seed Matches Correlates with Effects on Both mRNA Abundance and Translation. [score:3]
If however, the effects on ribosome occupancy and ribosome density were due to the same regulatory mechanism, we would expect a large overlap between mRNAs that show appreciable decreases in ribosome occupancy and ribosome density in the presence of miR-124. [score:2]
We chose 14 proteins encoded by mRNAs that are highly enriched in miR-124 Ago IPs, with predicted decreases in protein synthesis ranging from no change to 3-fold (Table S1). [score:1]
For mRNAs with 7mer or 8mer seed matches to miR-124 in their coding sequences, but no 7mer seed matches in their 3′-UTRs, there was also a significant, albeit weaker, correlation (coding sequence 7mer: r = −0.39, p<10 [−33]; coding sequence 8mer: r = −0.38, p<10 [−4]) (Figure S10B). [score:1]
Transfections with miR-124 oligonucleotides were performed analogously with 30 nM of oligonucleotides in 2.5 ml of transfection mixture. [score:1]
The average change in ribosome occupancy and ribosome density of targets was calculated by subtracting the average change of nontargets for the ribosome occupancy and ribosome density measurements following transfection with miR-124. [score:1]
For mRNAs with 7mer or 8mer seed matches to miR-124 in their 3′-UTR, there was a strong negative correlation between the magnitude of their enrichment by the Ago IP and the estimated changes in production of the protein they encode (3′-UTR 7mer: Pearson r = −0.72, p<10 [−192]; 3′-UTR 8mer: r = −0.72, p<10 [−26]) (Figure S10A). [score:1]
miR-124 siRNA: sense: 5′-UAA GGC ACG CGG UGA AUG CCA-3′ antisense: 5′-GCA UUC ACC GCG UGC CUU AAU-3′ HEK293T cells were obtained from ATCC (Cat# CRL-11268) and grown in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) with 10% fetal bovine serum (Invitrogen) and supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, and 4 mM glutamine at 37°C and 5% CO [2]. [score:1]
To this end, we lysed human embryonic kidney (HEK) 293T cells transfected with miR-124 and isolated Ago -associated RNA by immunopurification (IP) using a monoclonal antibody that recognizes all four human Ago paralogs [73]. [score:1]
If miR-124 induced ribosome drop-off (mechanism (iii)) stochastically along the coding sequence, the change in ribosome density would be exponentially related to the length of the coding sequence. [score:1]
Red circles correspond to mRNAs that were enriched by the Ago IP following miR-124 transfection (1% local FDR). [score:1]
This analysis compares 208 miR-124 targets for which we obtained quality measurements in both experiments. [score:1]
miR-124 recruits hundreds of specific mRNAs to Argonautes. [score:1]
Values Tr obtained from miR-124 transfected cells were divided by those from mock -transfected cells to estimate the change. [score:1]
miR-124 siRNA:sense: 5′-UAA GGC ACG CGG UGA AUG CCA-3′ antisense: 5′-GCA UUC ACC GCG UGC CUU AAU-3′ HEK293T cells were obtained from ATCC (Cat# CRL-11268) and grown in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) with 10% fetal bovine serum (Invitrogen) and supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, and 4 mM glutamine at 37°C and 5% CO [2]. [score:1]
Systematic Identification of mRNAs Recruited to Argonautes by miR-124. [score:1]
The Ago IPs were further bifurcated into two subgroups: miR-124 transfected and mock transfected. [score:1]
Subsequently, amino-allyl–containing cDNAs from miR-124 and mock -transfected cells were covalently linked to Cy5 NHS-monoesters, and universal reference cDNA was covalently linked to Cy3 NHS-monoesters (GE HealthSciences Cat# RPN5661). [score:1]
Dataset S3 Ribosome number values from miR-124 and mock -transfected cells and SAM results. [score:1]
Because of the small changes in ribosome occupancy and ribosome density between miR-124–transfected and mock -transfected samples, we conservatively adjusted the means of each experiment to be the same by subtracting the difference between the mean of that experiment and the mean of all the experiments to ensure that differences observed between miR-124–transfected and mock -transfected cells were not due to the doping control normalization. [score:1]
miR-124 seed matches: 6mer_n2-7 “ UGCCUU,” 6mer_n3-8 “ GUGCCU,” 7mer-m8 “ GUGCCUU,” 7mer-A1 “ UGCCUUA,” 8mer “ GUGCCUUA. [score:1]
1000238.g006 Figure 6(A) Western blots of 12 proteins encoded by mRNAs highly enriched in miR-124 Ago IPs from mock -transfected cells (−) and miR-124 transfected cells (+). [score:1]
Dataset S2 Ribosome occupancy values from miR-124 and mock -transfected cells and SAM results. [score:1]
Black circles correspond to mRNAs that were not enriched by the Ago IP following miR-124 transfection. [score:1]
To do this, we sampled with replacement measurements for each gene from the mock and miR-124 replicates, respectively, 10,000 times, then calculated the respective changes between miR-124 IP targets and nontargets for the 10,000 bootstrapped samples. [score:1]
Three replicates of Ago and control IPs were performed from both miR-124 and mock -transfected cells (Datasets S1 and S5). [score:1]
Unsupervised hierarchical clustering of the enrichment profiles in Ago IPs from miR-124 -transfected cells (black), mock -transfected cells (blue), and negative control IPs (no Ago antibody) from both types of cells (orange). [score:1]
We collected cell lysates 60 h (four to five cell divisions) after miR-124 or mock-transfection to reduce the likelihood of underestimating the change in protein synthesis for long-lived proteins. [score:1]
The Ago IP enrichment profiles were reproducible as evidenced by an average Pearson correlation coefficient between mRNA enrichment profiles of Ago IPs in mock -transfected cells and miR-124–transfected cells of 0.90 and 0.94, respectively. [score:1]
We tested these predictions by comparing ribosome occupancy and density profiles of mRNAs from miR-124 and from mock -transfected cells. [score:1]
Text S3 Relationship between ribosome occupancy in mock -transfected cells and changes in ribosome occupancy following transfection of miR-124. [score:1]
Figure S6 Relationship between ribosome occupancy in mock -transfected cells and change in ribosome occupancy following transfection of miR-124. [score:1]
Dataset S5 Compendium of miR-124 data used for most analyses. [score:1]
[1 to 20 of 131 sentences]
2
[+] score: 487
Recently it was reported that in patients with multiple sclerosis (MS), an autoimmune disease associated with Th1 autoimmune cells and shifting balance towards M1, the expression of miR-124 was downregulated and expression of miR-155 was upregulated in whole monocyte population [40]. [score:13]
Given the fact that miR-124 negatively regulates the expression of miR-223 as shown by us previously [15], there is a possibility that inhibition of miR-124 in the IL-4 treated macrophages results in a further upregulation of miR-223 and further increase in the Arg1 expression. [score:11]
Interestingly, in contrast to our previous studies when overexpression of miR-124 led to the upregulation of mRNA for TGF-β1, Fizz1 and Arg1 [15], the inhibition of miR-124 in IL-4 -treated macrophages of the current study did not result in the dowregulation of expression of transcripts for TGF-β1, IL-10, Fizz1 and Arg1. [score:11]
Since we postulated that miR-124 targeted CEBPα [15], we hypothesized that miR-124 contributed to the upregulation of CD206 and downregulation of CD86 in IL-4 treated macrophages by targeting CEBPα. [score:11]
Surprisingly, the expressions of M2 markers Arg1 and IL-10 were even enhanced in the presence of the miR-124 inhibitor (Fig. 4C ), probably due to the compensatory redundant mechanisms of regulation of Arg1 and IL-10 expressions by IL-4. Thus miR-124 contributes to the M2 phenotype acquisition by affecting the expression of multiple markers such as CD206, Ym-1, iNOS, TNF and CD86. [score:10]
Therefore miR-124 overexpression could replace IL-4 in order to induce expression of M2 related genes and downregulate expression M1 related genes. [score:10]
Thus overexpression of miR-124 resulted in downregulation of M1 genes (CD86, TNF, iNOS) and upregulation of M2 genes (Fizz1, TGF-b1, Arg1) as we previously reported [15]. [score:9]
Thus upregulation of miR-155 and downregulation of miR-124 could represent expansion of non-classical monocytes during autoimmune diseases such as MS (Table 2 ). [score:9]
In this study, we demonstrated that miR-124 is induced by IL-4 and inhibition of miR-124 in IL-4 treated macrophages resulted in downregulation of several M2 genes (CD206, Ym-1) and upregulation of M1 genes (CD86, iNOS, TNF, miR-155). [score:9]
As we mentioned earlier, overexpression of miR-124 resulted in downregulation of the M1 markers (MHC class II and CD86) and up-regulation of the M2 markers (TGF-β1, Fizz1 and Arg1) [15]. [score:9]
We found that miR-124 contributed to the development of this phenotype resulting in the upregulation of CD206 and downregulation of CD86. [score:8]
The expression of miR-124 in the microglia did not require the IL-4/IL-13 receptors and STAT6 signaling pathways, whereas in the lung macrophages, miR-124 was expressed at a low level in an IL-4/IL-13 dependent fashion and was substantially up-regulated during the OVA -induced allergic lung inflammation. [score:8]
One of the possible alternative mechanisms of skewing macrophages towards the M2 phenotype is by the induction of the miR-124 expression utilizing the ability of miR-124 to target IL-6R and inhibit the IL-6R-STAT3 pathway, which is associated with the development of the M1 phenotype [25]. [score:8]
However expression of Fizz1 and TGF-β1 were not changed and expressions of Arg1 and IL-10 were even enhanced by miR-124 inhibitor, suggesting that there are other mediators for M2 activation besides miR-124. [score:7]
We also found that miR-124 was essential for the up-regulation of CD206 and Ym1, and downregulation of CD86, iNOS (NO producing enzyme) and TNF in the M2-polarized macrophages. [score:7]
In addition to that, we found that the treatment with IL-4 upregulated miR-124, while treatment with IFN-γ/LPS upregulated miR-155 (Fig. 3B,C ). [score:7]
miR-124 inhibitor decreased expression of M2 markers CD206 and Ym-1 and increased expression of M1 markers CD86, iNOS, TNF, and miR-155 in the in-vitro polarized M2 macrophages. [score:7]
miR-124 Contributes to the Upregulation of CD206 and Ym-1 and Downregulation of CD86, iNOS, and TNF in M2 Polarized Macrophages. [score:7]
Thus we proposed that certain neuronal factors exist besides IL-4 or IL-13 that have an ability to upregulate the miR-124 expression in the microglia of the CNS [13]. [score:6]
As shown in Fig. 2B, the expression of miR-124 in alveolar macrophages was upregulated in WT but not in IL-4/13R deficient mice during the course of the allergic inflammation. [score:6]
We found that in IL-4 treated macrophages miR-124 inhibitor decreased expression of M2 markers CD206 and Ym-1 and increased expression of M1 markers CD86, iNOS, TNF and miR-155 when compared to control (Fig. 4A–C ). [score:6]
Expression of miR-124 is Substantially Upregulated in the Lung Macrophages during an Allergic Inflammation. [score:6]
Thus the expression of miR-124 is highly upregulated in the IL-4/IL-13 dependent manner in the lung macrophages during the allergic inflammation. [score:6]
Thus treatment of M1 macrophages with IL-4 did not result in either upregulation of miR-124 or conversion of M1 cells into M2 as determined by expression of phenotypical markers. [score:6]
Thus we believe that at least in the case of resident macrophages, the downregulation of CEBPα by miR-124 or by other means (e. g. CEBPα degradation regulated by Trib1) results in skewing towards the M2-like phenotype. [score:5]
To test our hypothesis we investigated factors that upregulate miR-124 in macrophages and found that exposure to IL-4 and IL-13 (M2a inducers) but not M1-inducing IFN-γ and LPS, or anti-inflammatory cytokines IL-10 or TGF-β1 (M2b inducers) resulted in upregulation of miR-124 in the cultured BM-derived and ex-vivo isolated peritoneal macrophages. [score:5]
The miR-124 inhibitor had a little or no effect on the expression of MHC class II (Fig. 4A ), TGF-β1 and Fizz1 (Fig. 4C ) in the IL-4 treated macrophages. [score:5]
We found that human monocytes from the peripheral blood of healthy individuals expressed miR-124 with the highest level of expression in the subset of the intermediate CD14 [+]CD16 [+] monocytes. [score:5]
The spontaneous expression of TNF in the BM-derived macrophages varied from one experiment to another influencing their responsiveness to IL-4 and the extent of the IL-4 -induced M2 phenotypical markers (e. g. Fizz1, Arg1) and miR-124 expression (not shown). [score:5]
We favor the second possibility, since we found that the expression of Arg1 was elevated even further in the presence of the miR-124 inhibitor. [score:5]
The miR-124 inhibitor (LNA-containing antisense oligonucleotide) or control scrambled antagomir (both from Exiqon) were used for in vitro transfections of the peritoneal macrophages cultured in the presence of IL-4 for 24 h. For transfection, miR-124 inhibitor was complexed with Lipofectamin 2000™ (Invitrogen) as described previously [15], [45]. [score:5]
Thus miR-124 in monocytic cells appears to be a useful marker for the M2-like macrophages and the overexpression or inhibition of miR-124 in macrophages may be beneficial for future therapeutic approaches to alter the balance towards M2 or M1. [score:5]
In the current study we show that during the allergic inflammation in the lung the balance is shifted towards the M2 phenotype, resulting in the upregulation of miR-124. [score:4]
The observed effect of treatment with IL-4 or IL-13 was detected at a wide range of IL-4 or IL-13 concentrations (10–200 ng/ml; not shown) and was stronger for the BM-derived macrophages resulting in a 6–12-fold upregulation of miR-124. [score:4]
Our previous study established that miR-124 directly targeted CEBPα, a master transcription factor of differentiation of monocytic cells [13], [15]. [score:4]
We also found that miR-124 was upregulated in M2 macrophages but was not induced in M1→M2 cells (Fig. 3C, M 1/M2). [score:4]
Thus, our study demonstrates that miR-124 contributes to the development of the M2 phenotype in various types of monocytic cells of different origins and high level of expression of this microRNA in lung macrophages is associated with allergic lung inflammation. [score:4]
Treatment of M1 macrophages with IL-4 did not result in upregulation of miR-124 and conversion of M1 cells into M2. [score:4]
We found that miR-124 is upregulated in macrophages either through an IL-4/IL-13 -dependent pathway during an allergic inflammation in the lung or independent of the IL-4/IL-13 pathway in case of the microglia. [score:4]
We have previously found that transfection of macrophages with miR-124 resulted in downregulation of the M1 -associated genes, such as TNF, MHC class II, and CD86, while at the same time upegulating the M2 -associated genes Fizz1, Arg1, and TGF-β1 [15]. [score:4]
Future experiments will determine the particular mechanisms of regulation of CD206 expression by miR-124 and CEBPα. [score:4]
Figure S2 Analysis of expression of miR-124 in the ex-vivo isolated microglia from the CNS of healthy B6-WT, B6-IL-4 (B6-IL-4 KO) and B6-STAT6 (B6-STAT6 KO) deficient (knock out) mice, or BALB/c-WT and BALB/c-IL-4/13R (BALB/c-IL-4/13R KO) deficient mice. [score:4]
We found that miR-124 was upregulated as early as at 4 hours of RAW 264.7 incubation with IL-4 in cell culture (Fig. 1C ). [score:4]
IL-4 and IL-13 Upregulate miR-124 in Macrophages on a Transcriptional Level. [score:4]
To confirm this, we injected intravenously IL-4 into IL-4 deficient mice that lack endogenous IL-4, and registered a 2.7-fold upregulation of miR-124 in the lung tissue macrophages which reached the level comparable to WT mice with endogenous IL-4 (Fig. 2A ). [score:4]
Our study clearly demonstrates that miR-124 may be used as an macrophage-specific M2 marker, which is significantly upregulated in macrophages during an allergic inflammation in mouse mo del. [score:4]
On the other hand, ex-vivo isolated peritoneal macrophages were already of the M2-like phenotype, given they were producing IL-4 (Fig. S1A) and were able to up-regulate miR-124 in response to the exogenous IL-4 up to 2–8 fold (Fig. 1 ). [score:4]
The effect of IL-4 or IL-13 on the ex-vivo isolated peritoneal macrophages or the macrophage line RAW 264.7 was less prominent, resulting in a 2–8-fold upregulation of miR-124, but these results were more consistent in the experimental repeats (Fig. 1C, E ). [score:4]
However, our in vivo results demonstrate the very dramatic (11-fold) upregulation of miR-124 during an allergic inflammation, indicating a role for miR-124 in alternative macrophage activation in vivo (Fig. 2 ). [score:4]
In our previous experiments we demonstrated that co-culture of macrophages with a neuronal line resulted in the up-regulation of miR-124 [15]. [score:4]
Expression of miR-124 in Normal Lung Resident Macrophages is IL-4/IL-13 -dependent. [score:3]
Expression of miR-124 in Microglia is IL-4/IL-13-independent. [score:3]
Analysis of kinetics of expression of the miRNA-124 precursor transcripts pri-miRNA-124.1, pri-miRNA-124.2 and pri-miRNA-124.3 in RAW264.7 cells treated with IL-4 1.. [score:3]
After which, the cells were stained for CD206, CD86 and MHC class II and analyzed by FACS (A), or used for RNA isolation and analysis of expression of miR-155 (B) or miR-124 (C) by real-time RT-PCR. [score:3]
0081774.g001 Figure 1Analysis of miR-124 expression in macrophages polarized in vitro towards M1 (IFN-γ/LPS), M2a (IL-4, or IL-13), or M2b (TGF-β1, or IL-10). [score:3]
To test the role of miR-124 in induction and maintenance of M2 phenotype, we performed the M2 polarization of the peritoneal macrophages by IL-4 in the presence of a miR-124 inhibitor (anatagomir) or control scrambled antagomir. [score:3]
We also found that induction of miR-124 in cultured bone-marrow derived macrophages depended highly on their initial state of activation and the baseline levels of expression of TNF. [score:3]
We have concluded that IL-4 and IL-13 did not contribute to the expression of miR-124 in the microglia of the CNS in vivo. [score:3]
We have previously shown that microglia in the normal CNS exhibited properties of the M2-type macrophages [8] and expressed high levels of miR-124 but not the M1 phenotype associated miR-155 or another reported M2 -associated miR-223 [15]. [score:3]
Human Intermediate CD14 [+]CD16 [+] Monocytes Express High Levels of miR-124 and Exhibit Properties of M2-like CellsIt was reported that human monocytic cells are altered in the peripheral blood of patients with allergies and severe asthma leading to a selective expansion of intermediate CD14 [+]CD16 [+] subset [16], [17]. [score:3]
We now show that classical and intermediate subsets expressed miR-124 and miR-424 while non-classical monocytes did not, suggesting that intermediate CD14 [+]CD16 [+] monocytes exhibited a more mature phenotype and properties of the M2-like cells. [score:3]
Although the expression of miR-124 in the lung resident (interstitial) macrophages was lower than in the microglia, it was still detected in WT B6 mice. [score:3]
The expression of pri-miR-124.3 was detected as early as at 30 minutes (0.5 hour) after exposure of the macrophages to IL-4 and was still observed 24 hours later. [score:3]
The classical CD14 [+]CD16 [−] monocytes (or same subset of CD14 [++]CD16 [−] or CD14 [high]CD16 [−] cells as described in other publications) expressed both miR-124 and miR-155 (miR-155 is associated with the M1 phenotype of the pro-inflammatory macrophages in pathology [13]) and exhibited the properties of dually activated M1/M2-lke cells (Fig. 5 ) [23], [37] similarly to the macrophages that migrated into the CNS from the periphery in mice with neuroinflammation [8]. [score:3]
Analysis of the miR-124 expression in lung macrophages in the baseline conditions or during the OVA -induced allergic lung inflammation. [score:3]
[1] The cells were treated with 50 ng/ml of IL-4 and harvested at indicated time points after adding of IL-4. RNA was isolated and expression of pri-miR-124.1, pri-miR-124.2 or pri-miR-124.3 was analyzed by real-time RT PCR as described “−”) if no product was detected after more than 40 cycles of amplification. [score:3]
In addition to the expression of miR-124 in lung macrophages during an allergic lung inflammation, miR-124 could potentially serve as a marker for changes of M1/M2 balance in the periphery. [score:3]
Thus the CNS-derived IL-4 and IL-13 could potentially induce miR-124 expression in the microglia of the normal CNS. [score:3]
We hypothesized that endogenous IL-4 contributed to the miR-124 expression in the lung resident macrophages under baseline conditions. [score:3]
Analysis of expression of miR-124 (the M2 marker), miR-155 (the M1 marker) and miR-424 (the marker for immature monocytes) in the populations of classical (CD14 [++]CD16. [score:3]
We found that exposure to the Th2 cytokines IL-4 and IL-13 but not the anti-inflammatory cytokines IL-10, TGF-β or the M1-inducing stimuli, such as IFN-γ/LPS, resulted in miR-124 expression in the bone marrow (BM) derived and peritoneal macrophages, as well as in a macrophage cell line RAW 264.7. [score:3]
Finally, we demonstrated that the subset of human intermediate CD14 [+]CD16 [+] monocytes, which is associated with asthma progression and allergic inflammation [16], [17], expressed high levels of miR-124. [score:3]
Indeed, we found that IL-4 induced the expression of all three known precursors for miR-124: pri-miR-124.1, pri-miR-124.2 and pri-miR-124.3. [score:3]
Thus there is a possibility that miR-223 can substitute for miR-124 in macrophages treated with miR-124 inhibitor. [score:3]
First, the miRNA inhibitors may not work efficiently enough to completely counteract the function of miR-124 in the cells. [score:3]
During the course of the Th1 -mediated autoimmune inflammation (i. e., experimental autoimmune encephalitis) the expression of miR-124 declined [15], while the CNS-derived IL-4 was shown to be important for the induction of several M2 markers in the microglia [8]. [score:3]
Peritoneal CD11b [+]F4/80 [+] macrophages were isolated and treated with IL-4 in the presence of liposomes with miR-124 inhibitor or control antagomir for 24 hours as described in. [score:3]
As for miR-124 it was also shown that another M2 -associated microRNA, miR-223, was capable of inhibiting the STAT3 pathway [26]. [score:3]
M1 Macrophages are Resistant to Induction of M2 Phenotype and Expression of miR-124. [score:3]
0081774.g002 Figure 2(A) Lung interstitial macrophages were isolated from the unmanipulated B6-WT mice, B6-IL-4 deficient mice, or B6-IL-4 deficient mice in which IL-4c was systemically administered as described in and the expression of miR-124 was measured as in Fig. 1. (B) Lung alveolar macrophages were isolated from the unmanipulated BALB/c-WT healthy mice, or BALB/c-WT and BALB/c-IL-4/13R deficient mice with OVA -induced allergic lung inflammation and the expression of miR-124 was analyzed. [score:3]
Microglia were isolated as described in and the expression of miR-124 was analyzed as in Fig. 1. The data is representative of three separate experiments with Mean ± S. E. of triplicate shown. [score:3]
We further investigated whether miR-124 expression contributed to the expression of the M2 markers in the polarized macrophages. [score:3]
Human Intermediate CD14 [+]CD16 [+] Monocytes Express High Levels of miR-124 and Exhibit Properties of M2-like Cells. [score:3]
In all our conditions for various mouse strains, we isolated sufficient amount of macrophages from lungs: 0.5–0.9×10 [6]/mouse for alveolar macrophages and 1–3×10 [6]/mouse for interstitial macrophages to perform analysis of miR-124 expression by real-time RT-PCR. [score:3]
To conclude, we found that IL-4 is capable of inducing the miR-124 expression in macrophages in vitro on a transcription level. [score:3]
miR-124 antagomir inhibitor or control scrambled antagomir were purchased from Exiqon Inc (Woburn, MA). [score:3]
We further investigated the expression of miR-124 in human peripheral blood monocytes and found that in contrast to their mouse counterparts that expressed rather low amounts of miR-124 [15], human circulating monocytes exhibited high levels of miR-124 (not shown). [score:3]
It was previously demonstrated that the IL-4/13R deficient mice are resistant to the OVA -induced lung inflammation [21], consistent with the fact that in our experiments the level of the miR-124 expression in the macrophages of IL-4/13R deficient mice challenged with OVA was even lower than in healthy mice (Fig. 2B ; Healthy WT mice). [score:3]
Thus, miR-124 expression in the CNS-resident microglia is IL-4/IL-13 independent. [score:3]
This finding suggests that endogenous IL-4 mediates miR-124 expression in the lung macrophages in vivo. [score:3]
The populations of CD14 [++]CD16 [−], CD14 [+]CD16 [+], and CD14 [low]CD16 [+] monocytes and CD14-CD16-CD4+ CD4 subsets were sorted by FACS and the expression of miR-124, miR-155, and miR-424 was analyzed as described in. [score:3]
We have previously demonstrated that in contrast to the mouse macrophages in the periphery, microglia expressed high levels of miR-124, but not miR-223 [15], and this microRNA contributed to the M2 phenotype in these cells, suggesting the role of miR-124 in polarization of CNS-resident macrophages [13], [15]. [score:3]
Analysis of miR-124 expression in macrophages polarized in vitro towards M1 (IFN-γ/LPS), M2a (IL-4, or IL-13), or M2b (TGF-β1, or IL-10). [score:3]
B6-WT and B6-IL-4 deficient mice, or BALB/c-WT and BALB/c-IL-4/13R deficient mice with an OVA -induced allergic lung inflammation and expression of miR-124 was analyzed. [score:3]
Transfection of Macrophages with miR-124 Inhibitor. [score:3]
0081774.g005 Figure 5Analysis of expression of miR-124 (the M2 marker), miR-155 (the M1 marker) and miR-424 (the marker for immature monocytes) in the populations of classical (CD14 [++]CD16 [−] ), intermediate (CD14 [+]CD16 [+]) and non-classical (CD14 [low]CD16 [+]) human monocytes. [score:3]
The expression of two other transcripts, pri-miR-124.1 and pri-miR-124.2, was transient and was detected less frequently between experiments (Table 1 ). [score:3]
Since the induction of miR-124 in macrophages by IL-4 was highly consistent in the peritoneal macrophages as well as the macrophage cell line RAW 264.7, we further investigated the kinetics and molecular mechanisms of miR-124 up-regulation by IL-4 in the RAW 264.7 mo del system. [score:2]
[3] Expression was considered positive (Bone marrow (BM) derived cultured macrophages (A, B), ex-vivo isolated CD11b [+]F4/80 [+] peritoneal macrophages (C, D), or macrophage cell line RAW 264.7 (E) were incubated with media alone (Media), or IFN-γ and LPS (IFN-γ/LPS), or IL-4, or IL-13, or TGF-β1, or IL-10 for 24 hours, after which the expression of miR-124 was measured by the real-time RT-PCR as described in. [score:2]
Finally we found that miR-124 was expressed at a high level during the allergic inflammation in the lung interstitial macrophages when compared to healthy mice of B6 and BALB/c strains (Fig. 2C ). [score:2]
Expression of miR-124 in IL-4 deficient (or in IL-4/13R deficient mice; not shown) was 2–4 fold lower compared to WT mice (Fig. 2A ). [score:2]
We further investigated particular molecular mechanisms of how miR-124 was upregulated in the macrophages treated with IL-4. In theory IL-4 could induce miR-124 on a transcriptional level or by enhancing the processing of this miRNA as was shown previously for other cell types [18], [19]. [score:2]
Finally, besides miR-124 and miR-223, other microRNAs may also contribute to M2 phenotype of macrophages further suggesting redundant mechanisms in the regulation of M2 polarization by several microRNAs [27]. [score:2]
[3] Expression was considered positive (In the following experiments we investigated whether IL-4 or IL-13 was required to induce the expression of miR-124 in macrophages in vivo. [score:2]
However, it was not clear from our previous studies whether miR-124 serves as a universal regulator of M2 macrophage polarization or its function was restricted to the microglial cells in the CNS only. [score:2]
We showed that miR-124 dowregulated CEBPα in microglia and macrophages resulting in the acquisition of the M2-like phenotype [15]. [score:2]
Thus miR-124 could only partially substitute for IL-4 in knockdown experiments. [score:2]
Expression of miR-124 (B), miR-155 (C) and miR-424 (D) was analyzed in three sorted monocyte populations and compared to CD4 T cells. [score:2]
We then asked which subset of human monocytes expressed miR-124 and found that classical CD14 [++]CD16 [−] monocytes had intermediate levels of miR-124, CD14 [+]CD16 [+] monocytes contained the highest levels of miR-124, and non-classical CD14 [low]CD16 [+] were virtually miR-124 -negative compared to that of CD4 T cells used as a negative control (Fig. 5A ). [score:2]
To investigate whether IL-4 and IL-13 induce the expression of miR-124 in the CNS, we compared the levels of miR-124 expression in the microglia isolated from the wild type (WT), STAT6 (Signal transducer and activator of transcription 6 that is downstream of IL-4 and IL-13 receptors)-, or IL-4-, and IL-4/IL-13 receptor common α-chain (IL-4/13R or IL-4Rα) -deficient mice. [score:2]
We compared the level of the miR-124 expression in the alveolar macrophages sorted by FACS from the BAL cells of WT vs. [score:2]
In the following experiments we investigated whether IL-4 or IL-13 was required to induce the expression of miR-124 in macrophages in vivo. [score:1]
Thus miR-124 appears to be a marker of the M2a cells (Fig. 1A ). [score:1]
We have shown previously that miR-124 determines the phenotype of the resident macrophages (microglia) in the CNS that exhibited properties of the M2 macrophages [8], [15]. [score:1]
If IL-4 induces miR-124 on the transcriptional level, then longer precursor transcripts (pri-miRNA) should be detected in the IL-4 treated macrophages. [score:1]
For the analysis of miR-124, miR-155, and miR-424 expression in the populations of monocytic cells, total RNA was isolated using miRNeasy Mini Kit (Qiagen), and real-time RT-PCR analyses were carried out using the TaqMan miRNA assays and the proper mouse and human primer and probe sets (Applied Biosystems). [score:1]
In this study we demonstrate that miR-124 contributes to the M2 phenotype of monocytic cells of various origins from several anatomic locations. [score:1]
Thus, we hypothesized that miR-124 promotes the M2 polarization. [score:1]
Bone marrow (BM) derived cultured macrophages (A, B), ex-vivo isolated CD11b [+]F4/80 [+] peritoneal macrophages (C, D), or macrophage cell line RAW 264.7 (E) were incubated with media alone (Media), or IFN-γ and LPS (IFN-γ/LPS), or IL-4, or IL-13, or TGF-β1, or IL-10 for 24 hours, after which the expression of miR-124 was measured by the real-time RT-PCR as described in. [score:1]
Since we found that IL-4 or IL-13 did not induce miR-124 in the microglia of the CNS (Fig. S2), we investigated the expression of miR-124 under the influence of IL-4 or IL-13 in the resident macrophages of other tissues such as lungs. [score:1]
[1 to 20 of 120 sentences]
3
[+] score: 476
In this study we aim to address the following questions: (1) whether estrogen suppresses miR-124 expression through ER, and which subunit of ER is required for estrogen-regulated miR-124 downregulation; (2)what is the role of miR-124 in ER positive and ER negative BC cell proliferation, migration and invasion with ER treatment; (3) what is/are functional target(s) of the miR-124; (4) whether the target(s) is/are regulated by estrogen in ER positive breast cancer cells; and (5) the role of miR-124 in regulating ER positive breast tumor growth and angiogenesis. [score:15]
To test whether E2 inhibits miR-124 expression through the function of ER, the ER -positive and ER -negative BC cells MCF7 and MDA-MB-231 were treated with E2 or Eth at different time points and the results showed that miR-124 expression was downregulated at 6, 12 and 24 h post E2 treatment in MCF7 cells (Figure 1B), but not in MDA-MB-231 cells (Figure 1C), suggesting that ER is necessary for E2 to inhibit miR-124 expression. [score:14]
miR-124 may act as a tumor suppressor to inhibit BC development by targeting AKT2, and ERα is required for E2 upregulated-AKT2 expression, which can bereversedby miR-124 in ERα -positive BC cells. [score:13]
In this study, we found that estrogen upregulated and downregulated the expression of certain miRNAs, and miR-124 was the most prominent downregulated miRNAs in response to estrogen treatment. [score:12]
In this study, we demonstrated that E2 could upregulate or downregulate certain miRNAs, and miR-124 was the most prominently downregulated miRNA which is regulated by E2 treatment in ER -positive BC cells. [score:11]
miR-124 directly targets and inhibits AKT2 expression, miR-124 levels inversely correlates with AKT2 expression levels in ERα -positive BC tissues. [score:10]
Interestingly, several miRNAs were significantly upregulated (miR-196a and miR-200a), or downregulated (miR-7, miR-124 and miR-497) among which miR-124 was the most significantly downregulated miRNA (Figure 1A). [score:10]
Although E2 treatment significantly induced AKT2 expression in MCF7 cells, but not in MDA-MB-231 cells, forced expression of miR-124 suppressed AKT2 expression with or without E2 treatment in both cells (Figure 7G–7J). [score:9]
To further determine which subunit of ER is responsible for the downregulation of miR-124 expression, MCF7 cells were transfected with siRNAs against ERα, ERβ or negative control (siNC) to knock down the expression of ERα and ERβ in the cells, respectively. [score:9]
Some reports indicated that ERα instead of ERβ interacts with and suppresses Drosha activity through which could downregulate numbers of miRNAs in ER -positive BC cells that were similar to our data [33], however, the in-depth mechanisms of downregulation of miR-124 induced by estrogen remains to be elucidated. [score:9]
Overexpression of AKT2 was sufficient to reverse miR-124 -inhibited cell proliferation, migration and invasion in both MCF7 (Figure 6C, 6E and 6G) and MDA-MB-231 cells (Figure 6D, 6F and 6H), suggesting that the inhibitory effect of miR-124 in human BC cells is via the function of its target AKT2. [score:9]
To determine whether miR-124 inhibits BC development through its target AKT2, the stable cells of MCF7 and MDA-MB-231 cells overexpressing miR-124 were transfected with AKT2 cDNA without 3′-UTR. [score:8]
ERα is required for E2 upregulated-AKT2 expression, which can be inhibited by miR-124 in ERα -positive BC cells. [score:8]
To fully understand the mechanisms of miR-124 in suppressing E2 induced BC development, TargetScan search program was used to predict the targets of miR-124. [score:8]
Although there were several identified targets of miR-124 which participated in miR-124 mediated BC development and progression, the researches about the functions and mechanisms of estrogen downregulated miR-124 in ER positive BC cells are still scanty. [score:7]
To further study whether E2 affects expression levels of AKT2, the target of miR-124, we found that E2 treatment promoted AKT2 expression in MCF7 cells (Figure 7A), but not in MDA-MB-231 cells (Figure 7B). [score:7]
However, there was no effect of ERβ knockdown on miR-124 expression (Figure 2B), indicating that ERα, but not ERβ, is involved in regulating miR-124 expression. [score:7]
In agreement with the results in vitro, overexpression of miR-124 suppressed AKT2 expression, in tumor tissues (Figure 8E). [score:7]
In this study, we discovered that AKT2 was a new direct target of miR-124, which was confirmed by clinical BC specimens showing that miR-124 levels inversely correlate with AKT2 expression levels. [score:6]
These results show that miR-124 acts as a tumor suppressor toinhibittumor development by attenuating cell viability, migration and invasion in both ERα -positive and ERα -negative BC cells. [score:6]
Estradiol (E2) mediates levels of certain miRNAs, and miR-124 is the most prominently downregulated miRNA which is inhibited by E2 treatment in estrogen receptor (ER) positive BC cells. [score:6]
The results of this study will shed light on how estrogen regulates BC development through regulating miR-124, and will be helpful for finding new biomarkers and/or therapeutic targets for ER positive BC. [score:6]
Besides, we identified AKT2 as a novel target of miR-124, which is upregulated in clinical BC specimens, which may be used to differentiate ERα -positive and –negative BC. [score:6]
Similar to E2 -downregulated miR-124, E2 induces AKT2 expression through ERα. [score:6]
Successful inhibition of endogenous miR-124 expression was confirmed by qRT-PCR (Supplementary Figure S1C–S1D). [score:5]
Forced expression of AKT2 reverses miR-124 -suppressed cell proliferation, migration and invasion. [score:5]
ERα, but not ERβ, is required for E2 -suppressed miR-124 expression. [score:5]
After 72 h, the relative expression levels of miR-124 were analyzed by qRT-PCR and normalized to U6 expression levels. [score:5]
It was also reported that miR-124 inhibited cellular proliferation and invasion by targeting Ets-1 in breast cancer cells [35]. [score:5]
Similarly, knockdown of ERα recovered E2 -suppressed miR-124 levels in MCF7 cells, but not in MDA-MB-231 cells (Figure 2E and 2F), demonstrating that miR-124 is regulated by E2 via ERα. [score:5]
The results showed that the silence of ERα significantly inhibited miR-124 expression in a dose -dependent manner (Figure 2A). [score:5]
miR-124 overexpression inhibits E2 -induced cell proliferation, migration and invasion in ER -positive BC cells. [score:5]
To further confirm the role of E2 and ERα in mediating miR-124 expression upon E2 treatment, we found that E2 decreased miR-124 levels in MCF7 cells, whereas the estrogen antagonist tamoxifen (TAM) restored miR-124 expression (Figure 2C). [score:5]
Overexpression of miR-124 inhibits tumor growth and angiogenesis. [score:5]
The new regulatory circuit of E2/ERα/miR-124/AKT2 in BC plays an important role in BC tumorigenesis and development, which will provide potential novel biomarkers and targets for the diagnosis and treatment of BC. [score:5]
Similarly, forced expression of miR-124 markedly suppressed E2 treatment-promoted cell migration and invasion in MCF7, the ER -positive BC cells (Figure 4C and 4E). [score:5]
In addition, stable cells of MCF7 and MDA-MB-231 overexpressing miR-124 showed decreased AKT2 expression at protein level (Figure 5C). [score:5]
ERα, but not ERβ, was required for E2 -suppressed miR-124 expression. [score:5]
These results suggest that miR-124 suppresses tumorigenesis and angiogenesis of human ERα -positive BC in nude mice, and AKT2 is an important target involved in this process. [score:5]
Overexpression of miR-124 in MDA-MB-231 cells decreased luciferase activity of wild type reporter to 50%, suggesting that miR-124 may inhibit the 3′-UTR function of AKT2. [score:5]
I. and J. The expression levels of AKT2 and GAPDH were determined by immunoblotting in miR-124- and miR-NC -overexpressing cells without or with E2 treatment for 48 h. The densities of AKT2 were quantified by Image J software and GAPDH levels were used as internal control, and normalized to the values of Eth control. [score:5]
These results show the negative correlation between the expression levels of miR-124 and its target AKT in human BC tissues. [score:5]
G. and H. The cells were cultured as above and the expression levels of AKT2 were determined by qRT-PCR in miR-124- and miR-NC -overexpressing cells without or with E2 treatment for 24 h using GAPDH levels as internal control, and normalized to the value of Eth control. [score:5]
C. The expression of AKT2 and GAPDH was determined using immunoblotting in MCF7 and MDA-MB-231 cells overexpressing miR-124 and miR-NC. [score:5]
On the contrary, E2 and TAM showed no effect on AKT2 expression in MDA-MB-231 cells, which is consistent with our previous results showing that E2 and TAM did not regulate miR-124 levels in MDA-MB-231 cells (Figure 7D). [score:4]
A. Knockdown of ERα in MCF7 cells induced miR-124 expression. [score:4]
These results indicate that AKT2 is a direct target of miR-124 by binding to the seed sequence. [score:4]
Downregulation of endogenous miR-124 promotes the proliferation, migration and invasion of BC cells. [score:4]
To explore whether miR-124 directly targets the 3′-UTR of AKT2, we constructed luciferase reporter plasmids containing the putative wild-type binding sites (WT) and seed sequence mutant sites (mut) at 3′-UTR of AKT2 (Figure 5A) and verified by sequencing. [score:4]
This result also indicates the downregulation of miR-124 induced by estrogen is involved in estrogen -mediated BC progression. [score:4]
Our previous results demonstrate that E2 regulates miR-124 expression in ERα -positive cells, but not in ERα -negative cells. [score:4]
More importantly, miR-124 plays an important role in ERα -positive BC cells to suppress the estrogen -induced cell viability, migration and invasion, demonstrating a novel role of miR-124 in E2-regulated BC, which accounts for about 75% of diagnosed breast tumors. [score:4]
In this study, we discovered that estrogen-regulated miR-124 plays an important role in BC cell proliferation, migration, invasion, tumor growth and angiogenesis, and also identified that miR-124 suppression caused by E2 in ER -positive BC cells is through ERα instead of ERβ. [score:4]
E. Knockdown of ERα recovered E2 -suppressed miR-124 levels in MCF7 cells. [score:4]
Figure 2 A. Knockdown of ERα in MCF7 cells induced miR-124 expression. [score:4]
Downregulation of endogenous miR-124 levels promotes cell proliferation, migration and invasion. [score:4]
F. E2 treatment and knockdown of ERα showed no effect on miR-124 expression in MDA-MB-231 cells. [score:4]
G. and H. Transwell invasion assay was performed as above using control cells and cells overexpressing miR-124 with or without AKT2 overexpression. [score:4]
Thus, we will test the role and mechanism of estrogen -suppressed miR-124 in BC development in this study. [score:4]
The inhibition of miR-124 remarkably increased cell growth, migration, and invasion of the breast cancer cells (Figure 3A-3F), demonstrating the potential important role of endogenous miR-124 in BC development. [score:4]
The downregulation of miR-124 by E2 in ER -positive BC cells is through ERα but not ERβ, which will broaden our understanding the mechanisms of estrogen-modulated BC. [score:4]
B. E2 treatment reduced miR-124 expression in MCF7 cells. [score:3]
Figure 3 A. and B. MCF7 and MDA-MB-231 cells were transfected with anti-miR-124 inhibitor (Anti-miR-124), or control anti-sense RNA (anti-miR-NC). [score:3]
Cells were cultured with E2 or Eth for 0, 6, 12 and 24 h. The relative miR-124 expression levels were analyzed as above. [score:3]
D. E2 and TAM had no effect on miR-124 expression. [score:3]
B. ERβ silencing had no effect on miR-124 expression. [score:3]
To identify whether endogenous miR-124 affects tumor progression, MCF7 and MDA-MB-231 cells were transfected with miR-124 inhibitor (Anti-miR-124) or control anti-sense RNA (Anti-miR-NC). [score:3]
In addition, miR-124 overexpression also decreased cell growth without E2 treatment (Figure 4A). [score:3]
Our previous studies have showed that miR-124 could govern glioma growth and angiogenesis and enhance chemosensitivity by targeting R-Ras and N-Ras [34]. [score:3]
D. Spearman's correlation analysis was used to determine the correlation between the expression levels of AKT2 and miR-124 in human BC specimens (n=46). [score:3]
MCF7 cells were cultured in estrogen-free medium and treated without or with 10 nM E2 and 100 nM TAM for 24 h. The expression of miR-124 was detected as above. [score:3]
MCF7 cells overexpressing miR-124 or miR-NC were subcutaneously injected into both posterior flanks of nude mice. [score:3]
Forced expression of miR-124 did not affect the transcriptional activation of mutant AKT2 3′-UTR (Figure 5B). [score:3]
To test whether miR-124 specifically inhibits AKT2 by binding its seed sequence, we also mutated the miR-124 binding site in the reporter construct (Mutant). [score:3]
C. E2 treatment had no effect on miR-124 expression in MDA-MB-231 cells. [score:3]
A. and B. MCF7 and MDA-MB-231 cells were transfected with anti-miR-124 inhibitor (Anti-miR-124), or control anti-sense RNA (anti-miR-NC). [score:3]
E2 or TAM treatment had no effect on miR-124 expression in MDA-MB-231 cells (Figure 2D). [score:3]
MCF7 cells stably expressing miR-124 or miR-NC were injected subcutaneously into both flanks of nude mice (5×10 [6] cells in 100 μl serum-free DMEM medium). [score:3]
C. E2 treatment decreased miR-124 expression, which was restored by tamoxifen (TAM) treatment. [score:3]
We found that E2 treatment significantly increased cell proliferation, whereas forced expression of miR-124 attenuated E2 -induced cell proliferation in MCF7 cells. [score:3]
In addition, silence of miR-124 by siRNAs reversed the AKT2 suppression caused by the interference of ERα in ER positive BC cells, and our result indicated high correlation between ERα and AKT2 levels via miR-124 levels (Figure 7K–7M). [score:3]
miR-124 has been reported to act as a tumor suppresser in many cancers including BC [30– 32]. [score:3]
MCF7 cells were cultured as above, then transfected with siERα or siNC for 24 h. Cells were treated with or without 10 nM E2 for 24 h and the expression of miR-124 were detected as above. [score:3]
Furthermore, Spearman's rank correlation analysis showed an inverse correlation between expression levels of AKT2 and miR-124 in human BC specimens (Spearman's correlation r=−0.3130, Figure 5D). [score:3]
We found AKT2, a well-known oncogene, could be a potential target of miR-124. [score:3]
To further study the role of miR-124 in E2-promoted BC development, MCF7 and MDA-MB-231 cells were transduced by lentivirus carrying miR-124 or negative control (miR-NC), and the stable cell lines were obtained by puromycin selection. [score:2]
In summary, we have demonstrated that miR-124 is one of the miRNAs which are regulated by estrogen levels. [score:2]
Our results demonstrate a key role of a new regulatory circuitof E2/ERα/miR-124/AKT2 in mediating tumor angiogenesis and cancer progression in BC. [score:2]
However, overexpression of miR-124 attenuated cell proliferation, migration and invasion when compared to miR-NC group in MDA-MB-231 cells (Figure 4B, 4D and 4F). [score:2]
** indicates significant difference compared to miR-NC+vector group at P < 0.01; ## indicates significant difference compared to miR-124+vector group at P < 0.01. miR-124- or miR-NC -overexpressing cells were transfected with vector or AKT2 cDNA without 3′-UTR. [score:1]
A. MCF7/miR-124 and MCF7/miR-NC cells were dispersed in 100 μl of serum-free DMEM medium and were subcutaneously injected into both sides of posterior flank of the nude mice (n=4). [score:1]
A. MCF7/miR-124 and MCF7/miR-NC stable cells were plated at 2,000 cells/well in 96-well plates. [score:1]
After 24 h, cells were co -transfected with either wild-type (WT) or mutant-type (mut) luciferase reporter plasmids containing AKT2-3′-UTR, pGL4.74 vector control (Ambion) and equal amounts of pre-miR-124 or pre-miR-NC using Lipofectamine 2000 (Invitrogen) according the manufacturer's instruction. [score:1]
Figure 8 A. MCF7/miR-124 and MCF7/miR-NC cells were dispersed in 100 μl of serum-free DMEM medium and were subcutaneously injected into both sides of posterior flank of the nude mice (n=4). [score:1]
The 3′-UTR-luciferase reporter constructs containing the 3′-UTR of AKT2 with wild-type and mutant binding sites of miR-124 were amplified using PCR method. [score:1]
Figure 5 A. Putative seed-matching sites (in bold) or mutant sites (red) between miR-124 and 3′-UTR of AKT2. [score:1]
The putative binding sites between miR-124 and 3′-UTR of miR-124 were shown in Figure 4A. [score:1]
B. MDA-MB-231/miR-124 and MDA-MB-231/miR-NC stable cells were treated and analyzed as above. [score:1]
The tumor size of miR-124 group was smaller than that of control group (Figure 8C). [score:1]
** indicates significant difference between two groups at P < 0.01 M. and N. Cells were cultured as above and transfected with Anti-miR-NC or Anti-miR-124. [score:1]
K. and L. MCF7 and MDA-MB-231 cells were cultured as above and transfected with siRNAs, and divided in four groups including siNC+Anti-miR-NC, siERα+Anti-miR-NC, siNC+Anti-miR-124, siERα+ Anti-miR-124 group. [score:1]
MDA-MB-231 cells were treated and miR-124 was analyzed as above. [score:1]
Figure 4The estrogen -positive and -negative cell lines MCF7 and MDA-MB-231 were infected with lentivirus carrying miR-124 or miR-NC to establish stable cell lines. [score:1]
A. Putative seed-matching sites (in bold) or mutant sites (red) between miR-124 and 3′-UTR of AKT2. [score:1]
The estrogen -positive and -negative cell lines MCF7 and MDA-MB-231 were infected with lentivirus carrying miR-124 or miR-NC to establish stable cell lines. [score:1]
ER -negative BC cells MDA-MB-231 were treated and miR-124 was detected as above. [score:1]
Lentivirus carrying miR-124 or negative control (miR-NC) was packaged in 293T cells and collected from the supernatant as instructed by the manufacturer's manual. [score:1]
Consistent with tumor size, the tumor weight of miR-124 group was 31% of control group (Figure 8B). [score:1]
[1 to 20 of 108 sentences]
4
[+] score: 429
miR-124 level is down-regulated (human-originated, n = 5; Lukiw, 2007), while the expression of β-site APP cleaving enzyme 1 (BACE1) is up-regulated, in AD patients’ brain (Bigl et al., 2000; Sun et al., 2002; Yang et al., 2003; Lukiw, 2007; Smith et al., 2011), indicating a possible inverse relationship between them. [score:9]
Utilizing a mouse mo del of multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE), Ponomarev et al. (2011) showed that microglia miR-124 expression decreased by ~70% during the course of the disease, while overexpression of miR-124 could promote microglia quiescence and suppress EAE by deactivating macrophages via the C/EBP-α-PU. [score:9]
Additionally, Liu et al. (2013) found that although a miR-124 mimic did not affect the infarct volume at 24 h after ischemia, inhibition of miR-124 effectively reduced the ischemic injury due to iASPP expression up-regulation. [score:8]
SCP1 down-regulation is another critical factor for inducing neurogenesis during embryonic CNS development in both chick and mouse embryos, and miR-124 contributes to this process in part by down -regulating SCP1 expression (Visvanathan et al., 2007). [score:8]
Hundreds of transcripts endogenously expressed in neurons with target sites for miR-124 are coordinately upregulated in a variety of neuronal stresses. [score:8]
Inhibitory member of the apoptosis -stimulating proteins of p53 family iASPP StrokeInhibition of miR-124 effectively reduced the ischemic injury due to the up-regulation of iASPP level (Liu et al., 2013). [score:8]
Fang et al. (2012) further demonstrated that miR-124 overexpression or knockdown could decrease or increase the expression of BACE1, and found that miR-124 may work as an important regulating factor to alleviate cell death in the process of AD by targeting BACE1 in rat PC12 cells (Fang et al., 2012), which is considered to participate in the rate-limiting step in the production of neurotoxic Aβ (Hebert et al., 2008). [score:8]
Others reported that miR-124 inhibits glioma cells migration and invasion by down-regulation of ROCK1 (An et al., 2013), and induced glioma differentiation by suppressing Twist and SNAI2 (Xie et al., 2012). [score:8]
Xia et al. (2012) demonstrated that the tumor suppressor activity of miR-124 could by partly due to its inhibitory effects on glioma stem – like traits and invasiveness through down-regulation of SNAI2 in human. [score:8]
In addition, the ectopic expression of miR-124 in a glioblastoma cell line resulted in significant inhibition of migration and invasion, suggesting that miR-124 may be a novel inhibitor of glioblastoma invasion (Fowler et al., 2011). [score:7]
Furthermore, a recent review has shown that one–fourth (49 out of 202, MIRECORDS database) of “validated” targets of miR-124 are de-regulated in PD (Sonntag, 2010), indicating an important role for miR-124 in the regulation of this disease. [score:7]
Thus, miR-124 may be involved in neurodegeneration diseases such as Alzheimer’s disease (AD) and Parkinson’s disease (PD). [score:7]
Overexpression of miR-124 indeed significantly inhibits expression of 100s of stress -induced transcripts detected by microarray (Manakov et al., 2012). [score:7]
It was recently reported that miR-124 is both necessary and sufficient to promote cell proliferation and repress neurogenesis at the optic vesicle stage which precedes optic cup formation, showing an anti-neural role by negatively regulating the expression of the pro-neural marker NeuroD1, and revealing a novel regulatory role of miR-124 in neural development (Liu et al., 2011a). [score:6]
The miR-124 regulates the expression of BACE1/beta-secretase correlated with cell death in Alzheimer’s disease. [score:6]
Target gene name Abbreviation CNS disorder Function in CNS SRY-box transcription factor Sox9 NeurogenesisNeurogenesis in embryonic neuroepithelial cells in the spinal cord is regulated by miR-124 and its target Sox9 (Farrell et al., 2011). [score:6]
Small C-terminal domain phosphatase 1 SCP1 Neurogenesis glioblastomaSCP1 down-regulation induces neurogenensis, and miR-124 contributes to this process in part by targeting it (Visvanathan et al., 2007). [score:6]
Solute carrier family 16, member 1 Slc16a1 MedulloblastomaSLC16A1 represents one of the non-neuronal targets regulated by miR-124, and its enhanced expression in medulloblastoma may confer growth advantage to tumor cells (Li et al., 2009). [score:6]
Overexpression of miR-124 could lead to the reduced astrocytic lineage differentiation by inhibiting STAT3 signaling (Krichevsky et al., 2006). [score:5]
MicroRNA-124 (miR-124) is highly and specifically expressed in all brain regions except for the pituitary gland, and at 100 times lower expression in other tissues (Mishima et al., 2007; Baroukh and Van Obberghen, 2009). [score:5]
miR-124 also ensures the transition from neural progenitors to neurons by repressing two endogenous targets, LAMC1 and ITGB1, which are highly expressed by neural progenitors, but are repressed upon neuronal differentiation in the chick embryos (Cao et al., 2007). [score:5]
miR-124 is frequently down-regulated in medulloblastoma and is a negative regulator of SLC16A1. [score:5]
miR-124 was also found to inhibit stroke -induced neurogenesis by targeting the JAG1/Notch signaling pathway (Liu et al., 2011b). [score:5]
Increased miR-124 expression affects the ability of tumor cells to survive under O [2] and/or nutrient deprivation, while miR-124 re -expression increases cell death in vivo and enhances the survival of mice bearing intracranial xenograft tumors. [score:5]
CCAAT/enhancer -binding protein-α C/EBP-α NeuroimmunityOverexpression of miR-124 could promote microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-α-PU. [score:5]
In mouse embryonic development, miR-124 directly targets polypyrimidine-tract -binding protein (PTBP) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in non-neuronal cells (Makeyev et al., 2007). [score:5]
Lawson et al. (2013) reported that expression of the p38α protein is suppressed in the brain by two neuron-selective miRNAs, miR-124, and -128. miR-124 may influence neuroimmunity by affecting p38α -mediated signaling. [score:5]
EPAC null mutation impairs learning and social interactions via aberrant regulation of miR-124 and Zif268 translation. [score:5]
Overexpression of miR-124 could lead to reduced astrocytic lineage differentiation by inhibiting STAT3 signaling (Krichevsky et al., 2006). [score:5]
Neuroblastoma RAS viral (v-ras) oncogene homolog NRAS GlioblastomaNRAS is among the oncogene targets of miR-124 in glioblastoma and its signaling pathway plays a crucial role in many cancers by regulating cell proliferation, differentiation, and survival (Lang et al., 2012). [score:4]
For example, miR-124 alleviates cell death in the process of AD by targeting BACE1, while increases cell death in glioblastoma by regulating TEAD1, MAPK14/p38α, and SERP1 (Mucaj et al., 2014). [score:4]
miR-124 is expressed from the beginning of eye development in Xenopus, and has been shown to repress cell proliferation in the optic cup. [score:4]
miR-124 expression is significantly decreased in anaplastic astrocytoma and glioblastoma relative in human patients to non-neoplastic brain tissue (Fowler et al., 2011; Hua et al., 2012; Lang et al., 2012; Ho et al., 2013), and is expressed at different levels in glioblastoma compared with normal brain (Silber et al., 2008; Godlewski et al., 2010). [score:4]
ephrin-B1 EfnB1 NeurogenesisEfnB1 is a target of miR-124 in neurogenesis, while miR-124 is itself regulated by EfnB1 in neural progenitor cells (Arvanitis et al., 2010). [score:4]
Distal-less homeobox 2 DLX2 NeurogenesisDLX2 is a miR-124 target and regulates generation of interneurons in the embryo and promotes neurogenesis (Liu et al., 2011b). [score:4]
Neurogenesis in embryonic neuroepithelial cells in the spinal cord is also regulated by miR-124 and its target Sox9 (Farrell et al., 2011). [score:4]
The anti-apoptosis proteins Bcl-2 and Bcl-xL, key regulators in attenuating stroke -induced apoptotic cell death (Martinou et al., 1994; Wiessner et al., 1999; Graham et al., 2000), are found to be the targets of miR-124 in this protective role for stroke. [score:4]
miR-124 expression gradually increased and accumulated in parallel to neuronal maturation (Smirnova et al., 2005) during CNS development (Deo et al., 2006; Krichevsky et al., 2006). [score:4]
Smirnova et al. (2005) compared miRNAs expression in embryonic neuron and astrocyte cultures, and found miR-124, a brain-enriched miRNA, preferentially expressed in neurons. [score:4]
Also, miR-124 is up-regulated in the rat hippocampus after acute immobilization stress (Meerson et al., 2010). [score:4]
X-ray repair cross-complementing protein 6 Ku70 StrokeKnockdown of cerebral miR-124 reduced cell death and infarct size, and improved neurological outcomes by negatively regulating Ku70, which is mainly involved in NHEJ of DSBs, V(D)J recombination, telomere maintenance, and regulation of Bax -mediated apoptosis (Zhu et al., 2014). [score:4]
microRNA-124 inhibits migration and invasion by down -regulating ROCK1 in glioma. [score:4]
Synaptogyrin 2 Syngr2 Neuronal differentiationSYNGR2 is down-regulated by miR-124 and is a non-neural paralogue of the neural-specific gene synaptogyrin 1 (Lim et al., 2005). [score:4]
Knockdown of endogenous miR-124 maintained purified SVZ stem cells as dividing precursors, whereas ectopic expression led to increased neuron formation. [score:4]
MicroRNA-124 (miR-124) regulates Ku70 expression and is correlated with neuronal death induced by ischemia/reperfusion. [score:4]
miR-124 regulates cocaine -induced plasticity by targeting BDNF in rats, which is well implicated in synaptic plasticity and plays a central role in reward and memory (Chandrasekar and Dreyer, 2009). [score:4]
Our group found miR-124 is necessary for the cholinergic anti-inflammatory action by inhibiting the production of pro-inflammatory cytokines (Sun et al., 2013b), and miR-124 may act as an NeurimmiRs. [score:3]
In neuroblasts, miR-124 was highly expressed in cells at G [0]/G [1] phase (Cheng et al., 2009), which results in the repression of Cdk6, a protein mediating cell-cycle progression from G [0]/G [1] (Silber et al., 2008). [score:3]
Another study examined the effect of maternal separation stress on miRNA expression and found the miR-124 level is elevated in the prefrontal cortex of stressed mice at P14 (Uchida et al., 2010). [score:3]
Similarly, our previous study showed that miR-124 overexpression decreased the infarct area of MCAO mice (Sun et al., 2013a). [score:3]
MiR-124 regulates early neurogenesis in the optic vesicle and forebrain, targeting NeuroD1. [score:3]
Overexpression of miR-124 induced morphological changes and neural differentiation in mouse neural stem cells and oligodendroglioma, accompanied by reduced self-renewal and tumorigenicity (Silber et al., 2008). [score:3]
Besides effects on neuron fate, miR-124 also contributes to the control of neurite outgrowth during neuronal differentiation possibly by cytoskeleton regulation in mouse P19 cells (Yu et al., 2008), and affects dendritic differentiation by regulating RhoG (Schumacher and Franke, 2013). [score:3]
Meerson et al. (2010) reported that stress changes rat brain miRNA profiles detected by microarray, and some of these stress-regulated miRNAs, including miR-124, regulate alternative splicing. [score:3]
CDA-2 induces cell differentiation through suppressing Twist/SLUG signaling via miR-124 in glioma. [score:3]
For example, Zhu et al. (2014) showed that knockdown of cerebral miR-124 reduced cell death and infarct size, and improved neurological outcomes by negatively regulating Ku70. [score:3]
p38alpha mitogen-activated protein kinase depletion and repression of signal transduction to translation machinery by miR-124 and -128 in neurons. [score:3]
It was reported that miR-124 controls self-renewal and tumorigenic competence of human glioblastoma cells by targeting SCP1 and PTPN12 phosphatases (Conti et al., 2012; Lee et al., 2013). [score:3]
Changes of miR-124 levels can serve as biomarkers that indicate the functional status of a normal brain, as well as progression of CNS diseases. [score:3]
In mammalian neurons, miR-124 suppresses the levels of 100s of non-neural genes, which contributes to the acquisition and maintenance of neuronal identity (Lim et al., 2005; Conaco et al., 2006). [score:3]
Several targets of miR-124 mediating this process have been identified. [score:3]
For example, miR-124 in SVZ progenitor cells mediates stroke -induced neurogenesis by targeting the JAG-Notch signaling pathway in adult rats (Liu et al., 2011b). [score:3]
These studies indicate that miR-124 is a potential therapeutic target in brain tumor treatment. [score:3]
Distinct patterns of miR-124 expression have been observed in many cancers including glioblastomas (Silber et al., 2008). [score:3]
miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. [score:3]
Several other targets of miR-124 have been identified in mediating the process of neurogenesis. [score:3]
LIM homeobox protein 2 Lhx2 NeurogenesisLhx2 is required for hippocampal formation, and miR-124 is essential for hippocampal axogenesis and retinal cone survival by repressing Lhx2 translation (Sanuki et al., 2011). [score:3]
miR-124 expression also varies over time during the stress hyporesponsive period, a neonatal period when GC signaling is modulated (Vreugdenhil et al., 2009). [score:3]
Furthermore, when miR-124 is aberrantly expressed, it contributes to pathological conditions involving the central nervous system (CNS) system. [score:3]
The ability to prevent and attenuate EAE has implications for miR-124 in the treatment of neurodegenerative diseases such as MS and AD, where microglial cells are thought to play an integral role in the inflammatory process (Conrad and Dittel, 2011). [score:3]
miR-124 controls self-renewal and tumorigenic competence of human glioblastoma cells by targeting SCP1 and PTPN12 phosphatases (Lee et al., 2013). [score:3]
Therefore, we believe miR-124 and other miRNAs that fulfill this criterion will replace single gene therapies for the treatment of these kinds of diseases in the near future. [score:3]
Blocking miR-124 activity in mature neurons leads selectively to increased levels of non-neuronal transcripts (Conaco et al., 2006), while increasing miR-124 activity in non-neuronal HeLa cells showed a shift of expression profile toward that of neuronal phenotype (Lim et al., 2005). [score:3]
MicroRNA-124 -mediated regulation of inhibitory member of apoptosis-stimulating protein of p53 family in experimental stroke. [score:3]
miR-124 exerts this phenotype in part by directly regulating TEAD1, MAPK14/p38α, and SERP1, which are factors involved in cell proliferation and survival under stress (Mucaj et al., 2014). [score:3]
Pim-3 proto-oncogene PIM3 GlioblastomaPIM3 is among the oncogene targets of miR-124 in glioblastoma and it promotes tumor cell growth through modulating cell cycle (Lang et al., 2012). [score:3]
Huang et al. (2011) showed that miR-124 plays a pivotal role in neuroblastoma by targeting aryl hydrocarbon receptor (AHR), which may promote neuroblastoma cell differentiation. [score:3]
One of its predicted targets, the VSNL1 gene, which is a neuronal calcium sensor protein identified as a specific and promising plasma biomarker of stroke patients (Laterza et al., 2006), was decreased in parallel with the increased miR-124 under the same conditions (Jeyaseelan et al., 2008). [score:3]
miR-124 is essential for hippocampal axogenesis and retinal cone survival, as it represses Lhx2 translation in mice (Sanuki et al., 2011). [score:3]
Sox9 was demonstrated to be the physiological target of miR-124 responsible for this role (Cheng et al., 2009; Akerblom et al., 2012). [score:3]
In post-mitotic neurons, miR-124 represses BAF53a, which is essential for an evolutionarily conserved program of post-mitotic neural development and dendritic morphogenesis in mouse embryos (Yoo et al., 2009). [score:2]
miR-124 has been reported to participate in chronic stress, neurodegeneration, alcohol/cocaine neuroadaptation, synapse morphology, neurotransmission long-term potentiation, neurodevelopment myeloid cell function, and hematopoiesis (Soreq and Wolf, 2011). [score:2]
MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation. [score:2]
MicroRNA-124 expression counteracts pro-survival stress responses in glioblastoma. [score:2]
miR-124 in CNS Development. [score:2]
microRNAs miR-124 let-7d and miR-181a regulate cocaine -induced plasticity. [score:2]
MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU. [score:2]
miR-124 regulates adult neurogenesis in the subventricular zone stem cell niche. [score:2]
MicroRNA-124 mediates the cholinergic anti-inflammatory action through inhibiting the production of pro-inflammatory cytokines. [score:2]
Here we review the role and potential therapy of miR-124 in CNS development and disorders. [score:2]
miR-124 was exclusively present presynaptically in a sensory-motor synapse where it constrains serotonin -induced synaptic facilitation through regulation of the transcriptional factor CREB in Aplysia, suggesting a role for miR-124 in long-term plasticity of synapses in the mature nervous system (Rajasethupathy et al., 2009). [score:2]
miR-124-regulated RhoG: a conductor of neuronal process complexity. [score:2]
BRG1/brm -associated factor 53a Baf53a Neuronal differentiationIn post-mitotic neurons, miR-124 represses BAF53a, which is essential for an evolutionarily conserved program of post-mitotic neural development and dendritic morphogenesis (Yoo et al., 2009). [score:2]
We have discussed the importance of miR-124 in neuronal development and function of the brain. [score:2]
The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development. [score:2]
By regulating GRs, miR-124 can affect a variety of systemic stress responses. [score:2]
Consistently, miR-124 was predicted to suppress acetylcholinesterase (AChE; Nadorp and Soreq, 2014), whose plasma level was reduced in patients post ischemic stroke (Ben Assayag et al., 2010), indicating a physiological relevance between miR-124 and AChE. [score:2]
miR-124 plays a critical role in the regulation of signaling molecules underlying synaptic plasticity and memory (Fischbach and Carew, 2009). [score:2]
Interestingly, it seems inverse effect of miR-124 in tumorogenic events and neurodegenerative processes. [score:1]
Taming of macrophage and microglial cell activation by microRNA-124. [score:1]
Visinin-like 1 Vsnl1 Stroke miR-124 level is elevated in the brain samples with MCAO followed by 24 h reperfusion, which is correlated with the repression of VSNL1 gene, aneuronal calcium sensor protein identified as a specific and promising biomarker in the plasma of stroke patients (Jeyaseelan et al., 2008). [score:1]
In general, miR-124 has been shown to promote cell differentiation and repress cell proliferation. [score:1]
Treatment of mice with miR-124 at the onset of EAE substantially ameliorated clinical symptoms and enhanced recovery in mice (Ponomarev et al., 2011). [score:1]
miR-124 in CNS Stress. [score:1]
Markedly increased plasma miR-124 was also observed at 24 h after stroke for both transient and permanent occlusions in rats (Laterza et al., 2009; Weng et al., 2011). [score:1]
Although there is no correlation between the infarct size and plasma miR-124 level in rats after MCAO introduction (Weng et al., 2011), efforts have been made to explore whether miR-124 treatment is effective in stroke. [score:1]
Moreover, microRNA-124 is a subventricular zone (SVZ) neuronal fate determinant. [score:1]
Accordingly, brain tissues from stroke-prone spontaneously hypertensive rats (SHR-SP) showed higher miR-124 levels than in spontaneously hypertensive rats (SHRs; Sun et al., 2013a). [score:1]
During neuronal differentiation, miR-124 reduces PTBP levels, leading to the transition from non-nervous system to nervous system specific alternative splicing patterns. [score:1]
Makeyev et al. (2007) demonstrated that miR-124 promoted this shift by triggering brain-specific alternative pre-mRNA splicing. [score:1]
miR-124 in Neuroimmunity. [score:1]
In vitro, miR-124 from primary cultured neurons was significantly increased in response to all four neuronal challenge response sets (transfection, KCl, kainite, aging; Manakov et al., 2012). [score:1]
The above suggests that plasma miR-124 released from the infracted brain may be a promising candidate biomarker for stroke identification. [score:1]
miR-124 in Neurodegeneration. [score:1]
The abundance of miR-124 in the CNS has accelerated efforts to determine if it can be used as an effective stroke treatment. [score:1]
Loss of brain-enriched miR-124 microRNA enhances stem-like traits and invasiveness of glioma cells. [score:1]
A clinical investigation also showed a negative correlation between miR-124 expression and a hypoxic gene signature in glioblastoma patient samples. [score:1]
A functional study of miR-124 in the developing neural tube. [score:1]
Wang et al. (2013) demonstrated that melatonin rescues the EPACs/miR-124/Egrl signaling pathway in rats, which is important in learning and memory (Yang et al., 2012). [score:1]
Polypyrimidine-tract -binding protein 1 PTBP1 Neuronal differentiationDuring neuronal differentiation, miR-124 reduces PTBP levels, leading to the transition from non-nervous system to nervous system -specific alternative splicing patterns (Makeyev et al., 2007). [score:1]
However, miR-124 was not affected by stress in mouse PVN (Mckennirey, 2011). [score:1]
Jeyaseelan et al. (2008) first reported an elevated level of miR-124 in the brain samples from rats with middle cerebral artery occlusion (MCAO) followed by 24 h reperfusion. [score:1]
miR-124 in Stroke. [score:1]
Plasma miR-124 as a biomarker for cerebral infarction. [score:1]
Ephrin-B1 reverse signaling controls a posttranscriptional feedback mechanism via miR-124. [score:1]
Vreugdenhil et al. (2009) found that miR-124 decreased GR protein level and GR -mediated events. [score:1]
The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. [score:1]
miR-124 in Brain Tumor. [score:1]
Silencing of miR-124 induces neuroblastoma SK-N-SH cell differentiation, cell cycle arrest and apoptosis through promoting AHR. [score:1]
Doeppner et al. (2013) showed that exogenous miR-124 reduced brain injury and functional impairment, enhanced neurovascular remo deling, and increased angioneurogenesis 8 weeks post-stroke in mice with MCAO, which is possible via the pathway involving Usp14 -dependent REST degradation. [score:1]
However, conflicting miR-124 stroke therapy results have also been reported. [score:1]
It was first identified in mice (Lagos-Quintana et al., 2002), and mature miR-124 is wholly homologous in mice, rats, and human. [score:1]
Melatonin attenuates scopolamine -induced memory/synaptic disorder by rescuing EPACs/miR-124/Egr1 pathway. [score:1]
Therefore, the use of miR-124 as an effective stroke treatment necessitates further research. [score:1]
[1 to 20 of 134 sentences]
5
[+] score: 395
Figure 6 The suppression of down-regulated of FOXQ1 was consistent with the suppression of the ectopic miR-124 and overexpression of FOXQ1 could rescue partially the suppression of miR-124. [score:12]
The probable target genes of miR-124 were predicted using three microRNA target database (PicTar, TargetScan and PITA), and the selected targets gene were validated by RT-qPCR and Western Blot. [score:9]
Functional studies showed that knockdown of Foxq1 inhibited cell growth, migration and invasion, whereas Foxq1 overexpression partially rescued the suppressive effect of miR-124 in NPC. [score:8]
MiR-124 down-regulated the expression of Foxq1 by directly targeting its 3′-UTR. [score:8]
Our results demonstrate that miR-124 functions as a tumor-suppressive microRNA in NPC, and that its suppressive effects are mediated chiefly by repressing Foxq1 expression. [score:7]
Our results also showed that Foxq1 overexpression could rescue partially the suppressive effect of miR-124, and we found a negative correlation between miR-124 and Foxq1 expression in NPC tissues. [score:7]
The ectopic expression of miR-124 suppressed the proliferative, migratory and invasive capacities of NPC cells in vitro, and suppressed tumor growth and metastasis in vivo. [score:7]
Figure 5 The ectopic miR-124 induced the expression of Foxq1 by directly targeting its 3′ -UTR. [score:6]
Moreover, we found that the expression of Foxq1 protein was down-regulated after transfected lv-miR-124 in NPC cells by western blot. [score:6]
The up-regulated expression of miR-124 was confirmed by Real-time PCR (Figure  2A). [score:6]
The Foxq1 protein expression of siRNA-Foxq1/5-8F and miR-124/5-8F were down-regulated compare with siRNA-Ctrl/5-8F (Figure  6D). [score:6]
As shown in Figure  7G, a significant inverse correlation was observed when Foxq1 expression levels were plotted against miR-124 expression levels (2-tailed Spearman’s correlation, r = -0.6056; p < 0.0001). [score:5]
Figure 2 The ectopic expression of miR-124 suppressed the proliferation, migratory and invasive capacity of NPC cell. [score:5]
Above all, these results supported that ectopic expression of miR-124 inhibited cell growth, colony formation, migration and invasion in NPC cell lines in vitro. [score:5]
Overexpression of Foxq1 could partially rescue the suppression of miR-124. [score:5]
The suppressive capability suggested that miR-124 functioned as a tumor-suppressive microRNA in NPC. [score:5]
of qRT-PCR showed the relative expression of Foxq1 was the most significant down-regulated in lv-miR-124/5-8F cells compared with lv-miR-Ctrl/5-8F. [score:5]
The ectopic expression of miR-124 is a frequently epigenetically silenced tumor-suppressive microRNA in various cancers [28– 34]. [score:5]
Then, the ectopic expression of miR-124 dramatically inhibited cell proliferation, colony formation, migration and invasion in vitro, as well as tumor growth and metastasis in vivo. [score:5]
Our study demonstrated that miR-124 acts as a novel proliferation and metastasis suppressor by targeting Foxq1 in NPC. [score:5]
As shown in Figure  7E, significant inverse correlation was observed when Foxq1 expression levels were plotted against miR-124 expression levels (2-tailed Spearman’s correlation, r = -0.5646; p < 0.001). [score:5]
The results showed that miR-124 could down-regulated the luciferase activity of the Foxq1 wt 3′-UTR construct (Figure  5F, lanes 1 and 2;P < 0.01). [score:4]
These results supported that Foxq1 was a direct target gene of miR-124. [score:4]
Migration and invasion arrays demonstrated that miR-124 overexpression inhibited cell migration and invasion compared with miR-Ctrl (Figure  2E, F, G and H). [score:4]
Furthermore, we identified Foxq1 as a novel direct target of miR-124. [score:4]
By using, Foxq1 was identified as a new direct and functional target of miR-124. [score:4]
We found that miR-124 was commonly down-regulated in NPC specimens and NPC cell lines. [score:4]
As shown in Figure  5D and Additional file 3: Figure S2B, Foxq1 was down-regulated after transfected lv-miR-124. [score:4]
Our previous study demonstrated that plasma miR-124 was down-regulated in NPC using microarray analysis and quantitative PCR validation. [score:4]
Though growing studies showed that down-regulated miR-124 was closely related to tumourigenesis in various types of cancers, the role of miR-124 in NPC remains largely unknown. [score:4]
To further investigate colony formation capacity, we used lentiviral vectors to stably up-regulate the expression level of miR-124 in 5-8 F and 6-10B cell lines (Figure  3B). [score:4]
As shown in Figure  6A-C, Foxq1 knockdown led to significant suppressive effects, similar to those induced by miR-124 (P < 0.01). [score:4]
Our previous study demonstrated for the first time that plasma miR-124 was down-regulated in NPC [21]. [score:4]
Our previous study demonstrated that plasma miR-124 was down-regulated in NPC. [score:4]
In this report, we identified for the first time that miR-124 was markedly down-regulated in NPC cell lines and clinical specimens. [score:4]
Taken together, these data provided strong evidence that miR-124 expression was closely related to the progression and clinicopathologic features of NPC. [score:3]
The reduced expression of miR-124 in NPC tissues was inversely correlated with clinical stages, T stages and marked the progression from locoregional tumors to metastatic tumors. [score:3]
MiR-124 inhibited tumor growth and metastasis in vivoTo determine whether miR-124 could affect tumor growth in vivo. [score:3]
Then we correlated Foxq1 with the miR-124 expression levels in the same NPC specimens. [score:3]
C, miR-124 expression was higher in stage I, whereas stages II-IV had lower levels. [score:3]
D, miR-124 expression was higher in stage T1, whereas stages T2-T4 had lower levels. [score:3]
Although miRNA -based therapeutics is still in their infancy, our findings on miR-124 are encouraging and suggest that this miRNA could be a potential target for the treatment of NPC in future. [score:3]
Compared with the immortalized nasopharyngeal epithelial cell line NP69, the basal expression level of miR-124 was generally down regulated in 7 NPC cell lines (5-8 F, 6-10B, CNE1, CNE2, HONE-1, C666-1 and Sune-1) (Figure  1A). [score:3]
A, The expression levels of miR-124 in 5-8 F and 6-10b cell lines were verified after tranfected with miR-124 mimics and miR-Ctrl. [score:3]
We examined the expression level of miR-124 in human NPC cells and tissues and tested its effects on cell growth, migration and invasion. [score:3]
Subsequently, we evaluated whether ectopic expression of Foxq1 could rescue the suppressive effect of miR-124. [score:3]
We then correlated Foxq1 with the miR-124 expression levels in the same NPC specimens. [score:3]
The expression levels of miR-124 were examined after the tumors were dissected (Additional file 1: Figure S1A). [score:3]
To study the expression level of miR-124 in NPC, a panel of NPC cell lines was first analyzed by Real-time PCR. [score:3]
Compared with the results in the present study, the expression level of miR-124 between NPC patient plasma and tissue changed in the same direction. [score:3]
Homo sapiens forkhead box Q1 (Foxq1) was confirmed as a novel direct target gene of miR-124 by the dual-luciferase assay and western bolt. [score:3]
MiR-124 was down-regulated in NPC cell lines and clinical specimens and associated with advanced clinical stage. [score:3]
E. The expression level of mir-124 in the distance metastasis was lower than in the local metastasis. [score:3]
These results showed that ectopic expression of miR-124 could dramatically repress the cell growth of 5-8 F and 6-10B cells respectively (Figure  2B and C). [score:3]
G, A scatter diagram shows an inverse correlation between miR-124 and Foxq1 expression in the same set of NPC tissue (Spearman’s correlation analysis, r = -0.6056; p < 0.0001). [score:3]
To further confirm that Foxq1 was a direct target of miR-124, dual-luciferase assay was performed. [score:3]
This study identifies miR-124 as a growth suppressive miRNA in human NPC, at least, partly through repression of Foxq1. [score:3]
We further tested the expression level of miR-124 in 178 primary NPC tissues and 55 non-cancer nasopharyngitis biopsy samples to analyze the clinicopathologic significance of miR-124. [score:3]
The expression of miR-124 was inversely correlation with clinical stages and marked on T stages. [score:3]
The expression levels of miR-124 were examined after the tumors were dissected from the livers (Additional file 1: Figure S1B). [score:3]
The present study is the first report to explore the expression of miR-124 in NPC tissues. [score:3]
E, In the mRNA levels, a significant inverse correlation was observed after correlated Foxq1 with the miR-124 expression levels in the 178 NPC specimens. [score:3]
We found that miR-124 expression was higher in stage I, whereas stages II-IV had lower levels, showing a significant correlation of miR-124 with clinical stages (Figure  1C). [score:3]
To elucidate whether the suppressive effect of miR-124 was mediated by repression of Foxq1 in NPC cells, we performed gain-of-function and loss-of-function studies. [score:3]
To obtain stable cell lines to overexpress miR-124, pre-miR-124 was cloned into the pLVTHM lentiviral vector, and the recombinant plasmid was named as lv-miR-124. [score:3]
First, we silenced Foxq1 to investigate whether the reduced expression of Foxq1 could mimic the suppressive effect of miR-124. [score:3]
Thus, these results showed that miR-124 suppressed tumor proliferation capacity in vivo. [score:3]
In summary, these results strongly suggested that miR-124 directly regulated Foxq1 in NPC cell lines. [score:3]
Furthermore, we found that the miR-124 expression was higher in stage T1, whereas stages T2-T4 had lower levels, showing a significant correlation of miR-124 with T stage (Figure  1D). [score:3]
In this study, our results provided strong evidences that miR-124 inhibited the proliferation, migration and invasion of NPC cells in vitro and in vivo. [score:3]
Figure 1 The expression level of miR-124 was reduced in NPC cell lines and clinical specimens. [score:3]
D, The protein expression level of Foxq1 was detected after transfect with siRNA-Foxq1 or miR-124 mimics. [score:3]
Livers and lungs of mice bearing miR-124 -expressing 5-8 F tumors harbored statistically significantly fewer microscopic and macroscopic metastases than those of mice bearing mock-infected 5-8 F tumors (P < 0.05; Figure  4A-D). [score:3]
A, The expression of miR-124 was reduced in NPC cell lines. [score:3]
Finally, we selected Foxq1 gene as the target gene of miR-124. [score:3]
Then they were used to infect 5-8 F cell lines which stably overexpressed miR-124. [score:3]
We found that the expression level of miR-124 between NPC patient plasma and tissue decreased simultaneously. [score:3]
To investigate the molecular mechanism for the proliferation, migration and invasion of suppression by miR-124 in NPC cells, we focused on 27 possible target genes of mir-124 by utilizing bioinformatic analysis. [score:3]
The selected targets were validated by RT-qPCR in lv-miR-124/5-8 F cells. [score:3]
A, The 27 possible target genes of mir-124 were predicted by bioinformatic analysis. [score:3]
The lv-miR-124/5-8 F cell line after transfected lv-Foxq1 was named lv-miR-124 + lv-Foxq1/5-8 F. The expression level of Foxq1 was tested using Real-time PCR and Western bolt (Figure  6I and J). [score:3]
Figure 3 The ectopic of miR-124 affected cell cycle in the NPC cell lines in vitro and suppressed cell growth in vivo. [score:3]
To determine the effect of miR-124 on cell proliferation, cells with stable overexpression of miR-124 were seeded into 96 wells plates at a density of 1 × 10 [3] cells/well with five replicate wells. [score:3]
Emerging evidence indicates that miR-124 is abnormally expressed and has been implicated in several tumors. [score:3]
Therefore, we showed that Foxq1 could partially rescue the suppression of miR-124 in NPC cells. [score:3]
The results demonstrated that ectopic expression of miR-124 arrest G0 + G1 phase and decreased S phase in 5-8 F and 6-10B cells compared with miR-Ctrl (Figure  3A). [score:2]
MiR-124 inhibited tumor growth and metastasis in vivo. [score:2]
B, The expression levels of Lv-miR-124/5-8F compared with Lv-miR-Ctrl/5-8F in tumor metastasis murine mo dels. [score:2]
Figure 4 MiR-124 suppressed the lung and liver metastases of NPC cells in vivo. [score:2]
MiR-124 suppressed the proliferative, migratory and invasive capacities of NPC cells. [score:2]
MiR-124 and Foxq1 expressions between tumor and control specimens were analyzed by a Mann–Whitney U test. [score:2]
Until now, several studies have demonstrated that miR-124 was down-regulated and inversely correlated with clinical characteristic and prognosis in breast cancer and colorectal cancer [28, 35]. [score:2]
D, The protein expression level of Foxq1 in lv-miR-124/5-8 F cell and lv-miR-124/6-10B cell compared with control. [score:2]
A, The expression levels of Lv-miR-124/5-8F compared with Lv-miR-Ctrl/5-8F in tumorigenesis in murine mo dels. [score:2]
Additional file 1: Figure S1: The expression levels of miR-124 in tumor xenograft mo del and tumor metastasis assay in vivo. [score:2]
B, The mRNA expression level of Foxq1 in lv-miR-124/5-8F cell and lv-miR-124/6-10B cell compared with control cells. [score:2]
Similar results indicated that miR-124 inhibited the colony formation ability in lv-miR-124/5-8 F and lv-miR-124/6-10B cells compared with lv-miR-Ctrl cells respectively (Figure  3C and D). [score:2]
A, The ectopic expression of miR-124 arrest G0 + G1 phases and decreased S phase in 5-8 F and 6-10b compared with miR-Ctrl. [score:2]
Consistent with the result of the NPC cell lines, the average expression level of miR-124 was decreased in NPC tissue compared with non-cancer biopsy samples (Figure  1B). [score:2]
B, the average expression level of miR-124 in human NPC specimens compared with non-cancer biopsy samples. [score:2]
Finally, we explored the underlying mechanism of miR-124 functions in NPC. [score:1]
MiR-124 mimics, miR-Ctrl, Foxq1 siRNAs and Foxq1-Ctrl were synthesized from Gene-pharma (Shanghai, China). [score:1]
1 × 10 [6] lv-miR-124/5-8 F or lv-miR-Ctrl/5-8 F cells were injected into the liver of each mouse. [score:1]
To determine whether miR-124 could affect tumor growth in vivo. [score:1]
We implanted lv-miR-124/5-8 F or lv-miR-Ctrl/5-8 F cells subcutaneously in nude mice respectively (n = 6 per group). [score:1]
1 × 10 [5] lv-miR-124/5-8 F or lv-miR-Ctrl/5-8 F cells were injected into the dorsal flank of each mouse. [score:1]
Additionally, the level of Foxq1 was inversely correlated with miR-124. [score:1]
A, Lungs and livers were obtained from the mice of the lv-miR-124/5-8 F and lv-Ctrl/5-8 F groups. [score:1]
As shown in Figure  3E, lv-miR-124/5-8 F cells resulted in an approximately 2.68-fold decrease in tumor size relative to lv-miR-Ctrl/5-8 F cells after 15 days (Figure  3F, P < 0.05). [score:1]
Then we analyzed the the mRNA and protein level of Foxq1 after transfected lv-miR-124 into 5-8 F and 6-10B cell lines. [score:1]
A, Putative miR-124 binding site in the 3′-UTR region of Foxq1 and interspecies conservation of seed matching sequences (gray box). [score:1]
5-8 F cells were transfected with siRNA-Foxq1 or miR-124 mimics. [score:1]
The relationship between the miR-124 expression level and clinicopathologic characteristics in NPC patients were summarized in Table  1. MiR-124 was not significantly associated with age and gender of the patients. [score:1]
Then, we explored the role of miR-124 in NPC tumorigenesis by in vitro and in vivo experiments. [score:1]
These recombinant vectors were co -transfected with miR-124 mimics or miR-Ctrl into 5-8 F cell line. [score:1]
Groups of BALB/c nude mice were inoculated with lv-miR-124/5-8 F or lv-Ctrl/5-8 F cells. [score:1]
The activity of mut3′-UTR vector was unaffected by a simultaneous transfection with miR-124 (Figure  5F, lanes 3 and 4). [score:1]
The reduced expression of miR-124 in NPC tissues was inversely correlated with clinical characteristic. [score:1]
The relationship between miR-124 and Foxq1 was analyzed using Spearman’s correlation analysis. [score:1]
Lv-miR-124/5-8 F cells and lv-miR-Ctrl cells were used for evaluating the effect of miR-124 overexpression on the growth of tumor xenografts. [score:1]
Foxq1 is highly conserved among different species, whose 3′-UTR of mRNA contained a complementary site for the seed region of miR-124 (Figure  5A). [score:1]
The similar results were obtained in lv-miR-124 + lv-Foxq1/6-10B cell lines (Additional file 5: Figure S4A-F). [score:1]
However, the role of miR-124 in NPC and the molecular mechanisms in which miR-124 exerts its functions remain largely unknown. [score:1]
The expression level of miR-124 was evaluated in NPC cell lines and patient specimens using quantitative reverse transcription-PCR (Real-time qPCR). [score:1]
E, 6-10B cells were transfected with siRNA-Foxq1 or miR-124 mimics. [score:1]
A, 5-8 F cells were transfected with siRNA-Foxq1 or miR-124 mimics. [score:1]
B, Stably expression of miR-124 cell lines were evaluated using real time qPCR. [score:1]
[1 to 20 of 127 sentences]
6
[+] score: 351
There was no difference in the levels of STAT3 mRNA between cells transfected with Pre-miR-124 and Pre-Scrambled miRNA, suggesting that miR-124 down-regulate STAT3 expression by means of inhibiting translation (Fig. 2D). [score:10]
Transient inhibition of HNF4α initiates transformation of hepatocytes and downregulates miR-124, resulting in elevated IL-6/STAT3 signaling that promotes HCC development by further suppressing HNF4α through miR-24 and miR-629 [39]. [score:9]
To ascertain that STAT3 is indeed the downstream mediator of miR-124’s inhibitory effect on cancer cell survival and in vivo tumor growth, we designed siRNA against STAT3 to specifically down-regulate STAT3 expression and seek to recapitulate the effect of miR-124 on CRC development. [score:9]
MiR-124 Serves as a Tumor Suppressor by Targeting STAT3 MiRNAs identify their targets through degenerate matching with target sequences. [score:8]
MiR-124 targets the 3′ untranslated region (3′UTR) of STAT3 to suppress its expression. [score:8]
MiR-124 therefore serves as a tumor suppressor through inhibition of STAT3 signaling, which explains its down-regulation in human CRC and other cancers. [score:7]
In summary, our study demonstrates that miR-124 serves as a tumor suppressor by inhibiting translation of STAT3 mRNA. [score:7]
These data indicate that the miR-124 directly interacts with the 3′UTR of STAT3 and inhibits its expression. [score:6]
These and previously described experiments show that the downregulation of STAT3 by miR-124 is an authentic mechanism of miR-124–mediated inhibition of tumor growth in CRC. [score:6]
MiR-124 was first demonstrated to be a “brain-specific” miRNA, and was shown to regulate Cocaine -induced neuronal plasticity by inhibiting the expression of BDNF [36]. [score:6]
By downregulating STAT3, miR-124 induces programmed cell death in human CRC cells and suppresses the growth of CRC tumors in vivo. [score:6]
MiR-124 suppresses the survival of human CRC cells by inhibiting the expression of STAT3. [score:6]
MiR-124 Inhibits Growth of CRCKnowing that miR-124 is significantly downregulated in CRC, we investigated whether miR-124 may serve as a tumor suppressor in CRC. [score:6]
0070300.g006 Figure 6 STAT3 overexpression bypasses the tumor inhibition function of miR-124. [score:5]
In mouse mo dels of hepatocellular carcinoma, miR-124 is involved in an inflammatory feedback loop where it suppresses the expression of IL-6R and reduces STAT3 activation in transformed cells [39]. [score:5]
STAT3 is a Target of Posttranscriptional Repression by miR-124 In order to identify targets of miR-124 we performed differential proteomic analysis from the protein of SW480 cells after treatment with either the Pre-miR-124 or Pre-Scrambled miRNA. [score:5]
Inhibition in cell growth by miR-124–overexpression was significantly attenuated by re-introduction of STAT3 (Fig. 6A). [score:5]
We amplified the 3′-UTR segment of STAT3 containing predicted miR-124 target site by PCR from SW480 cell genomic DNA, and inserted it into the SpeI/HindIII sites downstream the luciferase gene in pMIR–REPORT Luciferase miRNA Expression Reporter Vector (Ambion). [score:5]
STAT3 overexpression bypasses the tumor inhibition function of miR-124. [score:5]
MiR-124 is Down-regulated in Human CRCTo examine the expression profile of miR-124 in CRC, we performed quantitative real-time RT-PCR using TaqMan assay in 90 paired tumor and normal colorectal specimens. [score:5]
MiR-124 is also down-regulated in cervical cancers, but its target is not clear [38]. [score:5]
There have been extensive studies on the role of miR-124 in the nervous system, where it regulates neuronal development and neural plasticity by targeting Notch signaling and other genes involved in neuron differentiation and activation [36]. [score:5]
STAT3 expression level was also reduced in Pre-miR-124 -transfected cell-derived tumors compared to control (Fig. 4C), suggesting the inhibition of STAT3 by Pre-miR-124 is conserved under physiological condition. [score:4]
0070300.g005 Figure 5Knockdown of STAT3 using STAT3-siRNA recapitulated tumour inhibition effect of miR-124. [score:4]
Following miR-124 silencing, STAT3 protein level was upregulated (Fig. 2C). [score:4]
In conclusion, our study demonstrates that miR-124 is dramatically down-regulated in human CRCs. [score:4]
12 protein spots circled are presumably down-regulated by miR-124. [score:4]
We demonstrate that miR-124 is downregulated in human CRC. [score:4]
We found that down-regulation of STAT3 by miR-124 leads to increased cancer cell death and reduced tumor load when transplanted in mice. [score:4]
To test if STAT3 is a direct target of miR-124 regulation, we amplified 3′-UTR region of STAT3 by PCR from SW480 genomic DNA and inserted it to the downstream of the luciferase reporter gene of pMIR- REPORT vector for luciferase assay, with pMIR- REPORT β-gal vector as control (Fig. S1Bi). [score:4]
Among them, miR-124 is an interesting target to study in cancer development. [score:4]
In sum, these results showed that STAT3 is a direct target of miR-124. [score:4]
MiR-124 also inhibits the expression of SNAI2 in human glioma [40]. [score:4]
Targets of miR-124 in medulloblastoma include SLC16A1, which regulates lactic acid export during aerobic glycolysis [37]. [score:4]
In human cervical cancers, miR-124 locus is frequently methylated, which contributes to its down-regulation [38]. [score:4]
Knowing that miR-124 is significantly downregulated in CRC, we investigated whether miR-124 may serve as a tumor suppressor in CRC. [score:4]
Figure S1 STAT3 is a direct target of miR-124. [score:4]
MiR-124 Serves as a Tumor Suppressor by Targeting STAT3. [score:4]
MiR-124 promotes apoptosis of CRC cells by suppressing the expression of STAT3. [score:4]
After separating the proteins by isoelectric focusing and SDS-PAGE, we picked 12 protein spots that were down-regulated more than 2-fold in the cells treated with Pre-miR-124 and then identified with mass spectrometry (Fig. S1A). [score:4]
MiR-124 suppresses the expression of STAT3 in human CRC cells. [score:4]
To test whether miR-124 binds to 3′-UTR of STAT3 and regulates STAT3 expression through this site, we also constructed a luciferase vector fused to STAT3 3′UTR harboring a mutant miR-124 response element (Fig. S1Bii). [score:4]
Knockdown of STAT3 using STAT3-siRNA recapitulated tumour inhibition effect of miR-124. [score:4]
The mechanism by which miR-124 is down-regulated in human CRC remains elusive. [score:4]
In this article we show that miR-124 is down-regulated in human CRC. [score:4]
Growth of both cancer cell lines was significantly inhibited at 48 hour following transfection of Pre-miR-124 (Fig. 3B). [score:3]
Inhibition of STAT3 by miR-124 leads to increased cell apoptosis both in vitro and in vivo, and contributes to reduced tumor growth from transplanted human CRC cells. [score:3]
MiR-124 is down-regulated in human CRC. [score:3]
The role of miR-124 in CRC, and the mechanism by which miR-124 regulates cancer development, remain largely unknown. [score:3]
SW480 cells were transfected with luciferase constructs containing 3′-UTR of STAT3 (with the wild type or mutant miR-124 target sites) and/or Pre-miR-124 or Pre-Scrambled miRNA control. [score:3]
We also investigated the effect of overexpressing miR-124 on endogenous STAT3 expression in human CRC cells. [score:3]
Overexpression of miR-124 increases cell apoptosis in vitro. [score:3]
Expression of miR-124 following transfection was confirmed by TaqMan RT-PCR (data not shown). [score:3]
Overexpression of miR-124 induced cell death evidenced by rounding up morphology of cells (Fig. 3A). [score:3]
STAT3 is a Target of Posttranscriptional Repression by miR-124. [score:3]
Analysis with TargetScan software revealed a potential binding site for miR-124 within the 3′UTR of STAT3 (Fig. S1Biii). [score:3]
MiR-124 is frequently down-regulated in medulloblastoma, indicating its potential role in cancer [37]. [score:3]
MiR-124 is down-regulated in medulloblastoma and cervical cancer [37], [38], and is also involved in an inflammatory feedback loop in hepatocellular carcinoma (HCC) [39]. [score:3]
3′-UTR segment of STAT3 with mutant miR-124 target site was generated by overlap-PCR using wild type 3′-UTR construct as template. [score:3]
Quantitative Real-time RT-PCR Analysis of STAT3 mRNA ExpressionTotal RNA was extracted from cell lines transfected with Pre-miR-124 or control by TRIzol reagent (Invitrogen, Carlsbad, CA, USA). [score:3]
MiR-124 is Down-regulated in Human CRC. [score:3]
In order to identify targets of miR-124 we performed differential proteomic analysis from the protein of SW480 cells after treatment with either the Pre-miR-124 or Pre-Scrambled miRNA. [score:3]
Taken together, these results demonstrate that miR-124 is a tumor suppressor in CRC. [score:3]
0070300.g002 Figure 2(A–B) Effect of miR-124 overexpression on endogenous STAT3 level in human CRC cells. [score:3]
To further validate the effect of miR-124 on STAT3 in human CRC cells, we neutralized endogenously expressed miR-124 using antisense oligonucleotide (AS-miR-124). [score:3]
Induction of apoptosis following overexpression of miR-124 was confirmed by flow cytometry (FCM) (Fig. 3C). [score:3]
0070300.g001 Figure 1 MiR-124 is down-regulated in human CRC. [score:3]
0070300.g003 Figure 3Overexpression of miR-124 increases cell apoptosis in vitro. [score:3]
We then performed rescue experiments to further validate that STAT3 targeting is involved in miR-124–mediated antitumor properties in CRC cells. [score:3]
Importantly, over -expression of STAT3 in miR-124 -transfected CRC cells completely rescues the reduction in tumor size when growing in vivo (Fig. 6B, C). [score:3]
In this study, we aimed to decipher the role of miR-124 in CRC development. [score:2]
The following primers were used to generate 3′-UTR containing mutant miR-124 target site: 3′-UTR- STAT3-M-reverse, 5′-CCAGCCCTGAGGACTACACCACAGAAACAACCTAGCC-3′,3′-UTR- STAT3-M-forward, 5′-GTTTCTGTGGTGTAGTCCTCAGGGCTGGGATACTTCTG-3′. [score:2]
MiR-124 Inhibits Growth of CRC. [score:2]
Compared to colorectal cancer tissues from patients with low-grade CRC (Dukes A and B), high-grade (Dukes C and D) CRC tissues express even lower miR-124 (P = 0.0156; Fig. 1B). [score:2]
MiR-124 inhibits tumor growth in vivo. [score:2]
To examine the expression profile of miR-124 in CRC, we performed quantitative real-time RT-PCR using TaqMan assay in 90 paired tumor and normal colorectal specimens. [score:2]
0070300.g004 Figure 4 MiR-124 inhibits tumor growth in vivo. [score:2]
To further determine the role of miR-124 in regulating tumor growth in vivo, we established xenograft mo del by injecting SW480 cells subcutaneously into nude mice. [score:2]
Compared to cells untransfected or transfected with Pre-Scrambled miRNA, Pre-miR-124 -transfected human CRC cells showed reduced STAT3 expression evidenced by both immunostaining and Western blotting (Fig. 2A, B). [score:2]
At least 7 mice were employed per group to test the effect of miR-124 in tumor growth. [score:1]
SW480 cells were transfected with Pre-miR-124 or Pre-Scrambled miRNA control. [score:1]
Our data indicated a novel role of miR-124 in CRC, and demonstrated potential to use miR-124 as diagnostic marker or therapeutic tool for human CRC. [score:1]
Consistent with its role in promoting cell death in vitro, Pre-miR-124 -transfected cell-derived tumor also showed dramatically increased cell death, which explains the reduced tumor size after transplantation (Fig. 4D). [score:1]
As shown in Fig. S1C, transfection of Pre-miR-124, but not scrambled miRNA, significantly decreased luciferase activity of the luciferase reporter carrying WT STAT3 3′UTR. [score:1]
MiR-124 precursor (Pre-miR-124), miRNA precursor control (Pre-Scrambled miRNA), antisense miR-124 oligonucleotide (AS-miR-124), CY3-labled miR-Scramble, antisense miRNA control (AS-Scrambled miRNA), siRNA against STAT3 (STAT3-siRNA), and scrambled siRNA-oligonucleotide (siRNA-control) were purchased from Ambion (Austin, TX, USA). [score:1]
As shown in Fig. 1A, we found significantly decreased miR-124 in CRC samples (P<0.0001). [score:1]
These results suggest that miR-124 may be involved in the pathogenesis of CRC. [score:1]
Prior to injection, SW480 cells were transfected with Pre-miR-124 or Pre-Scrambled miRNA. [score:1]
The role of miR-124 in CRC was not reported before. [score:1]
Pre-miR-124 significantly decreases luciferase activity containing a WT miR-124 binding site but not a mutant binding site. [score:1]
To investigate the mechanism of STAT3 inhibition by miR-124, we tested the impact of Pre-miR-124 transfection on STAT3 mRNA stability. [score:1]
Loss of miR-124 in glioma cells enhances stem-cell like traits and increases invasiveness of these cells in vitro and in vivo [40]. [score:1]
Total RNA was extracted from cell lines transfected with Pre-miR-124 or control by TRIzol reagent (Invitrogen, Carlsbad, CA, USA). [score:1]
Given the link between miR-124 and STAT3, it would be interesting to test the potential of using miR-124 as diagnostic marker or therapeutic tool for human CRC. [score:1]
Introducing miR-124 back to human CRC cells resulted in increased cell apoptosis in vitro and decreased tumor growth in vivo. [score:1]
In contrast, tumor was not visible in two mice injected with SW480 cells treated with Pre-miR-124. [score:1]
SW480 cells were co -transfected with the luciferase constructs, Pre-miR-124 or Pre-Scrambled miRNA control, respectively. [score:1]
As shown in Fig. 4A, tumors originated from cells treated with Pre-miR-124 were significantly smaller than those treated with Pre-Scrambled miRNA, or mock transfected (P<0.01) at day 40. [score:1]
SW480 and LoVo cells were transfected with Pre-miR-124 or Pre-Scrambled miRNA control. [score:1]
In contrast, neither Pre-miR-124 nor Pre-Scrambled miRNA had any effect on the luciferase activity of the luciferase reporter containing mutant miR-124 binding site. [score:1]
Detection of Mature miR-124 by TaqMan Real-time RT-PCR. [score:1]
Importantly, the level of active (Tyrosine-phosphorylated) STAT3 was also reduced in Pre-miR-124 -transfected CRC cells but not in control (Fig. 2B). [score:1]
Increased cell death resulted from reconstitution of miR-124 led to reduced tumor growth in immune-compromised mice. [score:1]
Average tumor weight for Pre-Scrambled miRNA treated and untreated groups was 4.36±1.69 g and 3.99±1.11 g respectively, while in mice inoculated with Pre-miR-124 treated cells it was 2.42±1.55 g (p<0.01) (Fig. 4B). [score:1]
The miR-124 WT binding site and mutated binding site in the 3′UTR of STAT3 are shown in B. iii. [score:1]
SW480 and LoVo cells were transfected with Pre-miR-124 or Pre-Scrambled miRNA control as described above. [score:1]
[1 to 20 of 106 sentences]
7
[+] score: 351
As we have revealed the down-regulation of ROCK1, MMP2 and MMP9 in bladder cancer tissues by IHC, we wanted to know whether knocking down miR-124-3p could result in the up-regulation of ROCK1, MMP2 and MMP9. [score:8]
To further prove if miR-124-3p represses ROCK1 expression in the human bladder cancer intracellular environment, we analysed the changes of ROCK1 expression in T24, UM-UC-3 and J82 after miR-124-3p overexpression. [score:7]
It may suggest that down-regulated miR-124-3p is one of factors which lead to the upregulation of these genes. [score:7]
Figure 4 Forced expression of miR-124-3p and silenced expression of ROCK1 suppresses cell migration and invasion in transwell assay. [score:6]
As well as those three mesenchymal markers, they were down-regulated by miR-124-3p overexpression (Figure  7C). [score:6]
Furthermore, we demonstrated miR-124-3p could inhibit bladder cancer cell epithelial mesenchymal transfer, and regulated the expression of c-Met, MMP2, MMP9. [score:6]
To find the target which is involved in the regulation of cell motility and invasion capability triggered by miR-124, we used bioinformatics prediction software Targetscan (http:// http://www. [score:6]
Next, we observed that the expression of c-Met, MMP2 and MMP9 were suppressed after reintroduction of miR-124-3p. [score:5]
More cells in pT-ROCK1 + miR-124-3p group than NULL + miR-124-3p group showed that overexpression of ROCK1 abrogated the reduction of migration and invasion ability caused by ectopic expression of miR-124-3p in T24 cells (Figure  7A). [score:5]
Exogenous overexpression of miR-124-3p inhibits BCa cell EMT. [score:5]
The results demonstrated that the silencing of ROCK1 caused significant suppression of the migratory and invasive capability in much the same pattern as miR-124-3p overexpression. [score:5]
This is consistent with our results that exogenetic overexpression of miR-124-3p suppress the migration and invasion of human bladder cancer cells. [score:5]
Although ROCK2 was reported as a target gene of miR-124 in HCC cells [38], we could not observe any expression difference of ROCK2 after miR-124-3p treatment by western blot in BCa cells (data not show). [score:5]
In our study, we found that the mimics of miR-124 reverses EMT of T24 cell line, as shown by decreased expression of the mesenchymal markers like fibronectin, N-cadherin and vimentin while enhanced expression of the epithelial markers β-catenin. [score:5]
siROCK1 could simulate the effect of miR-124-3p over -expression and could reduce the expression of c-Met, MMP2, MMP9 as well (Figure  7C). [score:5]
As the representative micrographs clearly demonstrate, miR-124-3p overexpression led to potent inhibition of cell migration (Figure  4A). [score:5]
We performed flow cytometry to confirm that exogenetic overexpression of miR-124-3p do not suppresses bladder cell-line growth. [score:5]
After miR-124 was exogenous overexpressed in T24 cells, the expression levels of epithelial marker β-catenin increased (Figure  7C) while the levels of three mesenchymal markers (ie, fibronectin, N-cadherin and vimentin) decreased, (Figure  7C). [score:5]
org/) found that ROCK1, a potential metastasis promoter, is probably a direct target of miR-124-3p. [score:4]
Figure 6 miR-124-3p directly targets ROCK1. [score:4]
miR-124-3p directly targets ROCK1 3′-UTR. [score:4]
miR-124-3p regulates cell cycle and motility by targeting to CDK6 and ITGB1 [15, 18]. [score:4]
In this study, we demonstrated the pathologically down-regulation of miR-124-3p in both bladder cancer specimens and cell lines. [score:4]
miR-124-3p is down-regulated in various cancers, and modulates proliferation and aggressiveness of cancer cells. [score:4]
The dysregulation of miR-124-3p gains the expression of ROCK1, which promotes the epithelial mesenchymal transfer and increases c-Met, MMP2, MMP2. [score:4]
Overexpression of miR-124-3p induced G1-phase arrest in T24, UM-UC-3 and J82 cell lines and suppressed cell growth in colony-forming assay. [score:4]
Thus, our findings provide valuable clues toward understanding the specific tumor suppressive function and the regulatory mechanisms of miR-124-3p in human bladder cancer. [score:4]
These observations provide the evidence that miR-124-3p exerts its function in cell motility and invasion via regulating the expression level of ROCK1. [score:4]
Previous studies showed that miR-124-3p is commonly down-regulated in several human cancers and transfection of it represses cell proliferation and motility of cancer cell lines [14- 17]. [score:4]
Furthermore, as we revealed that miR-124-3p could regulate the expression of c-Met, MMP2 and MMP9, we were interested in its underlying molecular mechanism. [score:4]
Thus, methylation may be an important mechanism which contributes to the down-regulation of miR-124-3p in bladder cancer tissues. [score:4]
miR-124-3p is frequently down-regulated in bladder cancer both in three bladder cancer cell lines, T24, UM-UC-3, J82 and clinical samples. [score:4]
Collectively, these data supported our speculation that ROCK1 is a direct target of miR-124-3p. [score:4]
Figure 3 Forced expression of miR-124-3p suppresses cell motility in wound healing assay. [score:4]
miR-124-3p is frequently down-regulated in bladder cancer both in BCa clinical samples and cell lines. [score:4]
Therefore, miR-124-3p may regulate the expression of c-Met, MMP2, MMP9 through p38 pathway. [score:4]
We found SP1 was down-regulated in BCa cells after miR-124-3p treatment by western blot (data not show). [score:4]
More importantly, we illustrated that miR-124 directly target the Rho -associated, coiled-coil containing protein kinase 1 (ROCK1). [score:4]
Subsequently, we demonstrated ROCK1 as direct target of miR-124-3p in human bladder cancer. [score:4]
Tumor-specific silencing of miR-124-3p was a relatively frequent molecular event in primary HCCs and miR-124-3p exert cell growth -inhibitory effect, resulting in cell cycle arrest at the G1–S checkpoint and apoptosis in cells [16]. [score:3]
We found that both of miR-124-3p and siROCK1 could decrease the expression level of Phospho-p38 MAPK (p-p38) (Figure  7D). [score:3]
These results indicated that the loss of miR-124-3p gains the expression of ROCK1. [score:3]
Western blot of ROCK1, MMP2 and MMP9 after miR-124-3p inhibitor treatment. [score:3]
It has been shown that Slug is another target gene of miR-124-3p, which participates in epithelial mesenchymal transition [17]. [score:3]
Ectopic overexpression of miR-124-3p not only repressed cell motility and invasion capability, but also triggered G1-phase arrest of human bladder cancer cells. [score:3]
Figure 1 Expression patterns of miR-124-3p in urinary bladder cancer tissues and BCa cell lines. [score:3]
Exogenetic overexpression of miR-124-3p was established by transfecting mimics into T24, UM-UC-3 and J82 cells, after that cell proliferation and cell cycle were assessed by, flow cytometry and. [score:3]
In addition, we provide evidence that miR-124-3p appears to play an important role in epithelial mesenchymal transfer (EMT), and modulates the expression of genes which promote cancer metastasis, such as MMP2, MMP9, c-Met. [score:3]
Furthermore, our preliminary data suggested SP1 maybe a new potential target gene of miR-124-3p. [score:3]
Our findings show that miR-124-3p dramatically decreased their expression of ROCK1 in both mRNA level and protein level by bounding the complementary sites of its 3′-UTR. [score:3]
Cell migration and invasion is inhibited by miR-124-3p in human bladder cancer. [score:3]
Figure 7 Forced expression of ROCK1 rescues miR-124-3p -associated decrease in cell migration and invasion. [score:3]
The results indicated that overexpression of miR-124-3p represses the EMT phenotype of bladder cancer cells. [score:3]
The epigenetic silencing of miR-124-3p suggests its potential tumor suppressive function in glioma, oral squamous cell carcinomas, hepatocellular carcinoma (HCC) and breast cancer [14- 17]. [score:3]
Three human bladder cancer cell lines and samples from ten patients with bladder cancer were analyzed for the expression of miR-124-3p by quantitative RT--PCR. [score:3]
In conclusion, we confirmed that miR-124-3p works as a metastatic suppressor in BCa cells. [score:3]
Bioinformatics prediction software Targetscan predicts that SP1 may have three binding sites of miR-124-3p. [score:3]
Scale bars = 100 μm (B) Either miR-124-3p mimics or NC oligos were co -transfected with the pT-ROCK1 or the empty pTarget vector, pT-NULL, into T24 cells. [score:3]
Our data indicate that miR-124-3p could be a tumor suppressor and may have a potential to be a diagnostics or predictive biomarker in bladder cancer. [score:3]
Recent reports further demonstrated that decreased expression of miR-124-3p is related to carcinogenesis. [score:3]
Next, we tried to find the mechanism by which miR-124-3p suppresses cell motility and invasion ability. [score:3]
Click here for file Western blot of ROCK1, MMP2 and MMP9 after miR-124-3p inhibitor treatment. [score:3]
Alignment between the predicted miR-34a target sites and miR-124-3p is marked with black color. [score:3]
The results showed that ROCK1 was also dramatically decreased in protein level after ectopic overexpression of miR-124-3p (Figure  6C). [score:3]
Silencing of ROCK1 by siRNA could simulate the effect of miR-124-3p over -expression, reversing EMT of T24 and repressing c-Met, MMP2, MMP9. [score:3]
Notably, three cell lines showed a dramatic inhibition of clonogenicity in the miR-124-3p -treated group (p < 0.05; Figure  2B, C). [score:3]
As a possible novel target of miR-124-3p, the function of ROCK1 in the epithelial mesenchymal transition was further assessed via RNAi approach. [score:3]
miR-124-3p inhibits T24 EMT. [score:3]
miR-124-3p induces G1-phase arrest and inhibits clonogenicity in bladder cancer cell lines. [score:3]
As the important role of miR-124-3p in bladder cancer progression, we think further experiments in animal tumor mo dels and clinical samples are necessary to determine the potential value of miR-124-3p in bladder cancer patients treatment in this era of translational medicine. [score:3]
In addition, cell cycle, and colony-forming assay presented no significant difference via RNAi approach of ROCK1, suggesting that there may be other target genes to regulate the proliferation of BCa cells in miR-124-3p downstream network. [score:3]
In this study, we reported that the expression level of miR-124-3p was significantly lower in human bladder cancer cell lines and tissues, which is consistent with earlier study [19]. [score:3]
miR-124-3p mimic (named as miR-124-3p), miR-124-3p inhibitor, negative control duplex (named as NC) and siRNA against ROCK1 (named as siROCK1), were all synthesized by GenePharma (Shanghai, China), were applied for transfection. [score:3]
In addition, ROCK1 was identified as a new target of miR-124-3p. [score:3]
miR-124-3p mimics significantly suppressed the luciferase activity of reporter genes which contains wild type of 3′-UTR of ROCK1 (Figure  6B). [score:3]
We further compared the expression levels of miR-124-3p between bladder carcinomas tissue samples and paired adjacent normal mucosal tissues from 13 cases of bladder cancer patients. [score:2]
miR-124-3p can repress the migration and invasion of bladder cancer cells via regulating ROCK1. [score:2]
The result showed that the expression levels of miR-124-3p in all three cell lines were significantly reduced at different degrees compared with SV-HUC1 (Figure  1A). [score:2]
The target gene of miR-124-3p was determined by luciferase assays, quantitative RT--PCR and western blot. [score:2]
Therefore, despite the discordance of results of with results of flow cytometry and clonogenicity assay, we suppose miR-124-3p may inhibit cell proliferation in bladder cancer cells. [score:2]
We found that miR-124-3p expression levels were decreased in cancerous tissues compared to their corresponding non-cancerous controls (P < 0.001), with 11 out of 13 exhibiting over 50% reduction (Figure  1B). [score:2]
Therefore, western blot was performed to investigate the expression of these genes after knocking down miR-124-3p by synthetic oligonucleotides. [score:2]
The regulation of epithelial-to-mesenchymal transition by miR-124-3p was analyzed by western blot. [score:2]
A study reported that miR-124-3p was deregulated in bladder cancer tissues and cell lines because of methylation, by which they believed that it could serve as a diagnostic biomarker for BCa detection. [score:2]
Forced expression of miR-124-3p in all three cells led to retarded wound closing compared to NC groups (Figure  3). [score:2]
The above results suggest that miR-124-3p regulates proliferation in bladder cancer cells. [score:2]
It is necessary to take further experiments to illustrate miR-124-3p related downstream network in regulation of migration and invasion of BCa cells (Figure  7). [score:2]
Furthermore, our data suggested that miR-124-3p decreased p38 MAPK phosphorylation. [score:1]
Here, we confirmed that miR-124-3p reversed BCa cell EMT in vitro. [score:1]
Reintroduction of miR-124-3p dramatically repressed the capability of migration and invasion in three human bladder cancer cell lines. [score:1]
HEK 293 T cells were transiently transfected with these constructs and miR-124-3p mimics or NC. [score:1]
The co-transfection of pT-ROCK1 and miR-124-3p rescued the miR-124-3p induced repression in cell motility. [score:1]
Next, to investigate if miR-124-3p exerts its function via ROCK1 on migration and invasion of human bladder cancer cells, we ectopically expressed ROCK1 together with miR-124-3p in T24 cells. [score:1]
Considering T24, UM-UC-3 and J82 cells are highly metastatic cell, we wonder whether decreased miR-124-3p has any effect on migration and invasion capacity. [score:1]
To explore if ROCK1 has similar function as miR-124-3p in bladder cancer cells, RNA approach was used. [score:1]
Restoration of miR-124 may be an effective anticancer therapy [19]. [score:1]
From these results, we speculated that miR-124-3p may play some important roles in human bladder cancer. [score:1]
Therefore, the loss of miR-124-3p may also result in accumulation of Slug which promots EMT. [score:1]
Another study reported that miR-124-3p was frequently methylated in bladder cancer tissues, and the tumor tissues exhibited significantly higher methylation levels than their non-tumorous counterparts [19]. [score:1]
These findings suggest that miR-124-3p plays a critical role in the invasive and metastatic potential of BCa and may be potential diagnostic and predictive biomarkers. [score:1]
However, the specific function of miR-124-3p in bladder cancer progression, especially its molecular mechanisms by which miR-124-3p exerts its functions and modulates the malignant phenotypes of bladder cancer cells, has not been fully understood. [score:1]
However, the roles of miR-124-3p in human bladder cancer are elusive. [score:1]
The results of previous studies of SP1 were consistent with our results after miR-124-3p transfection. [score:1]
ROCK1 is involved in miR-124-3p -induced repression of BCa cell migration and invasion. [score:1]
However, the specific function of miR-124-3p in bladder cancer progression has not been fully understood. [score:1]
The miR-124-3p was detected in 46 animal species from Caenorhabditis to Homo sapiens [12] and it is inevitable in neurogenesis [13]. [score:1]
The loss of miR-124-3p endows breast cancer cells higher capability in migration and invasion [17]. [score:1]
We evaluated the epithelial and mesenchymal markers by western blot in Negative control group and miR-124 -overexpressing T24 cells. [score:1]
We rationally speculate that miR-124-3p has the potential to be a useful clinical noninvasive diagnostics or predictive marker in human bladder cancer. [score:1]
The Ct value of miR-124-3p and ROCK1 was quantified with the 2-∆∆Ct method. [score:1]
In order to discover whether miR-124 regulates cell motility and invasion capability via ROCK1 3′-UTR, we performed luciferase reporter assay. [score:1]
Since EMT is well known to be involved in invasion and metastasis of cancer cells, we asked whether miR-124-3p can reverse the EMT progression. [score:1]
No significant difference was observed between NC group and miR-124-3p treated group in (Data not shown). [score:1]
Altogether, the above results suggest that miR-124-3p reuglates migration and invasion capability of human bladder cancer cells via ROCK1. [score:1]
We performed western blot to explore whether miR-124-3p could affect these pathways. [score:1]
To our surprise, a significant accumulation of cells in the G1 phase was observed in three cell lines after miR-124-3p treatment (p < 0.05). [score:1]
miR-124-3p significantly repressed the capability of migration and invasion of bladder cancer cells. [score:1]
HEK293T cells were plated in 24-well plates and co -transfected with 50 nM miR-124-3p or NC RNA and with 100 ng of the pmirGLO. [score:1]
After an overnight incubation, the cells were transfected with the NC, miR-124-3p or siROCK1 for 24–96 h. The RNA concentration ranged from 25 to 75 nM. [score:1]
The cells were harvested 24 h after RNA treatment (50 nM of NC or 50 nM of miR-124-3p). [score:1]
Figure 2. (A) The T24, UM-UC-3 and J82 cells, transfected with NC RNA or miR-124-3p, were subjected to flow cytometry for cell cycle analysis. [score:1]
[1 to 20 of 121 sentences]
8
[+] score: 346
Consistent with our previous study, the present data indicated that miR-124 overexpression markedly decreased iASPP and ΔNp63 expression and enhanced TAp63 expression; in contrast, the inhibition of miR-124 resulted in a dramatic upregulation of iASPP and ΔNp63 expression and an attenuation of TAp63 expression (Figure 1D). [score:16]
The results of the present study demonstrate the downregulation of iASPP through miR-124 and the upregulation of TAp63; in addition, CRC cell growth was inhibited in response to the overexpression of miR-124. [score:11]
Significant downregulation of miR-124 and TAp63 expression was observed over time and was accompanied by the upregulation of iASPP and ΔNp63 expression (Figure 1E). [score:11]
In addition, the expression levels of miR-124, STAT1 and TAp63 were down-regulated in mouse tumors in a time -dependent manner on day 10, 20 and 30 after tumor formation, while the expression levels of miR-155, iASPP and ΔNp63 were up-regulated in mouse tumors in a time -dependent manner on day 10, 20 and 30 after tumor formation (Figure 5D). [score:11]
These findings indicate that STAT1 targets miR-124 and induces its expression and that it regulates p63 expression levels most likely through the targeting of miR-124 in CRC cells. [score:10]
Similarly, when both isoforms were knocked down, results similar to those after TAp63 knockdown were observed: miR-124 expression caused inhibition and iASPP expression caused induction. [score:9]
We observed that miR-124, an important miRNA in solid tumors, was transcriptionally regulated by STAT1 and that miR-124 inhibition downregulated TAp63 expression in CRC cells. [score:9]
The results showed that the expression of STAT1, miR-124 and TAp63 was significantly downregulated, while that of iASPP, ΔNp63 and miR-155 was upregulated in CRC tissues compared with adjacent normal tissues (Figure 7A). [score:8]
Because the regulatory effect of miR-124 on CRC cell proliferation was confirmed, we further examined the expression levels of iASPP and p63 in response to miR-124 overexpression and inhibition. [score:8]
Furthermore, miR-155 overexpression significantly reduced the expression of STAT1, miR-124 and TAp63 and enhanced the expression of iASPP and ΔNp63 (Figure 5C). [score:7]
Strikingly, stable cell line injection -induced inhibition of miR-124 was sufficient to elevate CRC cell growth and promote tumor formation in immunodeficient mice, while miR-124 overexpression strongly inhibited CRC cell proliferation and tumor formation (Figure 1B and 1C). [score:7]
Here, we further demonstrate that the iASPP/TAp63 axis regulates miR-155 expression, which prompted us to confirm whether the iASPP/TAp63 axis has a negative feedback regulatory role in the expression of miR-124 through miR-155. [score:7]
MiR-124 inhibition/overexpression was achieved using as-miR-124/miR-124; the expression efficiency was verified using real-time PCR 48 h after transfection (Supplementary Figure 1). [score:7]
Taken together, these results show that miR-155 exerts an inhibitory function on the miR-124/iASPP/p63 pathway via the direct targeting of the 3′-UTR of STAT1. [score:6]
MiR-124 significantly promoted TAp63 protein expression while inhibited ΔNp63 protein expression. [score:6]
In the present study, we show that miR-124 regulates p63 via iASPP, while p63 targets miR-155 via the modulation of STAT1 expression. [score:6]
The upregulation of miR-155 in CRC cells attenuated miR-124 expression through a STAT1 -dependent mechanism, which facilitated the proliferation of CRC cells. [score:6]
Taken together, these data suggest that miR-124 affects CRC development by targeting iASPP to regulate TAp63/ΔNp63, which is consistent with the mutual regulation that occurs between iASPP and TAp63 in CRC. [score:6]
Building on the in vitro and in vivo findings that the miR-124/iASPP axis regulates CRC cell proliferation via the inhibition of cell proliferation by TAp63 and the promotion of cell proliferation by ΔNp63, we hypothesized that p63 knockdown would result in negligible changes in cell proliferation; however, p63 knockdown significantly facilitated cell proliferation. [score:6]
Additionally, TargetScan and JASPAR predicted several TFs, including STAT1, could target miR-124. [score:5]
To provide a foundation for the determination of whether this miR-124-p63 feedback loop exerts tumor suppressive effects in human colon cancers, we obtained CRC samples and matched adjacent normal tissues to assess the expression of the components of the feedback loop. [score:5]
In these tumors on day 35, miR-124 expression remained suppressed (Supplementary Figure 2). [score:5]
The overexpression of any positive factor (iASPP, ΔNp63, and miR-155) or the inhibition of any negative factor (TAp63, miR-124, STAT1) transforms immortalized colonic cells. [score:5]
STAT1 overexpression restored the inhibitory effect of miR-155 on miR-124 and TAp63 and the inducing effect on iASPP (Figure 4E). [score:5]
Moreover, treatment with Ruxolitinib, a known blocker of the JAK/STAT pathway, markedly attenuated the expression of miR-124 and TAp63, while the expression of iASPP and ΔNp63 was enhanced (Figure 6D, 6E). [score:5]
Several TFs that might be targets of miR-124 were predicted by TargetScan and JASPAR. [score:5]
miR-124 suppresses the growth of human CRC via a PTB1/PKM1/PKM2 feedback cascade [6] or via the targeting of STAT3 [7]. [score:5]
To determine the expression correlation of iASPP, miR-124, TAp63 and ΔNp63 in tumor tissues derived from mice, we determined the expression levels of iASPP, miR-124, TAp63 and ΔNp63 over time. [score:5]
Figure 6Several TFs that might be targets of miR-124 were predicted by TargetScan and JASPAR. [score:5]
Based on our previous findings that STAT1 induces miR-124 expression and regulates the miR-124/iASPP/p63 axis, we examined whether miR-155 has a functional role in the regulation of the miR-124/iASPP/p63 axis through STAT1. [score:5]
Taken together, the data discussed above suggested that TAp63 plays a leading role in the regulation of CRC growth through p63 via the mediation of the negative feedback regulation of miR-124/iASPP expression. [score:5]
In a previous study, we showed that miR-124 regulates the growth of CRC cells via the direct targeting of iASPP [10]. [score:5]
In our previous study, we identified the miR-124/iASPP axis as a regulator of CRC growth that involves the direct targeting of iASPP by miR-124. [score:5]
We previously confirmed the effects of the inhibition of iASPP in terms of its regulatory effect of miR-124 on CRC growth [10]. [score:4]
We observed a decrease in miR-124 and TAp63 expression and an increase in iASPP and ΔNp63 expression in all six CRC cell lines and human tumors compared with the control (Figure 1A). [score:4]
The overexpression of iASPP partially restored the regulatory effect of miR-124 on TAp63 and ΔNp63 protein (Supplementary Figure 3). [score:4]
Recently, we described the regulation of CRC cell proliferation via the targeting of iASPP by miR-124 [10]. [score:4]
STAT1 directly targets miR-124. [score:4]
Figure 1 (A) In the non-transformed immortalized human colon cell line HCoEpiC, six CRC cell lines, LoVo, HT29, HCT116, SW480, DLD1 and SW620, normal tissue samples and tumor tissue samples miR-124, iASPP, ΔNp63 and TAp63 expression was determined using real-time PCR. [score:3]
miR-124 exerts tumor suppressive functions on cell proliferation in bladder cancer [31], breast cancer [32] and non-small cell lung cancer [33]. [score:3]
TAp63 induction rescued the si-p63#1 effect on the expression of miR-124 and iASPP. [score:3]
Hence, we speculate that miR-124 may influence p63 expression. [score:3]
The miR-124/p63feedback circuit primarily transforms immortalized human colonic cells through the conversion of a transient signal (e. g., acute miR-124 inhibition) into a stable signal. [score:3]
ΔNp63 overexpression also decreased miR-124 levels and increased the iASPP levels, but did not rescue the effect of si-p63#1 (Figure 2F). [score:3]
On day 5 and day 35 after tumor formation in nude mice, the expression levels of miR-124 were determined by RT-PCR (Supplementary Figure 2). [score:3]
The expression levels of miR-124 and miR-155 were detected using the Hairpin-it™ miRNAs qPCR Kit (Genepharma, Shanghai, China). [score:3]
Moreover, we transfected the LoVo and SW480 cells with Vector (empty vector used for control), TAp63 or ΔNp63 in the presence or absence of si-p63#1, and then the expression levels of miR-124 and iASPP were determined using real-time PCR. [score:3]
To elucidate the role and function of the miR-124/iASPP axis and p63 in CRC growth, we determined the expression of miR-124, iASPP and two isoforms of p63 (TAp63 and ΔNp63) in the following samples: the non-transformed immortalized human colon cell line HCoEpiC; six CRC cell lines (LoVo, HT29, SW480, SW620, DLD1 and HCT116); and human tumor tissues (N stands for normal tissues and T stands for tumor tissues). [score:3]
Building on the in vitro and in vivo findings that the miR-124/iASPP axis regulates CRC cell proliferation via TAp63 and ΔNp63, we assessed the functional roles of TAp63 and ΔNp63 in the regulation of proliferation. [score:3]
The as-miR-124/miR-124 or si-p63#1/si-p63#2 or TAp63/ΔNp63 or miR-155 polyclone stable expression cell lines were established using lentivirus infection and were used for mouse experiments. [score:3]
Figure 7 (A) The expression levels (mean ± SD) of STAT1, miR-124, iASPP, TAp63/ΔNp63 and miR-155 in CRC samples and adjacent normal tissues were determined. [score:3]
miR-155 targets STAT1 and consequently modulates the miR-124/iASPP/p63 pathway. [score:3]
Because p63 negatively regulates iASPP and plays a significant role in various cancers through its interactions with miRNAs [12], we speculated about the potential association between p63 and miR-124 and that these molecules may form a feedback loop that affects CRC development. [score:3]
Polyclone as-miR-124/miR-124 or miR-155 or si-p63#1/si-p63#2 or TAp63/ΔNp63 stable expression cell lines were used for the injection of the mice, 10 mice in each group. [score:3]
Overall, these data suggest that miR-124 inhibition induces growth of CRC cells, and p63 and iASPP are involved in this process. [score:3]
Using TargetScan and JASPAR, we found miR-155 binding sites in the 3′UTR of STAT1; we also found STAT1 binding sites in the promoter of miR-124. [score:3]
Thus, we were prompted to identify the potential mechanism whereby the interplay of miR-124, iASPP and p63 regulates CRC growth. [score:2]
Taken together, these results suggest that miR-155 promotes CRC cell growth, most likely through the regulation of the STAT1/miR-124/iASPP/p63 pathway. [score:2]
As a vital transcription factor, p63 is involved in the regulation of various miRNAs, including miR-205 [15], miR-34a [50] and miR-155 [18], which have been identified as oncogenic miRNAs that function in an opposite manner to that of miR-124 in CRC [51]. [score:2]
To evaluate the expression levels of STAT1, miR-124, iASPP and p63 in response to the regulation of CRC growth by miR-155, additional studies were performed. [score:2]
Moreover, the expression differences of miR-124, iASPP, TAp63 and ΔNp63 were the most significant in LoVo and SW480 cell lines, compared with the normal cell line, HcoEpic. [score:2]
The miR-124/iASPP axis modulates CRC cell growth via the regulation of p63. [score:2]
In addition, accumulating evidence has revealed that miR-124 is regulated by several TFs, including HNFα4 and NF-κB [8, 9]. [score:2]
The expression levels of miR-124, iASPP mRNA, TAp63 mRNA and ΔNp63 mRNA in CRC tissues and matched adjacent normal tissues were compared using Wilcoxon's paired test. [score:2]
Taken together, these results support the presence of a miR-124-p63 feedback loop comprising iASPP, STAT1 and miR-155, which is essential for CRC development. [score:2]
MiR-124, a major miRNA that is associated with cancer, exerts regulatory effects on various oncogenes and participates in signaling pathways that are closely associated with cancer growth [28– 30]. [score:2]
Moreover, STAT1 acts as a TF that binds to the promoter of miR-124, which leads to increases in p63 levels during feedback regulation. [score:2]
Taken together, these data reveal the dynamics of a complex molecular self-reinforcing circuit that involves miR-124, iASPP, TAp63/ΔNp63, miR-155 and STAT1 in the regulation of CRC growth (Figure 7C). [score:2]
Knockdown of p63 promotes CRC cell growth through miR-124/iASPP feedback. [score:2]
miR-124 has received a large amount of attention, and researchers have focused on its interactions with various TFs and its prominent role in CRC development. [score:2]
The miR-124/iASPP axis modulates cell growth in CRC via the regulation of p63. [score:2]
This result is consistent with previous results obtained in six CRC cell lines and tissues and suggests that miR-124 regulates CRC cell proliferation through iASPP and p63. [score:2]
cgi) to identify TFs that are regulated by miR-124, including Ets-1, Sp1, STAT3 and STAT1. [score:2]
To examine whether STAT1 binds to miR-124, 4 potential binding elements of STAT1 in the promoter region of the miR-124 gene were identified through a bioinformatics analysis (Figure 6A). [score:1]
Moreover, the miR-124/iASPP axis has been implicated in stroke [34] and glioblastoma [35]. [score:1]
Roles of the miR-124/p63 feedback loop in CRC growth. [score:1]
To explore the characteristics of the miR-124/p63 feedback, we examined the expression levels of STAT1, miR-124, iASPP, ΔNp63, TAp63 and miR-155 in 31 CRC tissues and adjacent normal tissue samples. [score:1]
Considering the importance of miR-124 and TAp63 in CRC carcinogenesis, this feedback circuit is not only essential for enhancing our current understanding of colon cancer pathogenesis but also indicates a novel strategy for CRC prevention and therapy. [score:1]
To confirm whether the miR-124/iASPP axis exerts its effect through p63, further studies were performed. [score:1]
We observed an inverse correlation between miR-124 and iASPP mRNA levels, an inverse correlation between miR-124 and miR-155 levels, a positive correlation between miR-124 and TAp63 mRNA levels, a positive correlation between miR-124 and STAT1 mRNA levels; an inverse correlation between TAp63 mRNA and iASPP mRNA or miR-155 levels, a positive correlation between TAp63 mRNA and STAT1 mRNA levels (Figure 7B). [score:1]
Given these data, we assume that the p63/miR-155 axis together with miR-124 might form a feedback loop by binding to other TFs. [score:1]
These results also indicate that the binding of elements B and C might contribute primarily to STAT-1 -induced miR-124 transcription. [score:1]
Together, these findings elucidate a feedback loop that consists of miR-124, iASPP, STAT1, miR-155 and p63 and plays an essential role in CRC growth. [score:1]
Collectively, these results revealed a miR-124-p63 feedback circuit that comprises specific miRNAs and TFs in CRC. [score:1]
[1 to 20 of 84 sentences]
9
[+] score: 336
22, 23 To elucidate the underlying mechanism through which hnRNPA1 upregulates miR-124, we first examined the expression levels of miR-124 primary and precursor transcript in the VSMCs expressing hnRNPA1 and observed that the expression level of the precursor, but not the primary miR-124 transcript, was significantly upregulated by hnRNPA1 overexpression (Figure 5A and 5B). [score:15]
Translationally, we have observed that hnRNPA1 expression levels were also downregulated during neointima formation after vessel injury and provided compelling evidence to support that locally enforced expression of hnRNPA1 in injured vessels increases miR-124, represses IQGAP1 gene expression levels, inhibits VSMC proliferation, and prevents postangioplasty restenosis. [score:14]
IQGAP1 expression was significantly inhibited by hnRNPA1 overexpression, but activated by miR-124 inhibition, while its expression level also returned to normal in the cotransfected VSMCs (Figure VA in the online-only Data Supplement). [score:11]
However, while enforced expression of miR-124 significantly decreased IQGAP1 expression at both mRNA and protein levels (Figure 4C and 4D), no such inhibitory effect was induced by miR-24 overexpression (Figure IIIC in the online-only Data Supplement), indicating that IQGAP1 is negatively regulated by miR-124 but not by miR-24. [score:10]
Mechanistically, we have demonstrated for the first time that (1) IQGAP1 is the functional downstream target of hnRNPA1 in the context of VSMCs, (2) IQGAP1 repression is required for the inhibitory effects of hnRNPA1 on VSMC proliferation and migration, and (3) hnRNPA1 regulates IQGAP1 through at least 2 regulatory mechanisms: upregulation of miR-124 and via the 3′-UTR of IQGAP1 in which a specific binding site for hnRNPA1 lies. [score:10]
A– C, Vascular overexpression of hnRNPA1 significantly increased the gene expression levels of hnRNPA1 (A and B) and microRNA-124 (miR-124; A), while downregulated the gene expression levels of IQGAP1 (IQ motif containing GTPase activating protein 1; A and B) and PCNA (proliferating cell nuclear antigen; A) and decreased the percentage of PCNA -positive cells (C) in the injured vessels. [score:10]
Gene expression data showed that hnRNPA1 overexpression significantly upregulated miR-124, but this effect was abolished in VSMCs transfected with a miR-124 inhibitor. [score:10]
We find a decreased gene expression level of hnRNPA1 and microRNA-124 but an increased gene expression level of IQGAP1 in the diseased femoral arteries and observe a significant inverse relationship between IQGAP1 and hnRNPA1 or microRNA-124 and a positive correlation between hnRNPA1 and microRNA-124 in the diseased femoral arterial specimens, as well as neighboring healthy tissues. [score:9]
[48] More pertinent to our study is that it has recently been reported that miR-124 inhibits the proliferation of pulmonary artery smooth muscle cells by suppressing the transactivation of nuclear factor of activated T cells signaling and targeting multiple genes. [score:7]
hnRNPA1 Downregulates IQGAP1 Through Upregulation of miR-124. [score:7]
Consequently, VSMC proliferation (Figure VB in the online-only Data Supplement) and migration (Figure VC in the online-only Data Supplement) were significantly inhibited and increased by hnRNPA1 overexpression and miR-124 inhibition, respectively, while such effects were normalized in the cotransfected cells, indicating that miR-124 is at least partially responsible for the effects of hnRNPA1 on IQGAP1 gene repression, as well as VSMC proliferation and migration. [score:7]
We found that the mature miR-124 transcript and its precursor, but not the primary transcript of miR-124, was significantly increased by hnRNPA1 overexpression, providing direct evidence to support a notion that hnRNPA1 upregulates miR-124 through an miRNA biogenesis mechanism. [score:7]
Our data show that hnRNPA1 is a critical regulator of VSMC function and behavior in the context of neointima hyperplasia, and the hnRNPA1/miR-124/IQGAP1 regulatory axis represents a novel therapeutic target for the prevention of cardiovascular diseases. [score:7]
Altogether, the above data demonstrates that IQGAP1 is a true mRNA target of miR-124, and miR-124 is upregulated by hnRNPA1 in VSMCs. [score:6]
Finally, IQGAP1 gene expression level was inversely associated with hnRNPA1 and miR-124 expression levels in the injured vessels (Figure 6A and 6B), indicating that IQGAP1 is also negatively regulated by hnRNPA1 and miR-124 in vivo. [score:6]
Data from our miRNA reporter assays showed that the activity of luciferase from construct harboring the wild-type IQGAP1 3′-UTR was significantly repressed by miR-124 overexpression (Figure 4E) but not by miR-24 overexpression (Figure IIID in the online-only Data Supplement), providing evidence that IQGAP1 is the target gene of miR-124. [score:6]
Compared with neighboring healthy tissues, a decreased gene expression level of hnRNPA1 and miR-124, while an increased gene expression level of IQGAP1, was observed in the diseased femoral arteries (Figure 7B). [score:6]
[22] In conclusion, we have shown that hnRNPA1 is a novel regulator of VSMC phenotypic modulation and arterial remo deling, and we have provided compelling evidence to support the notion that modulating the identified downstream target gene (miR-124 and IQGAP1) expression by hnRNPA1 can at least partially explain its effect on VSMC function and injury -induced neointimal formation. [score:6]
Kang K Peng X Zhang X Wang Y Zhang L Gao L Weng T Zhang H Ramchandran R Raj JU Gou D Liu L MicroRNA-124 suppresses the transactivation of nuclear factor of activated T cells by targeting multiple genes and inhibits the proliferation of pulmonary artery smooth muscle cells. [score:6]
B, miR-124 expression level was significantly upregulated by hnRNPA1. [score:6]
We have also identified IQGAP1 as the mRNA target of miR-124 in VSMCs and demonstrated that hnRNPA1 upregulates miR-124 through an miRNA biogenesis mechanism. [score:6]
Third, overexpression of miR-124 substantially downregulates IQGAP1 3′-UTR activity, but this repression was completely abolished when the miR-124–binging site was mutated. [score:6]
Further evidence suggests that hnRNPA1 upregulates miR-124 by modulating miR-124 biogenesis and that IQGAP1 is the authentic target gene of miR-124. [score:6]
Choe N Kwon DH Shin S Kim YS Kim YK Kim J Ahn Y Eom GH Kook H The microRNA miR-124 inhibits vascular smooth muscle cell proliferation by targeting S100 calcium -binding protein A4 (S100A4). [score:5]
Increasing evidence has suggested that miR-124 is a tumor suppressor by inhibiting various processes, including cancer cell growth, migration, and invasion. [score:5]
Mechanistically, hnRNPA1 regulates IQGAP1 mRNA degradation through 2 mechanisms: upregulating microRNA-124 (miR-124) and binding to AU-rich element of IQGAP1 gene. [score:5]
Finally, lower expression levels of hnRNPA1 and miR-124, while higher expression levels of IQGAP1, were observed in human atherosclerotic lesions. [score:5]
B, Quantitative reverse transcription polymerase chain reaction analysis of miR-124 precursor (pre-miR-124) and primary (pri-miR-124) transcript expression in VSMCs (vascular smooth muscle cells) transfected with control (pCMV) or hnRNPA1 overexpression plasmid (pCMV-hnRNPA1). [score:5]
qRT-PCR data (Figure 4B; Figure IIIB in the online-only Data Supplement) revealed that overexpression of hnRNPA1 significantly increased both miR-24 and miR-124 expression levels in VSMCs. [score:5]
Expression of hnRNPA1-miR-124-IQGAP1 Axis in the Healthy and Diseased Human Vessels. [score:5]
Lu Y Yue X Cui Y Zhang J Wang K MicroRNA-124 suppresses growth of human hepatocellular carcinoma by targeting STAT3. [score:4]
As expected, the conserved binding site of miR-124 within the 3′-UTR of IQGAP1 is responsible for miR-124 -induced repression of IQGAP1 3′-UTR reporter activity because the expression of miR-124 -binding site mutant reporter was not repressed by miRNA-124 overexpression as seen in our luciferase activity assays (Figure 4F). [score:4]
In this aspect, data from our recent predesigned/customized miR PCR array showed that miR-24 and miR-124 were 2 of the top upregulated miRs during VSMC differentiation into contractile phenotype in response to transforming growth factor-β treatment (Data not shown). [score:4]
Figure 5. hnRNPA1 (heterogeneous nuclear ribonucleoprotein A1) upregulates microRNA-124 (miR-124) through an miRNA biogenesis mechanism. [score:4]
hnRNPA1 increases IQGAP1 mRNA degradation through 2 mechanisms: increasing microRNA-124 biogenesis and direct binding to the AU-rich element within 3′ untranslated region of IQGAP1. [score:4]
Another novel finding in the current study that we have demonstrated for the first time is that hnRNPA1 upregulates miR-124 through an miRNA biogenesis mechanism. [score:4]
On the other hand, our data also show that hnRNPA1 also upregulates miR-124, which in turn promotes IQGAP1 gene repression through its own binding site (GTGCCTTA; Figure IIIA in the online-only Data Supplement) within 3′-UTR of IQGAP1 gene. [score:4]
Second, IQGAP1 gene and protein expression levels in VSMCs were negatively regulated by miR-124. [score:4]
Zhang J Lu Y Yue X Li H Luo X Wang Y Wang K Wan J MiR-124 suppresses growth of human colorectal cancer by inhibiting STAT3. [score:4]
Zhang C Hu Y Wan J He H MicroRNA-124 suppresses the migration and invasion of osteosarcoma cells via targeting ROR2 -mediated non-canonical Wnt signaling. [score:4]
Xu S Zhao N Hui L Song M Miao ZW Jiang XJ MicroRNA-124-3p inhibits the growth and metastasis of nasopharyngeal carcinoma cells by targeting STAT3. [score:4]
Figure 4. hnRNPA1 (heterogeneous nuclear ribonucleoprotein A1) increases IQGAP1 (IQ motif containing GTPase activating protein 1) mRNA degradation through upregulation of microRNA-124 (miR-124). [score:4]
hnRNPA1 Upregulates miR-124 Through an miRNA Biogenesis Mechanism. [score:4]
Data from RNA immunoprecipitation assays revealed that hnRNPA1, as well as the RNase III Drosha and its coactivator DGCR8 (DiGeorge syndrome critical region gene 8), directly bound to the 3′- but not the 5′-primary miR-124 transcript and that hnRNPA1 overexpression further increased such bindings (Figure 5D through 5F), suggesting that hnRNPA1 participates in miR-124 primary transcript processing into precursor. [score:3]
Data from fluorescent in situ hybridization and immunofluorescent staining show that miR-124 mainly expressed in VSMCs within human femoral arteries (Figure XIA in the online-only Data Supplement). [score:3]
C, Pearson correlation coefficient analyses of the gene expression levels of hnRNPA1 (heterogeneous nuclear ribonucleoprotein A1), microRNA-124 (miR-124), and IQGAP1 (IQ motif containing GTPase activating protein 1) in human femoral arterial specimens. [score:3]
Li L Luo J Wang B Wang D Xie X Yuan L Guo J Xi S Gao J Lin X Kong Y Xu X Tang H Xie X Liu M Microrna-124 targets flotillin-1 to regulate proliferation and migration in breast cancer. [score:3]
Our RNA immunoprecipitation data (Figure 5D through 5F) show that hnRNPA1, as well as DGCR8 and Drosha, specifically bind to 3′ end, but not the 5′ end, of the miR-124 primary transcript, and this binding process is significantly enhanced by hnRNPA1 overexpression. [score:3]
E and F, IQGAP1 is the target of miR-124, and the miR-124 binding site within IQGAP1 is required for miR-124–mediated IQGAP1 gene repression. [score:3]
Importantly, a significant inverse relationship between IQGAP1 and hnRNPA1 or miR-124, while a positive correlation between hnRNPA1 and miR-124, was observed in the diseased femoral arterial specimens, as well as neighboring healthy tissues (Figure 7C). [score:3]
miR-124 or miR-NC were cotransfected into VSMCs with wild-type IQGAP1 3′ untranslated region (3′-UTR) reporter (E) or the miR-124–binding site mutant (F), respectively. [score:3]
Northern blot analyses also showed that the abundance of the precursor and mature miR-124 was significantly increased by hnRNPA1 overexpression (Figure 5C). [score:3]
Figure 7. The expression profiles and relationships of hnRNPA1/miR-124/IQGAP1 axis in the human vessels. [score:3]
Indeed, direct infection of the injured vessels with Lenti-hnRNPA1 significantly increased the expression levels of hnRNPA1 (Figure 6A and 6B; Figure XA in the online-only Data Supplement) and miR-124 (Figure 6A) in the injured arteries compared with the control injured vessels. [score:3]
Accordingly, we speculated that hnRNPA1 inhibits IQGAP1 through activation of either miR-24 or miR-124 or both. [score:3]
In this regard, we have provided compelling evidence to support that IQGAP1 is the functional mRNA target of miR-124 in VSMCs. [score:3]
Moreover, several other genes have been identified as the target genes of miR-124 in VSMC context, such as nuclear factor of activated T cell signaling pathway components (nuclear factor of activated T cell c1, calmodulin -binding transcription activator-1, and polypyrimidine tract -binding protein 1), [49] S100 calcium -binding protein A4, [51] and Sp1. [score:3]
C and D, IQGAP1 was negatively regulated by miR-124. [score:2]
To determine whether miR-124 plays a causative role in IQGAP1 gene repression, as well as VSMC proliferation and migration regulated by hnRNPA1, a cotransfection experiment was conducted as indicated in Figure V in the online-only Data Supplement. [score:2]
Above data imply that hnRNPA1 regulates miR-124 not through a transcriptional mechanism, but via modulating the processing of miR-124 primary transcript to its precursor. [score:2]
To determine whether miR-124 can directly regulate IQGAP1, the 3′-UTR of IQGAP1 was cloned into a luciferase reporter using the primers shown in Table I in the online-only Data Supplement. [score:2]
Finally, we have also provided some preliminary but clear evidence to suggest a role of hnRNPA1/miR-124/IQGAP1 regulatory axis in human angiographic restenosis or atherosclerosis. [score:2]
The concept that hnRNPA1 plays an important role in miR-124 primary transcript processing is consistent with findings from other studies because hnRNPA1 has also been implicated in the regulation of let-7a biogenesis [23] and is required for processing of miR-18a. [score:2]
Fluorescent in situ hybridization assay and qRT-PCR analyses revealed that miR-124 is predominantly expressed in VSMCs (≈650 copies per cell; Figure IV in the online-only Data Supplement). [score:2]
VSMCs were transfected with miR-124 mimics (miR-124) or microRNA negative controls (miR-NC), respectively. [score:1]
Moreover, by closely scrutinizing the 3′-UTR sequence of IQGAP1, we have identified a conserved binding site for both miR-24 and miR-124 within the 3′-UTR of IQGAP1 (Figure IIIA in the online-only Data Supplement). [score:1]
Altogether, our data show that hnRNPA1 promotes the processing of primary miR-124 to precursor miR-124 through interaction with RNase III enzyme Drosha and its coactivator DGCR8 and recruiting them into miR-124 primary transcript. [score:1]
First, close scrutiny of the 3′-UTR sequence of IQGAP1 revealed a conserved binding site for miR-124 within the 3′-UTR of IQGAP1 (Figure IIIA in the online-only Data Supplement). [score:1]
C, Northern Blot analysis of miR-124 and pre-miR-124. [score:1]
[49] However, the mechanism through which miR-124 is modulated in the context of VSMC functions remains elusive. [score:1]
43– 47 Moreover, one study has indicated that miR-124 controls the proliferative, migratory, and inflammatory phenotype of pulmonary vascular fibroblasts. [score:1]
Taken together, above data provide evidence to support a notion that hnRNPA1 binds to the miR-124 primary transcript and recruits both Drosha and DGCR8 into the primary transcript, which works in concert to promote miR-124 processing from primary to precursor transcript. [score:1]
To further explore the functional role of hnRNPA1 in the regulation of miR-124, proximity ligation assays were conducted in VSMCs with a pair of antibodies (hnRNPA1/Drosha or hnRNPA1/DGCR8). [score:1]
[1 to 20 of 73 sentences]
10
[+] score: 324
miR-124 also directly targets and suppresses expression of small C-terminal domain phosphatase 1 (SCP1), an inhibitor of neuronal gene expression [44]. [score:12]
Our studies showed, for the first time to the best of the authors' knowledge, that miR-124 and miR-137: (1) are expressed at significantly lower levels in GBM tumors relative to non-neoplastic brain tissue; (2) are up-regulated during neuronal differentiation of adult mNSCs induced by growth factor withdrawal; (3) promote neuronal-like differentiation of growth-factor-deprived mNSCs, mOSCs and hGSCs; (4) promote G0/G1 cell cycle arrest in GBM cells and growth-factor-deprived hGSCs; (5) inhibit expression of CDK6 mRNA, CDK6 protein and phosphorylated RB in GBM cells. [score:10]
Finally, miR-124 overexpression in HCT-116 colon cancer cells inhibits the expression of CDK6, an established target of miR-124 (see [26]). [score:9]
It remains unclear why miR-124 and miR-137 were not detected previously in GBM tumors, particularly in light of our results that show dramatic expression decreases of miR-124 and miR-137 in GBMs (and AAs) relative to non-neoplastic brain tissue, and results that show clear down-regulation of miR-124 expression in human oligodendrogliomas [28], human astroblastomas [32] and GBM cell lines [32, 33]. [score:8]
CDK6 is an established target of miR-124 in HCT-116 colon cancer cells [26], a predicted target of miR-137 (TargetScan and PicTar), and has been functionally implicated in the development of multiple malignancies. [score:8]
We tested, therefore, whether expression of miR-124 and miR-137 could be activated in GBM cell lines following treatment with 5-aza-2'-deoxycytidine (5-aza-dC), a DNA methylation inhibitor and/or TSA, a histone deacetylase inhibitor. [score:7]
MiRNA-124 is down-regulated in human oligodendrogliomas [28], and both miR-124 and miR-137 are down-regulated over 10-fold in S100β-v- erbB tumor stem cells relative to mNSCs (Additional file 7). [score:7]
miR-124 and miR-137 are down-regulated in high-grade gliomas and up-regulated during adult NSC differentiation. [score:7]
Expression of miR-124 and miR-137, respectively, increased up to 8- and 24-fold, expression of miR-129 and miR-139, respectively, decreased up to 2- and 4-fold, and expression of miR-7 and miR-218 did not change appreciably. [score:7]
Overexpression of miR-124 or miR-137 also reduced the expression of phosphorylated RB (Figure 6B), a downstream target of CDK6 [30]. [score:7]
Figure 1 miR-124 and miR-137 are down-regulated in anaplastic astrocytomas and glioblastoma multiformes and are up-regulated in glioblastoma multiforme cell lines following treatment with DNA demethylating agents. [score:7]
Our studies revealed that miR-137, as well as miR-124, inhibited expression of CDK6, a predicted target of both miRNAs. [score:7]
As we observed that expression of miR-124 and miR-137 is reduced in HGAs and that miR-124 and miR-137 promote differentiation of non-neoplastic adult mNSCs, we tested next whether up-regulation of miR-124 and miR-137 could promote differentiation of brain tumor-derived stem cells. [score:6]
The second mechanism by which miR-124 and miR-137 expression may be suppressed in GBM stem cells is via epigenetic modification of their transcriptional regulatory sequences. [score:6]
Given that activation of EGF [37], PDGF [38] and FGF [39] signaling pathways have each been implicated in gliomagenesis, it is reasonable to speculate that one mechanism by which growth factor signaling promotes brain tumor formation is through suppression of miR-124 and/or miR-137 expression and NSC/TSC differentiation. [score:5]
It has also been shown that miR-124 expression is epigenetically suppressed in a number of tumor types including colorectal and breast cancers [26]. [score:5]
These results suggest that targeted delivery of miR-124 and/or miR-137 to GBM tumor cells may be therapeutically valuable for GBM disease treatment. [score:5]
Figure 6 CDK6 expression is inhibited by miR-124 and miR-137 in glioblastoma multiforme cells. [score:5]
These results suggest that targeted delivery of microRNA-124 and/or microRNA-137 to glioblastoma multiforme tumor cells may be therapeutically efficacious for the treatment of this disease. [score:5]
Previous studies have demonstrated that miR-124 is up-regulated during development of the rodent nervous system [41, 42], and during neuronal differentiation of mouse ES cells [12], and mouse and human embryonal carcinoma cells [25]. [score:5]
miR-124 and miR-137 inhibit CDK6 expression and phosphorylated retinoblastoma levels in GBM cells. [score:5]
For example, expression of miR-124 and miR-9 increases during differentiation of mouse ES cell-derived neural progenitors, and experimental manipulation of miR-124 and miR-9 expression affects neural lineage differentiation in the ES cell-derived cultures [12]. [score:5]
Our differentiation studies in mNSCs suggested that growth factor signaling, which is recurrently activated in HGAs, suppresses expression of miR-124 and miR-137. [score:5]
For example, in mouse neuroblastoma cell lines CAD and Neuro2a, ectopic up-regulation of miR-124 alone is sufficient to induce neuron-like differentiation, whereas in mouse embryonic carcinoma cells (P19), miR-124 enhances neuronal differentiation only in the presence of retinoic acid, an established inducer of P19 neuronal differentiation [13]. [score:4]
Therefore, miR-137, in addition to miR-124, is a direct inhibitor of CDK6. [score:4]
It is interesting to note that CDK6 is known to regulate both cell cycle progression and differentiation (reviewed in [29]), suggesting that mir-124- and miR-137 -mediated inhibition of CDK6 may, in part, account for the observed effects on GBM cell proliferation and differentiation in this study. [score:4]
Regulation of miR-124 and miR-137 expression. [score:4]
Up-regulation of miR-124 also induces neuronal differentiation of mouse neuroblastoma cell lines CAD and Neuro2a and the mouse embryonal tumor cell line P19 [13]. [score:4]
Of the 35 miRNAs, we identified six HGA-miRNAs, which were down-regulated in both AA and GBM tumors at a more stringent degree of significance (P < 0.01): miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218. [score:4]
In particular, prior work [28] has shown that miR-124 is only expressed in the neurons of adult human brains, which indicates that our observed decrease in miR-124 expression in HGAs is a likely consequence of there being relatively fewer neurons in tumor tissue compared with non-neoplastic glioses controls. [score:4]
Of particular interest to our studies, miR-124 is hyper-methylated in over one-third of colon, breast, lung, lymphoma and leukemia primary tumors, and is up-regulated in breast (MCF-7) and colon (HCT-116) cancer cell lines following DNA demethylation [26]. [score:4]
To ascertain the molecular mechanisms by which miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells, we assessed expression of CDK6, a regulator of the cell cycle and differentiation (reviewed in [29]), following transfection of these miRNAs to U251 cells. [score:4]
We identified six miRNAs of particular interest, miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218, which were down-regulated in both AAs and GBMs (Figure 1A, Additional file 8 and Table 1) at a more stringent level of significance (P ≤ 0.01). [score:4]
For example, miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, a global repressor of alternative pre-mRNA splicing in non-neuronal cells, resulting in the transition from non-neuronal- to neuronal-specific alternative splicing patterns [13]. [score:4]
To test whether up-regulation of miR-124 and miR-137 promote differentiation of adult mNSCs, we transfected proliferating mNSCs with double-stranded RNA oligonucleotides corresponding to the mature sequences of each miRNA. [score:4]
Overall, the most robust effects of miR-124 and miR-137 overexpression on cellular differentiation and proliferation were observed in growth factor-deprived human cells (Figures 4B and 5B). [score:3]
miR-124 and miR-137 inhibit proliferation of GBM cell lines. [score:3]
Our results reveal two potential mechanisms by which miR-124 and miR-137 may be suppressed in stem cells and/or tumor cells. [score:3]
Levels of phosphorylated retinoblastoma (RB) (pSer 807/811), a known target of CDK6 [30], were also reduced in response to miR-124 and miR-137 transfection (Figure 6B). [score:3]
Further analyses of miR-137 and miR-124 promoter sequence methylation in primary tumors, TSCs and NSCs are warranted to establish the degree to which epigenetic mechanisms contribute to suppression of these miRNAs in HGAs. [score:3]
The ability of miR-124 and miR-137 to induce potent antiproliferative and prodifferentiation effects in CD133+ and CD133- human GBM cells suggests their potential value for treatment of this disease. [score:3]
Since exit from the cell cycle is required for induction of differentiation, we tested whether miR-124 and miR-137 inhibit proliferation of GBM cells. [score:3]
Click here for file Validation of miR-124 expression and function in glioblastoma multiforme cells. [score:3]
Transfection of microRNA-124 or microRNA-137 also induced G1 cell cycle arrest in U251 and SF6969 glioblastoma multiforme cells, which was associated with decreased expression of cyclin -dependent kinase 6 and phosphorylated retinoblastoma (pSer 807/811) proteins. [score:3]
Validation of miR-124 expression and function in glioblastoma multiforme cells. [score:3]
Further analyses are required to determine the relative contributions of EGF-, FGF- and PDGF -induced signaling on suppression of miR-124 and miR-137 transcription in adult NSCs and GBM tumor stem cells. [score:3]
Our results show that miR-124 and miR-137 can induce neuronal differentiation of OSCs and GBM stem cells and inhibit proliferation of GBM cell lines. [score:3]
Our results indicate that overexpression of either miR-124 or miR-137 promotes neuron-like differentiation of non-neoplastic adult (mNSCs), mOSCs and CD133+ hGSCs. [score:3]
The first mechanism is growth factor signaling: removal of EGF, and FGF from the culture media resulted in robust increases in miR-124 and miR-137 expression in adult NSCs. [score:3]
Further, neuronal differentiation is enhanced following ectopic overexpression of miR-124 in mouse ES cells [12], mouse neuroblastoma cells [13], and mouse embryonal carcinoma cells [13]. [score:3]
Our studies revealed that expression levels of microRNA-124 and microRNA-137 were significantly decreased in anaplastic astrocytomas (World Health Organization grade III) and glioblastoma multiforme (World Health Organization grade IV) relative to non-neoplastic brain tissue (P < 0.01), and were increased 8- to 20-fold during differentiation of cultured mouse neural stem cells following growth factor withdrawal. [score:3]
Although we restricted further analyses of these six miRNAs to miR-124 and miR-137 because of their elevated expression during adult NSC differentiation (Figure 1B), assessments of the other HGA-miRNAs may lead to novel insights into the biology of high-grade gliomas. [score:3]
Transfection of microRNA-124 or microRNA-137 induced morphological changes and marker expressions consistent with neuronal differentiation in mouse neural stem cells, mouse oligodendroglioma-derived stem cells derived from S100β-v- erbB tumors and cluster of differentiation 133+ human glioblastoma multiforme-derived stem cells (SF6969). [score:3]
Consistent with our observations in mNSCs, we observed a significant increase in the numbers of cells that express the neuronal marker Tuj1 following transfection with miR-124, miR-137 or a combination of both miRNAs (Figure 4A). [score:3]
Thus, overexpression of miR-124 and miR-137 enhances neuronal-like differentiation of adult NSCs in vitro. [score:3]
Interestingly, we did not observe an increase in miR-124 expression in either cell line following 5-aza-dC treatment. [score:3]
While this does not change our conclusions that miR-124 and miR-137 can induce mNSC-, mOSC- and human GBM-derived stem cell (hGSC)-differentiation, it indicates that in situ expression analyses of miRNAs in HGAs, non-neoplastic adult brain tissue, and during fetal- and post-natal development of the mammalian central nervous system will be an important component of studies aimed at investigating the functions of miRNAs during normal brain development and tumorigenesis. [score:3]
miRIDIAN miRNA mimic negative control (cel-miR-67) and miRIDIAN miRNA mimics (mmu-miR-124, mmu-miR-137) were purchased from Dharmacon (Lafayette, CO) and validated using the pMIR-REPORT miRNA Expression Reporter Vector System (Ambion, Austin, TX). [score:3]
We observed that the majority of the HGA-miRNAs show expression changes during, or have been implicated in, differentiation of various cell lineages: miR-7 during photoreceptor differentiation [23]; miR-124 and miR-137 during erythropoiesis [24]; miR-124 and miR-218 during neuronal differentiation of embryonal carcinoma cell differentiation [25]; miR-124 during neuronal differentiation of ES cells [12]. [score:3]
Investigations of miR-124 expression and function during development of the embryonic chick spinal cord have determined that the proneural activity of miR-124 is, at best, subtle [43, 44], suggesting that additional factors- and/or signals are required for robust neurogenesis at this developmental stage. [score:3]
Figure 5 miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme stem cells and induce cell G0/G1 cycle arrest. [score:3]
Regulation of differentiation and the cell cycle by miR-124 and miR-137. [score:2]
Further investigations are needed to define the relationship between CDK6 down-regulation and cell cycle arrest and/or differentiation in GBM stem cells, and to identify and characterize additional miR-124 and miR-137 target genes. [score:2]
Recent studies have begun to shed light on the molecular mechanisms by which miR-124 regulates differentiation and proliferation. [score:2]
These data suggest that epigenetic modification of regulatory sequences in CpG islands may contribute to miR-124 and miR-137 silencing in GBMs. [score:2]
MiRNA-124 expression increased around 2-fold in U251 and U87 cells following combined treatment with 5-aza-dC (5 μM) and TSA (Figure 1B and Additional file 8). [score:2]
The ability of miR-124 to induce robust stem cell differentiation appears to be dependent on cell type, developmental timing and other, as yet unidentified, factors. [score:2]
A total of 100 nM miRIDIAN miRNA mimics (50 nM each for miR-124 and miR-137 co-transfections) were complexed with LipofectAMINE 2000 (Invitrogen) and added directly to cells growing in proliferating medium. [score:2]
Cells were transfected with miR-124 and/or miR-137 (100 nM) or a negative control oligonucleotide for 4 hours using lipofectamine. [score:1]
Our studies show that miR-124 and miR-137 enhance neurogenesis of mNSCs, mOSCs and hGSCs in the absence of growth factor signaling. [score:1]
Relative to control oligonucleotides, transfection of miR-124 or miR-137 resulted in a marked reduction in the number of cells in the S-phase of the cell cycle and a marked increase in the number of cells in G0/G1 in U251 GBM cells (Figure 5A) and early passage GBM cells derived from a newly diagnosed human GBM (Figure 5B). [score:1]
Further testing of miR-124 and miR-137 in pre-clinical mo dels of GBM [52, 53] in conjunction with various delivery strategies will help define their ultimate therapeutic potential for treatment of GBM. [score:1]
Our data suggest that miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells. [score:1]
Thus, our study is the first to implicate miR-124 in neuronal differentiation of post-natal NCSs and brain TSCs. [score:1]
However, cell cycle arrest was more pronounced in miR-124- and miR-137 -transfected GBM cells (SF6969) that were deprived of growth factors (Figure 5B). [score:1]
Collectively, our results suggest that while miR-124 and miR-137 have the capacity to induce alone cell cycle arrest and differentiation in human GBM cells and stem cells, abrogation of growth factor signaling enhances their capacity to do so. [score:1]
Figure 4 Induction of neuronal differentiation of tumor-derived neural stem cells by miR-124 and miR-137. [score:1]
Finally, transfection of miR-124, but not miR-137, resulted in a 2-fold decrease in the numbers of GFAP -positive cells (Figure 3A and 3C). [score:1]
Figure 3 miR-124 and miR-137 promote neuronal differentiation of subventricular zone-neural stem cells. [score:1]
We tested next whether miR-124 and miR-137 could promote differentiation of human GBM stem cells. [score:1]
We also observed that transfection of miR-124 and miR-137 reduced the numbers of GFAP -positive mOSCs (Figure 4A). [score:1]
For transfection of miR-124/137 into SVZ-NSCs, 50,000 cells were plated into eight-well culture slides (BD Falcon Biosciences) pretreated with 0.1 mg/ml poly-D-lysine (Sigma) and 10 μg/ml laminin (Invitrogen) 24 hours prior to transfection. [score:1]
microRNA-124 and microRNA-137 induce differentiation of adult mouse neural stem cells, mouse oligodendroglioma-derived stem cells and human glioblastoma multiforme-derived stem cells and induce glioblastoma multiforme cell cycle arrest. [score:1]
Transfection of either miR-124 or miR-137 resulted in a 5-fold increase in the numbers of cells stained with the neuronal marker Tuj1 relative to controls (Figure 3A, B and 3C). [score:1]
Both CD133+ and CD133- cells were transfected with miR-124 and/or miR-137 and then cultured for 10 days in NBE media without growth factors. [score:1]
Collectively, our results show that in the absence of growth factor signaling, miR-124 and miR-137 enhance neuron-like differentiation of oligodendroglial and GBM TSCs. [score:1]
In independent experiments we observed marked reductions of CDK6 transcript (Figure 6A) and CDK6 protein (Figure 6B) in response to miR-124 and miR-137 transfection. [score:1]
Transfection with either miR-124 or miR-137 resulted in rounded or trapezoidal cellular morphology of Tuj1 -positive cells with reduced neuritic outgrowth. [score:1]
Transfection of miR-124 and/or miR-137 dramatically increased the percentage of Tuj1 -positive cells, and reduced the percentage of GFAP -positive cells and in both CD133+ and CD133- GBM cell fractions (Figure 4B). [score:1]
Therapeutic potential of miR-124 and miR-137. [score:1]
miR-124 and miR-137 promote neuronal differentiation of adult NSCs. [score:1]
Levels of phosphorylated RB (pSer 807/811) are also markedly reduced in response to miR-124 or miR-137 transfection. [score:1]
Although we have not tested whether miR-124 and miR-137 alone can induce differentiation of the various stem cells tested in this study, transfection of miR-124 or miR-137 alone was sufficient to induce G1 cell cycle arrest in standard GBM cell lines (Figure 5A). [score:1]
Distinct morphological changes were also apparent for each miRNA; miR-124 induced neuritic branching of the cells whereas miR-137 induced a rounded or trapezoidal cellular appearance with no neuritic outgrowth (Figure 3A and 3B). [score:1]
These results suggest that miR-124 and miR-137 may be useful therapeutic agents for the treatment of GBMs. [score:1]
The inset shows a Tuj1+ cell with neuronal morphology from a miR-124 and/or miR-137 cotransfection. [score:1]
miR-124 and miR-137 promote neuronal differentiation of brain TSCs. [score:1]
was conducted by fluorescence-activated cell sorter at 48 hours after transfection of 100 nM (final total microRNA concentration) miR-124, miR-137, miR-124 and miR-137 together or negative control oligonucleotides (neg#1, neg#2) to U251 (A) and SF6969 (B) glioblastoma multiforme cells. [score:1]
We also identified a number of miRNAs, including miR-124 and miR-137, which have not been described in prior GBM profiling studies. [score:1]
[1 to 20 of 99 sentences]
11
[+] score: 308
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3
ROCK1 protein expression was also significantly downregulated in U87MG cells that were transfected with the miR-124 expression vector. [score:8]
Furthermore, we have identified that miR-124 regulated the ROCK1 gene, and ROCK1 protein expression caused actin cytoskeleton rearrangements, reduced cell surface ruffle, and suppressed glioma cell invasion. [score:6]
In the current study, we have observed that miR-124 was downregulated in malignant glioma and its expression was correlated negatively with the pathological grading of glioma. [score:6]
The expression level of miR-124 was downregulated significantly in high grade human glioma tissues (five grade III and three grade IV) than that in low grade human glioma tissues (three grade I and five grade II) determined using qRT-PCR. [score:6]
0069478.g001 Figure 1 The expression level of miR-124 was downregulated significantly in high grade human glioma tissues (five grade III and three grade IV) than that in low grade human glioma tissues (three grade I and five grade II) determined using qRT-PCR. [score:6]
In addition to the changes of stress fibres, the invasion behavior of glioma was inhibited by up-regulation of miR-124. [score:6]
Study by Fowler et al [33] has reported that transfection of commercialized miR-124 precursor in GBM cell line A172 resulted in diminished cell migration and invasion as well as downregulated three targeted genes: Ras GTPase activating protein 1 (IQGAP1), cytoskeletal proteins laminin c1 (LAMC1) and integrin β1 (ITGB1). [score:6]
Notably, a constitutively active ROCK1 in miR-124 over-expressed glioma cells reversed the effects of miR-124, suggesting the biological role of preventive invasion of miR-124 due mainly to the ROCK1 down-regulation. [score:6]
These data provided strong evidence that miR-124 suppressed ROCK1 gene expression by regulating 3′UTR at the post-transcription level. [score:6]
Our results revealed a novel mechanism that miR-124 inhibits glioma cells migration and invasion via ROCK1 downregulation. [score:6]
Based on the inhibitory effects of miR-124 on ROCK1 protein expression and glioma cell locomotion, we reasoned that miR-124 may have an impact on cell invasive capacity. [score:5]
Further in vitro experiments have showed that miR-124 reduced migration and invasion, affected actin cytoskeleton rearrangements and reduced cell surface protrusion by suppressing the expression of ROCK1 protein. [score:5]
miR-124 has been documented as a tumor suppressor since low expression of miR-124 was observed in several types of human cancers [27]– [35]. [score:5]
The qRT-PCR results (Figure 1) showed that the expression level of miR-124 was significantly lower in high grade gliomas than that in low grade gliomas, demonstrating a negatively correlation of the endogenous miR-124 expression with the WHO grade (Spearman r = -0.5423, p<0.01). [score:5]
In this study, we have demonstrated that the endogenous expression of miR-124 was negatively correlated with the tumor pathological grading of clinical glioma samples, and bioioformatic analyses have identified the target gene of miR-124. [score:5]
Quantitative real-time PCR (qRT-PCR) was performed to determine the expression of miR-124 with respect to the internal standard RNU6-2. Considering the fact that the our clinical samples were obtained from elderly patients and the research reports that anaplastic astrocytoma (WHO grade III) shares the similar biomolecular expression pattern and poor outcome of glioblastomas in the elderly patients [36], [37], we divided clinical samples into two groups: low grade gliomas (grade I∼II, n = 8) and high grade gliomas (grade III–IV, n = 8). [score:5]
Using TargetScan (Release 4.2) and miRanda (August 2010 Release) online searching programs, we have identified cell motility-related gene (ROCK1) as the potential target of miR-124. [score:5]
In this study, our results show that exogenous expression of miR-124 in U87MG cells substantially suppressed the formation of the stress fibres and cell protrusions. [score:5]
Quantitative real-time PCR (qRT-PCR) was performed to determine the expression of miR-124 with respect to the internal standard RNU6-2. Considering the fact that the our clinical samples were obtained from elderly patients and the research reports that anaplastic astrocytoma (WHO grade III) shares the similar biomolecular expression pattern and poor outcome of glioblastomas in the elderly patients [36], [37], we divided clinical samples into two groups: low grade gliomas (grade I∼II, n = 8) and high grade gliomas (grade III–IV, n = 8). [score:5]
To confirm the hypothesis that miR-124 targets the 3′UTR region of ROCK1, we cloned the vector that the entire 3′UTR region of ROCK1 was connected at the downstream of a modified luciferase reporter gene (named as pGL3M-ROCK1-3′UTR), and co -transfected the HEK293ET cells with this vector along with either the miR-124 expression vector or its negative control. [score:5]
miR-124 Overexpression Suppresses the Glioma Cell Invasion by Affecting the Actin Cytoskeleton Rearrangements and Reducing Cell Surface Ruffles. [score:5]
A dual-luciferase reporter assay was used to confirm that miR-124 targeted directly the 3′UTR of ROCK1 gene and repressed the ROCK1 expression in U87MG human glioma cell line. [score:5]
The Overexpressed miR-124 Inhibits the Cell Motility. [score:5]
A variety of targets have been found to be regulated by miR-124, including proliferation-related genes [27]– [30], invasion/metastasis-related genes [33]– [35] and so on. [score:4]
miR-124 is Significantly Downregulated in Human Glioma Tissues. [score:4]
These results suggest that the anti-invasion effects of miR-124 are in part facilitated by ROCK1 downregulation. [score:4]
They identified SNAI2, a member of the Snail family of zinc finger transcription factors - because it has been implicated in epithelial-mesenchymal transition (EMT) [48], [49] and tumor metastasis, as a direct functional target of miR-124. [score:4]
We performed a 3′UTR luciferase assay and observed that luciferase activity was decreased after co-transfection of the miR-124 expression vector and a 3′UTR vector containing the ROCK1/miR-124 target sequence. [score:4]
These observations suggested that miR-124 retard the glioma cell migration and invasion by inhibiting the formation of the stress fibres via ROCK1 regulation. [score:4]
The enhanced miR-124 expression significantly inhibited glioma cell invasion using matrigel invasion assay and tumor xenografts in nude mice. [score:4]
We have found that miR-124 is dramatically downregulated in clinical specimen of glioma and is negatively correlated with the tumor pathological grading in the current study. [score:4]
Xia et al [39] have reported the down-regulation of miR-124 in a larger patient clinical specimen, which included human glioma tissue samples (n = 27) and non-glioma patients samples (n = 20, two non-tumor brain tissues). [score:4]
All these data clearly indicate that ROCK1 is a direct target of miR-124. [score:4]
These results demonstrated unambiguously that miR-124 targeted specifically the 3′UTR region of ROCK1. [score:3]
However, the median survival was not significantly different between the high and low miR-124 expression of GBM patients, which might be due to the extraordinary high malignancy of GBM. [score:3]
Moreover, a constitutively active ROCK1 in miR-124 over-expressed glioma cells reversed the effects of miR-124. [score:3]
The target gene information of miR-124 was analyzed using miRanda (http://microrna. [score:3]
All these results proved a success and effectiveness of miR-124 expression vector construction and transfection. [score:3]
In this study, we identified that low expression of miR-124 was closely associated with a more aggressive tumor phenotype. [score:3]
The target of miR-124 in bold fonts was confirmed in this study. [score:3]
To determine the expression level of miR-124 in clinical tissue specimens, we collected sixteen primary glioma tissue samples and extracted their total RNA. [score:3]
Using a bioinformatics analysis approach, rho -associated coiled-coil containing protein kinase 1 (ROCK1), a well-known cell mobility-related gene, has been identified as the target of miR-124. [score:3]
To extend these findings to glioma tissues, we also measured ROCK1 mRNA expression by qRT-PCR in the same clinical samples for miR-124 expression. [score:3]
The cells transfected by miR-124 expression vector have demonstrated retarded cell mobility. [score:3]
Using bioinformatics and experimental methods, we assessed ROCK1 as potential functional targets of miR-124. [score:3]
The human pre-miR-124 sequence was amplified and cloned into pcDNA3.1-hisA constructs (Invitrogen) to generate pcDNA3.1-miR-124 expression vector. [score:3]
These data exhibits a good consistence with previous studies [38], [39]and indicates a putative tumor suppressor role for miR-124 in glioma. [score:3]
ROCK1 is target of miR-124. [score:3]
Images of the stained cells demonstrated that ectopic overexpression of miR-124 significantly reduced the invasiveness of U87MG cells (lower left image, Figure 4A); the number of invasive cells able to digest the extracellular matrix and migrate through pores in the membrane was reduced by over 50%. [score:3]
Reintroduction of ROCK1 rescues the miR-124 -induced invasion inhibition. [score:3]
Forty-eight hours later, the expression levels of miR-124 in all cell lines were examined using qRT-PCR. [score:3]
Moreover, we transfected U87MG cells with either control or pcDNA3.1-miR-124, and determined the endogenous expression of ROCK1 at both protein and mRNA levels, respectively. [score:3]
All these results were similar to our in vitro observations in miR-124 overexpressioned cells, indicating a potential role of ROCK1 in glioma cell invasion. [score:3]
Reintroduction of miR-124 through an expression vector dramatically repressed glioma cell migration and invasion in vitro. [score:3]
0069478.g005 Figure 5(A) Stress fiber staining in U87MG glioma cells treated with miR-124 expression vector along with p160 [ROCK]Δ3 or control pCAG-myc (Scale bars: 20 µm). [score:3]
A constitutively active ROCK1 in miR-124 over-expressed glioma cells reversed the effects of miR-124. [score:3]
In addition, homology analyses have shown that the nucleotide sequences of 3′UTR of the ROCK1 gene targeted by miR-124 seed sequence were highly conserved among different species (Figure 3C). [score:3]
As a next step, we used the on line websites to identify target genes of miR-124, interestingly, all of which are closely related to tumor migration and invasion. [score:3]
In this study, we focused on miR-124, a putative tumor suppressor in several human cancers. [score:3]
As expected, ectopic expression of ROCK1 (without 3′UTR) significantly abrogated the miR-124 -mediated anti-invasion by affecting the actin cytoskeleton rearrangements and reducing cell surface ruffles. [score:3]
HEK293ET cells were co -transfected using lipofectamine 2000 reagent with 100ng of firefly luciferase construct and 300ng of control-pcDNA3.1 or pcDNA3.1-miR-124 expression vector. [score:3]
In contrast, higher miR-124 expression led to remarkable morphological changes in that cells became a round-like and shrunken form, and there was an obvious reduction of long and thin protrusions on the surface of cells transfected with pcDNA3.1-miR-124 (lower left image, Figure 4C). [score:3]
0069478.g006 Figure 6 The target of miR-124 in bold fonts was confirmed in this study. [score:3]
ROCK1 Partially Rescues the miR-124 -induced Invasion Inhibition. [score:3]
L2K+pcDNA3.1-miR-124 was used as the miR-124 expression vector. [score:3]
Moreover, a constitutively active ROCK1 in miR-124 over-expressed glioma cells rescued the effects of miR-124. [score:3]
To decipher the biological function of miR-124 in glioma cells, we constructed a miR-124 expression vector (named as pcDNA3.1-miR-124) and transiently transfected into HEK293ET and human glioma cells U87MG and U251, respectively, to create a gain-of-function behavior in cell lines. [score:3]
After observing the altered cell mobility by miR-124, we started to search the potential genes involved in regulating the cell motility. [score:2]
It could be due to either the serum depletion during the longer experimental duration or some unclassified functions of miR-124 in regulating other proliferation-related genes. [score:2]
We found that co-transfection of miR-124 expression vector along with the full-length 3′UTR of ROCK1 caused a significant decrease by over 50% in luciferase units compared to controls (Figure 3D). [score:2]
microRNA-124 (miR-124) is abundantly expressed in normal brain tissue [25], necessary for embryonic neuronal differentiation which has been wi dely investigated in physiological neural development [26] and is highly conserved across species. [score:2]
Furthermore, the impact of miR-124 -mediated cell morphology alternation in U87MG cells was restored compared to control pCAG-myc -treated cells, as observed after miR-124 suppression under scanning electron microscope (Figure 5B). [score:2]
qPCR assays of miR-124 expression levels in glioma tissue samples. [score:2]
These results furnished additional experimental evidence that miR-124 plays an important role in regulating cellular events related to cancer invasion. [score:2]
As shown in Figure 2A, the expression of miR-124 was enhanced significantly (by a factor of hundreds) in HEK293ET cells transfected with pcDNA3.1-miR-124 vector when compared with cells transfected with pcDNA3.1. [score:2]
Figure S1 Wound-healing assay of U251 glioma cells transfected with either control or the miR-124 expression vector, respectively. [score:2]
Proposed mo del of miR-124 function in glioma development and progression. [score:2]
These results suggest that miR-124 may function as anti-migration and anti-invasion influence in glioma and provides a potential approach for developing miR-124 -based therapeutic strategies for malignant glioma therapy. [score:1]
Furthermore, the level of endogenous miR-124 is negatively correlated with the tumor pathological grading, indicating an association with the progression of glioma. [score:1]
However, biological impacts of miR-124 on glioma cell migration and invasion have seldom been published. [score:1]
The expression level of ROCK1 and miR-124 was calculated by using 2 [−ΔΔCt] analysis method [68], normalized to the control group. [score:1]
Based on our observations and results reported by other groups, we have proposed a mo del to elucidate the potential roles of miR-124 in glioma (Figure 6). [score:1]
These results indicated the anti-migration effect of miR-124 in glioma cells. [score:1]
0069478.g002 Figure 2 (A) The expression level of miR-124 was measured using qRT-PCR after miR-124 transfected HEK293ET and U87MG cells for 48 h. Data presented are mean values of three independent experimental results and compared with the level of miR-124 obtained in mock control (Lipofectamine2000 blank) that is normalized to 1. (B) Wound-healing assay of U87MG glioma cells transfected with either control or the miR-124 expression vector, respectively. [score:1]
These findings suggest that miR-124 plays a critical role in the invasive potential of glioma. [score:1]
Identification of biological function of miR-124 in U87MG cells. [score:1]
The changes in the F-actin localization in glioma cells treated with miR-124 in this study showed a good agreement (Figure 4B). [score:1]
However, the actin cytoskeletons of cells were completely different in the pcDNA3.1-miR-124 treated U87MG cells that they showed a decrease in the length and number of actin fibers in cells (lower left image, Figure 4B); do not have the same extent like the control groups. [score:1]
We performed functional analysis to examine the function of miR-124. [score:1]
The experimental data and conclusions in the present study furnish valuable information regarding the biological functions of miR-124 and the possible mechanism of the migration and invasion of glioma tumor. [score:1]
0069478.g003 Figure 3 (A) Illustration of the predicted miR-124 -binding sequences in the 3′UTR region of ROCK1. [score:1]
Spearman’s rank correlation test was used for association analysis between miR-124 and ROCK1 level data and pathological grading. [score:1]
miR-124 Interacts Specifically with the 3′UTR Region of ROCK1. [score:1]
Images in Figure 2B and 2C clearly showed that the cells transfected with vector pcDNA3.1-miR-124 have a retarded mobility in comparison with other two controls, and similar results were also observed in U251 cells (Figure S1). [score:1]
In the case of pGL3M, the luciferase activities of cells transfected with either pcDNA3.1 or pcDNA3.1-miR-124 showed a slightly difference (by <16%). [score:1]
Our findings uncovered an important role of miR-124 in glioma morphology, motility and invasion via ROCK1 for the first time. [score:1]
[1 to 20 of 96 sentences]
12
[+] score: 307
Overexpression of miR-124 significantly suppressed the luciferase reporter which contained Sp1 3′UTR and this suppression was interestingly abolished by the mutation of the miR-124 binding site in Sp1 3′UTR, and overexpression of miR-124 led to a significant reduction in Sp1 mRNA and protein levels, but the effect was reduced by miR-124 inhibitor. [score:12]
MiR-124 inhibits HCC metastasis in vivoSince miR-124 overexpression resulted in downregulation of integrin αV subunit expression, then animal experiments were performed to evaluate the influence of miR-124 overexpression on HCC metastasis in vivo. [score:10]
High level of miR-124 expression in HCC directly resulted in low expression of Sp1, which subsequently suppressed integrin αV subunit gene expression. [score:10]
Since miR-124 overexpression resulted in downregulation of integrin αV subunit expression, then animal experiments were performed to evaluate the influence of miR-124 overexpression on HCC metastasis in vivo. [score:8]
These suggested that ectopic expression of miR-124 contributed to the down-regulation of integrin αV subunit gene expression. [score:8]
Moreover, down-regulation of Sp1 by miR-124 subsequently inhibited integrin αV subunit expression since integrin αV subunit gene transcription relied on Sp1 as the major transcription factor in human hepatocellular carcinoma cells as demonstrated in our previous study 19. [score:8]
After transfection of anti-miR-124 inhibitor in SMMC-7721 and BEL-7404 cells, the expression of miR-124 was inhibited, and the expression levels of Sp1 and integrin αV subunit were simultaneously increased by 1.4 and 1.1 folds in SMMC-7721 cells, and 4 and 1.6 folds in BEL-7404 cells compared to negative control group (Fig. 4D). [score:8]
Sp1 is an important transcription factor for integrin αV subunit gene 19, and the down-regulation of Sp1 by miR-124 might lead to the down-regulation of integrin αV subunit gene transcription. [score:7]
Our data further indicated that high level of miR-124 expression inhibited the wound healing, migration and invasion in HCC and suppressed integrin αV which is the malignant driver for anchorage independence. [score:7]
A strong correlation was noted between miR-124 and integrin αV subunit expression levels with the correlation coefficient −0.605 (P < 0.01) (Fig. 2B), indicating that miR-124 was associated with the down regulation of integrin αV subunit expression. [score:6]
In our data, we identified Sp1 mRNA as the direct target of miR-124, and integrin αV gene as subsequent target in HCC. [score:6]
How to cite this article: Cai, Q. Q. et al. MiR-124 inhibits the migration and invasion of human hepatocellular carcinoma cells by suppressing integrin αV expression. [score:6]
These results indicated that miR-124 functioned as a negative regulator or tumor suppressor for the cell growth and migration in HCC, which might be related to its repressing integrin αV subunit expression. [score:6]
In order to confirm miR-124 regulation of integrin αV expression, we investigated and observed the mRNA and protein expression levels of Sp1 and integrin αV subunit in SMMC-7721 and BEL-7404 cells with over -expression of miR-124. [score:6]
In this study we observed that miR-124 alone down-regulated the expression of Sp1 efficiently. [score:6]
The analysis results indicated that there were 53 transcription factors that either matched miR-124 target or were expressed in HCC. [score:5]
The targets of miR-124 were analyzed using four online algorithms including miRanda, TargetScan, PicTar and microRNA. [score:5]
The results of RT-PCR and Western-blotting showed that in the cells with over -expression of miR-124, the expression levels of Sp1 and integrin αV subunit reduced significantly in both SMMC-7721 and BEL-7404 cells (Fig. 4B and C). [score:5]
Having found that miR-124 inhibited wound healing and migration which were related to down -regulating integrin αV subunit, we next investigated the possible regulation of integrin αV subunit expressions by miR-124. [score:5]
Through further analysis we noted that the expression levels of miR-124 in 11 HCC cell lines and other cancer cells was strikingly inversely correlated with the expression of integrin αV which is the driver molecule for the anchorage independence and migration of tumor cells 14. [score:5]
The predicated mRNA target for mature miR-124 was analyzed using four online algorithms including miRanda, TargetScan, PicTar and microRNA. [score:5]
Herein, we confirmed Sp1 as a direct target of miR-124, which played an important role in regulating integrin αV gene transcription. [score:5]
Through analysis using online algorithm TargetScan, we found that among 53 transcription factors screened Sp1 was not only predicted to match miR-124 target but also was the major transcription factor required for integrin αV gene promoter activation in HCC. [score:5]
The miR-124 expressional construct was transfected into human hepatocellular carcinoma cells of either SMMC-7721 or BEL-7404 cells, to achieve over -expression of miR-124. [score:5]
Our current results further showed that overexpression of miR-124 reduced the expression levels of Sp1 and integrin αV subunit significantly. [score:5]
In current study, we noted that the expression level of integrin αV significantly decreased in the cells overexpressing miR-124, but increased when the hepatoma cells were treated with miR-124 antagomir. [score:5]
Through the luciferase reporter assay and binding site mutation, the results showed that miR-124 directly targeted Sp1 mRNA. [score:4]
These results indicated that miR-124 directly targeted Sp1 mRNA via the putative binding sites in the 3′UTR. [score:4]
MiR-124 inhibits integrin αV expression. [score:4]
We further investigated the possible regulation of integrin αV subunit expression by miR-124 and noted that miR-124 has two conserved binding sites on the 3′ untranslated region of transcription factor Sp1 mRNA. [score:4]
These reports shows that the expression of miR-124 was reduced in carcinomas, which may result from multiple regulatory events, such as the methylation of CpG islands. [score:4]
MiR-124 inhibits integrin αV subunit expression. [score:4]
Our data is consistent with these reports that miR-124 was down-regulated in HCC. [score:4]
MiR-124 is abundantly expressed in the brain tissues, but the roles of miR-124 were also noted in gastric cancer 4 and nasopharyngeal carcinoma 6. In this study, we demonstrated that miR-124 was involved in the regulation of migration and metastasis of human hepatocellular carcinoma cells (SMMC-7721 and BEL-7404). [score:4]
This implied that miR-124 regulation of hepatocellular carcinoma cell migration might be related with the expression of integrin αV that is important in HCC cell migration and metastasis. [score:4]
Therefore, our findings identified a novel pathway for miR-124 regulation of HCC metastasis, and miR-124 could possibly be an alternative strategy for controlling integrin αV expression in liver cancer and a viable anticancer therapeutic approach for HCC metastasis. [score:4]
Four online algorithms were used to predicate miR-124 targets (b). [score:3]
Correlation analysis between miR-124 and ITGAV expressions. [score:3]
The red rectangle indicates miR-124, the yellow diamond indicates ITGAV gene, and the blue circles indicate the miR-124 -targeted TF mRNAs. [score:3]
SMMC-7721 or BEL-7404 cell, transfected with miR-124 construct or with miR-124 inhibitor oligonucleotide for 48 h, were harvested and lysed in lysis buffer (1%SDS containing 50 mM NaF, 1.5 mM Na [3]VO [4], 0.5 mM PMSF). [score:3]
These suggested that miR-124 suppressed cell migration in HCC. [score:3]
Since cell migration is usually controlled by integrins, we then analyzed the relationship between miR-124 and integrin αV expression. [score:3]
The group transfected with miR-124 rather than control vector significantly suppressed the luciferase activity of reporter genes containing 3′UTR of Sp1 in both cells. [score:3]
All the transcription factors screened were the predicted targets of miR-124 and all of them were important in HCC. [score:3]
In order to confirm that miR-124 directly targets Sp1 3′UTR, we performed luciferase reporter assay. [score:3]
Further in Hep3B, HepG2 and SK-Hep-1 cells which expressed high levels of integrin αV, the inhibitory effect on the cell migration by miR-124 was investigated (Fig. 2C). [score:3]
The miR-124 inhibitor and their scramble control oligonucleotides were synthesized and provided by Gene Pharma Co. [score:3]
Ectopic overexpression of miR-124 significantly reduced the metastasis foci in either liver or lung tissues in nude mice experiments. [score:3]
We employed the SMMC-7721 cells stably expressing miR-124 and green fluorescence protein (GFP) as the cell mo del for in vivo metastasis studies. [score:3]
We interestingly observed that the expression level of integrin αV subunit was often low when miR-124 level was high. [score:3]
This implied negative association of miR-124 with integrin αV expression levels. [score:3]
After lentivirus infection and selection, SMMC-7721 cells that stably expressed miR-124 (SMMC-7721 [MiR-124]) and control cells (SMMC-7721 [Mock]) (5 × 10 [6]) were injected into 6-week-old female nude mice through the tail veins (6 mice/group) for the assessment of in vivo metastasis. [score:3]
To confirm the role of miR-124 in migration further, both SMMC-7721 and BEL-7404 cells were transfected with specific miR-124 inhibitor. [score:3]
The low level of miR-124 expression may be a candidate biomarker for further prospective molecular stratification of cancer patients possibly for prognosis prediction. [score:3]
These results indicated that miR-124 was capable of suppressing HCC metastasis in vivo. [score:3]
Interestingly, all of these cases showed decreased miR-124 expression except 3 cases. [score:3]
MiR-124 suppresses the wound healing and migration capability of HCC. [score:2]
It was noted in our study that miR-124 played an important negative role in regulation of migration and metastasis of HCC cells. [score:2]
The protein levels of expression of Sp1 and integrin αV also reduced in miR-124 group by 85% and 74% in SMMC-7721, and 77% and 58% in BEL-7404 cells compared to control group. [score:2]
MiR-124 may act together with miR-137 and miR-128 synergistically to regulate neural cells 25. [score:2]
MiR-124 inhibits HCC metastasis in vivo. [score:2]
MiR-124 directly regulates the transcription factor Sp1. [score:2]
In vivo metastasis assaysAfter lentivirus infection and selection, SMMC-7721 cells that stably expressed miR-124 (SMMC-7721 [MiR-124]) and control cells (SMMC-7721 [Mock]) (5 × 10 [6]) were injected into 6-week-old female nude mice through the tail veins (6 mice/group) for the assessment of in vivo metastasis. [score:2]
MiR-124 suppresses the wound healing and migration of HCC. [score:2]
Systemic delivery of miR-124 may perturb the hepatocyte growth and prevent hepatocellular carcinogenesis 34. [score:1]
The miR-124 and integrin αV expression levels were measured in 11 different non-tumor and tumor cell lines with qPCR (Fig. 2A). [score:1]
In 58 cases both integrin αV and miR-124 expression were measured in the same sample. [score:1]
Moreover, the migrated cells through the polyporous membrane were significantly fewer in miR-124 group than control cells (Fig. 1B). [score:1]
The plasmid pLL 3.7-pre-miR-124 which carries green fluorescence protein (GFP) was constructed as described in our previous study 2. Plasmids pLL-3.7-pre-miR-124 and psiCHECK-2 containing Sp1 3′UTR, mutated sequence or psiCHECK-2 control vector were co -transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) at the ratio of 1:3 in weight. [score:1]
SMMC-7721 and BEL-7404 cells were infected with miR-124 or control lentivirus which is an efficient, stable gene delivery tool in mammalian cells to induce stable gain- and loss-of-function phenotypes for individual miRNAs 20 or shRNAs 21. [score:1]
Human hepatocellular carcinoma SMMC-7721, Hep3B, HepG2, SK-Hep-1and non-tumor hepatocyte LO2 cells were transfected with miR-124 or control plasmids and 48 h after transfection, the cells were transferred into the upper chamber of the Millicell inserts with 8-μm pore size polyporous membrane (Millipore, Billerica, MA, USA) in a serum-free DMEM with a cell density of 5 × 10 [6]/mL. [score:1]
Sp1 3′UTR sequence possesses two conserved binding motifs for miR-124, which are well conserved from worm to human being (Fig. 3C). [score:1]
The relative closure in miR-124 group was significantly slower than control (Fig. 1A). [score:1]
In functional studies, reintroduction of miR-124 dramatically repressed the migration and invasion of HCC in vitro and tumor metastasis in vivo. [score:1]
72 hours after wound healing in SMMC-7721 cells, the scratched wound in miR-124 group was not closed as fast as the control group. [score:1]
Expression of miR-124 was measured by RT-PCR (middle) and quantitative RT-PCR (right). [score:1]
HEK-293T and HeLa cells were co -transfected with these reporter constructs and miR-124 or control vectors. [score:1]
Strikingly, the group of mice receiving miR-124 transfection showed significantly fewer metastases colonies in the liver and lung by 79% and 77% respectively. [score:1]
SMMC-7721 and BEL-7404 cells were infected with lentivirus containing miR-124 (SMMC-7721 [miR-124], BEL-7404 [miR-124]) or control virus (SMMC-7721 [control], BEL-7404 [control]). [score:1]
The successful infection of miR-124 lentivirus was observed with fluorescence microscope (Fig. 4A) and the over -expression of miR-124 was validated in the miR-124 group by RT-PCR measurement (Fig. 4A middle & right). [score:1]
Four weeks after the injection by tail vein of nude mice, the metastasis foci were examined at the liver and lung of both miR-124 and control groups. [score:1]
MiR-124 regulates the transcription factor Sp1. [score:1]
The invasion capability of SMMC-7721 cells transfected with miR-124 through Matrigel in miR-124 group was lower than control (data not shown). [score:1]
MiR-124 is encoded in three genomic loci [miR-124a-1 (8p23.1), miR-124a-2 (8q12.3), and miR-124a-3 (20q13.33)], but these three miR-124a loci give rise to only one mature miRNA, miR-124 (Fig. 3A top). [score:1]
Parallel with the anatomy results, H&E staining of lungs also showed that the number and size of micro-metastases foci were significantly more and larger in control group than those in miR-124 group (p < 0.001, Fig. 5B). [score:1]
These findings suggest that miR-124 plays an important role in the metastatic and/or invasive potential of HCC, which could be a potential therapeutic approach for HCC. [score:1]
[1 to 20 of 86 sentences]
13
[+] score: 290
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3, hsa-mir-152, hsa-mir-506
Our research demonstrated that miR-124 and miR-506 directly down-regulate DNMT3B and indirectly down-regulate DNMT1 by targeting SP1; that is,. [score:11]
Furthermore, the overexpression of miR-124 or miR-506 markedly inhibited the ability of SW620 cells to migrate (Figure 2B), and the overexpression of either miR-124 or miR-506 remarkably attenuated cell invasion in SW620 cells (Figure 2C, five fields were counted in the Matrigel-coated cell invasion experiments). [score:7]
Overexpression of miR-124 or miR-506 inhibits tumor cell proliferation and invasion in vivoThe above results prompted us to verify that miR-124 or miR-506 inhibit CRC tumor cell proliferation and invasion in vivo. [score:7]
To understand the mechanism by which miR-124 and miR-506 suppress CRC growth and invasion, we used two algorithms (Targetscan and Miranda) to help identify miR-124 and miR-506 targets in CRC. [score:7]
Overexpression of miR-124 or miR-506 inhibits tumor cell progression and increases sensitivity to chemotherapy in vitroThe ectopic expression of miR-124 or miR-506 has been reported to be associated with the progression in many tumors [18– 24]. [score:7]
The above results may preliminarily indicate that DNMT3B is a direct target and that DNMT1 is an indirect target of miR-124 and miR-506. [score:7]
We hypothesized that miR-124 and miR-506 may directly target DNMT3B and may indirectly target DNMT1. [score:7]
miR-124 and miR-506 directly target DNMT3B and indirectly target DNMT1. [score:7]
Specifically, miR-124 expression is reportedly downregulated in the cells and tissues of esophageal cancer [44] breast cancer [45] and renal cell carcinoma [46]. [score:6]
MiR-124 and miR-506 expression levels are frequently downregulated in human CRC. [score:6]
Overexpression of miR-124 and miR-506 reduces global DNA methylation and restores the expression of E-cadherin, MGMT and P16. [score:5]
Figure 3Overexpression of miR-124 or miR-506 inhibits tumor cell proliferation and invasion in vivo A. SW620 cells infected with miR-124, miR-506 or scramble control were subcutaneously injected into the flanks of nude mice (n = 5 for each group). [score:5]
Overexpression of miR-124 or miR-50b inhibits tumor cell progression and increases sensitivity to chemotherapeutics in vitro. [score:5]
For example, miR-124 has been shown to inhibit cell proliferation and suppress tumor growth in breast cancer [50], and miR-506 has been shown to tumor proliferation and invasion in nasopharyngeal carcinoma [47]. [score:5]
Figure 6 Diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC. [score:5]
Diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC. [score:5]
Figure 2Overexpression of miR-124 or miR-50b inhibits tumor cell progression and increases sensitivity to chemotherapeutics in vitro A. SW620 (left) and SW480 (right) cells were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:5]
Therefore, restoring miR-124 and miR-506 expression in CRC inhibits tumor progression in vitro and in vivo. [score:5]
Moreover, we found that miR-124 and miR-506 targeted DNMT3B and DNMT1 (SP1 is a transactivator of the DNMT1 gene), which markedly reduced the expression of DNMT3B, DNMT1 and SP1 at both the RNA and protein levels. [score:5]
D. Representative images of lung metastasis of the miR-124 -overexpressing, miR-506 -overexpressing and scrambled control groups. [score:5]
Representative images of lung metastases for the miR-124 -overexpressing, miR-506 -overexpressing and control groups are shown in Figure 3D. [score:5]
Overexpression of miR-124 or miR-506 inhibits tumor cell proliferation and invasion in vivo. [score:5]
Furthermore, the overexpression of miR-124 or miR-506 results in global DNA hypomethylation and gene re -expression of the hypermethylated and silenced E-cadherin, MGMT and P16 genes in CRC. [score:5]
A diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC is shown in Figure 6. Figure 5 A. SW480 (left) and SW680 (right) cell were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:5]
Specifically, the overexpression of miR-124 and miR-506 inhibits colorectal tumor cell proliferation, migration, and invasion while also increasing drug sensitivity in vitro. [score:5]
A diagram of the mechanism by which miR-124 and miR-506 inhibit progression by targeting DNMT3B and DNMT1 in CRC is shown in Figure 6. Figure 5 A. SW480 (left) and SW680 (right) cell were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:5]
Overexpression of miR-124 or miR-506 inhibits tumor cell progression and increases sensitivity to chemotherapy in vitro. [score:5]
miR-124 and miR-506 are downregulated in colorectal cancer. [score:4]
The down-regulation of DNMT3B and DNMT1 by miR-124 and miR-506 has important functional ramifications. [score:4]
In this study, we found that miR-124 and miR-506 were strongly down-regulated in CRC tissues and cell lines. [score:4]
These data indicate an overt downregulation of miR-124 and miR-506 in CRC. [score:4]
To assess whether overexpression of miR-124 or miR-506 leads to the re -expression of hypermethylated and silenced genes in CRC, we measured the mRNA and protein levels of E-cadherin, MGMT and P16 in SW480 and SW420 cells by qRT-PCR and western blotting after transfection with miR-124, miR-506 or scrambled control. [score:3]
To assess the biological effects of overexpressing miR-124 or miR-506 in CRC cells, miR-124 or miR-506 mimic was transfected into SW620 and SW480 cells. [score:3]
The in vitro data demonstrated that miR-124 and miR-506 function as tumor suppressors in CRC. [score:3]
We found that the overexpression of miR-124 or miR-506 increased the sensitivity of CRC cells to these two agents (Figure 2D). [score:3]
A. Expression levels of miR-124 (top) and miR-506 (bottom) in 40 CRC patients were detected by qRT-PCR. [score:3]
Our study showed that miR-124 and miR-506 efficiently modulate DNA hypomethylation by targeting DNMT3B and DNMT1. [score:3]
C. The effect of miR-124 and miR-506 on the protein expression of DNMT3B, SP1 and DNMT1 by western blot. [score:3]
miR-124 has also been reported to target SP1, which is associated with DNA methylation [35]. [score:3]
C. Representative images of miR-124 and miR-506 expression by ISH. [score:3]
Our data showed that miR-124 and miR-506 target DNMTs (DNMT3B and DNMT1), thus leading to global DNA hypomethylation in CRC. [score:3]
C. The effect of the miR-124 or miR-506 mimics on the protein expression of E-cadherin, MGMT and P16, determined by western blotting in SW480 and SW680 cells. [score:3]
The effects of miR-124 and miR-506 inhibitors on tumor cell proliferation were also tested. [score:3]
Figure 1 A. Expression levels of miR-124 (top) and miR-506 (bottom) in 40 CRC patients were detected by qRT-PCR. [score:3]
The above results prompted us to verify that miR-124 or miR-506 inhibit CRC tumor cell proliferation and invasion in vivo. [score:3]
The results showed that the expression levels of miR-124 and miR-506 were significantly lower in SW620 and SW480 cells than in NCM460 normal colonic epithelium cells (Figure 1B). [score:3]
Furthermore, we studied the biological effects of the overexpression of miR-124 and miR-506 in CRC. [score:3]
Functional studies identified miR-124 and miR-506 acted as new tumor suppressors in CRC. [score:3]
These results suggested that the abnormal expression of miR-124 and miR-506 are associated with CRC. [score:3]
The above results suggest that miR-124 or miR-506 inhibit CRC tumor cell proliferation and invasion in vivo. [score:3]
The ectopic expression of miR-124 or miR-506 dramatically decreased the number of lung metastases in mice (Figure 3C). [score:3]
To generate the miR-124 and miR-506 expression vectors, a genomic fragment covering the region encoding pri-miR-124 or pri-miR-506 and its up-and downstream region were PCR-amplified and cloned into the pLvthm vector (Addgene Inc, USA). [score:3]
The ectopic expression of miR-124 or miR-506 has been reported to be associated with the progression in many tumors [18– 24]. [score:3]
The mean volume and weight of tumors were significantly lower in the miR-124- and miR-506 -overexpressing groups than in the control group (Figure 3A, 3B). [score:3]
The Mann–Whitney U-test and Spearman's correlation analyses were used to analyze the relationship between miR-124 and miR-506 expression and the clinicopathological features of CRC. [score:3]
The expression levels of miR-124 and miR-506 were detected by qRT-PCR in 40 pairs of CRC tissues and their matched adjacent tissues, as well as in CRC cell lines. [score:3]
B. Relative expression of miR-124 (left) and miR-506 (right) in 8 cell lines derived from CRC and a cell line derived from normal colonic epithelium was determined by qRT-PCR. [score:3]
We found that miR-124 and miR-506 inhibitors decreased the sensitivity of CRC cells to these two agents (Supplementary Figure S1 and S2). [score:3]
In conclusion, miR-124 and miR-506 may be valuable markers of CRC prognosis and may play an important role in the development and progression of human CRC. [score:2]
SW620 cells were used to stably over-express miR-124 and miR-506 using a lentiviral -based system (pLVTHM) for tumourigenesis assays. [score:2]
miR-124 and miR-506 have also been reported to function as important regulators in many human cancers [18– 20]. [score:2]
Compared with the scrambled control transfection, the overexpression of either miR-124 or miR-506 significantly attenuated the proliferation of the two cell lines (Figure 2A). [score:2]
SW620 cells infected with miR-124, miR-506 or scrambled control were subcutaneously injected into the flanks of nude mice (five in each group). [score:1]
Cells transfected with miR-124 mimic, miR-506 mimic and scrambled oligonucleotides (Ambion, USA) were plated in 12-well plates at the desired cell concentrations. [score:1]
B. SW480 (left) and SW680 (right) cells were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:1]
The intensities of miR-124 and miR-506 staining were scored on a scale from 0 to 4 as follows: 0–1 (no staining), 1–2 (weak staining), 2–3 (medium staining), and 3–4 (strong staining). [score:1]
The miR-124 and miR-506 expression levels in eight CRC cell lines were measured by qRT-PCR. [score:1]
However, transfecting miR-124 and miR-506 into SW620 cells also generated a marked decrease in DNMT1 protein levels (Figure 4C). [score:1]
In contrast to DNMT3B and SP1, miR-124 and miR-506 are not predicted to hybridize with the DNMT1 3′UTR region. [score:1]
Forty-eight hours after transfection with miR-124 mimic, miR-506 mimic or scrambled control, SW620 cells were exposed to a range of CDDP or 5-FU concentrations for 24 h, and the cell viability was determined and recorded. [score:1]
Several reports have indicated that either miR-124 or miR-506 plays a significant role in growth, metastasis and proliferation [18– 20]. [score:1]
However, miR-124 and miR-506 have rarely been studied in the context of CRC. [score:1]
Among samples from 40 patients with CRC, approximately 82.5% (P = 0.000, 33 of 40 patients) and 75% (p = 0.000, 30 of 40 patients) of tumor tissues revealed notable reductions in the miR-124 and miR-506 levels, respectively (Figure 1A). [score:1]
Therefore, we over-expressed miR-124 and miR-506 in SW620 and SW480 cells to evaluate the possible role of miR-124 and miR-506 in CRC pathogenesis. [score:1]
The transfections of miR-506 and miR-124 were successful (Supplement Figure S1). [score:1]
A. SW480 (left) and SW680 (right) cell were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:1]
Two concentrations of miR-124 mimic and miR-506 mimic (10 and 50 nM) were tested. [score:1]
miR-124 mimic, miR-506 mimic and scrambled oligonucleotides were purchased from Genecopoeia (China) and transfected into CRC cells using Lipofectamine 2000 reagent (Invitrogen, USA) according to the manufacturer's instructions. [score:1]
A. SW620 (left) and SW480 (right) cells were transfected with miR-124 mimic, miR-506 mimic or scrambled control. [score:1]
Briefly, miR-124 and miR-506 miRCURY LNA custom detection probes (Exiqon, Denmark) were used for ISH. [score:1]
Moreover, mutating the putative miR-124 and miR-506 sites in the 3′-UTR of DNMT3B and SP1 abrogated the luciferase responsiveness to miR-124 and miR-506 (Figure 4B). [score:1]
To further verify the biological roles of miR-124 and miR-506 in human CRC, we performed in situ hybridization (Figure 1C) to evaluate the miR-124 and miR-506 levels in 40 CRC tissues and 40 normal colon tissues and found that miR-124 and miR-506 were strongly downregulated in CRC tissues compared with normal tissues. [score:1]
Figure 4 A. The 3′UTRs of DNMT3B and SP1 contain putative binding sites for miR-124 and miR-506. [score:1]
A. SW620 cells infected with miR-124, miR-506 or scramble control were subcutaneously injected into the flanks of nude mice (n = 5 for each group). [score:1]
In this study, we showed that the miR-124 and miR-506 levels were significantly lower in CRC tissues than in normal tissues, as indicated by qRT-PCR and in situ hybridization histochemistry (ISH). [score:1]
The DNMT3B, SP1 and DNMT1 complementary sites were cloned downstream of the firefly luciferase gene and cotransfected with miR-124 mimic, miR-506 mimic or scrambled oligonucleotide. [score:1]
We also found that transfecting the miR-124 and miR-506 mimics into SW620 cells markedly decreased the protein levels of DNMT3B and SP1 (Figure 4C). [score:1]
The percentages of miR-124 and miR-506 cells in 3 representative high-power fields of individual samples were analyzed. [score:1]
A. The 3′UTRs of DNMT3B and SP1 contain putative binding sites for miR-124 and miR-506. [score:1]
Among samples from 40 patients with CRC, approximately 65% (P = 0.000, 26 of 40 patients) and 70% (P = 0.000, 28 of 40 patients) of tumors revealed notable reductions in the miR-124 and miR-506 levels, respectively. [score:1]
[1 to 20 of 90 sentences]
14
[+] score: 287
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3
This comparison highlighted 1 gene containing an hsa-miR-124 target site, namely IGFBP7, that showed 3.7 fold protein downregulation in HeLa_miR124 cells and a significant (false discovery rate (FDR) = 0.036) mRNA upregulation in cervical SCCs displaying hsa-miR-124 methylation. [score:9]
One of the previously identified targets mediating the tumour suppressive function of hsa-miR-124 is CDK6, via CDK6 mediated phosphorylation and subsequent inactivation of the tumour suppressor pRb [29, 32]. [score:7]
These results indicate that IGFBP7 may be a potential target of hsa-miR-124 in part of the cervical cancers, but other targets may be relevant for the tumour suppressive function of hsa-miR-124 in cervical cancer as well. [score:7]
In addition, effects of (ectopic) hsa-miR-124 expression on cellular proliferation, migration and mRNA expression of IGFBP7, a potential target gene, were studied. [score:7]
IGFBP7 is a potential target of hsa-miR-124 in a subset of cervical cancersTo identify potential hsa-miR-124 target genes in cervical cancer we used data from a recent study by Baek et al, in which the impact of hsa-miR-124 expression in HeLa cells on mRNA and protein output was determined [17]. [score:7]
As a control, SLC25A36, a gene without any hsa-miR-124 target sites, was included in this analysis and showed similar expression levels in cells with and without ectopic hsa-miR-124 expression (Figure 4B). [score:7]
In HPV-immortalised keratinocytes increased methylation levels were related to reduced hsa-miR-124 expression and higher mRNA expression of IGFBP7, a potential hsa-miR-124 target gene. [score:7]
In conclusion, these results suggest that ectopic expression of hsa-miR-124 in cervical cancer cells has tumour suppressive effects. [score:5]
Ectopic expression of hsa-miR-124 decreased the proliferation rate of both SiHa and CaSki cells and also inhibited the migratory capacity of SiHa cells. [score:5]
Tumour suppressive activities of hsa-miR-124 in cervical cancer cell linesThe fact that methylation of hsa-miR-124 is consistently found in cervical cancer cell lines and appears to be associated with gene silencing, suggests that hsa-miR-124 may possess tumour suppressive traits in cervical cancer. [score:5]
A. Whereas parental cell lines and empty vector control cells (SiHa_ctrl and CaSki_ctrl) showed no detectable expression of hsa-miR-124, cells transduced with hsa-miR-124 (SiHa_miR-124 and CaSki_miR-124) expressed hsa-miR-124. [score:5]
Expression of SLC25A36 (white bars), a gene without an hsa-miR-124 target site, was also determined as a control. [score:5]
Louis, MO, USA) dissolved in PBS to analyse the effect of global methylation inhibition on hsa-miR-124 expression. [score:5]
Consistent with our findings, both Agirre et al and Furuta et al observed inhibitory effects on cellular growth upon reintroduction of hsa-miR-124 expression in acute lymphoblastic leukaemia (ALL)-derived cells and hepatocellular carcinoma cell lines [26, 32]. [score:5]
Expression of SLC25A36 was similar in cells with and without ectopic hsa-miR-124 expression. [score:5]
To identify potential hsa-miR-124 target genes in cervical cancer we used data from a recent study by Baek et al, in which the impact of hsa-miR-124 expression in HeLa cells on mRNA and protein output was determined [17]. [score:5]
B. Effects of ectopic hsa-miR-124 expression on mRNA expression of IGFBP7 (grey bars) in SiHa and CaSki cells. [score:5]
E. Whereas in untreated and mock (PBS) treated SiHa cells no hsa-miR-124 expression was detectable, SiHa cells treated with 5000 nM DAC showed clear hsa-miR-124 expression. [score:5]
Interestingly, late passages of FK16B and FK18B cells, which were shown to have increased levels of hsa-miR-124-1 and hsa-miR-124-2 methylation and decreased levels of hsa-miR-124 expression (Figure 2), showed increased levels of IGFBP7 expression compared to their corresponding early passages (Figure 4A). [score:4]
The fact that methylation of hsa-miR-124 and concomitant reduced hsa-miR-124 expression was found in late passages of HPV-immortalised keratinocytes but not in early passages, indicates that this event takes place post-immortalisation and is not directly related to the presence of hrHPV. [score:4]
In addition, IGFBP7 showed decreased mRNA expression in CaSki cells ectopically expressing hsa-miR-124 compared to empty vector control cells and parental cells. [score:4]
Therefore we compared their proteomics data on HeLa cells ectopically expressing hsa-miR-124 to our own dataset of genome-wide mRNA expression in cervical SCCs, all of which showed hsa-miR-124 methylation by qMSP analysis (data not shown) [36]. [score:4]
Together, these results further support a (direct) correlation between methylation and expression of hsa-miR-124. [score:4]
In CaSki cells ectopic hsa-miR-124 expression resulted in reduction of IGFBP7 expression of more than 50% compared to the empty vector control cells and parental cells, however, no effect was observed in SiHa_miR-124 cells. [score:4]
A. Expression levels of IGFBP7, a potential target gene of hsa-miR-124, were increased in late passages of FK16B and FK18B cells, also showing increased methylation of hsa-miR-124, compared to their corresponding early passages. [score:4]
To determine whether hsa-miR-124 methylation also resulted in silencing of hsa-miR-124 expression in cervical lesions, we measured the expression of hsa-miR-124 in a panel of frozen specimens of normal cervical squamous epithelium (n = 5), CIN2/3 (n = 7), cervical SCCs (n = 9) and AdCAs (n = 5). [score:3]
Methylation levels of hsa-miR-124-1 and hsa-miR-124-2 were significantly negatively correlated with hsa-miR-124 expression levels (R = -0.451, p = 0.04 and R = -0.631, p = 0.002, respectively), whereas for hsa-miR-124-3 no significant correlation was found (R = -0.360, p = 0.109). [score:3]
Linear (Pearson) correlation was determined between hsa-miR-124 methylation levels and hsa-miR-124 expression. [score:3]
Ectopic hsa-miR-124 expression in SiHa and CaSki cells decreased proliferation rates and migratory capacity. [score:3]
hsa-miR-124 methylation and silencing is frequent in cervical (pre)malignant lesionsSince methylation of hsa-miR-124 becomes detectable in late passages of HPV-immortalised keratinocytes mimicking premalignant cervical disease [33], these regions may provide markers for the detection of cervical cancer and its high-grade precursor lesions. [score:3]
Hsa-miR-124 expression values were normalised to the reference again by using the comparative Ct method as described above. [score:3]
Figure 6 Correlation between hsa-miR-124 methylation and expression in cervical tissue specimens. [score:3]
In addition, we determined the correlation between hsa-miR-124 expression and methylation levels for the 3 regions in CIN2/3 lesions and carcinomas (Figure 6). [score:3]
Treatment of SiHa cells with a demethylating agent reduced hsa-miR-124 methylation levels and induced hsa-miR-124 expression. [score:3]
Figure 4 IGFBP7 and SLC25A36 expression in HPV-immortalised cells and cervical cancer cells transduced with hsa-miR-124. [score:3]
Since methylation of hsa-miR-124 becomes detectable in late passages of HPV-immortalised keratinocytes mimicking premalignant cervical disease [33], these regions may provide markers for the detection of cervical cancer and its high-grade precursor lesions. [score:3]
The overall correlation between A. hsa-miR-124-1, B. hsa-miR-124-2 and C. hsa-miR-124-3 methylation levels and hsa-miR-124 expression in CIN2/3 lesions, SCCs and AdCAs is shown. [score:3]
The fact that methylation of hsa-miR-124 is consistently found in cervical cancer cell lines and appears to be associated with gene silencing, suggests that hsa-miR-124 may possess tumour suppressive traits in cervical cancer. [score:3]
Ectopic expression of hsa-miR-124 was confirmed by qRT-PCR (Figure 3A). [score:3]
Figure 3Ectopic expression of hsa-miR-124 in SiHa and CaSki cells. [score:3]
Using the same analysis method as described above, we found methylation of hsa-miR-124-1 and/or hsa-miR-124-2 in 4.5% (1/22) of the women without disease versus 71.4% (15/21) of women with CIN3. [score:3]
IGFBP7 is a potential target of hsa-miR-124 in a subset of cervical cancers. [score:3]
Increased methylation levels of hsa-miR-124-1 and hsa-miR-124-2 were significantly correlated with reduced hsa-miR-124 expression in cervical tissue specimens. [score:3]
These results indicate that IGFBP7 may be a target of hsa-miR-124 in part of the cervical carcinomas. [score:3]
Increased methylation levels of hsa-miR-124-1 and hsa-miR-124-2 in cervical tissue specimens were significantly correlated with lower hsa-miR-124 expression levels. [score:3]
Figure 2 Hsa-miR-124 methylation and expression in early and late passages of HPV16 (FK16A/FK16B) and 18 (FK18A/FK18B) immortalised keratinocytes. [score:3]
The small nucleolar RNA transcript RNU43 was included as internal reference for hsa-miR-124 expression (001095; Applied Biosystems). [score:3]
Quantitative RT-PCR was performed for IGFBP7 in early and late passages of FK16B and FK18B cells as well as SiHa and CaSki cells with and without ectopic hsa-miR-124 expression, to determine the effects of hsa-miR-124 on the mRNA level of IGFBP7. [score:3]
Tumour suppressive activities of hsa-miR-124 in cervical cancer cell lines. [score:3]
For hsa-miR-124 expression analysis, frozen specimens of normal cervix, CIN2/3 lesions, SCCs, and AdCAs were first enriched for epithelial cells by means of laser capture microdissection using a Leica ASLMD microscope (Leica, Hei delberg, Germany) as described before [36]. [score:3]
Retroviral hsa-miR-124 or empty vector (ctrl) constructs previously described by Voorhoeve et al [41] were transfected into the Phoenix A retrovirus producer cell line and supernatants containing the replication -deficient hsa-miR-124 -expressing retrovirus or empty vector retrovirus were harvested 48 hours post-transfection. [score:3]
However, in cervical cancer the virally encoded oncoprotein E7 is thought to bind and inactivate pRb, suggesting hsa-miR-124 may (partly) function via other targets in this type of cancer. [score:3]
Intron-flanking primers for IGFBP7, a potential target gene of hsa-miR-124, were selected using Primer Express 3.0 (Applied Biosystems) (Table 1). [score:3]
Treatment of the cervical cancer cell line SiHa with the demethylating agent DAC resulted in > 50% decrease of methylation levels at all 3 regions and increased expression of hsa-miR-124 compared to untreated and mock -treated SiHa cells (PBS) (Figure 1D and 1E). [score:2]
In D. results of wound-healing assays in SiHa_miR-124, SiHa_ctrl and SiHa cells are shown, indicating decreased migratory capacity in cells expressing hsa-miR-124. [score:2]
To be considered as a candidate disease marker that potentially could be of value for the detection of high-grade CIN and carcinoma in cervical screening, methylation of hsa-miR-124 should be detectable in cervical scrapes containing few abnormal cells in a background of normal cells. [score:2]
The difference in hsa-miR-124 expression between normal cervical epithelium and CIN2/3 lesions and carcinomas was compared using the Wilcoxon rank test. [score:2]
Similarly, in late passage FK18B cells, showing methylation levels for hsa-miR-124-2 comparable to SiHa cells, lower hsa-miR-124 expression was found compared to its earlier passage. [score:2]
C. Late passages of FK16B and FK18B cells showed reduced expression of hsa-miR-124 compared to their corresponding earlier passages. [score:2]
Hsa-miR-124 methylation in cervical scrapes is predictive of underlying lesionsTo be considered as a candidate disease marker that potentially could be of value for the detection of high-grade CIN and carcinoma in cervical screening, methylation of hsa-miR-124 should be detectable in cervical scrapes containing few abnormal cells in a background of normal cells. [score:2]
Methylation -mediated silencing of hsa-miR-124 appears to occur during HPV -induced carcinogenesis at the post-immortalisation stage and is not directly related to the presence of hrHPV. [score:2]
The average expression of hsa-miR-124 in CIN2/3 lesions and cervical carcinomas compared to normal cervical epithelium was 4.4 fold decreased (p = 0.001). [score:2]
Proliferation rates between hsa-miR-124 -expressing cells and control cells were compared using the Student's t test. [score:2]
IGFBP7 mRNA levels were increased in late passages of FK16B and FK18B cells compared to their corresponding early passages, which also showed increased levels of hsa-miR-124-1 and hsa-miR-124-2 methylation and decreased levels of hsa-miR-124 expression. [score:2]
The somewhat reduced effect observed in CaSki_miR-124 cells compared to SiHa_miR-124 cells is likely correlated to the levels of hsa-miR-124 overexpression (Figure 3A). [score:2]
Ectopic hsa-miR-124 expression resulted in decreased proliferation rates of B. SiHa_miR-124 (red) and C. CaSki_miR-124 (red) compared to parental (black) and empty vector control cells (grey). [score:2]
The high positivity rates in CIN3 lesions and carcinomas as well as in scrapes with underlying CIN3 lesions combined with the fact that hsa-miR-124 methylation is not directly related to the presence of hrHPV, indicate that hsa-miR-124 methylation may provide a valuable marker for the triage of hrHPV -positive women. [score:2]
DNA methylation of hsa-miR-124 was first shown by Lujambio et al in colon, breast and lung cancer, as well as in leukaemia and lymphoma [29]. [score:1]
Figure 1 Hsa-miR-124 methylation in primary keratinocytes (EK cells) and cervical cancer cell lines SiHa, CaSki and HeLa. [score:1]
In addition, high percentages of methylation positivity for hsa-miR-124-1 and hsa-miR-124-2 were found in AdCAs as well (93.3% and 80% respectively). [score:1]
The DNA methylation status of the CpG-island containing promoter regions associated with the three genomic loci encoding hsa-miR-124 (hsa-miR-124-1, hsa-miR-124-2 and hsa-miR-124-3) was determined by qMSP analysis on sodium bisulfite -treated genomic DNA from cell lines, tissue specimens and scrapings. [score:1]
Methylation of hsa-miR-124 was found in cervical cancer cell lines SiHa, CaSki and HeLa as well as in late passages of HPV16/18 immortalised keratinocytes, reminiscent of high grade cervical precursor lesions, but not in normal primary keratinocytes. [score:1]
Amplicons (hsa-miR-124-1: -191 to -97; hsa-miR-124-2: -301 to -163; hsa-miR-124-3: -106 to -11 relative to the transcription start site, respectively) were detected and quantified using TaqMan probes (Table 1). [score:1]
Importantly, hsa-miR-124 methylation in cervical cancer was histotype-independent and could already be detected in CIN3 lesions and scrapes of women with underlying CIN3, underlining its potential value for cervical cancer screening. [score:1]
To test this hypothesis, we stably transduced SiHa and CaSki cells with a retroviral hsa-miR-124-containing vector (SiHa_miR-124 and CaSki_miR-124, respectively) and an empty vector (SiHa_ctrl and CaSki_ctrl, respectively). [score:1]
DNA methylation -based silencing of hsa-miR-124 is functionally involved in cervical carcinogenesis and may provide a valuable marker for improved detection of cervical cancer and its high-grade precursor lesions. [score:1]
Dotplots showing the levels of methylation for A. hsa-miR-124-1, B. hsa-miR-124-2 and C. hsa-miR-124-3 in normal cervical specimens, CIN1 lesions, CIN3 lesions, SCCs and AdCAs. [score:1]
Hsa-miR-124 methylation in cervical scrapes is predictive of underlying lesions. [score:1]
Quantitative MSP analysis of all 3 loci encoding the mature hsa-miR-124 (hsa-miR-124-1/-2/-3) showed methylation in cervical cancer cell lines SiHa, CaSki and HeLa as well as in late passages of human papillomavirus (HPV) type 16 or 18 immortalised keratinocytes. [score:1]
Methylation of hsa-miR-124 during hrHPV -mediated transformation in vitroTo determine whether hsa-miR-124 may be silenced due to promoter hypermethylation in cervical cancer, we assessed DNA methylation at the 3 promoter regions of hsa-miR-124 (hsa-miR-124-1 located at 8p23.1; hsa-miR-124-2 located at 8q12.3; and hsa-miR-124-3 located at 20q13.33) in cervical cancer cell lines using qMSP analysis. [score:1]
Combined hsa-miR-124-1 and/or hsa-miR-124-2 methylation analysis of 43 cervical scrapes of high-risk HPV positive women was predictive of underlying high-grade lesions. [score:1]
A. hsa-miR-124-1, B. hsa-miR-124-2. Both hsa-miR124-1 and hsa-miR-124-2 showed little to no methylation in early passages and increasing levels of methylation in later passages of HPV16 and HPV18 immortalised cells. [score:1]
The mature hsa-miR-124 sequence is processed from 3 separate premature sequences, located at chromosomes 8p23.1 (miR-124-1), 8q12.3 (miR-124-2) and 20q13.33 (miR-124-3), all of which contain CpG islands in their promoter regions. [score:1]
Figure 5 Hsa-miR-124 methylation levels in cervical specimens. [score:1]
A well-known epigenetically silenced miRNA in human carcinogenesis is hsa-miR-124. [score:1]
A. hsa-miR-124-1 methylation, B. hsa-miR-124-2 methylation, C. hsa-miR-124-3 methylation. [score:1]
The increase in hsa-miR-124-1 methylation in late passage FK16B cells, though being quite low compared to SiHa and CaSki cells, was associated with reduced hsa-miR-124 expression compared to its corresponding earlier passage (Figure 2C). [score:1]
Hsa-miR-124 was originally described as a brain-specific miRNA, involved in neuronal differentiation. [score:1]
Using qMSP analysis, we found methylation of hsa-miR-124-1 and/or hsa-miR-124-2 in none of the normal tissues, 58.5% of CIN3 lesions, 93.1% of SCCs and 93.3% of AdCAs. [score:1]
Whereas in primary keratinocytes no methylation was detectable, all cervical cancer cell lines were positive for methylation of hsa-miR-124-1, hsa-miR-124-2 and hsa-miR-124-3. D. In SiHa cells treated with 5000 nM DAC, methylation levels of hsa-miR-124-1 (black), hsa-miR-124-2 (white) and hsa-miR-124-3 (grey) were reduced by more than 50%. [score:1]
To determine whether hsa-miR-124 may be silenced due to promoter hypermethylation in cervical cancer, we assessed DNA methylation at the 3 promoter regions of hsa-miR-124 (hsa-miR-124-1 located at 8p23.1; hsa-miR-124-2 located at 8q12.3; and hsa-miR-124-3 located at 20q13.33) in cervical cancer cell lines using qMSP analysis. [score:1]
Subsequent studies confirmed frequent hsa-miR-124 methylation in leukaemia affecting clinical outcome and additionally showed frequent hsa-miR-124 methylation in gastric cancer and hepatocellular carcinoma [25, 26, 30, 32]. [score:1]
In this study we showed that epigenetic silencing of hsa-miR-124 is functionally involved in cervical carcinogenesis and may provide a valuable marker for risk stratification of hrHPV -positive women. [score:1]
hsa-miR-124 methylation and silencing is frequent in cervical (pre)malignant lesions. [score:1]
Combined hsa-miR-124-1 and/or hsa-miR-124-2 methylation analysis of 139 cervical tissue specimens showed an increasing methylation frequency from 0% in normal tissues up to 93% in cervical carcinomas. [score:1]
Further functional studies are needed to investigate whether the tumour suppressive function of hsa-miR-124 in cervical cancer may in part be mediated via IGFBP7. [score:1]
In acute lymphoblastic leukaemia (ALL) methylation of hsa-miR-124 was shown to negatively affect clinical outcome [30, 32]. [score:1]
Whereas early passages (range: p23-p43) of all 4 cell lines showed little to no methylation, increased methylation of hsa-miR-124-1 and hsa-miR-124-2 was observed in late passages (range: p70-p96) (Figure 2A and 2B). [score:1]
For hsa-miR-124-1 and hsa-miR-124-2, respectively, the percentages of methylation positivity increased from 27.8% and 5.6% in CIN1, to 46.3% and 19.5% in CIN3, to 86.2% and 82.8% in SCCs. [score:1]
This study shows that methylation of hsa-miR-124 is a frequent and functionally relevant event in cervical carcinogenesis. [score:1]
Methylation of hsa-miR-124 during hrHPV -mediated transformation in vitro. [score:1]
Future studies in large population -based cohorts will determine whether testing for hsa-miR-124 methylation either or not in combination with other promising methylation markers such as CADM1 and MAL [13, 14] can improve future cervical screening strategies based on primary hrHPV testing. [score:1]
Overall, the methylation positivity rates for hsa-miR-124 found in our study rank among the highest currently reported, although the use of different assays and methods, including non-quantitative MSP and combined bisulfite restriction analysis, makes a direct comparison difficult. [score:1]
Since DNA methylation -based silencing of hsa-miR-124 occurs in various human cancers, we studied the frequency and functional effects of hsa-miR-124 methylation in cervical carcinogenesis. [score:1]
Methylation of all 3 promoter regions of hsa-miR-124 was observed in SiHa cells as well as in another cervical cancer cell line, CaSki. [score:1]
Collectively, these results show that methylation analysis of hsa-miR-124-1 and hsa-miR-124-2 provides an attractive candidate marker for the triage of hrHPV -positive women. [score:1]
Lujambio et al were the first to show methylation -mediated silencing of hsa-miR-124 in different human cancer types, reaching the highest frequency in colorectal cancer (75%) [29]. [score:1]
For hsa-miR-124-2, late passages of FK18A and FK18B cells showed increased methylation, of which the methylation level in late passage FK18B cells was comparable to that observed in SiHa cells (Figure 1B). [score:1]
[1 to 20 of 108 sentences]
15
[+] score: 281
f of B4GALT1 expression in K562 and KU812 cells after they were transduced with miR-124-3p expression mimic or miR-124-3p inhibitor for 48 h. β-Actin was served as an internal control (n = 3) To confirm that miR-124-3p targets the 3‘UTR region of B4GALT1 in CML cells, HEK293 cells were co-transduced with miR-124-3p expression or control vector along with either the full-length 3‘UTR of B4GALT1(Luci-B4GALT1) or mutated Luci-B4GALT1 reporter vectors bearing deletions of the 3‘UTR target regions (△Luci-B4GALT1) (Fig.   7b). [score:13]
f of B4GALT1 expression in K562 and KU812 cells after they were transduced with miR-124-3p expression mimic or miR-124-3p inhibitor for 48 h. β-Actin was served as an internal control (n = 3)To confirm that miR-124-3p targets the 3‘UTR region of B4GALT1 in CML cells, HEK293 cells were co-transduced with miR-124-3p expression or control vector along with either the full-length 3‘UTR of B4GALT1(Luci-B4GALT1) or mutated Luci-B4GALT1 reporter vectors bearing deletions of the 3‘UTR target regions (△Luci-B4GALT1) (Fig.   7b). [score:13]
The results showed that SOCS3 over -expression enhanced the expression of miR-124-3p, and that SOCS3 knock-down inhibited the expression of miR-124-3p in both cell lines (Fig.   5 a, b). [score:10]
Over -expression of SOCS3 in K562 cells inhibited the expression of leukemia-specific genes and promoted the expression of some miRNAs, among which miR-124-3p was the highest. [score:9]
Moreover, we over-expressed or inhibited the expression of miR-124-3p in K562 and KU812 cells and determined the endogenous expression of B4GALT1 at both the protein and mRNA level. [score:9]
In addition, we found that B4GALT1 protein expression was significantly down-regulated by miR-124-3p over -expression in CML cells. [score:8]
These data indicated that B4GALT1 was the target gene of miR-124-3p in CML cells, and miR-124-3p suppressed B4GALT1 gene expression at the post-transcriptional level. [score:7]
In addition, imatinib treatment resulted in a significant increase of miR-124-3p in CML cell lines, while up-regulation of miR-124-3p induced by imatinib was inhibited by SOCS3 knock-down in K562 and KU812 cells (Fig.   5c). [score:7]
b of B4GALT1 expression in K562 cells stably expressing SOCS3 after transduction with the miR-124-3p inhibitor or negative control. [score:7]
The expression levels of miR-124-3p or B4GALT1 in K562 and KU812 cells were analyzed by qPCR after they were transduced with miR-124-3p expression mimic (d) or inhibitor (e). [score:7]
For example, miR-124-3p was obviously up-regulated by SOCS3 over -expression. [score:6]
Down-regulated SOCS3 in CML cells was associated with low level of miR-124-3p, then could not exert enough repressive effect on B4GALT1, resulting in the proliferation of CML cells and targeted drugs resistance. [score:6]
We further found that SOCS3 -induced down-regulation of B4GALT1 was attenuated by the presence of the miR-124-3p inhibitor (Fig.   8b). [score:6]
Thus, we analyzed the effect of SOCS3 on the expression of B4GALT1 and proved that SOCS3 modulated the expression of B4GALT1 by miR-124-3p and, in turn, B4GALT1 could rescue SOCS3 -induced chemo-sensitivity alterations in K562 cells. [score:5]
We found that luciferase activity of HEK293 cells was significantly decreased after co-transduction of miR-124-3p expression vector and a 3‘UTR vector containing the B4GALT1/miR-124-3p target sequence (Fig.   7c). [score:5]
Consistently, the tumor suppressing effects of SOCS3 were partially neutralized by the miR-124-3p inhibitor. [score:5]
However, imatinib treatment still induced miR-124-3p increase in the absence of SOCS3 and SOCS3 could inhibit colony formation, regardless of the presence of miR-124-3p inhibitor, which implied other signal pathways may be involved. [score:5]
The gene expression bead array results indicated that miR-124-3p, a tumor suppressor [24– 26], was significantly affected by SOCS3. [score:5]
In addition, we also found that some miRNAs were significantly affected by SOCS3 over -expression and that the expression of miR-124-3p was the highest in these miRNAs (data not shown). [score:5]
Using TargetScan and miRanda online search programs, we identified B4GALT1 as a potential target of miR-124-3p. [score:5]
The miR-124-3p inhibitor and control were transduced into K562 and KU812 cells that were stably transduced with SOCS3 over -expression vector. [score:5]
The hsa-miR-124-3p mimic or control sequence, and hsa-miR-124-3p inhibitor and hsa-miR-124-3p inhibitor negative control were all purchased from GenePharma (Shanghai, China). [score:5]
3’-UTR, 3’-untranslated region; BMNCs, bone marrow mononuclear cells; CML, chronic myeloid leukemia; CMPD, chronic myeloproliferative disorders; FACS, fluorescence - activated cell sorting; GFP, green fluorescent protein; miR-124-3p, microRNA-124-3p; miRNAs, microRNAs; qPCR, quantitative real-time PCR; siRNA, small interfering RNA; SOCS3, suppressor of cytokine signaling 3; WB, Western blotting Additional file 1: Figure S1. [score:5]
SOCS3 over -expression enhanced the expression of miR-124-3p and vice versa. [score:5]
These findings suggested the presence of a dysregulated molecular network involving SOCS3, miR-124-3p, and B4GALT1, which may provide novel insights into tumor biology and present a useful target for therapeutic interference of CML under certain circumstances. [score:4]
In our study, we found that miR-124-3p expression in CML cell lines was regulated by SOCS3. [score:4]
MiR-124-3p inhibitor and negative control were transduced into K562 and KU812 cells that were stably transduced by SOCS3 over -expression vector. [score:4]
SOCS3 miR-124 B4GALT1 Leukemogenesis Chemo-sensitivity Suppressor of cytokine signaling (SOCS) is a protein family of eight members (SOCS1–7 and CIS) that form a classical negative feedback system to regulate cytokine signal transduction [1]. [score:4]
Fig. 5SOCS3 regulated the expression of miR-124-3p in CML cells. [score:4]
The relative mRNA levels of SOCS3 or miR-124-3p in K562 and KU812 cells were analyzed by q-PCR after SOCS3 over -expression (a) or knock-down (b). [score:4]
B4GALT1 is a target of miR-124-3p in CML cells. [score:3]
Furthermore, we confirmed that B4GALT1, a multidrug resistance gene, was the target gene of the SOCS3/miR-124-3p axis. [score:3]
As shown in Fig.   5d, when the relative expression levels of miR-124-3p were plotted against that of SOCS3 in each patient, a significant positive correlation was found (miR-124-3p vs. [score:3]
miR-124-3p expression levels were quantified using U6 as the internal control (GenePharm). [score:3]
We further confirmed the effect of SOCS3 on the expression of miR-124-3p in K562 and KU812 cell lines by q-PCR. [score:3]
The human pre-miR-124 sequence was amplified and cloned into pcDNA3.1 constructs (Invitrogen) to generate the pcDNA3.1-miR-124 expression vector. [score:3]
However, B4GALT1 protein was markedly reduced after transduction with miR-124-3p expression vector, and vice versa (Fig.   7f). [score:3]
Data are expressed as the mean ± SD Next we explored the correlation between SOCS3 and miR-124-3p in BMNCs from CML patients (n = 30). [score:3]
SOCS3 promoted miR-124-3p expression in CML cells. [score:3]
Here, we first demonstrated that B4GALT1 was a target gene of miR-124-3p as predicted by bioinformatics, verified the conserved region in the B4GALT1 3‘UTR was binding to miR-124-3p. [score:3]
And, the inhibitory effect of SOCS3 on CML cell proliferation was attenuated in the absence of miR-124-3p. [score:3]
miR-124 radiosensitizes human esophageal cancer cell TE-1 by targeting CDK4. [score:3]
The correlation between the mRNA expression of SOCS3 and miR-124-3p in BMNCs from 30 CML patients was tested by qPCR and analyzed by Pearson correlation and linear regression analysis. [score:3]
d Statistically significant correlation between miR-124-3p and SOCS3 expression was observed by Pearson’s method. [score:3]
Data are expressed as the mean ± SDNext we explored the correlation between SOCS3 and miR-124-3p in BMNCs from CML patients (n = 30). [score:3]
In turn, alterations of miR-124-3p expression levels influenced the effect of SOCS3 on CML cells. [score:3]
As expected, the cell proliferation assay and clonogenic assay showed that the miR-124-3p inhibitor partially neutralized the inhibiting effects of SOCS3 (Fig.   6). [score:3]
Data represented three independent experiments and were shown as the mean ± SD (n = 3), * P < 0.05; compared with empty vector or inhibitor Next, we searched for potential genes regulated by miR-124-3p in leukemogenesis. [score:3]
Moreover, Shi et al. found that miR-124-3p could inhibit the proliferation of prostate cancer cells [28]. [score:3]
miR-124-3p mimic and inhibitor. [score:3]
Fig. 7B4GALT1 was a target of miR-124-3p. [score:3]
Fowler et al demonstrated that over -expression of miR-124 in GBM cells was associated with diminished tumor cell migration and invasion [27]. [score:3]
The vectors were co-transduced with control or pcDNA3.1-miR-124 expression vectors into K562 cells. [score:3]
The mRNA expression of miR-124-3p and SOCS3 in BMNCs from 30 CML patients was positively correlated. [score:3]
All these data indicated that miR-124-3p play an important role in SOCS3 -mediated growth inhibition. [score:3]
Our results showed SOCS-3 regulated miR-124-3p/B4GALT1 pathway played an important role in the pathogenesis of CML. [score:2]
Fig. 8B4GALT1 was regulated by SOCS3/miR-124-3p axis. [score:2]
B4GALT1 was regulated by the SOCS3/miR-124-3p axis. [score:2]
B4GALT1 was downstream of miR-124-3p and regulated by SOCS3/miR-124-3p in vitro. [score:2]
The potential target of miR-124-3p in CML cells was explored using the luciferase reporter assay, qPCR, and WB. [score:2]
We next investigated whether SOCS3 regulated CML cell function by up -regulating miR-124-3p. [score:1]
The effects of miR-124-3p on cell growth (a) and colony formation (b) were determined. [score:1]
a Bioinformatics analysis of the predicted interactions of miR-124-3p and its binding sites within the 3’UTR of B4GALT1. [score:1]
c Relative mRNA levels of miR-124-3p in K562 and KU812 cells that were stably transduced with shSOCS3 or shControl vector were examined at 48 h following imatinib treatment. [score:1]
The y-axis or x-axis represented the relative mRNA levels of miR-124-3p or SOCS3 in BMNCs from 30 CML patients, which were normalized against internal control RNU6-2 or β-Actin. [score:1]
We found that the mRNA level of B4GALT1 was not significantly affected by miR-124-3p in comparison with the control in both K562 and KU812 cells (Fig.   7d, e). [score:1]
SOCS3/miR-124-3p/B4GALT1 axis plays an important role in the pathogenesis of CML. [score:1]
In conclusion, SOCS3/miR-124-3p/B4GALT1 signaling pathway plays an important role in the pathophysiology of CML. [score:1]
A significant positive correlation between miR-124-3p and SOCS3 was observed. [score:1]
[1 to 20 of 69 sentences]
16
[+] score: 257
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3
To verify the target involved in progression of ovarian cancer, we searched putative target genes via miRanda and TargetScan and we focused on SphK1 because of its rank and function associated with migration and invasion, particularly, the ectopic expression of miR-124 substantially decreased the expression of SphK1 in both S KOV3-ip and HO8910pm ovarian cancer cells assessed by western blot assay (Figure  2D and Additional file 2C), although real-time PCR analysis did not show obvious changes in mRNA expression of SphK1 (Additional file 2B). [score:12]
In conclusion, our current study provides novel evidence that ectopic expression of miR-124 significantly suppresses migration and invasion of ovarian cancer cells and down-regulates SphK1, which is a direct functional target of miR-124. [score:11]
Meantime, overexpression of miR-124 dramatically inhibits the motility of ovarian cancer cells in vitro and substantially suppresses the protein expression of SphK1, reported as an invasion and metastasis-related gene in human cancers, whose expression is markedly increased in both ovarian cancer cell lines and clinical samples, particularly in two highly metastasis cells, S KOV3-ip and HO8910pm as well as metastatic ovarian tumor tissues. [score:11]
Additionally, the directionality of expression of miR-124 (down-regulated) and SphK1 (up-regulated) that we observed appeared to be definitive in the two high-metastasis potential ovarian cancer cell lines, S KOV3-ip and HO8910pm. [score:10]
In this context, our study indicates that miR-124, by targeting SphK1, inhibits migration and invasion of ovarian cancer cells, suggesting that miR-124 plays a key role as a tumor suppressor in the motility of ovarian cancer cells; and that reduced expression of SphK1 contributes to distant metastases in EOC. [score:9]
Furthermore, SphK1 is identified as a direct target of miR-124, and knock-down of SphK1 in ovarian cancer cells, S KOV3-ip and HO8910pm, could mimic the inhibition of migration and invasion by miR-124, while re-introduction of SphK1 abrogates the suppression of motility and invasiveness induced by miR-124 in both cell lines. [score:9]
Collectively, the reduced miR-124 expression and overexpressed SphK1 was probably associated in ovarian cancer tissues and cells, which indicates that SphK1 was a direct target of miR-124. [score:8]
On the other hand, our data showed that overexpression of miR-124 in ovarian cancer cells suppressed cell motility via SphK1, suggesting that SphK1 was identified as a direct and functional target for miR-124 in ovarian cancer progression. [score:8]
Overexpression of miR-124 inhibits aggressiveness of hepatocellular carcinoma cell by targeting ROCK2 and EZH2[21]. [score:7]
MiR-124 was first reported to be highly expressed in neuronal cells [17], but its tumor-suppressor activity was significantly down-regulated in various cancer tissues [8, 18- 21]. [score:7]
We showed that miR-124 is down-regulated in ovarian cancer specimens as well as in cell lines; and that low-level expression of miR-124 is much lower in highly metastatic ovarian cancer cells and tissues. [score:6]
The results are consistent with previous research [23], indicating that SphK1 is a predicted target of miR-124, and the inhibitory effect of miR-124 is due to direct interaction with the putative binding site of the 3’-UTR of SphK1. [score:6]
Figure 2 MiR-124 directly targets SphK1 and inhibits the migration and invasion of ovarian cancer cells. [score:5]
To verify the overexpression of miR-124, stem-loop qRT-PCR was performed and the results showed significantly increased expression of miR-124 in S KOV3-ip cells (Additional file 2A). [score:5]
Click here for file Overexpression of miR-124 has no effects on proliferation but suppresses the motility of cells. [score:5]
Expression of SphK1 reversed the miR-124 -induced inhibition of cellular migration and invasion. [score:5]
Overexpression of miR-124 has no effects on proliferation but suppresses the motility of cells. [score:5]
MiR-124 blocks migration and invasion of ovarian cancer cells by targeting SphK1, which would constitute a promising target for rational cancer therapy. [score:4]
Overexpression of miR-124 significantly suppressed the luciferase activity of reporter genes containing 3’UTR of SphK1 compared with controls but partially rescued when the binding site was mutated (Figure  2F and Additional file 2D lower panel). [score:4]
Our studies suggest a protective role of miR-124 in inhibition of migration and invasion in the molecular etiology of ovarian cancer, and a potentially novel application of miR-124 in the regulation of migration and invasion in EOC. [score:4]
It is important to note that one microRNA can exert different functions by targeting multiple mRNAs[37]; that is, other genes regulated by miR-124 may also lead to ovarian carcinogenesis. [score:4]
SphK1 is a direct target of miR-124. [score:4]
Migration and invasion assays showed that enforced expression of SphK1 reversed miR-124 -induced inhibition of migration and invasion (Figure  4B, C). [score:4]
Our studies indicated that miR-124 was down-regulated in ovarian cancer cell lines and clinical samples. [score:4]
To determine the expression level of miR-124 in ovarian cancer progression, we first compared the expression levels between 13 clinical tumor samples and 2 normal ovarian tissues by stem-loop qRT-PCR. [score:4]
Furthermore, we showed that miR-124 inhibited EOC cell migration and invasion, which may be involved in the development of ovarian cancer metastasis. [score:4]
In order to confirm that miR-124 directly targets SphK1, luciferase assay was performed. [score:3]
Reduced expression of miR-124 in highly metastatic ovarian cancer cell lines and clinical tumors. [score:3]
As expected, the invasion ability of these two cells was decreased markedly as a result of overexpression of miR-124 (Figure  2C). [score:3]
Figure 1 Expression of miR-124 in cell lines and tissues of ovarian cancer. [score:3]
Figure 4. (A) The transfection of pcDNA3.1 (−)–SphK1 restored the expression of Sphk1 in S KOV3-ip cells even with miR-124 co-transfection. [score:3]
The newly identified miR-124/SphK1 link provides novel insight into the metastasis of EOC, especially with respect to invasion and metastasis in vitro; and represents a new potential therapeutic target for the treatment of EOC. [score:3]
Click here for file Validation of miR-124 targeting SphK1 in HO8910pm cells. [score:3]
Validation of miR-124 targeting SphK1 in HO8910pm cells. [score:3]
These results suggest that the expression of miR-124 is significantly decreased in human ovarian cancer specimens and cell lines, which may be involved in EOC metastasis. [score:3]
The S KOV3-ip cells were co -transfected with NC or miR-124 together with pCDNA3.1 (−)-vector or pCDNA3.1 (−)-SphK1 for 48 h. The expression of SphK1 recovered after SphK1 transfection (Figure  4A). [score:3]
In this study, we observed that the expression level of miR-124 was low in ovarian cancer tissues, and even lower in the metastatic ovarian tissues. [score:3]
Interestingly, we observed that the expression level of miR-124 was lower in metastatic tissues than in primary ovarian cancer samples (p < 0.05) (Figure  1B). [score:3]
Thus, it is possible that miR-124 could attenuate EOC invasion partly through inhibition of the SphK1pathway. [score:3]
Also, clinical ovarian cancer samples were used to confirm the relationship between the endogenous expression levels of SphK1 and miR-124. [score:3]
Therefore, we now reasonably speculate that low expression of miR-124 contributes to SphK1 -mediated migration in EOC cells. [score:3]
The expression of miR-124 was assessed in clinical ovarian cancer specimens and cell lines using miRNA qRTPCR. [score:3]
However, the expression level and the possible role of miR-124 in ovarian cancer remain to be explored. [score:3]
MiRNAs are differentially expressed in ovarian cancer [2, 10], including miR-124 [2]. [score:3]
To investigate the functional role of miR-124 in epithelial ovarian cancer (EOC), we restored miR-124 expression in S KOV3-ip and HO8910pm cells, which shows the lowest expression of miR-124 in the nine ovarian cancer cell lines, by transient transfection with miR-124 mimics or negative control (NC). [score:3]
Interestingly, there is a significant correlation between the expression level of miR-124 and metastasis of ovarian cancer. [score:3]
In the present study, we found that miR-124 was down-regulated in ovarian cancer cell lines and tumor tissues compared with normal ovarian surface epithelial cells and normal ovarian tissues. [score:3]
In addition, We confirmed through luciferase reporter gene assays that miR-124 directly targets SphK1 by binding the 3’-UTR of SphK1 mRNA, which is consistent with Xia et al. [23]. [score:3]
Furthermore, we examined the expression of miR-124 between five paired metastatic and primary ovarian cancer tissues. [score:3]
Additionally, Fowler et al. reported that IQGAP1, laminin c1 and integrin b1 (which are not the only 3 targets of miR-124) are also associated with migration and invasion in clinical glioblastoma specimens, compared with normal brain tissue [38]. [score:2]
As shown in (Figure  1A and Table  1), the results showed that expression of miR-124 was decreased in 13 cases of ovarian cancer samples (p < 0.001), compared to normal ovarian tissues. [score:2]
The wound healing assay as well as migration Transwell assay indicated the ectopic expression of miR-124 can significantly inhibit cell migration compared to control group (Figure  2A, B). [score:2]
MiR-124 suppresses the migration and invasion of ovarian cancer cells in vitro. [score:2]
To investigate whether MiR-124 has its inhibitory effect on migration and invasion of ovarian cancer through its target gene SphK1, we next determined to silence SphK1 and evaluated its expression by western blot in S KOV3-ip and HO8910pm cells. [score:2]
S KOV3-ip and HO8910pm cells were transfected with wild-type full length 3’-UTR of Sphk1 which was cloned into the psiCHECK™2 Vector as a control and mutant vector contained 4 mutated bases on only one biding site on SphK1-3’-UTR (Figure  2E and Additional file 2D upper panel), as well as miR-124 or NC. [score:1]
100 ng wild-type or mutant SphK1 3’-UTR psiCHECK-2 plasmid (Promega, Madison, WI) was transiently co -transfected with 60 pmol miR-124 mimics or NC into HO8910pm and S KOV3-ip cells. [score:1]
Although it has been reported that miR-124 is functionally involved in gynecological cancer [36], to the best of our knowledge, there are no published data on the role of miR-124 regarding migration and invasion in EOC. [score:1]
Transfection of miR-124 or siRNA against SphK1. [score:1]
However, the role of miR-124 in ovarian cancer has not been reported in ovarian cancer [14, 33]. [score:1]
The loss of miR-124 may then contribute to the migration and invasion of EOC cells. [score:1]
In additionally, proliferation rate of cells post miR-124 transfection appeared no change (Additional file 3A, B). [score:1]
In order to investigate the contribution of SphK1 to cellular migration and invasion, we ectopically expressed SphK1 together with miR-124 in S KOV3-ip cells to evaluate whether this may overcome the suppressive effect of miR-124 on cell migration and invasion. [score:1]
In essence, this provided the possibility that the loss of miR-124 may lead to SphK1 -mediated migration and invasion in ovarian cancer. [score:1]
Collectively, our results indicate that miR-124 participates in SphK1 -mediated migration and invasion of EOC cells, suggesting that SphK1 is a functional mediator of miR-124 in EOC metastasis. [score:1]
We further detected the abundance of miR-124 in nine ovarian cancer cell lines. [score:1]
Also, It has been reported that miR-124 involves in several malignant processes, including tumor proliferation, Epithelial-mesenchymal transition (EMT), and angiogenesis [6, 19- 23]. [score:1]
We aimed to elucidate the involvement of miR-124 and SphK1 in migration and invasion of ovarian cancer. [score:1]
[1 to 20 of 67 sentences]
17
[+] score: 256
Pierson et al [21] have shown that miRNA-124 is down-regulated in medulloblastoma cells, and that its target, CDK6, is overexpressed [41]. [score:8]
Overexpression of miRNA-124 in uninfected UKF-NB cells also reduced CDK6 expression, implicating a direct effect of miRNA-124 on CDK6 expression levels. [score:8]
The gene encoding CDK6 is also a target for miRNA-124; thus, it is well established that miRNA-124 down-regulates the expression of CDK6 [21– 24]. [score:8]
Nonetheless these results are consistent with our observation that expression of miRNA-124 is associated with inhibition of CDK6 expression, accompanied by a concomitant decrease in cell proliferation. [score:7]
Thus, we tested whether MV infection up-regulates miRNA-124 expression in UKF cells. [score:6]
Downregulation of CDK6 following miRNA-124 expression. [score:6]
As miRNA-124 is strongly expressed in slowly dividing UKF-NB-MV cells, we first determined whether CDK6 was concomitantly down-regulated in individual clones of UKF-NB-MV cells isolated by limiting dilution (Fig 5A, Clone I, II and III). [score:6]
This result correlated with decreased CDK6 expression, a well-described target gene for miRNA-124, resulting in slower cell division. [score:5]
Here, we provide evidence that expression of miRNA-124 in neuroblastoma cells is an important molecular link between MV persistent infection, CDK6 inhibition, and reduced cell division that facilitates establishment of persistent infection. [score:5]
Three or seven DPI, cDNA libraries were prepared and miRNA-124 relative expression was determined by qPCR and expressed as the fold change relative to U6. [score:5]
Inhibition of miRNA-124 expression by transfection with ANTAGOmiRNA-124 induces increased cell proliferation in UKF-NB-MV cells, but not in UKF-NB cells. [score:5]
Here, we link these findings, and show that in persistently infected UKF-NB-MV cells, compared to uninfected cells, miRNA-124 is strongly expressed, and CDK6 expression is reduced. [score:4]
Elevated miRNA-124 in MV persistently infected cells correlates with down-regulation of CDK6. [score:4]
We propose that MV persistent infection is facilitated by the down-regulation of CDK6 by miRNA-124 in neuroblastoma cells. [score:4]
Similarly, miRNA-124 overexpression induces cell death in these cells, but not in uninfected UKF-NB cells. [score:3]
However, overexpression of miRNA-124 in UKF-NB-MV cells did not result in further reduction of CDK6. [score:3]
In neuroblastoma cells supporting MV persistent infection, the expression of miRNA-124 was augmented. [score:3]
Furthermore, post mitotic neuronal cells express high miRNA-124 levels [54]. [score:3]
We show that MV persistent infection of UKF-NB cells is accompanied by miRNA-124 increased expression, and reduced cell proliferation. [score:3]
To study the possible effects of ectopic overexpression of miRNA-124 on UKF-NB cells, UKF-NB and UKF-NB-MV cells were transiently transfected with a GFP-miRNA-124 plasmid. [score:3]
In turn, MV infection can persist in cells that express miRNA-124, which plays a neuron-protective role, possibly through CDK6 reduction. [score:3]
UKF-NB cells overexpressing miRNA-124 had a slower growth rate than control UKF-NB cells (Fig 4C). [score:3]
Expression of miRNA-124 is therefore dependent on demethylation of its promoter. [score:3]
Ectopic overexpression of miRNA-124 tilts this tenuous balance towards apoptosis and cell loss. [score:3]
Ectopic expression of miRNA-124 induces apoptosis in UKF-NB-MV cells, but not in UKF-NB cells. [score:3]
Cyclin dependent kinase 6 (CDK6) [21] and Solute Carrier Family 16 (SLC16A1) [40] are two identified key targets of miRNA-124 in Medulloblastoma, suggesting a role for this miRNA in cell proliferation and cell cycle. [score:3]
A significant decline in cell viability was observed exclusively in miRNA-124 over -expressing UKF-NB-MV cells (Fig 4B). [score:3]
We determined that persistent infection with the wild type virus can be attained and miRNA-124 expression is significantly increased in the infected cells (data not shown). [score:3]
These conclusions are strongly supported by the results in Fig 7C showing that stable UKF-NB MUT-miRNA-124 cells which survived acute infection and were initially miRNA-124 low expressers, were determined to be miRNA-124 positive after 21 days, presumably by selection of rare high threshold miRNA-124 positive cell subpopulations. [score:3]
Surely miRNA-124 is not the sole cellular factor that predisposes to the establishment of MV persistence, but evidence presented here shows that selected miRNAs, which may be expressed only in particular cell populations, can influence the cell cycle and overall cell viability, both of which may be important in the establishment of persistent infections. [score:3]
miRNA-124 overexpression induces cell death in UKF-NB-MV cells. [score:3]
MiRNA-124 was readily detected in pooled colonies after 21 DPI, suggesting that miRNA-124 expression is necessary for establishment of persistence (Fig 7C). [score:3]
0187077.g003 Fig 3 To study the possible effects of ectopic overexpression of miRNA-124 on UKF-NB and UKF-NB-MV cells and apoptosis, the cells were first transfected with GFP-miRNA-124 (miR124) or empty GFP-plasmid (miR control). [score:3]
We propose that miRNA-124 limits CDK6 expression which in turn results in decreased cell proliferation, facilitating the establishment of MV persistence in neuroblastoma cells. [score:3]
In Fig 2, we confirmed that three randomly chosen clones (Clone I, II and III) expressed various amounts of miRNA-124 (Fig 2C) and MV-P (Fig 2D). [score:3]
All colonies were MV -positive and GFP -positive expressing the full length GFP-miRNA-124. [score:3]
We conclude that cells expressing miRNA-124, by either selection or transfection, become permissive to MV persistent infection. [score:3]
Transfection of UKF-NB-MV cells with ANTAGOmiRNA-124, which inhibits miRNA-124 (from 186- to 13-fold change; Fig 4F), resulted in re-acquisition of rapid cell division, and reduced cell death (Fig 4D). [score:3]
In addition the morphology of MV infected UKF-NB colonies resembled the morphology of UKF-NB-MV cells (Fig 1B), suggesting that MV persistence is associated with miRNA-124 expression and neuronal differentiation. [score:3]
Cells were transfected with the inhibitor miRNA-124 antisense (Ambion). [score:3]
When uninfected cells were engineered to stably express miRNA-124, we attained the efficient establishment of MV persistence following acute infection. [score:3]
Since UKF-NB cells express low basal levels of miRNA-124, transfection with ANTAGOmiRNA-124 did not change the cell's growth rate (Fig 4E). [score:3]
cDNA libraries of three independent UKF-NB-MV clones (I, II, III) were prepared and miRNA-124 relative expression was determined by qPCR and normalized to U6. [score:3]
Ectopic overexpression of miRNA-124 led to a strong reduction in CDK6 protein levels and reduced the rate of cell proliferation. [score:3]
The clones expressed various amounts of miRNA-124 (Fig 2C), which inversely correlated with the amounts of CDK6 (Fig 5A). [score:3]
In these cells, both the uninfected and persistently infected cells express high amounts of miRNA-124. [score:3]
The presence of ANTAGOmiRNA-124 had no effect on UKF-NB cells, as these cells normally express low relative levels of basal miRNA-124 (Fig 5C). [score:3]
We conclude that overexpression of miRNA-124 is not sufficient to induce cell death, but can do so in the presence of persistent MV. [score:3]
CDK6 is also a known target gene for miRNA-124 [21], [29]. [score:3]
In addition elevated miRNA-124 expression may promote neuronal differentiation of neuroblastoma cells, and the differentiated state is more conducive to a persistent infection. [score:3]
CDK4 (Santa Cruz Biotechnology) is a functional homologue of CDK6 that is not a target for miRNA-124. [score:3]
Ectopic overexpression of GFP-miRNA-124 in UKF-NB-MV caused overall cell death over time, similar to cisplatin treatment (Fig 1F). [score:3]
Furthermore, neuronal differentiation is enhanced following ectopic expression of miRNA-124 in mouse neuroblastoma cells [37], mouse embryonic carcinoma cells, and mouse embryonic stem cells [38] as well as neuronal differentiation of postnatal neural stem cells and glioma stem cells [39]. [score:3]
The fact that persistently infected cells consistently express elevated miRNA-124 may reflect viral selection of cells providing the appropriate, more differentiated environment. [score:3]
The results show that acute infection, as determined 3 and 7 DPI at two different virus inocula, neither increased the levels of miRNA-124 (Fig 6A) nor decreased CDK6 (Fig 6B), suggesting that the establishment of persistent infection in UKF-NB cells requires prior miRNA-124 expression, rather than its induction. [score:3]
Indeed, miRNA-124 overexpression promotes neuronal differentiation [14, 37] and reduces apoptosis in bone marrow-derived mesenchymal stem cells [48]. [score:3]
To study the possible effects of ectopic overexpression of miRNA-124 on UKF-NB and UKF-NB-MV cells and apoptosis, the cells were first transfected with GFP-miRNA-124 (miR124) or empty GFP-plasmid (miR control). [score:3]
Here, we describe the contribution of miRNA-124 a host cell-encoded miRNAs in the development of MV persistent infection in the human neuroblastoma cell line UKF-NB (UKF-NB-MV). [score:2]
MiRNA-124 target protein CDK6 and negative control (CDK4) were detected by Western blot in uninfected (UKF-NB) cells, persistently infected (UKF-NB-MV) and acute infected UKF-NB cells (5x10 [3] PFU/ml 3DPI). [score:2]
In contrast to our results with the MV, Avila-Bonilla et al, recently reported the down regulation of miRNA-124 (among other miRNAs) in Dengue virus persistently infected versus acutely infected cells [59]. [score:2]
MiRNA-124 is expressed in MV persistently infected UKF-NB cells. [score:2]
MiRNA-124 expression in MV acutely infected cells. [score:2]
MiRNA-124 is strongly expressed in persistently infected cells and is abundant in normal neuronal cells. [score:2]
Interestingly, in cells acutely infected with the virus, we observed no increase in miRNA-124, nor reduction in CDK6, or impaired cell division. [score:1]
0187077.g004 Fig 4 (A) UKF-NB-MV cells were transfected with: GFP-miRNA-124 (miR124), empty GFP-plasmid, or GFP-MUT-miRNA-124 (Mut124). [score:1]
In particular, we investigated the role of the cellular hsa-miRNA-124, which we show to be strongly expressed in cells persistently infected with MV. [score:1]
These results seem to contradict the known role of miRNA-124 in protecting neurons from death [47]. [score:1]
Acute infection of UKF-NB cells with the MV Edmonston strain: 1x10 [6] cells/well UKF-NB, UKF-NB miRNA-124 or MUT-miRNA-124 transfected cells were seeded in a 6-well plate in 2 ml growth media overnight. [score:1]
The presence of miRNA-124 increases cell viability following MV infection, facilitating the establishment of persistent infection. [score:1]
It would be of interest to determine whether the persistently infected UKF-NB-MV cells as well as the very small, uninfected UKF-NB cell subpopulation of miRNA-124 positive cells harbor demethylated miRNA-124 CpG islands. [score:1]
To determine the absolute transcript copy number of miRNA-124, 2X10 [5]cells were seeded in 6-well plates. [score:1]
Stable transfectants (UKF-NB miRNA-124 or MUT-miRNA-124) were established following selection with 1μg/ml puromycin. [score:1]
Thus, the extent of apoptosis was most likely due to the combination of both miRNA-124 and the presence of MV in these cells. [score:1]
Stable miRNA-124 transfection of UKF-NB cells, followed by acute MV infection facilitated the establishment of persistently infected colonies. [score:1]
MiRNA-124 is one of the best-characterized miRNAs in the CNS; it is abundantly expressed in differentiated neuronal cells and in tumors of neuronal origin [14, 15]. [score:1]
Interestingly, UKF-NB cells transfected with MUT-miRNA-124 that survived acute infection with MV, and which were initially negative for miRNA-124, became positive after 21 days (Fig 7C). [score:1]
All persistently infected colonies were both GFP positive (transfected with either GFP-miRNA-124 or GFP-MUT-miRNA-124) and MV positive (Fig 7B). [score:1]
Transfection with the miRNA-124 antisense. [score:1]
qPCR of miRNA-124 was determined before MV infection (0 DPI); 1 hour post infection (1 HPI) and 21 days post infection (DPI). [score:1]
In this report, we show that neuroblastoma cells persistently infected with MV had high levels of miRNA-124. [score:1]
The sequences of the fragments are as follows: Hsa-124a-3p:5'GATCCT AAGGCACGCGGTGAATGCCCTTCCTGTCAGAGGCATTCACCGCGT GCCTTATTTTTG -3'5'AATTCAAAAAT AAGGCACGCGGTGAATGCCTCTGACAGGAAGGGCATTCACCGCGT GCCTTAG -3' Mutant hsa-124a-3p (MUT-miRNA-124):5'GATCCT TTCCGACGCGGTGAATTCCCTTCCTGTCAGAGGAATTCACCGCGT CGGAAATTTTTG -3'5'AATTCAAAAAT TTCCGACGCGGTGAATTCCTCTGACAGGAAGGGAATTCACCGCGT CGGAAAG -3'Cells were transfected with the plasmid containing the miRNA-124, the mutant MUT-miRNA-124 or with the control plasmid lacking the insert. [score:1]
To determine the contribution of miRNA-124 to the establishment of persistence we performed stable transfections of UKF-NB cells with GFP-miRNA-124 or GFP-mutant miRNA-124 (MUT- miRNA-124) (Fig 7). [score:1]
A reduction in miRNA-124 levels correlated with increased cell proliferation. [score:1]
First, the presence of miRNA-124 in UKF-NB transfected cells was confirmed by qPCR, at three days after transfection. [score:1]
For example, miRNA-124 is frequently methylated in tumors [43]. [score:1]
UKF-NB cells were stably transfected with constructs encoding GFP-miRNA-124 (miR124) or GFP-MUT-miRNA-124 (Mut124). [score:1]
Stable transfection of UKF-NB cells with miRNA-124, followed by acute MV infection facilitated the establishment of persistently infected colonies. [score:1]
Therefore in this study, we described the contribution of miRNA-124 in persistent MV infection of neuroblastoma cells. [score:1]
We obtained two subpopulations: GFP positive cells transfected with GFP-miRNA-124 or GFP-control plasmids (see below). [score:1]
The sequences of the fragments are as follows: Hsa-124a-3p: 5'GATCCT AAGGCACGCGGTGAATGCCCTTCCTGTCAGAGGCATTCACCGCGT GCCTTATTTTTG -3'5'AATTCAAAAAT AAGGCACGCGGTGAATGCCTCTGACAGGAAGGGCATTCACCGCGT GCCTTAG -3' Mutant hsa-124a-3p (MUT-miRNA-124): 5'GATCCT TTCCGACGCGGTGAATTCCCTTCCTGTCAGAGGAATTCACCGCGT CGGAAATTTTTG -3'5'AATTCAAAAAT TTCCGACGCGGTGAATTCCTCTGACAGGAAGGGAATTCACCGCGT CGGAAAG -3' Cells were transfected with the plasmid containing the miRNA-124, the mutant MUT-miRNA-124 or with the control plasmid lacking the insert. [score:1]
UKF-NB cells were stably transfected with constructs encoding GFP-miRNA-124(miR124) or the GFP-MUT-miRNA-124 (Mut124). [score:1]
The loss of GFP -positive UKF-NB-MV cells transfected with miRNA-124 was not due to the loss of the plasmid. [score:1]
Absence of CDK6 accompanied by high levels of miRNA-124 are consistent with the ability of MV to establish long-term persistent infection in non-dividing resident CNS cells [1]. [score:1]
Several miRNA genes, including miRNA-124, harbor CpG islands that can undergo methylation -mediated silencing, a characteristic of many tumor suppressor genes. [score:1]
To confirm these results further, we FACS-sorted the GFP positive cells three days after miRNA-124 transfection (Fig 4A). [score:1]
Thus, similarly to our results with UKF-NB-MV cells, the presence of miRNA-124 is associated with the ability of the virus to establish persistent infection. [score:1]
UKF-NB cells transfected with miRNA-124 showed equivalent amounts of miRNA-124 as similarly transfected UKF-NB-MV cells (Fig 3A). [score:1]
[1 to 20 of 97 sentences]
18
[+] score: 244
Furthermore, and qPCR analyses confirmed that in EC cells, forced expression of miR-124 significantly up-regulated the epithelial markers (E-cadherin, ZO-1 and CK-18), and down-regulated the mesenchymal markers (N-cadherin and Vimentin) in EC cells (Figure 2E; Figure 3F, 3G). [score:9]
Our qPCR and western blot analyses showed that increasing miR-124 levels in HI cells with the miR-124 mimic reduced IQGAP1 expression, whereas inhibiting miR-124 by means of an anti-miR-124 inhibitor in HEC-1 cells increased IQGAP1 expression (Figure 2D, 2E). [score:9]
MiR-124 is down-regulated in highly invasive EC cells and directly suppresses IQGAP1 expression. [score:8]
To elucidate the relationship between miR-124 and IQGAP1 expression, we examined the expression of miR-124 in different EC cells and found the lowest levels of miR-124 in the highly invasive HI cells (Figure 2C), suggesting that reduced levels of miR-124 cause a dysregulation of IQGAP1 expression. [score:8]
To examine whether DNA methylation and histone modification could account for the downregulation of miR-124 in EC, we treated EC cells with 5-aza-2′-deoxycytidine (5-AZA; a DNA methylation inhibitor) and/or Trichostatin A (TSA; a histone deacetylase inhibitor). [score:8]
MiR-124 is down-regulated in highly invasive endometrial cancer (EC) cells and directly suppresses IQGAP1 expression. [score:8]
Moreover, we uncovered a novel mechanism by which the DNA methylation -associated silence of tumor suppressor miR-124 contributes to the upregulation of IQGAP1, suggesting that targeting the miR-124-IQGAP1 axis may have therapeutic potential for the treatment of invasive ECs. [score:8]
Here we have shown that IQGAP1 induces EMT and enhances EC invasion, and also identified miR-124 as an epigenetically silenced tumor suppressor that inhibits the EC cell migration, invasion and proliferation, by down -regulating oncogene IQGAP1 expression. [score:8]
In conclusion, our findings provide a new mechanism that accounts for the observed downregulation of miR-124 and upregulation of IQGAP1 in EC. [score:7]
Collectively, these data suggest that miR-124 expression is inversely correlated with the IQGAP1 expression level, and decreased miR-124 expression may be associated with poor outcomes for patients with EC. [score:7]
To examine whether miR-124 suppress oncogenic phenotypes in HI cells through directly down -regulating IQGAP1, we performed the rescue experiments by overexpressing IQGAP1 in HI cells transfected with the miR-124 or a control mimic. [score:7]
Of these miRNAs, we chose to focus on miR-124 because the computational target prediction using TargetScan predicted the presence of two conserved miR-124 seed-matching sequences within the 3′ untranslated region (3′-UTR) of IQGAP1 mRNA (Figure 2B). [score:7]
We demonstrated that miR-124 is down-regulated in EC and the loss of its expression is at least partly mediated by DNA methylation. [score:6]
Down-regulation of miR-124 is associated with elevated IQGAP1 expression in ECs. [score:6]
E. Expression of the indicated mRNA and proteins in HI and HEC-1 cells after the overexpression or knockdown of miR-124. [score:6]
The miR-124 mimic, negative control for the miRNA mimic, anti-miRNA inhibitor for miR-124, negative control for the miRNA inhibitor, IQGAP1 siRNA, and negative control siRNA were all purchased from Ambion (TX, USA). [score:5]
D. Expression of miR-124 in HI or HEC-1 cells transfected with a miR-124 mimic, miR-124 inhibitor, or their respective negative controls. [score:5]
MiR-124 down-regulation is associated with elevated IQGAP1 expression in endometrial cancer cells. [score:5]
Wt or Mut IQGAP1 reporter vectors, together with the pGL3-basic firefly luciferase expression vector as a reference control (Promega, San Luis Obispo, CA, USA), were transfected with 30 nM of the miR-124 mimic or inhibitor using Lipofectamine 2000 (Invitrogen, CA, USA). [score:5]
In another cellular context, we verified the inhibitory effects of miR-124 on IQGAP1 mRNA expression in human cervical cancer cells (HeLa cells; data not shown). [score:5]
These studies suggest that methylation -mediated silencing rather than histone modification serves as an epigenetic event that negatively regulates miR-124 expression. [score:4]
F, G. Quantitative PCR analysis of the indicated genes in HI (F) and HEC-1 (G) cells after the overexpression or knockdown of miR-124, as indicated. [score:4]
C-E. Migration (C), invasion (D), and proliferation (E) of HI and HEC-1 cells after the overexpression or knockdown of miR-124. [score:4]
The methylation -mediated repression of miR-124 leads to the overexpression of IQGAP1, which in turn accelerates cancer cell proliferation, EMT and invasion. [score:3]
A-D. The expression levels of miR-124 (A), IQGAP1 (B), E-cadherin (C), and Vimentin (D) were assessed by a quantitative PCR analysis of 20 paired cancerous and normal tissue samples from endometrial cancer patients. [score:3]
F, G. HI (F) and HEC-1 (G) cells were cotransfected with reporter plasmids containing wild-type IQGAP1 or a mutant IQGAP1 3′-UTR together with a miR-124 mimic, miR-124 inhibitor, or respective negative control. [score:3]
To determine whether miR-124 inhibits EMT, we evaluated the effects of miR-124 overexpression on the cell morphology and invasion properties. [score:3]
Briefly, 5 × 103 cells were plated in 96-well plates for 24 hours and then transfected with the IQGAP1 cDNA vector/IQGAP1 siRNA, miR-124 mimics/inhibitors, and their respective controls. [score:3]
Overexpressing miR-124 reverses EMT-like phenotypes and reduces EC cell migration, invasion and proliferation. [score:3]
B. HEC-1 cells transfected with miR-124 inhibitor exhibit more mesenchymal morphology than the control cells. [score:3]
A. Overexpression of miR-124 in HEC-50-HI (HI) cells with fibroblastic morphology converts them to an epithelial-like morphology. [score:3]
F. Box plots demonstrating significantly lower levels of miR-124 expression in the high-risk patients. [score:3]
Figure 3 A. Overexpression of miR-124 in HEC-50-HI (HI) cells with fibroblastic morphology converts them to an epithelial-like morphology. [score:3]
Overexpression of IQGAP1 cDNA lacking the 3′-UTR sequence partially restored HI cell migration, invasion and proliferation reduced by miR-124 (Figure 3H, 3I and 3J). [score:3]
We also observed a positive correlation between miR-124 and E-cadherin expression in the EC tissues (Figure 4A, 4C). [score:3]
The expression of miR-124 was significantly increased after treating with 5-AZA or a combination of 5-AZA plus TSA (Figure 5A, 5B), but the miR-124 and miR-34b levels remained relatively unchanged in cells treated with TSA alone (Figure 5A, 5B). [score:3]
B. Two putative conserved miR-124 -binding sites in the IQGAP1 3′ untranslated region (3′-UTR). [score:3]
Indeed, the qPCR analysis revealed a negative association between the miR-124 and IQGAP1 expression levels. [score:3]
Ectopically expressing miR-124 in HI cells resulted in the occurrence of epithelial morphology (Figure 3A). [score:3]
demonstrated that miR-124 inhibited the migration, invasion and proliferation of EC cells (Figure 3C, 3D, 3E). [score:3]
Figure 4 A-D. The expression levels of miR-124 (A), IQGAP1 (B), E-cadherin (C), and Vimentin (D) were assessed by a quantitative PCR analysis of 20 paired cancerous and normal tissue samples from endometrial cancer patients. [score:3]
Thus, the restoration of miR-124 by targeted delivery system or by treatment with DNA-demethylating agents may be therapeutically efficacious for the treatment of EC. [score:3]
Taken together, we showed that the IQGAP1 mRNA is directly regulated by miR-124 via conserved seed-matching sequences. [score:3]
These results suggest that miR-124 induces epithelial-like phenotypes, and also indicate that the repression of IQGAP1 by miR-124 represents an important mechanism by which miR-124 suppresses migration, invasion and proliferation. [score:3]
Likewise, the expression of miR-124 negatively correlated with the Vimentin levels (Figure 4A, 4B, 4D). [score:3]
Kaplan–Meier survival analysis revealed that the overall survival rate in the high-risk group were marginally significantly lower than those in the low-risk group (P = 0.0694) and high-risk patients had lower miR-124 expression levels than the low-risk patients (Figure 4E, 4F). [score:3]
Using a dual-reporter luciferase assay to investigate whether IQGAP1 is directly targeted by miR-124, we found that the IQGAP1 3′-UTR reporter activity was decreased by a miR-124 mimic and increased by the anti-miR-124 inhibitor when the wild-type IQGAP1 3′-UTR was present. [score:3]
IGGAP1 is targeted by miR-124 [18] in hepatocellular carcinoma and by miR-506 in breast cancer [19]. [score:3]
DNA methylation -based silencing of tumor suppressive miRNAs, such as miR-34b [16] and miR-124 [17], occurs in various human cancers and stimulates metastasis. [score:3]
MiR-124 exerts tumor suppressor effects and is frequently methylated in multiple cancer types [17]. [score:2]
To investigate whether the down-regulation of miR-124 is associated with clinical outcomes in EC, we analyze data from 309 EC patients in the Cancer Genome Atlas (TCGA) database by using the SurvMicro web tool [20]. [score:2]
C. Relative expression of miR-124 in immortalized human endometrial epithelial and EC cells, assessed by quantitative PCR assays. [score:2]
In contrast, down -regulating of endogenous miR-124 in HEC-1 cells produced a spindle-like morphology (Figure 3B). [score:2]
To test whether miR-124/IQGAP1 axis is clinically relevant in EC, we examined tumor specimens and adjacent normal tissues from 20 EC patients. [score:1]
A, B. HI and HEC-1 cells were treated with 5-aza-2′-deoxycytidine (5-AZA), Trichostatin A, or both, after which, quantitative PCR was used to measure the expression levels of miR-124 (A) and miR-34b (B). [score:1]
H-J. A miR-124 mimic or its control was transfected into HI cells along with a control vector or the IQGAP1 cDNA vector lacking the 3′-UTR region. [score:1]
Conversely, the loss of miR-124 promoted these malignant features (Figure 3C, 3D, 3E). [score:1]
This repression of miR-124 in the EC cells results in the increased abundance of the key oncoprotein IQGAP1 and the subsequent induction of EMT. [score:1]
This supports a mo del that the loss of miR-124 activates IQGAP1 and contributes to EMT and cancer cell invasiveness. [score:1]
The Renilla luciferase-reporter plasmids containing human IQGAP1 mRNA [44] with either wild-type (Wt; #14503) or mutant (Mut; #14504) miR-124 binding sites (875–882 bp and 1172–1178 bp from the start site of the 3′-UTR) were obtained from Addgene (Cambridge, MA, USA). [score:1]
However, mutating the miR-124 binding sites in the IQGAP1 3′-UTR completely abrogated these effects (Figure 2F, 2G). [score:1]
Figure 5 A, B. HI and HEC-1 cells were treated with 5-aza-2′-deoxycytidine (5-AZA), Trichostatin A, or both, after which, quantitative PCR was used to measure the expression levels of miR-124 (A) and miR-34b (B). [score:1]
[1 to 20 of 62 sentences]
19
[+] score: 238
In the present study, we found that miR-124 was down-regulated in osteosarcoma cell lines and primary tumor samples, and miR-124 was further identified to be a tumor suppressor, as restoration of miR-124 expression in osteosarcoma cell lines was able to inhibit cell proliferation, promote cell cycle, and suppress cell invasion and metastasis by targeting Rac1. [score:14]
Western blot analysis of Rac1 protein expression in six patients whose miR-124 expression was down-regulated in osteosarcoma tissues. [score:8]
This conclusion is supported by the following reasons: complementary sequence of miR-124 is identified in the 3′UTR of Rac1 mRNA; overexpression of miR-124 led to a significant reduction in Rac1 at both mRNA and protein level; miR-124 overexpression suppressed Rac1 3′UTR luciferase report activity and this effect was abolished by mutation of the miR-124 seed binding site. [score:8]
To assess the regulation of miR-124 in Rac1 expression, the protein level of Rac1 was analyzed in six miR-124 down-regulated osteosarcoma tissues. [score:7]
To explore the molecular mechanism by which miR-124 suppressed osteosarcoma cell growth, migration and invasion, we identified Rac1 as a direct target of miR-124 in osteosarcoma cells. [score:6]
Meanwhile, down-regulation of miR-124 significantly promote cell proliferation, migration and invasion; enhanced cell viability in osteosarcoma cell lines, indicating that inhibition of miR-124 might repress tumor progression in osteosarcoma carcinogenesis. [score:6]
MiR-124 overexpression remarkably reduced luciferase activity of reporter gene with wild-type, but not mutant Rac 3′UTR, indicating that miR-124 directly targeted Rac 3′UTR. [score:6]
These results indicate that miR-124 may function as a tumor suppressor partly mediated by repressing Rac1 expression in osteosarcoma development. [score:6]
These results suggest that miR-124 acts as a tumor-suppressor whose downregulation may contribute to the progression and metastasis of osteosarcoma. [score:6]
Up-regulation of miR-124 significantly inhibited cell proliferation, migration and invasion; reduced cell viability in osteosarcoma cell lines, indicating that repression of miR-124 might promote tumor progression in osteosarcoma carcinogenesis. [score:6]
In line with previous studies, in our study, we also found that miR-124 was down-regulated in 60 cases (60/70, 85.7%) osteosarcoma tissues compared with the adjacent tissues and the expression of miR-124 in osteosarcoma tissues was significant lower than in adjacent tissues. [score:5]
Overexpression of miR-124 inhibits osteosarcoma cell migration and invasion. [score:5]
The expression of miR-124 is very low in many types of cancer cell and miR-124 is usually considered as a tumor-suppressant miRNAs that induces down regulation in many different cancer types, including both solid tumors and hematologic malignancy [22]– [25]. [score:5]
0091566.g002 Figure 2 (A) Expression levels of miR-124 were examined by real-time PCR after transfection of 50 nmol/L of miR-124 mimics or sramble or no transfection or miR-124 inhibitor. [score:5]
The function of Rac1 is further supported by the observations that inhibition in cell invasion by miR-124–overexpression was significantly attenuated by re-introduction of Rac1. [score:5]
Overexpression of Rac1 inpairs miR-124 -induced inhibition of invasion in MG-63 cells. [score:5]
In these malignancies, forced expression of miR-124 inhibits cancer cell growth. [score:5]
In addition, we found that overexpression of miR-124 suppressed osteosarcoma cell proliferation, migration and invasion in osteosarcoma cells MG-63 and U2OS. [score:5]
Overexpression of miR-124 inhibits osteosarcoma cell growth and affects cell cycle. [score:5]
Gastroenterology 21 Li KK, Pang JC, Ching AK, Wong CK, Kong X, et al (2009) miR-124 is frequently down-regulated in medulloblastoma and is a negative regulator of SLC16A1. [score:5]
Inhibition in cell invasion by miR-124–overexpression was significantly attenuated by re-introduction of Rac1 (Fig. 5B). [score:5]
In conclusion, the current study provides novel evidence that miR-124 functions as a tumor suppressor miRNA in osteosarcoma through repression of Rac1 expression. [score:5]
Overexpression of Rac1 inpairs miR-124 -induced inhibition of invasion. [score:5]
In this study, we found that miR-124 expression is down-regulated in osteosarcoma cells and tissues compared with osteoblastic cell and paired adjacent nontumoral bone tissues. [score:5]
To study the relationship of miR-124 with osteosarcoma development, the expression of miR-124 was detected in 70 clinical patients using Taqman real-time PCR. [score:4]
miR-124 is down-regulated in osteosarcoma cell lines and tissues. [score:4]
Furthermore, we also identified Rac1 as a direct target of miR-124. [score:4]
Meanwhile, miR-124 was up-regulated in 10 cases (10/70, 14.3%). [score:4]
Rac1 is a direct target of miR-124. [score:4]
Recently, miR-124 has been reproted to be down-regulated in some types of cancer, such as gastric cancer, breast cancer, hepatocellular carcinoma and glioblastoma [11]– [14]. [score:4]
Rac1 targeting is involved in miR-124–mediated antitumor properties in osteosarcoma cells. [score:3]
Our data showed that the ability of miR-124 to target Rac1 may provide one such mechanism of post-transcriptional control of Rac1. [score:3]
miR-124 targets Rac1 in osteosarcoma. [score:3]
Statistical analyses reveal that the expression level of miR-124 was significantly correlated with the metastases. [score:3]
miR-124 inhibits cell migration and invasion in vitro. [score:3]
The expression of miR-124 was examined in 4 human osteosarcoma cells lines (MG-63, U2OS, SOSP-9607, and SAOS-2), 4 osteosarcoma tissues and adjacent non-neoplastic tissues (Fig. 1B). [score:3]
In general, the expression of miR-124 in osteosarcoma tissues was significant lower than in adjacent tissues. [score:3]
The miR-124 mimics, inhibitor and the scramble mimics, which are non-homologous to the human genome were synthesized by GenePharma (Shanghai, China, Table 2) and transfected into the cells to a final oligonucleotide concentration of 10 nmol/L. [score:3]
miR-124 inhibits osteosarcoma cell proliferation and cell cycle progression. [score:3]
The expression of miR-124 in human osteosarcoma cell lines and tissues. [score:3]
Our findings on miR-124 are encouraging and suggest that this miRNA could be a potential target for the treatment of osteosarcoma in future. [score:3]
Furthermore, the lower expression of miR-124 in osteosarcoma specimens was correlated with metastasis. [score:3]
Out of 70 osteosarcoma samples, miR-124 was down-regulated in 60 cases (60/70, 85.7%) compared with adjacent tissues when the cutoff was set up as 2.0 (Fig. 1C). [score:3]
However, whether miR-124 is deregulated in osteosarcoma and its roles in osteosarcoma carcinogenesis and progression are still elusive. [score:2]
MiR-124 overexpression reduced the protein but not the mRNA levels of Rac1 in NP cells. [score:2]
Furthermore, the expression of miR-124 in osteosarcoma tissues decreased obviously compared with the adjacent tissues (Fig. 1B). [score:2]
Next, the effect of miR-124 on the translation of Rac1 mRNA into protein was assessed by luciferase reporter assay (Fig. 3C). [score:2]
miR-124 was first demonstrated to be a “brain-specific” miRNA, and was shown to regulate of BDNF [17], [18]. [score:2]
CCK-8 proliferation assary showed that cell growth rate was reduced in miR-124 mimics -transfected MG-63 and U2OS cells compared with scramble -transfected cells or untreated cells or inhibiors -transfected. [score:2]
To further verify the role of miR-124 in the development of osteosarcoma, cell transfection was performed. [score:2]
These osteosarcoma cells lines exhibited extraordinarily low expression of miR-124 compared to the 4 pairs of adjacent tissues. [score:2]
However, miR-124 inhibitor decreased the proportion of MG-63 and U2OS cells in G0/G1-phase and increased the propotion of MG-63 and U2OS cells in S-phase when compared with the scramble or untreated group. [score:2]
As predicted by PicTar, there was complementarity between has-miR-124 and Rac1 3′-UTR (Fig. 4A). [score:1]
0091566.g004 Figure 4 (A) Predicted duplex formation between human Rac1 3′-UTR and miR-124, Rac1 3′-UTR is highly conserved in different species. [score:1]
Both of two cell lines treated with miR-124 mimics were distinctively less migratory than scramble control or untreated cells at 12, 24, and 36 hours after scratching (Fig. 3A). [score:1]
To study the role of miR-124 in osteosarcoma carcinogenesis, MG-63 and U2OS were transfected with miR-124 mimics, both of them showed great transfection efficiency (Fig. 2A). [score:1]
Expression of miR-124 in clinical osteosarcoma patients and their correlation analysis with clinicopathological characteristics. [score:1]
Lower panel, sequence of the miR-124 binding site within the Rac1 3′-UTR of four species. [score:1]
Our findings, together with those other groups, suggest that miR-124 has a fundamental role in tumorigenesis and cancer cell invasion. [score:1]
miR-124 also is known to play an important role in the progression of diverse types of cancers [19]– [21]. [score:1]
Furthermore, we conducted cell invasion assay of Matrigel and stained the invaded cells to measure the directional invasion ability of the cells after ectopically expressing miR-124 in MG-63 and U2OS cells. [score:1]
After 24 h in culture, these cells were then co -transfected with either miR-124 (20 nM) and 2.0 µg pcDNA-Rac1, miR-124 (20 nM) and 2.0 µg pcDNA-empty. [score:1]
Upper panel, sequence alignment of miR-124 with binding site on the Rac1 3′-UTR. [score:1]
Thus, our date suggest important roles of miR-124 in osteosarcoma pathogenesis and indicate its potential application in cancer therapy. [score:1]
The HEK293T cells were co -transfected with 0.4 µg of the reporter construct, 0.2 µg of pGL-3 control vector, and miR-124 or negative controls. [score:1]
MG-63 cells in 6-well plates were first transfected with miR-124 or scrambled dsRNAs (60 nM). [score:1]
[1 to 20 of 66 sentences]
20
[+] score: 229
Other miRNAs from this paper: hsa-mir-214, hsa-mir-124-1, hsa-mir-124-3
Data suggested over -expression of miR-124 could down-regulate Vimentin, N-cadherin, ABCG2, SOX2 and Oct4 expression and up-regulate E-cadherin, ZO-1 expression, while over -expression of PRRX1 could rescue this effect. [score:15]
Furthermore, the up-regulation of miR-124 led to a simultaneous downregulation in the expression of stemness-related genes, namely, ABCG2, SOX2, and Oct4. [score:9]
Our results suggest that the up-regulation of miR-124 increases the expression of epithelial markers like E-cadherin and ZO-1 while simultaneously decreasing the expression of mesenchymal markers such as N-cadherin and Vimentin. [score:8]
These observations indicated that miR-124 sensitized cells to IR by downregulating the expression of PRRX1. [score:6]
Moreover, PRRX1 up-regulation rescued the effects of miR-124-overexpression on radiosensitivity of cells. [score:6]
In addition, the overexpression of miR-124 would cause the modulation of EMT and stemness-related genes expression, both of which are closely related with radioresistence. [score:5]
0093917.g005 Figure 5(A) PRRX1 expression was detected by western blot after transfecting pcDNA3.1-PRRX1 into miR-124 -overexpressed cells. [score:5]
Ectopic PRRX1 Reverses the expression of EMT and Stemness-related genes in Stably miR-124 -overexpressed cell Lines. [score:5]
To further reveal the functions of PRRX1 on cell radiosensitivity, we constructed stable PRRX1-knockdown cell lines LOVO and SW480 and found that PRRX1 knockdown induced cell sensitivity to irradiation in a manner that is similar to the effect induced by the overexpression of miR-124. [score:5]
PRRX1 expression was detected by qRT-PCR and western blot after modulation the expression of miR-124(Fig. 3B, 3C, 3D). [score:5]
In accordance with the data obtained from CRC cell lines, the average expression level of miR-124 was significantly lower in CRC specimenscampared to adjacent normal tissues (Fig. 1B) (A) miR-124 was expressed at significantly lower levels in six CRC cell lines in comparison with normal colonic mucosa pooled from three healthy individuals. [score:5]
We performed a bioinformatics analysis using TargetScan and Pictar and predicted that miR-124 may target PRRX1 3′UTR region. [score:5]
Table S4 Radiosensitivity parameters after overexpression of PRRX1 in miR-124 -overexpressed cell lines. [score:5]
Restoration of PRRX1 expression in miR-124 -overexpressed cells rescues the effects of miR-124 on radiosensitivity. [score:5]
Western blot analysis showed that PRRX1 could reverse the expression of EMT and stemness-related genes caused by overexpression of miR-124 (Fig. 6). [score:5]
In this research study, we have illustrated that miR-124 sensitized colorectal cancer cells to radiation treatment to some extent by downregulating PRRX1. [score:4]
PRRX1 Is a Direct Target of miR-124. [score:4]
We wonder whether miR-124 brings about this effect by downregulating PRRX1. [score:4]
Moreover, cells undergoing EMT showed greater radioresistance in human tumor cells [26], [31]– [33] Taking these observations into consideration, we inferred that miR-124 could radiosensitize CRC cells by downregulating PRRX1, which is associated with EMT and cancer stem cells. [score:4]
These research studies have illustrated that overexpression of miR-124 could radiosensitize CRC cells and miR-124 knockdown induced cell resistance to irradiation. [score:4]
miR-124 is down-regulated both in primary CRC tissues and cell lines. [score:4]
Moreover, PRRX1 is a novel, direct target of miR-124 that induces irradiation resistance. [score:4]
PRRX1 is a direct target of miR-124. [score:4]
MiR-124 is a brain-enriched miRNA, which is significantly down-regulated in many human malignant tumors, including glioblastoma, gastric carcinoma, medulloblastoma, hepatocellular carcinoma, and CRC [14]– [22]. [score:4]
Taken together, all these results strongly indicate that PRRX1 is a target of miR-124 in CRC cells. [score:3]
We found that when combination with IR, the overexpression of miR-124 significantly enhanced the apoptosis of cells in CRC cells than in the controls (Fig. 2B). [score:3]
MiR-124 Is Frequently Down-regulated in CRC Cell Lines and Tissues. [score:3]
Recent studies have shown that miR-124 radiosensitizes human glioma cells by targeting CDK4 [23]. [score:3]
0093917.g002 Figure 2 (A) LOVO and SW480 cells stably over -expression of miR-124 were treated with 0, 2, 4, 6, or 8Gy of IR. [score:3]
A panel of human CRC cell lines was quantitatively analyzed to determine the expression level of miR-124. [score:3]
Enforced expression of PRRX1 Restores the effects of miR-124 on radiosensitivity. [score:3]
Furthermore, we examined the expression level of miR-124 in CRC specimens and the matched normal tissues. [score:3]
In addition, the overexpression of PRRX1 could rescue the effect of miR-124 on EMT by stemming genetic alterations. [score:3]
0093917.g001 Figure 1(A) miR-124 was expressed at significantly lower levels in six CRC cell lines in comparison with normal colonic mucosa pooled from three healthy individuals. [score:3]
The GeneTailor Site-Directed Mutagenesis System (Invitrogen, USA) was used to perform site-directed mutagenesis of the miR-124 binding site in PRRX1 3′-UTR: the resultant was named mutant (mt) 3′-UTR. [score:3]
0093917.g007 Figure 7(A) Over -expression of miR-124 sensitized SW480 tumor xenografts to IR in vivo. [score:3]
Western blot analysis also indicated PRRX1 could restore the expression of caspase-3 and Bcl-2, which was triggered by miR-124 (Fig. 5D). [score:3]
To elucidate whether the effect of miR-124 on radiosensitivity was mediated by repression of PRRX1, pcDNA3.1-PRRX1 was transfected into miR-124 -overexpressed cells. [score:3]
Thereafter, we transfected pcDNA3.1-PRRX1 into miR-124 -overexpressed CRC cell lines SW480 and LOVO. [score:3]
These results indicate that the effect of miR-124 on cell sensitivity to irradiation is partly mediated by repressing the expression of PRRX1. [score:3]
Table S2 Radiosensitivity parameters after overexpression of miR-124. [score:3]
In this study, we found that miR-124 was downregulated in both CRC-derived cell lines and clinical CRC samples compared with normal tissues. [score:3]
Moreover, we have developed a new approach to sensitizing radioresistant cancers by targeting miR-124. [score:3]
We identified PRRX1 was a direct target of miR-124 by luciferase assay. [score:3]
Despite receiving the same dose of radiation (d11,10Gy) (Fig. 7A,7B), the size of xenografts derived from miR-124 -overexpressed cells were much smaller than that derived from control treated cells. [score:3]
In conclusion, we provide evidence that miR-124 sensitizes CRC cells to radiation treatment by inhibiting PRRX1. [score:3]
Compared with the normal colonic mucosa pooled from three healthy individuals, the expression level of miR-124 was lower in the six examined CRC cell lines. [score:2]
Clonogenic assay and cell apoptosis suggested that the ectopic expression of PRRX1 significantly reduced miR-124 -induced radiosensitivity (Fig. 5B and Supplementary TableS4, Figure. [score:2]
The clonogenic assay results confirmed that the overexpression of miR-124 were much more sensitive to IR than their counterparts (Fig. 2A and Supplementary Table S2). [score:2]
To determine whether miR-124 sensitizes tumors to IR in vivo, we irradiated the tumor area just once using a dose of 10 Gy 11 days after injection. [score:1]
MiR-124 mimic, a non-specific miR control, anti-miR-124, and a non-specific anti-miR control were purchased from Thermo Scientific Dharmacon(USA). [score:1]
Statistical significance(* P<0.05) is indicated vs LV-con and miR-124 group. [score:1]
Indeed, there was perfect base pairing between the seed sequence of mature miR-124 and the 3′UTR of PRRX1 mRNA, and these seed sequences were conserved across species (Fig. 3A). [score:1]
However, the function of miR-124 on radioresistance has been scarcely understood till date. [score:1]
The pre-miR-124 sequence was amplified and cloned into pCDH-CMV-MCS-EF1-coGFP constructs (System Biosciences, California, USA). [score:1]
miR-124 sensitizes colorectal cancer cells to irradiation treatment in vitro. [score:1]
miR-124 sensitizes colorectal cancer cells SW480 to irradiation treatment in vivo. [score:1]
The activity of mt 3′UTR vector was not affected by a simultaneous transfection with miR-124 (Fig. 3E, lanes 7 and 8). [score:1]
These findings have been uncovered for the first time, thereby illustrating how miR-124 plays a key role in inducing cells resistance to ionizing radiation. [score:1]
0093917.g003 Figure 3 (A) The predicted binding sequences for miR-124 within the human PRRX1 3′UTR. [score:1]
In this study, we illustrated that miR-124 enhanced the sensitivity to radiation, both in CRC cells and human xenograft tumors. [score:1]
The precursor form of miR-124 was amplified. [score:1]
On the other hand, caspase-3 and phosphorylation of histone H2AX (γ-H2AX) [30], an indicator of the cellular response to DNA damage increased when cells were either treated with miR-124 alone or subjected to a combined treatment of miR-124 and radiation therapy (Fig. 2C). [score:1]
The restoration of PRRX1 could rescue the effects caused by miR-124. [score:1]
The virus particles were harvested 48 h after transfecting pCDH-CMV-miR-124 with the packaging plasmid pRSV/pREV, pCMV/pVSVG, and pMDLG/pRRE into 293T cells using Lipofectamine 2000 reagent (Invitrogen, USA). [score:1]
In accordance with the data obtained from CRC cell lines, the average expression level of miR-124 was significantly lower in CRC specimenscampared to adjacent normal tissues (Fig. 1B) The colony survival assay is considered as a canonical standard to determine radiosensitivity [29]. [score:1]
In addition, we observed that miR-124 treatment alone can decrease Bcl-2, and the effect was much stronger when combined with radiation therapy. [score:1]
The results showed that PRRX1could rescue the effects of miR-124. [score:1]
To gain an insight into the function of miR-124, we performed in vitro experiments and human xenograft studies. [score:1]
Thereafter, HEK293 cells were transfected with wt or mt 3′UTR vector and miR-124 mimics. [score:1]
For miR-124, reverse transcription and qRT-PCR reactions were performed using a qSYBR-green-containing PCR kit (GenePharma, Shanghai, China). [score:1]
This indicates that miR-124 is an attractive prognostic/predictive biomarker, which can be used in diagnosing CRC cases. [score:1]
These results indicated that miR-124 caused an in vivo sensitization of tumors to radiation. [score:1]
So, we sought to explore the effects of miR-124 on the colony survival of CRC cells in the presence of ionizing radiation. [score:1]
What's more, cotransfection with anti-miR124 and wt 3′UTR vector in HEK293 cells led to an increase of luciferase activity (Fig. 3E, lanes 4 and 5; P<0.05). [score:1]
Taken together, these observations illustrated a synergistic effect between miR-124 restoration and IR. [score:1]
[1 to 20 of 76 sentences]
21
[+] score: 222
We also demonstrated that upregulation of miR-124 expression corresponded to decreased expression of its target, DNM2, in the JEV-infected PK15 cells. [score:10]
We show that expression of miR-124 is upregulated in response to JEV infection and that this results in the suppression of the target gene, DNM2, which is required for virus replication. [score:10]
Subsequently, miR-124 suppresses expression of the DNM2 gene via targeting its 3’ UTR sequence. [score:7]
The results confirmed the previous reports and further showed that miR-124 was upregulated immediately upon infection (4 hpi) and remained upregulated throughout the infection. [score:7]
To elucidate which host genes are targeted by miR-124, a genome-wide computational analysis of all potential miR-124 targets was performed using the TargetScan software (http://www. [score:7]
Considering the important role of DNM2 in the regulation of virus entry, it is possible that miR-124 -mediated suppression of DNM2 expression may block JEV -induced vesicle scission, thereby contributing to the antiviral effect of miR-124. [score:6]
Thus, we conclude that upregulation of miR-124 and the subsequent suppression of DNM2 represents a host response aimed at limiting JEV infection. [score:6]
The percentage of internalized viruses in the transfected cells was determined by flow cytometry and normalized to the value for the siCtrl, * p < 0.05 Previous studies indicated that expression of miR-124 is upregulated by JEV in swine testis cells [30]. [score:6]
In order to test this hypothesis, we screened for miR-124 targets using TargetScan and ultimately focused on the DNM2 gene. [score:5]
Therefore, miR-124 targets pig DNM2 gene mainly interacting with the second target site (miR-124 site2) of DNM 3’UTR. [score:5]
However, transfection of the miR-124 mimic did not significantly alter the expression of luciferase from the reporter constructs bearing either of the predicted miR-124 target sites from the JEV RNA (Fig.   2B). [score:5]
Therefore,miR-124 targets pig DNM2 gene mainly interacting with the second target site (miR-124 site2) of DNM 3’UTR. [score:5]
In addition, miR-124 was attenuated in several tumors, and the overexpression of miR-124 inhibited the metastasis of breast cancer and hepatocellular carcinoma [41, 42]. [score:5]
Therefore, the mechanism by which miR-124 inhibits virus replication is likely to involve miR-124 -mediated regulation of host genes. [score:4]
Renilla luciferase values were normalized against firefly luciferase values, ** p < 0.01, NS, not significantTo confirm that miR-124 directly targets the 3’UTR of DNM2, dual-luciferase reporter plasmids (psiCHECK2 Vector) carrying the DNM2 3’UTR with the wild-type or base-pair mutant miR-124 binding regions was constructed (Fig.   3A). [score:4]
Interestingly, previous studies showed that miR-124 could play an important role in virus entry by disturbing receptor -mediated endocytosis, and miR-124 was upregulated in JEV-infected porcine cells [30, 43]. [score:4]
Previous studies using high-throughput sequencing technology found that miR-124 was downregulated by JEV in swine testis cells [30]. [score:4]
Renilla luciferase values were normalized against firefly luciferase values, ** p < 0.01, NS, not significant To confirm that miR-124 directly targets the 3’UTR of DNM2, dual-luciferase reporter plasmids (psiCHECK2 Vector) carrying the DNM2 3’UTR with the wild-type or base-pair mutant miR-124 binding regions was constructed (Fig.   3A). [score:4]
miR-124 is highly expressed in neurons (representing 25 % to 48 % of all brain miRNAs), and it was first cloned from the mouse brain where it was later found to mediate neuronal differentiation [28, 29]. [score:3]
Because miR-124 did not target the JEV RNA, we instead focused on exploring host factors that may be involved in these antiviral processes. [score:3]
In order to determine the biological role of miR-124 in the host response to JEV infection, miR-124 was overexpressed through miRNA mimic transfection in order to assess its effect on JEV replication. [score:3]
miR-124 is highly expressed in neurons, and it plays a notable role in neuronal differentiation [28]. [score:3]
In addition, the expression of miR-124 and DNM2 is inversely affected by JEV infection. [score:3]
The expression level of miR-124 (a) and DNM2 mRNA (b) was assessed by qRT-PCR at 48 h after transfection. [score:3]
Interestingly, nucleotides 3–8 of the miR-124 (fall within seed region) was perfectly complementary with DNM 3’UTR in the miR-124 site 2, the other target position from the canonical seed region (nucleotides 2–8). [score:3]
These results demonstrate that expression of miR-124 and DNM2 are differentially modulated by JEV infection, which indicates that miR-124 and DNM2 play different roles in influencing JEV replication. [score:3]
Fig. 6Expression of miR-124 and DNM2 in PK15 cells during JEV infection. [score:3]
miR-124 inhibits JEV replication. [score:3]
c Western blot analysis of dynamin-2 expression in cells transfected with the NC and miR-124 mimics at 48 h after transfection. [score:3]
In addition, recent studies showed that miR-124 was differentially expressed in JEV-infected porcine cells [30]. [score:3]
PK15 cells were transfected with miR-124 specific or nonspecific miRNA mimics, and at 48 hpt, the expression of DNM2 was analyzed by qRT-PCR and western blot analysis. [score:3]
b Effect of miR-124 mimic on the expression of luciferase from reporter constructs. [score:3]
Furthermore, using bioinformatics tools, we identified dynamin2 (DNM2), a GTPase responsible for vesicle scission, as a target of miR-124. [score:3]
Fig. 2JEV genomic RNA is not the target of miR-124. [score:3]
In this study, we demonstrated that miR-124 inhibited JEV replication in porcine kidney epithelial PK15 cells. [score:3]
Luciferase activity markedly decreased when cells were co -transfected with the miR-124 mimic and wild-type or mutant target site1(Mut1) DNM2 3’UTR plasmids in comparison with NC mimic (Fig.   3B). [score:3]
The luciferase reporter assay showed that miR-124 directly interacts with the 3’ UTR of DNM2 and that DNM2 mRNA and protein levels were reduced in cells overexpressing miR-124 (Figs.   3 and 4). [score:3]
This finding implies that the miR-124-DNM2-pathway plays an important role in the suppression of virus replication. [score:3]
JEV genomic RNA is not a target of miR-124. [score:3]
Expression levels of miR-124 and DNM2 were normalized to U6 snRNA and RPL32, respectively. [score:3]
DNM2 is a target of miR-124. [score:3]
1: The pathways of predicted target genes of miR-124. [score:3]
In this study, quantitative methods were used to determine expression levels of miR-124 in PK15 cells before and after JEV infection. [score:3]
a Computational prediction of potential miR-124 target sites in JEV genomic RNA. [score:3]
a Potential base pairing is indicated by vertical lines between the sequence of miR-124 (bold) and its target sequences within the 3’ UTR of DNM2 in pig, human and mouse. [score:3]
The expression of miR-124 was significantly increased in the miR-124 transfection group when compared to the NC mimic (Fig.   4A). [score:2]
In order to determine whether via a direct interaction with viral RNA, computational screening of viral RNA for potential miR-124 binding sites was performed. [score:2]
These results suggest that miR-124 may be involved in the regulation of JEV infection. [score:2]
However, miR-124 may also target other host regulators, and their roles in JEV replication may have yet to be evaluated. [score:2]
JEV infection was significantly reduced in cells transfected with the miR-124 mimic (Fig.   1A, B), and the expression of JEV E protein was also decreased when compared to cells transfected with the NC mimic (Fig.   1C). [score:2]
To determine the levels of miR-124 and DNM2 during JEV infection, PK15 cells were infected with JEV, and the miR-124 and DNM2 mRNA levels were subsequently quantitated by qRT-PCR at different times post-infection. [score:1]
Thus, the key new finding of this study is that miR-124 is an anti-JEV miRNA. [score:1]
Mock-infected (M) or virus-infected (V) cells were harvested at the indicated times, and the miR-124 and DNM2 RNA levels were quantified using qRT-PCR. [score:1]
The flow cytometry and Western blot experiments revealed that miR-124 exhibited a significant antiviral effect (Fig.   1). [score:1]
miR-124 JEV DNM2 PK15 Porcine Japanese encephalitis virus (JEV) is a mosquito-borne neurotropic virus that belongs to the family flaviviridae. [score:1]
However, the luciferase reporter assay showed that miR-124 does not directly interact with the 2 predicted sites in the JEV RNA (Fig.   2). [score:1]
According to the online software analysis, there were two potential miR-124 binding sites in the JEV genomic RNA. [score:1]
BHK-21 cells were co -transfected with reporter constructs and the miR-124 or nonspecific (NC) miRNA mimics. [score:1]
The two miR-124 binding sites in the 3’UTR of DNM2 were conserved in Vertebrata, which includes pigs, mice and humans. [score:1]
Nucleotide sequences from JEV RNA predicted to interact with miR-124 were inserted into the 3’UTR of h-luc in the psiCHECK-2 vector. [score:1]
The DNM2 3’UTR mutants (Mut1 and Mut2), containing a mutated miR-124 binding site, are shown. [score:1]
We used ViTa software [36] to identify two potential miR-124 binding sites in the genomic RNA of the JEV strain. [score:1]
miR-124 levels increased as early as 4 hpi and showed modest increases of 1.2 to 1.5-fold in the first 24 hpi. [score:1]
We previously found that JEV infected PK15 cells via clathrin -dependent endocytosis [8], and miR-124 reduced caveolar density in porcine PK15 cells [43]. [score:1]
The observed changes in the JEV replication efficiency of cells transfected with the miR-124 mimic provide strong evidence for the antiviral activity of miR-124. [score:1]
The sequences of siDNM2 and mimics were as follows: siDNM2 5’-GGACAUGAUCCUGCAGUUTT-3’ [49], miR-124 mimics: 5’- UAAGGCACGCGGUGAAUGCCA-3’, NC (Negative control): 5’-UUCUCCGAACGUGUCACGUTT-3’. [score:1]
These data indicate that the antiviral effect of miR-124 is mediated by its interaction with the host genes. [score:1]
At 36 and 48 hpi, miR-124 levels increased abruptly (8-fold) (Fig.   6A). [score:1]
PK15 cells were transfected with nonspecific (NC) or miR-124 mimics as indicated. [score:1]
In order to examine the effect of miR-124 on JEV replication, PK15 cells were transfected with either a miR-124 mimic or a nonspecific (NC) mimic at a concentration of 50 nM, and then were infected with JEV at MOI = 1 after 36 h of transfection. [score:1]
miR-124 and DNM2 are inversely affected by JEV infection. [score:1]
The two miR-124 binding sites are located in the E and NS4B genes (Fig.   2A). [score:1]
Therefore, miR-124 may play a notable role in JEV infection. [score:1]
PK15 cells were transfected with synthetic mimics specific to miR-124 or nonspecific (NC) mimics. [score:1]
In addition, we assessed the effect of miR-124 mimic transfections on porcine DNM2 mRNA and protein levels. [score:1]
Overall, these results suggest the importance of miR-124 in modulating JEV replication and provide a scientific basis for using cellular miRNAs in anti-JEV therapies. [score:1]
b BHK-21 cells were co -transfected with luciferase reporter vectors containing the wild type or mutant 3’UTR of porcine DNM2 and the miR-124 mimic or miR -negative control. [score:1]
[1 to 20 of 77 sentences]
22
[+] score: 221
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-124-1, hsa-mir-124-3
As Stat3 is a key upstream regulator of HER2 expression (16, 17), down-regulation of miR-124 might be a driver event that causes up-regulation of Stat3 and, subsequently, cells lacking miR-124 are more likely to form HER2 -positive tumors with a higher resistance to radiotherapy (18, 19). [score:10]
Forced miR-124 expression in HER-2 positive breast cancer cell line SKBR3 resulted in down-regulation of Stat3 expression, inhibition of Stat3 signaling pathway, and enhanced sensitivity to irradiation. [score:10]
We then performed dual-luciferase reporter assays to determine whether miR-124 could regulate Stat3 expression by directly targeting its 3′-UTR. [score:6]
Bioinformatic prediction and function assay suggested that miR-124 directly targeted Stat3, which is a key regulator of HER2 expression. [score:6]
Interestingly, qPCR miR-124 expression was significantly lower in SKBR3 cells than in T47D and MCF7 cells (Figure 1B), suggesting a regulatory role of miR-124 inherently associated with HER2 expression. [score:6]
Liver X receptors signaling, which is a nuclear receptor signaling pathway playing a critical role in tumor metabolism and inflammatory responses (24), was also significantly down-regulated upon miR-124 overexpression. [score:6]
MiR-124 overexpression inhibited the proliferation of prostate cancer cells in vitro and sensitized them to inhibitors of androgen receptor signaling (13). [score:6]
Interestingly, Arabkheradmand et al (11) reported an association between miR-124 down-regulation and advanced clinical stage and the presence of lymph node metastasis in Iranian patients with breast cancer, however, they found no association between microRNA expression and HER2 status. [score:6]
In line with this, miR-124 overexpression in SKBR3 cells potently reduced the expression of endogenous Stat3 protein (Figure 2C). [score:5]
This regulatory loop might explain the preferential down-regulation of miR-124 in HER2 -positive breast cancer cells. [score:5]
Consistently, previous studies have reported that miR-124 functions as an important tumor suppressor in various cancers by targeting a variety of different proteins. [score:5]
MiR-124 overexpression down-regulated Stat3 and potently enhanced cell death upon irradiation. [score:5]
Based on pathway-specific transcription factor-responsive luciferase reporters, this systematic approach allowed us to identify 10 signaling pathways that were significantly suppressed and 4 signaling pathways that were significantly activated upon miR-124 overexpression (Figure 1D, >2 fold change, P < 0.001). [score:5]
Moreover, increased Stat3 expression and reduced miR-124 expression were associated with a poor response to radiotherapy in HER2 -positive breast cancers. [score:5]
Putative genes that are miR-124 targets were analyzed using TargetScan V7.1 (http://www. [score:5]
miR-124 overexpression in HER2 -positive breast cancer cells suppressed Stat3 signaling. [score:5]
As expected, miR-124 overexpression largely reduced protein expression of Stat3 and significantly abolished Stat3 phosphorylation in SKBR3 cells (Figure 3A, P < 0.001). [score:5]
As expected, Stat3 expression was significantly higher in non-responders than in responders (P = 0.032, Mann-Whitney U test), while miR-124 expression was significantly lower in non-responders than in responders (P = 0.002, Mann-Whitney U test). [score:5]
Weak miR-124 expression might enhance Stat3 expression and radiotherapy resistance in HER2 -positive breast cancer cells. [score:5]
Moreover, miRNA-124 might inhibit glioma cell migration and invasion by targeting ROCK1 gene and impairing actin cytoskeleton rearrangements and reducing cell surface ruffle (14). [score:5]
For example, it has been shown that miR-124 could directly target androgen receptor, enhancer of zeste homologue 2, and proto-oncogene tyrosine-protein kinase, which all contribute to prostate cancer progression and treatment resistance. [score:4]
Compared with control, miR-124 overexpression in SKBR3 cells inhibited the transcriptional activity of luciferase reporter containing the Stat3 3′UTR, but had no effect on the activity of the mutant lacking the miR-29b binding site (Figure 2B). [score:4]
Down-regulation of miR-124 in HER2 -positive breast cancers. [score:4]
Stat3 was a direct target of miR-124 in HER2 -positive breast cancer cells. [score:4]
We identified Stat3 as a putative direct target of miR-124 (Figure 2A). [score:4]
In the current study, we showed that miR-124 was down-regulated in breast cancer, particularly in HER2-postive breast cancer. [score:4]
These results support the function of miR-124 as a tumor suppressor in breast cancer and suggest a special regulatory role of miR-124 in HER2 -positive breast cancer subtypes. [score:4]
MiR-124 expression was significantly down-regulated in tumors compared with the matched normal tissues (Table 1, P = 0.002, paired t test). [score:4]
Target gene of miR-124 was determined using Targetscan and validated by and dual-luciferase assay. [score:4]
Figure 2Signal transducer and activator of transcription 3 (Stat3) was a direct target of microRNA-124 (miR-124). [score:4]
MiR-124 expression was down-regulated in HER2 positive breast cancers compared with normal tissues, and was negatively associated with tumor size. [score:4]
Cells cultured in 6-well plate were transfected with miR-124 or scramble control for 36 h, and then plated on the Cignal for transfection with a mixture of a transcription factor responsive firefly luciferase reporter and a constitutively expressing Renilla construct in each well. [score:3]
Activity changes of 50 canonical signaling pathways upon miR-124 overexpression were determined using Cignal. [score:3]
To test whether miR-124 overexpression enhances response to irradiation in HER2 -positive breast cancer, SKBR3 cells were transfected with miR-124 or scramble duplex and then treated with 10 Gy irradiation, a dose reported previously (15). [score:3]
Overexpression of miR-124 enhances response to irradiation in HER2 -positive breast cancer. [score:3]
Figure 1Changes in signal transduction upon microRNA-124 (miR-124) overexpression in human epidermal growth factor receptor 2 (HER-2) -positive cells. [score:3]
Activity changes of 50 canonical signaling pathways in response to miR-124 overexpression were determined using (Qiagen, Cambridge, MA, USA). [score:3]
In line with these results, flow cytometry analysis revealed that forced miR-124 expression dramatically enhanced cell death upon irradiation in SKBR3 cells (Figure 3B and C). [score:3]
Further large-scale studies are required to validate the association between miR-124 expression, HER2 status, and radioresistance in different populations. [score:3]
We thus believe that the miR-124 could be a promising new drug target for adjuvant radiotherapy in HER2 -positive breast cancers. [score:3]
To generate the luciferase reporter vector, a 312 bp human Stat3 gene 3′-untranslated regions (3′-UTR) segment encompassing the predicted miR-124 binding sites was PCR-amplified and subcloned into the pGL3 luciferase plasmid. [score:3]
Figure 3MicroRNA-124 (miR-124) overexpression enhances sensitivity to irradiation. [score:3]
In conclusion, these results suggest that miR-124 is a biomarker for HER-2 positive breast cancer and a putative novel therapeutic target that can be used to overcome radiotherapy resistance. [score:3]
Figure 4MicroRNA-124 (miR-124) expression and signal transducer and activator of transcription 3 (Stat3) is linked to radiotherapy resistance in vivo. [score:3]
In the current study, using a Cignal, we systematically scanned the signaling activity changes of 50 major pathways upon miR-124 overexpression in HER2 -positive cells. [score:3]
Second, we only focused on HER-2 positive breast cancer, so further studies are required to validate the association between miR-124 expression, HER2 status, and radioresistance in different cancer subtypes. [score:3]
MiR-124 showed the strongest inhibitory effect on the activity of Stat3 signaling pathway (Figure 1D). [score:2]
Together, these in vitro and in vivo results suggest that miR-124/Stat3 regulation is a key factor in radiotherapy response of HER2 -positive breast cancers. [score:2]
in SKBR3 cells resulted in >20-fold increase in miR-124 expression compared with cells transfected with scramble control (Figure 1C). [score:2]
A mutant construct with a disrupted miR-124 binding site was used as a control (Figure 2A). [score:1]
To investigate the molecular mechanisms underlying miR-124 function in HER2 -positive cells, we overexpressed miR-124 in SKBR3 cells. [score:1]
In contrast, without irradiation miR-124 only slightly induced apoptosis. [score:1]
MiR-124 overexpression in HER2 positive breast cancer cell line SKBR3 significantly reduced the activity of Stat3 signaling pathway compared with control transfection (P < 0.001). [score:1]
Total RNA was used as the template for reverse transcription using the TaqMan Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) with probes for miR-124 and U6 as the internal control. [score:1]
Stat3 and miR-124 expression was further measured in 10 relapsed (non-responder) and 10 recurrence-free HER2 -positive breast cancer patients. [score:1]
The sequences of the miRNA duplex were miR-124 sense: 5′- UAAGGCACGCGGUGAAUGCCA-3′; miR-124 antisense: 3′-UAAUUCCGUGCGCCACUUACG-5′. [score:1]
We then used a Cignal to investigate activity changes of 50 canonical signaling pathways upon miR-124 overexpression. [score:1]
Stat3 and miR-124 mediates radiotherapy resistance in HER2 -positive breast cancer patients. [score:1]
Transfection of miR-124 duplex. [score:1]
[1 to 20 of 59 sentences]
23
[+] score: 202
Statistical significance was concluded at * P < 0.05, ** P < 0.01, *** P < 0.001 Knockdown of NEAT1 down-regulates ATGL expression by upregulating miR-124-3p levelsSeveral studies have confirmed that microRNAs are important target of lncRNAs [23, 24]. [score:12]
e Real-time PCR and results revealed that inhibition of NEAT1 down-regulated ATGL expression, and this suppression was attenuated in cells with inhibited miR-124-3p. [score:12]
Our previous results demonstrated that knockdown of NEAT1 down-regulated ATGL expression, and we found that this suppression can be attenuated in HCC cells by inhibiting miR-124-3p (Fig. 6e). [score:11]
Importantly, the knockdown of NEAT1 down-regulated PPARα expression, but this process could be blocked by treatment with miR-124-3p inhibitor (or overexpression of ATGL/treatment with DAG+FFA). [score:11]
d Real-time PCR analysis and western blot analysis revealed that the sh- NEAT1 down-regulated PPARα expression in HCCLM3 and SK-Hep-1 cells, whereas miR-124-3p inhibitor treatment (or overexpression of ATGL/treatment with DAG+FFA) blocked this process. [score:10]
Knockdown of NEAT1 down-regulates ATGL expression by upregulating miR-124-3p levels. [score:10]
Fig. 6Knockdown of NEAT1 down-regulates ATGL expression through upregulation of miR-124-3p levels. [score:10]
NEAT1 was upregulated and miR-124-3p was downregulated in the five HCC tissues compared with the matched non-tumor tissues (Additional file 14: Figure S12A). [score:6]
d Real-time PCR and western blot analysis showing the effect of up-regulation of miR-124-3p using mimic on ATGL expression in HCCLM3 and SK-Hep-1 cells. [score:6]
In addition, our results showed that knockdown of NEAT1 reduced PPARα levels, however, treatment with miR-124-3p inhibitor (or overexpression of ATGL/treatment with 16 μM DAG+FFA) blocked this process (Fig. 7d). [score:6]
NEAT1 regulates ATGL expression via directly bind to miR-124-3p. [score:5]
NEAT1 regulates ATGL expression via competitively binding to miR-124-3p. [score:4]
These results support the idea that NEAT1 regulates ATGL expression through miR-124-3p. [score:4]
NEAT1 regulated ATGL expression by binding miR-124-3p. [score:4]
Next we explored that whether NEAT1 is able to regulate miR-124-3p expression. [score:4]
These results prove that NEAT1 regulate miR-124-3p expression in a sequence-specific and binding -dependent manner. [score:4]
In addition, a dual-luciferase reporter assay demonstrated that miR-124-3p mimics decreased the luciferase activities of NEAT1-WT but failed to influence the mutant, suggesting that miR-124-3p is able to directly bind to the NEAT1-WT target sites in 293 T cells (Fig. 6c). [score:3]
Correlation analyses revealed that expression levels of NEAT1 and ATGL were inversely associated with that of miR-124-3p in 40 clinical HCC samples (Fig. 6g). [score:3]
g Correlation analyses revealed that expression levels of NEAT1 (or ATGL) were inversely associated with those of miR-124-3p in 40 clinical HCC samples. [score:3]
b Real-time PCR analysis showing the effect of sh- NEAT1 on miR-124-3p expression in HCCLM3 and SK-Hep-1 cells. [score:3]
Statistical significance was concluded at * P < 0.05, ** P < 0.01, *** P < 0.001; NS represents no statistical significance To confirm the effect of miR-124-3p on lipolysis, we overexpressed miR-124-3p using miR-124-3p mimics in HCC cell lines. [score:3]
Next, we overexpressed miR-124-3p using a miR-124-3p mimic. [score:3]
For transfection, miR-124-3p mimic, miR-124-3p inhibitor, negative control, siRNA or si-control in Lipofectamine 2000 (Invitrogen) was transfected into cells according to the manufacturer’s instructions. [score:3]
In this study, our results indicated that the interaction of NEAT1 with ATGL might occupy the binding site of miRNAs so that suppression of ATGL by miR-124-3p would be significantly retarded. [score:3]
and qRT-PCR results indicated that exogenous miR-124-3p significantly reduced ATGL expression in HCCLM3 and SK-Hep-1 cells (Fig. 6d). [score:3]
Statistical significance was concluded at * P < 0.05, ** P < 0.01, *** P < 0.001; NS represents no statistical significanceTo confirm the effect of miR-124-3p on lipolysis, we overexpressed miR-124-3p using miR-124-3p mimics in HCC cell lines. [score:3]
Further, inhibition of miR-124-3p reversed this decrease in luciferase activity for ATGL-WT, but not for ATGL-MUT (Additional file 12: Figure S10A). [score:3]
Further, inhibition of miR-124-3p reversed this decrease in luciferase activity for ATGL-WT, but not for ATGL-MUT. [score:3]
A. Real-time PCR analysis of NEAT1 and miR-124-3p expression in five pairs of HCC and matched non-tumor tissues. [score:3]
NEAT1 and miR-124-3p mRNA was aberrantly expressed in 5 pairs of HCC and matched non-tumor tissues. [score:3]
Small interfering RNA (siRNA), si-control, miR-124-3p mimic, miR-124-3p miR-124-3p inhibitor, negative control were purchased from Ribobio (Guangzhou, China). [score:3]
Given the fact that miRNAs can target the nuclear lncRNA [25, 26], we first explored the subcellular distribution of miR-124-3p by FISH. [score:3]
The results indicated that NEAT1 knockdown led to a significant increase in miR-124-3p expression in HCC cells as assayed by qRT-PCR (Fig. 6b). [score:3]
Knockdown of NEAT1 attenuates HCC cell growth through miR-124-3p/ ATGL/ DAG+FFA/ PPARα signalingConsidering that cancer cells have been reported to increase fatty acid oxidation (FAO) for cell survival due to compromised glucose uptake and ATGL-PPARα signaling have been reported to mediate FAO [27, 28], we hypothesized that NEAT1 might serve as a means to mediate FAO through PPARα. [score:2]
Fig. 7Knockdown of NEAT1 attenuates HCC cell growth through miR-124-3p/ ATGL/ DAG+FFA/ PPARα signaling. [score:2]
Additionally, NEAT1 knockdown attenuated HCC cell growth through miR-124-3p/ATGL/DAG+FFA/PPARα signaling. [score:2]
ATGL and its products, DAG and FFA, are responsible for NEAT1 -mediated HCC cell growth through PPARα activation In this study, we demonstrated that the NEAT1/miR-124-3p/ATGL pathway plays an important role in regulating abnormal lipolysis in HCC. [score:2]
Knockdown of NEAT1 attenuates HCC cell growth through miR-124-3p/ ATGL/ DAG+FFA/ PPARα signaling. [score:2]
We identified four microRNAs (hsa-miR-103a-3p, hsa-miR-214-3p, hsa-miR-124-3p and hsa-miR-107) that exhibited potential to bind to both NEAT1 and ATGL. [score:1]
Dual-luciferase reporter assays reveals miR-124-3p is involved in the crossregulation between NEAT1 and ATGL. [score:1]
Additionally, NEAT1 mediates HCC cell growth through the miR-124-3p/ATGL/DAG+FFA/PPARα pathway. [score:1]
The subcelluar distribution of miR-124-3p was explored by FISH. [score:1]
A. Treatment with miR-124-3p mimic decrease intracellular DAG levels in SK-hep-1 and HCCLM3 cells B. Treatment with miR-124-3p mimic decrease intracellular FFA levels in SK-hep-1 and HCCLM3 cells. [score:1]
We also evaluated NEAT1 and miR-124-3p expression in five pairs of HCC and matched non-tumor tissues by qRT-PCR. [score:1]
The predictive information between miR-124-3p and the binding sites in the NEAT1/ATGL 3′-UTRs was illustrated in Fig.   6a. [score:1]
We further analysed the minimum free energy value of the hybrid between miR-124-3p and the binding site on the NEAT1/ATGL 3′-UTRs. [score:1]
a Predicted conserved miR-124-3P binding sites of NEAT1 and ATGL. [score:1]
Meanwhile, dual-luciferase reporter assays demonstrated that both NEAT1 and ATGL directly bind to miR-124-3p. [score:1]
The effect of miR-124-3p on lipolysis. [score:1]
The transfection efficiencies of miR-124-3p were detected by qRT-PCR (Additional file 11: Figure S9A). [score:1]
Therefore, we conclude that NEAT1 promotes HCC cell growth through miR-124-3p/ATGL/DAG+FFA/PPARα signaling. [score:1]
Thus, we concluded that NEAT1 mediates HCC cell growth via miR-124-3p/ATGL/DAG+FFA/PPARα signaling. [score:1]
The transfection efficiencies of miR-124-3p were detected by qRT-PCR (Additional file 11: Figure S9B). [score:1]
A. Representative images showing localization of CY3-miR-124-3p in HCC cell lines. [score:1]
The CY3 labeled miR-124-3p probe were designed and purchased from GenePharma Technologies (Shanghai, China). [score:1]
B The mRNA levels of miR-124-3p in Fig. 7d as detected by qRT-PCR. [score:1]
To further prove that miR-124-3p is involved in the cross-regulation between NEAT1 and ATGL, We performed a rescue experiment with a dual-luciferase reporter assay using ATGL with mutant miR-124-3p binding sites. [score:1]
A. The mRNA levels of miR-124-3p in Fig. 6e as detected by qRT-PCR. [score:1]
The transfection efficiencies of miR-124-3p were detected by qRT-PCR. [score:1]
The results showed that miR-124-3p was present both in the nucleus and cytoplasm (Additional file  10: Figure. [score:1]
[1 to 20 of 60 sentences]
24
[+] score: 199
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3, hsa-mir-140, hsa-mir-141, hsa-mir-675
Results showed that miR-140 inhibition or miR-124 inhibition could upregulate the protein levels of iASPP, Cyclin D1 and CDK1, downregulated the protein levels of P21; XIST knockdown could downregulate the protein levels of iASPP, Cyclin D1 and CDK1, upregulate the protein levels of P21; the effects of miR-140 or miR-124 inhibitor on the indicated protein levels could be partially reversed by XIST knockdown (Figure 7A-7C). [score:21]
Results showed that in BxPC-3 and PANC-1 cells ectopic miR-140/miR-124 expression significantly downregulated XIST expression, while miR-140/miR-124 inhibition upregulated XIST expression (Figure 5E and 5F). [score:15]
Knockdown of XIST was achieved by infection of LV-sh-XIST (Genepharma, China); knockdown of iASPP was achieved by transfection of si-iASPP (Genepharma, China); forced iASPP expression was achieved by transfection of iASPP vector (Genepharma, China); p73 knockdown was achieve by anti-TP73 (Genepharma, China); forced p73 expression was achieved by pcDNA3.1/p73 (Genepharma, China); miR-140/miR-124 overexpression or inhibition was achieved by transfection of miR-140/miR-124 mimics or inhibitor (Genepharma, China) using Lipofectamine 2000 (Invitrogen, USA). [score:14]
In PC tissues, miR-140, miR-124 and P21 expression was downregulated, while iASPP and CDK1 expression was upregulated. [score:11]
Results showed that miR-140, miR-124 and p21 mRNA expression was downregulated, while iASPP and CDK1 mRNA expression was upregulated in PC tissues compared with normal tissues (Figure 9A-9E). [score:10]
In the present study, we observed similar results: miR-124 inhibition upregulated iASPP, CDK1 and Cyclin D1 protein levels while downregulated P21 protein level. [score:9]
In our previous study, we demonstrated that miR-140 inhibits cell growth and invasion in pancreatic duct adenocarcinoma by targeting iASPP [20]; in addition, downregulation of miR-124 predicts poor prognosis in pancreatic ductal adenocarcinoma patients [21]. [score:8]
In this study, we report an inverse dual regulation between X-inactive specific transcript (XIST) and miR-140/miR-124 which regulates PC cell proliferation and cell cycle through directly targeting iASPP. [score:6]
Results showed that the luciferase activity of wt-XIST and wt-iASPP 3’UTR vectors were significantly suppressed by miR-140/miR-124 mimics, increased by miR-140/miR-124 inhibitors; the changes of luciferase activity were abolished by mutations in miR-140 or miR-124 binding sites in XIST or the 3’UTR of iASPP (Figure 6E and 6F). [score:6]
MiR-140/miR-124 mimics or inhibitor was transfected into BxPC-3 and PANC-1 cells to achieve miR-140/miR-124 overexpression or inhibition, respectively; the transfection efficiency was verified by using real-time PCR assays (Figure 5C and 5D). [score:6]
In LV-sh-XIST -transfected BxPC-3 and PANC-1 cells, the expression levels of miR-140 and miR-124 were significantly upregulated (Figure 5A and 5B). [score:6]
MiR-140/miR-124 expression data was normalized to U6 small RNA expression. [score:5]
The indicated luciferase reporter gene vectors were co -transfected into PANC-1 cells with miR-140 mimics/miR-140 inhibitor (Figure 6C and 6D) or miR-124 mimics/miR-124 inhibitor (Figure 6E and 6F). [score:5]
Figure 6 (A and B) A wt-XIST luciferase reporter gene vector, a mut-XIST vector containing a 4 bp mutation in the predicted binding site of miR-140, or a 6 bp mutation in the predicted binding site of miR-124, a wt-iASPP 3’UTR luciferase reporter gene vector, as well as a mut-iASPP 3’UTR vector containing a 6 bp mutation in the predicted binding site of miR-140, or a 5 bp mutation in the predicted binding site of miR-124 was constructed. [score:5]
Next, the XIST expression in miR-140/miR-124 mimics- or inhibitor -transfected BxPC-3 and PANC-1 cells was determined by using real-time PCR. [score:5]
A wt-XIST luciferase reporter gene vector, a mut-XIST vector containing a 4 bp mutation in the predicted binding site of miR-140, or a 6 bp mutation in the predicted binding site of miR-124, a wt-iASPP 3’UTR luciferase reporter gene vector, as well as a mut-iASPP 3’UTR vector containing a 6 bp mutation in the predicted binding site of miR-140, or a 5 bp mutation in the predicted binding site of miR-124 was constructed (Figure 6A and 6B). [score:5]
BxPC-3 and PANC-1 cells were co -transfected with LV-sh-XIST and miR-140 inhibitor or miR-124 inhibitor; then the protein levels of iASPP and cell cycle-related factors, P21, CDK1 and Cyclin D1 were determined by using Western blot assays (Figure 7A-7C). [score:4]
In addition, miR-124 regulates the proliferation of colorectal cancer cells by targeting iASPP [22]. [score:4]
The expression levels of miR-140, miR-124, iASPP mRNA, CDK1 mRNA and p21 mRNA in PC tissues and their correlations with XIST. [score:3]
A schematic diagram showing XIST inhibits miR-140/miR-124 to promote pancreatic carcinoma growth through iASPP and cell cycle-related factors. [score:3]
Moreover, the effects of LV-sh-XIST on the indicated protein levels could be partially reversed by miR-140 or miR-124 inhibitor, respectively. [score:3]
We also determined the expression levels of miR-140, miR-124, iASPP, CDK1 and P21 in PC tissues and adjacent normal tissues. [score:3]
After cultured overnight, cells were co -transfected with the wild-type and mutated XIST or wild-type and mutated PPP1R13L 3’UTR reporter plasmid or pRL-TK plasmids and miR-140/miR-124 mimics or miR-140/miR-124 inhibitor. [score:3]
By using Wilcoxon’s paired test we compared the expression of miR-140, miR-124, iASPP and CDK1 in PC tissues and the paired adjacent normal colonic tissues. [score:2]
To further investigate the mechanism by which XIST affected the cell cycle of PC cells, we validated whether XIST could regulate miR-140/miR-124 expression. [score:2]
XIST regulates cell cycle-related genes through miR-140/miR-124. [score:2]
To validate whether miR-140 and miR-124 were involved in XIST regulating PC cell cycle arrest through iASPP, we determined the protein levels of iASPP, CDK1, Cyclin D1 and P21. [score:2]
We determined the expression levels of miR-140, miR-124, iASPP mRNA, CDK1 mRNA and p21 mRNA in PC tissues and adjacent normal tissues by using real-time PCR assays. [score:2]
In PC cell lines, XIST and miR-140/miR-124 could inversely regulate each other, respectively. [score:2]
XIST inversely mutual-regulates miR-140/ miR-124. [score:2]
These data suggested that miR-140 and miR-124 were involved in the process of XIST regulating iASPP and cell cycle-related genes. [score:2]
Figure 9 (A- E) The expression levels of miR-140, miR-124, iASPP mRNA, CDK1 mRNA and P21 mRNA in a large panel of 73 paired PC tissues and matched adjacent normal tissues were determined by using real-time PCR assays. [score:2]
Moreover, miR-140 and miR-124 could directly bind to XIST and the 3’UTR of iASPP, respectively. [score:2]
miR-140 and miR-124 were involved in this process through direct binding to XIST and the 3’UTR of iASPP. [score:2]
We have demonstrated that knockdown of XIST induces cell cycle arrest at G0/G1 phase by regulating cell cycle-related genes in PC cell lines; given that miR-140/miR-124 could directly bind to XIST and the 3’UTR of iASPP, we then investigated whether/iASPP. [score:2]
XIST inversely mutual-regulates miR-140/miR-124. [score:2]
These data suggested that XIST might regulate cell proliferation- and cell cycle-related genes through miR-140/miR-124. [score:2]
MiR-140/miR-124 could directly bind to XIST and the 3’UTR of iASPP. [score:2]
To investigate the mechanism by which XIST regulate iASPP and cell cycle-related gene expression, we focused on two PC cell proliferation-related miRNAs: miR-140 and miR-124 [20, 21]. [score:2]
Here, we generated luciferase assays to investigate whether miR-140/miR-124 binds to XIST and iASPP to regulate their expression. [score:1]
XIST was positively related to iASPP and CDK1, inversely related to miR-140, miR-124 and P21, respectively. [score:1]
In RNA extracted from the precipitated AGO2 protein, we could detect XIST, miR-140/miR-124 and iASPP with a 1.8∼3-folds enrichment compared to IgG (Figure 6H), indicating that miR-140/miR-124 could directly bind to XIST and the 3’UTR of iASPP. [score:1]
Mature miR-140 and miR-124 expressions in cells was measured using a Hairpin-it TM miRNAs qPCR kit (Genepharma, Shanghai, China). [score:1]
By using Spearman’s rank correlation analysis, we observed that XIST was inversely correlated with miR-140, miR-124 and p21, respectively, positively correlated with iASPP and CDK1, respectively (Figure 9E-9I). [score:1]
Detection of AGO2 and IgG using Western blot (up); detection of XIST, miR-140/miR-124 and iASPP using qRT-PCR (low). [score:1]
According to previous studies, silencing of the miR-124 genes facilitates pancreatic cancer progression and metastasis [35]. [score:1]
[1 to 20 of 46 sentences]
25
[+] score: 193
Based on the miRNA signature that we have identified in glioblastoma stem cells, we may be able to develop targeted glioblastoma therapies by inhibiting the up-regulated miR-10a or miR-10b function using miR-10 antogonists or overexpressing the down-regulated miR-124 or miR-874. [score:13]
Furthermore, using the Targetscan algorithm, we predicted oncogenes NRAS and PIM3 as putative target genes of miR-124, one of the down-regulated miRNAs in glioblastoma stem cells. [score:8]
For miRNAs that were down-regulated in glioblastoma stem cells, both miR-124 and miR-874 displayed a significant decrease of expression in most of the glioblastoma tissues tested, compared to their average expression in normal brain tissues (Fig. 3C, D). [score:7]
Co-transfection of a miR-124 RNA inhibitor abolished the inhibitory effect of miR-124 on PIM3 expression (Fig. 5G). [score:7]
Co-transfection of a miR-124 RNA inhibitor abolished the inhibitory effect of miR-124 on NRAS expression (Fig. 5C). [score:7]
Eleven miRNAs that are down-regulated in glioblastoma stem cells (>1.5-fold, Table S1) in our study, including miR-124, are also down-regulated in malignant astrocytomas. [score:7]
miR-124, another miRNA that was down-regulated in glioblastoma stem cells, also exhibited reduced expression in glioblastoma tissues in this study, consistent with the results of previous glioblastoma tumor tissue profiling [12], [14], [27]– [31]. [score:6]
Likewise, miR-124 is also frequently down-regulated in other cancers, such as medulloblastoma, hepatocellular carcinoma, and oral squamous carcinoma [35]– [37], suggesting that it may function as a general tumor suppressor. [score:6]
This result indicates that miR-124 down-regulates endogenous NRAS expression in glioblastoma stem cells. [score:6]
This result indicates that miR-124 down-regulates endogenous PIM3 expression in glioblastoma stem cells. [score:6]
Next, we tested whether miR-124 targets NRAS expression in glioblastoma stem cells. [score:5]
Using Targetscan algorithm, miR-124 was predicted to have a targeting site at the 3′ UTR of the NRAS gene. [score:5]
The inverse expression pattern of NRAS and miR-124 is consistent with the observation that NRAS expression is repressed by miR-124 (Fig. 5B, C). [score:5]
G. of PIM3 expression in control RNA, miR-124 RNA duplexes, or the combination of miR-124 RNA duplexes and a miR-124 inhibitor -transfected GSC1 cells. [score:5]
miR-124 targets NRAS and PIM3 expression. [score:5]
These results suggest that miR-124 represses PIM3 expression through the predicted targeting site in its 3′ UTR. [score:5]
We also examined the expression of NRAS in glioblastoma stem cells and neural stem cells, where miR-124 exhibits differential expression. [score:5]
To validate the targeting of PIM3 by miR-124, we made a luciferase reporter construct with human PIM3 3′ UTR containing the predicted miR-124 targeting site and the flanking sequences inserted into the 3′UTR of a Renilla luciferase reporter gene. [score:5]
Furthermore, treatment with a miR-124 inhibitor reversed the inhibitory effect of miR-124 on the luciferase reporter activity (Fig. 5F). [score:5]
These results suggest that miR-124 represses NRAS expression through the predicted targeting site in NRAS 3′UTR. [score:5]
To validate the targeting of NRAS by miR-124, we made a luciferase reporter construct with human NRAS 3′ UTR containing the predicted miR-124 targeting site and the flanking sequences inserted into the 3′UTR of a Renilla luciferase reporter gene in a siCHECK vector. [score:5]
Furthermore, treatment with a miR-124 inhibitor reversed the inhibitory effect of miR-124 on the luciferase reporter activity (Fig. 5B). [score:5]
To test whether miR-124 targets PIM3 expression in glioblastoma stem cells, mature miR-124 RNA duplexes were introduced into GSC1 cells using the dendrimer -mediated delivery system [21], [22]. [score:5]
C. of NRAS expression in control RNA, miR-124 RNA duplexes, or the combination of miR-124 RNA duplexes and a miR-124 inhibitor -transfected GSC1 cells. [score:5]
Transfection of miR-124 led to significant repression of the reporter gene and mutation of the putative miR-124 targeting site abolished the repression (Fig. 5F). [score:4]
Moreover, a significant increase of PIM3 mRNA expression was detected in the glioblastoma stem cells tested, compared to neural stem cells (Fig. 5H), further supporting the idea that miR-124 represses PIM3 expression. [score:4]
Mutation of the putative miR-124 targeting site abolished the repression (Fig. 5B). [score:4]
0036248.g003 Figure 3The expression levels of miR-10a (A), miR-10b (B), miR-124 (C), and miR-874 (D) in 9 glioblastoma tissues and 4 normal brain tissues were determine by real-time RT-PCR analysis, shown in scatted graph and bar graph. [score:3]
On the other hand, miR-124, miR-137 and miR-451 exhibit reduced expression in malignant glioblastoma tissues relative to normal brain tissues [14], [15]. [score:3]
Luciferase reporter gene under the control of wild type (WT) or mutant (MT) PIM3 3′ UTR was transfected into HEK 293 cells along with control, miR-124 RNA duplexes, or the combination of miR-124 RNA duplexes and a miR-124 inhibitor. [score:3]
A putative targeting site of miR-124 was also identified in the 3′ UTR of both human and mouse PIM3, a proto-oncogene with serine/threonine kinase activity (Fig. 5E). [score:3]
The expression levels of miR-10a (A), miR-10b (B), miR-124 (C), and miR-874 (D) in 9 glioblastoma tissues and 4 normal brain tissues were determine by real-time RT-PCR analysis, shown in scatted graph and bar graph. [score:3]
miR-10a, miR-10b or miR-124 RNA duplexes and/ or their correspondent RNA inhibitors (Dharmacon) were mixed in 50 µl serum free media with Transfectin, incubated at RT for 20 min. [score:3]
Luciferase reporter gene under the control of wild type (WT) or mutant (MT) NRAS 3′ UTR was transfected into HEK 293 cells along with control, miR-124 RNA duplexes, or the combination of miR-124 RNA duplexes and a miR-124 inhibitor. [score:3]
0036248.g002 Figure 2The expression levels of miR-10a (A), miR-10b (B), miR-140-5p (C), miR-124 (D), and miR-874 (E) in three glioblastoma stem cell (GSC) lines were measured by real-time RT-PCR, and compared to their expression in three neural stem cell (NSC) lines. [score:2]
Both miR-124 and miR-874 exhibited reproducible decrease of expression in all three glioblastoma stem cell lines tested, compared to normal neural stem cells (Fig. 2D, E). [score:2]
The expression levels of miR-10a (A), miR-10b (B), miR-140-5p (C), miR-124 (D), and miR-874 (E) in three glioblastoma stem cell (GSC) lines were measured by real-time RT-PCR, and compared to their expression in three neural stem cell (NSC) lines. [score:2]
0036248.g005 Figure 5 A. The base-pairing of hsa-miR-124 with the 3′ UTR of NRAS gene. [score:1]
E. The base-pairing of hsa-miR-124 with the 3′ UTR of PIM3 gene. [score:1]
The binding site of hsa-miR-124 on the 3′ UTR of PIM3 and NRAS was mutated from GTGCCTT to GTG GACA ; the binding site of hsa-miR-10b on the 3′ UTR of CSMD1 was mutated from ACAGGGT to ACAG TCC. [score:1]
Reduction of PIM3 protein level was detected in miR-124 -transfected cells by. [score:1]
B. miR-124 -mediated repression of luciferase reporter gene downstream of 3′ UTR of NRAS. [score:1]
Transfection of miR-124 RNA duplexes led to significant repression of the reporter gene (Fig. 5B). [score:1]
Mature miR-124 RNA duplexes were introduced into GSC1 cells using a cationic triethanolamine-core polyamidoamine (PAMAM) dendrimer -mediated small RNA delivery system [21], [22]. [score:1]
2 −13.24 1.43E-09 hsa-miR-492 12q22 −7.77 5.38E-08 hsa-miR-874 5q31.2 −6.76 1.53E-08hsa-miR-30b * 8q24.22 −6.54 2.73E-09 hsa-miR-602 9q34.3 −5.75 2.63E-08 * hsa-miR-124 is transcribed from three chromosomal locations, but the mature sequences are the same. [score:1]
Reduction of NRAS protein level was detected in miR-124 -transfected cells. [score:1]
The miR-124 RNA duplex sense sequence is 5′ TAA GGC ACG CGG TGA ATG CC 3′. [score:1]
F. miR-124 -mediated repression of luciferase reporter gene downstream of 3′ UTR of PIM3. [score:1]
[1 to 20 of 48 sentences]
26
[+] score: 172
In the present study, we revealed that p53 promoted miR-124 expression to inhibit iASPP expression, so as to amplify the inhibitory effect of PDT on CRC cell proliferation; after p53 mutantion or knockout, miR-124 expression was downregulated while iASPP expression was upregulated, so that the inhibitory effect of PDT on CRC cell proliferation was reduced (Figure 7). [score:22]
showed that miR-124 expression was upregulated in p53 [wt] cells but downregulated in p53 [mut] cells, and the expression levels were altered in a p53 content -dependent manner in tumor tissues; iASPP expression was downregulated in p53 [wt] cells but upregulated in p53 [mut] cells, and the expression levels were altered in a p53 content -dependent manner in tumor tissues (Figure 6b). [score:21]
In the absence of PDT treatment, miR-124 expression was downregulated in a time -dependent manner in all kinds of mice tumors (p53 [wt] (R KO) -, p53 [mut] (HT29) -, p53 [+/+]- or p53 [−/−]-derived mice tumors) (Figures 3b and d); in the presence of PDT treatment, miR-124 expression was upregulated to a peak value on day 7 by PDT treatment, and fell down gradually to lower levels at later time points; however, miR-124 expression in the PDT treatment groups was higher than that in the non-PDT treatment groups (Figures 3b and d). [score:13]
Similar results were observed in p53 [+/+] and p53 [−/−] cells (Figure 2c): the expression levels of miR-3151 and miR-663b were upregulated in p53 [−/−] cells, while the expression levels of miR-140, miR-30b, miR-506, miR-124 and miR-30c were downregulated in p53 [−/−] cells compared with that in p53 [+/+] cells. [score:10]
For the first time, we demonstrated the amplificatory effect of miR-124 on PDT suppressing CRC cell viability, which could be partially abolished by p53 mutation or deletion; on the contrary, iASPP suppressed the inhibitory effect of PDT on CRC cell viability, which could be amplified by p53 mutation or deletion. [score:9]
[23] Interestingly, here we found that p53 binds to the promoter of miR-124 to promote its expression in the presence or absence of PDT and subsequently affect the expression of miR-124 downstream target gene, so as to form a regulation loop in the wild-type p53 cells. [score:8]
In our previous study, we revealed that miR-124 could inhibit iASPP by direct targeting to suppress CRC cell proliferation so as to affect the course of CRC. [score:8]
Among the five downregulated miRNAs, miR-124 showed to be the most strongly downregulated in p53 [mut] and p53 [−/−] cells. [score:7]
miR-124 mimics or miR-124 inhibitor was transfected into R KO, HT29, p53 [+/+] and p53 [−/−] HCT116 cells to achieve miR-124 overexpression or miR-124 inhibition (Figure 4a). [score:7]
These data indicated that these five miRNAs could be inhibited after p53 mutant or knocked out, and miR-124 was the most strongly suppressed one. [score:6]
On day 7 after PDT, the expression level of miR-124 presented a peak value, while iASPP expression presented a valley value at the same time, which was consistent with the tumor size alternation trend in response to PDT. [score:5]
In p53-mutant or - deleted cells, this binding no longer worked to promote miR-124 expression, and iASPP expression increased, which finally resulted in attenuated killing effect of PDT on CRC cells and promoted CRC cell viability. [score:5]
Among all of the candidate miRNAs, miR-124 showed to be significantly downregulated in p53 [mut] and p53 [−/−] cells. [score:4]
p53 regulates miR-124 expression by binding to its promoter. [score:4]
Our previous study revealed that miR-124 regulates the proliferation of CRC cells by targeting iASPP. [score:4]
Similarly, in all cells, the level of p53 antibody binding to miR-124 -binding element in miR-124 promoter was significantly promoted by PDT treatment (# P<0.05, ## P<0.01), compared with that in the absence of PDT, indicating that PDT treatment significantly upregulated p53 protein level (Figures 5f–h). [score:3]
The effect of PDT on miR-124 and iASPP mRNA expression. [score:3]
Cells were transfected with miR-124 and pGL3 luciferase reporter constructs harboring the miR-124 target sequence. [score:3]
[14] To investigate the effect of mutant p53 on the expression of miR-124 and iASPP, we then determined miR-124 and iASPP expression in p53 [wt] cells and p53 [mut] cells. [score:3]
Expression levels of miR-124 and iASPP was determined in tumors that were derived from the indicated cells by injection on days 3, 7, 13, 20 and 27. [score:3]
The data suggested that miR-124 could promote the sensitivity of CRC cells to PDT treatment, so as to promote the inhibitory effect of PDT on CRC cells. [score:3]
The correlation of p53, miR-124 and iASPP expression in CRC tissues. [score:3]
We revealed that the expression levels of miR-124 and iASPP were altered in a p53 content -dependent manner in tumor tissues, and then we further investigated the effect of PDT on miR-124 and iASPP expression in mice tumors that were derived from different tumor cells. [score:3]
In agreement with this finding, endogenous or ectopic expression of wild-type p53 increased miR-124 levels. [score:3]
Moreover, p53 mutation might reduce miR-124 -induced sensitivity of CRC to PDT treatment. [score:2]
Furthermore, the real-time chromatin immunoprecipitation (ChIP) assay showed that the level of p53 antibody binding to miR-124 -binding element in the miR-124 promoter was much greater than that of IgG in all the three indicated cell lines (Figures 5f–h), suggesting that p53 might bind to the promoter of miR-124 to activate its expression. [score:2]
Figure 5b is a schematic diagram of the potential p53 -binding element in the promoter region of the miR-124 gene predicted by Jaspar database. [score:1]
showed that the viability of p53 [wt] CRC cell line R KO in the PDT (+)+miR-124 group was the lowest, whereas the viability of the p53mut CRC cell line HT29 in the PDT (−)+miR-SCR group was the highest (Figure 4b). [score:1]
The influence of miR-124 or iASPP on p53 [wt]/p53 [mut]and p53 [+/+]/p53 [−/−]cells. [score:1]
The data were processed according to the 2 [−ΔΔCT] method; the relative expression of miR-124 was calculated with the formula, 2 [−(CTmiRNA−CTRNU6B)]. [score:1]
These all suggested the important role of miR-124/iASPP in PDT process. [score:1]
Similar results were observed in p53 [+/+]/p53 [−/−] cells: the viability of p53 [+/+]CRC cell line R KO in the PDT (+)+miR-124 group was the lowest, whereas the viability of p53 [−/−]CRC cell line HT29 in the PDT (−)+miR-SCR group was the highest (Figure 4c). [score:1]
To investigate the role of miR-124 further in CRC cells, we focused on the mechanism of miR-124 overexpression in these cells. [score:1]
Several miRNAs were proposed, among which seven of them were reported to be related to p53: miR-140, miR-30b, miR-3151, miR-506, miR-124, miR-30c, and miR-663b 19, 20, 21, 22, 23, 24 (Figure 2a). [score:1]
[1 to 20 of 34 sentences]
27
[+] score: 111
The correlations of miR-124 expression with various clinicopathological parameters of osteosarcoma tissues are summarized in Table I. Using the median miR-124 expression in all 105 osteosarcoma patients as a cutoff, the patients were divided into a high miR-124 expression group and a low miR-124 expression group. [score:9]
Using the Kaplan-Meier method and log-rank test, the OS times of patients with low miR-124 expression levels were found to be significantly shorter than those of patients with high miR-124 expression levels (P=0.005; Fig. 2). [score:5]
In vitro, ectopic miR-124 expression inhibits cell growth and induces apoptosis in gastric cancer (21), colorectal cancer (22), pancreatic cancer (24), prostate cancer (28) and cervical cancer (20). [score:5]
The upregulation of miR-124 also reduces cell invasion and migration in ovarian cancer (19), pancreatic cancer (24), hepatocellular carcinoma (23) and breast cancer (18). [score:4]
The mechanism by which miR-124 expression affects carcinogenesis and cancer development is complex. [score:4]
As shown in Table I, miR-124 was significantly downregulated in patients with osteosarcoma of advanced Enneking stage (P<0.001), positive distant metastasis (P=0.005) and poor response to neoadjuvant chemotherapy (P=0.013). [score:4]
Zheng et al observed that miR-124 downregulation occurred more frequently in hepatocellular carcinoma patients with large tumor size, multiple tumor nodes and advanced tumor stage (23). [score:4]
In conclusion, the results of the present study revealed that miRNA-124 was downregulated in osteosarcoma cell lines and clinical samples. [score:4]
In the current study, it was first demonstrated that miR-124 was downregulated in osteosarcoma cell lines and primary tumor samples. [score:4]
In vivo, Zhang et al revealed decreased miR-124 expression and its association with high tumor grade (Dukes C and D) in colorectal cancer (22). [score:3]
The MG63 cell line, which possessed the lowest levels of miR-124 expression among all tested osteosarcoma cell lines, was selected for analysis in further experiments. [score:3]
Low-level expression of miR-124 was significantly associated with a more aggressive and poor prognostic phenotype of patients. [score:3]
Multivariate Cox regression analysis including the aforementioned significant parameters revealed that miR-124 expression [relative risk (RR) 6.325; P=0.015], clinical stage (RR 8.973; P=0.008), metastasis status (RR 3.576; P=0.032), and response to preoperative chemotherapy (RR 4.728; P=0.022) were independent prognostic markers (Table II). [score:3]
Moreover, lower expression levels of miR-124 indicated worse prognosis of patients suffering from pancreatic cancer, colorectal cancer or hepatocellular carcinoma (23, 24). [score:3]
Decreased expression of miR-124 in osteosarcoma cell lines and primary tumor samples. [score:3]
These findings suggest that miR-124 might play an important role not only in tumor initiation and progression but also in the molecular -targeted therapy of human malignancies. [score:3]
However, the expression and function of miR-124 in osteosarcoma is largely unknown. [score:3]
As shown in Fig. 1A, the results revealed that miR-124 expression levels were significantly lower in osteosarcoma tissues (8.3±2.1) than in the corresponding noncancerous bone tissues (19.6±4.2; P<0.001). [score:3]
miR-124 expression and clinicopathological features in osteosarcoma. [score:3]
Restored miR-124 expression in MG63 cells exhibited antitumor effects in vitro. [score:3]
No significant difference was observed between miR-124 expression levels and patient age, gender, tumor size, anatomical location, or the serum levels of lactate dehydrogenase and alkaline phosphatase. [score:3]
Low levels of miR-124 expression were found to be correlated with aggressive clinicopathological features and unfavorable to survival. [score:3]
Previous research has reported the tumor suppressive function of miR-124 in numerous human malignancies. [score:3]
Correlation between miR-124 expression and prognosis of osteosarcoma patients. [score:3]
The expression levels of miR-124 in osteosarcoma tissues, corresponding noncancerous bone biopsy samples, osteosarcoma cell lines and the human normal osteoblastic cell line hFOB 1.19 were detected by RT-qPCR and normalized to U6 small nuclear RNA. [score:3]
These results indicate that miR-124 is involved in the negative regulation of osteosarcoma cell growth, invasion and migration in vitro. [score:2]
Decreased miR-124 expression was also observed in osteosarcoma cell lines compared with that in hFOB 1.19 cells (Fig. 1B; P<0.001). [score:2]
As shown in Fig. 3A, the expression level of miR-124 in the miR-124 mimic -transfected cells was significantly higher compared with that in NC -transfected cells (P<0.01). [score:2]
Liang et al identified that low miR-124 levels correlated with poor differentiation of breast cancer (18). [score:1]
These data suggest an important role of miR-124 in the molecular etiology and gene therapy of osteosarcoma. [score:1]
In addition, promotion of cell apoptosis was also observed in the miR-124 mimic -transfected cells (Fig. 3C). [score:1]
Effects of miR-124 on cell proliferation, apoptosis, invasion and migration. [score:1]
Furthermore, the effects of miR-124 on malignant phenotypes of osteosarcoma cells were elucidated. [score:1]
In xenotransplanted mo dels, miR-124 -treated nude mice exhibited smaller tumor sizes and lower tumor weights in comparison with those in the control group (21, 22, 24, 28). [score:1]
In addition, miR-124 radiosensitizes human glioma cells (29). [score:1]
The correlation of miR-124 levels with clinicopathological factors and prognosis was also statistically analyzed. [score:1]
Whether miR-124 expression has prognostic potential for the OS of osteosarcoma patients was investigated. [score:1]
To the best of the authors’ knowledge, this is the first study regarding the clinical significance and functional attributes of miR-124 in osteosarcoma. [score:1]
Subsequent studies revealed that miR-124 may modulate the process of tumorigenesis and the behavior of cancer cells. [score:1]
Furthermore, the transfection of miR-124 mimic into MG63 cells was able to reduce cell proliferation, invasion and migration, and promote cell apoptosis in vitro. [score:1]
One of the cancer-related miRNAs is miR-124. [score:1]
For RNA transfection, the cells were seeded into each well of 96-well plate and incubated overnight, then transfected with either miR-124 mimic or negative control (NC) (TIANGEN Biotech Co. [score:1]
[1 to 20 of 42 sentences]
28
[+] score: 98
However, our results show upregulation by miR-124 in melanoma cells, rather than downregulation. [score:7]
When the 124/506B binding site was mutated, miR-124 still upregulated lucifease expression to 240% (p = 0.0030). [score:6]
When both binding sites were mutated, miR-124 did not result in increased expression of the luciferase reporter, at least not as effectively as when both potential binding sites were functional (146% expression, p = 0.1864). [score:5]
Similar to what we observed using the luciferase-reporter assay, miR-124 was able to upregulate MITF expression in the MeWo cells. [score:5]
miR-148 and affect expression of the endogenous MITF In order to test if these miRNAs affect the level of endogenous MITF mRNA in melanoma cells, we used qRT-PCR to determine MITF mRNA expression after transfecting MeWo melanoma cells with the miRNAs miR-124, and miR-148. [score:5]
The possible role of miR-124 in regulating the expression of Mitf during eye development needs to be tested further. [score:5]
At present, it is not clear how miR-124 mediates this upregulation. [score:4]
The mechanisms that mediate this downregulation have not been described and may involve miR-124. [score:4]
miR-124 is interesting considering its expression in the retina [54], as Mitf plays an important role in eye development. [score:4]
When both binding sites are functional, miR-124 positively affects luciferase expression up to 3 fold compared to expression from the vector alone in HEK293 cells (p = 0.0086) (Fig. 3C). [score:4]
A. Expression of human MITF mRNA in MeWo cells transfected with miR-124,, miR-148 or and miR-148 combined. [score:3]
We therefore can not definitely conclude anything about the expression of miR-124 in our samples. [score:3]
miR-124, however resulted in significant increase in reporter gene expression. [score:3]
When the 124/506A binding site was mutated, miR-124 no longer affected expression of the reporter gene. [score:3]
In order to test if these miRNAs affect the level of endogenous MITF mRNA in melanoma cells, we used qRT-PCR to determine MITF mRNA expression after transfecting MeWo melanoma cells with the miRNAs miR-124, and miR-148. [score:3]
miR-124 resulted in increased luciferase expression as seen using the reporter gene construct in HEK293 cells. [score:3]
Role of the miR-124/506 target sites. [score:3]
miR-124 is predominantly expressed in the brain, specifically in differentiating and mature neurons [51], [52], [53]. [score:3]
and miR-124/506 affect m Mitf RNA in HEK293 cellsThe luciferase assay experiments were also performed in human embryonic kidney cells (HEK293), which do not express Mitf at significant levels. [score:2]
The level of miR-124 expression was considered to be too low to be detected in all cell types. [score:2]
In addition, both and miR-124 induced differentiation of adult mouse neural stem cells and were able to induce cell cycle arrest of glioblastoma multiforme cells [47]. [score:1]
The binding sites for microRNAs miR-124/506 are very well conserved in the Mitf 3′UTR sequence. [score:1]
Also, when miR-124 was combined with other miRNAs, the effects were always equal to the effects observed with miR-124 alone. [score:1]
We tested the effects of microRNAs which have conserved binding sites in the 3′UTR region of Mitf, including miR-27a (located at 229–235 in the mouse Mitf 3′UTR sequence), miR-25/32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR-124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931–2937) (Fig. 1A and 1B). [score:1]
There are two binding sites for miR-124/506 in the mouse Mitf 3′UTR sequence. [score:1]
When miR-124 and were combined, the same effect was observed as when was transfected alone (Fig. 2C). [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
These results suggest that miR-124 leads to positive effects on the Mitf mRNA by binding to the 124/506A binding site. [score:1]
Some miRNAs seem to have a tissue-specific function like miR-124 in neurons wheras other miRNAs are found more universally. [score:1]
B. analysis on MITF protein levels in MeWo cells, when transfected with miR-124,, miR-148 or and miR-148 combined. [score:1]
miR-124 and miR-506. [score:1]
and miR-124/506 affect m Mitf RNA in HEK293 cells. [score:1]
The effects of miR-124 might be an artifact of the reporter system. [score:1]
miR-124/506 also has a less conserved binding site at 548–554, and was therefore also tested in our study. [score:1]
Also, when miR-124 was transfected, higher MITF protein levels were observed (Fig. 4B). [score:1]
It has not been shown previously that miR-124 and/or miR-506 can affect Mitf mRNA. [score:1]
C. Effects of miR-124 on the mouseMitf-3′UTR-luciferase reporter when the potential binding sites are mutated. [score:1]
ND (1/9) ND (0/9) 34.69 (7/9) 37.39 (1/3) miR-124 34.37 (9/9) 34.73 (5/9) 35.09 (2/9) 32.68 (3/3) miR-506 35.19 (2/9) 34.73 (3/9) 32.87 (9/9) ND (0/9) miR-148a 27.90 (9/9) 28.29 (9/9) 28.82 (9/9) 33.12 (3/3) miR-148b 28.37 (9/9) 28.65 (9/9) 29.37 (9/9) 35.19 (1/3) miR-152 34.08 (9/9) 35.12 (9/9) 34.26 (9/9) 35.05 (2/3) miR-16 contr. [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
Ten vertebrate species contain both miR-124/506 binding site; the Loxodonta africana sequence only contains 124/506B. [score:1]
P-values are: Scramble  = 0.0396; miR-124 = 0.2228; = 0.0069; miR-148 = 0.0051;+148 = 0.0051. [score:1]
[1 to 20 of 41 sentences]
29
[+] score: 80
Other miRNAs from this paper: hsa-mir-204, hsa-mir-211, hsa-mir-124-1, hsa-mir-124-3, hsa-mir-155
Further validation through qPCR revealed that upregulation of miR-124 and miR-155 led to the downregulation of Runx2 (P < 0.05) in NaF treated HOS cells. [score:7]
Thus, it can be seen that miR-124/miR-155 can regulate the RANKL expression either through the direct binding of miR-124 with the RANKL untranslated regions or via RUNX2 mediated transcriptional inactivation. [score:7]
Further validation using real time PCR illustrated the upregulation of miR-124 and miR-155, whereas the expression levels of RANKL, BGLAP, and RUNX2 genes were decreased in NaF treated cells. [score:6]
Validation of miRNAs using qPCR demonstrated that sublethal concentrations of NaF can significantly (P < 0.05) upregulate miR-124 and miR-155 expressions in HOS cells (Figure 4). [score:6]
Further validation through quantitative RT-PCR showed that the expression profiles of the miR-124 and miR-155 were inversely proportional to the expression profiles of the RUNX2 and RANKL genes. [score:5]
Compared to the higher dose level, elevated expression levels of miR-124 and miR-155 at lower dose of NaF resulted in the higher degree of differential expression of genes (RUNX2, RANKL, BGLAP, and OPG) involved in the osteoclastic differentiation. [score:4]
Validation of other osteoblastic lineage markers (RANKL, BGLAP, and OPG) through qPCR suggested their possible correlation with the expression levels of miR-124 and miR-155. [score:3]
At higher dose level, fold change in the expression levels of miR-124 and miR-155 was observed to be 1.6 (±0.19) and 1.86 (±0.24), respectively. [score:3]
miR-124 displayed in silico hybridization with 3′ untranslated regions of RANKL (Figure 3). [score:3]
mirTarBase and miRANDA software were used to identify functionally validated targets of miR-124 and miR-155. [score:3]
Available literature entails that RUNX2 acts as a transcription factor of RANKL [7], whereas our results based on qPCR and in silico hybridization analysis revealed that miR-124 can be involved in the direct regulation of RANKL (Figures 3, 4, and 5). [score:3]
Thus, the higher expression levels of miR-124 and miR-155 at lower concentrations of NaF (8 mg/L) obtained in our study could be attributed to the biphasic effects exerted by NaF. [score:3]
Seed regions of the miR-124 and miR-155 displayed in silico hybridization with untranslated regions (UTRs) of the RUNX2. [score:3]
Functional targets of selected miRNAs (miR-124 and miR-155) were identified using mirTarBase and in silico hybridization analysis. [score:3]
Data obtained from in silico hybridization analysis revealed that miR-124 and miR-155 could be directly involved in the posttranscriptional regulation of RUNX2 and RANKL genes. [score:3]
At lower dose level, fold change in the expression levels of miR-124 and miR-155 was observed to be 3.24 (±0.13) and 4.03 (±0.3), respectively. [score:3]
In silico hybridization revealed that seed regions miR-124 and miR-155 can bind with the untranslated regions (UTRs) of the RUNX2 and RANKL (Figure 3). [score:3]
Future studies should be designed on the possible role of miRNAs (mIR-124 and mIR-155) and snoRNAs in the development of fluorosis and their implications as the possible therapeutic drug targets against fluorosis; in particular it is important to plan experiment to investigate the interactions between fluoride and proteins involved in the methylation cascade or in the miRNA dicer dependent and dicer independent biogenesis pathways. [score:2]
Compared to the higher dose of NaF (20 mg/L), elevated levels of miR-124 and miR-155 expressions were seen at lower dose level of NaF (8 mg/L). [score:2]
Thus, it can be inferred that miR-124/miR-155 could be involved in the posttranscriptional regulation of the RUNX2 and RANKL in NaF exposed HOS cells. [score:2]
Our results suggest the possible involvement of miR-124 and miR-155 in the development of fluorosis. [score:2]
Possible binding sites of miR-124 and miR-155 with the RUNX2 and RANKL were identified. [score:1]
Relative quantification of miRNA was performed on Applied Biosystems 7300 real time PCR system using EXPRESS SYBR GreenER qPCR SuperMix containing universal reverse primers (Invitrogen, USA) and forward customized primers of miR-124/miR-155 (Table 1). [score:1]
Herein, we report the direct/indirect possible interactions of mIR-124 and mIR-155 with the RUNX2 and RANKL in NaF treated HOS cells. [score:1]
Out of all the possible alignments of miR-124/miR-155 with the RUNX2/RANKL, pairs depicting hybridization with the conserved domains, good mirSVR and PhastCons scores were selected using miRANDA software. [score:1]
[1 to 20 of 25 sentences]
30
[+] score: 77
The immediate decrease in the N9 microglial miR-124 and miR-146 upon interaction with exosomes, indicative of M1 (pro-inflammatory) in opposite to M2 (alternative) microglia subtype, may justify the acute upregulation of inflammatory mediators previously observed (Figures 4, 6) for both wt (not significant) and mSOD1 NSC-34 MN-derived exosomes (at least p < 0.05). [score:4]
In contrast with the undetectable amounts of miR-146a and miR-155, we observed an upregulation of miR-124 in the mSOD1 NSC-34 MNs. [score:4]
MiR-124 was also found expressed in a subset of sensory neurons and suggested to have different functions and/or targets (Makeyev et al., 2007). [score:4]
When miR-124 is down-regulated, it triggers defective neuronal survival and reduced axonal outgrowth (Sanuki et al., 2011). [score:4]
Moreover, miR-124 upregulation was also demonstrated to be connected to a decreased capacity of cells to repair DNA strand breaks (Chen et al., 2015) and to be increased by stressful conditions (Sun et al., 2015). [score:4]
Presynaptic alterations were shown to correlate with increased miR-124 and miR-142, which regulate Rab3a expression in motor nerves providing the basis for impaired synaptic function in neuromuscular disorders (Zhu et al., 2013). [score:4]
Our results further enhance the knowledge of the dysregulated miRNAs in ALS reinforcing miR-155 (Roberts et al., 2013), but also miR-146a and miR-124 among the most highly expressed in the microglia after internalization of mSOD1 NSC-34 MN-derived exosomes. [score:4]
MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. [score:3]
The results obtained demonstrate that exosomes from mSOD1 MNs induce early activation of inflammatory signaling pathways and delayed increased expression of miR-124, miR-146a, and miR-155, together with mixed M1 and M2 phenotypic markers. [score:3]
Thus, overexpression of miR-124 was shown to be related with neuronal differentiation in neuroblastoma cell lines and embryonic stem cells (Krichevsky et al., 2006; Makeyev et al., 2007), and to contribute to neurite outgrowth (Yu et al., 2008), and neurogenesis (Visvanathan et al., 2007). [score:3]
Delayed activation is associated with enhanced expression of cell surface receptors and of miR-155, miR-146a, and miR-124. [score:3]
IL-4/IL-13 -dependent and independent expression of miR-124 and its contribution to M2 phenotype of monocytic cells in normal conditions and during allergic inflammation. [score:3]
Interestingly, exosomes from mSOD1 MNs evidenced to be enriched in miR-124, recapitulating their cells of origin, and again no expression of miR-146a or miR-155 was detected in either type of exosomes. [score:3]
Figure 7 Early decreased expression of calming microRNAs (miR-124 and miR-146a) is indicative of N9 microglia M1 phenotype, but their increase together with that of miR-155 suggests the coexistence of multiple activated phenotypes at 24 h. N9 microglial cells were incubated for 2, 4, and 24 h with exosomes (Exos) from wild-type (wt) NSC-34 MNs and mSOD1 NSC-34 MNs (N9+wt Exos and N9+mSOD1 Exos, respectively), as indicated in methods. [score:3]
The effect of microRNA-124 overexpression on anti-tumor drug sensitivity. [score:3]
MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation. [score:2]
Indeed, miRNAs are known to be crucial for neuronal differentiation and miR-124 was indicated to regulate hundreds of genes and to counteract astrocyte-specific route (Neo et al., 2014). [score:2]
Clearly, the harmful or beneficial effects of miR-124 upregulation in ALS require further investigation, namely in terms of its transfer to microglia. [score:2]
MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU. [score:2]
The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development. [score:2]
Moreover, and similarly to the presence of miR-124a found in secreted exosomes from primary cortical neurons (Morel et al., 2013), we noticed that exosomes from mSOD1 NSC-34 MNs collected by ultra-centrifugation were enriched in miR-124, as well. [score:1]
The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. [score:1]
We observed that a prompt reduction of calming miRNAs by NSC-34 MN-derived exosomes (Figures 7A,B–2 h incubation) was followed by a marked and moderate selective elevation of miR-124 and miR-155, respectively, by mSOD1 exosomes (Figures 7A,C–24 h incubation). [score:1]
Data highlight that increased level of miR-124 in circulating exosomes may reveal a good biomarker of MN degeneration in ALS and that its modulation may have benefits in halting exosomal-inflamma-miRs dissemination and induced effects on microglia activation and dysfunction. [score:1]
Quantification of total RNA (E) revealed no differences between samples from wt and mSOD1 NSC-34 MNs, while (F) miRNA profile show an increase only in miR-124 in both mSOD1 cells and in their derived exosomes. [score:1]
Interestingly, elevation of miR-124 in nerve terminals was associated to a decreased neurotransmitter release at the neuromuscular junction (Kye and Goncalves Ido, 2014), probably accounting to their dysfunction. [score:1]
In respect to miR-124 it was shown to promote microglia quiescence by diminishing M1 polarization and enhancing M2 phenotype (Ponomarev et al., 2011; Liu and Abraham, 2013), in particular the M2c microglia subset (Veremeyko et al., 2013). [score:1]
miR-124 Contributes to the functional maturity of microglia. [score:1]
In contrast, the marked elevation of miR-124 at 24 h incubation in the N9 microglia treated with mSOD1 exosomes may derive, at least in part, from its increased content in MNs and in their derived exosomes that are collected by the cells, thus skewing M1 to M2a polarization (Veremeyko et al., 2013). [score:1]
mSOD1 NSC-34 MNs and their derived exosomes show increased levels of miR-124. [score:1]
Increased content in miR-124 was found in mSOD1 NSC-34 MN-derived exosomes. [score:1]
An updated role of microRNA-124 in central nervous system disorders: a review. [score:1]
To study the role of exosomal miR-124, and other cargo contents, in producing microglia dynamic changes we evaluated the expression of two anti-inflammatory miRNAs (miR-146a and miR-124) and the proinflammatory miR-155, a recognized inducer of the M1 polarization found increased in ALS patients and mo dels (Koval et al., 2013; Liu and Abraham, 2013; Butovsky et al., 2015) in N9 microglial cells after the transfer of mSOD1 exosomes. [score:1]
Taken together, the results obtained in this work indicate that exosomes released from mSOD1 NSC-34 MNs are enriched in miR-124 and are preferentially internalized by N9 microglia, causing a specific pattern of cell activation determined by early and late NF-κB and lasting decrease of the phagocytic ability. [score:1]
In this work we established that exosomes derived from mSOD1 NSC-34 cells are enriched in miR-124 and responsible for N9 microglia activation and loss of function. [score:1]
[1 to 20 of 35 sentences]
31
[+] score: 76
By introducing tissue-specific miR-1 and miR-124 miRNAs into HeLa cells, Lim et al. showed that (1) miRNAs are able to downregulate messenger levels as monitored by microarray experiments and (2) that these artificially downregulated mRNAs are usually underexpressed in the tissue where the miRNA is expressed. [score:11]
For genes containing miR-1 or miR-124 targets, we expected that targeted isoforms would be downregulated in tissues where cognate microRNAs are known to be expressed. [score:10]
Figure 4 shows the average relative EST -based expression levels of targeted and nontargeted isoforms in cardiovascular tissues for miR-1 and brain tissues for miR-124, compared to their relative expression in other tissues. [score:8]
Only when tissues known to express miR-1 and miR-124 were singled out did a tendency emerge for specific downregulation of isoforms containing targets for these miRNAs. [score:8]
If certain miRNAs such as miR-1 and miR-124 are able to repress messenger levels, we expect a specific downregulation of targeted isoforms in tissues where such miRNAs are expressed. [score:8]
Figure 5 shows levels of repression of targeted versus nontargeted isoforms in each class, for genes containing miR-1 and miR-124 targets. [score:7]
While the level of targeted isoforms is usually higher than that of nontargeted isoforms in tissues taken as a whole, it is reduced in the tissue class where the cognate miRNA is expressed, with a one-way T test p-value of 0.03 for miR-1/cardiovascular, and 0.06 for miR-124/brain. [score:7]
MiR-1 is preferentially expressed in heart and skeletal muscle, and miR-124 is preferentially expressed in brain [15, 16]. [score:5]
Relative EST-Based Expression of Isoforms Containing or Not Containing a Target for miR-1 or miR-124. [score:5]
For the analysis of miR-1 and miR-124 targets (Figure 5), tissue class “nervous” was replaced by lower-level class “brain. [score:3]
For miR-124, the strongest repression is observed in lymphoreticular tissues, a class not reported to show miR-124 expression. [score:3]
We describe an application of this strategy to miR-1 and miR-124, the miRNAs first reported to cause tissue-specific transcript repression [5]. [score:1]
[1 to 20 of 12 sentences]
32
[+] score: 74
A. The miR-124 levels in control and miR-124-infected BE(2)-C. B. Immunofluorescence microscopy of BE(2)-C cells infected with a lentiviral-vector expressing GFP (control) or (C) BE(2)-C cells infected with lentiviral vector co -expressing miR-124 and GFP. [score:5]
As miR-124 expression is higher in more neuronal N-cells (Figure 2D) and is elevated with RA -induced neuronal differentiation (Figure 3B), we sought to determine whether overexpression of miR-124 by itself is capable of inducing neuronal differentiation of tumorigenic I-type stem cells. [score:5]
MiR-124 expression is exclusive to neuroblastic cells and overexpression of this miRNA in NB stem cells induces terminal differentiation with concomitant reduction in their malignant potential, suggesting a therapeutic potential for this miRNA in treating NB. [score:5]
Thus, we hypothesized that neuronal differentiation following miR-124 overexpression might also decrease cell tumorigenicity. [score:3]
Expression levels of two miRNAs, miR-124 and miR-375, were higher in the neuroblastic phenotype (Figure 2D and E). [score:3]
Several other researchers have shown that miR-124 expression is related to neuronal differentiation [21, 22]. [score:3]
Thus, reciprocal expression of miR-124 and miR-335 seems critical for NB differentiation. [score:3]
Thus, increased expression of miR-124 induces neuronal differentiation in I-type stem cells. [score:3]
Overexpression of miR-124 in stem cells induces terminal neuronal differentiation with reduced malignancy. [score:3]
Infection of I-type BE(2)-C cells with lentivirus coexpressing miR-124 and GFP induced a neuronal morphology within two weeks of infection. [score:3]
Consistent with our findings, Le et al. showed that over expression of miR-124 in SH-SY5Y cells induces neurite outgrowth [26]. [score:3]
RA -induced differentiation increases miR-124 expression 2.0-fold (P < 0.01), whereas BrdU treatment causes a 5.0-fold reduction (P < 0.01) (Figure 3B). [score:3]
MiR-124, that is specific for neuroblastic cells, has been shown to decrease JAG1 expression leading to inactivation of Notch signaling during miR-124 -induced neuronal differentiation [16]. [score:3]
B. Changes in miR-124 and -375 expression in BE(2)-C cells treated with RA or BrdU to induce an N or S phenotype, respectively. [score:3]
miR-124 -overexpressing lentivirus was purchased from SBI Biosciences (Mountain View, CA). [score:3]
Generation of miR-124 -overexpressing BE (2)-C clones. [score:3]
Three additional miRNAs, all showing higher expression in N compared to I cells— miR-124, miR-375 and miR-10b ― were selected for further analysis. [score:2]
Levels of (D) miR-124 and (E) -375 were normalized to loading control U6 and expressed as a fold change compared to a SH-SY5Y standard. [score:2]
The six N-type cell lines have the highest levels of miR-124 expression [12.5-fold higher compared to I-type lines] suggesting its association with neuronal differentiation; S-cells have barely detectable levels of this miRNA. [score:2]
GFP fluorescent cells expressing miR-124 have smaller, more rounded cell bodies and markedly increased numbers of elongated neurites (Figure 5C) compared to control cells (Figure 5B). [score:2]
Likewise, miR-124 -induced neuronal differentiation reduced N- myc mRNA levels nearly 2-fold (P < 0.008) (Figure 5E). [score:1]
Colony-forming efficiency (CFE) in soft agar revealed that, whereas control cells have a CFE of 29.5%, miR-124-infected BE(2)-C cells have a CFE of 5.2% (Figure 5F), a significant 5.7-fold reduction in malignant potential (P < 0.001). [score:1]
Therefore, miR-124 has the potential for use as a therapeutic miRNA in NB. [score:1]
Our studies confirm the association of miR-124 to neuroblastic cell lines [21, 22]. [score:1]
D. [3]H-NE uptake in BE(2)-C cells is increased 1.5–fold (P < 0.002) following treatment with RA and 3.7-fold (P < 0.001) with miR-124 lentiviral infection. [score:1]
F. Colony forming efficiencies (CFE) of BE(2)-C cells stably infected with miR-124 lentiviral vector or control. [score:1]
Figure 5 miR-124 induces neuronal differentiation in I-type NB cells. [score:1]
validation confirmed that increased levels of miR-21, miR-221 and miR-335 are associated with the non-neuronal phenotype, whereas increased levels of miR-124 and miR-375 are exclusive to neuroblastic cells. [score:1]
RA treatment increased [3]H-NE uptake by 1.5-fold (P < 0.002) and miR-124 infection increased it 3.7-fold (P < 0.001) (Figure 5D). [score:1]
miR-124 induces terminal neuronal differentiation with reduction in malignancy. [score:1]
In BE(2)-C/miR-124-infected populations, miR-124 levels were 4.5-fold (P < 0.001) higher than BE(2)-C vector-infected populations (Figure 5A). [score:1]
Increased [3]H-norephinephrine ([3]H-NE) uptake, an indicator of sympathetic neuron differentiation [23], was observed with both RA- and miR-124 -induced BE(2)-C cells. [score:1]
[1 to 20 of 32 sentences]
33
[+] score: 74
Our primary hypothesis in this instance was that if biological off-target activity of either siRNA occurred via a miRNA-like transcript down-regulation mechanism then it should be possible to detect enrichment of putative off-target transcripts (i. e. using enrichment of the complementarity seed motif as a proxy of transcript down-regulation), as described for the hsa-miR-124 dataset. [score:11]
Our primary hypothesis regarding this dataset was that should hsa-miR-124 selectively down-regulate target transcripts via a seed-pairing directed mechanism then the nucleotide complement of the hsa-miR-124 seed sequence should be preferentially enriched in the down-regulated transcript population. [score:10]
In this study [7] hsa-miR-124 (i. e. UAAGGCACGCGGUGAAUGCC) was over expressed in HepG cells and RNA extracted at time points 0, 4, 8, 16, 24, 32, 72 and 120 hours post-transfection to identify gene transcripts down-regulated by hsa-miR-124 over expression. [score:8]
Note that SBSE estimates that the most significant grouping of hsa-miR-124 direct transcript targets are located to the right of the vertical line and are included amongst approximately 15% of the most down-regulated transcripts. [score:7]
Comparing the various expression profiles emphasised the transient nature of the RNAi effect and that the narrower enrichment peaks observed at 16 and 24 hour post-transfection suggest these are the optimum time points with which to maximise identification of the direct hsa-miR-124 target transcripts. [score:6]
Figure 2 Plots summarising the estimated location of the direct target transcripts of hsa-miR-124 16 hours post-transfection. [score:4]
Considering our observations with the hsa-miR-124 time study data we propose that the hsa-miR-155 enrichment profile also varies with time and that the observed profile in this instance may not indicate the maximum enrichment potential (and by inference, inhibitory profile) of this miRNA. [score:3]
The selected data clearly summarises how the hsa-miR-124 motif gains in prominence in each of the post-transfection samples and becomes undetectable if the differential expression profile is shuffled (Panel D). [score:3]
Analysis of a hsa-miR-124 post-transfection time-series [7] emphasised the transient nature of miRNA induced changes of the global expression profile and underlines the risk associated with generating hypotheses and validation studies based on a single, arbitrary, post-transfection sample. [score:3]
The differential expression profiles of each respective time point was queried with a variety of motifs that encompassed the 5' hsa-mir124 seed region. [score:3]
From the resulting plots it was observed that the hexamer GCCTTA generated the maximum enrichment score of 320 and that the 24 hour post-transfection expression profile was the most enriched for the complement of the hsa-miR-124 seed motif (Figure 3C). [score:3]
First the ranked, differential expression profile of each respective time point, relative to the 0 hour array, was queried for enrichment of a "GCCTTA" motif (i. e. the nucleotide complement of the hsa-miR-124 seed region). [score:3]
In this study hsa-miR-124 was over expressed in HepG cells and RNAs extracted at time points 0, 4, 8, 16, 24, 32, 72 and 120 h post-transfection [7]. [score:3]
Each of the four Panels A-D represent the analysis of a separate time-point following hsa-miR-124 transfection. [score:1]
Note that the previous hsa-miR-124 signature has been abrogated and that there is now an absence of a significant estimate or partitioning of the data. [score:1]
Intriguingly this motif does not represent either the major or minor forms of hsa-miR-30a-3p, but it was noted that a similar composite profile (i. e. enrichment for AT-rich hexamers) was observed when analysing the 8 hour time-point of the hsa-miR-124 time-series[7] (Additional File 1 Figure S2A) and in other analyses of RNAi microarrays datasets (not discussed). [score:1]
The TGCCTT motif generated an enrichment score of 120, suggesting a significant functional role for the adenine residue in hsa-miR-124 RNAi activity (Additional File 1 Figure S1). [score:1]
Our analyses indicated that, with the exception of the 4 hour sample, all profile estimates detected an unambiguous and prominent over-representation of the nucleotide complement of the hsa-miR-124 seed query sequence (Figures 3A, B, C and 3D and Additional File 1 Figure S1). [score:1]
The hsa-miR-124 GCCTTA seed motif is coloured red throughout and the maximum enrichment score " i*" is indicated on Panels B and C. Furthermore, in Panels B and C the maximum enrichment score is the query sequence. [score:1]
Should our hypothesis prove correct, this approach could then be extended to further elucidate the degree of miRNA sequence conservation associated with hsa-miR-124 RNAi by iteratively querying with 'overlapping' variations of the hsa-miR-124 seed region. [score:1]
[1 to 20 of 20 sentences]
34
[+] score: 72
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3
Additionally, IQGAP1 and miR-124 are co-expressed in neuronal cells [13], [15], suggesting that IQGAP1 may be a direct target of miR-124 in the brain. [score:6]
As a potential target gene of miR-124, IQGAP1 is a wi dely expressed scaffold protein and is engaged in multiple fundamental cellular activities, such as cell adhesion, cell migration and regulation of cytoskeleton [10]. [score:6]
In this study, we demonstrated that individuals carrying the derived T allele of rs1042538, which destroys the miR-124-target interaction and leads to an increased IQGAP1 protein expression, is associated with better tactual performance. [score:5]
To validate if IQGAP1 is indeed a miR-124 target and if the two alleles have differentiated miRNA regulations, we constructed three reporter plasmid by fusing the IQGAP1 3′UTR into the downstream of the luc reporter gene (Figure. [score:4]
Meanwhile, the down-regulation of the entire miRNA repertoire in neuron, including miR-124, can enhance learning and memory in mice [38]. [score:4]
An earlier in vitro experiment showed that the reporter gene bearing the 3′UTR of IQGAP1 could be down-regulated by miR-124 [14]. [score:4]
Collectively, these findings demonstrate that IQGAP1 is a true target of miR-124, and that the T allele at rs1042538 can impair the interaction between miR-124 and IQGAP1. [score:3]
MiR-124 is one of the most conserved and abundantly expressed neuron specific miRNAs. [score:3]
0107065.g001 Figure 1(a) Three putative miR-124 binding sites were found in the 3′UTR of IQGAP1 using TargetScanS algorithm. [score:3]
2a), indicating that IQGAP1 can be targeted by miR-124. [score:3]
Taken together, the results indicate that the derived T allele of rs1042538 can impair miR-124 IQGAP1 interaction in vivo and leads to an increased expression of IQGAP1 proteins in the brain. [score:3]
Using tissue samples from 29 human parietal cortices (18 AA homozygote individuals and 11 TT homozygote individuals), we measured the mature miR-124 expression and IQGAP1 expression at both mRNA and protein levels. [score:3]
We found that miR-124 was equally expressed in both genotypes (Figure. [score:3]
Modulation of miR-124 regulation of IQGAP1 by rs1042538 in vitro and in vivo. [score:2]
We next transfected all three plasmids with miR-124 mimic, and as expected, the T allele caused a significant impairment of the miR-target interaction as compared to the A allele (p = 0.007, Student's t-test) (Figure. [score:2]
0107065.g002 Figure 2Modulation of miR-124 regulation of IQGAP1 by rs1042538 in vitro and in vivo. [score:2]
Based on these previous observations, we hypothesized that the presence of the SNP rs1042538 might alter miR-124's regulation of IQGAP1, and in doing so, exert some effect on cognitive performance across human populations. [score:2]
The duplexes sequences were as follows:miR-124 (as previously described [14]) UAAGGCACGCGGUGAAUGCCA/GCAUUCACCGCGUGCCUUAAU control miRNA UUCUCCGAACGU GUCACGUTT/ACGUGACACGUUCGGAGAATT HEK293T cells were grown in DMEM containing 10% FBS (Thermo Fisher, USA). [score:1]
The binding sites complementary to the miR-124 seed region (position 2–7), as well as position 1, are totally conserved across all major nonhuman primate lineages (New World monkey, Old World monkey and great apes) (Figure. [score:1]
This SNP at the position 1 of the miR-124 binding site in the 3′UTR of IQGAP1 gene and it is highly conserved in major non-human primate lineages, including chimpanzee, gibbon, rhesus macaque and common marmoset (www. [score:1]
Quantitative measurement of miR-124, IQGAP1 mRNA and protein expression. [score:1]
There are three putative miR-124 binding sites in the 3′UTR of IQGAP1 (Figure. [score:1]
The miR-124 and control miRNA duplexes were synthesized in Shanghai GenePharma. [score:1]
Hence, it may affect the binding affinity of miR-124, and eventually lead to possible functional consequences. [score:1]
Rs1042538 affects miR-124 IQGAP1 interaction. [score:1]
We next examined if the T allele could impair miR-124 IQGAP1 interaction in vivo. [score:1]
The duplexes sequences were as follows: miR-124 (as previously described [14]) UAAGGCACGCGGUGAAUGCCA/GCAUUCACCGCGUGCCUUAAU control miRNA UUCUCCGAACGU GUCACGUTT/ACGUGACACGUUCGGAGAATT HEK293T cells were grown in DMEM containing 10% FBS (Thermo Fisher, USA). [score:1]
We cloned IQGAP1 3′UTR fragment of 975 bp covering three putative miR-124 binding sites and inserted it into the downstream of firefly luciferase reporter gene. [score:1]
For this study, we opted to focus on rs1042538, a functional variant residing in a miR-124 binding site of the IQGAP1 3′UTR. [score:1]
The known involvement of both miR-124 and IQGAP1 in cognitive performance led us to hypothesize that this SNP may have functional consequence to human cognition. [score:1]
To test this supposition, we first tested whether this SNP affects miR-124 IQGAP1 interaction in vitro and in vivo. [score:1]
[1 to 20 of 31 sentences]
35
[+] score: 63
In order to maintain the neural state, miR-124 downregulates the expression of non-neural mRNAs by repressing the expression of non-neural transcripts and thus directing the gene expression profile towards the neural state [60, 104, 137]. [score:11]
Over -expression of miRNA-124 in Hela cells promotes neurogenesis [137] Conversely, inhibiting miRNA-124 expression in cultured neurons induces non-neuronal transcript expression [233]. [score:9]
During neuronal differentiation, miR-124 also regulates alternative splicing by targeting polypyrimidine tract -binding protein 1 (PTBP1) mRNA, a repressor of neuron-specific pre-mRNA splicing, leading to the activation of neuronal gene expression [104]. [score:6]
Cell fate determination is clearly illustrated by the inhibition of transcription factor SOX9 by miR-124, encouraging the neurogenic precursor transition to neuroblasts [178] and the targeting by miR-219 and miR-338 of the transcription factors SRY-Box 6 (SOX6) and Hes family bHLH transcription factor 5 (Hes5), both involved with progenitor proliferation and stemness during oligodendrocyte differentiation [179, 180]. [score:5]
MiRNAs are expressed at various stages of the SVZ stem cell lineage, including miRNA-124 that ends up highly expressed in the adult brain [232]. [score:5]
Conversely, neuronal differentiation can be brought about by miR-125a/b and miR-135b blocking BMP signalling [223], miR-124, and miR-9 via the targeting of several components of the Notch signalling pathway, which in turn regulates neuronal development and expansion of neural progenitors [195, 224, 225], or the activation of PAX6 by miR-135b, promoting neural lineage entry [226]. [score:5]
High levels of miR-124 found in differentiated neural cells are associated with the absence of the transcription factor human specificity protein 1 (Sp1), indicating that Sp1 is a direct target of miR-124 [138]. [score:4]
Mondanizadeh M. Arefian E. Mosayebi G. Saidijam M. Khansarinejad B. Hashemi S. M. MicroRNA-124 regulates neuronal differentiation of mesenchymal stem cells by targeting Sp1 mRNAJ. [score:3]
Clark A. M. Goldstein L. D. Tevlin M. Tavaré S. Shaham S. Miska E. A. The microRNA miR-124 controls gene expression in the sensory nervous system of Caenorhabditis elegansNucleic Acids Res. [score:3]
MicroRNA-124 (miR-124) is a highly expressed tissue-specific [132, 133, 134, 135, 136] miRNA of the nervous system. [score:3]
Cheng L. -C. Pastrana E. Tavazoie M. Doetsch F. miR-124 regulates adult neurogenesis in the subventricular zone stem cell nicheNat. [score:2]
Yu J. -Y. Chung K. -H. Deo M. Thompson R. C. Turner D. L. MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiationExp. [score:2]
Visvanathan J. Lee S. Lee B. Lee J. W. Lee S. -K. The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS developmentGenes Dev. [score:2]
Makeyev E. V. Zhang J. Carrasco M. A. Maniatis T. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicingMol. [score:1]
Cao X. Pfaff S. L. Gage F. H. A functional study of miR-124 in the developing neural tubeGenes Dev. [score:1]
However, contradicting studies [102, 186] have shown that the actual role played by miRNA-124 during neurogenesis in vivo needs further elucidation. [score:1]
[1 to 20 of 16 sentences]
36
[+] score: 63
Upregulation of mir124, 182, 27b and let7b could inhibit the CCA cells proliferation and arrest the cell cycle in G0/G1 phase, however, the proliferation and cell cycle were both promoted through upregulating mir221 or mir181a expression (Fig. 4A-B). [score:11]
In summary, the cell-cycle-regulatory genes CDK2, CDK4, CyclinD1 and CyclinE1 were targeted by mir124, CDK2 and CyclinD1 were targeted by mir182 and mir27b, CyclinD1 was targeted by mirlet7b, P27 was targeted by mir221 and mir181a. [score:10]
In one patient, the expression change of mir124, 182, 27b or let7b was less than its cutoff value and this single miRNA expression of the patient scored one; the expression change of mir221 or 181a was greater than its cutoff value and this single miRNA expression of the patient also scored one. [score:9]
The results further confirmed that these dysregulated miRNAs, including downregulated mir124, 182, 27b, let7b and upregulated mir221, 181a, were involved in the CCA genesis and promoted this process. [score:8]
In human tissues, Drosha expression change was positively correlated with the expression changes of mir124, 182, 27b and let7b (Fig. 7I), and negatively associated with mirs -expression score (Fig. 7J). [score:7]
Among these fourteen candidates, six miRNAs (hsa-mir-124-3p, hsa-mir-182-5p, hsa-mir-27b-3p, hsa-mir-let7b-5p, hsa-mir-221-3p and hsa-mir-181a-3p), which might target cell-cycle-regulatory genes according to bioinformatic algorithms, were selected for further study. [score:4]
In the xenograft tumor tissues, there were obvious differences of mir124, 182, 27b, let7b and 181a expression between metformin group and control group (Fig. 3E). [score:3]
Fig. 3D showed that the expression changes of mir124, 27b, let7b and 181a of G3 patients were significantly less than those of G2 patients. [score:3]
Based on the cutoff value of each miRNA expression change [27- 29, 31], G2 patients were divided into High and Low mir patients, and High mir patients of mir124, 182, 27b, let7b and Low mir patients of mir221, 181a had smaller tumor volume and longer postoperative survival. [score:3]
Fig. 6B showed that the expression change of mir124, 27b, let7b and 181a was also closely associated with postoperative survival of G2 patients (R≤-0.45 or ≥0.45). [score:3]
The postoperative survival of Low and High mir patients was listed in Supplementary Table 3 and there were significant differences of postoperative survival between Low and High mir patients of mir124, 27b, let7, 221 and 181a (Fig. 6D). [score:1]
And G2 patients could be divided into two subgroups, such as Low mir124 patients and High mir124 patients. [score:1]
[1 to 20 of 12 sentences]
37
[+] score: 55
However, in Xenopus, miR-124 is expressed from the beginning of eye development where it plays an important role in regulating retinal neurogenesis in the optic vesicle and forebrain (57, 80, 81). [score:5]
In addition to this, miR-124 is required for optimal regulation of dendrite growth and targets components of the retrograde BMP signaling pathway to regulate synaptic release at the NMJ (59). [score:5]
In Drosophila, mir-124 targets anachronism (ana), an inhibitor of neuroblast proliferation. [score:5]
Drosophila miR-124 regulates neuroblast proliferation through its target anachronism. [score:4]
When Yoo and colleagues (121) added miR-9 and miR-124 precursors to cultured neonatal foreskin fibroblasts, they were able to directly convert them to neurons expressing the mature marker MAP2, albeit at a conversion rate of <5%. [score:4]
Interestingly, increased apoptosis was also observed, and this was correlated with reduced expression of miR-9 and miR-124 (107), two miRNA families that have been wi dely implicated in brain development. [score:4]
In a different mechanism, miR-124 and miR-22 regulate cell shape changes in migrating cortical neurons by controlling expression of doublecortin, a microtubule -associated cytoskeleton protein involved in cell shape remo deling through multipolar and bipolar phases in migrating neurons, through CoREST/REST (128). [score:4]
Therefore, the above-mentioned in vivo studies suggest that miR-9 and miR-124 are major players in the regulation of cerebral cortex development, but in vitro studies have shown that miR-9 and miR-124 can drive the neurogenic program. [score:3]
The absence of miR-124 results in decreased proliferative activity, which is coupled with an increase in ana expression (58). [score:3]
In neuronal differentiation, miR-124 is involved in a mechanism with the transcriptional repressor REST, whereby REST represses miR-124a and expression of neuronal genes in non-neuronal cells and neural progenitors. [score:3]
Another transcriptional repressor involved in the REST complex, MeCP2, also has predicted miR-124 -binding sites in its 3′UTR (118), and MeCP2 mutation or copy number variant has been implicated in multiple neurodevelopmental disorders including X-linked intellectual disability and autism (119, 120). [score:3]
For example, similar to other mo del organisms, miR-124 regulates early neurogenesis. [score:2]
In addition to being crucial for neuronal progenitor proliferation, miR-9 and miR-124 are emerging as key regulators of neuron migration. [score:2]
REST also has miR-124 -binding sites in its 3′UTR, suggesting a complex regulatory loop exists (118). [score:2]
For example, control of neuronal progenitor proliferation is fine-tuned by the highly conserved miRNA, miR-124, which has been shown in various organisms to regulate neuronal stem cells (54– 57). [score:2]
Also, miR-124 regulates RhoG, which is a major player in the control of axon and dendrite outgrowth and complexity, in mouse hippocampal neurons (135). [score:2]
The miR-124 family is also conserved from C. elegans to humans. [score:1]
miR-9 along with miR-124 and miR-125b has also been associated with inducing human pluripotent stem cells to differentiate into neurons (142). [score:1]
[1 to 20 of 18 sentences]
38
[+] score: 55
Each data point stands for one gene Of the four miRNAs that were significant, three miRNAs, miR-124, miR-9, and miR-128, show highly specific expression in the brain, based on a dataset of miRNA expression profiles across 40 human tissue samples [21] (Fig.   3b), which is consistent with the observed brain-specific destabilization of their targets. [score:7]
Each data point stands for one gene Of the four miRNAs that were significant, three miRNAs, miR-124, miR-9, and miR-128, show highly specific expression in the brain, based on a dataset of miRNA expression profiles across 40 human tissue samples [21] (Fig.   3b), which is consistent with the observed brain-specific destabilization of their targets. [score:7]
For validation of miRNA targets, we obtained experimentally validated targets of hsa-miR-124-3p, hsa-miR-128-3p, hsa-miR-29(a/b/c)-3p, and hsa-miR-9-5p from miRTarBase [35] release 6.1, which is a database of miRNA-target interactions collected from literature. [score:7]
High-confidence predicted targets of miR-124 are also 3.6-fold more likely to be downregulated in HeLa cells that express an ectopic copy of miR-124 [26], compared to transcripts that only have a match to miR-124 seed sequence (Fisher’s exact test P < 3 × 10 [–6], Fig.   4d). [score:7]
We used the set of genes with at least one probe on Rosetta 25k array as the background, in order to control for unobserved gene expression values, and calculated the enrichment of high-confidence stability targets of miR-124 among downregulated genes using Fisher’s exact test. [score:6]
d Venn diagram of genes with a match to miR-124 seed sequence, the subset in the high-confidence network, and genes that are downregulated when miR-124 is expressed in HeLa cells [26]. [score:6]
We also obtained the list of genes that are downregulated after ectopic expression of miR-124 in HeLa cells from ref. [score:6]
Of these miRNAs, miR-124 and miR-9 are involved in development and function of the nervous system 22, 23, and de-regulation of miR-128 is associated with tumors of the nervous system 24, 25. [score:3]
Cheng LC Pastrana E Tavazoie M Doetsch F miR-124 regulates adult neurogenesis in the subventricular zone stem cell nicheNat. [score:2]
Specifically, presence of 3′ UTR binding sites for miR-124, miR-29, miR-9 and miR-128 was significantly associated with reduced mRNA stability, whereas binding sites of RBFOX and ZFP36 families of RBPs were significantly associated with increased stability. [score:1]
Furthermore, our high-confidence network is significantly enriched for experimentally validated interactions that are collected from the literature for each of the four miRNAs miR-124, miR-128, miR-29, and miR-9 [35] (Fig.   4e). [score:1]
Furthermore, high-confidence binding sites of miR-124 contain conserved sequences that are compatible with extended base-pairing beyond the miR-124 seed region, in contrast to spurious matches to miR-124 recognition sequence (Supplementary Fig.   17c). [score:1]
We show that a substantial portion of the brain mRNA stability profile can be explained by the functions of two RNA -binding protein families (the RBFOX and ZFP36 families) and four miRNAs (miR-124, miR-29, miR-9, and miR-128). [score:1]
[1 to 20 of 13 sentences]
39
[+] score: 54
Several mRNAs targeted by neuronal miRNAs (i. e., miR-124, miR-9 and miR-96) were downregulated upon increased miRNA expression, consistent with expectations of the role of miRNAs in repressing downstream targets, whereas for the decreasing miR-302 cluster and miR-103, similar proportions of the targets were up- and downregulated. [score:15]
We initially analyzed the correlations between the expression levels of miR-302a-d, miR-124, miR-96, miR-9 and miR-103 and their experimentally validated (miRTarBase 4.4 (Hsu et al, 2011)) mRNA targets that are expressed in iNGN cells (Supplementary Fig S8). [score:7]
Validated targets for active transcription factors (having positive activation score: NEUROG2, NEUROG3, NEUROD1, NEUROD2, SPARC, SNAI1, SNAI2, ZEB1, and ZEB2) and upregulated miRNAs (miR9, miR96, miR124) were combined, respectively. [score:6]
This miRNA is known to be important for neuronal differentiation, since inhibition of miR-124 in vivo blocked adult neurogenesis in the mouse subventricular zone and its overexpression depleted the neural stem cell pool (Akerblom et al, 2012). [score:5]
Consistent with this view, fold changes of validated miR-124, miR-96 and miR-9 targets were often smaller than the targets of the proneural transcription factors in our network (Fig 6D). [score:5]
To further test the impact of miRNAs in iNGN cell differentiation, we knocked down the expression of the miR-302/367 cluster and miR-124 in iNGN cells by miRNA sponges (Ebert et al, 2007). [score:4]
At every time point and for each replicate, the relative miR-124 qRT–PCR expression levels were normalized to miR-302a and miR-96 and these ratios were multiplied with corresponding nCounter counts for miR-302a and miR-96 separately. [score:3]
Knockout experiments of miR-124 in mice resulted in brain abnormalities and increased apoptosis in retinal neurons (Sanuki et al, 2011). [score:2]
In our cells, miR-124 accounted for 12.8% of total miRNAs at day 0 and increased to 79% by day 4. We also observed increases in the abundance of the neuronal miR-96 (10-fold) and miR-9 (57-fold) (Fig 4B and E; Supplementary Fig S5) among others (Fig 4C). [score:1]
We used the average value for the estimated miR-124 (miR-124 [X]) counts. [score:1]
We also measured miR-124, a brain-enriched miRNA (Akerblom & Jakobsson, 2013), by qRT–PCR (Supplementary Fig S5) and normalized its expression levels to nCounter results (see). [score:1]
The miRNA sponge sequences for hsa-miR-124 and the hsa-miR-302/367 cluster were in silico designed as previously described by Krol et al (2010), synthesized (Genewiz), PCR-amplified and placed downstream of a GFP-T2A-puromycin cassette driven by the EF1α promoter within a lentiviral vector (Addgene Plasmid 12252: pRRLSIN. [score:1]
The nCounter and qRT–PCR fold changes correlated well (Supplementary Fig S5), thus allowing the reliable estimation of miR-124, which nCounter could not detect. [score:1]
Thus, miRNA profiles rapidly changed in the course of iNGN differentiation, consistent with the loss of pluripotency (miR-302 cluster) and the establishment of neuronal miRNA signatures (miR-124, miR-96 and miR-9). [score:1]
miR-124 [X] refers to estimated counts from qRT–PCR. [score:1]
[1 to 20 of 15 sentences]
40
[+] score: 54
Consistent with other glioma miRNA profiling studies [9], [14], [15], [31], we also observed down-regulation of miR-124, miR-128, miR-132, and miR-7, and up-regulation of miR-10b, amongst others, demonstrating that high-throughput sequencing can be an effective method for profiling miRNA expression. [score:9]
Several of the miRNAs down-regulated in glioblastoma (including miR-124-3p and miR-323-3p) exhibited 5′ truncations or additions while one up-regulated miRNA, miR-10b-5p, exhibited 5′ variations (Table S8). [score:7]
Brain-enriched miR-124 and miR-7, for example, show poor expression in neural progenitors, but are highly expressed in neurons and have been implicated in neural differentiation [20], [23], [54]. [score:5]
MiRNAs down-regulated in gliomas include miR-7, miR-124, miR-128, miR-137, and miR-181a/b [9], [14], [15], [18], [19]. [score:4]
miR-7, miR-124, miR-128, miR-132, and miR-212 are amongst the most highly down-regulated miRNAs found in glioblastomas compared to non-transformed cells (Fig. 1, Table S4, S6). [score:3]
To validate results from our deep sequencing experiments, we selected four differentially expressed miRNAs for further analysis: miR-21, miR-128, miR-124, and miR-132. [score:3]
Congruent with previous studies [42], [43], ATRA treatment of SH-SY5Y cells induced expression of the brain-enriched miRNAs miR-128 and miR-124 (Fig. 5A) as well as miR-132 and miR-7 (not shown). [score:3]
Additionally, we could not detect expression of miR-128, miR-124, or miR-132 in three glioblastoma cell lines (A172, U373, and U87). [score:3]
Primer extension analysis confirmed enhanced expression of miR-21 (Fig. 2A) and decreased expression of miR-128, miR-124, and miR-132 (Fig. 2B) in glioblastomas compared to non-tumor brain tissue samples. [score:3]
Furthermore, miR-7, miR-124, and miR-128 have been reported to impair cell growth and proliferation when over-expressed in glioma-derived stem cells [14], [15], [19], [41]. [score:3]
These 5′ nucleotide variations were observed in all nine sequencing libraries, and with the exception of miR-124-3p, there was no correlation of 5′ end variability and miRNA expression differences in tumors versus non-tumor samples (Table S4, S7, and S8). [score:3]
miR-128, miR-124, and miR-137 are all enriched in the brain and have been shown to regulate neuronal differentiation, maturation, and/or survival [15], [20]– [23]. [score:2]
B. miR-128, miR-124, and miR-132 expression levels detected by primer extension. [score:2]
At least 20 cellular miRNAs were differentially expressed in the six glioblastomas assayed here compared to non-tumor brain tissue, many of which (miR-128, miR-124, miR-7, miR-132, miR-139) are consistently dysregulated in not only gliomas but also other brain cancers including medulloblastomas and neuroblastomas [33]. [score:2]
A. Brain-enriched miRNAs, miR-128 and miR-124, are induced during neuronal differentiation of SH-SY5Y cells. [score:1]
Brain-enriched miRNAs, miR-128 and miR-124, are induced during neuronal differentiation of SH-SY5Y cells. [score:1]
[1 to 20 of 16 sentences]
41
[+] score: 53
Among the identified miRNAs, miR-124-3p, -125b-5p, -135b-5p, and -199a-5p showed a gradual decrease in expression in either HRECs or RPE cells along with an increase in HG-treatment time, whereas miR-145-5p and -146a-5p exhibited opposite expression changes (downregulation in HRECs and upregulation in RPE cells) in response to HG exposure for increasing durations. [score:11]
Although the expression of miR-124-3p and -125b-5p decreased gradually with an increase in HG-exposure time and concomitant with the early development of DR, miR-135b-5p, -145-5p, -146a-5p, and -199a-5p were upregulated on the first day and then downregulated on the following days (Figure 2(a)). [score:10]
Although miR-124-3p and -125b-5p remained downregulated during the different periods of DR examined, miR-135b-5p, -145-5p, -146a-5p, and -199a-5p exhibited increases in expression along with DR development. [score:7]
MiR-124, which was identified as a tumor suppressor, has been confirmed to be downregulated in cancers and investigated for its role in regulating cell proliferation and apoptosis by targeting different genes in distinct types of cancer [28– 30]. [score:6]
The expression of miR-124-3p, -125b-5p, -135b-5p, and -199a-5p decreased gradually along with an increase in HG-exposure time, whereas the expression of miR-145-5p and -146a-5p was elevated from day 1 to 7 (Figure 2(b)), with the levels of these two miRNAs on day 7 > 2.5-fold higher than those in the NG-exposed group. [score:5]
Unexpectedly, the expression of only miR-124-3p and -125b-5p was lower in the retina of DM rats in relation to DR development. [score:4]
Among the miRNAs studied here, miR-124-3p and -125b-5p were found to be downregulated during DR progression both in vitro and in vivo. [score:4]
Here, based on the results of bioinformatics analysis, we examined the expression of hsa-miR-124-3p, -125b-5p, -135b-5p, -145-5p, -146a-5p, and -199a-5p in HRECs or RPE cells under hyperglycemic conditions or in vivo in diabetic rats. [score:3]
These results and those presented in the preceding subsection together showed that both in vitro and in vivo, the expression of miR-124 and -125b decreased in correspondence with DR progression, but that of miR-135b and -199a decreased in retinal cells under hyperglycemia exposure and increased in the DM retina. [score:3]
[1 to 20 of 9 sentences]
42
[+] score: 52
These results suggest that miR-124 expression was rapidly upregulated during SeVdp(ABMN) -mediated MEF conversion and that miR-124 continued to accumulate in neuronal cells over time. [score:6]
In contrast to miR-124, we did not observe miR-9 expression over time during neuronal conversion (Fig.   2d,e), even though miR-9 reportedly exhibits strong expression in the brain and promotes neural differentiation [44]. [score:5]
Furthermore, we found that SeVdp-124T infection did not alter overall levels of miR-124 in the converted cells, suggesting that SeVdp-miR-Sensor did not appreciably disturb target miRNA expression (Fig.   2f). [score:5]
Additionally, we found that simple co-infection with SeVdp(ABMN) and SeVdp-124T enabled monitoring of miR-124 expression during direct neuronal conversion (Fig.   2d). [score:4]
Interestingly, overexpression of miR-9 and its opposite strand (miR-9*) in combination with miR-124 facilitates the reprogramming of human fibroblasts into neurons [45], suggesting a positive role for miR-9 in direct neuronal conversion. [score:4]
Notably, qRT-PCR analysis indicated that miR-124 levels were significantly upregulated at 7 days post-SeVdp(ABMN) infection, whereas miR-9 levels remained comparable to levels observed in uninfected MEFs (Fig.   2e). [score:4]
Based on its stable reporter gene expression, SeVdp-miR-Sensor enabled sensitive monitoring of miR-124 and let-7 during direct neuronal conversion and hiPSC generation, respectively. [score:4]
Subsequent qRT-PCR analysis indicated that expression levels of let-7a in NHDFs and WJSCs were considerably higher than those in hiPSCs and H9-NSCs, but H9-NSCs had relatively high levels of miR-9 and miR-124 compared to other cells (Supplementary Fig.   S2b,c), suggesting that the extent of the reduction in EGFP synthesis should be affected by levels of target miRNAs in the infected cells. [score:4]
Quantitative RT-PCR (qRT-PCR) analysis indicated that both miR-302a and miR-124 were expressed in hiPSCs (Supplementary Fig.   S2a,b). [score:3]
Expression levels of miR-9 and miR-124 were examined by qRT-PCR at 7 days post-infection of MEFs with SeVdp(ABMN). [score:3]
Because miR-124 is specifically expressed in neurons, but not astrocytes, it can be exploited as a neuron-specific molecular marker. [score:3]
Our time-lapse imaging results using SeVdp-124T revealed a spatiotemporal expression pattern associated with miR-124 during direct neuronal conversion, suggesting that SeVdp-124T might contribute to the efficacious evaluation of various protocols related to neuronal differentiation. [score:2]
Monitoring of miR-124 during direct neuronal conversion. [score:2]
MEFs were co-infected with SeVdp(ABMN) and SeVdp-FlucT (ABMN + Control) or SeVdp-124T (ABMN + 124 T), and miR-124 levels were examined by qRT-PCR on day 7. Values are the same as those described for (e). [score:1]
miR-124 is enriched in the animal brain and plays a critical role in the developing central nervous system 42, 43. [score:1]
To investigate the potency of SeVdp-miR-Sensor, we constructed vectors containing target sequences for let-7a (SeVdp-let-7aT), miR-302a (SeVdp-302aT), miR-9 (SeVdp-9T), or miR-124 (SeVdp-124T), as well as a vector containing complementary sequences for a portion of the firefly luciferase gene (SeVdp-FlucT) as a control. [score:1]
[1 to 20 of 16 sentences]
43
[+] score: 50
For example, inhibition of miR-106B and miR-124* resulted in 20-fold and 40-fold increased ADAMTS7 gene expression levels, respectively, while CPE gene expression was slightly reduced by miRNA inhibitors. [score:9]
In contrast, inhibition of miR-106B and miR-124* resulted in a >20-fold and >40-fold increase of DPP3 gene expression, respectively (Figure 5C), while miR-1254, miR-1272, and miR-17-3p inhibition caused a decrease of DPP3 expression. [score:9]
At 24 h post-treatment, ADAMTS7 gene expression levels increased 20-fold when miR-106B was inhibited, and 40-fold when miR-124* was inhibited (Figure 5A). [score:7]
Of the 8 miRNA inhibitors tested, inhibition of miR-106B was associated with a decrease in influenza virus replication, while inhibition of miR-124 resulted in an increase in virus replication with respect to the negative control. [score:7]
Although miR-124-a was not found to regulate any of the 5 host protease genes from our screen, it is reported to have a putative target in both swine influenza virus and the 2009 pandemic H1N1 strain [67]. [score:4]
Given the evidence that miR-1254, miR-1272, miR-17-5p, miR-17-3p, miR-106B, miR-106B*, miR-124-a, and miR-124* are involved in governing aspects of ADAMTS7, CPE, DPP3, MST1, and PRSS12 gene expression (Figure 5), the role of these miRNAs in the regulation of influenza virus replication was determined (Figure 6). [score:4]
A library of miRNA antagonists was used to confirm miRNA regulation, and several miRNAs were identified to affect virus replication and host gene regulation, notably miR-1254, miR-106B, miR-106B*, miR-124-a, and miR-124*. [score:3]
Inhibition of miR-124-a resulted in an increase of influenza virus replication relative to the negative control. [score:3]
Since none of the 5 validated genes were increased by inhibition of miR-124-a, it is likely miR-124-a affects influenza replication through other genes yet identified. [score:3]
Pathway analysis of the five validated host genes revealed potential miRNA interaction (Figure S4) with eight miRNAs (miR-1254, miR-1272, miR-17-5p, miR-17-3p, miR-106B, miR-106B*, miR-124-a, and miR-124*). [score:1]
[1 to 20 of 10 sentences]
44
[+] score: 50
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3, hsa-mir-488
However, over -expression of miR-124 did not regulate AR expression in MCF7 or T47D cells, which otherwise display no endogenous expression of this miRNA. [score:8]
To quantitate the expression of miR-124, total RNA from transfected MCF7 and T47D cells was extracted using Trizol (Invitrogen) and the expression of miR-124 determined relative to RNU6B using the miScript PCR System according to the manufacturer's instructions (Qiagen). [score:5]
Cells transfected with pcDNA 3.1(+)-mir-124 expressed high levels of mature miR-124 at 12, 24, 39 and 48 hr time intervals post-transfection, whereas no endogenous expression was detected in control -transfected cells (Figure 6a). [score:5]
Bioinformatic analysis revealed that miR-124 was the only miRNA predicted to target the human AR 3'UTR using miRanda and TargetScan. [score:5]
These results suggest that miR-124 is unlikely to regulate AR expression in these cells. [score:4]
miR-124 does not regulate the AR 3'UTR in breast cancer cellsMiRNAs are small non-coding RNAs of ~20nt in length that are capable of modulating gene expression post-transcriptionally. [score:4]
MCF7 and T47D cells were transfected with pcDNA 3.1(+)-mir-124 vector and expression of miR-124 verified. [score:3]
To examine whether miR-124 regulates the expression of the AR transcript, we used a reporter gene assay. [score:3]
MiR-124 was the only miRNA predicted by two commonly used algorithms to target the AR 3'UTR. [score:3]
miR-124 overexpression did not alter luciferase activity of the AR 3'UTR construct in any of the cell lines examined (Figure 6b). [score:3]
The role of miR-124 in regulating AR expression was also investigated, however no evidence for this was found. [score:2]
miR-124 does not regulate the AR 3'UTR in breast cancer cells. [score:2]
This suggests that either miR-124 is unable to regulate AR in this particular experimental system, or that the prediction not correct. [score:2]
Only miR-124 was predicted by both algorithms. [score:1]
[1 to 20 of 14 sentences]
45
[+] score: 45
The suspected target gene was Sox9 and embryonic overexpression of mir-124 lead to overexpression of this target gene in the adult mouse, presumably to compensate for the abnormal embryonic miRNA profile [55]. [score:9]
A selection of target genes for mir-9 and mir-124 (list in S7 Dataset) were tested by qPCR but none of them were significantly suppressed in the obese group (S8 Dataset). [score:5]
MicroRNAs miR-96, miR-124, and miR-199a regulate gene expression in human bone marrow-derived mesenchymal stem cells. [score:4]
In a study of macrophages in lung inflammation, mir-124 expression was up regulated in macrophages by IL4 and IL13 stimulation as well as by allergy induced inflammation [53]. [score:4]
On the other hand, adipocytes have also been proven to express mir-124 [54]. [score:3]
IL-4/IL-13 -dependent and independent expression of miR-124 and its contribution to M2 phenotype of monocytic cells in normal conditions and during allergic inflammation. [score:3]
The overexpression of mir-9 and mir-124 in the adipose tissue of obese pigs may also contribute to the lipid accumulation in the adipocytes. [score:3]
Inactivated lipid carrying HSCs have higher mir-9 and mir-124 expression than activated HSCs that carry no lipids [63]. [score:3]
Additionally, only mir-124 is significantly up regulated in abdominal adipose tissue of male obese pigs and both mir-9 and mir-124a are up regulated in the liver of obese male pigs. [score:3]
MiRTarbase Verified mir-9 and mir-124 Target Genes. [score:3]
Mir-124 expression has previously been linked to weight gain. [score:2]
Mir-124 is also targeting ADIPOR2 –a receptor for the protein hormone adiponectin, which is secreted in adipose tissue [58]. [score:2]
An example is that mir-9 and mir-124 are slightly up regulated in the blood of diabetic patients compared to non-diabetic controls [52]. [score:1]
[1 to 20 of 13 sentences]
46
[+] score: 44
Therefore, to explore if targeting of an ORF region of DEN4 by mosquito-specific miRNAs can result in specific viral attenuation in mosquitoes, targets for mosquito-expressed mir-184 and mir-275 as well as three targets for human neuron-specific mir-124 miRNA were introduced in the DEN4 genome between sequences encoding the two C-terminal stem-anchor domains of DEN4 E protein (D4-E virus; Fig 1). [score:9]
Both D4-E and D4-E-NCR1 viruses contained miRNA targets for mosquito-specific mir-184 and mir-275 and three copies of target sequences for vertebrate brain-specific mir-124 in the duplicated E/NS1 region (Fig 1). [score:5]
1004852.g001 Fig 1 Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
Another significant observation of this study was the fact that targeting of the DEN4 genome with mosquito specific miRNA does not interfere with the capacity of CNS-enriched mir-124 miRNA to restrict replication of mir-124 targeted DEN4 viruses in the brain of newborn mice (Fig 7). [score:5]
Target sequences for mosquito specific mir-1 (5’-CTCCATACTTCTTTACATTCCA-3’), mir-184 (5’-GCCCTTATCAGTTCTCCGTCCA-3’) and mir-275 (5’-GCGCTACTTCAGGTACCTGA-3’) or human brain-specific mir-124 (5’-GGCATTCACCGCGTGCCTTA-3’) were introduced into the 3’NCR of DEN4 genome between nts 10,277 and 10,278 (position 1, Fig 1) or 10,474 and 10,475 (position 2, Fig 1); these sites of target insertion are located 15 or 212 nts downstream of the TAA stop codon in the 3’NCR, respectively. [score:5]
As a control virus for comparative assessment in the CNS of mice, we generated a D4-E** virus based on D4-E that contained synonymous mutations in the third base position of each codon of the CNS-specific mir-124 target sequences. [score:4]
Specifically, the introduced sequence was inserted between nts 2451 and 2452 of DEN4 genome and contained five tandem targets for mir-124, mir-184 and mir-275 that were followed by a duplicated DEN4 E/NS1 region (nts from 2130 to 2451 of DEN4 genome) encoding 98 amino acids from the C-terminal end of the DEN4 E protein and 7 amino acids from the N-terminal end of the NS1 protein (Fig 1). [score:3]
Interestingly, D4-E** virus with scrambled mir-124 target sequences in the ORF had a lower titer in the brain at each time point as compared with D4 virus (Fig 7A, p<0.001; 2-way ANOVA) and only 25% of mice infected with D4-E** virus died during a 21-days observation period (Fig 7B, p = 0.0014; log-rank test). [score:2]
The effect of mir-124 targeting in limiting neurotropism of flaviviruses has been extensively characterized in our laboratory previously [34– 36]. [score:1]
[1 to 20 of 10 sentences]
47
[+] score: 44
In addition, an FGF 5′ UTR region and a 3′UTR containing the target sequence for miR124 are added to regulate expression of ICP4 for tumour-specific translation (Figure 1). [score:8]
Significantly downregulated ICP4 expression was observed in the presence of miR124 precursor (Figure 4A). [score:6]
Our results showed that combined with 5′UTR and 3′UTR miR124 translational regulators, survivin promoter -driven ICP4 expression was higher in tumour cells. [score:6]
To select an effective micro RNA target for our glioma-specific oncolytic virus, we studied miR124, miR143 and miR145 expression profiles in a panel of different human tissues and found that the miRNA 124 level is significantly higher in human brain tissue (Figure 3A). [score:5]
C. miR124 expression levels in the indicated gliomas and normal cells were detected by qRT-PCR. [score:3]
To that end, we further tested an HSV-1 vector, SU4-124 HSV-1, of which the ICP4 gene is controlled by the survivin promoter and FGF 5′UTR in addition to the miR124 target in the 3′ regions. [score:3]
Moreover, replication of CMV-124T HSV-1 in which the ICP4 gene is controlled by a 3′UTR region with an miR124 target, drastically decreased in miR124 precursor -transfected cells (Figure 4B). [score:3]
Moreover, its expression profile in different mouse tissues also confirmed the augmentation of miR124 in the brain (Figure 3B). [score:3]
Replication & cytotoxicity of miRNA124 targeted amplicon virus. [score:3]
Data are presented as means ± S. D. To evaluate the specificity of the miR124-regulated ICP4 expression, 293FT cells were co -transfected with different concentrations (20 ng, 50 ng and 200 ng) of miR124 precursor and CMV-124T plasmid. [score:2]
miR124 prevented the replication of miRNA regulated virus. [score:2]
[1 to 20 of 11 sentences]
48
[+] score: 42
A previous study also found that miR-124 was closely related to stroke, which could be used to monitor ischemia-related brain injury starting at 8h and peaking at 24 h after occlusion 8. Another study indicated that miR-124 regulated Ku70 expression and was correlated with neuronal death induced by ischemia/reperfusion 9. Moreover, miR-124a was also found to mediate stroke -induced neurogenesis by targeting the JAG-Notch signaling pathway 10. [score:6]
Twenty-nine genes got involved in the activation and inhibition directly, 14 of which were targetgenes of miR-124 (Fig. 4). [score:6]
The targetgenes of miR-124 accounted for 40.0%, 31.6%, and 29.4% of all the genes associated with the three pathways, respectively (Table 2). [score:3]
Of these, 7 miRNAs (hsa-mir-122, hsa-mir-124, hsa-mir-133a, hsa-mir-145, hsa-mir-155, hsa-mir-181a, and hsa-mir-362) could predict targetgenes in all the three databases. [score:3]
Our results showed that targetgene SP1 of miR-124 activated EGFR of miR-133a by MAPK cascade. [score:3]
Number of targetgenes of miR-124 in the top 3 KEGG pathways and GO processes. [score:3]
The six predicted miRNAs were associated with 34 genes, 16 of which were the targetgenes of miR-124, such as VIM, KANK1, PRKAG2, and ARPC1B. [score:3]
As miR-124 had the largest number of targetgenes, it might play important roles in the whole network. [score:3]
The proportions of targetgenes of miR-124 in the top three functional modules were 64.11%, 72.01%, and 63.63%, respectively. [score:3]
The targetgenes of miR-124 were involved in all the 13 functional modules. [score:3]
miR-124 had the largest proportion of targetgenes, accounting for 67.57%, followed by miR-181a and miR-155, accounting for 10.11% and 8.76%, respectively (Supplementary Table 1). [score:3]
Our study demonstrated that miR-124 was the most important regulator. [score:2]
A total of 11 miRNAs (hsa-mir-122, hsa-mir-124, hsa-mir-133a, hsa-mir-145, hsa-mir-155, hsa-mir-181a, hsa-mir-298, hsa-mir-362, hsa-mir-497, hsa-mir-1, and hsa-let-7f) were identified to be related to human stroke based on the HMDD. [score:1]
[1 to 20 of 13 sentences]
49
[+] score: 42
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3
These results indicated the conservation of REST inhibitory effect on miR-124 in GBM in human and we can speculate that one mechanism by which REST sustains self-renewal and tumorigenic competence of isolated GB cells might be through the repression of miR-124 expression (and deregulation of miR-124 targets) (Figure 6). [score:8]
Among them, miR-124 represents the most differentially expressed miRNA between GBM and normal brain being poorly expressed in GBM [38], [39]. [score:5]
miR-124 expression increases during NSC differentiation [40], and over -expression of miR-124 in putative GBM-derived stem cells has been shown to induce a dramatic increase in neuronal differentiation markers accompanied by reduced self-renewal and tumorigenicity [38]. [score:5]
Data are means ± s. d. (B) Expression levels of miR-124 targets, SCP1 and PTPN12 phosphatases, in GB cells are controlled by REST. [score:5]
We also found that the increase of miR-124 levels in REST -depleted GB cells resulted in a substantial reduction of SCP-1 and PTPN12 levels (Figure 5B), two phosphatases whose expression has been previously demonstrated to be controlled by a REST-miR-124 circuitry [41], [42]. [score:3]
REST Controls SCP1 and PTPN12 Phosphatases Expression Levels in Human Tumorigenic-competent GBM Cells by Modulating miR-124 Levels. [score:3]
REST controls SCP1 and PTPN12 phosphatases expression levels in human tumorigenic-competent GBM cells by modulating miR-124 levels. [score:3]
0038486.g005 Figure 5(A) Quantitative RT-PCR analysis shows elevated miR-124 expression following REST knockdown in GB7 cells (shREST; 4 days post infection) compared to CTRL and NT shRNA control cultures. [score:3]
miR-124 expression level was normalized to RNU48 levels. [score:3]
Of note, miR-124 levels directly correlated with patients’ survival [39]. [score:2]
We thus assayed miR-124 expression levels in normal and REST -depleted GB cells. [score:2]
[1 to 20 of 11 sentences]
50
[+] score: 41
In contrast, inhibition of miR-124 raised the relative number of TH -positive neurons, despite the general reduction of neuronal differentiation observed in cultures transfected with miR-124 inhibitor (Figure 5B, C). [score:5]
It will be interesting to explore whether FXRP1 has a role in the regulation of mature miR-124 and miR-9 expression during differentiation of human neural stem cells. [score:4]
Within Group 1, we found several brain-enriched and neuronal -associated miRNAs including miR-124, miR-125b and miR-9, which we have recently described in the context of lt-NES cell differentiation [28] All three miRNAs were up-regulated during neuronal differentiation of lt-NES cells (Figure 2A). [score:4]
Besides the known neural -associated miR-124, miR-125b and miR-9/9*, our profiling revealed many other miRNAs up-regulated during human neural lineage entry and differentiation. [score:4]
0059011.g005 Figure 5(A, B) Histograms showing the percentage of β-III tubulin -positive cells in 7 days (A, ND7) and 15 days (B, ND15) differentiated lt-NES cells (I3 cell line) transfected with control (ctr), miR-124, miR-125b, miR-181a and miR-181a* mimics and inhibitors. [score:3]
Our northern blot analyses of miR-124 and miR-9 expression patterns in hES cells and neural derivatives show that their precursor processing is compromised at the pluripotent stage. [score:3]
In contrast, ectopic expression of miR-124 led to a pronounced reduction in the numbers of both TH -positive neurons and GAD -positive neurons (Figure 4C, D). [score:3]
Quantification of the percentage of β-III tubulin -positive cells in lt-NES cultures transfected with miRNA mimics and inhibitors confirmed that miR-124, miR-125b, miR-181a and miR-181a* are all impacting on neuronal differentiation (Figure 5A, B). [score:3]
Mature miR-125b, miR-124 and miR-9 were found expressed in neural cells (lt-NES, ND15, ND30) only, whereas their precursors were also detected in hES cells (Figure 2A). [score:3]
Moreover, miR-9/9* and miR-124 were shown to significantly contribute to the direct conversion of fibroblasts into neurons [12], [13]. [score:2]
As recently shown, the RNA binding protein FXRP1 (fragile X mental retardation syndrome-related protein 1) is involved in the regulation of miRNA biogenesis and participates in pre-miR-9 and pre-miR-124 processing in the mouse brain [55]. [score:2]
MiR-124, miR-125b and miR-181a/a*affect subspecification of lt-NES cell-derived neurons. [score:1]
0059011.g004 Figure 4(A, B) Immunostainings for β-III tubulin plus TH (A) or GAD65/67 (B) in lt-NES cells (I3 cell line) transduced with LVTHM-ctr or LVTHM-miR-124, -miR-125b and -miR-181a/a*, respectively, and differentiated for 15 days. [score:1]
We extended the analysis to the known neural -associated miR-124 and miR-125b for a comparison, since we have recently demonstrated their general contribution to neuronal differentiation of lt-NES cells [28]. [score:1]
Histogram showing the percentage of TH -positive neurons in untransduced lt-NES cells (I3 cell line, dashed line) and in lt-NES cells transduced with LVTHM-ctr, -miR-124, -miR-125, -miR-153, -miR-181a/a* and miR-324-5p/3p constructs, respectively, after 15 days of differentiation. [score:1]
Furthermore, loss-of-function experiments proved that miR-181a, as well as the neural -associated miR-124 and miR-125b are required for the differentiation of lt-NES cells into neurons. [score:1]
[1 to 20 of 16 sentences]
51
[+] score: 39
On the other hand, miR-138 expression was significantly higher in tumor than in normal tissues and miR-26a and miR-124 expression was comparable between the two types of tissues. [score:5]
On the other hand, expression of miR-138 was significantly higher in tumor tissues than in matched normal tissues (Figure 2D) and the expression levels of miR-26a and miR-124 were not significantly different between tumor and matched normal tissues (Figure 2E and F). [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 inhibit the expression of EZH2 in nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma, respectively [21- 26]. [score:5]
On the other hand, it was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 could inhibit the expression of EZH2 in some tumors. [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 were involved in the regulation of EZH2 expression in some human tumors such as nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma [21- 26]. [score:4]
Considering that the expression and function of miRNAs may vary in different types of tumors, here we set out to investigate whether these miRNAs (miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214) regulate tumor metastasis via altering EZH2 expression in human ESCC. [score:4]
MiR-26a, miR-98, miR-101, miR-124,miR-138 and miR-214 were reported to be decreased in some human tumors and posttranscriptionally regulate the expression of EZH2 [21- 26]. [score:4]
showed that the expression of miR-98 (A), miR-101 (B) and miR-214 (C) were significantly decreased in tumor tissue compared with the matched normal tissue; while that of miR-138 (D) was significantly increased in tumors tissue, and there was no significantly difference in the expression of miR-26a (E) and miR-124 (F) between the two groups. [score:4]
In the present study, we first examined the expression levels of MiR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 in clinical samples of ESCC and matched normal tissues using qPCR. [score:3]
[1 to 20 of 9 sentences]
52
[+] score: 39
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-3, hsa-mir-155
We also ensured that the two target sets were indistinguishable across a variety of metrics, including 3′ UTR length, total length, and expression (Additional file 1: Figure S2), so that the miR-155 targets would serve as suitable no-site controls for the miR-124 transfections, and vice versa. [score:7]
As expected given the criteria used to choose the target sets, robust decreases in the RNA abundance of cognate targets was observed (Fig.   1a; median log [2] fold change = −0.80, p < 10 [−15] for the miR-124 transfection; median log [2] fold change = −0.52, p < 10 [−15] for the miR-155 transfection; two-tailed Kolmogorov–Smirnov [K–S] test). [score:5]
These included four highly abundant reference mRNAs (ACTB, G6PD, GAPDH, and RPL19) to allow intersample normalization, 95 high-confidence miR-124 targets, and 94 high-confidence miR-155 targets. [score:5]
NanoString quantification of mRNAs that co-immunoprecipitated with DDX6 showed that miRNA targeting substantially increased DDX6 occupancy, with median increases of 43 and 27% observed for cognate targets after transfection of miR-124 and miR-155, respectively (Fig.   2a; p < 10 [−10] and p < 10 [−6], K–S test). [score:5]
Overall, we observed robust increases in AGO2 occupancies for miRNA targets (Fig.   1a; median log [2] fold change = 1.66, p < 10 [−13] for miR-124; median log [2] fold change = 1.14, p < 10 [−10] for miR-155; K–S test). [score:3]
Consistent with previous reports [58– 60], targets were enriched in the AGO2 precipitations when cognate miRNA was introduced (Fig.   1a; median log [2] fold change = 0.87, p < 10 [−6] for miR-124; median log [2] fold change = 0.65, p < 10 [−4] for miR-155; K–S test). [score:3]
Line graphs plot the cumulative distributions of changes in total mRNA (left), AGO2-immunoprecipitated mRNA (middle), and AGO2 occupancy (right) due to transfection of miR-124 (top) or miR-155 (bottom), distinguishing the results for targets of the transfected miRNA from those of the other miRNA (red and black, respectively). [score:3]
To investigate this process for endogenous mRNAs transcriptome-wide, we determined the lengths of poly(A) tails in the total and PABP-bound fractions in the presence and absence of miR-124 or miR-155, using an antibody against PABPC1, the most highly expressed PABP in the cytoplasm of HEK293 cells. [score:1]
We used poly(A)-tail length profiling by sequencing (PAL-seq) [36] to determine tail lengths in both DDX6-immunoprecipitated and steady-state total mRNA from mock and miR-124- and miR-155 -transfected cells. [score:1]
In the case of miR-124 transfection, eIF4G and PABP occupancy decreased by 7.3 and 11.7%, respectively (p = 0.0005 and p < 10 [−8], K–S test). [score:1]
Figure S2 Broadly similar characteristics of the miR-124 and miR-155 target sets detected by NanoString. [score:1]
In each experiment, HEK293 cells were transfected with either miR-124, miR-155, or no miRNA. [score:1]
As with the, DDX6 occupancy on site-containing RNPs significantly increased in the presence of the cognate miRNA (Fig.   2b; median log [2] fold change = 0.09, p < 10 [−15] for miR-124; median log [2] fold change = 0.10, p < 10 [−15] for miR-155, K–S test). [score:1]
For both the miR-124 and the miR-155 analyses, no significant difference was observed (Fig.   4f; p = 0.36 and 0.78, respectively). [score:1]
As observed for DDX6-bound mRNAs in the mock transfection, tails of DDX6-bound mRNAs in miR-124- and miR-155 -transfected cells were significantly shorter than those of total mRNA in the cell (Fig.   3d; p < 10 [−15], Mann–Whitney U test). [score:1]
[1 to 20 of 15 sentences]
53
[+] score: 38
In addition, two known proliferation-promoted targets (IL6R and DLX2) of miR-124 were found to be downregulated by the knockdown of circHIPK3, and the miR-124 -mediated repression of the two target genes was rescued by ectopic expression of circHIPK3 (Fig. 7d). [score:11]
circHIPK3 and miR-124 were both highly expressed in brain tissues, and their expression levels positively correlated in various normal human tissues (Fig. 7f). [score:5]
Taken together, these results suggest that circHIPK3 could directly bind to miR-124 and inhibit its activity. [score:4]
Specifically, the expression of miR-124 was determined by TaqMan real-time PCR. [score:3]
Moreover, the ectopic expression of circHIPK3 could attenuate the anti-proliferative effects of miR-124 (Fig. 7e). [score:3]
circHIPK3 sponges with miR-124 and inhibits its activity. [score:3]
A cell proliferation assay revealed that four of the miRNAs (miR-124, miR-193, miR-379 and miR-654) could significantly inhibit HEK-293 T cell growth, and miR-124 exerted the most striking effect (Fig. 7a). [score:2]
The double FISH assay was performed in HeLa cells after co-transfection with circHIPK3 and miR-124 expressing vectors. [score:2]
The correlation between circHIPK3 and miR-124 is also shown. [score:1]
We also investigated the expression level and correlation between circHIPK3 and miR-124 in different tissues. [score:1]
The signals of Dig -labelled locked nucleic acid miR-124 probes were detected using tyramide-conjugated Alexa 488 fluorochrome TSA kit. [score:1]
Biotin -labelled probes specific to circHIPK3 and Dig -labelled locked nucleic acid miR-124 probes (Exiqon, Vedbaek, Denmark) were used in the hybridization. [score:1]
The co-localization experiments are consistent with circHIPK3 interacting with miR-124 (Fig. 7c). [score:1]
[1 to 20 of 13 sentences]
54
[+] score: 37
Three hStau1-specific mRNAs contained predicted miR-124 targets and have been described as related to neuron function: The homeobox-containing gene engrailed2 (en2), which is involved in autism disorder [61], [62], the magnesium transporter 1 gene (magt1), identified by differential expression during epilepsy [63] and most interestingly, synaptic cell-adhesion molecule2/ leucine-rich repeat and fibronectin III domain-containing molecule1 (salm2/lrfn1) gene. [score:5]
Among these, miR-124 stands out as particularly enriched in hStau1-containing complexes and is over-expressed upon differentiation of human neuroblastoma cells in vitro and (ii) Expression of hStau1 is essential for proper dendritic arborisation during neuroblastoma cell differentiation, yet it is not necessary for maintenance of the differentiated state. [score:5]
Previous reports have documented that miR-124 participates in the neural development by modifying several of the regulation layers indicated above, like transcription [24], alternative splicing [48] or specific protein silencing [49]. [score:3]
To verify these results in a more physiological setting we used human neuroblastoma SH-SY5Y cells, since both miR-124 and miR-9 are highly expressed in neural cells [45], [46]. [score:3]
Interestingly, two of the most prominent miRNAs found associated to hStau1 during screening were miR-124 and miR-9, which have been described as highly relevant for neural development [24], [47]– [49]. [score:2]
To analyse the size pattern of miR-124–containing complexes during differentiation, total cell extracts derived from SH-SY5Y cells were prepared at days 0 and 10 in the differentiation process and fractionated by gel filtration on Sephacryl S400 as indicated above. [score:1]
Fraction pools F1 to F4 were generated as indicated in Fig. 4 and the RNA was used for miR-124 determinations using RT-qPCR. [score:1]
Figure S1 Induction of miR-124 upon neuroblast differentiation. [score:1]
In addition, miR-124 showed higher concentration in the hStau1 fractions than in the initial cell extract, whereas the rest of the miRNAs analysed were not enriched in the hStau1 complexes (Fig. 3D). [score:1]
The size pattern of miR-124-containing complexes changes during neuroblast differentiation. [score:1]
Particularly interesting were miR-124 and miR-9, that showed the highest hStau1 vs TAP ratio, using as a control miR-147a, that was not present among those detected in the initial screening (Fig. 3C). [score:1]
Association of miR-124 to hStau1 complexes in undifferentiated and differentiated neuroblastoma cells. [score:1]
Furthermore, the association of both miR-124 and miR-9 to hStau1 complexes was verified in non -transfected SH-SY5Y human neuroblastoma cells (Figs. 4, 5). [score:1]
All miRNAs tested were detected in the hStau1-containing F1 pool and, interestingly, miR-124 and miR-9 were preferentially found in this fraction. [score:1]
Here we identify miR-124 and miR-9 as miRNAs specifically associated to hStau1, one of these proteins, and show that hStau1 is important for the proper differentiation of human neuroblastoma to neuron-like cells. [score:1]
In agreement with the reported role of miR-124 in neuronal cell differentiation in chick and mouse [47]– [49], a large increase in the total miR-124 concentration was observed in human neuroblastoma SH-SY5Y cells upon differentiation in vitro (Fig. S1). [score:1]
Whereas most of the miR-124 co-migrated with the hStau1 complexes in undifferentiated cells, it was mostly present in smaller complexes co-migrating with Ago2 when the cells became differentiated. [score:1]
Here we show that, as expected, the levels of miR-124 increase during the differentiation of neuroblastoma to neuron-like cells in vitro (Fig. S1) and, furthermore, its pattern of association to hStau1 complexes changes along this process (Fig. 5), suggesting a role for hStau1 in neural differentiation. [score:1]
We show the association of hStau1 with the Ago components of the RISC and identify miR-124 and miR-9 as the miRNAs preferentially associated to hStau1 RNA granules. [score:1]
These results were verified for miR-124 and miR-9 in three independent filtration experiments and the data are presented in Fig. 4C. [score:1]
miR-124 accumulates in human Staufen1 complexes. [score:1]
The specific association of miR-124 with hStau1 complexes and the alterations observed in this interaction during human neuroblast differentiation prompted us to address the role of hStau1 in this process. [score:1]
In addition, miR-124 was the only miRNA among those tested that showed higher concentration in the hStau1 -associated RNA than in total cell RNA (Fig. 3D). [score:1]
Total cell RNA was isolated and the concentration of miR-124 was determined by TaqMan RT-qPCR. [score:1]
[1 to 20 of 24 sentences]
55
[+] score: 37
We have previously shown that miR-124 down-regulates Tip110 expression by directly targeting its 3′ UTR [7]. [score:9]
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
The second group that had a low expression level on day 1 and a high expression level on day 7 included miR-148, miR-494, miR-124, miR-193, and miR-300. [score:5]
Recently, we have reported that miR-124 specifically binds to Tip110 and regulates Tip110 expression followed by differentiation of human cord blood (CB) CD34+ cells, and production of hematopoietic progenitor cells (HPCs) in vitro [7]. [score:4]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG (A) Schematic of the Tip110 3′UTR region with predicted miRNA binding sites (Tip110 miRNA). [score:1]
[1 to 20 of 9 sentences]
56
[+] score: 35
Lim et al. identified 96 genes that were significantly down-regulated (p-value < 0.001) at both 12 and 24 hours with miR-1 over -expression and 174 genes with miR-124 over -expression. [score:8]
Ensembl accession numbers of genes down-regulated in human HeLa cells with miR-124 over -expression. [score:6]
Both miR-1 and miR-124 are known for their tissue specificity in mammals, where the former is preferentially expressed in heart and skeletal muscle, while the latter is preferentially expressed in brain. [score:5]
Click here for file Accession numbers of miR-124 over -expression. [score:3]
Accession numbers of miR-124 over -expression. [score:3]
The motif cluster with the most significant p-value predicted by CompMoby was the target site of miR-1 (Figures 5A, 5B) and miR-124 (Figures 5A, 5C). [score:3]
The input sequence files for the miR-124 over -expression analysis used in the CompMoby analysis can be found at. [score:3]
Lim et al. generated the datasets by independently over -expressing miR-1 or miR-124 in human HeLa cells and then profiling the mRNA on whole genome microarrays. [score:3]
Also shown is the match between the predicted motif cluster to the miR-124 seed region. [score:1]
[1 to 20 of 9 sentences]
57
[+] score: 34
These proteins include the direct targets of hsa-miR-124 and the downstream proteins of the hsa-miR-124-regulated target genes [47]. [score:7]
The analysis herein identified 1,544 differentially expressed proteins whose expression resulted from expression of hsa-miR-124 in HeLa cells. [score:7]
This phenomenon was observed not only in the hsa-miR-148a-regulated DNMT3B gene, but also in many target genes regulated by hsa-miR-124, hsa-miR-1, and hsa-miR-181a. [score:5]
Figure 3 Cumulative curves representing the cumulate fraction of target proteins that were repressed or activated after transfection of hsa-miR-124 to HeLa cells. [score:3]
Of these 1,486 proteins, the presence of the seed” region on the transcript indicated that only 408 proteins are directly regulated by hsa-miR-124 (Proteomics∩Seed(ALL), red line in Figure  3). [score:3]
In addition to hsa-miR-124, the SILAC analysis [46] was also used to examine the on the global impact of hsa-miR-1 and hsa-miR-181a on protein expression in HeLa cell. [score:3]
The repressive effect is also observed in the target genes of hsa-miR-124 at the protein level. [score:3]
The global impact of a microRNA, such as miR-124, on the protein expression in the HeLa cell has been measured by stable isotopic labelling with amino acids in cell culture (SILAC) analysis [46], a mass spectrometry technique for using non-radioactive isotopic labelling to detect differences in protein abundance among samples. [score:1]
Therefore, these “se