1077 publications mentioning hsa-let-7g (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name let-7g. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Thus, in let-7 mutants, larval genes turned off by lin-29 will be up-regulated in addition to direct targets of let-7. In lin-29 mutants, the same downstream larval genes should be up-regulated, yet the upstream direct targets of let-7 should be unaffected.

The developmental defects observed in let-7 mutants are caused by the over -expression of direct regulatory targets such as lin-41 and hbl-1, and some of these defects can be suppressed by RNAi knockdown of these targets in let-7 mutants [6], [7], [9], [10].

The large number of down-regulated genes in let-7(n2853) mutants likely represents indirect targets, reflecting mis-regulation of direct targets that transcriptionally regulate some of these genes.

From the three prediction methods, there were 167 unique direct target candidates, including the known targets lin-41, daf-12, and hbl-1. Elimination of likely indirect downstream targets of let-7 regulationWe also employed an alternative filter to select potential let-7 targets independent of preconceptions about base pairing requirements.

Unexpectedly, a subset of the genes that suppressed let-7 mutant phenotypes also suppressed a lin-28 phenotype that is due to up-regulation of let-7 expression, suggesting nonlinear pathways between these targets and let-7 in vulval precursor cells.

Enrichment of let-7 complementary sequences in the 3′ UTRs of genes up-regulated in let-7 mutantsDirect mRNA targets of miRNAs typically have partially complementary miRNA binding sites, making prediction of miRNA targets from genomic sequence difficult [42], and many groups have developed a variety of rules for target recognition [11], [36], [38], [39], [40], [41], [69].

This approach was sensitive enough to detect the established let-7 targets, lin-41, daf-12 and hbl-1. While these genes are regulated at the mRNA level, other targets that are only subject to translational repression would be missed by focusing on transcripts up-regulated in let-7 mutants.

At least three of these genes, which encode transport proteins and a modifying enzyme, appear to be new direct targets of let-7. In conclusion, let-7 appears to regulate a variety of direct targets, which in turn influences the expression of hundreds of other genes.

The up-regulated genes represent direct, including the known targets lin-41, daf-12, and hbl-1, and indirect targets of let-7 repression.

The let-7(n2853) mutation changes the fifth G to an A in the mature let-7 miRNA [6], which destabilizes target interactions and results in up-regulation of lin-41 mRNA, an established let-7 target [7], [67], [70].

Furthermore, we found let-7 complementary sites (LCS) within the ALG-1 binding sites of these targets (Figure 5B), supporting these genes as new direct targets of let-7. Interestingly, T27D12.1 and opt-2, which contain predicted target sites in coding exon sequences, showed weak mis-regulation at the mRNA level in let-7(n2853) versus WT worms (Figure 5C).

Widespread gene mis-regulation in worms deficient for let-7 activityWe have previously shown let-7 -dependent mRNA destabilization of known direct targets [67], suggesting that in addition to giving a general picture of let-7 function, microarray analysis of gene-misregulation in let-7 mutants will provide a basis for the discovery of new direct targets.

To further investigate the regulatory relationships between let-7 and the up-regulated genes, a combination of computational and molecular-genetic criteria were used to enrich for direct target candidates among the up-regulated genes.

Candidate RNAi clones from the rupturing suppression screen were tested for suppression of the cell cycle exit defect in let-7(n2853) mutants also carrying the integrated transgene Int[scm::GFP], which expresses a nuclear localized GFP specifically expressed in seam cells.

Nonetheless, the observation that RNAi of many different genes results in suppression of the rupturing phenotype in let-7 mutants points to the existence of cross-regulatory pathways that are sensitive to down-regulation of a single target.

To score for suppression of the extra seam cell phenotype, let-7 mutants expressing nuclear GFP in seam cells (let-7(n2853); Int[scm::GFP]) were grown at the restrictive temperature (25 °C) on bacteria expressing dsRNA against candidate targets and the vector control.

Since early accumulation of let-7 miRNA is expected to cause premature down-regulation of targets, we anticipated that further silencing of potential targets by RNAi would enhance the pmuv phenotype in lin-28(n719) worms.

This gene lacks predicted target sites for let-7 in its 3′UTR but came through our screen as a modestly up-regulated gene in let-7(n2853) that was capable of suppressing the extra seam cell phenotype of these mutants.

We have previously shown let-7 -dependent mRNA destabilization of known direct targets [67], suggesting that in addition to giving a general picture of let-7 function, microarray analysis of gene-misregulation in let-7 mutants will provide a basis for the discovery of new direct targets.

From the three prediction methods, there were 167 unique direct target candidates, including the known targets lin-41, daf-12, and hbl-1. We also employed an alternative filter to select potential let-7 targets independent of preconceptions about base pairing requirements.

Our approach for discovering new let-7 regulatory targets takes advantage of let-7 dependent expression differences of the known targets, including lin-41 [67], [68].

One of the targets, opt-2, may be a general downstream effector in the let-7 pathway as down-regulation of opt-2 suppresses phenotypes in the vulva and seam cells.

Combining the candidates that emerged from the computational and mRNA expression analyses, there were 340 candidates to test for genetic interactions with let-7. Several transcription factors suppress vulval rupture in let-7 mutantsTo identify functionally important genes among the list of candidates, we used RNAi screens to find genetic interactions by suppression of let-7 mutant phenotypes.

However, the microarray data revealed that thousands of genes are mis-regulated when there is insufficient let-7 activity, supporting a widespread role for this miRNA in regulating, directly and indirectly, gene expression.

Illustrating the role of let-7 as a master regulator of development, the up-regulated genes were enriched for Biological Process Gene Ontology (GO) terms representing larval growth and development (Table S1).

Novel targets associated with ALG-1 in a let-7–dependent mannermiRNAs repress target mRNA expression through their association with Argonaute proteins allowing them to act as sequence-specific guides for the RISC complex [4], [5].

In comparison to WT, 930 common genes were up-regulated in both let-7(n2853) and lin-29(n333) and 649 common genes were down-regulated in both.

Candidate let-7 targets differentially affect vulva formationThe twenty-three candidate let-7 targets were also tested for potential roles in a vulva formation abnormality due to precocious let-7 expression.

let-7 regulates developmental timing, in part, through the direct target genes lin-41 and hbl-1 [6], [7], [9], [10].

The abnormally low expression of let-7 detected in various types of tumors has been linked, in some cases, to aberrant up-regulation of LIN-28 [24].

In contrast, prmt-1 and the positive control lin-41, which contain 3′UTR target sites, were up-regulated over three-fold at the mRNA level in the let-7 mutant worms.

Three of these suppressors, opt-2, prmt-1, T27D12.1, are likely direct targets of let-7 since their association with Argonaute is dependent on this miRNA.

The relevance of the up-regulated genes for let-7 phenotypes was tested through RNAi -based suppressor screens.

Two of the let-7(n2853) suppressors identified in Grosshans et al., 2005, lin-59 and lss-18, were found to be up-regulated in let-7 mutants by our microarray analyses.

Thus, the pmuv phenotype is dependent on let-7, and suggests that the precocious expression of let-7 in the lin-28 mutants might prematurely repress targets needed to regulate vulval cell patterning.

Accordingly, the fold change in let-7 target mRNA expression for lin-41, for example, is less dramatic in let-7(n2853) compared to wild type at the L4 stage than it is in stages before (L2) and after (L4) let-7 expression in wild type worms [67].

Surprisingly, there were also several candidates that decreased the percentage of pmuv in lin-28(n719) worms including, nhr-25, hbl-1, sox-1, prmt-1, and nduf-7. Since this effect is also observed when let-7 is removed from lin-28(n719), these suppressors potentially feedback to regulate the expression or function of let-7 in vulval precursor cells.

A combined approach, incorporating let-7 target predictions by PicTar, reporter assays and screens for suppression of rupturing in let-7(n2853), resulted in twelve potential new targets [38].

Of the nineteen candidates up-regulated in let-7 mutants, nine also suppressed rupturing in let-7(n2853).

Typically, expression of let-7 family miRNAs is negligible in stem cells and in early embryonic tissues and is then up-regulated as cells take on more differentiated fates.

Over one-third of the genes up and down-regulated in let-7(n2853) were changed in the same direction in lin-29 mutants, indicating that failure to trigger the lin-29 -dependent transcriptional program also accounts for many of the mis-regulated genes in let-7 mutants.

Since then, many genes that promote cell division or antagonize the differentiated state have been implicated as direct or indirect targets of let-7 regulation [28], [29], [30], [31], [32], [33].

The more conventional miRNA target, prmt-1, has an LCS within its 3′UTR and was previously predicted by the mirWIP and PITA algorithms as a let-7 target [40], [41].

By analyzing gene -expression in lin-29 versus let-7 mutants, novel targets can be found that may not have obvious binding sites.

Loss of this miRNA alone results in extensive changes in gene expression and abnormal development in multiple tissues, supporting the role of let-7 as a master gene regulator.

Suppressors of the supernumerary seam cell divisions in let-7(n2853) represent a diverse set of gene functions and there is only modest overlap with the rupturing suppressors, suggesting that the two phenotypes are likely under separate genetic control (Table 3).

Three genes, prmt-1, opt-2, and T27D12.1, were found to associate with the miRNA complex in a let-7 dependent manner and, thus, emerged as likely novel direct targets of let-7. A large fraction of the transcriptome is mis-regulated in let-7(n2853) worms.

Considering that the two well-established targets of let-7, lin-41, and daf-12, suppress both the rupturing vulva and extra seam cell phenotypes of let-7 mutants, it was surprising to find almost entirely distinct sets of new genes affecting one phenotype versus the other.

The twenty-three candidate let-7 targets were also tested for potential roles in a vulva formation abnormality due to precocious let-7 expression.

Another likely direct target, T27D12.1, also seems to be regulated by let-7 through sequences in its open reading frame.

Fourteen new genes were found to suppress the bursting vulva phenotype when subjected to RNAi conditions, none of which overlapped with the previously described suppressors of this let-7 phenotype [11], [74].

We have undertaken a multi-step approach for the discovery and validation of let-7 targets in C. elegans, beginning with analysis of global, let-7 -dependent gene expression changes, and followed by genetic interaction analysis of candidates.

Among the suppressors were lin-41 and daf-12, which suppress two other let-7 phenotypes, vulval rupture and alae formation [6], [7], [11].

In lin-28(n719) mutants, let-7 miRNA is expressed precociously, resulting in premature repression of its targets.

Therefore, in vivo expression changes were analyzed in wild-type (WT) and let-7 mutant animals using microarray analysis to identify a list of relevant candidate target genes.

To grow a population of let-7(mn112) mutants to be able to score suppression, we generated a transgenic strain in which the worms were maintained by the presence of an extrachromosomal array (Ex[let-7(+); myo-2::GFP]), which contains a let-7 rescue fragment, allowing the mutants to survive, and the myo-2 promoter driving expression of a GFP marker in the pharynx to indicate the presence of the array (Figure 2A).

Since these effects are due to mis-regulation of let-7 targets, identification of the biologically relevant genes regulated by this miRNA has been a paramount research goal.

Elimination of likely indirect downstream targets of let-7 regulation.

Although several groups have attempted to identify let-7 targets in C. elegans, the criteria and, consequently, the predicted targets from these approaches have minimal overlap [11], [36], [38], [39], [40], [41], [69].

Thus, let-7 functions as a tumor suppressor in at least in some settings, where it represses the expression of genes needed for oncogenesis.

Combining the candidates that emerged from the computational and mRNA expression analyses, there were 340 candidates to test for genetic interactions with let-7. To identify functionally important genes among the list of candidates, we used RNAi screens to find genetic interactions by suppression of let-7 mutant phenotypes.

Multiple lines of molecular and genetic evidence support opt-2, prmt-1 and T27D12.1 as new direct targets of let-7 regulation.

Genes involved in translation make up another class of let-7(n2853) suppressors [74].

Many of the genes we identified as suppressors of vulva rupturing encode transcription factors, a category also prominent on the list of potential let-7 targets described in Grosshans et al., 2005 [11].

6-mer enrichment in genes up-regulated in let-7(n2853) versus non-regulated genes was computed using methods described in [106].

A set of the up-regulated genes proved to be biologically relevant for the developmental abnormalities that arise in the absence of let-7 activity.

We postulated that other direct targets would also be mis-regulated in let-7 mutants.

RNAi mediated suppression of vulval rupturing in let-7 mutants has been used to find new genetic interactions in sets of computationally predicted targets and in genes on chromosome I [11], [38], [74].

Reporters driven by the let-7 promoter also show intestinal expression, suggesting that let-7 miRNA is available for directly regulating opt-2 in this tissue [96], [97], [98].

This group included the known let-7 targets, such as daf-12 and lin-41, as well as hbl-1, which is also a target of other let-7 miRNA family members (Table 3) [7], [9], [10], [11], [85], [86], [87].

Sheets 2 and 3 show the results of DAVID analysis for genes up- or down-regulated in let-7(n2853), respectively.

Our analyses indicate that let-7 regulates a large cast of genes, both directly and indirectly.

We uncovered new targets of let-7 that contribute to these phenotypes when they fail to be properly regulated.

Final validation of direct targets was confirmed by let-7 dependent RISC association (Figure 1).

Based on enrichment in the WT compared to let-7 RIP from 4 independent experiments, three new targets were identified, T27D12.1, prmt-1, and opt-2. (B) let-7 complementary sites (LCS) are present in each of the newly identified targets.

158 genes that were up-regulated in let-7 mutants had at least one of these two 6-mers in their 3′ UTRs.

In fact of our list of let-7 suppressors, only lin-41 and daf-12 were mis-regulated by more than two-fold by microarray analyses.

To enrich for biologically relevant candidates and allow for non-canonical binding sites, we searched for enriched 6-mer sequences in the 3′ UTRs of the genes up-regulated in let-7 mutants.

This is due at least in part to direct targeting of several metabolic genes by let-7 miRNA.

Genetic mutation or RNAi depletion of any one of these let-7 targets is sufficient to at least partially rescue the lethality of let-7 mutants.

In C. elegans, processing of the let-7 miRNA early in larval development is inhibited by LIN-28 protein [21], [23].

Several of these genes also affect let-7 dependent phenotypes seen in lin-28 mutants revealing a complex genetic interaction with let-7. By showing let-7 dependent association with Argonaute, we were able to confirm three new direct targets of let-7 with binding sites in the 3′ UTRs as well as in coding regions.

By using reproducibility in the direction of change, instead of the absolute fold difference in mRNA levels, we identified twenty new genes in the let-7 pathway that exhibited only modest expression differences in let-7 mutants.

Several transcription factors, such as the nuclear hormone receptor daf-12, the forkhead transcription factor pha-4 and the zinc finger protein die-1, genetically interact with let-7 and are also likely direct targets [11].

Down-regulation of prmt-1 by let-7 in late larval stages could influence the lifespan of worms by causing reduced methylation and, hence, activity of DAF-16.

Enrichment of let-7 complementary sequences in the 3′ UTRs of genes up-regulated in let-7 mutants.

We selected the 192 genes that were up-regulated in both of the let-7(n2853) vs.

Two conserved 6-mers complementary to let-7 mature sequence were enriched in the 3′ UTRs in the up-regulated gene set (Table S1).

Sheet 5 lists the enriched motifs found in the 3′UTRs of genes up-regulated in let-7(n2853).

Genes regulated by let-7 are expected to be enriched in wild-type samples versus let-7 mutant samples, while genes targeted by other miRNAs should be amplified similarly in both strains.

The ability of opt-2 RNAi to suppress let-7 phenotypes in vulval and seam cells suggests that signaling from the intestine influences development of these tissues.

How let-7 positively regulates the expression of LIN-29 protein is presently unknown.

Sheets 2 and 3 show the results of DAVID analysis for genes up- or down-regulated in let-7(n2853) versus lin-29(n333), respectively.

Table S3Differential gene expression in let-7(n2853) versus lin-29(n333) worms.

Negative regulation of lin-41 by let-7 in late larval stages allows the transcription factor LIN-29 to accumulate and to directly control the terminal differentiation of multiple cell types [6], [7], [72], [73].

In fact, one of the first discovered targets of let-7 in humans is RAS, a notorious oncogene [27].

These results suggest that some of the candidate genes may have a more complicated relationship with let-7, possibly affecting let-7 expression or activity in tissue-specific feedback loops.

1003353.g002 Figure 2Novel suppressors of vulval rupture in let-7 null mutants.

Our screen identified eight new genes that suppress the supernumerary seam cell divisions of let-7(n2853) mutants.

Through a combination of genetic and molecular screens in C. elegans, we have uncovered twenty-three genes that are up-regulated in let-7 mutants and contribute to the developmental abnormalities characteristic of these mutants.

Sheet 1 shows the microarray results of mRNA expression in let-7(n2853) versus N2 wildtype worms at the L4 stage.

In the presence of the let-7(mn112) null allele, the pmuv phenotype is no longer observed in lin-28(n719) worms, and 100% of the double mutant population expresses the pvul phenotype (Figure 4A).

Feedback loops between let-7 family members and targets, such as daf-12 and hbl-1, in other tissues have been previously demonstrated [9], [10], [85], [86], [87], [90].

1003353.g001 Figure 1Shown is a flowchart outlining the experiments and analyses leading to the discovery of 3 new potential let-7 targets.

While some direct targets of the let-7 miRNA are known, a full picture of the let-7 regulatory network remains largely uncharacterized.

1003353.g004 Figure 4Differential effects of let-7 target candidates on vulva formation.

Genes down-regulated more than 2-fold in let-7(n2853) compared to wild-type.

Surprisingly, another set of genes significantly decreased the incidence of pmuv in lin-28(n719) (Figure 4B) and, in the case of nhr-25, the pvul phenotype was also suppressed in the lin-28(n719);let-7(mn112) double mutants (Figure 4C).

Phenotypic suppressors of let-7 mutants.

Enrichment of a different set of transcription factors was also noted by the Slack lab as genetic suppressors of their computational let-7 predictions [11].

Also enriched was AACCTA, complementary to nucleotides 9–14 of let-7, which overlaps with the newly described “centered sites” observed for some miRNA target interactions [43].

Several transcription factors suppress vulval rupture in let-7 mutants.

Candidate let-7 targets differentially affect vulva formation.

Suppression of supernumerary seam cell nuclei in let-7 mutants.

However, they failed suppress vulva rupturing in the null let-7(mn112) background and, thus, did not appear on our final list of candidates.

Thus lin-41 and daf-12 RNAi are sufficient to suppress all previously described phenotypes of let-7 mutants.

As expected, the nucleotides TACCTC, which are complementary to the let-7 seed sequence (nucleotides 2–7 of a mature miRNA), were enriched, consistent with the prevailing mo del for miRNA target recognition [42].

1003353.g003 Figure 3Suppression of supernumerary seam cell nuclei in let-7 mutants.

However, these candidates failed to suppress the rupturing of let-7(mn112) worms, in agreement with the previous study [11].

Novel suppressors of vulval rupture in let-7 null mutants.

Before this study, opt-2 was not a predicted let-7 target because it lacks complementarity to the 5′ end of the miRNA (seed) in its 3′UTR.

Novel targets associated with ALG-1 in a let-7–dependent manner.

Argonaute associates with targets in a let-7–dependent manner.

adt-2 had similar levels in the WT and let-7(n2853) mutant strains suggesting it may be targeted by a different miRNA, which could mask any let-7 dependent RISC association.

1003353.g005 Figure 5Argonaute associates with targets in a let-7–dependent manner.

let-7–dependent seam cell cycle exit is controlled by a diverse set of downstream genesTo broaden the search for genes that interact with let-7 beyond those involved in vulval rupture, we reasoned that novel targets might control other phenotypes found in let-7 mutants.

A distinction from these studies is that we screened for suppression in null let-7(mn112) worms as opposed to the weaker let-7(n2853) strain.

The known targets lin-41 and daf-12, served as positive controls with both showing let-7 -dependent enrichment in the ALG-1 IP.

The loss of function lin-28(n719) mutants exhibit a partially penetrant temperature-sensitive protruding multiple vulva (pmuv) phenotype that is dependent on let-7. At 25 °C, this phenotype is expressed in ∼67% of the lin-28(n719) population with the remaining worms displaying a single protruding vulva (pvul) (Figure 4A).

Table S1Differential gene expression in let-7(n2853) versus N2 wildtype worms.

We combined several molecular and genetic methods to identify physiologically relevant targets of let-7 in C. elegans.

Sheet 1 shows the microarray results of mRNA expression in let-7(n2853) versus lin-29(n333) worms at the L4 stage.

Using the Ahringer feeding RNAi library [75], the Vidal feeding RNAi library [76] and a few clones we generated, 308 genes out of the 340 candidates were tested for suppression of vulval rupturing in the let-7(mn112) null strain.

Shown is a flowchart outlining the experiments and analyses leading to the discovery of 3 new potential let-7 targets.

Bursting suppression was scored as more than 25% non-bursting, non-green (non-rescued) 40 hr adult PQ79 mnDp1(X/V)/+; unc-3(ed151) let-7(mn112); Ex[let-7(+); myo-2::GFP] worms grown at 25°C.

Here we utilized molecular and genetic approaches to identify biologically relevant targets of the let-7 miRNA in Caenorhabditis elegans.

Genes up-regulated more than 2-fold in let-7(n2853) compared to wild-type.

Another group tested 181 genes with various criteria for being potential let-7 targets for changes in protein levels in WT versus let-7(n2853) worms [54].

To broaden the search for genes that interact with let-7 beyond those involved in vulval rupture, we reasoned that novel targets might control other phenotypes found in let-7 mutants.

Differential effects of let-7 target candidates on vulva formation.

One of the first discovered miRNAs, let-7, generally promotes cellular differentiation pathways through a repertoire of targets that is yet to be fully described.

prmt-1 has a broad expression pattern that is largely overlapping with let-7 transcriptional reporters [96], [97], [98], [101].

Consistent with its role in promoting differentiated states, decreased expression of let-7 miRNA has been associated with numerous types of cancer [14].

In worms and mammalian cells, the LIN-28 RNA binding protein is largely responsible for keeping let-7 miRNA levels low during early development [15].

let-7 is near the end of a genetic pathway controlling developmental timing in C. elegans [71].

To understand how let-7 or any miRNA controls a cellular process, the genes it regulates must be identified.

Widespread gene mis-regulation in worms deficient for let-7 activity.

lin-14 was also used as a negative control because it is a known target of a different miRNA, lin-4, and as expected there was no significant change in ALG-1 binding in let-7 mutants compared to WT.

These phenotypes place let-7 in the heterochronic pathway, which includes genes that regulate the temporal identity of cell divisions and fates [6], [8].

let-7 was originally discovered as a miRNA controlling developmental timing in Caenorhabditis elegans [6], [7].

These caveats were avoided by using the let-7(mn112) strain containing the extrachromosomal let-7 rescue construct, as RNAi clones that affected development regardless of the presence of the let-7 transgene could be flagged.

The let-7 mutant worms display an array of developmental timing defects at the larval to adult transition including rupturing (Rup) of the intestine and gonads through the vulva [6], [7].

Given the highly conserved nature of let-7 from worms to humans, our studies highlight new genes and pathways potentially under let-7 regulation across species.

Loss of let-7 activity in C. elegans results in multiple developmental abnormalities and, ultimately, death.

In let-7 mutants, lin-41 persists in late larval stages where it can continue to negatively regulate lin-29 [6], [7].

Four independent RIPs were analyzed, and targets enriched in the wild-type for at least 2 of the 4 replicates were considered to be dependent on let-7 for ALG-1 association.

The let-7 miRNA is a wi dely conserved animal miRNA and its role in regulating differentiation also appears to be conserved [12], [13], [14].

To identify globally the genes regulated by let-7, six independent and paired wild-type and let-7(n2853) fourth larval stage (L4) RNA samples were labeled and hybridized to Affymetrix arrays.

The heterochronic gene lin-29 is downstream of let-7 and is a master regulator of seam cell differentiation [6], [73].

Our combination of molecular and genetic screens revealed a complex network of genes that interact with let-7 in C. elegans.

Fifty to one hundred lin-28(n719) or lin-28(n719);let-7(mn112) worms were grown on RNAi until 48 hr (25°C) adults and then scored for the protruding multivulva (Pmuv) or protruding single vulva (Pvul) phenotypes.

Figure S2 Conservation of potential let-7 complementary sites (LCSs) in mammalian prmt-1. (A) Genome browser track showing the last exon of PRMT1.

While prmt-1 has ALG-1 binding sites in its 3′UTR as well as coding exon sequences, only the 3′UTR site includes an obvious let-7 complementary site.

These genetic analyses revealed twenty new downstream effectors of let-7 phenotypes, including multiple transcription factors and metabolic proteins.

Figure S1Seam cell fusion proceeds normally in let-7 mutants.

Loss of let-7 activity results in lethality in worms and contributes to oncogenesis in mammalian tissues [14], [89].

This partially penetrant pmuv phenotype is dependent on let-7 because lin-28(n719);let-7(mn112) strains only produce single protruding vulvas.

let-7–dependent seam cell cycle exit is controlled by a diverse set of downstream genes.

In addition to the rupturing phenotype, let-7 mutants also have defects in the terminal differentiation of their seam cells, a specialized type of hypodermal cell [6], [7], [82].

3′UTR locations complementary to let-7 are drawn as black rectangles.

Remarkably, the introduction of let-7 miRNA into lung or breast tumors in mouse mo dels has been shown to halt tumor growth in vivo [31], [34], [35].

The failure of seam cells to properly differentiate in let-7 mutants seems to be largely due to a lack of lin-29 activity [6], [7].

Strains used in this study include the following: wild type (WT) Bristol N2, MT7626 let-7(n2853), MT333 lin-29(n333), MT1524 lin-28(n719), PQ79 mnDp1(X/V)/+; unc-3(ed151) let-7(mn112); Ex[let-7(+); myo-2::GFP], PQ270 mnDp1(X/V)/+; unc-3(ed151) let-7(mn112); lin-28(n719), PQ293 let-7(n2853); Int[scm::GFP].

Synchronized WT and let-7(n2853) worms were grown at 25°C for 29 hours before being cross-linked by UV treatment.

Additionally, lateral hypodermal seam cells fail to terminally differentiate at the larval to adult transition in let-7 mutants.

This enhanced phenotype is dependent on let-7 because the pmuv phenotype is almost entirely absent in lin-28 mutant worms that also lack let-7 activity (lin-28(n719);let-7(mn112)) (Figure 4C).

However, a single ALG-1 binding site is present in the second last exon of opt-2 and this region includes a predicted let-7 binding site.

Three of the paired replicates of WT and let-7(n2853) were also paired with lin-29(n333) replicates for array analysis.

Interestingly, seam cell fusion was unaffected in let-7(mn112) null mutants, suggesting that some aspects of seam cell terminal differentiation are let-7 independent (Figure S1).

The let-7 miRNA is exceptional in its conservation and essential role in cellular differentiation across species [13].

WT and the let-7(n2853) vs.

To test if let-7 is responsible for the interaction of ALG-1 with these genes, we analyzed their association with ALG-1 using in wild-type and let-7(n2853) worms (Figure 5A).

RNA was isolated from WT and let-7(n2853) worms grown at 25°C for 28 hours.

Three of these genes, lin-41, daf-12 and hbl-1, are the best previously characterized let-7 targets in C. elegans, validating the sensitivity of our approach [6], [7], [9], [10], [11].

LIN-28 prevents the maturation of let-7 family miRNAs by blocking Drosha or Dicer processing or promoting destabilization of let-7 precursors [16], [17], [18], [19], [20], [21], [22], [23].

Fused seam cells are seen in WT (A) and let-7(mn112) (B) at the young adult stage by the lack of junctions between cells (white arrowheads), which are apparent in lin-29(n333) worms where seam cell fusion fails (C).

Additionally, let-7 and LIN-28 have opposing effects on insulin sensitivity in mice [25], [26].

Three lin-29(n333) mutant L4 RNA samples paired with wildtype and let-7(n2853) samples were collected, labeled and hybridized to Affymetrix microarrays.

In let-7 mutants, the seam cells inappropriately undergo the larval type division instead of differentiating to the adult fate, where the cells normally fuse and cease dividing [6].

However, let-7(n2853) is a temperature sensitive loss of function strain that maintains some let-7 activity even at the non-permissive temperatures.

Six paired replicates of L4 RNA from WT or let-7(n2853) worms were prepared and labeled as per manufacturer's instructions (Affymetrix, Santa Clara) and hybridized to Affymetrix C. elegans Gene microarrays.

Exit of the seam cells from the cell cycle and secretion of alae have been shown to be retarded in let-7 mutants [6], [7], [82].

Homozygous let-7(mn112) mutants die at the late larval stages and must be maintained by a wild-type copy of the let-7 gene coming from a balanced translocation or a rescuing transgene [6], [7].

While it is not entirely understood why let-7 mutants rupture through the vulva, it has been postulated that improper cell fusions during vulva formation cause weakening and destabilization of this structure.

Seam cell nuclei were counted at 40 hr (25°C) in 20 adult PQ293 let-7(n2853); Int[scm::GFP] worms grown on vector control or gene specific RNAi plates for one generation.

Although there is not a canonical LCS in the 3′UTRs of mammalian homologs of prmt-1, there are several well conserved potential let-7 binding sites (Figure S2).

2

Let-7 expression has been shown to decrease during Fas -mediated apoptosis because Fas activation suppresses Dicer; however, exogenous expression of let-7 inhibits cell sensitivity to Fas -mediated apoptosis via directly targeting Fas [43, 68], which suggests that let-7 family miRNAs may suppress tumor innate immune reactions.

The crosstalk between these oncogenes and LIN28A/LIN28B and let-7 loop is summarized in Fig.   5. Fig. 5 In summary, in a variety of cancer types, let-7 is most frequently down-regulated, while LIN28A/LIN28B is most frequently up-regulated, and the aberrant expression of one component of theLIN28A/LIN28B and let-7 loop due to transcriptional and/or post-transcriptional level dysregulation in human malignant tumors would result in the alteration of the other one.

Indeed, RAS has been found to inhibit the generation of let-7 by upregulating the expression of LIN28 via MAPK activated myc expression [26].

Interestingly, over -expression of LIN28 was shown to elevate the expression of myc via down-regulation of let-7, which targets the MYC gene.

Secondly, through repressing let-7, LIN28A/LIN28B indirectly up-regulates some cell-cycle regulators targeted by let-7, such as cyclinD1/2, CDK6, CDC34, CDC25a and Trim71 (a repressor of CDK inhibitor 1A).

Additionally, up-regulation of let-7 family miRNA expression upon estrogen exposure in endometrial adenocarcinoma enhanced cellular survival through the direct targeting of the anti-apoptosis gene BAX [97].

In addition to let-7, the miRNAs miR-26a, miR-181, miR-9, miR-30, miR-125, miR-212 and miR-27 have also been shown to directly bind the 3′UTR of LIN28A/LIN28B and repress translation of the protein, and as these miRNAs are frequently under-expressed in malignant tumors, higher levels of LIN28 expression are seen [31– 34].

As previously mentioned, STAT3 also suppresses the expression of let-7 through directly activating LIN28A/LIN28B expression during inflammation-stimulated EMT [28].

Lastly, through the down-regulation of let-7, enhanced expression of LIN28A induced the development of CSC ‘stemness’ coupled with resistance to chemotherapy -induced apoptosis [94, 95].

They showed that over -expression of LIN28B upon the activation of NF-κB inhibited the generation of let-7 family member miRNAs and elevated the production of IL-6, a target of let-7. In turn, IL-6 activated NF-κB and STAT3 transcription factors through the RTK signaling pathway.

For instance, let-7 targets the IGF1 receptor and AKT2 to inhibit PI3K/AKT pathway activity and RAS to inhibit MAPK pathway activity.

RNA binding proteins MicroRNAs LIN28A/LIN28B and let-7 loop Hallmarks of cancer MicroRNAs (miRNAs) are small non-coding RNAs that bind the mRNA of target genes to inhibit their translation and/or induce their decay.

Additionally, through the LIN28A/LIN28B -mediated inhibition of let-7, PI3K/AKT-mTOR signaling may promote ribosomal biogenesis and translation in mammary cells via activating S6, eIF4E and eIF4B, as let-7 is known to target key components of this pathway, such as AKT2 and Raptor [60, 61].

Since myc is one of the target genes of let-7, let-7 -mediated inhibition of myc thus inhibits the crosstalk of hallmarks of cancers; LIN28A/LIN28B, of course, has the opposite effect.

A recent study showed that let-7 inhibited the cancer cell migration via direct targeting of four genes in the actin cytoskeletal pathway, including RDX, DIAPH2, ITGB8 and PAK1 [81].

Additionally, let-7 represses the proliferation of cancer cells by directly targeting HMGA2, a protein which is frequently over-expressed in and promotes proliferation of many cancer types [52, 57, 58].

They observed that LIN28A over -expression promoted 3 T3 cells to form clones in vitro and form solid tumors in nude mice with a concomitant down-regulation of multiple mature let-7 family member miRNAs.

Another study showed that p53 directly bound to and inhibited the expression of let-7 during this process [99].

For instance, hepatitis B virus x protein (HBx) promotes cellular proliferation through down -regulating let-7 expression, thus elevating levels of the transcription factor signal transducer and activator of transcription 3 (STAT3), another let-7 target, in HBV infected cells [56].

Both LIN28A and LIN28B reportedly enhance aerobic glycolysis, while let-7 suppresses this process at least in part through targeting pyruvate dehydrogenase kinase 1(PDK1), which negatively regulates pyruvate dehydrogenase (PDH), thus preventing pyruvate entry into TCA under normoxic conditions [64].

IL-6 was also a direct target of let-7 to inhibit cancer cell invasion and migration.

In contrast to the expression of LIN28A/LIN28B proteins, the expression of let-7 family miRNAs is typical decreased in cancers (Table  1).

Further studies showed that IMP3 recruits LIN28B mRNA and prevents the binding of argonaute 2 (Ago2) and let-7 to LIN28B, thus allowing the increased expression of it and other let-7 target genes, like HMGA2 [38].

Conversely, let-7 miRNA may bind complementary sites on the 3′ UTR of both LIN28A and LIN28B mRNAs, thus inhibiting the expression and function of LIN28A/LIN28B protein [9, 25].

They showed that targeted expression of LIN28B promoted crypt transformation and fostered intestinal polyp and adenocarcinoma formation in vivo in a let-7 -dependent manner [72].

It’s now known that members of let-7 family play important roles in regulating cellular differentiation, metabolism and the development of certain diseases, including tumorigenesis [6].

The many established studies suggest that the LIN28A/LIN28B and let-7 loop is a master regulator of cancer development and would be a valuable target for future cancer therapeutic strategies.

BesidesHMGA2, let-7 also was reported to inhibit invasion, migration and metastasis via targetingITGB3, MAP4K3 and MYH9 [76, 79].

HMGA2 is the most frequently reported target of let-7 in the process of inhibiting invasion and metastasis [57, 77].

Fig. 2 Let-7 targets insulin signaling pathway and thus inhibits cancer cell metabolism The immune system is responsible for recognizing and eliminating cancer cells; however, tumors typically evade immune destruction through either avoiding detection by the immune system or limiting the extent of immunological eradication [53].

It has been revealed that c-myc can directly bind the promoter of LIN28B and thus elevate the production of LIN28B and consequently inhibit the generation of let-7 family of miRNAs upon activation of MAPK signaling [26].

While LIN28A/LIN28B represses apoptosis via let-7, it may also regulate the expression of pro-apoptosis and/or anti-apoptosis genes through unidentified mechanisms.

The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancer has been shown in Fig.   4. Fig. 4 The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancerThe expression of LIN28/let-7/MYC feedbacks is regulated by many signaling pathways and oncogenes.

Regulation of let-7 expression also occurs at the transcriptional level.

The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancer has been shown in Fig.   4. Fig. 4 The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancer The expression of LIN28/let-7/MYC feedbacks is regulated by many signaling pathways and oncogenes.

Interestingly, let-7 reportedly triggers human cell senescence through modifying chromatin at the promoters of RB1/E2F target genes, thus repressing their transcription, which suggests that the LIN28A/LIN28B and let-7 loop may also be involved in the regulation of cancer cellular replicative immortality [100].

Interestingly, RAS and AKT are the direct targets of let-7 s respectively [60, 112].

Many studies have shown that the over -expression of let-7 or knockdown of LIN28A/LIN28B increases the radiosensitivity or chemosensitivity of cancer cells [84– 87].

As discussed, the expression patterns and functions of LIN28A/LIN28B and let-7 in malignancies are largely opposing and appear to compose a double -negative feedback loop regulating cancer progression.

AKT also activates the NF-κB signaling via activating IKK, and NF-κB has been reported to directly promotes the transcription of LIN28B and thus inhibits the generation of let-7 s [27].

This double -negative feedback loop between LIN28A/LIN28B and let-7 is shown in Fig.   1. Fig. 1 LIN28A/LIN28B proteins are frequently up-regulated in various malignancies originating from three germ layers (Table  1).

Indeed, LIN28A/LIN28B and let-7 are inversely expressed in normal and malignant tissues [11, 12].

While let-7 miRNAs may be regulated at multiple levels, most studies support the significance of their post-transcriptional regulation.

As previously mentioned, by competing with TGFBR3 to bind let-7, HMGA2 represses the inhibitory effect of let-7 on TGFBR3, thus elevating TGFBR3protein and facilitating cancer invasion and metastasis [52].

The binding of LIN28A/LIN28B to either pri-let-7 or pre-let-7 inhibits let-7 precursor processing by Drosha and Dicer [19].

Thus, inhibition of let-7 by LIN28A/LIN28B would increase the activities of both pathways and, subsequently, increase proliferation.

In fact, the mechanism by which let-7 inhibits invasion and metastasis is, actually, well-studied.

Conversely, let-7 miRNAs can repress DAF-12 expression by binding its 3′UTR, which suggests a complex feedback loop between DAF-12 and let-7 miRNAs [48].

Many studies have shown that LIN28A/LIN28B promotes and let-7 inhibits invasion and metastasis in various cancer types, including colon cancer, breast cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, lung cancer and esophageal cancer [57, 74– 79].

Of note, let-7 may inhibit apoptosis under certain conditions.

For example, the lncRNAH19 reportedly inhibits the bioavailability of let-7 family miRNAs through a molecular sponge mechanism [51].

In addition to LIN28A/LIN28B proteins, the complex of NF90 and NF45 proteins can inhibit pri-let-7a processing into pre-let-7a by binding to pri-let-7a [41], while Ago proteins can bind and stabilize mature miRNAs and thereby increase let-7 levels [42].

In addition to being repressed for their expression, the antitumor functions of let-7 have also been attenuated in malignant tumor cells.

Indeed, HMGA2 functions as a ceRNA, competing with the transforming growth factor beta receptor 3(TGFBR3) for let-7, thus allowing for the heightened expression of TGFBR3 and subsequent lung cancer progression [52].

For instance, Fas and TRAIL-R2 were reported to reduce the levels of mature let-7 miRNA by inhibiting the activities of Dicer [43] and Drosha [44], respectively.

Thus, LIN28A/LIN28B not only inhibits the biogenesis of let-7 family miRNAs, but also induces their degradation.

Through inhibiting let-7, LIN28A/LIN28B can activate a variety of cellular proliferation signaling pathways.

However, a recent study found that the expression of let-7 was decreased in colon cancer cells following radiation exposure [99].

A double -negative feedback loop between LIN28A/LIN28B and let-7. The mechanisms of aberrant expression of LIN28A/LIN28B and let-7 in cancer.

Moreover, the exogenous expression of let-7 increased radiation -induced cytotoxicity, which suggests that let-7 family miRNAs may also increase the genome-instability of cancer cells.

LIN28A/LIN28B and let-7 loop regulates genome instability.

High levels of LIN28A/LIN28B and low levels of let-7 contribute to the development of human malignances through promoting cellular proliferation, cell death resistance, angiogenesis, metastasis, metabolism reprogramming, tumor -associated inflammation, genome instability, acquiring immortality and evading immune destruction of cancer cells.

For instance, during tumorigenesis, mature let-7 was found to be absent, whereas pri-let-7 was present at high levels, which suggests post-transcriptional regulation of mature let-7 [40].

Crosstalk between LIN28/let-7 loop and oncogenes in regulating hallmarks of cancer.

Recent studies found that LIN28A/LIN28Band let-7 family miRNAs tend to have opposing roles in many cellular processes, in particular those involved in cancer development and progression [10].

Let-7 reportedly induces cellular apoptosis through targeting the anti-apoptotic protein B-cell lymphoma-extra large (BCL-XL) in many cell types [86– 88] as well as the IL-6/STAT3 pro-survival pathway [89].

These results suggest that the let-7 family miRNAs play a multifaceted role in the regulation of cellular apoptosis.

While the LIN28A/LIN28B and let-7 loop is known to be involved in the development of chemotherapeutic sensitivity of cancer cells to apoptosis, it is also purportedly involved in the maintenance and/or differentiation of CSCs.

LIN28A/LIN28B and let-7 loop regulates cancer cell proliferation.

LIN28A/LIN28B and let-7 loop regulates cancer cell metabolism.

LIN28A/LIN28B and let-7 loop regulates cancer cell death.

The LIN28A/LIN28B and let-7 axis is known to regulate cellular apoptosis and is involved in resistance/sensitivity to therapy.

These results suggest that the activation of TLR7 induced by extracellular let-7 may also be involved in the regulation of immune response or inflammation in cancer; however, this hypothesis has yet to be validated experimentally.

LIN28A/LIN28B and let-7 loop regulates metastasis.

The nuclear hormone receptor DAF-12, a transcriptional activator or repressor depending on the presence or absence of a DA (dafachronic acid) ligand, can directly modulate the transcription of certain let-7 miRNAs [47].

Involvement of the LIN28A/LIN28B and let-7 loop in the regulation of cancer cell invasion and metastasis is, naturally, intimately associated with EMT.

To date, the LIN28A/LIN28B and let-7 loop has been demonstrated to regulate almost all of these hallmarks.

Recent studies suggest that the LIN28A/LIN28B and let-7 loop may also regulate cancer cell immune evasion.

LIN28A/LIN28B and let-7 loop regulates the hallmarks of cancer.

LIN28A/LIN28B and let-7 loop may regulate other hallmarks of cancer.

LIN28A/LIN28B can elevate cellular proliferation signals in both let-7 -dependent and -independent manners.

The presence of a double -negative feedback loop between LIN28A/LIN28B and let-7 was also reported [10].

A recent study uncovered that extracellular let-7 interacts with and then activates TLR7, an RNA-sensing neuronal TLR, and induces neurodegeneration [70].

Activation of transcriptional factors necessary for cellular proliferation in a let-7 -dependent manner is another method by which LIN28A/LIN28B can increase proliferation.

Both the CSD and CCHC zinc fingers of LIN28A/LIN28B can interact with the conserved residues ofpri-let-7 and pre-let-7. Briefly, the CSD inserts into the apical point of the precursor loop, while the CCHC zinc fingers dimerize on a GGAG motif adjacent to the Dicer cleavage site [17, 18].

Through let-7, LIN28A/LIN28B activates insulin signaling by elevating components involved in insulin signaling pathways, such as IGF1R, insulin receptor (InsR), IRS2, AKT2 and Rictor (Fig.   2) [60].

The miRNA let-7 was identified in the nematode Caenorhabditis elegans in 2001, seven years after let-4, the first known miRNA, was identified in the same species [3].

Oligo-uridylated pre-let-7 can also be degenerated by the 3′-5′ exonuclease Dis312 [23, 24].

As previously mentioned, LIN28A/LIN28B is a common post-transcriptional repressor of let-7 miRNAs.

These results suggested a complicated feedback loop consisting of LIN28B, let-7 and MYC.

LIN28A/LIN28B and let-7 loop mediates tumor -associated inflammation.

The let-7 family of miRNAs is the largest of all miRNA families, and members of this family are highly conserved in sequence and function from C. elegans to humans [4, 5].

Interestingly, in a metastatic gastric cancer cell line, let-7 family miRNAs could be selectively secreted into the extracellular environment via exosomes [71].

Even though the hypothesis of ceRNA is challenged by some researchers recently [50], ceRNAs attenuating let-7 -mediatedantitumor activity has been extensively reported.

These results suggested that there is a complicated crosstalk between RAS, PI3K/AKT, NF-κB, LIN28A/LIN28B and let-7 loop.

LIN28A/LIN28B and let-7 loop mediates cancer cell evasion of immune destruction.

Like let-4 and let-7, LIN28A was also first identified in C. elegans [7], though it is also present in a wide variety of mammals.

Upon binding to pre-let-7, LIN28A/LIN28B recruits TUT4/TUT7, which causes oligo-uridylation at the 3′terminal of pre-let-7 [20– 22].

Importantly, this effect could be attenuated by re-introducing let-7. Recently, a consistent result was observed by Madison et al. in intestinal epithelial cells.

LIN28A/LIN28B promotes invasion and metastasis through the let-7/HMGA2/Slug or Snail/E-cadherin axis [57, 77], but also in a let-7-independent manner.

Recently, it was demonstrated that the LIN28A/LIN28B and let-7 loop is a key switch linking inflammation to cell transformation.

3

Owing to differences in RRM2 expression and gemcitabine chemosensitization upon overexpression of pre -let-7 members, we suspected that some of these precursors failed to process into mature let-7 forms in MIA PaCa-2. Hence, we quantified relative mature let-7 levels by qRT-PCR in various pre- let-7 -expressing MIA PaCa-2 clones and compared them with mock-transduced MIA PaCa-2. Interestingly, significant increases (averages range from 2–5-fold) in mature let-7 forms were identified in all pre- let-7 -overexpressing cells tested, except for pre- let-7-a-1 -overexpressing cells which did not show any alteration in mature let-7a levels (Fig. 3A ).

Consistently, earlier studies have implicated a causal relationship between let-7 and RRM2, identifying downregulation of many let-7 family members in RRM2 -overexpressing, gemcitabine-resistant pancreatic cancer cells or a reduction in RRM2 expression after let-7 overexpression [17], [18].

Taken together, these data likely suggest that let-7 members may endogenously inhibit RRM2 expression by direct post-transcriptional repression in MIA PaCa-2. Human let-7 Precursors Differentially Modify RRM2 Expression and Gemcitabine Chemosensitization in MIA PaCa-2We next attempted to generate stable clones of MIA PaCa-2 that overexpresses one of ten human let-7 precursors [27] to study their effects on RRM2 protein and chemosensitivity.

Taken together, these data likely suggest that let-7 members may endogenously inhibit RRM2 expression by direct post-transcriptional repression in MIA PaCa-2. A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE.

In searching for putative miRNA inhibitors of RRM2 by computational miRNA target prediction algorithms, we found the let-7 family of tumor suppressor miRNAs to possess a seed match for base pairing with the 3′ UTR of RRM2 (context score percentile: 94; TargetScanHuman 5.1).

In order to test whether the let-7 -mediated increase in gemcitabine cytotoxicity was facilitated by RRM2 suppression, we overexpressed RRM2 cDNA with or without the 3′ UTR regions into MIA PaCa-2 expressing pre- let-7a-3. Our results identified lower gemcitabine cytotoxicity IC [50] in cells expressing RRM2 with the 3′ UTR (69.34±3.4 nM) compared with those without the 3′ UTR (383.4±20.3 nM).

Nevertheless, pre- let-7 -mediated alterations in RRM2 expression may not be just because of a simple translation inhibition process.

Second, certain miRNAs, including members of the let-7 family, have been shown to activate rather than suppress target gene expressions under specific cellular environments [36].

Interestingly, Western blotting analysis showed significant reductions in RRM2 protein expression only in MIA PaCa-2 stably expressing pre -let-7a-3, pre -let-7e, pre -let-7f-1, and pre -let-7i but only minimally in MIA PaCa-2 cells expressing pre -let-7b, pre -let-7d, and pre -let-7-f-2 cells (Fig. 2A ).

MIA PaCa-2 exhibited reduced expression of let-7a, let-7b, let-7c, let-7e, let-7f, and let-7g, PANC-1 exhibited reduced expression of let-7b, let-7c, let-7d, let-7g, let-7h, and let-7i, and BxPC-3 exhibited reduced expression of let-7b, let-7c, let-7d, let-7f, and let-7i (Fig. 1C ).

D, RRM2 is a direct target of let-7. 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1, let-7a-2, let-7a-3, let-7b, and miR-214 (negative control) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct.

We then tested the direct interaction of let-7 with RRM2 by transfecting a luciferase -expression construct fused to the 3′ UTR of RRM2 into 293Ta (ATCC-CRL-9078) [23] and MIA PaCa-2 transiently overexpressing let-7 members.

While all let-7 members significantly decreased luciferase expression in 239Ta cells, many let-7 members brought a significant decrease in luciferase expression in MIA PaCa-2 cells as well (Fig. 1D ), suggesting that the direct binding of let-7 to the RRM2 3′ UTR causes RRM2 repression.

LIN-28 and SET Oncoprotein Affect Mature let-7 Expression and Chemosensitization Differentially in Gemcitabine-sensitive Versus Gemcitabine-resistant Cells: Pronounced Growth Suppression with SET knockdown.

LIN-28 and SET Oncoprotein Affect Mature let-7 Expression and Chemosensitization Differentially in Gemcitabine-sensitive Versus Gemcitabine-resistant Cells: Pronounced Growth Suppression with SET knockdownWe next examined whether manipulating LIN-28 and SET, which produced the highest changes in let-7a levels in our screen (Fig. 5B ), could influence the biogenesis of various let-7 miRNAs.

To assess the let-7 control of RRM2 expression, we subsequently profiled the aforementioned cell lines for relative expression of all let-7 family members by qRT-PCR.

Recently, forced expression of let-7 miRNAs was shown to inhibit pancreatic cancer cell proliferation in vitro but not tumor growth in vivo suggesting the presence of complex functional ramifications [22].

0053436.g002 Figure 2Differential RRM2 expression and gemcitabine chemosensitization by let-7 precursors in MIA PaCa-2. A, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members.

First, the diverse targets, even for closely-related miRNAs such as those within the let-7 family [27], can evoke markedly different cellular outcomes based on the collective effect of their individual targets.

Comparisons with computationally predicted RRM2 targeting miRNAs identified that in addition to reduction in several let-7 members, mir-140-3p, the miR-30 family, and miR-342-5p were also found to potentially contribute to the overall induction of RRM2 expression in Capan-1-GR cells (Fig. 4F ).

RRM2 and let-7 are Inversely Expressed in Human Pancreatic Cancer CellsWe first verified RRM2 expression in pancreatic cancer cell lines that were categorized earlier as inherently gemcitabine-sensitive or -resistant [23].

n = 3. B, Relative expression of precursor (filled bars; right axis) and mature (open bars; left axis) let-7 forms in pancreatic cancer cells transiently expressing let-7a precursors.

For instance, unlike the majority of let-7 precursors that decreased RRM2 expression, pre- let-7a-1 and pre -let-7a-2 stimulated RRM2 expression while other let-7 members (i. e., pre- let-7f-2) did not significantly alter RRM2 levels.

Finally, since let-7 overexpression increases the G2/M fraction of fibroblasts [25] and RRM2 expression is specific to S-phase cells, we evaluated the role of let-7 in reducing RRM2 expression by decreasing the proportion of MIA PaCa-2 in S-phase.

In order to study whether misexpression of regulatory proteins were responsible for the observed defects in let-7a processing in pancreatic cancer cells, we first investigated the expression of LIN-28, a pluripotent stem cell protein that has been well-established to negatively regulate let-7 biogenesis [28], [29].

0053436.g003 Figure 3Defective processing of pre- let-7a-1, but not pre- let-7a-3, into let-7a in MIA PaCa-2. A, Relative expression of mature forms of let-7 in MIA PaCa-2 stably expressing pre- let-7 family members.

None to only a few let-7 members had significantly reduced expressions in the remaining cell lines that expressed similar levels of RRM2 protein as HPDE (i. e., L3.6pl: none; AsPC-1: let-7c; Capan-1: let-7c, let-7f) (Fig. 1C ).

Likewise, even when mature let-7 increased with overexpression of other precursors (i. e., pre- let-7d, pre- let-7f-2), no alterations in RRM2 expression were observed.

These data identify that RRM2 expressional outcomes significantly differ with the overexpression of specific pre- let-7 subtypes in pancreatic cancer cells.

Third, since precursor let-7 forms are also capable of binding to target transcripts similar to mature let-7 [37], increased levels of pre- let-7a-1, even in the absence of mature let-7, could force incorporation of RRM2 into RISC, perhaps modulating gene expression.

Interestingly, significantly lower expressions of most of the let-7 miRNAs were observed only in cell lines with relatively greater RRM2 expression.

Varied consequences upon overexpressing mammalian let-7 precursors in MIA PaCa-2, in particular the effects on RRM2 expression and gemcitabine chemosensitivity, suggest the existence of intricately controlled mechanisms.

A, Relative expression of mature forms of let-7 in MIA PaCa-2 stably expressing pre- let-7 family members.

Several Novel RNA -binding Proteins Influence Mature let-7a Biogenesis in MIA PaCa-2In order to study whether misexpression of regulatory proteins were responsible for the observed defects in let-7a processing in pancreatic cancer cells, we first investigated the expression of LIN-28, a pluripotent stem cell protein that has been well-established to negatively regulate let-7 biogenesis [28], [29].

Human let-7 Precursors Differentially Modify RRM2 Expression and Gemcitabine Chemosensitization in MIA PaCa-2. Differential RRM2 expression and gemcitabine chemosensitization by let-7 precursors in MIA PaCa-2..

It is likely that SET inhibits the transcription of many miRNAs, perhaps including tumor suppressors such as let-7, while silencing of SET removes this block.

Further, overexpression of let-7 was found to increase the radiosensitization of pancreatic tumor cells [19], while inhibition of RRM2 was identified to sensitize pancreatic tumors to ultraviolent radiation [20], [21].

These results suggest that the reduction in RRM2 protein as a result of pre- let-7a-3 overexpression was facilitated by post-transcriptional repression of RRM2, although RRM2-independent mechanisms are likely to play predominant roles in other pre- let-7 -overexpressing cells (e. g., pre- let-7f-2).

Furthermore, let-7 regulatory proteins can also be targeted.

Here we report an intricate regulation of RRM2 expression and gemcitabine chemosensitization by let-7 a precursors and identify that the miRNA transcriptional/processing machinery involved in mature let-7a biogenesis is likely to act as a crucial factor when considering let-7a -based therapeutics for pancreatic cancer.

Levels of two other known regulators of let-7 biogenesis, KHSRP (positive regulator) and hnRNP-A1 (negative regulator) [30], were not notably different between the various pancreatic cancer cell lines tested and HPDE (Fig. 5A ).

Figure S1 Lack of cell cycle changes in MIA PaCa-2 expressing pre- let-7 members.

RRM2 and let-7 are Inversely Expressed in Human Pancreatic Cancer Cells.

Interestingly, significant reductions in gemcitabine cytotoxic IC [50] estimations were identified in almost all pre- let-7 -expressing MIA PaCa-2 stable clones generated with the only exception being pre- let-7a-1 whose introduction brought no differences (Fig. 2C ).

B, Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members.

MIA PaCa-2 stably expressing pre- let-7a-1, pre- let-7a-2, pre- let-7a-3, pre- let-7b, pre- let-7d, pre- let-7e, pre- let-7f-1, pre- let-7f-2, and pre- let-7i were generated successfully by lentiviral gene transfer; however, repeated attempts to stably transduce pre- let-7c and pre- let-7g failed due to a lack of surviving colonies.

Generation of MIA PaCa-2 Stable Cells Overexpressing Pre- let-7 MembersFIV-let-7 constructs (let-7a-2, let-7a-3, let-7b, let-7c, let-7e, let-7f-1, let-7f-2, let-7g, and let-7i) from GeneCopoeia (Rockville, MD) and HIV-let-7 constructs (let-7a-1 and let-7d) from System Biosciences (Mountain View, CA) were used.

Generation of MIA PaCa-2 Stable Cells Overexpressing Pre- let-7 Members.

C and D, Relative expression of mature let-7 members in LIN-28- (filled bars) or SET-silenced (open bars) MIA PaCa- 2 (C) and L3.6pl (D).

A, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members.

These results support an inverse relationship between RRM2 and let-7 expression in pancreatic cancer cells.

Our study identified reduced let-7 expression to contribute to the RRM2 -mediated inherent chemoresistance in poorly differentiated pancreatic cancer cells.

We next attempted to generate stable clones of MIA PaCa-2 that overexpresses one of ten human let-7 precursors [27] to study their effects on RRM2 protein and chemosensitivity.

A direct role of LIN-28, a zinc finger protein that promotes pluripotency in embryonic stem cells [28], [29], was readily evident in the defective processing of let-7a as observed by increases in mature let-7 levels upon LIN-28 knockdown and the concurrent enhancement of chemosensitivity.

Under these conditions, however, no prominent decreases in S-phase cells were observed in any of the pre- let-7 overexpressing MIA PaCa-2 (Fig. S1).

Together, these results identify LIN-28 and SET oncoprotein to differentially modulate let-7 expression and chemosensitivity in gemcitabine-sensitive versus –resistant pancreatic cancer cells with LIN-28 selectively influencing gemcitabine chemosensitivity in poorly differentiated pancreatic cancer cells (i. e., MIA PaCa-2).

In summary, RRM2 was found to be a key determinant of both inherent and acquired gemcitabine with reduced let-7 expression likely to contribute to RRM2 -mediated inherent chemoresistance in poorly differentiated pancreatic cancer cells.

Identification of the interaction between let-7 miRNA and the 3′ UTR of RRM2 transcripts and the concomitant decrease in RRM2 protein expression in the absence of prominent cell cycle alterations provide supportive evidence for the let-7 -mediated post-transcriptional repression of RRM2.

While qRT-PCR showed that knockdown of LIN-28 (Fig. 6B ) only increased mature let-7 levels in MIA PaCa-2 (8 out of 8 let-7 members) and not L3.6pl, knockdown of SET (Fig. 6B ) increased the levels of let-7 members in both L3.6pl (6 out of 8 let-7 members) and MIA PaCa-2 (8 out of 8 let-7 members) (Fig. 6C–D ).

Our findings that let-7 is capable of influencing gemcitabine chemosensitivity along with its tumor suppressive and differentiation-promoting functions in solid tumors extend its promise as a therapeutic candidate for pancreatic cancer.

Next, to investigate the correlation between defective let-7 processing and RRM2 expression, we profiled 6 matched normal and PDAC tissues (i. e., derived from the same donors) for let-7 and RRM2 expressions.

These data persuaded us to test for the existence of additional regulators of let-7 biogenesis in drug-resistant pancreatic cancer cells.

Evidently, we noticed pre- let-7a-1 to moderately activate RRM2 expression in reporter -based RNA interference assays in MIA PaCa-2 (Fig. 1 D) despite its inability to process pre- let-7-a-1 to mature let-7a.

The observed increase in both precursor and mature let-7 levels upon SET knockdown supports this hypothesis.

C, MIA PaCa-2 cells stably overexpressing pre- let-7 family members (red) or vector alone (blue) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay.

For example, the direct introduction of mature let-7 forms is likely to bring enhanced outcomes in a heterogenic tumor population than the pre- let-7 forms.

It displayed several putative candidates that could have a direct impact on post-transcriptional let-7 processing (Thoc4, Cldn1, Npm1, Igfbp5, ESR1, Lrp1 and LIN-28; Fig. 4C–E ).

However, the ability of pancreatic cancer cells to restore or augment mature let-7 expression must be carefully considered when choosing let-7 as a therapeutic candidate.

Overall, these data expand our current understanding of let-7 regulation of growth control in pancreatic cancers.

Hence, to study the potential interplay between let-7 and RRM2 and to further explore the opportunity of utilizing let-7 for pancreatic cancer therapeutics, we sought to determine the direct impact of the human let-7 family on RRM2 -mediated inherent gemcitabine resistance.

FIV-let-7 constructs (let-7a-2, let-7a-3, let-7b, let-7c, let-7e, let-7f-1, let-7f-2, let-7g, and let-7i) from GeneCopoeia (Rockville, MD) and HIV-let-7 constructs (let-7a-1 and let-7d) from System Biosciences (Mountain View, CA) were used.

An inverse relation of RRM2 and let-7 in human pancreatic cancer cells.

In addition, distinct let-7 precursors were identified to improve chemosensitization in gemcitabine-resistant pancreatic cancer cells partially via post-transcriptional repression of RRM2.

Likewise, careful selection of pre- let-7 subfamilies can also overcome defects associated with let-7 processing machinery in pancreatic cancer cells.

Silencing of LIN-28 and SET showed differential let-7 biogenesis, growth, and gemcitabine chemosensitivity effects.

Defective Processing of Pre- let-7a-1 in MIA PaCa-2Although we used pre- let-7 members for generating all stable MIA PaCa-2 clones, functional RNA interference was expected to be mediated by the mature let-7 miRNAs generated after a series of intracellular RNA processing events.

Silencing SET not only increased mature let-7a levels but also other members within the let-7 family in both poorly differentiated MIA PaCa-2 and well-differentiated L3.6pl.

Since most let-7 members [27] seemed to negatively influence RRM2 expression, we further investigated whether pre- let-7 could augment chemosensitivity of MIA PaCa-2 to gemcitabine.

MIA PaCa-2 cells transiently infected with lentiviruses harboring empty (control) or various pre -let-7 members were subjected to cell cycle analysis (48 h after transfection) as described earlier [23].

0053436.g006 Figure 6Silencing of LIN-28 and SET showed differential let-7 biogenesis, growth, and gemcitabine chemosensitivity effects.

Finally, RRM2 may not be a global determinant of drug-resistance in pancreatic cancer cells, in which case the proposed let-7-RRM2-chemoresistance axis may not be as effective as expected in RRM2 -dependent resistance.

Target In Vitro Reporter AssayFor luciferase binding assays, 293Ta cells were seeded on a 24-well cluster (5×10 [3] cells/well) and transduced with various let-7 precursors using the lentiviral gene transfer method (as described earlier).

We decided to examine all of the 10 human let-7 members for their potential roles as chemosensitization factors [17], [31]– [33].

Future studies, especially in animal mo dels, are expected to improve the collective understanding of let-7 cancer biology and its therapeutic applications in solid tumors.

Besides several possibilities, alterations in let-7 processing machinery were found to influence the levels of mature let-7 as well as nucleoside analog chemoresistance in tumor cells.

Investigating expressional alterations of let-7 miRNAs in pancreatic cancer cells led to the identification of the influence of various RNA binding proteins in these processes.

Fourth, let-7 could also act on transcriptional factors, proteasomal machinery, cell cycle check points, DNA replication/repair enzymes, etc.

Although we used pre- let-7 members for generating all stable MIA PaCa-2 clones, functional RNA interference was expected to be mediated by the mature let-7 miRNAs generated after a series of intracellular RNA processing events.

0053436.g001 Figure 1An inverse relation of RRM2 and let-7 in human pancreatic cancer cells.

Our study also elucidates several RNA processing proteins, including SET oncoprotein and LIN-28, to disparately modulate mature let-7 biogenesis and chemosensitivity in gemcitabine-sensitive- versus –resistant pancreatic cancer cells.

As shown in Fig. 3D, a pre- let-7a-1 fusion construct failed to undergo complete processing, but a control pre- let-7b fusion construct, which produced significantly higher mature let-7 levels (Fig. 3A ), did not.

In addition, MIA PaCa-2 represents a poorly-differentiated pancreatic cancer cell mo del [23] and let-7 plays critical roles in cellular differentiation.

We next examined whether manipulating LIN-28 and SET, which produced the highest changes in let-7a levels in our screen (Fig. 5B ), could influence the biogenesis of various let-7 miRNAs.

Since not all RRM2 protein induction (>5-fold in Capan-1) could be fully accounted for by the increase in RRM2 transcripts (≤2-fold), we subsequently tested whether a decrease in let-7 -mediated post-transcriptional repression of RRM2 was promoting acquired resistance.

4

Consistent with this idea of a negative feedback loop, shRNA -mediated suppression of endogenous MYC was found to up-regulate let-7 (Wang et al., 2011), whereas let-7 expression was shown to suppress MYC expression in a Burkitt lymphoma cell line (Sampson et al., 2007).

Moreover, up-regulation of RAS was found to require down-regulation of let-7 in lung cancer and non-small cell lung cancer (NSCLC) (Takamizawa et al., 2004; Johnson et al., 2005; Kumar et al., 2008), and let-7g was shown to block tumorigenesis by suppressing RAS in NSCLC (Kumar et al., 2008).

The inverse relationship between the expression levels of let-7 and HMGA2 was further supported by recent studies demonstrating that ectopic let-7 expression can inhibit cell growth and mammosphere formation by down -regulating RAS and HMGA2 in mouse breast cancers (Sempere et al., 2007; Yu et al., 2007).

In an unfavorable environment, ligand-unbound DAF-12 suppresses let-7 expression with its co-repressor, DIN-1. When environmental conditions favor developmental progression, however, ligand-bound DAF-12 activates the transcription of let-7. This feedback loop may regulate cellular fate and developmental arrest (Bethke et al., 2009; Hammell et al., 2009).

In addition to the role of let-7 in modulating the RAS oncogene, multiple let-7 members were found to be down-regulated in human cancers and cancer stem cells, strengthening the notion that let-7 may also function as a tumor suppressor (Takamizawa et al., 2004; Shell et al., 2007; Yu et al., 2007; Dahiya et al., 2008; O’Hara et al., 2009).

It thus seems that let-7 should be expressed at specific stages of terminal differentiation, but down-regulated in stem cells being maintained in their undifferentiated state.

During differentiation, increased expression of let-7 down-regulates HMGA2 by interacting with its 3′ UTR (Yu et al., 2007; Boyerinas et al., 2008; Nishino et al., 2008).

let-7 was shown to regulate the expression of high-mobility group AT-hook 2 (HMGA2), which is an early embryonic oncofetal gene that is overexpressed in stem cells and contributes to their self-renewal (Yu et al., 2007; Nishino et al., 2008).

As a result, the majority of let-7 mutants die due to bursting of the vulva, earning this mutation its name: lethal-7. The expression pattern of let-7 is consistent with its mutant phenotype, as its expression is first detected at the L3 stage and peaks at the L4 stage (Reinhart et al., 2000; Esquela-Kerscher et al., 2005).

Purified LIN28A inhibits pri-let-7 processing in vitro and its ectopic expression selectively blocks pri-let-7 processing in vivo (Newman et al., 2008; Viswanathan et al., 2008).

The observation that let-7 expression gradually increases during development suggests that let-7 biogenesis may be tightly regulated by additional factors (Pasquinelli et al., 2000; Sempere et al., 2002; Thomson et al., 2006; Liu et al., 2007).

Moreover, the SET7/9 -mediated post-translational modification (methylation) appears to act as a switch that changes the action mode of LIN28A in the inhibition of let-7 biogenesis.

Thus, although it is not yet clear whether LIN28A directly inhibits Drosha activity, it appears to negatively regulate let-7 biogenesis in the nucleus as well as in the cytoplasm.

Transcriptional regulation of let-7 C. elegans harbors a feedback circuit between let-7 and the nuclear hormone receptor, DAF-12, in that DAF-12 is a target of let-7, but also regulates the transcription of let-7 in a ligand -dependent manner.

Even though let-7 is ubiquitously expressed in adult mammalian tissues (Sempere et al., 2004), expression of individual let-7 family members is also context -dependent.

This context -dependent expression of let-7 family members would be tightly related with the expression of LIN28A/B as well as transcription factors (Thornton and Gregory, 2012).

As let-7 is induced during development and represses the expression of pluripotency factors, its biogenesis must be precisely regulated.

In the presence of LIN28A/B, TUTases instead inhibit pre-let-7 processing by oligo-uridylation via LIN28A/B -mediated targeting.

Together, these lines of evidence strongly suggest that the let-7 family members act as crucial tumor suppressors that inhibit diverse oncogenes.

As let-7 expression gradually increases during development, and this miRNA plays important roles in many biological processes, it could be expected that the biogenesis of let-7 should be tightly regulated (Pasquinelli et al., 2000; Sempere et al., 2002; Thomson et al., 2006; Liu et al., 2007).

Indeed, DIS3, other catalytic subunit of cytoplasmic exosome, also indirectly regulates the expression of let-7 through degradation of LIN28B mRNAs in several mammalian cancer cell lines (Segalla et al., 2015).

With respect to the function of let-7 as tumor suppressor, the targets of C. elegans let-7 were initially predicted using computational analysis, and the 3′ UTR of let-60 [also known as an ortholog of the RAS (human Rat sarcoma) oncogene] was identified as having the highest identified sequence complementarity to let-7 (Johnson et al., 2005).

Although the expressions of LIN28A and LIN28B are mutually exclusive and these proteins play somewhat different inhibitory roles in let-7 biogenesis, recent results suggest that they might share the consensus of their molecular mechanism.

Thus, one of the mechanisms of maintaining undifferentiated state in stem cells is upregulation of HMGA2 by maintaining the low level of let-7 miRNA.

The involvement of let-7 miRNA in stem cell regulation also provided a clue as to how let-7 may function as a tumor suppressor.

Indeed, recent studies have shown that let-7 family members generally promote differentiation during development and function as tumor suppressors in various cancers (Reinhart et al., 2000; Takamizawa et al., 2004; Grosshans et al., 2005; Johnson et al., 2005; Yu et al., 2007; Caygill and Johnston, 2008; Kumar et al., 2008).

In summary, two major biological roles have been elucidated for the let-7 miRNA: as an essential regulator of terminal differentiation, and as a fundamental tumor suppressor.

This conservation suggests that let-7 may act as a regulator of gene expression across diverse animal species (Pasquinelli et al., 2000; Hertel et al., 2012).

LIN28B appears to directly bind to pri-let-7 in the nucleus and sequester it to the nucleolus, which lacks Drosha, thereby suppressing let-7 maturation via a TUTase-independent pathway.

Cluster1-a (let-7a-2, miR-100, miR-125b-1) and Cluster1-b (let-7c, miR-99a, miR-125b-2) are involved in HSPC (hematopoietic stem and progenitor cell) homeostasis such as self-renewal, proliferation, quiescence, and differentiation by blocking TGFβ pathway and amplifying Wnt signaling (Emmrich et al., 2014), whereas LIN28B represses let-7 to inhibit erythroid development and maintain stemness (Copley et al., 2013; Lee et al., 2013b).

Interestingly, a similar feedback loop has also been demonstrated in mammals: MYC is a target of let-7, but it can also repress the transcription of let-7 during MYC -mediated tumorigenesis by directly binding to the promoter and upstream region of the let-7a-1/let-7f-1/let-7d cluster (Chang et al., 2008; Wang et al., 2011).

C. elegans harbors a feedback circuit between let-7 and the nuclear hormone receptor, DAF-12, in that DAF-12 is a target of let-7, but also regulates the transcription of let-7 in a ligand -dependent manner.

In mammals, let-7 expression is high during embryogenesis and brain development (Thomson et al., 2004; Schulman et al., 2005; Thomson et al., 2006; Wulczyn et al., 2007) and remains high in adult tissues (Sempere et al., 2004; Thomson et al., 2004).

For instance, miR-48, miR-84, and miR-241 regulate the second larval (L2) to third larval (L3) transition, while let-7 regulates the fourth larval (L4) to adult transition (Fig.   1) (Reinhart et al., 2000; Abbott et al., 2005).

Several other lines of evidence strongly suggest that let-7 functions as tumor suppressor in general.

Consistent with this mutant phenotype, let-7 expression in D. melanogaster gradually increases during the third larval instar stage and peaks in the pupa (Pasquinelli et al., 2000; Bashirullah et al., 2003).

Ultimately, detailed mechanistic studies for let-7 biogenesis and its regulation involved in the developmental timing, cell division and differentiation in animals should be elucidated.

Thus, the let-7 miRNAs of C. elegans and D. melanogaster both act as essential regulators for proper development at the larva-to-adult transition.

During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Let-7 miRNAs are found in various animal species, including the human.

LIN28B has also been shown to inhibit let-7 biogenesis (Fig.   4), but the similar functions of LIN28A and LIN28B are achieved through very different action mechanisms (Piskounova et al., 2011).

In addition, a subset of let-7 family member would be expressed in specific tissues, cell lines, and cancers (Boyerinas et al., 2010; Chiu et al., 2014).

In C. elegans, let-7 controls the crucial developmental timing of the last larval transition (L4-to-adult) via regulation of transcription factors (daf-12, pha-4, die1, and lss4) in different tissues (Fig.   1) (Reinhart et al., 2000; Grosshans et al., 2005).

The let-7 mutant is lethal in the nematode (Reinhart et al., 2000), and decreased let-7 expression or genomic deletion has been detected in several human cancer types (Takamizawa et al., 2004; Dahiya et al., 2008; O’Hara et al., 2009).

This conserved feature of the let-7 miRNAs suggests that their targets and functions may be similar across diverse animal species.

However, the exact role of let-7 family members in mammalian development has not yet been fully elucidated (Lancman et al., 2005; Schulman et al., 2005; Wulczyn et al., 2007), in large part because it is technically difficult to knock out multiple let-7 family members in the same individual.

These studies collectively support the notion that let-7 is a key regulator of proper developmental timing in C. elegans.

LIN28A and LIN28B inhibit the biogenesis of let-7 via both TUTase -dependent and -independent pathways.

In addition, precocious expression of let-7 at the L2 stage yielded an early adult-like phenotype at the L4 stage (Hayes and Ruvkun, 2006).

According to miRBase, Caenorhabditis elegans (nematode), Drosophila melanogaster (fly), Xenopus tropicalis (frog ), Danio rerio (zebra fish), Gallus gallus (chicken), Canis familiaris (dog), Mus musculus (mouse) and Homo sapiens (human) all express a version of let-7 (let-7a) that possesses the exact consensus sequence of ‘UGAGGUAGUAGGUUGUAUAGUU’ (Fig.   2A).

When LIN28A is overexpressed in HEK293T cells, the 3′-terminal oligo-uridylation of pre- let-7 yields a uridine tail of ~14 nt (Heo et al., 2008).

Further studies examining the molecular mechanisms of let-7 biogenesis and its regulation by nuclear/nucleolar and cytoplasmic factors should provide new insights into the biological roles of the let-7 family members.

The detailed relationship between LIN28B and TUTases needs to be further understood LIN28A/B negatively regulates let-7 biogenesisAs noted above, LIN28A is required for the oligo-uridylation of pre-let-7 by TUTases (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Piskounova et al., 2011; Thornton et al., 2012).

Figure 4 Regulation of let-7 biogenesis by LIN28A/B.

Thus, it appears that LIN28A may regulate pri-let-7 processing in a TUTase-independent fashion in the nucleus as well as a TUTase -dependent pathway in the cytoplasm.

In addition, pri-let-7 processing is rescued by knockdown of LIN28A in mouse embryonal carcinoma (Viswanathan et al., 2008).

In contrast, seam cells harboring the let-7 mutation fail to finish the L4-to-adult transition and instead exhibit extra cell division without proper formation of the adult alae (Reinhart et al., 2000).

Oligo-uridylation by TUTases is a marker for pre-let-7 degradationIt has been reported that let-7 is also post-transcriptionally regulated by additional factors.

Dysregulation of let-7 family members leads to abnormal physiological processes.

It has been reported that let-7 is also post-transcriptionally regulated by additional factors.

For example, let-7 family members have been shown to repress cell cycle regulators (e. g., cyclin A, cyclin D1, cyclin D3, and CDK4) and block cell cycle progression and anchorage-independent growth in cancer cells (Johnson et al., 2007; Schultz et al., 2008).

LIN28A/B negatively regulates let-7 biogenesis.

REGULATION OF let-7 BIOGENESIS.

In addition, we discuss recent progress in better understanding the regulatory mechanisms that act upon let-7. The discovery of let-7 in C. elegansExperiments using forward genetics originally identified let-7 (lethal-7) as a heterochronic gene in C. elegans (Reinhart et al., 2000).

Despite let-7 is one of the first discovered miRNAs, the details on transcriptional regulation of let-7 family, especially individual members of let-7 family, are not clearly understood.

Interestingly, MYC can also negatively regulate let-7 family members such as let-7a, - 7d, and - 7g by binding to their promoters, thus, forming a negative-feedback loop (Chang et al., 2008; Wang et al., 2011).

Based on this, it seems reasonable to speculate that other transcription factors may also participate in the transcriptional regulation of let-7 family members.

LIN28A/B proteins also regulate let-7 biogenesis via TUTase-independent pathways.

Moreover, let-7 is known to regulate hematopoietic stem cell fate along with miR-99a/100, miR-125b-1/2, and LIN28B (Copley et al., 2013; Lee et al., 2013b; Emmrich et al., 2014).

To date, several transcriptional and post-transcriptional mechanisms have been proposed as regulators of let-7 biogenesis.

Transcriptional regulation of let-7. Oligo-uridylation by TUTases is a marker for pre-let-7 degradation.

In chicken and mice, let-7 is involved in limb development (Mansfield et al., 2004; Lancman et al., 2005; Schulman et al., 2005).

Pre-let-7 is mono-uridylated at the 3′ end by LIN28A and TUTases prior to Dicer -mediated processing.

The group II pri- let-7 precursors have a bulged adenosine (pri-let-7d) or uridine (all other members of the group) next to the processing site (Heo et al., 2012).

As discussed above, TUTase is essential for the processing of the group II pre-let-7 miRNAs, which have a unique 3′ overhang (Fig.   3) (Heo et al., 2012).

Notably, each let-7 family member is often present in multiple copies across the genomes of higher animals (Table  1).

Comparison of let-7 family members in D. melanogaster and higher animals has revealed that such sequences tend to show similar genomic positions, suggesting that they form well-preserved clusters (Lagos-Quintana et al., 2001; Bashirullah et al., 2003; Sempere et al., 2003).

This oligo-uridylated pre-let-7 resists Dicer cleavage and is instead susceptible to degradation.

It was recently shown that LIN28A can prevent the biogenesis of let-7 independent of TUT4/7 in hESCs, in a manner similar to that seen for LIN28B (Fig.   4) (Kim et al., 2014).

X-ray crystallography has shown that the three RNA binding domains of DIS3L2 form an open funnel that facilitates uridine-specific interactions with the first 12 uridines of the pre- let-7 tail.

In the human, let-7g and let-7i are located individually on chromosomes 3 and 12, respectively, while the other let-7 family members are distributed among four clusters (clusters 1 to 4) (Table  2).

In the human, for example, 12 distinct loci encode nine mature let-7 miRNAs (Fig.   2B and Table  2).

For one, whereas the nematode and the fly have only one let-7 miRNA, higher animals (e. g., fishes and mammals) have diverse let-7 family members including let-7a, - 7b, - 7c, - 7d, - 7e, - 7f, - 7g, - 7h, - 7i, - 7j, - 7k (see below for a discussion of this nomenclature) and miR-98 (Table  1) (Lagos-Quintana et al., 2001; Lau et al., 2001; Chen et al., 2005; Landgraf et al., 2007).

Genomic location and four clusters of these precursors are describedIn animal genomes, the let-7 family members can be encoded individually or as clusters with other family members and/or unrelated miRNAs.

Biological roles of let-7 family membersThe high degree of conservation among let-7 miRNAs across different animal species suggests that they may play important (and potentially similar) roles in the biological processes of various organisms (Pasquinelli et al., 2000; Hertel et al., 2012).

Moreover, HuR, RNA -binding protein, binds and represses MYC mRNA by recruiting the let-7/RISC complex to 3′ UTR region of MYC (Ma et al., 1996; Kim et al., 2009).

The nematode and fruit fly have a single isoform, whereas higher animals have multiple let-7 isoforms.

In addition, while the mature let-7 miRNA is not detected, pri-let-7 exists in some cell types including mESCs (Suh et al., 2004; Thomson et al., 2006; Wulczyn et al., 2007).

LIN28A is mainly localized in the cytoplasm, but it can enter the nucleus and shows affinity for both pri- and pre-let-7 (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008).

The machinery responsible for degrading oligo-uridylated pre-let-7 was recently identified as the catalytic subunit of the cytoplasmic exosome, DIS3L2 (Chang et al., 2013; Malecki et al., 2013; Ustianenko et al., 2013).

The detailed relationship between LIN28B and TUTases needs to be further understood As noted above, LIN28A is required for the oligo-uridylation of pre-let-7 by TUTases (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Piskounova et al., 2011; Thornton et al., 2012).

Figure 2 Sequence comparison of let-7 family members across diverse animal species.

Although let-7 maturation generally follows the canonical miRNA biogenesis pathway, some family members require an additional step.

The terminal loop of pre- let-7 has three independent binding sites for LIN28A, which can be multiply assembled in a stepwise fashion (Desjardins et al., 2014).

LIN28B blocks the biogenesis of the let-7 miRNA via TUTase-independent pathways.

During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Characteristics of the let-7 family Let-7 miRNAs are found in various animal species, including the human.

Experiments using forward genetics originally identified let-7 (lethal-7) as a heterochronic gene in C. elegans (Reinhart et al., 2000).

In this review, we provide an overview of the features and biological roles of the let-7 family members in higher eukaryotes.

For instance, we do not yet know what happens to pri-let-7 following its sequestration into the nucleolus by methylated LIN28A or LIN28B.

These lines of evidence suggest that LIN28A might participate in multiple steps of let-7 biogenesis, including both Dicer- and Drosha -mediated processing.

Mammals have two paralogs of LIN28, LIN28A (also known as LIN28) and LIN28B, which can bind to both pri- and pre-let-7 to block the activities of Drosha and Dicer (Fig.   4) (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008).

org, bottom panel) Although the let-7 sequence is well conserved from the nematode to the human, several differences distinguish the closely related let-7 family members of various animal species (Roush and Slack, 2008).

This multimerization of LIN28A is likely to be required for the efficient blockade of Dicer -dependent pre-let-7 processing.

GENERAL FEATURES OF THE let-7 FAMILY.

LIN28A helps TUTases to oligo-uridylate pre-let-7. Methylated LIN28A binds to pri-let-7 in the nucleus and sequesters it into the nucleolus to prevent Drosha -mediated processing.

Let-7 (lethal-7) was one of the first miRNAs to be discovered.

In this context, the level of pre-let-7 appears to influence the subcellular localization of LIN28B (Suzuki et al., 2015).

org, bottom panel)Although the let-7 sequence is well conserved from the nematode to the human, several differences distinguish the closely related let-7 family members of various animal species (Roush and Slack, 2008).

Three members of the let-7 family (pre- let-7a-2, -7c, and -7 e) carry the typical two-nucleotide 3′ overhang in their precursors (group I pre-miRNAs), while the rest possess one-nucleotide 3′ overhang (group II pre-miRNAs) (Heo et al., 2012).

Indeed, studies have shown that LIN28A/B blocks let-7 biogenesis in several different ways to maintain self-renewal and pluripotency in stem cells (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008; Heo et al., 2009; Piskounova et al., 2011; Kim et al., 2014).

Genomic location and four clusters of these precursors are described In animal genomes, the let-7 family members can be encoded individually or as clusters with other family members and/or unrelated miRNAs.

Subsequently, let-7 was shown to interact with let-60 and RAS in C. elegans and human cancers, respectively (Johnson et al., 2005).

The let-7 miRNA is evolutionarily conserved across various animal species, including flies and mammals, but it is not found in plants (Pasquinelli et al., 2000; Hertel et al., 2012).

The high degree of conservation among let-7 miRNAs across different animal species suggests that they may play important (and potentially similar) roles in the biological processes of various organisms (Pasquinelli et al., 2000; Hertel et al., 2012).

Higher animals have generally similar sets of let-7 family members, although slight differences may be observed (for example, let-7h exists in the zebrafish but not in the human).

TUT4 and TUT7 were recently shown to oligo-uridylate pre-let-7 in embryonic stem cells and cancer cells (Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012).

The discovery of let-7 in C. elegans.

let-7 has also been shown to function as a heterochronic gene in D. melanogaster (Caygill and Johnston, 2008; Sokol et al., 2008), wherein let-7 mutants show abnormal (delayed) cell cycle exit in the wing (Caygill and Johnston, 2008) and an irregular maturation of neuromuscular junctions in the adult abdominal muscles that results in immaturity of the neuromusculature and defects in adult fertility, motility, and flight (Sokol et al., 2008).

LIN28A reportedly competes with Dicer for pre-let-7 and blocks processing of the precursor (Rybak et al., 2008); in the absence of LIN28A, pre-let-7 is mono-uridylated by TUT2/4/7 and further processed by Dicer to generate the mature let-7 (Heo et al., 2012).

miRNA processing miRNA biogenesis let-7 family TUTase LIN28A/B MicroRNAs (miRNAs) are short (~22-nucleotide-long) non-coding RNAs found in diverse eukaryotes from plants to animals.

The details of the relationship between DIS3L2-related cytoplasmic exosomes and let-7 biogenesis are also unknown.

In the human, for instance, the let-7 family is composed of nine mature let-7 miRNAs encoded by 12 different genomic loci, some of which are clustered together (Ruby et al., 2006; Roush and Slack, 2008).

Through its RNA -binding activity, LIN28A associates with the bulging GGAG motif in the terminal loop of pre-let-7 and recruits TUT4/7 (Nam et al., 2011).

Most of let-7 sequences include the ‘seed sequence’.

Biological roles of let-7 family members.

Interestingly, the TUTases play a second role in the degradation of pre- let-7 through their terminal uridylation activity (Fig.   4) (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012).

This substantial total includes 401 let-7 sequences from various organisms.

Consensus sequences of the mature human let-7 family members, as assessed by MEME (http://meme-suite.

To distinguish between the various isoforms, a letter and/or number are placed after the term ‘ let-7’.

In this review, we briefly summarize the current state of knowledge regarding the let-7 miRNA family and its biological functions, focusing on let-7 biogenesis in higher animals.

In addition, TUTase has been shown to be involved in degrading the let-7 precursor (pre-let-7) to block the generation of mature let-7 in the cytoplasm (Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012).

Moreover, these multiple let-7 family members are likely to have functionally redundant roles.

In general, the let-7 miRNA is generated through the canonical miRNA biogenesis pathway, which involves Drosha- and Dicer -dependent processing and is supported by TUTases.

In addition, recruitment of HuR and let-7 to the transcript of MYC is interdependent (Kim et al., 2009; Gunzburg et al., 2015).

At present, the detailed molecular mechanisms underlying let-7 miRNA biogenesis are not fully understood.

Although let-7 family is generated through canonical miRNA biogenesis pathway, it would be helpful to understand the let-7 biogenesis when comparing with the non-canonical miRNA biogenesis.

5

We observed that let-7 miRNA was over expressed in C. elegans mo del of PD expressing wild type ‘human’ alpha-synuclein protein, while its expression was reduced in C. elegans mo del expressing mutant alpha-synuclein.

Our results suggest that loss of function of let-7 miRNA results in significant upregulation of daf-12 and daf-16 gene expression validating the fact that let-7 miRNA controls the expression level of daf-12 and daf-16 mRNA.

In our study, we found that let-7 miRNA silenced worms showed downregulation of ced-4 and jnk-1 while upregulation of lin-45 mRNA.

Thus knocking down of let-7 miRNA protects cell death by reducing the expression level of ced-4 and jnk-1 as well as via maintaining vulval viability by increasing the expression level of lin-45.

Asikainen et al. (2010) reported that let-7 miRNA was downregulated in transgenic strain expressing mutant alpha-synuclein (A53T).

RNAi of Let-7 miRNA Resulted in Upregulation of Downstream Target Genes.

Let-7 miRNA Was Over-expressed in C. elegans Mo del of PDImpaired miRNA expression is known to be associated with the development and progression of neurodegenerative PD (Wong and Nass, 2012).

Let-7 miRNA acts as tumor suppressing miRNA and may well come up as an interesting target for various cancers (Barh et al., 2010).

FIGURE 1Graph depicting relative expression of let-7 miRNA and its targets, studied through real-time PCR (qPCR).

FIGURE 9GFP expression pattern in the unc-17::GFP strain (A: control, B: lct-7 miRNA knockdown) and dat-l::GFP strain (C: control and D: let-7 miRNA knockdown) using fluorescence microscopy.

We found that loss of let-7 miRNA leads to decreased alpha-synuclein expression, increased autophagy, increased Daf-16 expression, increased oxidative stress and increased fat content with no effect on dopaminergic/acetylcholinergic neurons.

FIGURE 4Assay for autophagy marker genes in C. elegans; (A) relative expression of autophagy marker genes studied through real-time PCR after let-7 miRNA silencing (B): Expression pattern of LGG-1::GFP in DA2123 using fluorescence microscope; control (a), let-7 knockdown (b), number of puncta as quantified using ImageJ software (c).

In order to quantify the expression level of let-7 miRNA, we carried out TaqMan based real-time PCR studies for let-7 miRNA in wild type (N2) and alpha-synuclein expressing strain (NL5901) of C. elegans.

Our results also open avenues for further research toward deciphering the importance of let-7 miRNA in the context of various other diseases and may prove to be beneficial target for the treatment of PD in future.

We observed that there was a significant 174% (p < 0.05), and 134% (p < 0.05) upregulation of daf-12 and daf-16, respectively, as compared to control (Figure 1B) that validated the role of let-7 miRNA in the regulation of daf-12 (previously reported; Grosshans et al., 2005) and predicted daf-16 genes (miRBase21) [2].

Knockdown of Let-7 miRNA Influenced the Expression of Autophagy Marker Genes.

Here, we employed transgenic C. elegans strain LX929 (unc-17::GFP; expressing GFP under the influence of the unc-17 promoter specifically in cholinergic neurons) and BZ555 (P dat-1::GFP; expressing GFP under the influence of the dat-1 promoter specifically in the dopaminergic neurons) for assaying the effect of let-7 miRNA silencing on acetylcholinergic and dopaminergic neurons (Pu and Le, 2008; Barbagallo et al., 2010).

We observed no significant effect on expression of GFP either in let-7 miRNA knockdown LX929 or BZ555 strain as compared to their respective controls (Figures 9A– D), suggesting that knockdown of let-7 miRNA has no effect on these neuronal subpopulations.

Expression of alpha-synuclein protein was examined in control and let-7 miRNA knockdown worms of the NL5901 strains as described previously (Jadiya et al., 2012).

Knockdown of Let-7 miRNA Led to Reduced Expression of Alpha-synuclein Protein.

The effect of let-7 miRNA knockdown on acetylcholinergic and dopaminergic neurons was studied via expression of GFP tagged with unc-17 and dat-1 transporter of acetylcholinergic and dopaminergic neurons, respectively.

We observed that knocking down of let-7 miRNA led to increase in lgg-1 and atg-13 whereas it led to decrease in atg-5 and atg-7 expression.

FIGURE 3Alpha-synuclein expression in NL5901 strain of C. elegans (studied through fluorescence microscopy) fed on control (A) and let-7 miRNA knockdown condition (B).

Wishing to delineate the possible role of let-7 in multifactorial aspect of PD, we further examined the effect of let-7 miRNA knockdown on the expression level of genes associated with cell death.

Let-7 miRNA is found to be downregulated in different types of cancer including lung cancer, breast cancer, colon cancer, gastric cancer, and Burkitt’s lymphoma.

Our studies indicate that knockdown of let-7 miRNA protects cells from death by reducing the ced-4 and jnk-1 mRNA expression.

However, some studies have shown that its expression levels were altered in C. elegans mo del of PD (Asikainen et al., 2010), which implies that let-7 miRNA networking pathways may be playing a critical role in PD development.

Mature Let-7 miRNAs Were Downregulated in Let-7 miRNA Silenced Worms.

Let-7 miRNA are also downregulated by pathogenic LRRK2 (Gehrke et al., 2010).

Regulation of let-7 and its target oncogenes (Review).

Target genes of let-7 miRNA are denoted by yellow color.

Our study shows fat content was increased by decreasing the expression of alpha-synuclein in let-7 miRNA silenced worms.

We employed C. elegans mo del of PD, (NL5901) for quantification of the expression level of let-7 miRNA.

daf-12 mRNA acts as a downstream target of let-7 miRNA as reported previously (Hammell et al., 2009).

Our studies further provide evidence that let-7 possibly decreases alpha-synuclein expression via increasing autophagy and increasing daf-16 forkhead box O (FOXO) transcription factor.

Let-7 miRNA Was Over-expressed in C. elegans Mo del of PD.

Our studies further provide a clue toward the role of let-7 miRNA in possibly decreasing alpha-synuclein expression via increasing autophagy and increasing daf-16 FOXO transcription factor.

Our studies suggest that the targets of let-7 miRNA might be involved in autophagy pathway which was increased in the absence of let-7 miRNA.

Toward our studies of exploring the importance of let-7 miRNA in the context of PD, we constructed an RNAi feeding bacterial clone of let-7 miRNA and studied it employing transgenic C. elegans strain expressing human alpha-synuclein.

FIGURE 5Graphical representation of relative mRNA expression of apoptosis pathway genes after let-7 miRNA silencing using qPCR analysis in C. elegans.

Expression of Apoptosis Marker Genes Was Altered in Let-7 miRNA Silenced Worms.

Let-7 miRNA is differentially expressed in alpha-synuclein transgenic animals and human Parkin ortholog pdr-1 mutant animals (Asikainen et al., 2010).

Worms in the control group (NL5901 fed on EV) expressed optimal level of alpha-synuclein protein (Figure 3A), while let-7 miRNA silenced worms showed reduction in the level of alpha-synuclein protein (Figure 3B).

Let-7 miRNA Knockdown Had No Effect on Acetylcholinergic and Dopaminergic Neurons.

According to findings gathered from this tool, let-7 miRNA is involved in pathways of apoptosis, autophagy, cell cycle regulation, glycolysis/gluconeogenesis, MAPK signaling pathway and P13K-Akt signaling pathway (Figure 2).

In order to investigate the role of let-7 miRNA in PD and its associated factors we designed RNAi feeding bacterial clone of let-7 miRNA toward knocking down let-7 miRNA in the nematodes and studied its effect on disease mo del for various endpoints, including investigation of alpha-synuclein protein expression, lipid content, oxidative stress, quantification of autophagy/apoptosis marker genes, dopaminergic neurodegeneration and associated phenotypes.

GFP::LGG-1 was also increased in let-7 knockdown worms that further validate the previous findings.

Let-7 miRNA, by bioinformatics analysis, is known to regulate genes of cell death, autophagy, mTOR and insulin pathway.

Knockdown of let-7 miRNA exhibited no marked effect on motility in wild type strain N2.

For the validation of RNAi mediated inhibition we carried out TaqMan miRNA assay toward quantification of let-7 miRNA levels under untreated and let-7 miRNA silenced conditions.

We observed fluorescence intensity of 3.636 ± 0.3434 relative fluorescence intensity units (RFU) per worm in control group whereas let-7 miRNA knockdown worms exhibited fluorescence intensity of 7.300 ± 0.5500 RFU per worm, thereby displaying 50.19% (p < 0.05) increased ROS level with respect to that of control group (Figure 7).

A feedback circuit involving let-7 -family miRNAs and DAF-12 integrates environmental signals and developmental timing in Caenorhabditis elegans.

daf-12 mRNA is negatively regulated by let-7 miRNA.

Age synchronized control and let-7 knockdown worms were washed twice with 0.2% DEPC (Sigma, Cat.

Role of microRNA Let-7 in modulating multifactorial aspect of neurodegenerative diseases: an overview.

Knockdown of Let-7 miRNA Increases Oxidative Stress.

C. elegans wild type strain N2 {control and let-7 knockdown} (A).

We observed that wild type N2 strain exhibited a mean response time of 1.600 ± 0.2449 s (N = 10) whereas the mean response time of let-7 miRNA knockdown worms was 2.200 ± 0.3742 s (N = 10) (Figure 10A).

The temporal patterning microRNA let-7 regulates several transcription factors at the larval to adult transition in C. elegans.

In our studies, we observed that alpha-synuclein accumulation, and end points associated with PD were decreased in the absence of let-7 miRNA indicating the importance of let-7 miRNA directly with the progression of NDs.

The knockdown of let-7 miRNA decreased the fluorescence intensity of alpha-synuclein::YFP by 2.82-fold (p < 0.001) when compared to control worms; with mean fluorescence intensity for the control group 31.57 ± 0.5497 (N = 10) arbitrary units and that for let-7 miRNA knockdown worms was 11.18 ± 0.2047 (N = 10) arbitrary units (Figure 3C).

Oncogenes that are regulated by let-7 are ras, hgma2, myc, NIRF and JAK-STAT3 pathway molecules (Wang et al., 2012).

Let-7 is an evolutionarily conserved miRNA that has been reported to repress multiple oncogenes by affecting key regulators of the cell cycle, cell differentiation, and apoptotic pathways.

FIGURE 2 The KEGG pathway “FOXO signaling pathway” is regulated by let-7 miRNA.

Let-7 directly regulates oncogenic genes that are involved in signaling pathways in tumor progression.

Our results indicate no direct role of let-7 miRNA on functions associated with dopamine content.

We observed that let-7 miRNA was overexpressed in PD mo del by 75% (p < 0.001) as compared to that of control group (Figure 1A).

We studied the effect of let-7 miRNA knockdown on the alteration of ROS level.

let-7 sequence (C05G5.6); tacactgtggatccggtgaggtagtaggttgtatagtttggaatattaccaccggtgaactatgcaattttctaccttaccggagacagaactcttcga.

Silencing of Let-7 miRNA.

The effect of let-7 miRNA silencing on fat content in nematodes was studied by staining worms with Nile red (MP Biomedicals cat no.

In order to understand the effect of let-7 miRNA knockdown on normal locomotory behavior we employed thrashing assay to quantify motility in the worms.

This provides a clue toward protective role of let-7 miRNA in cell death.

Let-7 miRNA is 22 nt long non-coding RNA, which was first discovered in C. elegans.

Pathway Analysis of Let-7 miRNA.

There is very little that is known about the role of let-7 miRNA in the progression of PD.

We observed that let-7 miRNA was reduced by 46% (p < 0.05) in let-7 miRNA silenced worms as shown in Figure 1B.

It suggests that loss of let-7 miRNA function does not have any effect on dopamine synthesis or overall availability.

C. elegans homolog of amyloid precursor protein apl-1 is also reported to be controlled by let-7 miRNA (Yokota et al., 2003; Revuelta et al., 2008).

-D5758) was used to remove adhering bacteria from age synchronized N2 and let-7 silenced groups.

Let-7 miRNA Silenced Worms Exhibited Enhanced Motor Function in Transgenic Strain NL5901.

This suggests that absence of let-7 miRNA might help in maintaining lipid content in worms.

Nile red was mixed with control (EV)/let-7 miRNA RNAi clone and seeded onto NGM-IPTG plates followed the protocol as described previously (Ashrafi et al., 2003).

Our study leads to an understanding of the role of C. elegans let-7 miRNA in progression of PD and confirms that absence of let-7 miRNA leads to decrease in accumulation of alpha-synuclein protein in transgenic worms.

These results suggest that absence of let-7 miRNA exerts its effects via atg-5/atg-7 independent alternative pathway for clearance of misfolded aggregated proteins.

Worms of control and let-7 miRNA silenced groups were washed thrice with M9 buffer and twice with phosphate buffer saline (PBS).

In this study, control and let-7 miRNA silenced worms were washed with M9 buffer to remove any adhering bacteria.

We carried out quantitative real-time PCR of some of previously reported genes of cell death (Cecconi et al., 1998; Kuan et al., 1999; Hayakawa et al., 2011; Rutkowski et al., 2011; Jiang and Wu, 2014) under control and let-7 miRNA silenced condition.

In contrast transgenic strain NL5901 displayed mean response time of 2.600 ± 0.5099 s (N = 10) and silencing of let-7 miRNA in this strain resulted in a mean response time of 2.000 ± 0.4472 s (N = 10) (Figure 10B).

Our findings indicate that mRNA levels of lgg-1 and atg-13 were increased in let-7 silenced worms.

Our finding indicates that loss of let-7 miRNA might play protective role in C. elegans.

FIGURE 7ROS production levels as estimated by H [2]DCFDA assay in wild type strain N2 (control and let-7 knockdown condition).

Therefore, silencing of let-7 miRNA might be protecting the dopaminergic neurons via decreasing the accumulation of alpha-synuclein.

Our findings indicate that absence of let-7 miRNA has no effect on these neurons.

Let-7 miRNA Silenced Worms Displayed Enhanced Fat Content.

Our studies showed enhanced motility which suggests let-7 miRNA may have role in excitatory neurotransmission.

let-7 sequence (C05G5.6); tacactgtggatccggtgaggtagtaggttgtatagtttggaatattaccaccggtgaactatgcaattttctaccttaccggagacagaactcttcga.

To assess the effect of let-7 knockdown on dopamine function, we employed the odor -based repellent assay using 1-nonanol for various conditions.

MicroRNA let-7: an emerging next-generation cancer therapeutic.

However, motility was significantly increased after knockdown of let-7 miRNA in NL5901 strain as compared to that of N2 and NL5901.

GFP::LGG-1 Was Increased in Let-7 miRNA Silenced Condition.

Thus absence of let-7 miRNA might help in the reduction of alpha-synuclein protein aggregates in C. elegans mo del and enhancing life span.

Our studies prove that loss of let-7 miRNA did not affect the dopaminergic and acetylcholinergic neurons.

Keeping this in mind we created RNAi feeding bacterial clone for let-7 miRNA in order to decipher its function.

We carried out quantitative real-time PCR studies toward quantification of the mRNA levels of daf-12 and daf-16 in worms of control and let-7 miRNA silenced groups.

The mean punctae for the let-7 miRNA silenced worms was 57.67 ± 1.453 (N = 5) whereas it was 43.00 ± 3.215 (N = 5) for the control group (Figure 4B).

Hence, we studied ROS in the worms at the basal level and after silencing of let-7 miRNA.

So, we next examined the effect of let-7 miRNA silencing on programmed cell death associated genes.

Silencing let-7 in NL5901 transgenic strain led to decreased accumulation of alpha-synuclein.

Silencing of let-7 miRNA leads to elevated ROS level and mild increase in ROS level acts as inducer of autophagy pathway.

FIGURE 8Nile red staining for fat content in C. elegans from control (A), let-7 miRNA silenced group (B), and graphical representation for fluorescence intensity of the worms as quantified using ImageJ software (C).

To explore the function of let-7 miRNA in autophagy mediated neuroprotection, we studied known autophagy marker genes (Yue et al., 2009) and quantified their mRNA levels using quantitative real-time PCR (qPCR) in normal and let-7 miRNA silenced condition.

In brief let-7 miRNA gene sequence was retrieved from WormBase (sequence number C05G5.6).

Molecular basis for interaction of let-7 microRNAs with Lin28.

Our study provides understanding of the role of miRNA let-7 in PD and confirms that absence of let-7 miRNA leads to decrease in accumulation of alpha-synuclein protein in transgenic C. elegans.

Dopamine Associated Function Is Not Affected under Let-7 miRNA Silencing.

Employing H [2]DCFDA assay we checked ROS level in control and let-7 miRNA knockdown groups.

It is highly conserved across animal species and the let-7 family consists of 9, 14, and 13 members in C. elegans, mouse and humans, respectively (Shamsuzzama et al., 2016).

6

We picked six genes upregulated more than twofold and are GLD-1 or predicted let-7 targets (red and blue spots above the twofold line) and three genes upregulated more than 1.2-fold that are GLD-1 and predicted let-7 targets (purple spots above the 1.2-fold line).

When we tested some of the upregulated proteins for suppression of the vulva-bursting phenotype associated with the gld-1(op236) ; let-7 (mg279) ; [let-7 sponge] strain, we detected a strong suppression with the RNAi -mediated knockdown of cdl-1 gene.

Conversely, reduced expression (60.5%; n = 114) in gld-1(op236) /gld-1(q485) ; let-7(mg279) strains indicates that the phenotype is due to a mutation of gld-1. Figure 3. gld-1 affects the let-7 regulated hypodermal development (a) Simplified diagram of the let-7 pathway leading to col-19 expression.

Among them GLD-1 targets [55, 56] are coloured blue, mirWIP database let-7 target predictions [57] are coloured red, and the possible GLD-1 and let-7 co-targets based on these lists are coloured purple.

Even though these phenotypes might be unspecific, as we do not know whether GLD-1 is expressed in this tissue, co -expressing the let-7 sponge partially suppresses these phenotypes.

Interestingly, let-7 and at least one let-7 target, hbl-1, is also reported to have a similar expression pattern [50], although it is not known to what extent let-7 miRNA phenotypes require hypodermal or neuronal expression.

Thus, cdl-1 is a strong candidate to be co-regulated by both let-7 and GLD-1. However, we cannot rule out the possibility that the cdl-1 upregulation is not directly controlled by let-7 or GLD-1 and it may arise owing to secondary effects.

let-7 miRNA levels in wild-type animals are sufficient to regulate both the endogenous targets and also an additional transgene target (let-7 sponge).

Even though these reporter constructs might not exactly represent endogenous GLD-1 expression, together with our genetic results, they suggest somatic roles for gld-1. One of the targets of let-7 miRNA during larval development is the lin-41 mRNA [45].

CDL-1, DNJ-2 and B0303.3 are possible GLD-1 and let-7 targets that are upregulated more than 1.2-fold (arrows).

Overexpressing a lin-41 3′UTR construct acts as a ‘sponge’ to sequester let-7 miRNA and provides a sensitized system to assay GLD-1 activityOne of the targets of let-7 miRNA during larval development is the lin-41 mRNA [45].

Interestingly, only 28% of gld-1(op236) ; let-7(mg279) double-mutant animals have wild-type levels of transgene expression (figure 3 b) and 47% of double-mutant animals do not express col-19::GFP in the hypodermal hyp7 cells (figure 3 d).

However, another likely interpretation of these experiments is that GLD-1 and let-7 act in conjunction to excessively repress target mRNAs possibly in the same pathway, and that reducing the ‘dose’ of let-7 using the sponge alleviates target gene repression.

A transcriptional reporter expressing GFP under the control of the col-19 promoter reveals that both gld-1(op236) and let-7(mg279) single mutants have unaltered col-19::GFP expression (figure 3 b).

Either lack of let-7 or disrupted let-7 function, causes loss of col-19 expression owing to increased LIN-41 expression that leads to reduced LIN-29 activity (figure 3 a) [41].

During the L4 to adult transition, let-7 downregulates lin-41, a TRIM-NHL domain protein that keeps the transcription factor LIN-29 in an inactive state possibly through mRNA regulation as described for mammalian systems [45].

Targeting the [let-7 sponge] which is a col-10::GFP::lin41 3′UTR construct by GFP RNAi lead to a complete suppression of the vulva-bursting phenotype and thus served as a positive control.

cdl-1 is a predicted let-7 miRNA target and it was identified as a GLD-1 target [55– 57].

Similarly, lin-28 and ztf-7 are let-7 miRNA targets [70, 71] and these genes have also been identified as GLD-1 targets [55].

We next expressed gld-1 under the control of the col-10 promoter in the hypodermis to investigate whether such expression of gld-1 might cause any phenotype associated with the loss of let-7 targets.

Expression of a let-7 sponge with a deletion of the 3 let-7 binding sites or expression of the unrelated unc-54 3′UTR did not cause any bursting phenotype in let-7(mg279) and in gld-1(op236) ; let-7(mg279) animals supporting the specificity of the let-7 sponge and the interactions between gld-1 and let-7 miRNA (figure 5 a).

4.4. gld-1(op236) affects let-7 regulation of hypodermal developmentIn order to better understand the extent of genetic interactions between gld-1 and the let-7 miRNA, we focused on the role of let-7 miRNA in hypodermal development.

In addition, we wanted to determine whether GLD-1 and the let-7 miRNA regulate distinct or same targets.

Using stable isotope labelling with amino acids in cell culture (SILAC) -based proteomics, we show that the upregulation of the histone mRNA -binding protein CDL-1 is partially responsible for the genetic interactions between GLD-1 and let-7 miRNA.

The mg279 allele has a promoter mutation that reduces let-7 expression [43].

Either way, we can conclude that CDL-1 upregulation in a let-7 and GLD-1 -dependent manner is in part responsible for the vulva-bursting phenotype.

For instance, moulting defects in let-7 mutants are partly due to mis-regulation of the nuclear hormone receptors nhr-23 and nhr-25 [41], and nhr-23 is a predicted GLD-1 target [55, 56].

The depletion of one of the candidates, namely cdl-1 lead to a reduced vulva-bursting phenotype consistent with the notion that the upregulation of CDL-1 in the gld-1(op236) ; let-7(mg279) background might contribute to the vulva-bursting phenotype.

This finding can be explained by the robustness and redundancy of the let-7 miRNAs and also by the target genes whose mis-regulation is well tolerated.

A dumpy phenotype also occurs following mutation of let-7 targets such as lin-41 [45].

Proteins (239) overlap with 1322 predicted let-7 targets (figure 6 a, coloured in red, mirWIP database [57]).

gld-1(op236) affects let-7 regulation of hypodermal development.

However, the suppression of the vulva-bursting phenotype by CDL-1 RNAi in gld-1(op236) ; let-7(mg279) ; [let-7 sponge] animals is not complete.

We tested whether the depletion of these three proteins suppresses the vulva-bursting phenotype of the gld-1(op236) ; let-7(mg279) ; [let-7 sponge] strain (figure 6 b).

Our results show that gld-1 can genetically interact with the let-7 miRNA family during somatic development when the let-7 miRNA pathway is sensitized through mutations of the let-7 family miRNAs.

Fifty-four proteins are predicted to be both GLD-1 and let-7 targets (figure 6 a, coloured in purple).

Co -expression of the let-7 sponge partially rescues the dumpy and loss of alae phenotypes (figure 5 b–d).

The penetrance of the vulva-bursting phenotype is dramatically enhanced in gld-1(op236) ; let-7(mg279) double mutants expressing the GFP::lin-41–3′ UTR (let-7 sponge) (figure 5 a).

col-19::GFP expression is not affected in gld-1(op236) /+; let-7(mg279) (1.5%; n = 66) again indicating recessiveness of gld-1(op236).

let-7 sponge partially rescues the alae defects in col-10::GLD-1 expressing animals.

However, when the let-7 miRNA levels are limiting, such as in the hypomorphic let-7(mg279) mutants, endogenous targets are not efficiently dealt with when the let-7 sponge is present (figure 5 a).

Thus, by comparing the animals with a weak phenotype (B) to animals with a strong phenotype (C), we aimed to identify proteins whose expression change might be responsible for the bursting through the vulva phenotype and help explain the interaction between gld-1 and the let-7 miRNA.

By using already established tools, we could show that gld-1 affects multiple let-7 miRNA regulated pathways (figures  2– 4).

The relative abundance of the majority of suspected GLD-1 and let-7 co-targets do not change when the C/A ratios are compared with the B/A ratios.

Based on these results, we cannot exclude the possibility that gld-1 and let-7 miRNA function in parallel pathways during the hypodermal development.

To determine whether a germline is required for seam cell fusion defects in gld-1(op236) and gld-1(op236) ; let-7(mg279) animals, we used RNAi to inactivate glp-1, which is essential for germline development [49].

gld-1(q485) null/gld-1(op236) ; let-7(mg279) and gld-1(q485) null; let-7(mg279) double-mutant worms show supernumerary moulting phenotypes confirming that the synthetic phenotypes are really caused by mutations of the gld-1 gene.

Hypodermal defects in gld-1(op236) ; let-7(mg279) could be the result of mis-regulation of lin-41 mRNA.

let-7-related phenotypes arise much later during development, making a mechanism involving the maternal contribution of miRNAs unlikely.

Our results suggest that GLD-1 and let-7 synergistically affect animal development.

Overexpressing a lin-41 3′UTR construct acts as a ‘sponge’ to sequester let-7 miRNA and provides a sensitized system to assay GLD-1 activity.

SILAC in nematodes identifies proteome wide changes in gld-1 and let-7 mutantsOur results suggest that GLD-1 and let-7 synergistically affect animal development.

We indeed found that gld-1 enhances multiple let-7 and mir-35 family miRNA phenotypes affecting somatic development.

In order to better understand the extent of genetic interactions between gld-1 and the let-7 miRNA, we focused on the role of let-7 miRNA in hypodermal development.

To check whether the genetic interactions of gld-1 with the let-7 miRNA family are restricted to the hypodermal development, we looked into the let-60/RAS pathway that functions during vulva formation [48].

In summary, our combined data suggest that gld-1 affects hypodermal development in let-7 mutant background, either by acting through let-7 or through a parallel pathway.

As the animals expressing let-7 sponge alone do not display any phenotype, we considered them as the baseline similar to using wild-type.

GLD-1 affects let-60 signallingTo check whether the genetic interactions of gld-1 with the let-7 miRNA family are restricted to the hypodermal development, we looked into the let-60/RAS pathway that functions during vulva formation [48].

ain-1 and ain-2 RNAi induced the vulva-bursting phenotype only in the sensitive let-7(mg279) ; let-7 sponge animals.

The let-7 family (let-7, mir-48, mir-84, mir-241 and mir-795) miRNAs are much more studied compared with mir-35 family miRNAs during C. elegans development.

Strong ectopic junctions (arrow heads), weak ectopic junctions (small, thin arrows) and lack of junctions (not shown) are observed in gld-1(op236), let-7(mg279) and gld-1(op236) ; let-7(mg279) worms (right hand panel).

gld-1 genetically interacts with let-7 family miRNAs.

Depletion of cgh-1 enhances the defects of let-7 family mutants and CGH-1 biochemically interacts with ALG-1, AIN-1 and NHL-2 [5].

We thank Gary Ruvkun for sharing the let-7(mg279) strain, Rafal Ciosk for supporting J. E. W., and the Caenorhabditis Genetics Centre for supplying most of the parental strains.

Our let-7 sponge system confirms the notion that the miRNA pathways are highly redundant.

Furthermore, we observed that let-7 phenotypes are enhanced by gld-1 even when glp-1 RNAi animals lacking a germline were analysed.

The strongest genetic interaction between gld-1 and let-7 occurs in the let-7 sponge system (figure 5 a).

We did not observe such a phenotype in gld-1(op236) and in the hypomorphic let-7(mg279) single mutant, but to our surprise, this phenotype occurred in 84% of gld-1(op236) ; let-7(mg279) double mutants (figure 2 b and electronic supplementary material, movie S1).

Thus, gld-1(op236) specifically enhances the let-7 -dependent phenotypes, and the extent of genetic interactions between gld-1 and the let-7 miRNA pathway becomes more evident when the let-7 miRNA pathway is further compromised.

Owing to the sterility of gld-1(null) animals, gld-1(null) ; let-7(mg279) phenotype is determined by slow movement and lack of pharyngeal activity during L4 to young adult transition.

We have shown that the GLD-1 interactors CGH-1 and PAB-1 affect let-7 miRNA function (figure 7).

However, let-7(mg279) mutants showed a low penetrance bursting through the vulva phenotype reminiscent to let-7(null) phenotype (figure 5 a).

Forty-two per cent (n = 43) of mir-48 mir-241; mir-84 triple mutants die owing to a burst vulva during the L4 to adult transition reminiscent to the let-7(null) phenotype [44].

mir-84 and let-7 antagonize let-60/RAS signalling in vulval precursor cells that are not destined to form the vulva.

A supernumerary fifth moult has been described in let-7(mg279) ; mir-84(tm1304) double mutants [41], during which adult animals cease to move and stop pharyngeal activity.

However, it is unlikely that such a mo del can explain the genetic interactions we observed between gld-1 and let-7 family miRNAs.

For the SILAC experiment synchronized L1 larvae of three strains, namely (A) [let-7 sponge], (B) let-7(mg279); [let-7 sponge] and (C) gld-1(op236) ; let-7(mg279) ; [let-7 sponge] were grown up to the young-adult stage until the bursting phenotype just becomes visible and subjected to quantitative mass spectrometry (figure 6 a).

In a recent study, one of the C. elegans poly(A) binding proteins, PABP-2, was shown to antagonize let-7 miRNA function [73].

Figure 5. A let-7 sponge transgene generates a sensitive system to test miRNA function.

Analysis of differential interference contrast (DIC) images and the AJM-1::GFP junction marker indicate defects in alae formation and seam cell fusions in gld-1(op236), let-7(mg279) and gld-1(op236) ; let-7(mg279) animals (figure 3 e).

The timing of seam cell fusion and alae formation is controlled by let-7 family miRNAs [43].

Importantly, we generated a sensitized system using a let-7 sponge and showed that gld-1(op236) specifically enhances let-7 loss-of-function phenotypes (figure 5).

Indeed, cdl-1 3′UTR harbours a GLD-1 and a let-7 binding site (electronic supplementary material, figure S7).

Blots were probed with labelled let-7 RNA and U6 snRNA DNA oligonucleotides as previously described [33].

We identified a similar rise in GFP levels in SILAC experiments, and the level of GFP was further increased in gld-1(op236) ; let-7(mg279) ; let-7 sponge animals (C to A; electronic supplementary material, figure S5 b).

As previously observed for let-7(mg279) ; mir-84(tm1304) double mutants [41], gld-1(op236) ; let-7(mg279) animals with only partially shed cuticles can be observed (figure 2 c).

gld-1(op236) did not affect levels of mature let-7 miRNA, thereby ruling out the possibility that GLD-1 has an essential, non-redundant role in miRNA processing (see electronic supplementary material, figure S2).

Among the GLD-1 interactors besides alg-1 RNAi, cgh-1 and pab-1 RNAi also induced a strong vulva-bursting phenotype in the let-7(mg279) ; let-7 sponge animals, supporting their role in miRNA function.

We next quantified the extent of seam cell fusion defects and found that the incidence of seam cell fusion defects is higher in gld-1(op236) ; let-7(mg279) double-mutant animals than in single mutants (figure 3 c).

Only in this ‘very sensitive’ situation, a role for gld-1 in the let-7 miRNA pathway becomes apparent.

Figure 6. SILAC -based proteomics in let-7 and gld-1 mutants.

Bursting dramatically increases in gld-1(op236) ; let-7(mg279); [let-7 sponge] animals (error bars = s. e. m. ).

One of the phenotypes in let-7 mutants relates to moulting [41].

Heterozygous gld-1(op236) /+; let-7(mg279) animals have wild-type appearance (figure 2 b) consistent with gld-1(op236) behaving as a recessive allele.

We likened this observation to a sponge-like effect of the GFP::lin-41–3′ UTR towards let-7 miRNA.

Using lin-41 3′UTR with deleted let-7 binding sites ([Δlet-7sponge]) or [unc-54 3′UTR] in the sponge construct doesn't cause any phenotypes.

As expected, alg-1 RNAi induces a strong vulva-bursting phenotype in both let-7 sponge and let-7(mg279) ; let-7 sponge animals (figure 7 b).

In our study, we show that PAB-1 is required for proper let-7 function and this is in line with the interactions between PAB-1 and AIN-1 [63].

gld-1(op236) m+ z-; let-7(mg279) (m, maternal genotype; z, zygotic genotype) animals have a comparable phenotype with gld-1(op236) m- z-; let-7(mg279) animals (figure 2 b), showing that maternal contribution of gld-1 does not affect the supernumerary moulting phenotype.

let-7 sponge partially rescues the dumpy phenotype and the short size of the animals are rescued to wild-type levels.

This further supports the involvement of gld-1 either in the let-7 pathway or in a parallel pathway.

SILAC in nematodes identifies proteome wide changes in gld-1 and let-7 mutants.

Figure 2. gld-1 genetically interacts with mir-35 and let-7 family miRNAs.

7

What was previously reported was confirmed; that is, apoptosis related proteins BaX and BaK were upregulated, whereas apoptosis inhibiting protein Bcl-xL was downregulated after reexpression of let-7g precursor for 72 hours (Figure 6(e)), suggesting that it is through upregulating the Bax and BaK and downregulating Bcl-xL that let-7g induced apoptosis of HCC cell lines, MHCC97-H and HCCLM3.

So far, the potential mechanism by which let-7g work in the antiproliferation and antimetastasis of HCC still remains unknown, despite the recent peer findings available that let-7g may suppress HCC metastasis partially through targeting COL1A2 [10] and that let-7g inhibit cell proliferation of HCC by downregulating the c-Myc and upregulating p16 (INK4A) [20].

Despite the let-7g being reported to negatively regulate Bcl-xL expression and induce apoptosis in cooperation with anticancer drug targeting Mcl-1 in HCC [12] and to inhibit the cell migration in HCC through targeting collagen type I α2 [10], the underlying mechanism by which let-7g works to inhibit proliferation and migration in HCC remains largely unknown.

On reexpressing the let-7g, E-cadherin that has been a typical pathological marker for epithelial trait was upregulated; meanwhile, N-cadherin and Snail were downregulated.

Put together, we found that restoration of let-7g can significantly inhibit the malignant behaviors of HCC cells in vitro in the way through downregulating the K-Ras/HMGA2A/Snail axis and suppressing HCC tumorigenesis in vivo at the earlier stage.

Therefore, based on findings of our own as well as other peer findings, results suggest that reexpression of let-7g could suppress the EMT process via downregulation of K-Ras/ERK1/2 signaling pathway.

To explore the possible mechanism of let-7g, we hypothesized that let-7g reexpression inhibited malignant cellular behaviors via downregulating K-Ras -mediated mitogen-activated protein kinase (MAPK) signaling pathway, based on the analysis and reanalysis of published reports available [14– 16].

Based on the earlier report [12] that let-7g could induce cellular apoptosis via downregulation of Bcl-xL and meanwhile upregulation of Bax.

Reexpression of let-7g can significantly inhibit the malignant behaviors of HCC cells in vitro and suppress HCC tumorigenesis at the earlier stage in vivo.

We found that reexpression of let-7g could alleviate the epithelial-mesenchymal transition (EMT) via downregulating the K-Ras/HMGA2A pathway.

Reexpression of Let-7g Suppressed the Expression of HMGA2 and EMT Markers.

HMGA2A expression was expectedly and significantly decreased after upregulation of let-7g (Figure 7), which was wholly consistent with Zucchini-Pascal et al. 's observation [18].

It can be seen that let-7g was mainly localized in cytoplasm of HCC cells and let-7g was heterogeneously expressed, with some cases being high and others being low expression in HCC tissues (Figure 2(a)).

In light of the conflicting expression patterns of let-7 family across human cancers [8], we first tested the expression levels of seven kinds of let-7 family members we have chosen in our study in 40 paired HCC tissues and their corresponding normal controls.

It was shown that let-7g reexpression can significantly inhibit the tumorigenesis of HCC in nude mice, which is highly consistent and similar with Kumar et al., in their study in the evaluation of suppression of tumorigenesis of let-7g in nonsmall cell lung cancer [14].

In the present study, we have identified that expression of let-7g was lowest among the seven let-7 family members that we have chosen in terms of basal expression in clinical HCC tissues using the real-time RT-PCR, and that it is only let-7g that is significantly associated with metastasis of HCC.

To examine whether or not reexpression of let-7g could induce cell apoptosis and cell cycle variation, both MHCC97-H and HCCLM3 cell lines were subjected to Flow Cytometry analysis after reexpression of let-7g for 48 hours.

Next, to test whether or not let-7g re -expression could suppress the tumor formation in vivo, nude mice xenografted with HCCLM3 cells were employed.

It is shown that reexpression of let-7g in MHCC97-H and HCCLM3 can significantly suppress the migration and invasion ability of MHCC97-H and HCCLM3 cells in culture system, which was in line with and in agreement with Qian and coworkers' report in spite of whose consistent results were found in breast carcinoma [11].

It was found that the migration (P < 0.01, Figure 4) and invasion (P < 0.05, Figure 5) were both significantly inhibited in MHCC97-H and HCCLM3 cell lines after reexpression of let-7g.

What is the potential mechanism by which reexpression of let-7g inhibited migration and invasion in HCC cell lines?

Further, in HCC cell lines, we found it is the way through K-Ras/HMGA2A/Snail axis that reexpression of let-7g inhibitied the proliferation, migration, and invasion of HCC cells.

Reexpression of Let-7g Inhibited Proliferation in HCC Cell Lines.

The epithelial trait marker, E-cadherin, was upregulated whereas at the same time N-cadherin and Snail which belonged to specific mesenchymal biomarker were correspondingly decreased in a different level, suggesting that restoration of let-7g could alleviate the EMT extent that is crucial event in HCC progression and recurrence [22].

Reexpression of Let-7g Suppressed Tumorigenesis of HCC Xenografts.

Reexpression of Let-7g Inhibited Migration and Invasion of HCC Cell Lines.

To test whether or not let-7g reexpression could have an effect on the metastasis of HCC cell lines, we examined the rate of migration and invasion through wound-healing and Transwell approach.

In our present study, we have employed 40 cases of HCC tissues and their controls, although quite limited, observing that low expression of let-7g was significantly associated with poorer overall survival.

In our present study, we found that among the let-7 family miRNAs, endogenous expression of let-7g was lowest in the clinical HCC tissues.

To observe the basal expression of let-7 family in HCC, we performed real-time RT-PCR to detect the 7 members of let-7 miRNA family in 40 paired HCC clinical tissues and paired normal control.

Additionally, a recent study has shown that HMGA2, one of the targets of let-7g, was involved in the process of epithelial-mesenchymal transition (EMT) [17].

A growing evidence suggests that restoration of let-7 expression has an antiproliferative effect on cancer cells of different kinds [8], thus indicating that let-7 restoration may be a useful therapeutic option in HCC.

It was found that let-7g can significantly suppress the tumorigenesis of HCC in vitro at the earlier stage.

Additionally, low expression of let-7g was significantly associated with inferior overall survival of patients with HCC.

Let-7 is a family consisting of 13 members located on nine different chromosomes whose expression usually has been lost, reduced, or deregulated in the majority of human cancers [2].

It can be seen that injection with let-7g precursor plasmid can significantly reduce the tumor volume of HCCLM3 before or at the 10th day (Figure 8), suggesting that reexpression of let-7g could be used as ideal therapeutic agent in the treatment of HCC at the earlier stage.

Expression of let-7g in 40 paired of HCC tissues and normal controls were detected by ISH with probes for let-7g (Exiqon, Woburn, Massachusetts).

Thus, it can be seen that the continuous let-7g delivery might lead to initial suppression of tumor growth before the 10th day but let-7g-resistant tumors would eventually and inevitably emerge.

Among them, relative expression of let-7g was significantly the lowest (Figure 1).

Furthermore, we found that low expression of let-7g was significantly associated with poorer survival outcomes.

To verify the proposal, we have tested the protein markers mentioned previously in HCCLM3 after reexpression of let-7g.

What is more is that low expression of let-7g was significantly associated with inferior overall survival of patients with HCC.

Kaplan-Meier analysis was conducted illustrating that there was significant correlation between poor overall survival and low expression of let-7g in the 40 cases of HCC cohort using ISH method (Figure 2(b)).

Let-7 family has been reported to be downregulated significantly in HCC [8] whose 9 members have been found in humans [9].

Nonetheless, one dilemma that is inevitable and we fell into in the experimentation of xenografted nude mice is that let-7g reexpression was only workable at the earlier stage (at or before the 10th days).

Our results suggest that reexpression of let-7g could be used as an ideal therapeutic agent in the management of HCC at earlier stage.

For cell cycle analysis, cells were plated at a density of 3 × 10 [5] per well in 6-well plate and transfected with either PCMV-let-7g overexpression plasmid or a blank vector control.

To elucidate the functional role of let-7g in HCC, eukaryotic expression vector harboring let-7g precursor sequence and control vector harboring scramble sequence of let-7g were transfected into two different kinds of HCC cell lines, MHCC97-H and HCCLM3, respectively.

it was shown that K-Ras and phosphorylated ERK1/2 (p-ERK1/2) were decreased in both MHCC97-H and HCCLM3 cell lines after reexpression of let-7g as compared with control group.

However, the proliferation in the group transfected with let-7g precursor plasmid was significantly suppressed as compared with the group transfected with scramble sequence of let-7g for MHCC97-H and HCCLM3 cell lines (Figure 3).

We found that reexpression of let-7g can substantially induce apoptosis rate as compared with control group where scramble sequence of let-7g was transfected, and cell cycles were significantly arrested at G1 stage.

Reexpression of Let-7g Induced Apoptosis and Cell Cycle Change of HCC Cell Lines.

Low Expression of Let-7g Was Significantly Associated with Prognosis.

Intratumoral injection with let-7g precursor plasmid at two-day interval was as experimental group.

Slides were hybridized with 20 nmol/L let-7g probe in a hybridization buffer for 2 h at 55°C then washed with SSC buffers.

In spite of the limitation of the results, our study indicates that let-7g could still be used as an ideal therapeutic agent in vivo in the earlier stage therapy of HCC.

Plasmid vector pCMV-let-7g harboring let-7g precursor and scramble sequence were purchased from OriGene (SC400010, OriGene, USA).

MHCC97-H and HCCLM3 cells were grown to 80–90% confluence in 6-well plates and were transfected with 4.0  μg of pCMV-let-7g or scramble control vector together with 10  μL Lipofectamine 2000 (Invitrogen, CA, USA) in Opti-MEM (Invitrogen, CA, USA) following the manufacturer's instruction (Invitrogen Life Technologies, CA, USA).

In the following, we have analyzed whether or not there were variations of cellular apoptosis and cell cycle after restoration of let-7g.

Among the 9 members of let-7 family, let-7g was reported to be significantly associated with metastasis of HCC and breast cancer [10, 11].

The reaction mixtures of let-7g and U6 were incubated at thermal cycling conditions comprised 95°C for 30 sec, and 40 cycles at 95°C for 5 sec followed by 56.5°C for 30 sec.

Our results suggest that let-7g could be used as an ideal therapeutic agent in vivo in the management of patients with earlier stage of HCC.

One week after implantation when the tumor became visually palpable at the size of 2 mm in diameter, intratumoral injection with 40  μg of let-7g precursor plasmid dissolved in 100  μL of DMEM mixed with 5  μL of Lipofectamine 2000 (Invitrogen) was done every two days.

Given the significant anti-proliferation effect of let-7g, we have developed the xenografted nude mice to evaluate the effect after reexpression of let-7g in vivo in the tumorigenesis of HCC.

Among these, we have identified that only let-7g was significantly correlated with HCC metastasis, which was highly consistent with result obtained by Zhao and colleagues that let-7g was found to be reduced and associated with metastasis of HCC [19].

To investigate the expression and localization of let-7g in patients with HCC, in situ hybridization (ISH) was performed.

Hence, let-7g was chosen as miRNA of interest in our following experiment.

The active effect of let-7g may be related to the drug infiltration and microenvironment change of the tumors [26].

We therefore hypothesized that the low let-7g may contribute to the high metastasis rate of HCC cells.

To test the hypothesis we proposed, we transfected the two different HCC cell lines, MHCC97-H and HCCLM3 with the similar metastatic ability, with let-7g precursor plasmid and control plasmid, respectively.

Thus, to better understand the potential mechanism of let-7g, we explored the variations of the several possible important protein markers that were reported to be involved in EMT process based on the evidence available [21, 22].

8

Let-7 Down-Regulation and HMGA2 Up-Regulation Are Associated with a Stem Cell Signature in Intestinal Cancers in Humans and Lin28b [Lo]/ Let7 [IEC- KO] MiceTo extrapolate relevance to human CRC from these mouse mo dels, we examined expression data from human samples from The Cancer Genome Atlas (TCGA) [35] by querying for expression of Let-7 target mRNAs, with a focus on targets that exhibited significant up-regulation in either Vil-Lin28b [Med] or Lin28b [Lo]/ Let7 [IEC- KO] mouse mo dels (namely, ARID3A, PLAGL2, HMGA1, HMGA2, MYCN, IGF2BP1, IGF2BP2, and E2F5).

To extrapolate relevance to human CRC from these mouse mo dels, we examined expression data from human samples from The Cancer Genome Atlas (TCGA) [35] by querying for expression of Let-7 target mRNAs, with a focus on targets that exhibited significant up-regulation in either Vil-Lin28b [Med] or Lin28b [Lo]/ Let7 [IEC- KO] mouse mo dels (namely, ARID3A, PLAGL2, HMGA1, HMGA2, MYCN, IGF2BP1, IGF2BP2, and E2F5).

The critical nature of maintaining sufficient levels of mature Let-7 miRNAs is reflected in the large number of studies that have found LIN28A or LIN28B up-regulated in human cancers, with expression often associated with an aggressive disease phenotype and/or predictive of poor outcomes [12– 15].

K) Comparison of stem cell marker expression and Let-7 target mRNA expression levels in WT jejunum, Lin28b [Lo] /Let7 [IEC- KO] jejunum, and Lin28b [Lo] /Let7 [IEC- KO] tumors by linear regression yielded Pearson correlation coefficients, with Arid3a, Hmga1, and Hmga2 correlating very highly with expression of stem cell markers.

For example, Let-7 regulates insulin-PI3K-mTOR signaling in muscle by inhibiting expression of INSR, IGF1R, and IRS2 [21], yet can also inhibit mTORC1 without affecting insulin-PI3K signaling [22], whereas we have observed no effects on insulin-PI3K-mTOR signaling following depletion of Let-7 miRNAs in the small intestine [18].

Expression analysis was performed by Q-RT-PCR, normalized to Hprt and Actb, with n = 3 mice for each genotype at 12 weeks of age with error bars representing +/–the S. E. M. D) Identification of conserved Let-7 target genes in ten of eleven Let-7 target genes based upon TargetScan.

For examination of Let-7 miRNA expression and expression relative to candidate target genes we examined a cohort of 199 CRC patients from the TCGA Pan-Cancer analysis project visualized using the starbase miRNA CLIP-seq portal (http://starbase.

Expression of all Let-7 targets also correlated significantly between Lin28b [Lo]/ Let7 [IEC- KO] and Vil-Lin28b [Med] intestine crypts, with Hmga2, Igf2bp2, Hif3a, Arid3a, and E2f5 being the most highly induced targets in both mo dels (Fig 2C).

Let-7 Down-Regulation and HMGA2 Up-Regulation Are Associated with a Stem Cell Signature in Intestinal Cancers in Humans and Lin28b [Lo]/ Let7 [IEC- KO] Mice.

Analysis of Let-7 target mRNAs revealed two basic patterns of expression, with one group displaying expression highest in intact tumors or tumoroids/enteroids (Fig 4F).

Many studies have focused on RAS and MYC as cancer-relevant Let-7 targets, although recent high-throughput sequencing (mRNA-seq, miRNA-seq, and CLIP-seq) and meta-analyses indicate that these mRNA targets are not frequently regulated by Let-7, especially in the context of cancer [5, 6, 20, 23].

Identification of Let-7 targets up-regulated specifically in transformed cells from intestinal adenocarcinomas.

Concurrent deletion of the MirLet7c-2/Mirlet7b bi-cistronic cluster is necessary as Lin28b is unable to effectively target and inhibit processing of these specific Let-7 miRNAs [18].

Onco-fetal Let-7 targets such as HMGA2 and IGF2BP1-3 appear to be more frequently up-regulated in multiple contexts, across multiple tissues, and in association with somatic stem cell potential [4, 5, 20, 24– 29].

Dissecting the interaction and possible cooperation of Let-7 target mRNAs is critical for designing strategies to ameliorate the loss of Let-7 in human cancers via combinatorial targeted therapies against multiple oncogenes.

A) Expression of Let-7 target mRNA levels in small intestine crypts isolated from wild-type (WT) and Vil-Lin28b [Med] mice.

1005408.g002 Fig 2A) Expression of Let-7 target mRNA levels in small intestine crypts isolated from wild-type (WT) and Vil-Lin28b [Med] mice.

B) Expression of Let-7 target mRNA levels in small intestine (jejunum) crypts isolated from wild-type (WT), Vil-Lin28b [Lo], Let7 [IEC- KO], Lin28b [Lo] /Let7 [+/-], and Lin28b [Lo] /Let7 [IEC- KO] mice.

Co -expression of Let-7 Targets HMGA2, ARID3A, IGF2BP2, PLAGL2, HMGA1, HIF3A, E2F5, NR6A1, MYCN, and DDX19A with stem cell markers (LGR5, EPHB2, ASCL2, MSI1, z-score threshold +/– = 1) in two human colon cancer datasets from TCGA (http://www.

However, the differences between Let-7 target mRNAs in each of these mo dels can be quite disparate; e. g. KRAS has a larger effect on tumorigenesis than does HMGA2 in a non-small cell lung cancer mo del [49], whereas HMGA2 appears to have a much larger role in other cancer mo dels [28, 50– 53], likely as a modifier of chromatin structure and gene expression [54– 57].

edu) comparing expression of Let-7 target mRNAs in normal tissue (N. T. ) vs.

While Let-7a and Let-7b depletion and increased expression of stem cell markers may appear to be a general feature of colon cancer, our discovery of a relationship between expression of Let-7 and stem cell markers suggests a functional connection.

To gain insight into the association of several Let-7 targets with tumorigenesis in vivo, we examined Hmga1, Hmga2, Arid3a, and Hif3a protein expression by immunostaining adenomas and adenocarcinomas, as well as adjacent normal tissue, from Lin28b [Lo] /Let7 [IEC- KO] mice.

S2 TableCo -expression of Let-7 Targets HMGA2, ARID3A, IGF2BP2, PLAGL2, HMGA1, HIF3A, E2F5, NR6A1, MYCN, and DDX19A with stem cell markers (LGR5, EPHB2, ASCL2, MSI1, z-score threshold +/– = 1) in two human colon cancer datasets from TCGA (http://www.

Since Let-7a and Let-7b appear to be the most highly expressed Let-7 miRNAs in normal colonic epithelium, and are significantly depleted in CRC specimens [20, 30] (S1A, S1B and S1C Fig), we examined these miRNAs in a subset of colon cancer specimens.

Let-7 miRNAs and Let-7 Target anti-correlation in CRC TCGA datasets.

In the mouse intestine we have achieved comprehensive depletion of all Let-7 miRNAs in this large multi-genic family through use of an inhibitory protein, called LIN28B, that specifically represses Let-7, and genetic inactivation of another gene cluster called MirLet7c-2/Mirlet7b.

We have achieved comprehensive depletion of all Let-7 miRNAs in the intestinal epithelium and demonstrated the critical nature of their cumulative tumor-suppressive properties.

A) Schematic of the intestine-specific deletion of the Mirlet7c-2/Mirlet7b floxed locus via Villin-Cre and expression of Lin28b with a Villin-Lin28b-ires-tdTomato transgene, which repress all 8 of the Let-7 clusters.

To assay exogenous expression of Let-7 targets in enteroids, we used a lentivirus vector for transduction of wild-type mouse small intestine enteroids (Fig 6D–6G).

Inverse relationships for Let-7 and target mRNAs could be discerned by plotting miRNA-seq data against mRNA-seq data for Let-7c vs.

1005408.g001 Fig 1A) Schematic of the intestine-specific deletion of the Mirlet7c-2/Mirlet7b floxed locus via Villin-Cre and expression of Lin28b with a Villin-Lin28b-ires-tdTomato transgene, which repress all 8 of the Let-7 clusters.

Nascent tumorigenesis beginning with aberrant crypt foci and/or microadenomas may occur spontaneously in our mouse mo del of Let-7 depletion, likely due to sporadic deregulation of Wnt signaling or potential spontaneous loss of other tumor suppressive mechanisms.

We focused on Hmga2, rather than Hmga1, as it is consistently up-regulated in non-malignant intestinal tissue from Vil-Lin28b [Med] and Lin28b [Lo]/ Let7 [IEC- KO] and thus appears highly dependent on Let-7 [18].

Vil-Lin28b [Med] mice express higher levels of Lin28b, have partially depleted Let-7 miRNAs and develop adenocarcinomas of the small intestine as do Lin28b [Lo] /Let7 [IEC- KO] mice but do not exhibit a phenotype as severe as Lin28b [Lo] /Let7 [IEC- KO] mice (18).

Let-7 miRNAs comprise one of the largest and most highly expressed families of miRNAs, possessing potent anti-carcinogenic properties in a variety of tissues [3].

To circumvent this obstacle and elucidate the mechanistic roles of Let-7 miRNAs in intestinal tumorigenesis in a genetic mouse mo del we have combined a Vil-Lin28b [Low] (Lin28b [Lo]) transgene with intestinal deletion of the MirLet7c-2/Mirlet7b bi-cistronic cluster (Let-7 [IEC- KO]) to achieve robust repression of all Let-7 miRNAs expressed in the intestinal epithelium.

In addition to our findings for HMGA2, IGF2BP1, and IGF2BP2, there is experimental evidence that HMGA1, E2F5, and ARID3A are also direct targets of Let-7 [6, 31, 32].

These compound Lin28b [Lo]/ Let7 [IEC- KO] mice, exhibit depletion of all Let-7 miRNAs specifically in intestinal epithelial cells (IEC) achieved through deletion of the MirLet7c-2/MirLet7b locus and repression of all other Let-7 miRNAs through inhibition by Lin28b [18] (and Fig 1A).

D-I) Scatter plots of Let-7 miRNA expression vs.

As documented in developmental programs in C. elegans and in human cancers, Let-7 miRNAs repress a stem cell phenotype and tumor-initiating phenotype [3], an association we observe here as well.

Comprehensive depletion of all Let-7 miRNAs leads to the development of intestinal adenocarcinomas.

All targets contained conserved Let-7 sites in the 3’UTR or coding sequence, except for Trim6, for which only the mouse mRNA possesses Let-7 sites (Fig 2D).

To examine a possible relationship between Let-7 target mRNAs and stem cell markers, we evaluated co -expression in mouse samples (from Fig 5I) and found that Hmga1 and Hmga2 had very high correlation with all of the markers we examined (Fig 5K).

Perhaps consistent with its association with a stem cell phenotype, HMGA2 is also frequently co-expressed with the stem cell markers MSI1 and LGR5 in human CRC, and notably, more frequently than any of the other Let-7 targets evaluated here in this study (Fig 5L and S2 Table).

Comprehensive Depletion of Let-7 miRNAs Leads to the Development of Intestinal Adenocarcinomas in Mice.

Let-7 biogenesis is tightly regulated, revealed by the discovery of several proteins that regulate processing by DGCR8/DROSHA in the nucleus, and by DICER1 cleavage in the cytoplasm.

We next pursued 3-D culture and manipulation of intestinal organoids (enteroids) to explore the relationship between Let-7 targets and a stem cell phenotype.

However, Let-7 action appears dependent on the particular mRNA targets affected, although Let-7 represses de-differentiation in multiple contexts.

We also observed significant elevation of mRNAs for these Let-7 targets in crypts from small intestine epithelia from Lin28b [Lo]/ Let7 [IEC- KO] (Fig 2B).

Lin28b [Lo] /Let7 [IEC- KO] mice reveals similar expression changes in each mo del of Let-7 depletion, with significant correlation (Pearson correlation shown).

Examination of Let-7 targets in these tumors and in tumoroid cultures suggest that HMGA2 is likely playing a major role in driving carcinogenesis following Let-7 depletion, a novel in vivo finding.

This activity is likely mediated via Let-7 repression of a multitude of onco-fetal mRNAs and other pro-proliferative and/or pro-metastatic targets, such as HMGA2, IGF2BP1, IGF2BP2, and NR6A1 [4– 6].

We have previously shown that crypt hyperplasia and Hmga2 expression is dependent on Let-7 depletion in crypts from Vil-Lin28b [Med] mice [18].

While HMGA2 is playing a key role, it is likely that the effects of Let-7 on an intestinal stem cell phenotype and epithelial tumorigenesis are dependent on the collective and/or cooperative role of multiple Let-7 targets.

To generate compound mutant animals we used a low -expressing transgenic line (Lin28b [Lo] ), in which we could not detect measureable changes in either protein or mRNA levels of Let-7-independent Lin28b targets [18].

We next examined Let-7 targets that might mediate programs of tumorigenesis in Lin28b [Lo]/ Let7 [IEC- KO] mice in the context of tumors and cellular transformation.

Identification of Relevant Let-7 Target mRNAs in the Intestinal Epithelium and Tumors.

These effects appear to be due to Let-7, although LIN28B can bind mRNAs and modulate protein levels of targets in the intestinal epithelium [18].

Let-7 targets were examined in small intestine crypts from Vil-Lin28b and Lin28b [Lo]/ Let7 [IEC- KO] mice.

C) Comparison of Let-7 target mRNA changes in small intestine crypts from Vil-Lin28b [Med] mice vs.

Quantification of Let-7 target mRNA levels in intestinal epithelium crypts.

Let-7 miRNA genes are shown as black hairpins while non-let-7 miRNA genes are depicted as gray hairpins.

Levels of HMGA1, HMGA2, PLAGL2, IGF2BP2, E2F5, and ARID3A transcripts were also inversely proportional to levels of Let-7 miRNA by examination of a cohort of 199 CRC patients from the TCGA Pan-Cancer analysis project [20] (Fig 5B–5E and S1D–S1I Fig).

LIN28B appears to act by sequestering primary-Let-7 (pri-Let-7) miRNAs within the nucleolus to prohibit processing by DGCR8 and DROSHA [9].

LIN28A works in concert with TRIM25 and TUT4 to mediate terminal uridylation and subsequent degradation of immature precursor-Let-7 (pre-Let-7) miRNA molecules [9– 11].

Quantification by Taqman RT-PCR confirmed that Let-7 miRNAs are severely repressed in tumoroid/enteroids and transformed tumoroid cysts (Fig 4D).

The exploration of Let-7-dependence through genetic manipulation in mouse mo dels is currently untenable due to the large number of miRNA clusters, with 12 Let-7 genes located at 8 separate clusters on 7 different chromosomes.

Supporting this hypothesis is the documentation that LIN28 proteins and Let-7 miRNAs do indeed affect proliferation, migration, and invasion in cell culture mo dels and xenografts of various malignancies [16, 17, 46– 49].

Most notable are LIN28A and LIN28B, which are RNA -binding proteins that directly bind to and block the processing of Let-7 mRNAs [7, 8].

D) Let-7 miRNAs are repressed consistently in tumoroid/enteroids (TE) and tumoroid cysts (TC).

Let-7 miRNAs were quantified using Taqman Q-RT-PCR kits (Life Technologies), according to the manufacturers instructions and normalized to U6 and SNO135 small RNA levels.

Large gene families, such as the Let-7 family, are difficult to silence or mutate because of the large amount of redundancy that exists between similar copies of the same gene; the mutation of one will often be masked or compensated by the continued function of others.

9

To test whether was a negative regulator of let-7 expression, we altered the expression of in different cell lines and monitored the expression of let-7. In MCF7 cells which express very low endogenous levels of, ectopic expression of decreased the expression of mature let-7c (Figure 5B ).

In addition, we also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. Further studies will be aimed at identifying the mechanism of promotion of p53 expression and its mechanism of negatively regulating let-7. In 2007, several groups identified the miR-34 family of miRNAs (miR-34a, b, and c) as a direct transcriptional target of the key tumor suppressor p53 [26]– [29], [36], [37].

However, neither the overexpression nor the inhibition of let-7 had any effect on the expression of p53 in HCT116 cells, nor did fusion of the p53 3′UTR to a luciferase gene show any suppression when let-7 was coexpressed in 293T cells (data not shown).

Downregulation of let-7 following chemotherapeutic treatment has been shown to increase stemness and tumorigenicity of breast cancer cells through regulation of multiple targets including the let-7 targets c-Myc, Ras, and HMGA2 [65].

In addition, we also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. Further studies will be aimed at identifying the mechanism of promotion of p53 expression and its mechanism of negatively regulating let-7. CSCs have gained much interest as a likely mechanistic explanation for cancer progression, tumor heterogeneity, emergence of aggressiveness, and drug resistance [16], [57], [58].

In addition, we also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. Further studies will be aimed at identifying the mechanism of promotion of p53 expression and its mechanism of negatively regulating let-7. All cells were maintained in a humidified incubator at 37°C with 5% CO [2].

Our data on the connection between p53 and let-7 are consistent with a recent report describing an inhibitory role for p53 in HCT116 cells in which let-7a and let-7b were suppressed upon upregulation of wt p53 induced by γ-irradiation.

Alternatively, the data do not exclude the possibility that regulates the expression of let-7. It has been noted that expression of is higher in let-7 low Type I cells, and is lower in Type II cells with higher let-7 expression [35].

While the lower expression of let-7 in the less differentiated cells was consistent with its function as a regulator of cellular differentiation, it was surprising that the difference in let-7 expression between the Type I and Type II cells that were sensitive to -mediated apoptosis was more significant (p<0.0005, see our previous report [15]) than the difference in let-7 expression between the Type I and Type II cells that were completely resistant to -mediated apoptosis (p>0.05, Figure 5A ).

Expression of let-7 is suppressed during embryogenesis and in ES cells but upregulated before birth and maintained at high levels during adulthood in most tissues [20].

Given our finding that expression inversely correlates with the expression of let-7 the possibility arose that changes in let-7 expression could regulate the amount of p53.

Alternatively, the data do not exclude the possibility that regulates the expression of let-7. It has been noted that expression of is higher in let-7 low Type I cells, and is lower in Type II cells with higher let-7 expression [35].

We also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. In studying -mediated apoptosis, our laboratory has made extensive use of a collection of 60 human cancer cell lines maintained by the National Cancer Institute's Developmental Therapeutics Program (NCI60).

While may directly affect stemness through regulation of stem cell regulator genes, our data suggest that this could occur through its regulation of let-7, which in turn affects the expression of stem cell genes (Figure 6 ).

We suggest that suppresses the stemness -inhibitory let-7 family, thereby predisposing cells to possible adverse outcomes to the loss of this crucial maintainer of cellular differentiation.

We therefore conclude that p53, at least in the tested cells, is not a target of let-7 suggesting that the effect of altered expression on p53 is independent of let-7. A confounding problem complicating our studies is the fact that many of the connections in the network were detected as low level tonic signaling.

Expression of mRNA was shown to decrease upon differentiation in a similar fashion as the validated let-7 target Lin28.

We therefore conclude that p53, at least in the tested cells, is not a target of let-7 suggesting that the effect of altered expression on p53 is independent of let-7. A confounding problem complicating our studies is the fact that many of the connections in the network were detected as low level tonic signaling.

We suggest that suppresses the stemness -inhibitory let-7 family, thereby predisposing cells to possible adverse outcomes arising from the loss of this crucial maintainer of cellular differentiation.

A component of the mo del is the negative feedback loop as described by Geng at al. [21] in which let-7 targets and decreases expression.

It appears that the mere presence of p53 or can affect expression levels of miRNAs, although stimulation through did not have a major effect on the expression of either let-7 or miR-34 (data not shown).

let-7 miRNAs are able to directly target mRNA causing its degradation and a functional desensitization to -mediated apoptosis [56].

The suggested mechanism for this inhibition involves direct binding of p53 to an enhancer in the promoter sequence shared by these two let-7 family members [55].

Numerous let-7 targets are directly involved in maintenance or induction of stemness.

A similar negative connection between and let-7 was also observed after knockdown of (using an shRNA targeting endogenous as previously described [10]) in CAKI-1 or HCT116 cells (Figure 5B ).

That (and p53) negatively correlates with expression of let-7 can be explained by a mo del in which both and p53 are part of a regulatory network.

This analysis suggested that miR-34a and let-7 inversely correlate with a p53 response which may directly affect the expression of.

The presence of affects the expression of let-7. Mo del of proposed regulatory network.

Thus, the mere presence of may affect let-7 expression.

We noticed that the p53 3′UTR contains a highly conserved seed match for let-7 (TargetScan 6.1) making this scenario a possibility.

While miR-34a was the miRNA that best correlated with the ability of cells to respond to activation of p53, the most significant correlation between p53 responsiveness and the expression of miRNAs was a negative correlation with the let-7 family of miRNAs.

Future studies are aimed at determining the mechanism of suppression of let-7 by p53 and.

A mo del for the role of the/let-7/p53/miR-34a regulatory network and its potential relevance in cancer stem cells.

In summary, we propose that is part of a novel regulatory network together with p53 and the miRNAs let-7 and miR-34a.

We have discovered a p53 regulated network that involves, miR-34a, and let-7. Every component of this novel network has crucial functions in the generation or maintenance of cancer stem cells (CSCs).

The let-7 family of miRNAs is a key regulator of embryogenesis and differentiation.

The let-7 miRNAs are possibly the best studied family of stemness regulating miRNAs.

Based on these data we now formulate a hypothesis that links all of these players,, p53, miR-34a, and let-7, in a regulatory network (Figure 6 ).

is a negative regulator of let-7..

Direct evidence of a negative feedback loop between let-7 and in multiple cancer cell lines has also been reported [21].

Such miRNAs include the let-7 [20], miR-200 [60], and miR-34 families of miRNAs [61]– [64].

All let-7 family members are highlighted in yellow and miR-34a in light blue.

Among the top ten miRNAs to most negatively correlate with p53 response status were 6 of the 9 distinguishable let-7 activities.

Interestingly, an inverse connection between let-7 and has been reported.

Similar data were obtained for other let-7 family members including let-7g and d (data not shown).

We recently identified let-7 as a significant marker for Type II cells [15].

miR-34a and let-7 are functional opposites of p53-responsiveness.

Let-7. p53 and miR-34.

Interestingly, Type II cells were more sensitive to apoptosis induction when treated with solubleL, and Type I cells were more sensitive when treated with the agonistic anti-CD95 antibody anti-APO-1. While let-7 was found to be a marker of differentiation in the NCI60 cells it did not correlate with the sensitivity of cells to -mediated apoptosis even though signaling through was different between the two differentiation stages [15], [22].

10

The targets of let-7 include oncogenes as well as genes frequently found upregulated in tumors (LIN28 itself is a target of let-7), therefore, let-7 may have tumor suppressive effects.

In fact, treating with #44 for 2 days followed by treatment withdrawal for 2 days completely reversed the effect of this compound on various let-7 target genes (Fig.   3D), suggesting that this compound transiently regulated expression of let-7 targets.

RT-PCR for HMGA2 showed that #44 could suppress expression of this let-7 target gene in as few as 8 hours (Fig.   3C).

The fact that 3 out of 5 let-7 targets were suppressed by #44 could suggest that let-7 activity is induced in these cells, and let-7 levels are altered depending on their endogenous expression levels.

Finally, we performed a pulse-chase of treatment with #44 to determine if the effect on let-7 targets was permanent or instigated a feed forward program of suppression of let-7 targets.

Finally, treatment of HUH cells with cAMP itself also led to a downregulation of HMGA2 (Fig.   5F), further suggesting that at least some let-7 target genes are regulated by cAMP signaling.

It is possible that by downregulating LIN28B and/or upregulating let-7 activity, cancer progression can be reversed.

To measure complete degree to which #44 could regulate gene expression in Huh cells, we carried out RNA-seq to identify which genes are changed in response to treatment with these compounds and whether let-7 targets are enriched amongst these gene expression changes (Fig.   5B).

Compounds found in the HTS to significantly stimulate or inhibit Renilla luciferase expression, suggesting let-7 activity regulation, were procured from the MSSR and plated at 10uM on Huh7.5.1 reporter line cells in 48-well.

In addition, we found that the Huh cell line expressed a number of let-7 targets that could be tightly regulated by changes in let-7 levels (Fig.   1C).

We chose this gene because it is expressed in several different isoforms, only one of which has more than one let-7 target site in its 3′ UTR.

Here we describe small molecule screening for compound that affect the expression of let-7 targets.

Figure 2A secondary screen to Identify compounds that suppresses let-7 targets.

#44 appeared to dramatically slow the growth of Huh cells at 1uM, the same dose used to effectively suppress let-7 targets (Fig.   6A).

Furthermore, let-7 activity is tightly controlled to ensure appropriate regulation of their target genes, and misregulation of let-7 is strongly associated with inappropriate growth of the liver [19].

Screening using expression of let-7 target genes.

Currently, the experimental approaches employed to modulate LIN28 activity includes RNAi or overexpression; whereas let-7 activity can be induced by transfection of let-7 mimics or suppressed by antagomirs [12].

Treating a AML cell line with #44 also showed a dose-responsive effect on those let-7 targets that are expressed (Fig.   3E).

In response to the downregulation of LIN28B, mature microRNA levels rose about 2 to 3 fold for all let-7 family members (Figure  S1D).

Perhaps as a consequence, treatment of AML cells significantly upregulated mature let-7 levels in MOLM-13, THP-1 and HL60 cell lines (Fig. 2E).

As an alternative method designed to minimize the identification of molecules that target luciferase, we transiently transfected replicate wells with a PSI-Check2 plasmid that either contained the let-7 seed sequence or a clean version that should not be regulated by let-7. We then quantified the signal change in the screen as a function of the effect on the luciferase without let-7 sites (Fig. S 1E and H), and as a function of internal controls on each reporter consisting of alternate luciferase gene (firefly) driven by a constitutive promoter.

Huh 7 transiently expressing let-7 luc and Psi-Check2 line cells in were grown in standard Huh media including: DMEM High Glucose (Invitrogen), 10% FBS (HyClone), 1% HEPES Buffer (Invitrogen), 1% NEAA (Invitrogen), 1% penicillin/streptomycin, 5ml L-Glutamine.

These let-7 family members of miRNA are known to regulate developmental timing and cell-fate decisions in less complex organisms 6, 7. let-7 family members have identical seed sequences and divergent stem-loop regions.

While this approach was useful to narrow the list of candidates, we found in subsequent experiments that many of the candidates passing this secondary screen either had small or highly variable activities on let-7 activity when judged by relative amounts of let-7 target genes (data not shown).

We posited that it should be possible to use small molecules to modulate levels of let-7 targets to influence differentiation or the progression of cancer [14].

We generated a stable let-7-luciferase reporter line (Huh7.5.1 L7L), which expresses far less luciferase mRNAs (and proteins) than transiently transfected cell lines.

The Renilla luciferase gene was driven by T7 promoter and contained eight let-7 targeting sequences in the 3′ UTR, and Firefly luciferase driven by a constitutive promoter as a transfection control.

Lin28B has been proposed to chaperone primary let-7 (pri-let-7) in the nucleolus and away from the processing machinery, thus inhibiting its maturation.

After eliminating false positive hits, several potential let-7 stimulators and inhibitors remained (Fig.   2A).

As expected, many of the false positive appeared to target luciferase enzymes, and not let-7 activity.

By quantifying the relative expression of the HMGA2 isoform with many let-7 sites versus all HMGA2 isoforms, we could identify specific activation of let-7 activity without the use of an exogenous reporter.

Generation of a Huh7 cell line stably expressing a let-7 activity reporter.

In short, the Renilla luciferase is flanked by 8 repeats of let-7 target sequence and therefore its mRNA will be subject to a higher rate of degradation in the presence of a higher let-7 activity.

To determine the general applicability of #44 to influence let-7 target expression, we measured the effect of this compound on various Acute Myeloid Leukemia (AML) cell lines each with well-characterized expression levels of let-7s and LIN28.

As let-7 miRNAs are highly expressed in Huh7 cells, endogenous changes of mature let-7miRNA levels are difficult to detect.

We proceeded to validate the top potential let-7 stimulators and potential let-7 inhibitors.

Our own data and that of many others has shown that the LIN28/ let-7 circuit can be exploited to regulate developmental progression in various murine and human tissues [11].

To identify candidate regulators of let-7 activity from the screen more directly, we performed a tertiary screen that measured levels of the let-7 target HMGA2.

Most AML cell lines do not express high levels of let-7 miRNA levels.

In the cytoplasm, Lin28A recruits the TUTase Zcchc11 to inhibit the maturation of precursor let-7 (pre-let-7) [5].

On the other hand, because let-7 activity is typically diminished in human tumors, any reagents that could block the induction of let-7 targets would potentially be important to the treatment of cancer.

Cancer cells have been show to exhibit reduced malignancy and motility when LIN28 is suppressed and let-7 activity is elevated [13].

This demonstrated that strong induction of let-7 levels by direct transfection was able to effectively silence the reporter (Fig.   1E).

We observed a high level of LIN28B expression at both the RNA and protein level (Fig. S 1B and C); and as a result, a low level of let-7 activity, as shown by let-7-luc luciferase assay (Figure  S1A).

The initial screens with the let-7 reporter stably introduced into Huh cells generated significant numbers of false positives in both directions.

As a result, we were able to screen for molecules that affected let-7 activity directly, after controlling for both luciferase and transfection efficiency (Fig.   1A).

Alternatively, a fluorescence -based reporter on let-7 activity should also be considered in future screening efforts to reduce false positives due to inhibition or stimulation of the luciferase enzyme itself.

Generation of a Huh7 cell line stably expressing a let-7 activity reporterWe and others have shown that let-7 activity can be precisely assayed using a luciferase -based method (PSI-Check2 let-7 8X, Fig.   1A).

Figure 1Design of screen to identify regulators of let-7 activity.

The High Throughput Screen (HTS) measures renilla luciferase expression as a function of let-7 activity in let-7 luc transfected Huh7 cells.

We have generated a cell -based mo del suitable for high throughput small molecule screening for let-7 activity modulators in 8 small molecule libraries.

siRNA against Lin28B and let-7 mimics were purchased from Dharmacon.

Figure 6Extended treatment of cancer cells with let-7 inducing compounds blocks their growth.

Compounds were added to individual wells of either Psi-check2 transfected Huh7 cells or Psi- let-7 transfected Huh7 cells.

Structural analysis revealed that these domains bind to the stem loop and the GGAG domains of let-7 precursors respectively, allowing specific interactions with various pre-let7 members 2, 3. Spatially, it has been suggested that Lin28B is localized in the nucleus and Lin28A resides mostly in the cytoplasm [4].

Huh7.5.1 was transfected with the selectable let-7 activity reporter using Lipofectamine 2000 (Life Technologies) according to manufacturer’s protocol.

Human liver cancer cell line (HUH) is transfected each with the let-7: Luciferase and PsiCheck2-control reporter plasmids.

Our own data show that cells carefully titrate let-7 activity to prevent cancer formation.

Positive controls were luciferase readouts of let-7 mimics, negative controls were luciferase signals from control treated cells.

The Amplicin-resistance cassette in psiCHECK2- let-7 8X was digested with BamHI and BglII (New England Biolabs) and the 5000 bp fragment containing the luciferase reporters (but no Amp [R]) was ligated with the linearized Pbabe Neo.

Therefore, when let-7 activity is increased, the renilla luminescence will be decreased.

Selectable let-7 activity reporter.

Indeed, loss of function of let-7 has been linked to cancer formation in murine mo dels [8].

Psicheck2 plasmid was manipulated to contain the let-7 seed sequence 8 times in tandem and linked to the renilla sequence.

siRNA and let-7 mimic transfection.

To demonstrate the dynamic range of detection in let-7 activity, we transfected this Huh7.5.1 let-7 luciferase reporter line (Huh7.5.1 L7L) with siRNA against LIN28B (Fig. S 1F), as well as let-7 mimics (Fig.   1D).

We cloned a Neomycin resistance cassette into the PSI-Check2 let-7-luciferase, and then stably introduced the reporter plasmid into the Huh7.5.1 cell line and selected with G418 for 3 weeks (Fig.   1B).

After 48 hour incubation, let-7-regulated Renilla luciferase and constitutively expressed Firefly luciferase were measured using Promega’s Dual-Luciferase Reporter Assay System and a GloMax 96 Microplate Luminometer (Promega).

Since this luciferase system reports for let-7 mediated degradation of the Renilla luciferase mRNA, it allowed a higher sensitivity for any reagents that can modestly change the let-7 activity.

Huh7.5.1 let-7 -luciferase line was transfected with Lipofectamine RNAiMax (Life Technologies) according to manufacturer’s protocol.

This was addressed by comparing the psiCHECK2- let-7 8 × luciferase reporter and the psiCHECK2 control luciferase reporter during the screening process to weed out false positive hits and prevent the loss of false negatives.

In addition, we used transfection of mimics of let-7s to determine how sensitive the reporter was to changes in let-7 levels (Fig.   1E and F).

11

Thus, γ, γ [1], γ [2] and γ [3], respectively, represents the coefficient of Lin28 expression inhibited by let-7, the coefficient of let-7 expression, the rate constant of let-7 expression, and the efficiency of let-7 expression inhibited by Lin28, after nondimensionalization.

κ [P] is the coefficient of Lin28 expression inhibited by let-7. Γ [1] is the coefficient of let-7 expression, Γ [2] is the rate constant of let-7 expression, and Γ [3] is a measure of the efficiency of let-7 expression inhibited by Lin28.

For example, miR-181 upregulates expression of let-7 by effectively repressing Lin28 expression, and eventually promoting megakaryocytic differentiation, thus providing insight into future development of miRNA-oriented therapeutics [33].

These findings may highlight why let-7 is required for normal gene expression in the context of cell development and oncogenesis, facilitating development of approaches to exploit the regulatory pathway by manipulating Lin28/let-7 axis for novel treatments of human diseases.

Our mo del of let-7 regulated by Lin28 may provide insights into understanding of how precise levels of let-7 are maintained in the context of cell development and oncogenesis, which would facilitate the development of approaches to exploit this regulatory pathway by manipulating Lin28/let-7 axis for novel treatments of human diseases.

let-7 is wi dely viewed as a tumor suppressor miRNA and its expression is downregulated in many cancer types compared to normal tissue during tumor progression.

We perturbed the inhibition of let-7 by Lin28 to study the contribution of the double negative feedback loop on the overall response curves of let-7. Firstly, we delete the Lin28 inhibition (γ [3] = 0) (Figure 4A), the results show that the absence of inhibition by Lin28 slightly change the S-shape of the let-7 response curve compared with γ [3] = 0.5, it pushes the off-state threshold of let-7 to the left on the diagram.

This suggests that the Lin28/let-7 pathway plays an important role in fine-tuning cellular processes of self-renewal and differentiation and Lin28A/B upregulation in some cases expression correlates with advanced tumor stage and poor prognosis [9].

Generally, the on-state of let-7 denotes early development where Lin28 is expressed at a very low level, the off-state represents other processes (e. g., cancer) where Lin28 is over-expressed.

Kim C. W. Vo M. T. Kim H. K. Lee H. H. Yoon N. A. Lee B. J. Min Y. J. Joo W. D. Cha H. J. Park J. W. Ectopic over -expression of tristetraprolin in human cancer cells promotes biogenesis of let-7 by down-regulation of Lin28 Nucleic Acids Res.

We perturbed the inhibition of let-7 by Lin28 to study the contribution of the double negative feedback loop on the overall response curves of let-7. Firstly, we delete the Lin28 inhibition (γ [3] = 0) (Figure 4A), the results show that the absence of inhibition by Lin28 slightly change the S-shape of the let-7 response curve compared with γ [3] = 0.5, it pushes the off-state threshold of let-7 to the left on the diagram.

By systematically analyzing the coarse grained mo del of let-7 biogenesis network in close association with plausible experimental parameters, we find that, in the presence of Lin28 inhibition, the system undergoes a transition from monostability to a bistability and then to a one-way switch as strength of positive feedback of let-7 increases, while in the absence of Lin28 inhibition, the system loses bistability.

It is well known that Lin28 can inhibit let-7 maturation and let-7 can inversely repress Lin28 expression.

α [M] denotes expression of let-7, α [P] describes the constitutive Lin28 expression due to signal transduction pathways activated by signals in the extracellular medium.

Interestingly, another recent study portrayed that lin28 mRNAs are themselves let-7 targets, their expression are repressed by let-7, thus promoting neural stem cell differentiation [16].

Figure 1 summarizes how the complex biogenesis network is coarse-grained to a mo del with two mutually inhibited components, which represent Lin28 and let-7. Unless otherwise noted, Lin28 is Lin28 protein; let-7 represents mature let-7. It is worth noting that, in the Lin28/let-7 feedback loop, we ignored the regulatory differences among members of Lin28 family (Lin28a and Lin28b) and members of let-7 family (let-7d, let-7f, let-7a, let-7b, let-7c, etc.

The presence of [Lin28] in the denominator accounts for the Lin28 -dependent down-regulation of let-7 biogenesis.

Thus we assume a Hill function (Γ 1 [l e t − 7 ] 2 Γ 2 + [l e t − 7 ] 2 + Γ 3 [L i n 28 ] ) that was used in the mo del of E2F/Myc/miR-17-92 feedback loops [26] to represent the auto-regulated mode of let-7, which is inhibited by Lin28.

At this critical threshold, the higher stable state of let-7 switches to the lower stable state (off-state), which is accompanied by the upregulation of Lin28.

Sakurai M. Miki Y. Masuda M. Hata S. Shibahara Y. Hirakawa H. Suzuki T. Sasano H. LIN28: A regulator of tumor-suppressing activity of let-7 microRNA in human breast cancer J. Steroid Biochem.

The trends of temporal expression profiles of let-7 in fluctuation cases are similar as those in the cases without fluctuation.

If the Lin28 inhibition (γ [3] = 0) were deleted, γ has no effect on let-7 response curves (Figure 5A–C), and the systems display only the one-way switch.

The higher stable state denotes the let-7 level in an on-state, in which increased let-7 levels reduce proliferation and lead to the decrease of several oncogene targets including Myc [36].

Note that, when we use “on” and “off” state, the level of let-7 (ψ [s]) or the coefficient of let-7 expression (γ [1]) used to correlate with entry into or exit from a certain state needs to be clearly specified.

Effects of Expression of Lin28 and let-7 on Switching Behavior.

Rybak A. Fuchs H. Hadian K. Smirnova L. Wulczyn E. A. Michel G. Nitsch R. Krappmann D. Wulczyn F. G. The let-7 target gene mouse lin-41 is a stem cell specific E3 ubiquitin ligase for the miRNA pathway protein Ago2 Nat.

This mo del prediction is consistent with observations in many normal and cancer (or differentiated) cells that expression levels of let-7 and Lin28 are reciprocal [3, 31, 32].

Therefore, our results suggest that deactivation of Lin28 in some cancer cells may greatly enhance the let-7 -dependent tumor suppression and improve the treatment efficiency.

It can be observed that the let-7 activity occupies a higher stable steady state until the inhibition of let-7 by high concentration of Lin28 reaches the limit point of stable and unstable steady states.

The other parameters ε = 0.02, γ [2] = 1. We note that ε = β [M] /β [P] represents the ratio of the degradation rates of let-7 and Lin28, α = α [M] /α [P] denotes the ratio of the expression rates of let-7 and Lin28.

let-7 activity presents discontinuous bistable behavior with respect to inhibition of Lin28 (Figure 2).

Hagan J. P. Piskounova E. Gregory R. I. Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells Nat.

Cimadamore F. Amador-Arjona A. Chen C. Huang C. T. Terskikh A. V. SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors Proc.

Despite concrete progress, a lot of mechanisms such as bistability and oscillations need to be further researched in a cellular system, which can help us to understand the crucial roles of let-7 in gene regulation and physiological functions.

Effects of Dual Negative Feedback Regulation of Lin28 and let-7 on Switching Behavior.

This Lin28/let-7 axis has been demonstrated to play central roles in cell differentiation and development [9].

According to this equation, the steady states of let-7 and Lin28 increase or decrease in the opposite direction.

Although this predicted result has not been validated by experimental methods, it might also be a desirable property for such a system because the Lin28/let-7 axis is central to maintaining proper cell fate and coordinating proliferation, growth, and energy utilization at the cellular level as well as growth, developmental timing, tissue homeostasis, and metabolism in whole organisms [9].

Precise regulation of let-7 by Lin28 is a rapidly growing field and it points to the importance of small RNA metabolism in disparate fields of mammalian biology [9].

Since it is one of the factors required for pluripotency of cells, let-7 involved in a regulatory feedback loop with Lin28 is essential for stem cell differentiation and maintenance [33, 34].

In addition, although gene regulatory processes including Lin28/let-7 axis are typically subject to considerable delays induced by the underlying biochemical reactions, the impacts of a time delay would probably not qualitatively change the results of a negative feedback loop [44, 45].

For let-7, transcription of the let-7 gene is positively regulated by let-7 and can therefore be considered to act as an auto-regulatory positive feedback loop.

let-7, an important member of the miRNA family, was originally identified in C. elegans and found to be conserved in controlling late temporal transitions during embryonic development across animal phylogeny [8].

Then, we increase the strength of inhibition by Lin28 (γ [3] = 1) (Figure 4C), it also maintains the S-shape of the let-7 response curve compared with γ [3] = 0.5, while it pushes the off-state threshold of let-7 to the right on the diagram (Figure 4C).

Finally, the dynamics of Lin28 and let-7 concentrations are respectively described by following Equations (1) and (2).

Figure 6Dynamic behaviors of let-7 in response to different ε and α.

Both dimensionless parameters determine the steady states of let-7 and Lin28, and affect the switch behavior.

Since half-life of let-7 after Tamoxifen (TAM) treatment is about 4 h [27], and half-life of Lin28 is about 1.5 h [28], thus ε is about 0.4. α is allowed to vary in the range of 0~0.4.

Implications of Lin28/let-7 Axis in Cancer Treatment.

β [P] and β [M] denote the degradation rates of Lin28 and let-7, respectively.

Li X. Zhang J. Gao L. McClellan S. Finan M. A. Butler T. W. Owen L. B. Piazza G. A. Xi Y. MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit Cell Death Differ.

For examples, increased biogenesis of let-7 in differentiated cells represses progenitor cell-specific mRNA to increase the fi delity of cell fate transition during differentiation [3, 34], while exogenous Lin28 rescued the neural precursors (NPCs) proliferation and some neurogenic deficits in the absence of SOX2 [34].

Figure 1Schematic illustration of the let-7 biogenesis network involving Lin28.

It functions in blocking the processing of let-7 at both pri- and pre-miRNA steps [13, 14], since Lin28 recruits terminal uridylyl transferase-4 (TUT4) to add uracil to the 3' end of pre-let-7, thereby resulting in blockade of let-7 maturation [15].

Although mRNAs are generally less stable than many proteins, this is not the case for miRNAs, which are up to 10 times more stable than mRNA [37], for example, let-7 [37] is more stable than Lin28 [38].

Besides, the threshold that makes bistability of let-7 switch to monostability is also increased (Figure 4D).

In (A) and (B), γ [3] = 0, γ = 0.1, ε = 0.02, γ [2] = 1; in (C) and (D), γ [3] = 1, γ = 0.1, ε = 0.02, γ [2] = 1. In addition, we investigate the effects of let-7 inhibitory strength (γ) on switching behavior.

These findings imply that a double -negative feedback loop is established between let-7 and Lin28 during cell differentiation (Figure 1A).

Increasing value of ε would enhance the amplitude of let-7 fluctuation, suggesting that large ε value decreases the stability to resist stimulus fluctuations.

Figure 2The dimensionless let-7 concentration ψ [s] as a function of α under steady state conditions.

From the figure, we find that as the value of ε increases, let-7 undergoes a faster transition from off to on state.

Therefore, for convenience, we assign the lower/higher let-7 concentration as the off/on state.

This result suggests that the posttranscriptional modification of Lin28 activity during let-7 biogenesis and the interruption of Lin28/let-7 axis may play a central role in carcinogenesis.

This suggests that very high level of let-7 may interrupt the Lin28/let-7 feedback circuit, and disables the cell to maintain and transmit its state.

This established the Lin28/let-7 axis which is highly conserved across the animal kingdom and nematode worms and operates as a switch function to maintain either a differentiated or an embryonic cell fate [9].

Rybak A. Fuchs H. Smirnova L. Brandt C. Pohl E. E. Nitsch R. Wulczyn F. G. A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment Nat.

We provide the dynamic behaviors of let-7 in response to environment fluctuation described by Gaussian white noise with mean α = 0.2 and variance 0.05 (Figure 6B).

Since module let-7 with a positive feedback loop can create switching behavior, it has two possible stable states in the appropriate parameter regime.

When γ [1] ≥ 2.48 in Figure 3A (e. g., γ [1] = 3, 4), a portion of the S-shaped response curve of let-7 is pushed onto the negative regime of the diagram therefore the off-state threshold of let-7 is a negative number.

Effects of the Positive Feedback of let-7 on Switching Behavior.

Therefore the regime of γ [1] is enlarged to keep the bistability of let-7. For instance, when 2.48 ≤ γ [1] < 2.87, the system still has bistable switching behavior (Figure 4C).

In (A) and (B), γ [3] = 0, γ = 0.1, ε = 0.02, γ [2] = 1; in (C) and (D), γ [3] = 1, γ = 0.1, ε = 0.02, γ [2] = 1. In addition, we investigate the effects of let-7 inhibitory strength (γ) on switching behavior.

The value of the parameter Γ3 is a measure of the efficiency of Lin28 inhibition of let-7 biogenesis, and it combines all factors that influence Lin28 to block the biogenesis of let-7. For Lin28, the efficiency of Lin28 mRNA degradation is associated with the binding of the let-7. Thus we assume a term β P [L i n 28 ] [l e t − 7 ] [l e t − 7 ] + κ P for describing degradation of Lin28.

Due to its functional importance, major progress has been made in understanding the basic mechanism of let-7 biogenesis.

The dynamic behaviors of let-7 in response to ε = 0.1 and 0.375 are illustrated in Figure 6A.

As the α decreases, the activity of let-7 moves toward the left of the bifurcation diagram along the upper stable state and remains in an on-state when α equals to zero.

Moreover, the ratio of degradation rates of let-7 and Lin28 is critical for the switching sensitivity and resistance to stimulus fluctuations.

12

More accurately, Lin28 down -expression could inhibit insulin sensitivity mostly by suppressing the let-7 targets Insr, IGF1r, Irs2, Akt2, and Rictor, and also in part by directly reducing the ribosomal translation of mRNAs encoding IGF2 and mitochondrial OxPhos enzymes.

Interestingly, Lin28A and Lin28B mRNAs themselves have potential let-7 complementary sites (3′UTR of Lin28) and serve as let-7 targets, making let-7 regulate Lin28 expression by cleaving Lin28 mRNAs or inhibiting translation of Lin28 mRNAs [6, 20– 25].

Additionally, the let-7 target genes, such as c-MYC [26] and CDC25A [23], could regulate their downstream Lin28 via translational repression, making let-7 an indirect inhibitor of Lin28.

For instance, high Lin28A expressing exosomes could induce EMT-related gene expression and promote non-metastatic target cells to migrate and invade [108], Lin28 suppressor let-7 could activate autophagy by repressing the mTOR signaling pathway [109], human induced pluripotent stem cells (iPSCs) generated by Lin28 could spontaneously differentiate into polarized retinal pigmented epithelium [110].

For example, Cai et al. have reported that Lin28 upregulation and let-7 posttranscriptional downregulation were identified in the Wnt-β-catenin pathway-stimulated breast CSCs phenotype, while loss of function of Lin28 impaired Wnt-β-catenin-pathway -mediated let-7 inhibition and breast cancer stem cell expansion [80].

The response then led to Lin28-regulated expression of the anti-inflammatory cytokine interleukin-6 (IL-6) via inhibiting let-7 expression, thus revealing a new mechanism containing cancer cells and immune molecules [75, 76].

Lin28 downexpression could inhibit insulin sensitivity mostly by regulating the let-7 targets Insr, Igf1r, Irs2, Akt2, and Rictor.

Lin28 regulated the expression of the anti-inflammatory cytokine interleukin-6 (IL-6) via inhibiting let-7 or depending on hnRNP A1 expression.

The majority of studies revealed that most of let-7 family members were down-regulated in breast cancer samples with either lymph node metastasis or higher proliferation index versus normal tissues [85– 88], while one study showing up-regulation of let-7b [89].

They also found that let-7 inhibited IL-6 expression both directly through its 3′UTR and indirectly by interacting with RAS to reduce the NF-κB activity.

Recent advanced studies also have revealed that long non-coding RNA H19 acts as a sponge to antagonize let-7. For example, the ability of let-7 to repress the expression of an array of metastasis-promoting genes is compromised when H19 expression is high, leading to decreased bio-availability of let-7, increased expression of c-Myc, Hmga2 and Imp3, and activation of cell migration and invasion [107], thus prompting us to study the relationship among H19, let-7 and Lin28 during carcinogenesis.

The let-7 family of microRNA (miRNA), which was also firstly discovered in Caenorhabditis elegans [8], has been reported to be a key suppressive target of Lin28, and serves as a potent tumor suppressor via post-transcriptional repression of multiple oncogenic messenger RNA (mRNA) [9].

Since the impact of Lin28/let-7 axis on radio-sensitivity has been confirmed in vitro, increasing evidence has shown that down -expression of Lin28 and over -expression of let-7 could decrease the expression of RAS oncogene and genes associated with DNA like RAD51, RAD21, FANCD2 and CDC25, eventually radiosensitizing the cancer cells [57– 59].

More specifically, the results support a mo del in which RKIP suppresses Raf-1/MEK/ERK activity, leading to the inhibition of Lin28 and induction of let-7, finally blocking the induction of Snail transcription and other genes involved in tumor cell invasion and metastatic colonization.

Many studies focusing on proliferative signaling in cancers suggest that Lin28 functions as an oncogene by repressing let-7, leading to the dysregulation of multiple genes regulated directly or indirectly by let-7, including MYC, Hmga2, and components of PI3K-mTOR pathway [43– 46].

Besides, Chen et al. demonstrated that the C allele of rs3811463, a SNP that located near the let-7 binding-site of Lin28, could weaken the suppression of Lin28 by let-7, which means an increasing level in Lin28 expression along with a reduction of let-7 level, elevating the risk of breast cancer [40].

As for clinical researches, apart from cases for let-7 as the classical suppressor [98], other studies have suggested that let-7 does not function as a tumor suppressor under all circumstances [99– 101].

Zhang et al. found that induction of Lin28 over -expressing mouse ESCs compromised basal and maximal oxygen consumption rate (OCR), but that levels of let-7 did not change from their already suppressed levels [66].

In the aspect of cell cycle, Li et al. have demonstrated that Lin28 promotes proliferation of tumor cells through regulating the G0/G1 transition in cell cycle, namely, increasing the expression of Cyclin D1/D2, CDC25A, CDK34, CDK6, as well as other cell cycle-related factors by depressing let-7 [42].

According to Figure S4 in their study, authors not only verified that let-7 mimic in Lin28 -overexpressing cells could not reverse the reduced OCR, but also knockdowned Lin28 in Dgcr8 [−/−] ESCs (scant quantities of let-7) to exclude other possibly let-7-related microRNAs function.

As for other inflammatory mechanisms, Yang et al. have reported that breast cancer cells lacking Lin28 could increase levels of anti-inflammatory cytokines, and that the regulation of the major cytokine genes is dependent on the expression of hnRNP A1, suggesting a mechanism independent of let-7 [65].

Taken together, regulation of let-7 expression is controlled by Lin28 proteins through the post-transcriptional blockade of let-7 biogenesis.

X pathway while over -expression of let-7 enhanced the sensitivity to radiation [55].

Segalla et al. reported that the ribonuclease DIS3 could promote let-7 maturation and inhibit Lin28B mRNA levels through recognition of AU-rich elements in the 3′UTR [106].

Lin28B sequesters primary let-7 transcripts and inhibits their processing by the Microprocessor [18], while Lin28A recruits TUTase4 to induce oligo-uridylation of pre-let-7, which blocks DICER processing and facilitates degradation of the RNAs [11– 13].

In fact, Lin28 can regulate multiple tumor -associated progressions in let-7 independent way, including proliferation, chemo-resistance, metabolism, inflammation, stemness and cell development (Figure 3).

Lin28 can regulate multiple tumor -associated progressions without let-7, but with proliferation (CyclinA/B/D, CDK1/2/4/6, miR-125b), chemoresistance (pRb, p21, Bcl-xL, miR-107), metabolism (IGF2, Oxidative enzymes), inflammation (hnRNP A1), stemness (OCT4, miR-200), cell development (Hbl-1, Lin4/14, miR-48/84/241) related proteins and RNAs.

It is worth mentioning that Jolly et al. discovered that independent of let-7, Lin28 was strongly inhibited by miR-200 which pushed epithelial end towards mesenchymal end of CSCs, thus allowing mesenchymal phenotype cells to gain stemness [83] (Table 1).

Lin28 also could activate or inhibit other miRNAs besides the let-7 family.

Furthermore, studies revealed that Lin28A and Lin28B inhibited let-7 biogenesis by distinct mechanisms.

Figure 3 Lin28 can regulate multiple tumor -associated progressions without let-7, but with proliferation (CyclinA/B/D, CDK1/2/4/6, miR-125b), chemoresistance (pRb, p21, Bcl-xL, miR-107), metabolism (IGF2, Oxidative enzymes), inflammation (hnRNP A1), stemness (OCT4, miR-200), cell development (Hbl-1, Lin4/14, miR-48/84/241) related proteins and RNAs.

The association of let-7 with pathogenesis of breast cancer is supported by studies examining let-7 expression in breast cancer cell lines and clinical samples (Table 2).

The canonical targets of Lin28, let-7 family members, have been most notably implicated in cancer [84].

Another study indicated that Lin28 used two different TUTases to control let-7 expression and had important implications for stem cell biology as well as cancer [19].

Therefore, Lin28/let-7 axis establishes a double -negative feedback loop whereby either let-7 or Lin28 is expressed at high levels, promoting physiological or pathological conditions, respectively (Figure 2).

Lin28 decreased chemosensitivity via inhibiting miRNA-107, let-7, Rb, p21 and Bcl-xL.

The expression of let-7 in breast cancer.

Additionally, except for researches that Lin28/let-7 loop is involved in ten hallmarks of cancer [117], the aberrant loop also regulates cellular senescence and has connection with various oncogenes and signaling pathways, including MYC, RAS, MAPK signaling and PI3K/AKT signaling [118].

The GGAG sequences in the terminal loop of let-7 precursors serve as the binding sites for the zinc finger domains critical for let-7 regulation [14].

Lin28 homologs (Lin28A and Lin28B) are small (< 30kDa) proteins which can block the processing of let-7 family members by binding to the terminal loop of the let-7 precursor (pre-let-7) hairpin via a CSD and two retroviral-like CHCC zinc-finger knuckles [11– 13].

Orange refers to factors of let-7 -dependent way, blue refers to factors of let-7-independent way, gray means factors involved in both mechanisms.

As for let-7 independent way, Cho et al. mapped the Lin28A binding sites on the genomic scale by RNA crosslinking-immunoprecipitation-sequencing (CLIP-seq) technology and ribosome footprinting.

Other researchers also have found that Lin28 -induced chemotherapy resistance is associated with let-7, Rb, p21 and Bcl-xL, thus unraveling complicated relationship between Lin28 and tumor resistance [61, 62].

Figure 2 A primary let-7 (pri-let-7) transcript produced by let-7 gene is processed by the Drosha DGCR8 microprocessor in the nucleus.

Figure 4 Lin28 exerts its critical role in breast cancer through two distinct ways: let-7 dependent and let-7 independent.

A primary let-7 (pri-let-7) transcript produced by let-7 gene is processed by the Drosha DGCR8 microprocessor in the nucleus.

Lin28′s let-7-independent functionality.

Subsequent reports have demonstrated that Lin28 blocks the processing of let-7 at primary, precursor, and mature forms of let-7 family members, as Microprocessor complexes (DGCR8 and Drosha) and DICER complexes cannot associate with Lin28-bound let-7 [15– 17].

Then the generated precursor let-7 (pre-let-7) is transported to the cytosol and further processed by the Dicer and Argonaute proteins (AGO) to generate the mature let-7. The biogenesis of pri-let-7 is blocked by Lin28A in the nucleus and Lin28B in the nucleolus, the biogenesis of pre-let-7 and mature let-7 are blocked by Lin28A/B in the cytosol, and the mature let-7 can in turn block the biogenesis of Lin28A/B.

Mechanistically, Lin28 is involved in various pathological processes of cancers via let-7 dependent and let-7 independent pathways [3].

Epithelial-to-mesenchymal transition (EMT) is known to accelerate tissue remo deling from epithelial phenotype to mesenchymal phenotype, and Lin28/let-7 axis is also a prerequisite for the process of EMT among some cases [51].

[77– 83] Lin28 exerts its critical role in breast cancer through two distinct ways: let-7 dependent and let-7 independent.

Other studies also found that gain or loss of function of let-7 in wild-type cells did not change OCR, suggesting that Lin28 reduced OCR through several let-7-independent mechanisms [67].

Studies in the past decade have shown that the Lin28/let-7 axis plays a significant role in stem cell renewal [79].

It is therefore appropriate to assign the critical functions of Lin28 to one of two classifications: let-7 dependent and let-7 independent.

Lin28′s let-7 -dependent functionality.

Taken together, these evidences support the hypothesis of Lin28/let-7 axis contributing to the anti-angiogenesis effects of the breast cancer [48].

Subsequently, several functional studies have reported novel mechanisms of let-7 in breast cancer cells [90– 97].

13

Our comparison of the ability of hbl-1- and lin-41-knockdown to suppress a let-7 null mutation reveals that lin-41 has a more significant role downstream of let-7. Therefore, we propose that hbl-1 is the most proximal regulator of L2 fates, being regulated by the three let-7 paralogs, and lin-41 is let-7's target for controlling later events (Figure 5).

First, because LIN-28 protein is down-regulated by the L3, we must consider the time of let-7 expression.

The ain-1 mutation did substantially suppress the precocious adult alae phenotype of a lin-28 mutant, as if let-7 was fully active, demonstrating that the ain-1 mutation was able to reduce although not eliminate microRNA function in seam cell development (Table 2, line 11).

We observed that the two let-7 target genes differed in their abilities to suppress this phenotype: penetrance of let-7's retarded defect was reduced from 100% to 80% by hbl-1(RNAi), whereas it was reduced to 6% by lin-41(RNAi) (Table 4).

We established stable lines carrying each construct and found that those with the chimeric pre-let-7 expressed higher mature let-7 in early larval development than those with the wildtype pre-let-7 (Table S5).

We observed that let-7 was up-regulated 42-fold in the absence of lin-28, and that no other microRNA was affected more than 1.5-fold (Table S3).

The serendipitous discovery that mammalian LIN28 binds to and inhibits let-7 precursor processing [26], and the subsequent proof that this mechanism is evolutionarily conserved in C. elegans [29], [31], caused us to consider what their molecular interaction means for the regulation of cell fate succession in C. elegans.

Given the redundancy of the three let-7 paralogs mir-48, mir-84, and mir-241 in regulating L2 fates, two alternatives seem likely: either lin-28 inhibits the accumulation of multiple let-7 family members, including these three let-7s known to control the L2-to-L3 transition, or let-7 is at least partially redundant with its relatives in controlling this early fate transition.

Therefore, the inhibition of mature let-7 accumulation is likely the means by which lin-28 governs seam cell development after the L2.

Its inhibition of let-7 microRNA processing is a novel form of gene regulation and offers a molecular explanation for how lin-28 controls cell fate succession in C. elegans.

LIN-14, LIN-28, HBL-1 and LIN-41 are expressed at the start of larval development and are eventually repressed by the microRNAs lin-4, let-7 and the three let-7 family members miR-48, miR-84, and miR-241 (3 let-7s).

This observation indicates that lin-28 is a positive regulator of hbl-1 expression that acts independently of the let-7 relatives.

Curr Opin Genet Dev 6 Abbott AL Alvarez-Saavedra E Miska EA Lau NC Bartel DP 2005 The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans.

In other words, to explain the relevance of let-7 to lin-28 function, we hypothesized that lin-28 acts in two mechanistically independent steps: first to control early fates and second to control later fates via direct action on pre-let-7. Ambros and Horvitz documented that some seam cell lineages in lin-28 null mutants display precocious development that skips two larval stages [1], [55].

Thus we could construct a version of let-7 that encoded the loop sequence of Drosophila pre-let-7 and thereby was insensitive to LIN-28's inhibitory activity.

Thus, a parsimonious explanation for lin-28's inhibition of let-7 in C. elegans is that it constitutes the second of two activities.

hbl-1 has been shown to be the primary target of let-7's relatives mir-48, mir-84; and mir-241 [6].

The let-7 family microRNAs have two known targets in the heterochronic pathway: hbl-1 and lin-41.

Histograms depicting the temporal expression profiles of (A) let-7, (B) miR-84, (C) miR-48 and (D) miR-241 levels in wild type (grey bars) and lin-28(n719) (blue bars).

Therefore, because lin-28 regulates no other microRNA in the same manner it regulates let-7, we conclude that it possesses a different molecular activity to control L2 cell fates.

1002588.g001 Figure 1Histograms depicting the temporal expression profiles of (A) let-7, (B) miR-84, (C) miR-48 and (D) miR-241 levels in wild type (grey bars) and lin-28(n719) (blue bars).

Given that the premature accumulation of mature let-7 does not account for lin-28's precocious phenotype, why then does LIN-28 inhibit let-7?

The Relative Roles of hbl-1 and lin-41 The let-7 family microRNAs have two known targets in the heterochronic pathway: hbl-1 and lin-41.

In other words, to explain the relevance of let-7 to lin-28 function, we hypothesized that lin-28 acts in two mechanistically independent steps: first to control early fates and second to control later fates via direct action on pre-let-7. Ambros and Horvitz documented that some seam cell lineages in lin-28 null mutants display precocious development that skips two larval stages [1], [55].

Early reports showed mature let-7 rising in the L4 stage, however as microRNA detection methods have improved, expression of mature let-7 could be seen a full stage earlier [6], [49].

Considering the long evolutionary association of lin-28 and let-7 with cell fate succession in diverse contexts, we propose that having two sequential, mechanistically distinct activities is critical to lin-28's role in governing successive developmental transitions.

lin-28 Has Two Separable ActivitiesWe were surprised that despite the evolutionary conservation of lin-28's ability to block let-7 accumulation, this activity is not required for its primary effect on C. elegans larval development, namely the normal execution of L2 cell fates.

Our results show, however, that lin-28 does not act via any of these let-7 family members in its primary role in C. elegans development.

lin-28 Acts Independently of let-7 MicroRNAs to Control Cell FatesTo test whether let-7 family microRNAs are required for lin-28's developmental activity, we examined mutants lacking both lin-28 and let-7 family members.

let-7 Controls L4 Development.

These observations suggest that let-7 acts primarily through lin-41 to regulate seam cell differentiation.

To test whether let-7 microRNAs indeed mediate lin-28's developmental function we first examined its ability to interact with precursor forms of let-7 relatives.

Thus we propose that let-7 (and possibly other regulators believed to control the L4-to-adult transition such as lin-41) act earlier than previously thought.

To test whether let-7 family microRNAs are required for lin-28's developmental activity, we examined mutants lacking both lin-28 and let-7 family members.

Thus, it is LIN-28's direct action on pre-let-7 that exerts influence on those later events via lin-41.

We were surprised that despite the evolutionary conservation of lin-28's ability to block let-7 accumulation, this activity is not required for its primary effect on C. elegans larval development, namely the normal execution of L2 cell fates.

To construct mir-48 mir241; mir-84 let-7 quadruple mutants, animals of the genotype mir-48 mir-241; mir-84 unc-3 let-7/+ were cultured on hbl-1(low RNAi) (see below) to suppress the lethality characteristic of these mutations.

Therefore, one possibility is that let-7 mutants reiterate L3 developmental events in the L4 stage.

Similarly, lin-28 first determines what events occur in the L2, then by its positive regulation of lin-41 via let-7, influences events of the L3.

Vertebrate homologs of several heterochronic genes, including lin-28, lin-41, and let-7, have developmental roles in a variety of contexts [11]– [16].

4Strains carrying the let-7 mutation additionally contained a linked unc-3 mutant allele.

let-7 Controls L4 Development let-7 is thought to act during the L4 stage to cause the L4-to-adult transition, including the terminal differentiation of seam cells [2].

A let-7 null mutant causes retarded development by reiterating larval fates and delaying differentiation [2].

lin-28 and let-7 had been thought to act at wi dely separated times in C. elegans larval development, with lin-28 controlling an early, proliferative fate of seam cells and let-7 controlling their terminal differentiation two larval stages later [3], [58].

The LIN-28 protein is known to bind to and block the maturation of the small RNA encoded by let-7. This mechanism would seem to explain lin-28's role in development.

It remains possible that other let-7 family members mediate lin-28's control of L2 fates, however, the LIN-28 protein interacts with none these (Table 1), and no microRNAs other than let-7 itself are dysregulated in a lin-28 null mutant (Table S3).

let-7 is thought to act during the L4 stage to cause the L4-to-adult transition, including the terminal differentiation of seam cells [2].

To analyze the V5 cell-lineage in let-7 mutant males, wIs78; him-5(e1467) males were crossed to wIs78; mnDp1(X:V)/+;unc-3(e151) let-7(mn112) X hermaphrodites and Unc males among the cross progeny were examined for V5 seam cell divisions.

E, a hbl-1::GFP::unc-54 3′UTR reporter in lin-28; mir-48 mir-241; let-7 mir-84 (lin-28; 4 let-7s).

Earlier studies of the C. elegans heterochronic pathway had not addressed the issue of whether lin-28 requires let-7 microRNAs for its function [2], [29], [39].

Furthermore, changes in let-7 levels do not fully account for Lin28's activity in this system.

C. elegans LIN-28 protein interacted with pre-let-7, pre-miR-48, pre-miR-84 and pre-miR-241, but not with the other let-7 family pre-microRNA sequences (Table 1; Figure S1).

However, this strain did not make precocious adult alae (Table 2, line 8), indicating that let-7 is required by lin-28 after the L2.

A modified version of this sequence was made by replacing the C. elegans pre-microRNA loop sequence with that of Drosophila let-7 (see Table S1).

Two of these genes, lin-28 and let-7, are evolutionarily conserved in animals where they have roles in pluripotency and differentiation.

The three let-7 family members mir-48, mir-84, and mir-241 act redundantly to control seam cell fates: when they are deleted together, the L2-specific symmetric cell division is reiterated, resulting in supernumerary seam cells [6].

1002588.g004 Figure 4Nomarski images of wild type (A) and let-7 null (B) L4 males approximately 8 hours after the L3 molt.

However, another possibility is that let-7 acts earlier together with its relatives in a previously unrecognized role, which would explain lin-28's action upon it.

A 2.5 kb let-7 genomic sequence identical to the rescuing fragment used previously [2] was cloned into pCR2.1-TOPO (Invitrogen).

We surmised that lin-28 might act on a microRNA unrelated to let-7 to control L2 events.

We and others have observed that let-7 accumulates in the L3 stage in wild type, a stage earlier than originally reported (Figure 1) [2], [6], [48], [49].

lin-28 Represses the Accumulation of let-7 in the L1 and L2.

We examined let-7 null mutant animals in the L4 stage to see whether any defects had already occurred by this time.

LIN-28 Protein Binds a Subset of let-7 Family Precursor RNAs.

We constructed a strain lacking all four genes and assessed its seam cell phenotypes: we observed that animals lacking all four let-7 family members had the same seam cell number as those lacking only three (Table 2, lines 5 and 7).

D, lin-28; mir-48 mir-241; let-7 mir-84 (lin-28; 4 let-7s).

Relative contribution of hbl-1 and lin-41 for the let-7 retarded phenotype.

let-7 itself has been believed to act much later in the heterochronic pathway, at the L4-to-adult transition.

By finding that C. elegans lin-28 has two distinct activities, we surmise that the split phenotype in mammalian neurogenesis is a consequence of a similar two-step mechanism involving let-7 -dependent and let-7-independent activities.

None of the previous data concerning let-7's role in seam cells decides whether it acts to control the L3-to-L4 transition or the L4-to-adult transition.

Animals receiving either transgene had an average of 16 seam cells at the L4 stage, indicating no change in the early cell fate decision (wildtype let-7, n = 47; chimeric let-7, n = 51).

lin-28 mutants can be two stages precocious due to let-7 activity.

The male tail tip morphogenesis is delayed in let-7 males.

The binding of mammalian LIN-28 to pre-let-7 leads to the degradation of the precursor and eventual loss of mature let-7 [27]– [32].

Second, although it is impossible at present to distinguish between L3 seam cell fates and L4 seam cell fates, we must reconsider the time of let-7's activity.

Thus, LIN-28 can specifically recognize the precursors of the four let-7 family members already known to function in the heterochronic pathway.

Seven C. elegans microRNAs—let-7, miR-48, miR-84, miR-241, miR-793, miR-794, and miR-795—belong to the let-7 family based on 5′-end sequence identity of the mature microRNAs [41]– [43].

To determine whether C. elegans lin-28 prevents the developmental accumulation of the let-7 family microRNAs, quantitative RT-PCR assays were performed on wildtype and lin-28 mutant larvae.

The absence of lin-28 caused substantial premature accumulation of let-7 in both the L1 and L2 stages, higher than its peak at the L4 molt in wild type (Figure 1A, blue bars).

Significantly, Abbott and colleagues discovered that three let-7 relatives—miR-48, miR-84 and miR-241—function redundantly to repress the transcription factor gene hbl-1 and cause the succession of L2 to L3 cell fates [6].

As previously reported [2], [6], [48], [49], mature let-7 was very low or undetectable in wildtype larvae at the L1 and L2 molts, accumulated during the L3 stage, and reached its peak by L4 (Figure 1A, grey bars).

Thus loss of let-7 might actually cause the reiteration of L3 fates, the consequence of which would be problems in the L4.

We observed a cell division in the V5 lineage that normally occurs during the L3 lethargus to be reiterated at the end of the L4 stage: 100% of animals showed a V5 lineage division in let-7 males recurring 12–13 hours after the L3 molt, in the late L4 (n = 10).

lin-28 Acts Independently of let-7 MicroRNAs to Control Cell Fates.

Importantly, only let-7 levels were altered at the L1 lethargus, the period immediately preceding the seam cell divisions of the L2.

LIN-28 dramatically represses the accumulation of the let-7 microRNA.

These observations indicate that the earliest observable consequence of let-7 activity occurs long before the L4-to-adult transition, and suggest let-7 acts at the late L3 stage.

Given that mir-48, mir-84, and mir-241 act redundantly and are related in sequence to let-7, we first wished to test whether let-7 might also be redundant with them in controlling L2 seam cell behavior.

Surprisingly, a strain lacking lin-28 and all four let-7 genes had the reduced seam cell number of a lin-28 mutant (Table 2, line 8).

However, we observed consistent abnormal cell division and morphogenesis events in the L4 male, which is in agreement with a reiteration of L3 cell fates in let-7 null mutants.

let-7 null mutants, whose defect in these lineages is first visible in the late L4 stage.

Lin-28 encodes one of twelve proteins and let-7 one of five microRNAs known to act in the heterochronic pathway [3]– [5].

Thus, the let-7 null allele is epistatic to the lin-28 null allele only for the alae phenotype, not for the early seam cell division defect; the animals display both precocious and retarded characters.

We addressed whether any aspect of lin-28's two-stage precocious phenotype depended on let-7 family members.

lin-28 Represses the Accumulation of let-7 in the L1 and L2The binding of mammalian LIN-28 to pre-let-7 leads to the degradation of the precursor and eventual loss of mature let-7 [27]– [32].

We sought to clarify the roles of these two genes with respect to let-7 activity.

let-7 null mutants show retarded adult alae synthesis, but produced the normal number of seam cells (Table 2, line 3) [2].

Like other animals, C. elegans possess multiple let-7 family members [40]– [44].

However, removing ain-1 in a strain lacking lin-28 and the three let-7 family members did not result in an increase in seam cell number (Table 2, line 11).

Here we show that lin-28's primary activity in C. elegans—the proper timing of second larval stage cell fates—does not require let-7 or related genes.

We therefore reconsidered when let-7 has its earliest role in larval development.

Arrow head, unretracted hypodermis in the let-7 mutant.

Our quantitative RT-PCR data indicate that mature let-7 accumulates during the L3 (Figure 1), after LIN-28 has disappeared [62].

We demonstrate by using null alleles that lin-28 does not require let-7, mir-48, mir-84, and mir-241 for its control of L2 cell fates (Table 2).

Similar results were obtained with animals lacking all four let-7 family members (Figure S2).

The first of lin-28's activities governs the L2-to-L3 transition and is independent of let-7 and the second acts via let-7 to control the L3-to-L4 transition.

Thus, lin-28 requires none of these let-7 family members to control the L2 seam cell fates.

Table S5Copy number, let-7 levels, and phenotypes of let-7 transgenic lines.

Another consistent defect observed in let-7 null males was a delay in tail tip retraction that normally occurs in male tail morphogenesis during the L4 (Figure 4) [57].

These observations indicate that let-7, and not its three relatives, is needed for the two-stage precocious phenotype of lin-28 null mutants.

Lack of Evidence for Additional MicroRNAs Mediating lin-28 ActivityWe surmised that lin-28 might act on a microRNA unrelated to let-7 to control L2 events.

Global microRNA profiling was performed by Exiqon (Vedbaek, Denmark) using miRCURY LNA miRNA Arrays annotated to miRBase version 14.0. let-7 TransgenesA 2.5 kb let-7 genomic sequence identical to the rescuing fragment used previously [2] was cloned into pCR2.1-TOPO (Invitrogen).

Because mature let-7 levels are very low at the L2 molt and nearly at their peak by the end of the L3, it is reasonable to assume that let-7 could act by the end of the L3.

We generated animals carrying either a wildtype let-7 genomic transgene or a chimeric worm/fly transgene.

While investigating the mechanism by which accumulation of the mature let-7 microRNA is blocked in pluripotent cells, Viswanathan and colleagues discovered that mammalian LIN28 protein can bind the let-7 pre-microRNA and inhibit its processing [26].

By contrast, none of the lin-28; let-7 animals displayed adult alae at the L2 molt (Table 3).

In contrast to removing let-7, which had no effect, removing ain-1 from a strain lacking mir-48, mir-84, and mir-241 nearly doubled its seam cell nuclei number (Table 2, line 10).

In a let-7 null mutant background, seam cells divide at the L4 molt and synthesize adult alae one stage later [2].

let-7 Transgenes.

Because lin-28's primary role is to govern this same cell fate transition, it is reasonable to hypothesize that it acts via one or more of these let-7 relatives.

Nomarski images of wild type (A) and let-7 null (B) L4 males approximately 8 hours after the L3 molt.

14

In addition, miRNAs including let-7 negatively regulate target gene expression by two major mechanisms, i. e. mRNA cleavage (transcriptional level) and/or translational repression (translational level), in a sequence-specific manner [7], [8], [11], [12].

Expression of members of the let-7 family has been reported to be significantly downregulated in multiple cancer types, and this decreased let-7 expression has been correlated with poorer clinical outcomes.

For example, the expression of let-7a, let-7c, and let-7g have been found to be selectively downregulated in breast cancer [52], suggesting that there are other independent mechanisms affecting the expression of each individual let-7 family member.

Conversely, their regulatory miRNA, let-7, shows a reciprocal temporal expression pattern that is dramatically increased during differentiation and development, and it is extensively expressed in adult tissues [2]– [5].

Copy Number Alteration of let-7b is Positively Correlated with Mature let-7b Expression in Ovarian CancerTo determine whether copy number alterations of let-7b affect mature let-7 expression in cancer, we examined an ovarian cancer dataset from The Cancer Genome Atlas (TCGA) [32], because this independent genomic dataset contains matched data on both genome-wide copy number (SNP array) and mature miRNA expression (miRNA array) from a large collection of human ovarian tumor specimens.

Reduced expression of let-7 has been associated with shortened postoperative survival in patients with cancer [7], [11], [12], and forced expression of let-7 family members can suppress cancer cell growth both in vitro and in vivo [13]– [16].

For example, some direct targets of let-7, such as LIN28, RAS, MYC and HMGA2, are not expressed or activated in normal cells, but are the ‘driver’ genes promoting cell growth in tumors.

Two molecular mechanisms have been proposed that may lead to global downregulation of let-7 expression in cancer.

To determine whether copy number alterations of let-7b affect mature let-7 expression in cancer, we examined an ovarian cancer dataset from The Cancer Genome Atlas (TCGA) [32], because this independent genomic dataset contains matched data on both genome-wide copy number (SNP array) and mature miRNA expression (miRNA array) from a large collection of human ovarian tumor specimens.

Given that let-7 simultaneously inhibits multiple oncogenic pathways that are involved in most steps of tumorigenesis (such as RAS, MYC, and HMGA2), restoration of let-7 expression in tumor cells provides a novel therapeutic strategy to treat cancer.

Moreover, having found that let-7 expression is lower in lung tumors than in normal lung tissue, while RAS protein is significantly higher in lung tumors, they proposed that let-7 is a tumor suppressor gene [9], which is consistent with previous clinical observations in lung cancer [10].

46 Dangi-Garimella S, Yun J, Eves EM, Newman M, Erkeland SJ, et al (2009) Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J 28: 347– 358.

In consistent with this common behavior of miRNAs, we showed that the mRNA expression levels of multiple well-known let-7 target genes such as CCND1, CDC25A, HMGA2, IL6 and LIN28B were significantly decreased by let-7b mimic treatment (all p<0.05).

We believe it is one of important mechanisms to decrease let-7 expression in these diseases, although other mechanisms such as transcriptional deregulations, epigenetic alterations, mutations, and defects in the miRNA biogenesis machinery are needed to be further characterized in ovarian and breast cancers.

Meanwhile, the mRNA expression levels of well-known let-7 target genes such as CCND1, CDC25A, HMGA2, IL6 and LIN28B were significantly decreased by let-7b mimic treatment.

The role of let-7 in cancer was first discovered by Johnson et al. when they found that the let-7 family negatively regulates let-60/RAS in C. elegans by binding to multiple let-7 complementary sites in its 3′ untranslated region (3′UTR) [9].

These results indicate that deletion in copy number is an important mechanism leading to the downregulation of specific let-7 family members in at least these three types of human cancers.

Since it has been found that human cancers show a significantly reduced expression of the let-7 family, and that this is associated with shorter survival times in these patients [7], [11], [12], the characterization of the mechanisms leading to let-7 downregulation in cancer has important clinical significance.

This may result in an unselective, global downregulation of miRNAs, including the let-7 family.

However, the above two mechanisms cannot explain the finding that, in most cancer types, only some let-7 family members are downregulated.

Therefore, transcriptional deregulations, epigenetic alterations, mutations, DNA copy number abnormalities and defects in the miRNA biogenesis machinery might each contribute, either alone but more likely together, to the let-7 family deregulation in human cancer [29], [61], [62].

We also monitored endogenous let-7b activity using a constitutively expressed let-7b luciferase reporter that contained sequences complementary to let-7 in the 3'UTR [33], [34].

It has been well demonstrated that the mature let-7 expression is a robust biomarker to predict clinical outcome in patients with cancer.

The let-7 family is one of the first miRNA tumor suppressor families shown to be involved in human cancer.

Proc Natl Acad Sci U S A. 52 Qian P, Zuo Z, Wu Z, Meng X, Li G, et al (2011) Pivotal role of reduced let-7g expression in breast cancer invasion and metastasis.

In addition, let-7 targets multiple cell cycle associated genes, including CDC25A [24], CDK6 [24], and CDK4 [25] as well as Cyclin A [25], D1 [25], D2 [24], and D3 [25].

Importantly, focal reductions in the copy numbers of the let-7 family suggest that deletion of let-7 may play an important role during tumorigenesis, and suggests that restoring expression of these let-7 family members may be a novel strategy to treat medulloblastoma, breast cancer, and ovarian cancer.

Taken together, this demonstrates that the in vivo delivery of a let-7b mimic can functionally restore let-7 expression and remarkably reduce tumor growth in a pre-clinical animal mo del of ovarian cancer.

B. Heat map of mature let-7 family expression levels in matched TCGA specimens.

This result indicated that the DNA copy number alteration is not the only reason by which the mature let-7 expression is reduced in cancer.

The let-7 target genes lin-28 (an RNA -binding protein) and lin-41 (a putative ubiquitin ligase) block let-7 maturation and interact with argonaute proteins, respectively.

Restoration of let-7b Expression Significantly Reduces Ovarian Tumor Growth in vitro Focal loss in copy number of the let-7 family members in medulloblastoma, breast, and ovarian cancers strongly suggests that let-7 may have an important role in tumorigenesis.

In addition, it has been shown that the RNA -binding protein, LIN28, which selectively inhibits some miRNA families, including the let-7 family [36]– [41], is activated in a large percentage of cancer patients [42]– [51].

In agreement with our observations, restoration of let-7 expression has also been shown to reduce tumor growth in pre-clinical mo dels of other cancer types, such as lung cancer [13]– [16], in which the let-7 family is globally decreased [9], [10].

D. Correlations between let-7b DNA copy number and expression levels of mature miRNA of other let-7 family members in ovarian cancer from the TCGA dataset.

It is likely that let-7 performs these functions by targeting various genes.

Interestingly, we found that our let-7b treatment did not significantly affect normal ovarian surface epithelial cell growth, suggesting that treatment to restore let-7 expression may be less toxic than traditional chemotherapy.

The inhibitory function of the let-7 family in cancer has been corroborated by a number of groups and in various types of tumors [7], [11], [12].

This finding may be due to the fact that normal cells already express higher levels of endogenous let-7 and therefore the delivery of additional let-7 does not significantly increase its gene silencing activity in normal cells.

Finally, let-7 represses expression of the reprogramming factor LIN28 that functions to block differentiation and maintain cancer stem cell populations [26].

Most importantly, we confirmed the correlation between let-7 copy number alterations and mature let-7 expression in ovarian cancer.

The stable clones expressing the let-7 reporter were further confirmed by a luciferase assay.

Proc Natl Acad Sci U S A. 18 Yu F, Yao H, Zhu P, Zhang X, Pan Q, et al (2007) let-7 regulates self renewal and tumorigenicity of breast cancer cells.

After two weeks, the mice were randomly assigned to two groups, to be treated with either the let-7 mimic or the control oligonucleotide by i. p. injection.

However, this mechanism is likely cancer-type specific, since we did not find significant copy number alterations of the let-7 family in other cancer types, such as colon and prostate cancers.

For example, a systematic review of 43 published studies shows that let-7 is the miRNA most frequently and significantly associated with clinical outcomes in patients with cancer [60].

This led us to examine whether the copy-numbers of the let-7 family were altered in cancer.

0044399.g002 Figure 2Members of the let-7 family show copy number deletions in medulloblastoma, breast, and ovarian cancers.

In this pathway, the microRNA (miRNA) let-7 controls the progression of timing events, ensuring that cell cycle exit and terminal differentiation occur at the correct time [6], [7].

Briefly, we found that four let-7 loci harboring five let-7 members showed significant deletions in copy number in a cancer-type specific manner (Figure 2).

In the present study, we have shown that three let-7 loci, which harbor four let-7 members (let-7a-2, let-7a-3, let-7b, and let-7e), have deletions in copy number in a cancer-type specific manner in medulloblastoma, breast cancer, and ovarian cancer.

To determine the copy number of the let-7 family members, we analyzed a high-resolution SNP array (Affymetrix 250 K Sty array) dataset, Tumorscape, created by the Broad Institute of MIT and Harvard [27].

Frequency indicates the fraction of cancers which exhibit amplification/ deletion at the genomic locus harboring a given let-7 gene.

The let-7 family is made up of thirteen members located at eight loci of the human genome.

Summary of DNA copy number alterations of the let-7 family in 14 types of human cancers (n = 2,969).

Finally, only one let-7 family member, let-7i, was found to be amplified (in non-small cell lung carcinoma).

Members of the let-7 family show copy number deletions in medulloblastoma, breast, and ovarian cancers.

Thirteen members of the let-7 family have been identified in the human genome [7], [8] which display both distinct and overlapping functions [8].

Certain Members of the let-7 Family have Deletions in Copy Number in Medulloblastoma, Breast Cancer, and Ovarian Cancer.

In addition, two non-focal deletions (let-7a-3/ let-7b, frequency 40%; let-7g, frequency 36%) were also found in breast cancer, and single non-focal deletions were found in melanoma (let-7a-2, frequency 43%) and non-small cell lung carcinoma (let-7e, frequency 31%).

Certain Members of the let-7 Family have Deletions in Copy Number in Medulloblastoma, Breast Cancer, and Ovarian CancerTo determine the copy number of the let-7 family members, we analyzed a high-resolution SNP array (Affymetrix 250 K Sty array) dataset, Tumorscape, created by the Broad Institute of MIT and Harvard [27].

Two weeks after the tumor cell injection (Figure 5A), the mice were randomly assigned to two groups, to be treated with either the let-7 mimic or the control oligonucleotide (40 ug per animal).

The let-7 reporter vector was transfected into A2780 cells using the FuGene6 Transfection Reagent (Roche).

To test this hypothesis, we delivered a small RNA mimic for let-7b, the most frequently deleted let-7 family member in ovarian cancer patients, to ovarian cancer cells in vitro and in vivo.

This suggests that genomic focal copy number deletions of let-7 may play an important role during tumorigenesis in the above cancer types.

For example, let-7 inhibits many well-characterized oncogenic proteins, including KRAS [9], [17], [18], HRAS [9], [17], [18], HMGA2 [18]– [21], c-Myc [22], and NF2 [23].

We did not find a correlation between any other let-7 family members with the let-7b copy number (Figure 3D).

Dark green represents focal deletion of the let-7 family.

Focal deletions of these let-7 family members were found in three cancer types: medulloblastoma (let-7a-2, frequency 25%; let-7e, frequency 9%), breast cancer (let-7a-2, frequency 47%), and ovarian cancer (let-7a-3/ let-7b, frequency 44%).

Taken together, our data indicate that a reduction in copy number of specific let-7 family member genes were frequent in medulloblastoma, breast, and ovarian cancers.

Focal loss in copy number of the let-7 family members in medulloblastoma, breast, and ovarian cancers strongly suggests that let-7 may have an important role in tumorigenesis.

15

In summary, we found that BR-DIM up-regulated the expression of the let-7 family and consequently down-regulated the expression of EZH2 not only in PCa cell lines but also in human PCa tissue specimens from our on-going phase II clinical trial.

To further determine the biological consequence of the let-7 family expression in the regulation of EZH2 expression, we transfected PC3 and PC3 PDGD-D cells with let-7 precursors, and the results showed that let-7 family members could significantly inhibit the expression of EZH2 in these two cell lines (Fig. 2A, middle and lower panel).

BR-DIM treatment led to the upregulation of the let-7 family and consequently down-regulated the expression of EZH2 in PCa cells.

Figure S1 BR-DIM treatment upregulated let-7 expression and consequently reduced EZH2 expression in LNCaP cells at different time points.

The let-7 family is commonly viewed as a tumor suppressor consistent with down-regulation of oncogenes such as Ras [10], high mobility group A2 (HMGA2) [11] and c-myc [12] by binding to 3′UTR of these target mRNAs.

The results obtained from eleven tumor specimens from this phase II clinical trial are exciting because it showed, for the first time, that let-7 miRNAs could be upregulated in tumors by BR-DIM intervention with consequent down-regulation of EZH2.

BR-DIM intervention in PCa patients resulted in the increased expression of let-7 family and consequently inhibited EZH2 expression in tumor tissues.

We found that the overexpression of let-7 family significantly inhibited the clonogenic growth of PC3 PDGF-D cells, which initially showed lower expression of let-7 (Fig. 2D).

0033729.g002 Figure 2 (A) Expression of EZH2 was found to be higher in PCa cell lines compared with immortalized prostate epithelial cell lines: PZ-HPV-7 and RWPE-1 (upper panel) and transfection of let-7 precursors inhibited EZH2 expression in PC3 and PC3 PDGF-D cells 3 days after transfection (middle and lower panel).

We have searched targets of the let-7 family using TargetScan software and we found that EZH2 could be regulated by the let-7 family because there is a specific binding site in the 3′UTR of EZH2 mRNA.

Therefore, finding novel approaches by which one could re-express the lost miRNAs such as let-7 family with consequent down-regulation of EZH2 could become a newer avenue for the prevention of PCa and/or treatment of aggressive PCa.

Expression of EZH2 was increased in PCa tissue specimens and was inversely correlated with the expression of the let-7 family.

Enhancer of Zeste homolog 2 (EZH2) is one of the targets of the let-7 family of miRNAs, and that the expression of EZH2 is strongly associated with molecular features of both normal stem cells and CSCs or CSLCs.

Our results showed that the let-7 family, especially let-7a, let-7b, let-7c and let-7d are highly expressed in human normal prostate tissue specimens and their expression was lost in PCa tissues, especially, in patients with aggressive (higher Gleason grade tumors) tumors.

These results were consistent with corresponding increased expression of EZH2, which appears to be a target of the let-7 family.

Our results suggest that the loss of expression of let-7 with a consequent over -expression of EZH2 could be associated with PCa aggressiveness.

In the current study, we found loss of expression of let-7 family consistent with over -expression EZH2 in PCa cells and in human PCa tissue specimens, especially in tumors with higher Gleason grade.

The results from correlation analysis showed that let-7 expression was inversely associated with EZH2 expression in patients with higher Gleason grade tumors.

Let-7 regulated EZH2 expression, and inhibited clonogenic growth capacity of PCa cell lines.

Therefore, our results suggest that BR-DIM could be an important agent to re-express the lost miRNAs especially the let-7 family, which would reduce the level of EZH2 expression and compromise CSCs or CSLCs function.

Interestingly, let-7 family members have been demonstrated to regulate the self-renewal capacity of breast cancer cells [17] and PCa cells by regulating stem cell -associated factors such as Oct4, Sox2, and Nanog expression [18].

Recent studies have also documented that let-7 could regulate the expression of Lin28 and Lin28B, which in turn block the accumulation of mature let-7 [19].

These results suggest that let-7 family regulates the expression of EZH2.

Emerging evidence suggests that deregulated expression of many microRNAs (miRNAs) including the let-7 family contributes to cancer progression and recurrence [8].

In order to gain further mechanistic insight, we tested whether let-7 could directly repress the expression of EZH2 by binding to 3′UTR of EZH2 mRNA.

Let-7 repressed EZH2 expression and inhibited clonogenic growth of PCa cells.

The results from miRNA expression by mircroarray expression profiling showed that all the members of the let-7 family (miR-98 was undetectable) decreased in the PCa tissues compared to adjacent normal tissue specimens (Fig. 1A).

Moreover, decreased let-7 expression was found in many cancers, including PCa [13], and it has been linked with poor patient prognosis in lung cancer [14], head and neck squamous cell carcinoma [15], and ovarian cancer [16].

BR-DIM treatment increased let-7 and consequently reduced EZH2 expression.

Expression of the let-7 family was lost in prostate cancer (PCa) tissue specimens.

These results suggest that the loss of let-7 could be responsible for increased expression of EZH2.

In the present study, we found that BR-DIM treatment increased the expression of let-7 family in several PCa cell lines including LNCaP, C4-2B and PC3 cells (Fig. 3A and Fig. S1A–C).

In this study, we found that the expression of the let-7 family was lost in PCa tissue specimens with Gleason grade 7 or higher but not in patients with Gleason grade 6 tumors.

These results suggest that the let-7 family could play a key role in the progression of PCa by maintaining and regulating molecular features of CSCs or CSLCs in PCa; however, how let-7 family contributes to PCa aggressiveness is unknown.

Our data suggest that the let-7 family of miRNAs also be responsible for the regulation of EZH2 in human PCa.

We observed that the expressions of the let-7 family in grade 6 tumors are not statistically different compared to normal control.

0033729.g003 Figure 3 (A) Total RNA was isolated from LNCaP, C4-2B and PC3 cells treated with 25 µM BR-DIM for 24 h and the results from real time RT-PCR showing that the expression of let-7 was increased following BR-DIM treatment compared to untreated control (c: DMSO control).

We discovered that the expression of the let-7 family in histologically normal prostate tissues from Gleason grade 7 or higher tumor was decreased compared to histologically normal tissue from Gleason grade 6 tumors (data not shown), suggesting that the histologically normal tissues from the prostate gland of patients with higher grade tumors are not normal.

Loss of the let-7 family inversely correlated with increased expression of EZH2 in PCa tissue specimens compared to adjacent normal prostate tissues.

Although it is known that the let-7 family is associated with maintenance of stem cell signature, which is believed to be strongly linked with cancer recurrence, the mechanism by which let-7 family regulates the stem cell signatures is unknown.

Moreover, the results from 3′UTR of the EZH2 luciferase assay and further confirmed that let-7 could repress EZH2 expression by binding to 3′UTR element of EZH2 mRNA.

The results from soft agar assay further showed that the treatment of C4-2B cells with 10 or 25 µM BR-DIM reduced the colony size and numbers (Fig. 5C and 5D), suggesting that BR-DIM could eliminate tumor cells especially the cells with CSCs or CSLCs characteristics by up -regulating let-7 family and consequently by down -regulating the expression of EZH2.

We co -transfected EZH2 3′UTR luciferase plasmid and let-7 precursors, and found that let-7a, let-7b, let-7c, and let-7b could strongly inhibit EZH2 3′UTR luciferase activity compared to transfection of cells with control miRNA (Fig. 2B).

Here we also provide evidence for the role of BR-DIM (formulated DIM: 3,3′-diindolylmethane, abbreviated as either BR-DIM or B-DIM) in the regulation of let-7 and EZH2 in PCa cells as documented by our pre-clinical findings as well as findings from our on-going phase II clinical trial in PCa patients received BR-DIM prior to radical prostatectomy.

These results suggest that the loss of let-7 family could be associated with PCa aggressiveness especially because the lower grade tumors were no different from the normal tissue control, whereas higher grade tumors were different.

Cells were transfected with 40 nmol/L of let-7 precursors or miRNA precursors negative control#1 (Ambion, Austin, TX) using DharmaFECT3 transfection reagent (DHARMACON, Lafayette, CO).

To determine the levels of the let-7 family in PCa tissue specimens, we collected pre-treatment PCa tissues and matched adjacent normal tissue specimens (used as control for comparison with tumor tissues).

The let-7 binding sites in the 3′UTR of EZH2 mRNA are shown in Figure 2C.

The human let-7 family consists of let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i and miR-98.

PC3 PDGF-D cells with lower levels of let-7 were seeded at a density of 6×10 [3] cells/well in a 96-well plate and incubated for 24 h. The cells were co -transfected with EZH2 3′UTR luciferase plasmid (Origene, Rockville, MD) or Renilla luciferase plasmid and control miRNA, let-7a, let-7b, let-7c, and let-7d precursors using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO).

C4-2B, PC3 PDGF-D, and PC3 PDGF-D cells transfected with the let-7 family for 24 h were collected after trypsinization, and re-suspended in the complete medium.

16

miRNA Let-7–targeted TUSC2 mRNA CleavageWe used the most extensively characterised human miRNAs, the let-7 family, and their natural mRNA target, the tumour suppressor candidate 2 gene (TUSC2, also known as FUS1), to demonstrate the mammalian miRNA -mediated target mRNA cleavage and regulatory activities in human cells using a novel SLA–RT-PCR assay (Fig. 1a).

Inhibition of let-7–mediated Target mRNA Cleavage and 3′-uridylation by Ago2- and TUTase-specific siRNA Inhibitors.

These results, together with the patterns of accumulated fragments at the C6 and C8 positions of the TUSC2 mRNA let-7 target site (Fig. 1a-I,II), suggest that the miRNA -mediated target mRNA cleavage occurred at specific positions on mRNA sequences and the concurrent 3′-oligouridyl modification of cleaved mRNA fragments with one or two uridyl residues may be sufficient to promote targeted 5′-3′ mRNA decay 21 22.

To demonstrate whether the observed accumulation of cleaved and 3′-uridylated TUSC2 mRNA fragments was specific to let-7 miRNA activity, we examined the effects of knocking down expression of endogenous let-7 miRNAs by a let-7–specific miRNA inhibitor on SLA– and U-SLA–RT-PCR outputs in H1299 cells.

To determine the potential effects of structural and spatial contexts of the target mRNA on miRNA -mediated mRNA cleavage, we developed an enhanced green fluorescence protein (EGFP) reporter plasmid -based mo del system with a defined let-7 target and SLA–RT-PCR primer binding sequences and a fully functional mammalian mRNA structure to monitor the precise action of miRNA on its target in a time- and space -dependent manner.

To determine whether Ago2 was involved in the let-7–mediated target mRNA endonucleolytic cleavage in miRISC, we analysed the effects of Ago2 knockdown on let-7–mediated target mRNA cleavage and uridylation in H1299 cells co -transfected with the pLJ-T214 plasmid and Ago2-specific siRNA (siR-Ago2) (Fig. 5a–c).

We have shown that target gene silencing mediated by let-7 family miRNAs and other human miRNAs could be initiated by Ago2-catalysed endonucleolytic cleavage on base-paired miRNA:mRNA target sites, which is consistent with the fact that the Ago2 endonucleolytic RNase H domain prefers paired bases as substrates 15 24.

pLJ-T722 let-7 dual-target expression vector.

We used the most extensively characterised human miRNAs, the let-7 family, and their natural mRNA target, the tumour suppressor candidate 2 gene (TUSC2, also known as FUS1), to demonstrate the mammalian miRNA -mediated target mRNA cleavage and regulatory activities in human cells using a novel SLA–RT-PCR assay (Fig. 1a).

A DNA fragment with two copies of let-7 targets identical to the TUSC2 let-7 target site was synthesized by GenScript.

We previously identified miR-98, a member of the let-7 miRNA family, as targeting the 3′UTR of TUSC2 mRNA and showed that overexpression of miR-98 decreased the TUSC2 mRNA level in various NSCLC cells 17.

In pLJ-T214–transfected H1299 cells, three identical copies of TUSC2 let-7 target sites were produced: one copy in the 3′UTR of the endogenous TUSC2 mRNA transcript and two copies in the 3′UTR of the exogenously expressed pLJ-T214 EGFP reporter transcript.

Overexpressed miR-622 and let-7d mRNAs were detected by qRT-PCR in H1299 cells transfected with a miR-622 or a let-7 expression vector, respectively (Fig. 2b).

To predict the actual let-7–targeted cleavage sites and their possible origins, we performed in-depth analysis of the unique pattern and relative quantity of these accumulated SLA–RT-PCR products derived from let-7–mediated TUSC2 mRNA cleavage and 3′-uridylation activities at various positions in the let-7: TUSC2 target site and its 5′- and 3′-adjacent regions (Fig. 1).

With a maximum bulge loop of 3 nt permitted on the target sequence, a putative let-7 miRNA:target base-pairing map was composed according to the minimal free energy (MFE) of each pair, as calculated with the assistance of RNA Hybrid 19, to compare the contributions from each let-7 family member to the detected target mRNA cleavage activities (Fig. 1c).

AATTCCCTAGGAAGAGGTAGTAGGTTGCATAGTTTTAGGGCAGGGATTTTGCCCACAAGGAGGTAACTATACGACCTGCTGCCTTTCTTAGGC TCGAGCCTAAGAAAGGCAGCAGGTCGTATAGTTACCTCCTTGTGGGCAAAATCCCTGCCCTAAAACTATGCAACCTACTACCTCTTCCTAGGG A DNA fragment with two copies of let-7 targets identical to the TUSC2 let-7 target site was synthesized by GenScript.

The first let-7 target site from the 5′ cap was annotated as T1 (2nd underlined section) and the second let-7 target as T2 (3rd underlined section).

To determine the structural effect of the target mRNA on let-7 miRNA–mediated mRNA fragment distribution, we constructed a plasmid vector pLJ-T722 (Fig. 2c) similar to the pLJ-T214 plasmid (Fig. 4a), in which the two copies of identical let-7:target pairing sequences in the 3′UTR of the eGFP reporter gene had the length and composition of nt adjacent to their 5′- and 3′- ends altered, labelled as ST1 and ST2 (Fig. 4c).

pLJ-T214 let-7 dual-target expression vector.

For these two identical target sites located at different positions in the same transcript, the upstream T1 appeared to have more let-7–mediated cleavage activity than the downstream T2, suggesting a potential positional advantage of T1 over T2 in accessing let-7–guided miRISCs and miRISC scanning along mRNA sequences in the 5′ to 3′ direction.

The reporter plasmid (pLJ-T214) consisted of an EGFP reporter coding sequence under the control of a cytomegalovirus (CMV) promoter, immediately followed by a 3′UTR with two identical copies of let-7 target sequences (T1 and T2) directly derived from TUSC2 mRNA sequences arranged in tandem and a BGH poly(A) signalling sequence (Fig. 4a).

The significant reduction of oligouridylated mRNA fragments at A4 and C18 suggests the indirect involvement of Ago2 in let-7–mediated target mRNA cleavage, where the majority of detected mRNA fragments at T1 originated from the 3′-5′ decay products of cleaved 5′-miRNA fragments at the T2 site.

These observations suggested that the endonuclease activity of Ago2 was directly responsible for the let-7–guided target mRNA cleavage activity at G17 and C27, leading to progressive reduction of the 3′-uridylated fragments by 3′-uridylation–facilitated 5′-3′ RNA decay.

miRNA let-7 knockdown was carried out in H1299 cells transfected with 10 μM of miRCURY LNA anti-miR-98 inhibitor packaged in a DOTAP:Chol:siRNA complex.

The accumulation of cleaved TUSC2 5′-mRNA fragments was markedly reduced by this knockdown of endogenous let-7 expression (Fig. 1a-III,b, +miR-98 LNAi).

H1299 cells were transfected with a miR-98 locked nucleic acid inhibitor (miR-98-LNAi) that is effective in all let-7 miRNA members.

The let-7: TUSC2 mRNA target interaction analysis predicted strong and extended base-pairing in the seed region (Fig. 1c).

The 3′UTR of the EGFP reporter gene containing two copies of identical predicted let-7:target pairing sequences but with varied lengths and compositions of nt (underlined) at their 5′- and 3′-adjacent regions (ST1 and ST2).

miRNA Let-7–targeted TUSC2 mRNA Cleavage.

The accumulation patterns of the 3′-uridylated T2 fragments at 16 h after transfection (Fig. 4b-II) and those of the 3′-uridylated T1 fragments at 72 h (Fig. 4b-IV) resembled the pattern obtained with the endogenous TUSC2 mRNA let-7 target site (Fig. 1a-II), particularly within the base blocks defined by red boxes in Fig. 4b.

Varied expression levels of the let-7 family miRNAs were detected in H1299 cells by real-time quantitative RT-PCR (qRT-PCR) (Fig. 1b).

Amplicon intensities at the block positions U3-C8, U15-C18, U25-C27 and G28-C32 along the let-7: TUSC2 target site (Fig. 1b-II) were significantly higher in oligouridylated mRNA fragments, as detected by 2U-SLA–RT-PCR, than those at the corresponding positions in unmodified mRNA fragments, as detected by unmodified SLA–RT-PCR reactions (Fig. 1a-I).

The specificities of the miR-98–mediated TUSC2 mRNA cleavage and sequential 3′-oligouridylation were further demonstrated by the dramatically different patterns and intensities of 2U-SLA–RT-PCR amplicons detected at various positions around the let-7: TUSC2 mRNA target site between the miR-98-LNAi–treated (Fig. 1a-IV) and –untreated (Fig. 1a-II) H1299 cells.

SLA–RT-PCR amplicons of 528 bp and 234 bp were expected on agarose gel for let-7–cleaved mRNA fragments from target sites T1 and T2, respectively.

Prediction and detection of the let-7 miRNA–mediated target cleavage sites in the 3′UTR of TUSC2 mRNA.

The accumulation of a cleaved 5′-mRNA fragment at a specific cleavage site within and near the predicted let-7: TUSC2 target pairing sequences was represented by the relative intensity of each specific SLA–RT-PCR amplicon resolved on an agarose gel (Fig. 1a-I, upper panel) and by the relative fragment abundance (RFA) on a qRT-PCR histogram (Fig. 1a-I, lower panel).

These SLA–RT-PCR products represented the dynamic activities mediated by let-7 on the TUSC2 mRNA target site.

Our results, using a novel SLA–RT-PCR assay, show endogenous let-7 miRNA–guided and Argonaute-catalysed endonucleolytic cleavage of target TUSC2 mRNAs at various sites in partially paired miRNA:mRNA sequences, predominantly within the miRNA seed region or in the 3′ supplementary pairing region.

The endogenous let-7–mediated mRNA cleavage activity on the ST1 and ST2 target sites was examined by SLA–RT-PCR or SLA-qRT-PCR (only at sites whining the red boxes), using total RNAs prepared from H1299 cells transfected by pLJ-T722 at 24 h as templates and the SLA-RT primers described in Supplementary Table 1c (Fig. 4d).

Endogenous let-7–mediated mRNA cleavage of those target sites would produce 5′-mRNA fragments with identical 3′ termini, which could be detected competitively by the same SL-RT primer in RT.

To test whether oligouridines were added to the cleaved 5′ fragments that accumulated around the let-7 target site on TUSC2 mRNA, we modified the SLA-RT primers by adding varied numbers of adenosines at the 5′ end of the probe sequences to match the non-templated oligouridine that could be added to the 3′ ends of cleaved mRNA fragments (Supplementary Fig. 1b).

To investigate the involvement of TUTases in miRNA -mediated mRNA cleavage and 3′-uridylation of the cleaved mRNA fragments within and near the miRISC, we analysed the effects of TUTase gene knockdown on let-7–mediated target mRNA 3′-oligouridylation in H1299 cells treated with siRNAs specific to all known mammalian TUTases by SLA–RT-PCR (Fig. 5d,e).

Cleavage activities on the T1 and T2 sites of the pLJ-T214 transcripts served as a control for verifying the endogenous TUSC2 mRNA fragments and internal references for defining the spatial effect of target sites on endogenous let-7 activity by the SLA–RT-PCR assay or SLA-qRT-PCR.

The expression of let-7 miRNAs was depleted in the cells transfected with miR-98 LNAi 48 h after treatment, as shown by qRT-PCR analysis using let-7–specific SL-RT primers (Fig. 1b).

RNAi gene knockdown of Let-7 family miRNAs, Ago2 and TUTases.

A series of SLA-RT primers with a 6-nt probe at their 3′ termini was designed to match along the entire let-7: TUSC2 mRNA target sequence as well as their 5′- and 3′-adjacent regions for the initial RT reaction (Supplementary Fig. 1a and Supplementary Table 1a), using total RNAs prepared from H1299 cells (Fig. 1a-I,II) as RT templates.

However, the accumulation of oligouridylated mRNA fragments at base positions G17, A26 and C27 remained strong 48 h after let-7 knockdown (Fig. 1a-IV), suggesting that degradation of the 3′-oligouridylated 5′-mRNA fragments was delayed.

SLA-RT primers and PCR primers are listed in Supplementary Table 3. (c) let-7 miRNA: TUSC2 target mRNA sequence pairing and potential cleavage sites were detected by a minimal free energy (MFE)–based miRmate algorithm 17.

The uridine base-paired G17, which was positioned at the centre of the let-7 RNA sequences near the 3′-end of the seed region, displayed a substantial accumulation of both the unmodified (Fig. 1a-I) and 3′-uridylated (Fig. 1a-II) mRNA fragments and was immediately followed by 3′-uridylation at its 3′ side close to the central bulge region, making G17 the most likely cleavage site.

As expected, the let-7–mediated TUSC2 mRNA cleavage activities were concentrated in the intensively base-paired seed region and in the predicted supplementary base-pairing region (Fig. 1a), while no apparent let-7–mediated mRNA cleavage activities were detected in the central bulge region, which lacks miRNA:mRNA base-pairings and has a high MFE microenvironment (Fig. 1a-I,III).

The characteristic pattern and intensity of mRNA fragment accumulation detected surrounding the endogenous let-7: TUSC2 target site reflected the collective activities of all let-7 family members in H1299 cells.

Let-7 miRNAs differ from each other in a few bases, primarily in the central bulge region (hence the lack of base-pairing) and the 3′ supplementary pairing region, and they share a conserved short stretch of base-paired (7–10 nt) sequences at the seed region (Fig. 1c).

Let-7 family miRNA, hsa-miR-622, hsa-miR-30a and hsa-RNU44 in H1299 cells were determined by SLA–RT-PCR methods.

Undetectable oligouridylated mRNA fragments in the central bulge region confirmed the lack of let-7–mediated mRNA cleavage activity in that region (Fig. 1a-II,IV).

17

In fact, the protein expression levels of LIN28B were upregulated by the existence of HBV preS2 transcript, which were antagonized by the forced expression of let-7 g. Although let-7 g is one of the twelve let-7 family members 30, because LIN28B blocks the maturation of all let-7 family members 34 35, the increased LIN28B expression may lead to repression of all miRNAs in the let-7 family, leading to a concomitant increase of let-7 targets.

In addition, when HBV products expressed from the cellular genome were suppressed by adding tetracycline after culturing the cells without tetracycline, HBV preS2 protein, although its expression was lower to begin with due to let-7 g overexpression, was decreased more rapidly in let-7 g -overexpressing Hep38.7 cells than in control Hep38.7 cells.

These results support the in vitro results that HBV transcripts may suppress let-7 function and, in those cases, let-7 target protein expression is upregulated.

The inhibitory effects on cccDNA production by let-7 g may be due to the decreased large S protein, direct effects of let-7 on cccDNA production, or indirect effects via let-7 g function on expression level changes of its target host genes.

As expected, the protein expression levels of HMGA2, LIN28B, and c-myc, which are let-7 g targets, were increased in Large S–S -expressing cells (Fig. 2d).

Expression of Large S–S (pCDH-Large S–S) reversed such suppression by inhibiting let-7 g function (left), but not in case of miR103 (right).

Forced stable expression of let-7 g in Large S–S -expressing Huh7 cells canceled the effects of Large S–S expression.

As shown in Fig. 4c, the cccDNA levels were lower in let-7 g -overexpressing cells than in control Hep38.7-tet cells in cultures without tetracycline (Fig. 4c), suggesting that let-7 g has, albeit slightly, suppressive effects on the HBV cccDNA levels.

The details of the effects on cccDNA by let-7 g expression or targeting the corresponding sequences need to be further determined.

In these cells, let-7 g -overexpressing Hep38.7 cells expressed lower levels of HBV preS2 protein after long-term culture without tetracycline (Fig. 4a).

Additionally, to introduce mutations into the seed region putatively targeted by let-7, another mutagenesis was performed to introduce mutations (ACACUCCA to TCTCUCCA) into pCDH-large S–S, constructing pCDH-large S-SM.

When examining the effects of forced expression of miRNAs, 0.4 μg Let-7 g or miR103 precursor -expressing plasmids (pCDH-let-7 g or pCDH-miR103) were transfected simultaneously.

However, when using let-7 g reporter and precursor constructs, simultaneous expression of the Large S–S construct significantly suppressed the let-7 g function, and luciferase values were recovered (Fig. 2b).

Additionally, to examine the expression levels of LIN28B, a let-7 target gene, in liver tissues derived from patients with HBV infection, immunohistochemistry was performed using HCC and the surrounding tissues from HBV-infected and -uninfected cases.

These effects were not observed when expressing the Large S-SM construct, which has mutations in the complementary regions of the let-7 g seed sequences, suggesting that the effects were let-7 g-specific.

To establish large S mRNA -expressing transgenic mice with and without mutations in the let-7 g-specific seed sequences, a DNA fragment of 2,535 bp, containing the CMV promoter region, the coding region of the large S mRNA, and a transcriptional terminator, was excised from the pcDNA3.1-Large S–S or pCDNA3.1-Large S-SM plasmids and subcloned into the EcoRI sites of pCDH-large S–S and pCDH-large S-SM by the In-Fusion method, as described above, by digestion with NruI and DraIII.

Let-7 g overexpression suppressed preS2 protein levels.

The values of the sample without let-7 g overexpression were set as 1. Data represent the means ± s. d. of three independent experiments.

The suppression of miRNA function by the Large S–S construct was not observed when using the miR103 reporter or precursor constructs (Fig. 2b), again suggesting specificity to let-7 g function.

Figure 4b, suggesting that cellular let-7 g has suppressive effects on HBV protein levels.

Based on the results in this study, supplementation of let-7 g into infected hepatocytes may be beneficial to both the prevention of tumorigenesis and the inhibition of viral envelop protein production.

While the role of Large S protein in cccDNA amplification is still controversial 27 28, we examined the levels of cccDNA by Southern blotting with and without let-7 g overexpression in Hep38.7-tet cells.

The firefly luciferase -based reporter carrying let-7 g- and miR103-responsive elements in its 3′ untranslated region, to examine corresponding miRNA function (pGL4-let-7 g and pGL4-miR103), and the internal control renilla luciferase -based plasmids (pGL4-TK) have been described previously 47.

However, the let-7 g levels in RISC were reduced by ~50% when using the cells stably expressing the let-7 g precursor construct and Large S–S.

Therefore, suppression of intrinsic function of even only let-7 g by preS2 transcript may be one of the causative factors for long-term hepatocarcinogenesis during chronic HBV infection.

Let-7 g and miR103 precursor -expressing plasmids were constructed previously 48 49.

Simultaneously, on the part of the effects of miRNA to the virus, let-7 g overexpression decreases the HBV preS2 protein levels and possibly HBV cccDNA levels.

HBV preS2 mRNA inhibits let-7 g function.

Let-7 is a well-regarded tumor-suppressive miRNA 30.

Two bases corresponding to the let-7 g seed sequences in the Large S transcript -expressing construct were mutated (Large S-SM).

In this study, we describe that sequences in HBV preS2 region can be targeted by cellular let-7 g, resulting in the impaired function of this miRNA through the decreased intrinsic recruitment of the miRNA into Ago2-related complexes.

These sequences are targeted by let-7 g, with complementarity at positions 1–13 from the miRNA 5′-end, including the seed region, and 83% complementarity of the entire miRNA sequence (Fig. 1a).

These effects were not observed when using the cells stably expressing the let-7 g precursor construct and Large S-SM, suggesting that the Large S transcripts sequestered let-7 g from RISC through their interactions and reduced let-7 g intrinsic function.

Potential let-7 g -targeting sequences, shown in red, are from nucleotides 99 to 120, and the nucleotides differing from the sequences used in this study are shown in black.

From this point, let-7 g indeed inhibited preS2 protein levels in the HBV product-inducible system both stably and after shutting off the transcription of the viral products.

In summary, we have shown that HBV preS2 transcript can be targeted by host cellular let-7 g, which may mutually anatagonize the intrinsic let-7 g function and HBV replication.

HBV preS2 mRNA can be targeted by let-7..

HBV preS2 mRNA interacts with cellular microRNA let-7 g. HBV large S mRNA suppress let-7 g function.

Let-7 g decreases HBV preS2 protein expression.

To visualize the results more easily by enhancing the basal effects, let-7 g precursor -expressing cells were used for this assay.

In addition, a construct with mutations in the preS2 sequences that disrupts the complementarity to the seed sequences of let-7 g was generated from the Large S–S construct (named as “Large S-SM”) (Fig. 1e).

How to cite this article: Takata, A. et al. Mutual antagonism between hepatitis B viral mRNA and host microRNA let-7. Sci.

Although the precipitated Ago2 protein levels were almost unchanged, let-7 g levels in RISC were approximately 20-fold higher than those in the control cells stably transfected with a control vector (Fig. 2e).

It may be important to determine which genes are indeed affected by the impaired host miRNA by the existence of HBV transcripts during the steps of chronic hepatitis and to determine the most appropriate timing for the supplementation of let-7 g into hepatocytes, to overcome the pathogenesis induced by the existence of HBV transcripts in hepatocytes.

We identified that the sequences in the HBV preS2 RNA can sequester let-7 g, which, in turn, impairs the intrinsic let-7 g function.

Data are shown after normalizing the let-7 g levels to miR103 levels in the Ago2 -associated complexes.

Through these in silico selections, the highest probabilities were attributed to the HBV preS2 sequences and let-7 g. Representative HBV genotypes A, B, C, and D were selected by referring to a previous study 10, and their sequences were extracted from the HBV sequence database, Hepatitis Virus Database (http://s2as02.

Positions of the let-7 g seed sequences are also indicated.

18

In addition, we also targeted MYCN as a positive control because of its previously established ability to regulate let-7 transcription [1, 26, 27] and based on its expression pattern in our neurodevelopmental mo del.

These issues are highly relevant to the study of cancer, where let-7 targets are strongly induced, consistent with a loss of mature let-7. It is possible that transcriptional induction of let-7 family members could be a strategy to drive a cascade of re -expression of let-7 in cancerous tissues, akin to the process which appears to happen during early human development.

Perhaps, the constitutive transcription and maturation of small amounts of let-7 serves as something of a rheostat of developmental timing that is tuned as cells become more specified, leading to changes in let-7 targeted TFs that can then in turn regulate let-7 transcription, leading to even more mature let-7 through an additional feed-forward mechanism.

Taken together, forkhead box proteins have the molecular components necessary to induce reorganizations of the epigenetic state, and some are expressed at anatomic locations and times that correlate with let-7 expression.

Two regulatory regions upstream of the locus were identified as the temporally regulated expression binding site (TREB) and the let-7 transcription element (LTE), and many studies have tested the binding and transcriptional control exerted by several TFs including elt-1 and daf-12[2, 16– 18].

Hypothesized regulatory regions were assembled by searching 20 kilobases upstream and downstream of each transcript for colocalization of H3K27Ac, H3K4me3, and DNAse sensitivity in samples known to express let-7 primary transcripts, and H3K27me3 or H3K9me3 in samples without appreciable primary let-7 transcripts.

It is worth pointing out that some let-7 targets also regulate let-7 maturation, such as LIN28A, LIN28B and LIN41.

Studies in C. elegans, where the activity and expression of let-7 is regionally and temporally constrained, have attempted to clarify transcriptional regulation from the single let-7 locus.

Furthermore, it has been proposed that some let-7 target RNAs can act as ceRNA or sponges of mature let-7 to regulate their activity[37].

In addition, some of the TFs shown here and elsewhere to regulate let-7 transcription (e. g. N-MYC) are also let-7 target genes[27, 38, 39].

Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells.

As a first step to determine how let-7 miRNAs are transcriptionally regulated, we attempted to define developmental mo dels that display dynamism of transcription.

Even in the early neural lineage where mature let-7s are scarce, some of the let-7 polycistrons are not transcribed, whereas others appear to be constitutively expressed.

Together, these data allowed us to identify primary let-7 transcripts, based on their expression in our Chromatin -associated RNA-seq samples and in DGCR8 [-/-] RNA-seq samples, even when they disagreed with RefSeq-annotated MIRLET7 genes.

Taking advantage of the annotation of promoters, we attempted to identify mechanisms of transcriptional regulation of the dynamic versus constitutively regulated let-7 polycistrons.

0169237.g002 Fig 2Expression of pri-let-7 during neural specification.

The fact that the polycistronic let-7 pri-miRNAs appeared to be regulated in concert as a result of these manipulations is further evidence of the co-regulatory mechanisms used during cell fate decision-making.

The fact that let-7 miRNAs can be dynamically regulated at the transcriptional level has only recently been appreciated, but the relative contribution of this regulation relative to levels of mature let-7s remains undefined.

While we can only speculate, it is possible that both dynamic and constitutive let-7 transcription is a function of feed-back activity of let-7-target interactions.

Therefore, sophisticated mechanisms for let-7 regulation have been preserved and expanded across evolution, perhaps pointing to their critical roles in both developmental timing and tumorigenesis.

In both developmental scenarios, we observed that a subset of let-7 family members showed transcriptional induction over developmental time, while other members appeared to be constitutively transcribed (Fig 2A).

Reciprocal expression of lin-41 and the microRNAs let-7 and mir-125 during mouse embryogenesis.

We previously identified dynamic transcriptional regulation of some let-7 family members between neural progenitors that represent distinct developmental stages[20].

Together, these data demonstrate that proper annotation of let7 loci can facilitate prediction of regulatory elements that are bound by transcription factors with the ability to regulate let-7 transcription.

Finally, by analyzing publically available data for let-7 loci, we identify transcription factors that appear to regulate let-7 transcription by acting at either promoter or enhancer elements enriched in dynamically regulated let-7 polycistrons.

Because all the let-7 family members have the same seed sequence, it seems redundant to express so many.

We knocked down several of these candidate let-7 regulator transcription factors in tissue-derived NPCs.

Expression of pri-let-7 during neural specification.

The study of regulation of the let-7 family of miRNAs has focused on these processing steps, but less is understood about how the pri- let-7 transcripts are regulated by transcription prior to any processing.

This study is not the first to identify transcriptional mechanisms for let-7 family members, but previous studies from lower organisms did not take advantage of genome-wide analyses to systematically define regulatory modules or transcription factors that regulate them.

Autoregulation of microRNA biogenesis by let-7 and Argonaute.

The time of appearance of the C. elegans let-7 microRNA is transcriptionally controlled utilizing a temporal regulatory element in its promoter.

We found that the levels of all mature let-7 family members were strongly induced across development (Fig 2B).

Using RT-PCR with primers specific to the let-7 miRNAs at different stages of processing, we tested changes in expression of the pri-let-7s (A) and their mature forms (B).

Identification of potential epigenetic regulation of let-7 polycistrons.

LIN28A and LIN28B are RNA binding proteins that regulate several of these processing steps to control levels of mature let-7 transcripts[14, 15].

While some studies have identified transcriptional mo dels of pri-miRNAs in higher organisms, the lack of proper annotation left the precise regulatory motifs for human let-7 transcripts undefined.

Together, these analyses define contexts in which particular let-7 polycistrons are transcriptionally regulated, and identify TFs that play roles in this dynamism.

SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors.

The temporal patterning microRNA let-7 regulates several transcription factors at the larval to adult transition in C. elegans.

Dynamic transcriptional regulation of some pri-let-7 transcripts.

Another group later induced pri-let-7 accumulation in the context of DGCR8 knockout, and validated with RACE PCR that primary let-7 transcripts have multiple isoforms, some of which aligned nearly identically to our observed annotation patterns and varied in different cellular contexts[21].

All other datasets are listed in supplemental tables 1 and 2. The let-7 family of miRNAs were first identified in C. elegans as a single heterochronic factor controlling developmental timing[1, 2].

Complete annotation of let-7 miRNA transcripts and regulation in human PSCs and NPCs by Chromatin RNA-seq.

Functionally defining regulators of let-7 transcription.

Here, after complete annotation of let-7 transcripts, we attempt to define regulatory motifs for this family of miRNAs by taking advantage of Chromatin -associated RNA-seq and the latest genomic descriptions of chromatin states within let-7 loci.

We then sought to determine whether the dynamic versus constitutive let-7 polycistrons display distinct regulatory schemes.

We mo del let-7 transcription in distinct neural paradigms to reveal subsets of let-7 family members that are transcribed constitutively versus dynamically regulated in particular contexts.

0169237.g001 Fig 1Dynamic transcriptional regulation of some pri-let-7 transcripts.

While all mature miRNAs increased over the course of differentiation, only a subset (marked with dotted lines), the dynamically regulated let-7s, also increased before processing, at the primary let-7 stage.

In higher organisms, a different system for regulating let-7 miRNA transcription must have been established.

Dynamically and constitutively transcribed let-7 loci show distinct epigenetic signatures.

Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA.

This is potentially an important issue to resolve as recent evidence suggests that not all let-7 miRNAs are processed by the same machinery[36], and therefore, the level of mature let-7 might not simply be DICER dependent.

In C. elegans, where let-7s were first discovered, there is evidence for both transcriptional and maturation control despite the fact that all let-7 is transcribed from a single locus.

We previously took advantage of a method that allows for the capture of nascent RNA transcripts, which are still associated with the chromatin from which they are transcribed, to carefully annotate pri- let-7 transcripts[19, 20].

In addition, in the case of let-7 miRNAs, other processes such as uridylation are used to stabilize or destabilize miRNAs[11– 13].

In so doing, we find that the RefSeq annotations underestimate the length of the let-7 polycistrons.

From these annotations, it is clear that many let-7 family members are transcribed within very long (up to 200KB), often polycistronic transcripts[20, 21].

0169237.g003 Fig 3Dynamically and constitutively transcribed let-7 loci show distinct epigenetic signatures.

Here we show that there is dynamism of let-7 transcription as measured by Chromatin -associated RNA-seq as witnessed by the fact that the let-7a3/b locus is practically silent in pluripotent stem cells, and neural progenitors derived therein, but strongly expressed in tissue derived neural progenitors (Fig 1A).

Accession numbers for these datasets are also found in Tables 1 and 2. S1 FigShown are each of the let-7 family member transcripts, including polycistrons.

At top are the Chromatin -associated RNA-Seq peaks and RefSeq annotations of the primary let-7 transcripts, and below are the relative intensities of DNAse sensitivity or histone modification ChIP-Seq peaks at those loci.

Furthermore, Chromatin -associated RNA-seq also allows for mapping reads which highlighted the fact that let-7 transcripts are long and sometimes polycistronic.

The middle section are data from the Chromatin RNA-seq described in Fig 1. Below in green are the annotations for let-7 miRNAs described in Cheng et al in the indicated cell types.

As further evidence that let-7 transcripts are polycistronic, the data in Fig 1A and 1B on dynamic versus constitutive indeed showed a shared pattern for those let-7s that are in the same polycistron.

Using these data and the imputed chromatin state mo del in tamed, we clearly identified TSSs, promoters (active and poised), enhancers, and actively transcribed regions for two of the let-7 polycistrons (Fig 3).

The study of mammalian pri- let-7 transcription is hampered by the relative scarcity of the transcript which is processed immediately in the nucleus and therefore difficult to detect.

Over evolution, let-7 isoforms have expanded such that the human genome contains 9 isoforms.

Z wgEncodeEH003090 GSM733662 NHDF-Ad H3K27ac wgEncodeEH001049 GSM733745 NHDF-Ad H3K27me3 wgEncodeEH001050 GSM733733 NHDF-Ad H3K36me3 wgEncodeEH001051 GSM1003526 NHDF-Ad H3K4me1 wgEncodeEH002429 GSM733753 NHDF-Ad H3K4me2 wgEncodeEH001052 GSM733650 NHDF-Ad H3K4me3 wgEncodeEH001053 GSM1003554 NHDF-Ad H3K79me2 wgEncodeEH002430 GSM733709 NHDF-Ad H3K9ac wgEncodeEH001054 GSM1003553 NHDF-Ad H3K9me3 wgEncodeEH002431 GSM1003486 NHDF-Ad H4K20me1 wgEncodeEH002417 WI-38 CTCF wgEncodeEH001902 GSM945265 WI-38 H3K4me3 wgEncodeEH001914 The genome regions surrounding known let-7 gene locations were surveyed for the presence of histone modifications and open chromatin in cell types representative of the stages of differentiation from PSCs to NPCs and neurons.

These sequences are not present upstream of mammalian let-7 gene, and there are not similarly consistently present sequences near all the different let-7 loci.

A complete presentation of transcriptional data from the other let-7 loci as demonstrated by Chromatin -RNA-seq is in (S1 Fig).

Shown are each of the let-7 family member transcripts, including polycistrons.

Complete annotation of let-7 miRNA transcripts and summary of available data on epigenetic marks across various cell types.

Chromatin -associated RNA-seq reads were mapped onto two distinct polycistronic let-7 loci.

Annotation of epigenetic marks at two let-7 polycistronic loci.

As with other miRNAs, the initial pri- let-7 transcripts are first transcribed by RNA polymerase II, then processed via the canonical pathway through the pre-miRNA stage generated by the action of Drosha/DGCR8.

Z wgEncodeEH003090 GSM733662 NHDF-Ad H3K27ac wgEncodeEH001049 GSM733745 NHDF-Ad H3K27me3 wgEncodeEH001050 GSM733733 NHDF-Ad H3K36me3 wgEncodeEH001051 GSM1003526 NHDF-Ad H3K4me1 wgEncodeEH002429 GSM733753 NHDF-Ad H3K4me2 wgEncodeEH001052 GSM733650 NHDF-Ad H3K4me3 wgEncodeEH001053 GSM1003554 NHDF-Ad H3K79me2 wgEncodeEH002430 GSM733709 NHDF-Ad H3K9ac wgEncodeEH001054 GSM1003553 NHDF-Ad H3K9me3 wgEncodeEH002431 GSM1003486 NHDF-Ad H4K20me1 wgEncodeEH002417 WI-38 CTCF wgEncodeEH001902 GSM945265 WI-38 H3K4me3 wgEncodeEH001914The genome regions surrounding known let-7 gene locations were surveyed for the presence of histone modifications and open chromatin in cell types representative of the stages of differentiation from PSCs to NPCs and neurons.

These issues bring to light an interesting question, why have mammals evolved to have so many let-7 isoforms in their genomes, and why do so in polycistronic fashion.

Using data from the Epigenetic Roadmap, we annotated the chromatin states across each polycistronic let-7 locus (Fig 3 and S2 Fig).

Computationally imputed chromatin states generated by the ChromHMM algorithm at the same let-7 loci.

Identification of dynamics of let-7 polycistron transcription.

S3 Fig Shown are the let-7 genomic loci with accompanying epigenetic marks as identified by ChIP-seq data available from the epigenetic roadmap across the indicated cell types.

We previously showed that pri-let-7 transcripts can be identified by Chromatin -associated RNA-seq data[20](NIH GEO Dataset GSE32916).

As further evidence for their polycistronic nature, these updated epigenetic data from a wide variety of primary cell types again predicted single, long transcripts across entire loci that encompass multiple let-7 family members, as opposed to older analyses on transformed cell lines upon which the RefSeq annotations were created.

19

It is interesting to note that most genes in this network are suppressed when let-7 family miRNAs are over-expressed (hES-MSC) and up-regulated when let-7 family gene expression goes down (HEPG2 cells).

Most genes in this network show a higher expression in HEPG2 cells (let-7 family miRNA expression low) relative to hES-MSC (let-7 family miRNA expression high) providing further support to our hypothesis that let-7 family of miRNAs are regulating these genes.

However combining the networks generated by sequence alignment of expressed miRNAs and Targetscan, we predict that HNF4A is indirectly regulated by the let-7 family of miRNAs.

Using such framework to conceptualize predicted miRNA gene targets from TargetScan, the targets for the let-7 family of miRNA were subjected to pathway exploration using the Ingenuity Pathway Analysis (Ingenuity [® ]Systems, http://www.

Since MSC conditioned medium contains exosomes with let-7 family miRNAs and these let-7 family miRNAs may regulate HNF4A (based on our network and expression analysis), it is highly likely that MSC conditioned medium mediated reduction of infarct size is achieved by indirect regulation of HNF4A mediated by the let-7 family of miRNAs.

Thus, a high level of expression of let-7 family of miRNA coincide with a low level of expression of HNF4A (e. g. hES_MSC) and vice versa (e. g. HEPG2).

Among the most abundantly expressed transcripts across both intra and extra-cellular environment (Tables 1 & 2) the let-7 family of miRNAs was the only overexpressed family of known miRNAs.

In summary, our study using a combination of alignment, statistical and network analysis tools to examine deep sequencing data of microRNAs in hES-MSC has led to a result that (i) identifies intracellular and exosome microRNA expression profiles of hES-MSCwith a possible mechanism of miRNA mediated intercellular regulation by these cells and (ii) placed HNF4A within the cross roads of regulation by the let-7 family of microRNAs.

Hepatic nuclear factor 4 alpha (HNF4A) was found to be a common node in both networks making it a highly probable downstream target of indirect transcriptional regulation by let-7 family of miRNA.

Conversely in HEPG2 cells where a high level of HNF4A is expressed, we find very low expression of let-7 family miRNAs.

It will be interesting to study the effect of Lin28 overexpression on differentiation of hepatocytes from hES-MSC since Lin 28 is a transcription factor that inhibits function of let-7 family miRNAs.

Since HNF family of transcription factors have been reported to be upregulated in hepatocytes derived from adipose tissue MSC [26], it is possible that let-7 regulates HNF4A levels during this process.

In undifferentiated MSC when let-7 miRNAs are highly expressed, expression of HNF4A is very low.

TargetScan [33] was used to predict gene targets for the let-7 family of miRNAs.

We suggest that let-7 family microRNAs might play a signalling role via such a mechanism amongst populations of stem cells in maintaining self renewal property by suppressing HNF4A expression.

let-7 targets include cell cycle regulators such as CDC25A and CDK6 [13]; promoters of growth including RAS and c-myc [14, 15] and a number of early embryonic genes including HMGA2, Mlin-41 and IMP-1 [16, 17].

Since genes in the HNF4A alignment network also show a similar expression profile to HNF4A in HEPG2 and hES-MSC cells, it is possible that the let-7 family miRNA regulation of HNF4A is mediated through genes in this network.

We utilized these results of which directed our attention towards establishing hepatic nuclear factor 4 alpha (HNF4A) as a downstream target of let-7 family of microRNAs.

Further we also verified the prediction that let-7 family miRNAs regulate the network of 50 genes, by examining the expression profiles of these genes in MSC and HEPG2 cells.

None of the target prediction algorithms predict the regulation of HNF4A by let-7 family of miRNAs.

Complexity Reduction using Gene interaction Networks revealed similarity in topology that suggested downstream targets for let-7 family of miRNAs.

let-7 miRNA was expressed at 5.7 fold higher levels in hES-MSC compared to HEPG2 cells, whereas HNF4A was undetectable in hES-MSC and very strongly expressed in HEPG2 cells (56,000 fold lower in hES-MSC {C [T ]32.63} compared to HEPG2 cells{C [T ]20.36}).

In conclusion, our study using a combination of different available tools to examine deep sequencing data by examining alignment, computer predictions, mathematical and network analysis has led us to a hypothesis that HNF4A is indirectly regulated by the let-7 family of miRNAs.

Further, let-7 also targets Dicer [18, 19] which is the protein responsible for miRNA maturation.

However, the large amount of predictive targets for the let-7 miRNA family constitutes a complexity that can be difficult to interpret and explore.

Thus, our study suggests the possibility of let-7 family of miRNAs indirectly regulating this particular transcription factor to achieve physiological changes.

The expression of let-7 family of miRNAs was verified by quantitative real time PCR.

Comparing both gene interaction network, similar topology was observed with HNF4A as a node amongst the interactions suggesting HNF4A as a possible downstream target for let-7 family miRNAs.

Our way of visualizing the roles of miRNA is via the concept of an integrated network emerging from the culmination of the interactions of the gene targets associated with the family of let-7 miRNAs.

Further results derived from visualization of our alignment data and network analysis showed that let-7 family microRNAs could affect the downstream target HNF4A, which is a known endodermal differentiation marker.

Therefore it is possible that the let-7 family of miRNA acts as a master regulator of miRNA function.

Since the let-7 family of miRNAs were abundantly expressed in MSC and given their central role in controlling cellular differentiation and miRNA regulation, we decided to focus on this family of miRNAs for further investigations.

To test the hypothesis that the network of genes surrounding HNF4A was controlled by let-7 family miRNA, we compared the expression of genes identified in the let-7 family alignment network in HEPG2 cells and hES-MSC.

let-7 family of miRNAs was first identified in C. elegans and has since been emerging as having important tumour-supressor role.

This led to our growing interest of let-7 miRNA's functional roles in hES-MSC.

The complete list of miRNAs in the intracellular and extracellular space of MSC ranked according to their abundance is given in supplementary file 1. let-7 family of miRNAs is represented predominantly in the top rankings miRNAs in both intra and extra cellular samples of hES-MSC.

Measurements of expression levels of let-7 family of miRNAs and HNF4A by quantitative real time reverse transcriptase polymerase chain reaction (qRT-PCR).

High read counts of let-7 family miRNAs transcripts are present in both intra and extra cellular samples of hES-MSC.

However, a high level of let-7 family of microRNAs is predominant in both intra- and extra- cellular samples of hES-MSC.

The elevated presence of let-7 microRNA in both intracellular and extra cellular environment further suggests a possible intercellular signalling mechanism through microvesicles transfer.

In our study, a high level of let-7 family of miRNA transcripts was predominant in both intra and extra cellular samples for our hES-MSC.

Apart from the let-7 family, other miRNAs like miR199b, miR22 & miR143 were also significantly overrepresented in both the intracellular and the extracellular hES-MSC samples.

20

Although HMGB1 was not shown to be a direct let-7 target, its expression is modulated by the direct let-7 target HMGA1 [51].

Furthermore, aberrant let-7 expression was associated with a variety of human diseases as, for example, cardiovascular diseases [28], liver fibrosis [29], lung diseases [30], and cancer [9– 12, 26, 31– 34].

Interestingly the expression of the direct let-7 target HMGA1 is as well induced by c-Myc [48], which constitutes a positive feedback loop, stimulating c-Myc expression [50] (Figures 6 and 10).

Additionally STAT3 was reported to bind the promoter of the let-7 biogenesis regulating gene Lin28, resulting in the concomitant upregulation of the let-7 targets RAS, c-Myc, and HMGA2 [158].

As described above let-7 was shown to be downregulated in prostatic CSCs [36] whereas reconstitution of the let-7 suppressed the growth of PC cells [10, 12].

Due to the complex regulation mechanisms of let-7 and its potential role in PC development and relapse the present review highlights let-7 and its direct and downstream targets in the context of PC.

Apart from various posttranslational protein modifications and transcriptional regulations of the c-Myc gene products, this gene was reported to be directly negatively regulated by members of the let-7 family [114, 115] (Figures 6 and 10).

Further, the reconstitution of the let-7 expression resulted in suppression of PC cell proliferation [10, 12].

Additionally, members of the miRNA let-7 family directly target IL6, which in turn constitutes a positive feedback loop on NF κB [31, 49] (Figures 7 and 10).

For a better overview all described interactions between the master regulator family let-7 and its major targets are summarized in Figure 10.

The expression of both HMGA1, HMGA2, and of its regulator let-7 was shown to be negatively correlating in gastroenteropancreatic neuroendocrine tumors [44] and retinoblastomas [72].

Furthermore, c-Myc was shown to transcriptionally activate Lin28 [119], which in turn inhibits the biogenesis of its regulator let-7 constituting a double negative feedback loop [47] (Figures 6 and 10).

Interestingly, CCND2 was shown to be a direct let-7 and miR-154 target like HMGA2 [11, 41, 45, 105] (Figures 5 and 10).

In conclusion the expression of the oncogenes NRAS, KRAS, and HRAS was described to be negatively regulated by several members of the let-7 family [42, 162] (Figures 8 and 10).

Thus, the master regulator family let-7 is as well a promising target in cancer of the prostate gland.

Although the role of let-7 is still not fully understood, it is evident that the let-7 family members have a distinct expression pattern in animal development [26].

Remarkably, the miRNA let-7 family members are major players in the regulation of gene expression and appear to contribute greatly to the maintenance of the Ying and Yang in “normal” prostatic cells.

Interestingly, the let-7 family [10, 11] and some of its above mentioned targets were already found to be implicated in PC.

In accordance they were found to be directly, negatively regulated by let-7 [45, 73, 74] (Figures 2 and 10).

In the embryonic stage the let-7 miRNAs were found to be barely detectable, but having an increased expression in differentiated cells [20, 27].

Notably, these let-7 targets are involved in a wide range of diverse cellular processes interwoven with let-7 and each other in a fine balanced way (Figure 10).

Further, miRNAs of the let-7 family were reported to directly, negatively regulate IL6 [24], NRAS [42], c-Myc, HMGA1 [43, 44], HMGA2 [45], and CCND2 [11].

Remarkably HMGA2 was described to bear seven let-7 -binding sites in its 3′-untranslated region (3′-UTR) [33].

Moreover, the disrupted pairing between let-7 and HMGA2 by mRNA truncations of the 3′UTR was reported to induce HMGA2 overexpression leading to tumor formation [33].

Additionally, HMGB1 was found to stimulate DNA binding of several steroid receptors including the let-7 downstream target AR (Figure 10) [97].

The elicited phosphorylation of MAPK1 and MAPK14 induces in turn the activation of the transcription factor NF κB (Figures 8 and 10) which controls the expression of various genes including the let-7 biogenesis-controlling Lin28 [47] and the cytokine IL6 [31, 161] (Figures 8 and 10).

The connection between EMT and let-7 is represented by the HMGA1 and HMGA2 genes, which are directly regulated by let-7 and were found to be implicated in EMT [40, 41].

HMGB1 was found to bind the AR promoter [52], AR protein was described itself to stimulate let-7 expression [53] (Figure 10).

Furthermore, HMGA2 was recently described to modify gene expression not only as protein but as well as a competing endogenous RNA (ceRNA) by acting as a decoy for mature let-7 miRNAs [78].

A promising marker candidate gene is the miRNA let-7, which was reported to be down regulated among others in human PC [9– 11].

Nevertheless, it is to be expected that a deeper understanding of the molecular interactions of let-7 and associated genes will significantly contribute to the development of novel diagnostic and therapeutic treatment modalities for PC.

Additionally the let-7 regulated oncogene c-Myc and the stem cell marker Klf4 were reported to stimulate the CCND2 transcription [106, 107] (Figures 5 and 10).

Additionally, a direct causal link between cancer and inflammation is given by the association of let-7, IL6, and NF κB, which are major players involved in the epigenetic switch from inflammation to cell transformation [31].

In previous reports a direct causal link between cancer and inflammation has been described with IL6, let-7, Lin28, and NF κB being the major players involved in the epigenetic switch from inflammation to cell transformation [31].

The c-Myc protein regulates the biogenesis of let-7 by stimulating Lin28 [46], Lin28 in turn blocks the maturation of let-7 [47].

In contrast to “less complex” organisms such as worms, vertebrates show a higher number of let-7 isoforms coded by different genes [16].

Remarkably, Johnson et al. reported numerous let-7 binding sites in the 3′-UTR of the RAS genes [42].

Furthermore, Tummala et al. highlighted the impact of the Lin28/ let-7/Myc axis on PC and demonstrated that Lin28 activates the AR (Figures 9 and 10) and promotes growth of PC [177].

One of the first described members of the large class of non-protein-coding RNAs is let-7 which was the second miRNA discovered and designated as lethal-7 (let-7) according to the phenotype of a let-7 deficient C. elegans mutant [20].

Lin28B was demonstrated to block the maturation of let-7 [46].

Remarkably, a linkage between these factors is the let-7 miRNA family.

As let-7 is linked with all these protein-coding genes a deeper insight into these connections is of great interest.

In humans, 13 let-7 family precursor miRNAs were described (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7e, let-7f, let-7g, let-7i, miR-98, and mir-202) which code for 10 different mature let-7 miRNA isoforms [25].

Concerning let-7 the respective acting ways are actually not entirely deciphered.

Soon thereafter, further let-7 homologs were identified in a variety of species ranging from vertebrates to mollusks [24].

Interestingly several let-7 family members were found to be located at fragile sites of human chromosomes potentially contributing to aberrant let-7 transcript levels [35].

21

Small molecule probes capable of restoring the levels of let-7 miRNAs through inhibition of the Lin28–pre-let-7 interaction would be powerful tools for assessment of its potential as a novel target in human disease, as well as for further elucidation of this pathway.

Two small molecules capable of inhibiting the interaction between Lin28 and pre-let-7g, and consequently able to restore Dicer -mediated cleavage of pre-let-7g in the presence of the inhibitor Lin28, were found.

The overall design of this study could be utilized as a basis to identify small molecule inhibitors of this interaction (inclusive of other members of the let-7 family), or other RNA targets of Lin28.

28, 32– 34 For example, a terminal loop mutant of pre-let-7g and a loopmiR targeting the pre-let-7a-1 terminal loop, both capable of directing pre-let-7 away from a Lin28 -mediated Dicer processing block, were shown to reverse Lin28-directed cellular transformation.

28, 35 These observations suggest that the LIN28–let-7 interaction might be an attractive target for conventional small molecule therapies; however, the well-known difficulties in targeting RNA–protein interactions with small molecules 30, 31 hamper validation of this hypothesis.

Studies in vitro and in vivo have generated compelling data to support the role of the micro-ribonucleic acid (miRNA) let-7 (Lethal 7) as a bona fide tumour suppressor gene, consistent with its involvement in regulating cell proliferation and differentiation.

4– 6 This inhibition is mediated by direct interactions between Lin28 and the let-7 precursor (pre-let-7), 7– 9 and has been suggested to be the result of a consequent combination of RNA structural changes, 10– 12 steric effects 6, 10, 11, 13 and uridylation.

Such interactions were responsible for destabilization of Watson–Crick base pairs within the terminal loop 10, 13 and consequently capable of inhibiting dicer processing of pre-let-7. [10] Lin28 itself is involved in a variety of let-7 -dependent and independent cellular processes; examples include cellular reprogramming, 18– 23 proliferation, 20, 24 skeletal myogenesis, [25] glucose metabolism, [26] neurogliogenesis 6, 27 and tumorigenesis.

Fig. 6 In vitro validated inhibitors of the interaction between pre-let-7g and Lin28.

1– 3 The biogenesis of specific members of the let-7 family of miRNAs is inhibited by the pluripotency factor, human abnormal cell lineage protein 28 (Lin28), predominantly at the Dicer processing step, in both embryonic stem cells (ESC) and embryonic carcinoma cells.

This confirms that the increase in Dicer processing of pre-let-7g by 6-hydroxy- dl-DOPA is due to inhibition of the Lin28–pre-let-7g interaction.

A fluorescence polarization based in vitro assay was established and exploited to identify small molecules capable of inhibiting the direct interaction between Lin28 and a truncated form of pre-let-7g (tpre-let-7g).

10, 36 To confirm that the change in P of FAUtpre-let-7g observed in the presence of Lin28 (0.33 μM, ΔmP, ∼50 mP) was due to a direct interaction between Lin28 and tpre-let-7g and not due to indirect effects, several control experiments were conducted.

Furthermore, two of the active molecules successfully restored Dicer processing of pre-let-7g in the presence of the inhibitor, Lin28, validating the overall approach.

Activity of the validated hits against the Lin28 -mediated inhibition of pre-let-7g processing by Dicer.

Upon addition of Lin28, the intensity of the mature let-7g band reduced, and that of the pre-let-7g band increased (Fig. 7a, compare lane 2 & lane 3, Fig. 7b) confirming Lin28 inhibition of Dicer processing of pre-let-7g in vitro.

Fig. 7Activity of the validated hits against the Lin28 -mediated inhibition of pre-let-7g processing by Dicer.

The effects of 6-hydroxy- dl-DOPA and SB/ZW/0065 on let-7g levels in Lin28 -expressing P19 embryonal carcinoma cells were also assessed.

In conclusion, we have identified inhibitors of the interaction between Lin28 and pre-let-7g.

In vitro validated inhibitors of the interaction between pre-let-7g and Lin28.

All validated hits displayed a dose -dependent inhibition of the Lin28–tpre-let-7 interaction.

A library of 2768 pharmacologically active small molecules, including FDA approved drugs, was screened and several small molecule inhibitors of the interaction between Lin28 and pre-let-7g were identified.

Remarkably, two of the active entities also prevented the Lin28 -mediated inhibition of Dicer processing of pre-let-7g in vitro, validating the screening approach.

Furthermore, it presents an alternate screening approach to those recently reported by Roos et al. [44] and Lin et al. [45] for identification of small molecule inhibitors of the Lin28–pre-let-7-TUTase system.

To assess whether the validated hits could prevent the Lin28 -mediated inhibition of let-7g biogenesis, the effect of these compounds on Lin28 blockage of pre-let-7g cleavage by Dicer was assessed through an in vitro.

28– 31 Lin28 is thought to act as an oncogene at least in part due to its role in the suppression of specific members of the let-7 family.

Small molecules can alter the polarisation value without inhibiting the FAUtpre-let-7g–Lin28 interaction.

[43] Of note, no change in thermal melting and/or RNase foot-prints of pre-let-7g was observed in the presence of 6-hydroxy- dl-DOPA and SB/ZW/0065 at compound concentrations of up to 30 μM, suggesting that these compounds are not binding directly to pre-let-7g (data not shown).

To facilitate the identification of small molecule inhibitors of the interaction between pre-let-7g and Lin28, a fluorescence polarization (FP) based binding assay was first established.

For the LIN28 inhibition assay, [32]P-pre-let-7g was pre-incubated with either the corresponding small molecule (1 vol% DMSO) or DMSO alone (1 vol%) in 1× Dicer buffer at RT for 30 min.

Several of these molecules were subsequently validated as inhibitors of the interaction between Lin28 and full-length pre-let-7g in an alternate biochemical assay.

All validated hits were again shown to inhibit the interaction between Lin28 and pre-let-7g at a concentration of 20 μM in the FP assay.

The attrition rate in the EMSA assay was high (see discussion) with only four compounds confirmed as true positives that inhibit the interaction between [[32]P]-pre-let-7g and Lin28 by ≥50% (Fig. 5a: compare lanes 2 & 10 to lane 6; Fig. 5b: compare lanes 2 & 11 to lanes 5, 6 and 9, Fig. 5c).

Results were normalized relative to the Dicer processing efficiency obtained for [[32]P]-pre-let-7g alone (positive control, lane 1) and in the presence of Lin28 (negative control, lane 2).

10, 13 Observation of the lower stoichiometric Lin28–pre-let-7 complexes is dependent on the concentration of Lin28 and the presence of competitor RNAs.

b. The change in fluorescence polarisation of 0.017 μM FAUtpre-let-7g in the presence of increasing concentrations of Lin28 was quantified from three independent experiments and represented as the average fraction of Lin28-bound FAUtpre-let-7g.

This resulted in a calculated fraction inhibition that was greater than 1 and suggested that these small molecules interfere with the fluorescence of the fluorescein label of FAUtpre-let-7g, lowering the baseline polarisation value.

Small molecules (100 μM, 1× binding buffer, 5 vol% DMSO), binding buffer/DMSO (1× binding buffer, 5 vol% DMSO) or unlabeled pre-let-7g (1× binding buffer, 5 vol% DMSO) were mixed with [32]P-pre-let-7g in 1× binding buffer and incubated at RT for 30 min.

It was noteworthy that one of the validated hits, 6-hydroxy- dl-DOPA (validated hit 10), restored Dicer processing of pre-let-7g to the level observed by Dicer alone (Fig. 7a, compare lane 1 to lane 2), in the presence of Lin28 (Fig. 7a, compare lane 2 and 3 to lane 7, Fig. 7b).

LIN28 (1.5 μM, 1× binding buffer) was added to the negative control ([32]P-pre-let-7g), samples ([32]P-pre-let-7g/small molecules) and positive control 1 ([32]P-pre-let-7g/unlabeled pre-let-7g).

Furthermore, no significant change in the intensity of FAUtpre-let-7g on addition of Lin28 was detected (ESI Fig. 1c †).

This data confirms that the ΔmP observed is due to specific interactions between tpre-let-7g and Lin28.

The secondary hits identified were tested against the full-length pre-let-7g–Lin28 interaction in an EMSA.

Validation of the secondary hits against the interaction between [[32]P]-pre-let-7g and Lin28 by EMSA.

Unlabeled tpre-let-7g (5 vol% DMSO, 1× binding buffer) was added to positive control 1 wells and used as a positive control competitor.

On addition of 1× and 10× unlabeled tpre-let-7g relative to the concentration of FAUtpre-let-7g, ΔmP reduced by ∼50 and 100% respectively (ESI Fig. 2 †), confirming that the system is responsive to specific competitors.

For FP detection, tpre-let-7g was labeled at the 3′ end with fluorescein (FAUtpre-let-7g) (Fig. 1a).

The effect of the validated hits upon this Lin28 -mediated block in pre-let-7g processing varied greatly.

a. & b. Representative EMSAs performed with [[32]P]-pre-let-7g, Lin28 (0.300 μM) and secondary hits (20 μM).

In contrast, a much larger excess (50×) of a C/A tpre-let-7g mutant (reported to display reduced LIN28 binding more than 8-fold relative to the wild-type [36]) was required to induce a ∼100% reduction in the ΔmP (ESI Fig. 2 †).

The final concentrations of small molecule and unlabeled tpre-let-7g were 20 μM and 0.170 μM, respectively.

The final concentrations in 1× binding buffer were as follows: LIN28 (0.300 μM), small molecules (20 μM) and unlabeled tpre-let-7g (0.170 μM).

SB/ZW/0065 and 6-hydroxy- dl-DOPA had no significant effect on let-7g levels in this cell system (data not shown).

To fulfil both of these criteria, the secondary hits were tested (at 20 μM concentration) in a radioactivity based EMSA against the interaction between [32]P-labeled full-length pre-let-7g ([[32]P]-pre-let-7g) and Lin28.

[9] The Dicer cleavage reaction and non-cleaved control consisted of [32]P-pre-let-7g, 1× Dicer buffer (75 mM NaCl, 20 mM Tris-HCl pH 7.5, 3 mM MgCl [2]) and in the case of the former recombinant Dicer (0.1 units, Invitrogen).

Unlabeled tpre-let-7g, used as a specific competitor, successfully depleted the ΔmP.

were normalized relative to the Dicer processing efficiency obtained for [[32]P]-pre-let-7g alone (positive control, lane 1) and in the presence of Lin28 (negative control, lane 2).

The dissociation constant (K [d]) of the FAUtpre-let-7g–Lin28 complex at equilibrium was 0.33 ± 0.04 μM (Fig. 1b).

[10] In the presence of Dicer we observed a reduction in the amount of pre-let-7g, and the appearance of an approximately 20 nt band, corresponding to the mature let-7g (Fig. 7a, compare lane 1 and lane 2).

Wells were defined as follows: negative control (FAUtpre-let-7g/Lin28), samples (FAUtpre-let-7g/Lin28/small molecules), positive control 1 (FAUtpre-let-7g/Lin28/unlabeled tpre-let-7g) and positive control 2 (FAUtpre-let-7g).

The FP signal of FAUtpre-let-7g and fluorescein was not altered in the presence of glutathione S-transferase (GST) and Lin28, respectively (ESI Fig. 1a & b †).

a. Structure of FAUtpre-let-7g.

FAUtpre-let-7g alone (0.017 μM) was added to the positive control 2 well.

a. Representative autoradiogram of the of [[32]P]-pre-let-7g in the presence of Lin28 and the validated hits (20 μM).

This study provides biophysical and biochemical proof of concept for the small molecule enhancement of Dicer processing of pre-let-7g.

Using this approach, a library of 2768 pharmacologically active small molecules (including FDA approved drugs) was screened and molecules that successfully prevented binding of Lin28 to tpre-let-7g were revealed.

Addition of unlabeled pre-let-7g (10×) to the Lin28–[[32]P]-pre-let-7g binding reaction was used as the positive control, and Lin28–[[32]P]-pre-let-7g binding reaction as the negative control.

A solution of pre-mixed recombinant human Lin28 (0.300 μM) and FAUtpre-let-7g (fluorescein modified tpre-let-7g) (0.017 μM) in 1× binding buffer was distributed to sample, negative control, and positive control 1 well.

Conditions described above were applied in all assay development steps, with substitutions of Lin28 for GST, FAUtpre-let-7g for fluorescein and unlabeled tpre-let-7g for alternative RNAs (C/A pre-let-7g mutant and total yeast RNA).

Fig. 5Validation of the secondary hits against the interaction between [[32]P]-pre-let-7g and Lin28 by EMSA.

We describe the development and validation of a fluorescence polarization (FP) based assay for high-throughput screening of modulators of the Lin28–pre-let-7g interaction.

22

Here we showed that the overexpression of miR-203 results in increased expression of let-7, and knockdown of let-7 reversed the inhibitory effects of miR-203 overexpression on tumor cell growth.

Mechanistically, miR-203 directly targets LIN28B, which is a critical repressor of the maturation of miRNAs, particularly let-7. Previous studies have defined a regulatory loop consisting of Lin28 and let-7, in which LIN28B suppresses let-7 maturation and let-7, in turn, directly targets LIN28B 21 22.

After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1).

Consequently, the expression levels of let-7 were decreased (Fig. 3C), suggesting that the induction of miR-203 inhibits LIN28B expression and subsequently rescues the suppression of let-7 by LIN28B.

Our findings are consistent with previous studies showing that LIN28B inhibits let-7 biogenesis, which in turn promotes the proliferation and inhibits the apoptosis of cancer cells 24 25, A549 cells transfected with LIN28B siRNA had a significantly lower proliferation rate and a higher apoptosis rate, whereas the cells transfected with the LIN28B overexpression plasmid showed the opposite effects (Fig. S2).

In summary, the present findings indicate that LIN28B is crucial for the proliferation and invasion of lung cancer cells due to its suppression of let-7 biogenesis and that miR-203 enhances let-7 biogenesis by silencing LIN28B expression, and consequently functions as a critical tumor suppressor during lung tumorigenesis.

On the other hand, the expression of the LIN28B protein was increased in A549 and 95D cells transfected with the miR-203 antagomir (Fig. 3B), leading to the subsequent downregulation of let-7 in A549 and 95D cells (Fig. 3C).

In this study, let-7 expression was found to be concordant with the miR-203 expression in normal and tumor tissues, underscoring the coordinated regulation of these two miRNAs via LIN28B as a link.

Taken together, the findings of this study show that miR-203 directly targets LIN28B and enhances let-7 biogenesis to suppress tumor growth in lung cancer.

Together, our results indicate that miR-203 directly recognizes and binds to the 3′-UTR of the LIN28B mRNA transcript and suppresses LIN28B expression, which in turn enhances let-7 biogenesis in lung cancer cells.

How to cite this article: Zhou, Y. et al. miR-203 enhances let-7 biogenesis by targeting LIN28B to suppress tumor growth in lung cancer.

A549 cells in which LIN28B expression was silenced using siRNA had a much higher level of let-7, whereas the cells transfected with the LIN28B overexpression plasmid showed decreased let-7 (Fig. S2).

miR-203 inhibits the proliferation and promotes the apoptosis of lung cancer cells by suppressing LIN28B and enhancing let-7 biogenesis.

The notion that LIN28B is the direct target of let-7 has already been established 24 25.

In fact, let-7 has been regarded as a bona fide tumor suppressor, and accumulating evidence has demonstrated that it has crucial roles in the development of cancer.

In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein.

miR-203 enhances let-7 biogenesis by directly targeting LIN28B.

Indeed, LIN28B and let-7 are inversely expressed in normal and malignant tissues 9 41.

Thus, LIN28B not only inhibits the biogenesis of let-7 family miRNAs but also induces their degradation.

Accordingly, miR-203 -induced let-7 provides a conserved mechanism to explain the suppressive role of miR-203 during lung tumorigenesis.

The binding of LIN28B to either pri-let-7 or pre-let-7 inhibits let-7 precursor processing by Drosha and Dicer 48.

The LIN28B protein and mRNA and let-7 expression levels in NSCLC tissues.

For the overexpression of miRNAs, 10 pmol of miR-203 agomir or let-7 agomir were used.

Recently, let-7 has been shown to act in a metastasis -associated signaling cascade involving the RAF kinase inhibitory protein 56 57.

Recent studies have discovered that LIN28 and let-7 family miRNAs tend to play opposing roles in many cellular processes, in particular those involved in cancer development and progression 12.

These results suggest that LIN28B functions as a link between the miRNAs miR-203 and let-7. We next investigated whether the overexpression or knockdown of miR-203 influenced cell proliferation and apoptosis by affecting let-7 biogenesis.

For the miRNA knockdown, 10 pmol of miR-203 antagomir or let-7 antagomir were used.

As expected, A549 cells transfected with the let-7 agomir exhibited decreased proliferation and increased apoptosis; in contrast, knockdown of let-7 had the opposite effects on A549 cells (Fig. S4).

A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2).

Oligo-uridylated pre-let-7 can also be degenerated by the 3′-5′ exonuclease Dis312 51 52.

These results demonstrated that miR-203 specifically represses LIN28B protein at the post-transcriptional level to enhance let-7 biogenesis.

The presence of a double -negative feedback loop between LIN28A/LIN28B and let-7 was also reported 12.

Both the CSD and CCHC zinc fingers of LIN28B can interact with the conserved residues of pri-let-7 and pre-let-7; the CSD inserts into the apical point of the precursor loop, while the CCHC zinc fingers dimerize on a GGAG motif adjacent to the Dicer cleavage site 46 47.

23

More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55].

It was found that miR-15a and miR-16 were deleted or downregulated in lymphocytic leukaemia [39]; let-7 was downregulated in lung cancers [40, 41]; the miR-17 cluster was amplified in several types of lymphoma and solid tumours [31, 42, 43]; miR-21 was overexpressed in glioblastoma [44, 45] and breast cancer [46]; levels of miR-143 and miR-145 were decreased in colorectal neoplasia, breast, prostate and cervical cancers [46, 47]; miR155 was upregulated in Burkitt and B-cell lymphomas [48- 50] and also in breast cancer [46].

We present evidence for the down-regulation of c-MYC, one of the most potent and frequently deregulated oncogenes, by let-7 miRNA, via the predicted binding site in the 3'UTR, and verify the suppression of BCL-2 by miR16.

In humans, let-7 is expressed in normal adult lung tissue but poorly expressed in case of lung cancers [40, 71], which suggests that this miRNA may function also as a tumour suppressor.

Mounting evidence shows that the expression of the RAS oncogene is regulated by let-7, and that RAS is significantly over-expressed in lung tumour samples [40].

Both let-7 and miR-16 have been shown to downregulate their target oncogenes, c-MYC and BCL-2, respectively.

We present here evidence that let-7 binds to the 3'UTR of c-MYC oncogene and downregulates its expression.

Here we demonstrate that c-MYC is targeted by let-7. We show that 22-nt sequence from the c-MYC 3'UTR, predicted to be a binding site for let-7c, is enough to cause down-regulation of a reporter gene in HeLa cells.

Spontaneous c-MYC over -expression could be therefore the result of down-regulation or loss of specific let-7 loci.

In addition, suppression of let-7 miRNAs in these cells by anti-let-7 significantly recovers reporter gene expression.

Moreover, the suppression of let-7 in HeLa affects also the expression of the endogenous c-MYC, leading to an increase at both mRNA and protein levels.

Moreover, it has been shown that over -expression of let-7 inhibited cell growth of a lung cancer cell line in vitro [71].

We have monitored c-MYC expression at the mRNA and protein levels following the inhibition of let-7 with the antisense synthetic let-7 oligo (anti-let-7c from Dharmacon) in HeLa cells.

Finally, we determined the extent to which endogenously-expressed c-MYC is subjected to the regulation by let-7 microRNA.

Given the known importance of the regulatory miRNA we tested (let-7) and the targeted oncogene (c-MYC) studied, the validation of a let-7/ c-MYC interaction may be of particular interest.

The miRNAs that are encoded by let-7 family are conserved between mammalian species, both at the sequence level and at their temporal expression patterns, which probably indicates their general role in gene regulation [16].

The sensor construct carrying the c-MYC potential single binding site for let-7c appeared to be consistently well down-regulated by let-7 microRNA.

In this last report, the down-regulation of let-7 was shown to correlate with metastasis or higher proliferation index, which could additionally support our hypothesis for c-MYC involvement [46].

Moreover, the down-regulation of let-7 family members (including let-7c but excluding let-7b) has been reported elsewhere for breast cancer [46].

Based on our analysis it is not possible to specify which member(s) of the let-7 family is (are) responsible for the down-regulation of c-MYC.

Our results indicate that the expression of the c-MYC gene, which is one of the critical oncogenes, is modulated by let-7, expanding the number of validated oncomirs.

The 3'UTRs of the human RAS genes contain multiple let-7 complementary sites, allowing let-7 to regulate RAS [40].

However, the mechanism by which let-7 regulates cell cycle is unknown.

Although at present a comprehensive picture of the regulatory function of the let-7 miRNA family cannot be drawn, it is tempting to speculate on possible roles for this miRNA family in a complex network of interacting, proproliferative/proapoptotic factors.

The construct with the single let-7 b. s reduced the luciferase activity to 66.8 % of the control, while for the construct with the whole 3'UTR the reduction was on average up to 45.6 %.

In each tested MYC mRNA we could detect and identify in the 3' UTR a binding site for a representative of the human/murine let-7 member of miRNAs (Additional file 2).

The following reporter constructs were tested: (A) BCL-2 reporter constructs carrying a single binding site for miR-16, (B) BCL-2 reporter construct carrying a triple binding site for miR-16, (C) c-MYC reporter constructs carrying a single binding site for let-7, (D) c-MYC reporter constructs including sensors carrying the whole 3'UTRs from the c-MYC gene.

Predicted interactions of different human and murine MYC mRNAs with miRNAs of the let-7 family.

Click here for file Predicted interactions of different human and murine MYC mRNAs with miRNAs of the let-7 family.

The co-transfection of anti let-7 resulted in derepression of the luciferase activity in sensor constructs (the exception was the construct bearing PM b. s for c-MYC), although derepression was not equally efficient for all sensor constructs (Additional file 3).

Biological data may give some clues as to which of the let-7 family members may be more likely to interact with c-MYC in vivo.

We have also checked all the human/murine MYC potential interactions with let-7 and found that they are all located in the 2/3-th region of the 3'UTR.

24

To determine whether the let-7 miRNA is a critical mediator regulating IL-6 expression in MSCs, we overexpressed let-7 in 3A6 cells by transfecting cells with a synthetic let-7c precursor as the representative let-7 miRNA because of its higher expression than other members in 3A6 (data not shown), or inhibited expression levels using anti-miR oligonucleotides complementary to mature let-7 sequences, respectively.

Unlike these miRNAs are upregulated, we have shown here that the loss of let-7 in bone marrow-derived MSCs triggers their adipogenic differentiation through upregulating IL-6 expression.

This result corresponded to our marker analysis in which the expression of PPARγ, Adipoq, and UCP1 was suppressed in 3A6 [LNCaP] and 3A6 [PC3] cells when the cells were transfected with the let-7c precursor and upregulated in anti-miR let-7 -treated 3A6 [RWV] cells compared to the control oligonucleotides -transfected cells (Fig. 8B).

Collectively, these results demonstrated that let-7 downregulation confers the reactive stromal phenotypes of prostate cancer -associated MSCs through its target gene IL-6. 10.1371/journal.

Collectively, these results demonstrated that let-7 downregulation confers the reactive stromal phenotypes of prostate cancer -associated MSCs through its target gene IL-6. 10.1371/journal.

Let-7 microRNA (miRNA) is Downregulated in Cancer -associated MSCs and Targets IL-6 mRNA.

There is a possibility that these 3A6 [LNCaP]-specific miRNAs and/or -associated genes involve in the regulation of IL-6 expression by pass the function of let-7, and this could explain, at least in part, why 3A6 [LNCaP] and 3A6 [PC3] expressed similar level of let-7 but different amount of IL-6. However, the causative molecular basis of let-7 alterations in cancer -associated MSCs is not yet understood.

Conversely, the inhibition of let-7 expression in normal 3A6 [RWV] cells resulted in a 20% increased level of adipocyte formation (Fig. 8A).

A recent study [58] reported a regulatory circuit in which inflammatory signals stimulate NF-κB nuclear translocation which directly activates LIN28 transcription and substantially inhibits the biogenesis of let-7, thereby generating high levels of IL-6, an activator of NF-κB.

The inhibitory effects of ectopic let-7 expression on adipogenesis and pro-metastatic activity of 3A6 [PC3] cells can be reversed by additional IL-6 (Fig. S5).

Treatment with exogenous let-7 would target both cancer cells and their associated MSCs and could be an attractive therapeutic approach to effectively inhibit prostate cancer recurrence and prevent metastasis.

Other than let-7 family members that were significantly downregulated in both 3A6 [LNCaP] and 3A6 [PC3] in comparison with 3A6 [RWV], some miRNAs were found up or down only in one cell line by microarray analysis.

Among 9 miRNAs that were characterized to be significantly downregulated in both 3A6 [LNCaP] and 3A6 [PC3] cells in comparison with 3A6 [RWV] by microarray analysis (data not shown), let-7c, let-7d, let-7g, let-7f, and miR-98 are members of the let-7 family and were identified to potentially bind the 3′-UTR of IL-6 mRNA using the TargetScan algorithm.

Values are presented as the means ± SD of relative expression levels of let-7c expression in the let-7-specific transfectants compared to that of negative control (Ctr) oligonucleotide transfectants after normalized with the U6 internal control.

To characterize the biological effects of downregulated let-7 in the behavioral changes of cancer -associated MSCs, we modulated the expression levels of let-7 in the normal 3A6 [RWV] and the cancer -associated 3A6 [LNCaP] and 3A6 [PC3] cells by transient transfection of the anti-miR let-7 and let-7c precursor, respectively (Fig. S4).

Taken together, these results demonstrated that IL-6 is the direct target of let-7 in MSCs.

Thus, it is possible that one of the reasons for the downregulation of let-7 in cancer -associated MSCs is increased LIN28 activity through the positive feedback loop of IL-6 that is initiated by prostate cancer cells.

The autocrine production of IL-6 through the downregulation of let-7 miRNA by MSCs, in particular those that are associated with osteolytic prostate cancer, is central to facilitating the adipogenic differentiation of MSCs and for their supporting effects on cancer metastasis.

The impact of altered let-7 expression on adipogenic differentiation was first determined.

Identification of let-7 as an IL-6 targeting miRNA in cancer -associated MSCs.

0071637.g007 Figure 7(A) Quantitative RT-PCR analysis of the expression levels of let-7 miRNA in normal 3A6 [RWV] and cancer -associated 3A6 [LNCaP] and 3A6 [PC3] cell lines.

Let-7 miRNA Inhibits Reactive Stromal Phenotypes of Cancer -associated MSCs.

Cells were transfected with either pre-miRNAs (pre-miR negative control and pre-miR-let-7c) (Ambion, Austin, TX) or the LNA™ miRNA inhibitors (anti-miR negative control and anti-miR-let-7) (Exiqon, Vedbaek, Denmark) at a final concentration of 10 nM or 30 nM, respectively, using DharmaFECT transfection reagent (Dharmacon, Lafayette, CO) according to the manufacturer’s instructions.

Importantly, repressed let-7 expression was observed in various cancers [60], including prostate cancer [61], and contributes to carcinoma aggressiveness.

Figure S4 Expression level of let-7 in the transfectants of 3A6 derivatives.

Cancer -associated 3A6 [LNCaP] and 3A6 [PC3] cells transfected with the let-7c precursor or miR control, and normal 3A6 [RWV] cells transfected with let-7 inhibitors or the anti-miR control were induced to adipogenic differentiation (A, B), or were cocultured with prostate cancer cell lines for transwell migration assay (C).

0071637.g008 Figure 8Cancer -associated 3A6 [LNCaP] and 3A6 [PC3] cells transfected with the let-7c precursor or miR control, and normal 3A6 [RWV] cells transfected with let-7 inhibitors or the anti-miR control were induced to adipogenic differentiation (A, B), or were cocultured with prostate cancer cell lines for transwell migration assay (C).

Quantitative RT-PCR results confirmed the significantly decreased expression of these let-7 family members in 3A6 [LNCaP] and 3A6 [PC3] cells compared to normal 3A6 [RWV] (Fig. 7A).

Quantitative RT-PCR and ELISA analysis showed that IL-6 expression was decreased in let-7c precursor -transfected cells and increased in anti-miR-let-7 -transfected cells compared with the respective control oligonucleotides (Fig. 7B).

We next analyzed the effects of let-7 on the pro-metastatic activity of MSCs.

Moreover, cotransfection of these reporter vectors with a let-7 unrelated miRNA, miR-199a, caused no difference in luciferase activity, further confirming the specificity of the binding sequences.

Effect of let-7 on reactive phenotypes of MSCs.

Moreover, let-7 blockage in 3A6 [RWV] cells augmented the chemotactic responsiveness of prostate cancer cells in vitro (Fig. 8C).

25

Depleting RCK/p54 in HeLa cells up-regulated RAS protein, and this increase in RAS levels was higher than that in general translation of control actin (Figure 7C), suggesting that multiple sites of let-7 miRISC binding to target 3′ UTR dictate the potency and specificity of translation suppression.

Interestingly, combining these two approaches to release translation suppression, let-7 2′- O-Me oligo and RCK/p54 depletion, did not show additive effects to induce NRAS and KRAs expression.

HeLa cells transfected with an Rr-luc -expressing vector, pRL-TK, and a Pp- luc -expressing vector, pGL3-control, pGL3-NRAS, or pGL3-KRAS, were co -transfected with 100 nM of 2′- O-Me oligonucleotide (let-7 2′- O-Me inhibitor or 2′- O-Me control) and siRNA against RCK/p54 or CDK9 mm control.

We chose RAS because it is an endogenous target of let-7, and 3′ UTRs of human RAS genes contain multiple complementary sites for let-7 to bind and regulate RAS expression levels [13].

Cells transfected with a control siRNA and let-7 inhibitor induced more firefly luciferase expression when reporter plasmids contained 3′ UTR sequences for NRAS and KRAS than for the control siRNA and a 2′- O-Me oligo control (Figure 7D), consistent with a recent report [13].

Furthermore, let-7 inhibitors are known to enhance RAS protein expression in HeLa cells [13].

HeLa cytoplasmic extracts expressing Myc-Ago1 and Flag-Ago2 were incubated with 3′-biotinylated- let-7–2′- O-Me inhibitor, which is complementary to the let-7 miRNA, and incubated with streptavidin-conjugated magnetic beads.

let-7 miRISC cleavage of a perfectly matched RNA target was inhibited by 2′- O-Me oligonucleotides complementary to let-7 miRNA (let-7–2′- O-Me or let-7–2′- O-Me-biotin).

To further probe our findings of endogenous RAS regulation by RCK/p54, we co -transfected HeLa cells with RAS 3′ UTR reporter constructs and let-7 2′ - O-Me inhibitor or siRNA against RCK/p54.

For example, relatively low levels of let-7 miRNA up-regulate RAS protein in lung cancer cells, demonstrating a possible role of miRNA in tumorigenesis [13].

miRISCs purified by anti-Ago2 and anti-RCK/p54 antibodies showed efficient target let-7 cleavage (Figure 5D, lanes 4 and 6).

Cell extracts containing let-7 miRISC cleaved perfectly matched radiolabeled target mRNA with high efficiencies, whereas a substrate mRNA containing a mismatched sequence was not cleaved (Figure 3A, lanes 2 and 3).

As a control, cell extracts were treated with the let-7–2′- O-Me inhibitor without 3′-biotinylation.

These results are consistent with previous reports [54, 55] that adding 2′- O-Me oligonucleotides complementary to let-7 abolishes target cleavage activity by let-7 in cell extracts, indicating complete hybridization of the 2′- O-Me probe.

Incubation with let-7 inhibitors (with or without 3′-biotin) blocked the cleavage activity of let-7 miRISC in supernatant or beads (Figure 3B, lanes 2–3, and lanes 5–6).

To address these questions, we disrupted P-bodies in cells by depleting Lsm1 and immunopurified endogenous miRISC, and analyzed its ability to cleave a target mRNA with perfect complementarity to let-7 miRNA (Figure 5).

To specifically capture endogenous miRISC, 2′- O-methyl (2′- O Me) inhibitors of let-7 miRNA were employed [54, 55].

When cells were treated with let-7 inhibitor, RAS protein levels increased, consistent with previous findings [13].

We further show that depletion of RCK/p54 did not significantly affect the RNAi function of RISC, but released general, miRNA -induced and let-7 -mediated translational repression.

HeLa cells were transfected with 100 nM of 2′- O-Me oligonucleotide (let-7 2′- O-Me inhibitor or 2′- O-Me control), and siRNA against RCK/p54 or CDK9 mm control.

Furthermore, depletion of RCK/p54 did not significantly affect the RNAi function of RISC, although general, miRNA -mediated, and let-7 -mediated translational repression were released.

Despite the significant loss of P-body structures in cells treated with Lsm1 siRNA, the efficiency of let-7 target mRNA cleavage by miRISC purified by anti-RCK/p54 antibody was not significantly affected (compare Figure 3A, lane 9 with Figure 5D, lane 6).

Figure S3 Let-7 Inhibition Does Not Affect RAS mRNA Levels Total RNA samples (3 μg) from HeLa cells transfected with 100 nM of let-7 2′- O-Me oligonucleotides or 50 nM siRNA against RCK/p54 were reverse-transcribed and analyzed by quantitative PCR to quantify mRNA levels.

RAS mRNA levels did not differ drastically in HeLa cells after treatment with let-7 inhibitor, RCK/p54 silencing, or mock treatment (Figure S3).

The data in Figure 3B (lanes 1 and 4) show that cell extracts containing active let-7 miRISC cleaved the perfectly matched target mRNA with high efficiencies [54, 55].

miRISCs purified by anti-Ago2 and anti-RCK/p54 antibodies showed efficient cleavage of let-7 target mRNA (Figure 3A, lanes 7 and 9).

To test our hypothesis, we analyzed RAS protein levels in HeLa cells under two conditions: either let-7 function was inhibited by 2′- O-Me oligonucleotides complementary to the let-7 sequence or RCK/p54 was depleted by RNAi (Figure 7C).

Cytoplasmic extracts of HeLa cells expressing Flag-Ago2 and Myc-Ago1 were incubated with 2′- O-Me oligonucleotides complementary to let-7 miRNA (let-7–2′- O-Me or let-7–2′- O-Me-biotin), affinity-purified by streptavidin-magnetic beads to capture let-7 miRISC.

Function was determined by assaying for in vitro cleavage of a [32]P-target mRNA that perfectly matched the let-7 sequence.

Target mRNAs were prepared and in vitro cleavage by GFP-siRISC and let-7-miRISC was assayed as described [53].

Such a protein, human RAS, has been elegantly shown by Slack and colleagues [13] to be regulated by the let-7 miRNA family.

After establishing the functional assay to analyze miRISC, we next affinity-purified miRISC on magnetic beads using anti-Ago2 and anti-RCK/p54 antibodies and assessed the cleavage of perfectly matched let-7 target mRNA by the bead and supernatant phases.

The Pp-luc/ Rr-luc signals were normalized to those from pGL3-control -transfected cells, showing let-7-regulated gene silencing of RAS 3′ UTR.

Let-7 Inhibition Does Not Affect RAS mRNA Levels.

To assess the ability of endogenous immunopurified miRISC to cleave target mRNA with perfect complementarity to let-7 miRNA, in vitro cleavage assays for let-7 miRISC were conducted.

A 182-nt [32]P-cap-labeled let-7 substrate mRNA was incubated with the supernatant (S) or bead (B) phases of captured miRISC.

miRISC did not cleave a mismatched substrate RNA for let-7 (Figure 5D, lane 7).

After immunoprecipitation, RISC activities were analyzed by incubating the supernatant (S) or bead (B) phases with 182-nt [32]P-cap-labeled let-7 substrate mRNAs having a perfectly matched or a mismatched sequence to the let-7 miRNA.

Immunoblot analysis of affinity-purified miRISC using anti-Myc, anti-Flag, anti-RCK/p54, and anti-eIF4E antibodies (Figure 3C) showed that Myc-Ago1, Flag-Ago2, and RCK/p54 were associated with let-7 miRISC.

After immunoprecipitation, RISC activities were analyzed by incubating the supernatant (S) or bead (B) phases with 182-nt [32]P-cap-labeled let-7 substrate mRNAs having a perfectly complementary or mismatched sequence to the let-7 miRNA.

26

SNAI1 Expression Is Temporally Associated with Let-7 DownregulationNext, we explored the potential mechanism by which SNAI1 enhances reprogramming, noting the references that link EMT with downregulation of the let-7 family of tumor suppressor miRs (Chang et al., 2011; Kong et al., 2010; Li et al., 2009; Yang et al., 2012).

As shown here, SNAI1 binds several let-7 promoters, and SNAI1 expression is associated temporally with downregulation of let-7 miRs early in reprogramming, consistent with prior evidence that EMT factors suppress let-7 expression in cancer (Yang et al., 2012).

Expression of let-7 miRs can promote differentiation of pluripotent stem cells, and a let-7 inhibitor promotes dedifferentiation; thus, let-7 downregulation is likely essential to reprogramming (Melton et al., 2010).

• Knockdown of SNAIL reduces and overexpression enhances reprogramming • SNAIL-YFP -positive fractions reprogram at higher efficiency • Let-7 decreases early in reprogramming, and expression of SNAIL reduces let-7 • SNAIL binds to the promoters of let-7 family members during reprogramming somatic cells to induced pluripotent stem cells (iPSCs) holds great promise for disease mo deling and therapeutic applications.

We also noted a trend toward higher expression of several let-7 members in FVB than in B6×129 strain prior to reprogramming, correlating high expression with augmentation of reprogramming efficiency upon SNAI1 overexpression (Figure S4F).

The downregulation of let-7 transcription by SNAI1 may be associated with upregulation of LIN28 by pluripotency factors, thereby potently reversing the differentiated state.

While let-7 is downregulated in the first week of reprogramming, its expression appears to recover thereafter before again diminishing to near zero in the iPSC state (Figures 4E, 4F, and S4D).

Next, we explored the potential mechanism by which SNAI1 enhances reprogramming, noting the references that link EMT with downregulation of the let-7 family of tumor suppressor miRs (Chang et al., 2011; Kong et al., 2010; Li et al., 2009; Yang et al., 2012).

LIN28, a regulator of miR biogenesis and an alternative reprogramming factor (Viswanathan et al., 2008; Yu et al., 2007), inhibits the processing and maturation of let-7 and is in turn a let-7 target (Rybak et al., 2008).

SNAI1 Expression Is Temporally Associated with Let-7 Downregulation.

Let-7 inhibition stimulates OSK reprogramming efficiency (without c-MYC) to the same extent as does c-MYC, and forced let-7 expression decreases reprogramming efficiency (Worringer et al., 2014).

We further demonstrated that SNAI1 binds the let-7 promoter, which may play a role in reduced expression of let-7 microRNAs, enforced expression of which, early in the reprogramming process, compromises efficiency.

Mature let-7 family miRs, regulators of developmental timing (Ambros, 2011), are absent in pluripotent cells and are expressed at high levels in differentiated cell populations (Viswanathan et al., 2008).

Let-7 inhibits expression of pluripotency factors (including LIN28, c-MYC, and SALL4) (Melton et al., 2010) and cell cycle regulators critical for the ES cell phenotype (such as CDK6, CDC25A, and cyclin D) (reviewed in (Mallanna and Rizzino, 2010).

Using inducible Snail ER, we observed downregulation of let-7 after 7 days of TMX treatment in mouse fibroblasts (Figures 4A and S4A).

Moreover, overexpressing SNAI1 in a poorly reprogramming strain augments both reprogramming efficiency and SNAI1 binding to the let-7 promoter, suggesting SNAI1 regulation of let-7 may be the basis for enhanced reprogramming efficiency.

These data suggest downregulation of the let-7 miRs as a possible mechanism by which SNAI1 influences reprogramming (diagrammed in Figures 4H, S4G, and S4H).

To understand the role of let-7 in reprogramming, we expressed let-7 in MEFs from a strain of mice carrying a dox-inducible transgene at various stages of reprogramming (Zhu et al., 2011).

KD of SNAI1 resulted in increased let-7 expression (Figure 4B).

We found that let-7 overexpression compromised efficiency when done during the first, but not the second, 7 days of reprogramming (Figure 4G).

Upon TMX treatment of SNAI1-ER expressing fibroblasts (without reprogramming), SNAI1 binding to let-7 members similarly increases (Figure 4D).

A role for let-7 in reprogramming has been established since its inhibition increases reprogramming efficiency (Melton et al., 2010).

We propose that suppression of let-7 miRs is a mechanism whereby SNAI1 might be acting to confer these stem cell properties.

Chromatin immunoprecipitation (ChIP) confirmed that SNAI1 binds the promoters of several let-7 family members during early stages of reprogramming in B6×129 fibroblasts (Figure 4C) and in FVB overexpressing SNAI1-ER more so than without induction (Figure S4B).

Moreover, a connection between EMT factors and the transcriptional regulation of let-7 has been reported (Chang et al., 2011; Kong et al., 2010; Li et al., 2009).

We evaluated expression of let-7 during OSKM -induced reprogramming and found let-7a, let-7e, let-7g, and let-7i decreased in both fibroblasts and keratinocytes in the early phase (Figures 4E, 4F, S4C (parallel fibroblast data for Figure S1A), and S4D).

27

Lin-28B overexpression increased the expression of the HMGA2, c-MYC and KRAS genes, which are targeted by the cancer suppressor miRNA let-7. High Lin28B expression was associated with decreased let-7 expression and increased HMGA2, c-MYC and KRAS expression in human PDAC samples.

In addition, Lin28B silencing in PDAC cells inhibited cell proliferation, cell cycle transition, migration and the EMT and increased the expression of the c-MYC, HMGA2 and KRAS genes, which are targeted by the cancer suppressor miRNA let-7. However, Lin28B overexpression had the opposite effect.

Thus, Lin28B may increase the proliferation and migration of PDAC cells by directly inhibiting let-7 expression and subsequently upregulating HMGA2, c-MYC and KRAS expression.

We analyzed the GSE data sets to determine whether Lin28B promotes the growth and survival of PDAC cells by inhibiting let-7. The expression of let-7 targets was substantially increased in the subtype with high Lin28B expression, which exhibited increased levels of KRAS signaling intermediates and c-MYC targets (Figure 6A).

NF-kB directly activates Lin28B transcription, leading to the inhibition of let-7 and expression of IL-6 (a let-7 target).

In this study, Lin28B overexpression decreased let-7 levels and Lin28B expression was inversely correlated with let-7 expression in human PDAC samples.

Of the known let-7 targets, HMGA2 is the most frequently reported target of let-7 involved in inhibiting invasion and metastasis [39].

Figure 6GSEA plot of let-7, MYC targets and the KRAS signaling pathway in the subgroups with high and low Lin28B expression.

Lin28 and Lin28B each contain an N-terminal cold shock domain and a pair of retroviral-type CCHC zinc fingers near the C-terminus that confer RNA binding ability [7, 8] and inhibit the biogenesis of tumor-suppressive miRNAs of the let-7 family [9– 11].

GSEA plot of let-7, MYC targets and the KRAS signaling pathway in the subgroups with high and low Lin28B expression.

Lin28 inhibits let-7 biogenesis by recruiting a non-canonical poly (A) polymerase (Zcchc11/TUT4) to suppress pre-let-7 maturation [29], whereas Lin28B blocks let-7 processing through a Zcchc11-independent mechanism.

Although Lin28B -mediated repression of let-7 expression does not depend on Zcchc11 in multiple cell types, Lin28B may locate in the cytoplasm and use Zcchc11/TUT4 to suppress let-7 biogenesis in certain context, including PDAC cells.

However, Lin28 and Lin28B function through distinct mechanisms to suppress let-7 processing [12].

Taken together, these results further support the notion that overexpression of Lin28B decreased let-7 levels and activated oncogenic pathways, thereby facilitating the progression and metastasis, and leading to poor prognosis in patients with PDAC (Figure 6H).

Indeed, inverse expression of Lin28/Lin28B and let-7 is observed in normal and malignant tissues [18, 21].

In the second feedback loop, Lin28/Lin28B depresses c-MYC by inhibiting let-7, and c-MYC transcriptionally activates Lin28/Lin28B [38, 42].

Aberrant regulation of the Lin28B and let-7 loop in human malignancies is reportedly involved in cancer development, contributing to cell transformation, metastasis, resistance to cell death, metabolic reprogramming, and tumor -associated inflammation [27, 28].

Lin28B overexpression decreases let-7 levels and activates oncogenic pathways.

The effects of Lin28 and Lin28B, which seem similar to the effects of an oncogene, are largely due to their abilities to inhibit the let-7 miRNA family [10].

Lin28/Lin28B and the let-7 family have recently been shown to exert opposite roles in many cellular processes, particularly in cancer development and progression [27].

The presence of a double -negative feedback loop between Lin28/Lin28B and let-7 has also been reported [11, 28].

Lin28B is necessary and sufficient for MYC -mediated let-7 repression, and Lin28B has a key role in MYC -dependent cellular proliferation [38].

Therefore, Lin28 and let-7 may form a complex feedback loop during malignant transformation.

Lin28B decreases let-7 levels and activates oncogenic pathways.

Further studies are needed to elucidate the roles of Lin28/Lin28B and the let-7 network in PDAC.

Besides, Lin28B decreased let-7 levels and activated several oncogenic pathways in PDAC samples.

Lin28B participates in the EMT and represses the biogenesis of let-7, which may be one of the molecular mechanisms by which Lin28B promotes cancer progression and metastasis.

Although Lin28 and Lin28B share similar structures, they function through distinct mechanisms to repress let-7 processing.

Lin28B functions by sequestering primary let-7 transcripts and repressing their processing by the Microprocessor [12].

The third feedback loop involves Lin28B, let-7, NF-kB, and IL-6 [16].

The most well-characterized function of Lin28B is to repress the biogenesis of a family of 12 tumor suppressor miRNAs, collectively referred to as let-7 [10].

Lin28B decreased let-7 levels and activated several oncogenic pathways in PDAC cells.

28

The miRNA let-7 is often implicated in disease and the let-7 miRNA sequence and timing of expression during development are highly conserved amongst vertebrates [11].

Supplementing cells with exogeneous let-7 effectively inhibited GFP translation, reducing fluorescence by more than 3-fold (Figure 2a,c).

Another approach focuses on inhibitors of let-7 degradative enzymes Lin28 [27, 28] and the terminal uridylyltransferase Tut4 [29] as targets for small molecule chemotherapeutics.

Cells transfected with the reporter construct pMiRAR-let-7 expressed GFP (Figure 2a,c), indicating that endogenous let-7 levels do not entirely silence gfp expression.

Mutations in the let-7 binding sites abolish the regulatory effect of let-7 on gene expression.

Let-7 also regulates apoptosis via let-7 binding sites in the 3′-UTR of Caspase 3. By interfering with Caspase 3 expression, let-7 allows cells to escape apoptotic effector caspases [17].

In normal cells and tissues, let-7 suppresses tumor proliferation and cell survival by negatively regulating oncogenic signaling pathways [12].

Thus, let-7 biosynthesis and the regulation of let-7 levels are of increasing interest as new therapeutic targets [25].

Similarly, let-7 is down-regulated in numerous cancers [20, 21, 22] and low let-7 levels are associated with shortened post-operative survival [23].

Screening for small molecule inhibitors of let-7 degradative enzymes currently relies on in vitro biochemical assays to screen for functional inhibition of the respective proteins.

Wang X. Cao L. Wang Y. Wang X. Liu N. You Y. Regulation of let-7 and its target oncogenesOncol.

Akao Y. Nakagawa Y. Naoe T. Let-7 miRNA functions as a potential growth suppressor in human colon cancer cellsBiol.

Takamizawa J. Konishi H. Yanagisawa K. Tomida S. Osada H. Endoh H. Harano T. Yatabe Y. Nagino M. Nimura Y. Reduced expression of the let-7 miRNA in human lung cancers in association with shortened postoperative survivalCancer Res.

Lightfoot H. L. Miska E. A. Balasubramanian S. Identification of small molecule inhibitors of the lin28 -mediated blockage of pre-let-7g processingOrg.

We fused a let-7 regulated 3′-UTR from the human kras gene to a GFP reporter, allowing for a direct readout of let-7 activity in vivo, thus generating a miRNA activity reporter (MiRAR).

Hagan J. P. Piskounova E. Gregory R. I. Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cellsNat.

Other genes regulated by let-7 include Hmga2 and Caspase 3. Hmga2 regulates the G2/M checkpoint in cell cycling and contains binding sites for let-7 miRNA in its 3′-UTR [24].

KRas, Hmga2, Caspase 3, and other oncogenes are directly regulated by let-7 levels in the cell.

Boyerinas B. Park S. M. Shomron N. Hedegaard M. M. Vinther J. Andersen J. S. Feig C. Xu J. Burge C. B. Peter M. E. Identification of let-7-regulated oncofetal genesCancer Res.

Indeed, in the Tut4 knockdown, a 2.7-fold increase in let-7 miRNA levels was observed, correlating with the 2.4-fold decrease in GFP fluorescence in the pMiRAR-let-7 reporter.

In the future, we envision that changes in sensitivity or adaptation to other miRNA species can be achieved by either fusing the 3′-UTR of a miRNA-regulated gene to gfp, or by mutating the binding sites of e. g., miR-122 or let-7 in the existing constructs to another seed sequence.

Visualizing Let-7 Accumulation due to Inhibition of Let-7 Degradative Enzymes.

Previous studies relied on biochemical assays to identify inhibitors of let-7 degradative enzymes Lin28 [27, 28] and Tut4 [29].

In contrast, GFP fluorescence in cells carrying a plasmid with a mutated KRas-UTR fused to GFP (pMiRAR-let-7-mutant) did not respond to a Tut4 knockdown (Figure 3a,b).

To further confirm that the Tut4 knockdown decreases let-7 levels in the cell, we quantified let-7 miRNA levels by qPCR (Figure 4).

Briefly, a primer with an internal stem loop structure was designed to target mature let-7 miRNA (5′-GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACTAT-3′) or miR-122 (5′-GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACCAAACA-3′).

The 3′-UTR of KRas contains several let-7 miRNA binding sites (Figure 1a), and KRas mRNA stability is well known to be regulated by let-7 miRNA [16].

The let-7 un-responsive KRas-3′UTR mutant was described previously [34], and cloned downstream of the gfp coding sequence.

High KRas levels and low let-7 levels generate a highly cancerous phenotype.

Thus, we can utilize the reporter to observe small changes in miRNA activity resulting from increasing and decreasing let-7 levels.

To confirm that the changes in fluorescence were indeed exclusively due to let-7 binding to the KRas-UTR in our reporter, we generated a variant of the reporter gene construct with mutated let-7 binding sites.

Let-7 levels are significantly lower in cancer cells and stem cells compared to differentiated cell types, highlighting the role for let-7 in cell cycle regulation [18, 19].

The resulting PCR product was cloned downstream of GFP into pcDNA3.1-GFP using KpnI and BamHI restriction sites, yielding the plasmid pMiRAR-let-7 and pMiRAR-let-7-mutant.

Roush S. Slack F. J. The let-7 family of microRNAsTrends Cell Biol.

Johnson C. D. Esquela-Kerscher A. Stefani G. Byrom M. Kelnar K. Ovcharenko D. Wilson M. Wang X. Shelton J. Shingara J. The let-7 miRNA represses cell proliferation pathways in human cellsCancer Res.

Boyerinas B. Park S. M. Hau A. Murmann A. E. Peter M. E. The role of let-7 in cell differentiation and cancerEndocr.

Barh D. Malhotra R. Ravi B. Sindhurani P. MicroRNA let-7: An emerging next-generation cancer therapeuticCurr.

In lung cancers, let-7 and the oncogene Kirsten rat sarcoma viral oncogene homolog (kras) have a reciprocal relationship [16].

Mutation of Let-7 Binding Sites Abolishes the Sensitivity of the pMiRAR to Changes in Let-7 Levels.

Increasing let-7 levels, however, cause KRas levels to decrease and normal cell morphology to return.

Supplementation of the anti-miRNA will eventually bind and deactivate free cellular let-7, and if provided in excess will not further decrease GFP fluorescence.

Let-7 directly binds to complementary regions of mRNAs with protein products involved in cell cycle proliferation and apoptosis, such as e. g., Ras, high mobility group A2 (Hmga2), Caspase 3, and others [11, 13, 14, 15, 16, 17].

The KRas mRNA has seven predicted let-7 binding sites in its 3′-UTR [16].

We developed an optogenetic green fluorescence protein (GFP) -based reporter to assess the level of active let-7 in live cells.

Tut4 polyuridylates let-7 miRNAs, marking them for degradation by the exonuclease Dis3L2 (Figure 1b) [1].

These data further confirm that depletion of Tut4 leads to an increase of let-7 levels in the cells, as described previously [29].

As expected, the depletion of Tut4 resulted in a decrease of GFP fluorescence by 2.4-fold, confirming an increase in cellular let-7 levels (Figure 2a,c).

RNAs co -transfected were as follows: let-7 (5′-p-UGAGGUAGUAGGUUGUGUGGUU-3′) and anti-let-7 (5′-p-AACCACACAACCUACUACCUCA-3′) at 80 pM concentration; hsa-miR-122 (5′-p-UGGAGUGUGACAAUGGUGUUUG-3′) and anti-hsa-miR-122 (5′-p-CAAACACCAUUGUCACACUCCA-3′) at 100 nM.

In contrast, supplementing cells with anti-let-7, which binds to and de-activates cellular let-7, led to a marked decrease in active let-7 molecules in the cell as reported by a 1.3-fold increase in GFP production and fluorescence (Figure 2a,c).

Current treatments have focused on a let-7 replacement strategy [20], yet the delivery of RNA therapeutics has proven difficult [26].

We further tested the reporter system by assessing miRNA levels in cells depleted for the let-7 degradative enzyme Tut4, which has been shown previously to affect miRNA degradation [1, 29, 36, 37].

Screening drugs with MiRAR can circumvent time and effort spent on in vitro hits that subsequently fail to permeate the cell or increase let-7 levels in the cell.

Co -transfected miRNA let-7 or anti-let-7 efficiently reduced or elevated GFP fluorescence in the anticipated inverse relationship.

The 3′-UTR of KRas was cloned downstream of a gfp gene into pcDNA3.1 to generate a reporter system where GFP fluorescence is responsive to changes in let-7 concentration in the cell (Figure 1a).

Lin28 binds to precursor miRNA (pre-miRNA) let-7 and recruits Tut4, which subsequently polyuridylates the pre-miRNA.

Thus, elevation of miRNA concentrations caused by inhibition of the uridylyltransferase Tut4, and the subsequent lack of U -dependent let-7 degradation can be measured using our GFP reporter system.

A 2.4-fold decrease in fluorescence corresponds to a 2.7-fold increase in miRNA content upon depletion of the let-7 degradative enzyme Tut4.

These data confirm that the change in fluorescence is indeed due to binding of let-7 to the KRas-3′-UTR.

Thus, the reporter system can also be utilized as a tool to not only quantify changes in let-7 levels, but our data suggest that MiRAR may also be a valuable tool to quantify absolute let-7 levels by titrating increasing concentrations of anti-let-7 until no further increase in GFP fluorescence is observed.

Recent work has begun to reveal the role of let-7 in maintaining cell differentiation and cancer proliferation [12, 13, 15].

The let-7 reporter displayed high sensitivity, with changes in fluorescence corresponding to pM of miRNA transfected.

29

The expression of let-7g was marginally associated with disease-free survival in patients with advanced pathological stages (p = 0.053) and disease-specific survival rates in patients with pT3-4 disease (p = 0.071).

Because the prognostic signature of three miRNAs, mir-218, let-7g, and mir-125b were found to be the major miRNAs that associated with the three hub genes (SP1, MYC, and TP53) predicted to be their targets, we sought to determine whether there were concordant changes in their expression after in vitro treatment with the global transcription inhibitor tetra- O-methyl nordihydroguaiaretic acid (M [4]N) [26] To this aim, we exposed cell lines derived from OSCC patients to M [4]N and evaluated the cultured cells for proliferation, death, and the expression of the three hub genes with their potential miRNA regulators.

71%); (D) an increased expression of let-7g predicted a better disease-specific survival in the subgroup of patients with pT3-4 disease (76% vs.

Notably, a higher expression of let-7g was also associated with better disease-specific survival rates in patients with pT3-4 disease (p = 0.048, Figure 3D).

These data are in accordance with our results showing that an increased expression of mir-218, let-7g, and mir-125b predicts disease-free and disease-specific survival in OSCC patients (Figure 3).

The miRNA prognostic modulators centered on the three hub regulatory genes are depicted in Figure 2. The upstream regulatory miRNAs (miR-218, let-7g, and miR-125b) and the related downstream gene clusters were found to have a concordant prognostic value on disease-free survival and disease-specific survival.

Of the miRNAs regulating MYC, let-7g was associated with local control (OR = 5.917, p = 0.032), neck control (OR = 250, p = 0.009), distant metastases (OR = 31.25, p = 0.023), disease-free survival (OR = 6.329, p = 0.002), and disease-specific survival (OR = 6.329, p = 0.004).

Let-7g was associated with the expression of a MYC-related gene cluster, which had an adverse impact on disease-free survival and disease-specific survival.

Taken together, these data suggest that miR-218, let-7g, and miR-125b may be valuable prognostic indicators of disease-free survival and disease specific survival.

Among patients with p-stage III–IV, a decreased expression of let-7g resulted in a reduced disease-free survival.

Effect of global transcription inhibition on OSCC cell growth and mir-218, let-7g, and mir-125b expression.

Concerning let-7g, one unit decrease in its expression increased the risk of disease recurrence by 2.6-fold and, most significantly, increased the risk of death by 12.9-fold.

An increased expression of let-7g was associated with a lower incidence of poor disease-free survival in patients with advanced pathological stages (p = 0.039, Figure 3C).

Moreover, a low level of let-7g expression identified a high-risk subgroup of pT3-4 patients with poor disease-specific survival.

From a translational standpoint, the results of our study reveal that the integration of the expression of the miR-218, let-7g, and miR-125b with traditional risk factors may improve current stratification strategies.

By contrast, a high expression of miR-218, let-7g, or miR-125b is associated with better clinical outcomes in patients' adverse pathological risk factors (pT3-4, pN+, and p-stage III–IV).

While after exposure to M [4]N, the expression of mir-218, let-7g, and mir-125b was significantly increased in all of the cell lines (Figure 4).

Recent studies have shown that miR-218 and let-7g can inhibit cell invasion and metastasis in gastric cancer [35] and breast cancer [36], respectively.

As expected, the specific upstream miRNAs (miR-218, let-7g, and miR-125b) were selected by the mo del as corresponding to the downstream target gene clusters.

Effects of M [4]N on the expression of miR-218, miR- let-7g, and miR-125b in OSCC cancer cell lines.

In patients with traditional risk factors, we were able to identify distinct prognostic subgroups based on the expression of miR-218, miR-125b, and let-7g.

0102403.g004 Figure 4Effects of M [4]N on the expression of miR-218, miR- let-7g, and miR-125b in OSCC cancer cell lines.

57%); (C) a high let-7g expression was associated with a lower risk of tumor relapse in patients with advanced pathological stage (46% vs.

Notably, we identified three miRNAs (miR-218, let-7g, and miR-125b) that play a key role as prognostic modulators in OSCC patients.

Table S7 Logistic regression analysis of clinical outcomes associated with the miR-218, let-7g, and miR-125b in validation cohort.

To validate the clinical significance of the miRNA signature, we carried out qRT-PCR for miR-218, let-7g and miR-125b in an independent cohort.

30

Co-transfection with Let-7g and let-7i downregulates the expression level of Bcl-xL.

Furthermore, let-7 family members have been found to be downregulated in a number of human cancers, including lung, colon, ovarian, uterine leiomyoma and breast cancer, as well as hepatocellular carcinoma (HCC) (7– 13), indicating that let-7 miRNAs may present potential tumor suppressors.

This previous study demonstrated that the overexpression of let-7c or let-7g led to a marked decrease in Bcl-xL expression in Huh7 and HepG2 hepatoma cell lines (11).

Overexpression of let-7g/i inhibits hepatoma cell proliferation.

Therefore, the combinatorial role of let-7g and let-7i led to the downregulation of Bcl-xL protein.

According to the bioinformatics (DIANA Lab and PICTAR) prediction, Bcl-xL is a direct target gene of let-7, which was also confirmed by a previous molecular study (11).

However, the difference in nucleotides at the 3′end indicates that let-7 families are not functionally equivalent with regard to combination strength and efficiency of interactions with target genes (15, 16).

Overexpression of let-7g/i induces hepatoma cell apoptosis.

The expression levels of let-7g and let-7i were quantified using the SYBR Premix Ex TaqTM II (Perfect Real Time) kit (Takara Bio, Inc.

However, the protein expression was not significantly influenced after transfection with let-7g or let-7i (Fig. 4B), suggesting that let-7g and let-7i exert a combined effect on Bcl-xL protein in BEL-7402 cells.

Full-scale analysis of miRNomes has indicated that only 0.9% of miRNAs are expressed abundantly in the normal human liver; however, these miRNAs account for 88.2% of all miRNAs in the liver, and four of the first nine miRNAs belong to the let-7 family (6).

Let-7 miRNAs act as tumor suppressors by modulating major oncogenes, including high mobility group protein (10, 24), ras (25) and caspase-3 (26).

It has been reported that members of the let-7 family, mir-48, mir-84 and mir-241, which have the same seed sequences but different nucleotide sequences at the 3′end, exhibit specific and redundant roles in the regulation of developmental timing in Caenorhabditis elegans (16).

Quantitative PCR data were analyzed as follows: U6 snRNA was used to normalize let-7g/i expression levels.

It has been demonstrated that the let-7 family are important tumor suppressor genes (17).

U6 small nuclear RNA (snRNA) was used to normalize let-7g/7i expression levels.

Expression levels of let-7g and let-7i in the BEL-7402 cell line following transfection.

Bioinformatics analysis (DIANA Lab and PICTAR) (11) indicates that the anti-apoptotic protein B-cell lymphoma-extra large (Bcl-xL) is a target gene of let-7g and let-7i.

The expression levels of let-7g in the groups transfected with let-7g or co -transfected with let-7g and let-7i were 2,073- and 441-fold those of the control group, respectively.

The present study also showed that Bcl-xL protein expression in the BEL-7402 hepatoma cell line was significantly decreased following combined transfection with let-7g and le-7i.

Bioinformatics analysis (DIANA Lab and PICTAR) predicted that the anti-apoptotic protein Bcl-xL is a target gene of let-7g and let-7i, with a potential binding site on the 3′UTR of Bcl-xL (Fig. 1B).

These results indicate that let-7g and let-7i exhibit a combinatorial role in suppressing HCC progression.

However, the Bcl-xL protein expression was not significantly influenced by transfection with let-7g or let-7i alone.

The expression levels of let-7i in the groups transfected with let-7i and co -transfected with let-7g and let-7i were 1,303- and 605-fold those of the control group, respectively (Fig. 2C).

In addition, the effects of let-7g/i on the biological behavior of hepatoma cells were investigated, and it was found that the overexpression of let-7g/i significantly inhibited the cell proliferation and promoted the cell apoptosis of BEL-7402 cells.

let-7g, let-7i and Bcl-xL expression in hepatoma cells.

According to a previous study, the let-7 family members mir-48, mir-84 and mir-241, function together to control the L2-to-L3 transition, likely by base pairing to complementary sites in the hbl-1 3′ UTR, indicating that let-7 family miRNAs function in combination to affect early and late developmental timing decisions (16).

let-7g/i expression was decreased in SMMC-7721 and BEL-7402 hepatoma cells when compared with the immortalized liver cell L-02 line (P<0.01) (Fig. 2A).

In conclusion, let-7g and let-7i exhibit a combined effect to regulate hepatoma cell proliferation and apoptosis, and this function is hypothesized to be mediated via the Bcl-xL protein.

The loss of let-7 activity induces abnormal development in Caenorhabditis elegans (21).

In this study, the expression of let-7g/i was found to be significantly decreased in HCC cells when compared with the L-02 cell line.

The gray-value quantitative analysis showed that Bcl-xL protein expression in BEL-7402 cells was markedly decreased after co-transfection with let-7g and let-7i compared with that in the control.

When compared with the let-7i group or let-7g group, DNA replication activity of the let-7g + 7i group was inhibited (P<0.05) (Fig. 3B), indicating that there may be a combinatorial effect between let-7g and let-7i.

In humans, 12 genomic loci have been identified, which encode the let-7 family members, including let-7a-1, -2, -3, let-7b, let-7c, let-7d, let-7e, let-7f-1, -2, let-7g, let-7i and miR-98 (3).

DNA replication activity in the groups of transfected with the negative control, let-7g, let-7i and let-7g + 7i was 37.7, 23.6, 21.4 and 18.6%, respectively (Fig. 3B).

Furthermore, the effect of let-7g/i on the Bcl-xL protein in HCC cells was analyzed.

The rates of apoptosis in the groups transfected with let-7g, let-7i and let-7g + 7i were 14.3, 7.7 and 14.1%, respectively, which were significantly greater than the rate in the control group (2.2%) (P<0.05; Fig. 3D).

The miR-let-7g/i (let-7g/i) agomir (an engineered miRNA mimic) and a negative control (similar to agomir-let-7g/i but with a scramble seeding sequence) were obtained from Guangzhou RiboBio Co.

The let-7g/i agomir and/or let-7 agomir negative control were transfected into the human hepatoma BEL-7402 cell line using transfection reagent Lipofectamine™ 2000 in Opti-MEM (Gibco Life Technologies), according to the manufacturer’s instructions.

The relative expression of let-7g/i in hematoma cell lines was calculated using the following formula: ΔΔCt = (Ctlet-7g/i − CtU6) cancer − (Ctlet-7g/i − CtU6) L-02.

One negative control group, which was transfected with 100 nm negative control agomir, and three experimental groups, which were transfected with 100 nm let-7g agomir, 100 nm let-7i agomir or co -transfected with 50 nm let-7g and 50 nm let-7i agomir (let-7g + let-7i) were used.

The results revealed that transfection with let-7g/i agomir increased the percentage of apoptotic cells in the BEL-7402 cell line (Fig. 3C).

Two different nucleotides have been identified at the 3′end of let-7g and let-7i base sequences, resulting in two different binding sites and modes with Bcl-xL mRNA 3′UTR (Fig. 1B).

The relative expression of let-7g/i after transfection was calculated using the equation: ΔΔCt = (Ctlet-7i/g − CtU6) post-transfection − (Ctlet-7g/i − CtU6) pro-transfection.

In addition, the LIN28/let-7 pathway exhibits a critical pathobiological role in malignant germ cell tumors (22).

The fold-changes in let-7g/i levels in the HCC BEL-7402 cell line were detected following transfection with agomirs or the negative control.

org/) were used to predict let-7 family members that could potentially bind to Bcl-xL mRNA.

These results indicated that let-7g and let-7i may exhibit a coordinated effect on the Bcl-xL protein.

31

Translational repression directed by miRNAs occurs in C. elegans, where both the lin-4 and let-7 miRNAs have been shown to block translation of their target mRNAs without altering mRNA stability (Wightman et al. 1993; Ha et al. 1996; Moss et al. 1997; Olsen and Ambros 1999; Reinhart et al. 2000; Seggerson et al. 2002).

Consequently, many of the phenotypes associated with the loss of let-7 reflect overexpression of LIN-41 protein; let-7 mutants are partially suppressed by mutations in lin-41.

let-7 represses translation of lin-41 mRNA by binding to a partially complementary site in the lin-41 3′-untranslated region (Reinhart et al. 2000; Slack et al. 2000; Vella et al. 2004).

In C. elegans, the miRNAs lin-4 (Lee et al. 1993; Olsen and Ambros 1999) and let-7 (Reinhart et al. 2000) regulate developmental timing, whereas the Drosophila miRNAs bantam and miR-14 control cell survival by repressing translation of proapoptotic genes (Brennecke et al. 2003; Xu et al. 2003).

When injected into C. elegans larvae, a let-7-complementary 2′- O-methyl oligonucleotide can efficiently suppress lin-41 translational repression by the let-7 miRNA.

Although the 2′ -O-methyl oligonucleotides were not toxic and when coinjected with an unrelated DNA transformation reporter did not prevent the uptake and expression of the coinjected DNA, we did not observe inhibition of lin-4 or let-7 activity (data not shown).

In C. elegans, the Argonaute protein-encoding genes alg-1 and alg-2 are required for the biogenesis or function (or both) of the miRNAs lin-4 and let-7 (Grishok et al. 2001), but it has not been shown whether ALG-1 and ALG-2 proteins are directly associated with let-7. We prepared extracts from wild-type adult worms carrying a transgene expressing GFP-tagged ALG-1 and ALG-2 proteins.

Addition of this 2′- O-methyl oligonucleotide efficiently blocked target RNA cleavage directed by the endogenous let-7-programmed RISC in the HeLa S100 extract and by the RISC programmed with exogenous let-7 siRNA duplex in Drosophila embryo lysate (Figure 5C).

In C. elegans, the Argonaute protein-encoding genes alg-1 and alg-2 are required for the biogenesis or function (or both) of the miRNAs lin-4 and let-7 (Grishok et al. 2001), but it has not been shown whether ALG-1 and ALG-2 proteins are directly associated with let-7. We prepared extracts from wild-type adult worms carrying a transgene expressing GFP-tagged ALG-1 and ALG-2 proteins.

We reasoned that if the phenotypes observed in the injected larvae reflect a loss of let-7 activity, then they should likely be partially suppressed by a lin-41 mutation (Reinhart et al. 2000; Slack et al. 2000).

We incubated the Pp-luc siRNA duplex with the human HeLa S100 to form Pp-luc-directed RISC, then added the let-7-complementary 2′- O-methyl oligonucleotide and the target RNA.

Furthermore, human HeLa cells express multiple let-7 family members, and endogenous let-7 is present naturally in RISC (Hutvágner and Zamore 2002; Zeng and Cullen 2003).

We tested whether a 31-nt 2′ -O-methyl oligonucleotide complementary to let-7 could block target cleavage guided by the endogenous let-7-programmed RISC present in HeLa S100 extract (Figure 5A).

Target RNA and 2′- O-methyl oligonucleotide (right) were added to HeLa S100 extract, which contains endogenous human let-7-programmed RISC.

Figure 5A Complementary 2′ -O-Methyl Oligonucleotide Blocks Endogenous let-7-Containing RISC Function(A) Sequence of the let-7-complementary site in the target RNA (black), of the siRNA (red, antisense strand; black, sense strand), and of the let-7-complementary 2′ -O-methyl oligonucleotide (blue).

The observed suppression (64%) was nearly identical to that reported for a let-7, lin-41 genetic double mutant (70%; Reinhart et al. 2000; Slack et al. 2000).

Finally, we use a tethered 2′- O-methyl oligonucleotide to demonstrate association of the C. elegans Argonaute proteins ALG-1 and ALG-2 with let-7. Inhibition of RNAi by 2′- O-Methyl OligonucleotidesAlthough RNAi has proved a straightforward and cost-effective method to assess the function of protein-coding mRNAs (Fire et al. 1998; Caplen et al. 2000, 2001; Carthew 2001; Elbashir et al. 2001a) and even some noncoding RNAs (Liang et al. 2003), no comparable method allows the sequence-specific inactivation of the siRNA or miRNA components of the RISC.

For in vivo inhibition of let-7 function, 1 mg/ml let-7-complementary 2′- O-methyl oligonucleotide in water (100 μM) was injected into either wild-type (N2) or lin-41(ma104) L2 larvae.

Consistent with the idea that the injected oligonucleotide specifically inactivates let-7, the absence of alae- and vulval-bursting phenotypes were both suppressed in the lin-41(ma104) mutant strain (Figure 6A).

The oligonucleotide blocked cleavage by the endogenous let-7-programmed RISC, but had no effect on cleavage directed by the exogenous Pp-luc siRNA in the same reaction (Figure 5D).

Injection of a 2′- O-methyl oligonucleotide complementary to the let-7 miRNA into C. elegans larvae phenocopied a let-7 loss-of-function mutation, demonstrating that 2′ -O-methyl oligonucleotides can disrupt the function of a single miRNA in vivo.

First, we tested whether injection into the germline of wild-type adult hermaphrodites of 2′ -O-methyl oligonucleotides complementary to either lin-4 or let-7 could block lin-4 or let-7 function during the larval development of the resulting progeny.

After larvae were injected with the let-7-specific 2′ -O-methyl oligonucleotide, 80% of the adult worms lacked alae; 77% lacked alae and also exhibited bursting vulvae (Figure 6A).

To recover the proteins associated with the let-7 miRNA, the beads were boiled for 10 min in 20 μl of SDS loading buffer (10 mM Tris–HCl [pH 6.8], 2% [w/v] SDS, 100 mM DTT, and 10% [v/v] glycerol).

shtml) accession numbers for the let-7 family members are MI0000060–MI0000068, MI0000433, and MI0000434.

In addition to containing endogenous let-7-programmed RISC, HeLa S100 can be programmed with exogenous siRNA duplexes (Martinez et al. 2002; Schwarz et al. 2002).

let-7 phenotypes were also observed at 10 μM oligonucleotide, but were less penetrant.

The let-7-complementary 2′- O-methyl oligonucleotide blocks let-7-programmed, but not Pp-luc siRNA-programmed, RISC function.

When tethered to a paramagnetic bead, this oligonucleotide could also quantitatively deplete the let-7-programmed RISC from the Drosophila embryo lysate (Figure 5E), demonstrating that, again, the interaction between the 2′- O-methyl oligonucleotide and the RISC was apparently irreversible.

In human cells, miRNAs such as let-7 are in a protein complex that contains Argonaute proteins (Hutvágner and Zamore 2002; Mourelatos et al. 2002; Dostie et al. 2003).

2′- O-methyl oligonucleotides (either from IDT, Santa Clara, California, United States, or from Dharmacon) were 5′-CAU CAC GUA CGC GGA AUA CUU CGA AAU GUC C-3′ and 5′-Bio-CAU CAC GUA CGC GGA AUA CUU CGA AAU GUC C-3′ (complementary to the Pp-luc siRNA sense strand); 5′-GGA CAU UUC GAA GUA UUC CGC GUA CGU GAU G-3′ and 5′-Bio-A CAU UUC GAA GUA UUC CGC GUA CGU GAU GUU-3′ (complementary to the Pp-luc antisense strand); and 5′-Bio-UCU UCA CUA UAC AAC CUA CUA CCU CAA CCU U-3′ (complementary to let-7); 5′ biotin was attached via a six-carbon spacer arm.

Loss of let-7 function causes worms to reiterate the L4 larval molt and inappropriately produce larval cuticle at the adult stage.

In contrast, let-7 functions during the L4 stage, and we found that L2 and L3 larvae survive the microinjection procedure (see).

gov/LocusLink/) ID numbers for the genes discussed in this paper are alg-1 (181504), alg-2 (173468), bantam (117376), let-7 (266954), lin-4 (266860), lin-41 (172760), miR-14 (170868), and rde-4 (176438).

Northern blot analysis of the immune complex showed that it contained mature 22-nt let-7 miRNA (Figure 6D).

In contrast, the RNA -binding protein RDE-4, which is required for RNAi but not for miRNA function in C. elegans, did not copurified with the let-7-complementarity oligonucleotide, providing further support for the specificity of the let-7:ALG-1/ALG-2 interaction (Figure 6C).

Depletion of let-7 miRNA was monitored by Northern blotting.

Finally, we used a coimmunoprecipitation assay to examine the interaction between let-7 and ALG-1/ALG-2. In this assay, a monoclonal anti-GFP antibody was used to coimmunoprecipitate ALG-1/ALG-2 and small RNAs from the GFP::ALG-1/GFP::ALG-2 strain, which expresses GFP::ALG-1/ALG-2 fusion proteins.

Loss-of-function let-7 phenotypes include weak cuticles prone to bursting at the vulva, defects in egg-laying, and loss of adult-specific cuticular structures that run the length of the animal's body, the alae (Reinhart et al. 2000).

As a control, the experiment was performed in parallel using an oligonucleotide not complementary to let-7. The let-7-complementary, but not the control, oligonucleotide depleted nearly all the let-7 miRNA from the extract (Figure 6B).

Northern blot analysis of let-7 miRNA remaining in the supernatant of the worm lysate after incubation with the let-7-complementary (let-7) or Pp-luc (unrelated) oligonucleotide.

In this study, we have used a tethered 2′- O-methyl oligonucleotide to demonstrated the association of ALG-1/ALG-2, two C. elegans Argonaute proteins, with the endogenous worm miRNA let-7. Our in vitro and in vivo studies using 2′- O-methyl oligonucleotides demonstrate that cells and extracts have a limited capacity to assemble RISC on exogenous siRNA.

RNA was resolved on a 15% denaturing polyacrylamide gel, transferred to Hybond-N membrane (Amersham Biosciences), and detected by Northern blot analysis using a 5′- [32]P-radiolabeled antisense let-7 RNA probe (UAU ACA ACC UAC UAC CUC AUU) as described elsewhere (Hutvágner and Zamore 2002).

Injection of a 2′- O-Methyl Oligonucleotide Complementary to let-7 miRNA Can Phenocopy the Loss of let-7 Function in C. elegans.

“Mock” indicates that no oligonucleotide was used on the beads; “ let-7” indicates that the beads contained the let-7-complementary oligonucleotide shown in (A).

The extracts were then incubated with the let-7-complementary 2′ -O-methyl oligonucleotide tethered by a 5′ biotin to streptavidin-conjugated paramagnetic beads.

To isolate let-7-containing complexes from C. elegans adults, we incubated 20 pmol of immobilized 2′- O-methyl oligonucleotide with 1 mg of total protein.

No detectable let-7 was recovered with the anti-GFP antibody from the N2 wild-type strain.

The unbound and immunoprecipitated RNAs were analyzed by Northern blot hybridization for let-7 (D), and 5% of the immunoprecipitated protein was analyzed by Western blotting for GFP to confirm recovery of the GFP-tagged ALG-1/ALG-2 proteins (E).

The bottom panel shows the same samples analyzed separately to better resolve the let-7 5′ cleavage product.

Figure 6Injection of a 2′- O-Methyl Oligonucleotide Complementary to let-7 miRNA Can Phenocopy the Loss of let-7 Function in C. elegans (A) Wild-type and lin-41(ma104) L2-stage C. elegans larvae were injected with either a 2′ -O-methyl oligonucleotide complementary to let-7 miRNA (Figure 5A) or an unrelated Pp-luc 2′- O-methyl oligonucleotide.

By comparing the fraction of let-7 associated with GFP::ALG-1/ALG-2 with the unbound fraction of let-7 miRNA, we estimate that approximately 30% of the 22-nt let-7 RNAs coimmunoprecipitate with GFP::ALG-1 and GFP::ALG-2. These data support a mo del in which that ALG-1 and ALG-2 form a complex, in vivo, that contains a substantial fraction of the mature let-7 miRNA.

All of the phenotypes associated with injection of the let-7-complementary 2′ -O-methyl oligonucleotide are consistent with a loss of let-7 activity.

Western blotting using an anti-GFP antibody revealed that both GFP-tagged ALG-1 and ALG-2 protein copurified with the let-7-complementary oligonucleotide, but not the control oligonucleotide (Figure 6C).

A Complementary 2′ -O-Methyl Oligonucleotide Blocks Endogenous let-7-Containing RISC Function.

32

In total, 532 human genes were identified as potential targets of the differentially expressed let-7 miRNA shown in Figure 2. Next, mRNA profiling analyses were performed on the circulating erythroid cells to determine which of the target genes demonstrated down-regulated abundance in the adult cells.

As shown, miRNA defined as being differentially expressed (p < 0.01 and fold change > 2) were grouped into down-regulated (Down), up-regulated (Up), and let-7 (Let-7) gene products.

Since let-7 miRNA is involved in ontogeny-related gene expression and regulation in lower organisms [8], our study was extended to identify potential mRNA targets of let-7 that are expressed in fetal versus adult human erythroid cells.

Based upon the importance of let-7 for developmental transitions in lower organisms, it is proposed here that differential expression of miRNA including let-7 in erythroid cells should be explored for their potential to regulate changes in erythropoiesis or hemoglobin expression patterns in humans.

Among the differentially-expressed miRNA, a majority of let-7 family members were significantly upregulated in adults.

Profiling studies of messenger RNA (mRNA) in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells.

Differential expression of predicted let-7 target genes was also detected in the cells.

Figure 3Reticulocyte mRNA expression levels of 10 genes that are predicted targets of let-7 miRNA.

Alternatively, the increased let-7 expression in adult cells could affect other aspects of erythropoiesis since the predicted target genes are largely involved in cellular proliferation and apoptosis.

These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

Among the up-regulated subset, the let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array -based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA).

While the expression of let-7 genes in human erythroid cells was reported previously [20], this is the first study to demonstrate a developmental increase in the abundance of these gene products.

This report provides initial evidence that human let-7 miRNA, as a group, are up-regulated in association with fetal-to-adult hemoglobin switching.

While the results described here may be helpful for generating new hypotheses related to miRNA expression, more robust methods (including coordinated manipulation of multiple miRNA members) are needed to understand the functional significance of increased let-7 in adult erythroid cells.

Average intensities of each probe set for let-7 target genes in umbilical cord blood versus adult blood were calculated from mRNA expression profiling data using the Affymetrix U133Plus chips.

In addition to the let-7 miRNA group, qPCR was also used to confirm the expression patterns of other miRNA in these cells.

Expression of some miRNA is evolutionarily-conserved including the let-7 miRNA family.

We speculate that let-7 or other differentially expressed miRNA are involved in the hemoglobin switching phenomenon.

A. Relative expression patterns for the let-7 miRNA that were quantitated by qPCR.

Unlike the mo del organisms like C. elegans, there was little evidence suggesting let-7 significantly regulates Ras mRNA in these human cells.

Experimental findings suggest that let-7 miRNAs play major roles in growth and development [7].

Based upon involvement of let-7 miRNA in the larval-to-adult transition in C. elegans and the juvenile-to-adult transition in Drosophila, a similar function for let-7 miRNA in mammalian development is being explored [8].

The pattern of increased let-7 miRNA abundance demonstrated on the arrays was confirmed by qPCR (Figure 2A).

First, miRBase predictions (Version 5) of let-7 major strands were catalogued according to a prediction p-value of less than 0.001.

Among the let-7 miRNA detected on the arrays with significantly increased abundance, let-7d and let-7e miRNA demonstrated the greatest increases with more than 10 fold increases with qPCR (p < 0.01).

Also noteworthy were hsa-miR-411 with a 7.5 fold increase, hsa-miR-182 with a 5.1 fold increase, and hsa- let-7 miRNAs with 4.3 to 5.1 fold increases (Figure 1).

33

These data indicate that let-7 regulated HMGA2 expression and FSH stimulates HMGA2 expression by down -regulating let-7. The observations that FSH increases the risk of ovarian malignancy and that pregnancies or oral contraceptives protect the ovaries by suppressing FSH secretion led to numerous studies (13).

let-7 is frequently downregulated in human neoplasms, suggesting that embryonic target genes of let-7 are upregulated in cancer.

These data indicate that let-7 regulated HMGA2 expression and FSH stimulates HMGA2 expression by down -regulating let-7. HMGA2, let-7, p53 and FSHR had similar expression levels in FTE cells of LGSCs and HGSCs.

A previous study showed that HMGA2 was a direct target for let-7 in human cancer cell lines and let-7 regulated HMGA2 expression in OC and predicts disease progression (20).

Members of the let-7/miR-98 family are induced late in mammalian embryonic development to suppress the expression of embryonic genes that are not expressed in the adult organism.

Previous studies show that let-7s specifically repress HMGA2 expression both in vivo and in vitro, revealing the regulatory role of let-7 in HMGA2 expression (5– 7).

FSH stimulates HMGA2 expression by downregulating let-7. Discussion.

To confirm that let-7 regulated HMGA2 expression, we pretreated the FTE cells of HGSCs with anti-miR let-7b transfection for 48 h. HMGA2 expression was detected and p53 was absent, as demonstrated by western blot analysis.

FSH increases expression of HMGA2 and decreases expression of let-7 in normal fimbria of HGSCs.

Notably, we observed that the let-7 expression levels decreased gradually with time and an inverse correlation between the expression of let-7b and HMGA2 in FTE cells of the HGSCs was observed following (r=−0.55, P=0.006).

In the present study, we observed that the let-7 expression levels decreased gradually over time and an inverse correlation between the expression of let-7b and HMGA2 in FTE cells of the HGSCs stimulated by FSH was present.

Therefore loss of let-7 expression plays a key role in the regulation of FTE cells (24).

In conclusion, our results suggest that of HMGA2 expression is mediated by let-7. Further studies to understand the role of FSH in tumorigenesis of FTE cells at cellular and molecular levels are required, as this may elucidate the etiology of OC development.

let-7 expression causes degradation of HMGA2 mRNA.

Reported let-7 targets include RAS, c-myc and HMGA2.

The expression of HMGA2, let-7, p53 and FSHR in FTEs.

HMGA2, let-7, p53 and FSHR had similar expression levels in FTE cells of LGSCs and HGSCs.

The efficient degradation of HMGA2 mRNA may be due to the high degree of complementarity of let-7 to certain let-7 seed matches present in the HMGA2 untranslated region (3′-UTR) (18– 23).

OC patients with high HMGA2 and low let-7 expression in cancerous cells had a lower survival than patients with a low HMGA2/high let-7 ratio (6, 7).

The purpose of the present study was to investigate the effect and mechanism of FSH on let-7, HMGA2 and p53 expression in the normal fimbrial epithelial cell of HGSCs and reveal the different susceptibilities to FSH of fimbria in HGSCs and LGSCs.

However, thus far little is known about the mechanism of of let-7 and HMGA2 expression and it was lack of investigation in vitro and in vivo to confirm the mechanism.

34

Since radiation up-regulates let-7g, the data also indicate that the miRNA up-regulation is correlatively or causatively associated with the direct anti-endothelial radiation effect as determined by clonogenic survival and proliferation inhibition.

Radiation up-regulated miRNA expression levels included let-7g, miR-16, miR-20a, miR-21 and miR-29c, while miR-18a, miR-125a, miR-127, miR-148b, miR-189 and miR-503 were down-regulated.

Corresponding to the let-7g up-regulation in our irradiated endothelial cells we found a reduction of clonogenic survival by overexpression of the miRNA.

In contrast, the inhibition of let-7g attenuated the growth inhibitory effect of the radiation treatment at the dose of 2 Gy.

We found that overexpression or inhibition of let-7g, miR-189, and miR-20a markedly influenced clonogenic survival and cell proliferation per se.

Other let-7 family members were not regulated upon radiation treatment (RT) or slightly up-regulated like let-7d and let-7f (see Additional file 3).

We found that the overexpression or inhibition, respectively, of miR-189, let-7g and miR-20a showed the strongest effects on functional cell behavior.

We also found that overexpression and inhibition, respectively, of let-7g had similar effects on clonogenic survival like miR-189 (Fig. 3).

One of the up-regulated miRNAs in response to radiation was a member of the let-7 family (let-7g).

A role of let-7 in cell growth has been described in normal and lung cancer cells, in which let-7 is down-regulated [15].

We found enhanced survival by inhibition of let-7g both in untreated and in irradiated cells.

An alteration in the expression of let-7 miRNAs in response to radiation was recently shown in human fibroblasts [17].

Panels A-C show the proliferation data of cells pre -treated with precursor or inhibitor molecules of miR-189, let-7g and miR-20a.

In Fig. 8 the effects of ionizing radiation after transfection with precursors or inhibitors of miR-189, let-7g and miR-20a are shown.

Furthermore, a role of several let-7 miRNA family members for radiation sensitivity in lung cancer cells was reported by Weidhaas et al. The authors showed that overexpression of let-7g protected A549 cells from radiation.

After irradiation the same pattern was observed: Overexpression of let-7g further reduced clonogenic survival of cells irradiated with 2 Gy vs.

irradiated controls, while let-7g inhibition significantly improved clonogenic survival (P < 0.05) vs.

As shown in Fig. 8B, overexpression of let-7g further reduced cell number after irradiation with 2 Gy in comparison to the control miRNA.

Notably, the radiosensitivity of HDMEC was significantly influenced by differential expression of miR-125a, -127, -189, and let-7g.

Figure 3 Clonogenic survival of HDMEC after transfection with let-7g precursor or inhibitor.

The data suggest that let-7g negatively regulates EC growth and furthermore sensitizes them to radiation.

Let-7 negatively regulates human Ras genes and it was reported that it is a negative regulator of cell proliferation pathways in human cells [16].

This prosurvival effect in endothelial cells of anti-let-7g was also present in the 10 Gy radiation setting (P < 0.05).

Microarray data of let-7 family members from HDMEC.

Out of the microRNA list from the microarrays we selected six miRNAs (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a) for further functional analysis.

We found that especially miR-189, let-7g, and miR-20a seem to play a role in endothelial cell clonogenic survival and/or proliferation, and to a weaker extend also miR-125a, -127, and -148b.

The addition of pre-let-7g caused a dramatic reduction by ~50% of clones.

Click here for file Microarray data of let-7 family members from HDMEC.

Anti-let-7g had the opposite effect and enhanced the clonogenic survival (P < 0.05).

While miR-125a and miR-189 had a radioprotective effect, miR-127 and let-7g enhanced radiosensitivity in human endothelial cells.

The following pre- and anti-miRs were used: hsa-let-7g, hsa-miR-125a, hsa-miR-127, hsa-miR-148b, hsa-miR-189, hsa-miR-20a, pre-miR negative control #1, and anti-miR negative control #1 (all purchased from Ambion).

Six microRNAs (miRs) were chosen for subsequent functional analyses (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a).

s Out of the microRNA list from the microarrays we selected six miRNAs (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a) for further functional analysis.

While in particular miR-189 and miR-125a have a protective effect on endothelial cells, miR-127 and let-7g enhance their sensitivity to irradiation.

35

In eukaryotes including worms and mammals, Lin28 blocks let-7 expression, whereas let-7 negatively regulates Lin28 expression by binding to the 3’UTR of Lin28 mRNA, thereby establishing a double negative feedback loop.

Lin28B and its paralog Lin28A are small RNA binding proteins that have similar inhibitory effects, although they target separate steps in the maturation of let-7 miRNAs in mammalian cells.

Although the precise mechanism underlying the Lin28B -mediated inhibition of let-7 remains controversial, it has been demonstrated that Lin28B expression and let-7 loss almost invariably correlate with poor prognosis [4].

The Lin28/let-7 axis plays a pivotal role in stem cell biology and the development and control of glucose metabolism, as well as in human diseases [4, 5].

Because Lin28B participates in the promotion and development of tumors mostly by blocking the let-7 tumor suppressor family members, we sought to explore the associated mechanisms to gain insights into how Lin28B might be decreased in human cancer cells to increase let-7 levels and reverse malignancy.

In this study, we found that knockdown of Lin28B in the human lung adenocarcinoma cell line H1299 abrogated the inhibition of let-7 miRNA.

Both Lin28A and Lin28B interact with PCAF via their CSD, and let-7 binds to the 3’UTR of both Lin28 paralogs, thereby repressing Lin28 translation in a negative feedback loop; however, TRIM71, a specific E3 ubiquitin ligase, negatively regulates Lin28B (but not Lin28A) protein levels by ubiquitinating its C-terminal unique region, which is absent in the Lin28A paralog [24, 25].

The effect of Lin28B knockdown on let-7 expression in H1299 cells.

We then determined the expression of let-7 in H1299 cells and their Lin28B-K/D counterparts and found that knockdown of Lin28B enhanced the biogenesis of let-7 family members detected (let-7a-1, b, c, d, e, f, and g).

Lin28B PCAF let-7 Acetylation Lin28 and the microRNA let-7 were first discovered in C. elegans as heterochronic genes that regulate developmental timing [1– 3].

Consistent with the literature [8], Lin28B is mainly found to be distributed in the nucleus (Fig.   1a), where it abrogates the expression of let-7 miRNA.

H1299 cells express high levels of Lin28B and low levels of let-7 [8, 16].

A high Lin28A or Lin28B and low let-7 expression pattern is found in approximately 15% of human cancers [16].

The new role of PCAF in mediating Lin28B acetylation and the specific release of its target microRNAs in H1299 cells may shed light on the potential application of let-7 in the clinical treatment of lung cancer patients.

The expression of Lin28A in the cytoplasm blocks let-7 processing by Dicer and uridylation of pre-let-7 by TUTase [11], whereas Lin28B primarily accumulates in the nucleus, where it binds pri-let-7 miRNAs and blocks the activity of the microprocessor complex [5, 8, 11].

The relative expression of let-7a-1 and let-7g was normalized to that of U6 snRNA using the comparative CT method according to the manufacturer’s instructions (Bio-Rad CFX Connect Real-Time System).

To reveal the mechanism underlying the PCAF -mediated acetylation of Lin28B and its effect on the biogenesis of let-7, we first determined the expression of Lin28B in different cell types and detected it in three cell lines, H1299, HepG2, and HEK293T, but it was not detectable in other cell lines including HCT116, MCF7, and HeLa cells (Fig. 3e).

Lin28A/B selectively represses the expression of let-7 miRNAs [11, 29– 31].

In this report, we demonstrated that knockdown of Lin28B in H1299 cells elevated the level of let-7a-1/g, although this level of let-7a-1 was lower than that of let-7g in Lin28B-knockdown cells.

These findings indicated that the acetylation of Lin28B was induced by PCAF, which removed the inhibition on let-7 biogenesis in H1299 cells, as schematically shown in Fig. 3i.

These results suggested that the acetylation of Lin28B by PCAF is a critical event that abrogates the inhibitory effect of native Lin28B on the biogenesis of let-7a-1 and let-7g miRNAs in H1299 cells.

To explore the functional role of PCAF compared with its HAT-domain- deleted counterpart in non -modified H1299 cells, RT-qPCR analysis was performed, and elevated expression levels of the let-7a-1 and let-7g miRNAs were found in the presence of PCAF but not the HAT-domain- deleted PCAF, whereas mir-16-1 was not induced by PCAF transfection (Fig. 3c).

d RT-qPCR analysis showing the levels of let-7a-1, let-7g and mir-16-1 in the control and Lin28B stable knockdown cells.

The effects of acetylated Lin28B on let-7a-1 and let-7g are similar to that of stable knockdown of Lin28B in H1299 cells.

In addition, it has been reported that Merlin/NF2 is a key regulator of Lin28B localization and let-7 biogenesis in response to cell-cell contact [32].

In humans, there are twelve let-7 family members located at eight different chromosomal loci.

RT-qPCR showing the levels of let-7a-1, let-7g and mir-16-1. Each bar represents the mean value ± S. D. from at least three independent experiments (#, P > 0.05; * p ≤ 0.05; ** p ≤ 0.01, upper panel).

Mature let-7a-1 (RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT, F: GCCGCTGAGGTAGTAGGTTGTA and R: GTGCAGGGTCCGAGGT), mature let-7g (RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTGACA, F: GCCGCTGAGGTAGTAGTTTGT and R: GTGCAGGGTCCGAGGT), mature mir-16-1 (RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAA.

It is well known that cytoplasmic Lin28A first binds to the conserved terminal loop of pre-let-7 and then recruits TUT4 for polyuridylation, thereby blocking Dicer cleavage [4, 5].

Most importantly, we demonstrated that the PCAF -mediated acetylation of Lin28B might de-repress the processing of let-7a-1 and let-7g, and these findings shed light on the potential application of acetylated Lin28B for future cancer therapy.

The results of two representatives of let-7 miRNAs were shown in Fig. 1d, the let-7a-1 was increased and let-7g was drastically induced in Lin28B-K/D cells relative to their basal levels in the wild-type H1299 cells but mir-16-1 was not induced at all.

c Effect of PCAF on let-7. H1299 cells were transfected with FLAG-PCAF, FLAG-PCAF-△HAT or the vector.

As a bona fide cancer-related protein, Lin28B is subject to polyubiquitination that leads to the enhancement of let-7 biogenesis [24, 25].

The HAT domain of PCAF is indispensable for PCAF mediated acetylation of Lin28B and de-repression of let-7a-1 and let-7g.

Our data suggested that acetylation of Lin28B by PCAF may affect Lin28B localization and let-7 biogenesis.

However, whether the acetylation of Lin28B affects the let-7 biogenesis involved in tumorigenesis is not yet fully understood.

PCAF acetylates Lin28B and involves in de-pression of let-7. Discussion.

Fig. 3Acetylation of Lin28B by PCAF and its effect on the level of let-7. a. GST-PCAF was incubated with GST-Lin28B in the presence of CoA, and blotting with antibodies against pan-acetyl lysine (AcK) and GST.

These findings provide new insights into the potential application of acetylated Lin28B in mediating let-7 biogenesis, which may serve as a novel therapeutic approach for lung cancer.

The discovery of a new role of PCAF in mediating Lin28B acetylation and, particularly, in elevating the level of microRNAs in lung adenocarcinoma-derived H1299 cells may shed new light on the potential application of let-7a-1 and/or let-7g in the clinical treatment of lung cancer.

Lin28B, after acetylation by PCAF, might translocate from the nucleus to cytoplasm in H1299 cells and it may be further involved in the de-repression of let-7 biogenesis.

i A schematic representation of the effect of PCAF -induced Lin28B acetylation on the synthesis of let-7 We have previously reported that the protein stability of Lin28A, the paralog of Lin28B, decreases when it is acetylated by PCAF [26]; however, no apparent change was observed in the protein level of Lin28B in the cells transfected with PCAF (data not shown).

36

Changes in IGF2BP-1 and IGF2R expression in vitro after overexpression or knockdown of let-7f-5p and let-7g-5pTo further investigate the effect of let-7 miRNA on decidualization, the expression of target genes was evaluated following overexpression or knockdown of the miRNAs mediated by corresponding miRNA mimics or inhibitors, respectively.

Given their apparently crucial roles in establishing endometrium receptivity and in mediating events such as spontaneous miscarriage, we therefore sought to identify target genes by overexpression or knockdown of let-7 miRNA expression in vitro.

Let-7f-5p and let-7g-5p mimics (dsRNA oligonucleotides) and inhibitors (single-stranded chemically modified oligonucleotides) (GenePharma, Shanghai, China) were used for the in vitro overexpression and inhibition of let-7f-5p and let-7g-5p activity, respectively in S1 Table.

IGF2R expression in vitro after overexpression or knockdown of let-7g-5p.

Changes in IGF2BP-1 and IGF2R expression in vitro after overexpression or knockdown of let-7f-5p and let-7g-5p.

To further investigate the effect of let-7 miRNA on decidualization, the expression of target genes was evaluated following overexpression or knockdown of the miRNAs mediated by corresponding miRNA mimics or inhibitors, respectively.

Likewise, the expression of IGF2R mRNA increased in cells transfected with let-7g-5p inhibitor and decreased in cells transfected with let-7g-5p mimic (Fig 5).

Hu et al [31] analyzed miRNA expression in mouse uterus using miRNA microarrays and showed that let-7a, let-7b, let-7c, let-7d, let-7e, let-7f-5p, let-7g-5p, and let-7i are highly expressed in IMs (inter-implantation sites).

Our in vitro data reveal an inverse relationship between the expression of the abundant let-7 miRNAs and their target genes, suggesting that miRNAs are involved in mediating endometrial receptivity and decidualization.

In vitro overexpression and inhibition of let-7f-5p and let-7g-5p.

In addition, although miRNAs of the let-7 family are highly expressed in mature oocytes and zygotes, their expression declines in the two-cell stage [34].

We demonstrated for the first time that there is a significant inverse relationship between the expression of let-7 miRNAs and target genes.

As IGF2BP1 and IGF2R [39] are known to be involved in pregnancy establishment and maintenance [40], we hypothesized that let-7 disrupts decidualization from a maternal aspect by down -regulating the expression of IGF2BP1 and IGF2R.

Our previous study showed that let-7 family members were expressed abundantly in decidua and their down regulation in normal pregnancy might involve in decidualization comparing to the aborted decidua [11].

Because miRNAs of the let-7 family were found to be abundantly expressed in decidua in a previous study [11], our in vitro experiments had focused solely on the effects of let-7f and let-7g-5p.

And some of let-7 family members also differentially expressed in decidua and menstrual endometrium.

0143116.g005 Fig 5(a) Overexpression of let-7g-5p in HEK293T and hESCs cells.

Cells were cultured and incubated with hsa-let-7g-5p inhibitor or negative control.

However, little is currently known about the function and role of miRNAs of the let-7 family in the decidua, and no reports of the significance of let-7 involvement in embryo implantation have been published.

Levels of let-7g-5p were determined using qPCR.

Cells were cultured and incubated with let-7g-5p mimic or negative control.

Hence, the roles of let-7 miRNAs in decidualization at pregnancy initiation require further clarification.

37

Renilla luciferase expressing plasmid containing a part of the 3′ UTR of human HMGA2 that carries four let-7 target sites were transfected into HeLa cells together with Firefly expressing plasmid, as internal control, and the indicated 2′- O-methyl oligos.

Let-7 complementary oligo: 5′-biotin- UCUUCACUAUACAACCUACUACCUCAACCUU-3′, let-7 seed mismatched oligo: 5′-biotin- UCUUCACUAUACAACCUACUACGAGAACCUU-3′ PTB(-) oligo: 5′-biotin- UGAUCACUAUACAACCUACUACCUCAACCUU-3′ control oligo: 5′-biotin– CAUCACGUACGCGGAAUACUUCGAAAUGUCC-3′ siRNAs to knock down PTB and nPTB expression were purchased from Dharmacon (On target plus, catalog numbers J-003528-06, 07, 08 and 09 and J-021323-09, 10, 11, and 12 respectively) and were used as an equimolar mixture.

Let-7 complementary oligo:5′-biotin- UCUUCACUAUACAACCUACUACCUCAACCUU-3′, let-7 seed mismatched oligo:5′-biotin- UCUUCACUAUACAACCUACUACGAGAACCUU-3′ PTB(-) oligo:5′-biotin- UGAUCACUAUACAACCUACUACCUCAACCUU-3′ control oligo:5′-biotin– CAUCACGUACGCGGAAUACUUCGAAAUGUCC-3′ siRNAs to knock down PTB and nPTB expression were purchased from Dharmacon (On target plus, catalog numbers J-003528-06, 07, 08 and 09 and J-021323-09, 10, 11, and 12 respectively) and were used as an equimolar mixture.

As expected, the let-7 complementary oligo enhanced the expression of the reporter plasmid significantly by inhibiting the miRNA function (Fig. 2A).

PTB and let-7 miRNA contribute together to regulate gene expression in C. elegans.

0033144.g006 Figure 6PTB and let-7 miRNA contribute together to regulate gene expression in C. elegans.

A 2′- O-Methyl containing oligonucleotide inhibitor that interferes with let-7 function in human cells and C. elegans has already been reported (Fig. 1A) [36].

Renilla luciferase reporter constructs: pRL-TK H2-H5: Renilla luciferase that containing four let-7 target sites in the 3′UTR in the context of the part of HMGA2 3′UTR, pRL-TK ΔH2-ΔH5: same as H2-H5 only the seed sequences complementary sites of the let-7 were mutagenized at second and third nucleotides.

Endogenous PTB in Hela cells (A), PTB fused with GFP in HeLa cells (B) and stably expressed GFP::PTB in U2OS cells (C) co-purify with endogenous hAgo2 and let-7. Immunoprecipitations (IP) were carried out with the indicated antibodies.

On the other hand, the let-7 mismatched oligo did not show any significant effect on the expression of the let-7 reporter suggesting that the mutated oligo no longer interferes with miRNA action (Fig. 2A).

We co -transfected the control, the let-7 complementary, and the let-7 seed mismatched oligos into HeLa cells together with a luciferase reporter plasmid that carried a portion of the 3′UTR of the human HMGA2, which contains four bona fide let-7 target sites [39], [40].

MiRNAs bind their target through the seed sequence; we therefore mutated two nucleotides in the let-7 oligo that pair with the seed sequence of members of the let-7 miRNA family (Fig. 1A).

Affinity purification of PTB using biotinylated 2′-O-Methyl let-7 inhibitor.

Taken together, our data suggest that like observed in humans, C. elegans PTB is working in collaboration with let-7 miRNA to regulate let-7-specific gene.

We can therefore test if the C. elegans ortholog of the human PTB gene called ptb-1 contributes to let-7 -mediated gene regulation in animals.

Furthermore, a genetic interaction observed between C. elegans PTB and let-7 miRNA supports a conserved function of PTB in modulating miRNA -mediated gene regulation.

PTB binding to the let-7 complementary oligo is sensitive to mutations in the let-7 seed complementary sequence.

PTB is associated with hAgo2 and let-7 miRNA.

Affinity purification of let-7 associated complexes.

PTB modulates let-7 mediated gene silencing in C. elegans.

PTB association with the let-7 loaded human RISC is maintained by using different lysis protocols (A) and; using different antibodies of hAgo2 and PTB (B).

In all cases, we could detect Ago2 and let-7 specifically associated with the PTB bound fractions.

Since we did not observe change in the steady state level of let-7 in the double mutant (Figure 6B), we concluded that PTB is likely required for miRNA -mediated gene silencing at the effector step.

We asked if we could use this approach to purify additional proteins associated with the let-7 programmed miRNA induced silencing complex (miRISC) in human cells.

0033144.g003 Figure 3PTB is associated with hAgo2 and let-7 miRNA.

We showed that PTB imunoprecipitates with Ago2 (Fig. 3A upper panel) and the mature let-7 miRNA (Fig. 3A lower panel).

RNA oligonucleotides to detect human and C. elegans let-7 in Nortern hybridization: 5′-UAUACAACCUACUACCUCAUU-3′, to detect human miR-21: 5′-UCAACAUCAGUCUGAUAAGCUA-3′ synthetic let-7a: 5′-UGAGGUAGUAGGUUGUAUAGU-3′ and RNA to detect tRNA-Ile: 5′-UGGUGGCCCGUACGGGGAUCGA-3′ were purchased from Dharmacon and MWG.

Next, we carried out scaled-up affinity purifications to identify proteins that bound specifically along with let-7 and the let-7 associated RNPs.

0033144.g002 Figure 2PTB association with the let-7 bead depends of the let-7 seed complementary sequences.

***: p<0.0001 (B) let-7 level remained unchanged in the let-7ts/ ptb-1 animals.

Figure S1 PTB co-purifies with the let-7 loaded RISC.

Blue nucleotides indicate changes generated from the original let-7 oligo.

We also showed that the XR tagged nPTB co-immunoprecipitates with let-7 (Fig. 4B).

Finally, we carried out co-fractionation experiment and observed that a substantial fraction of let-7 co-fractionates with PTB (Figure S2).

The quantity of let-7 of the fractions was determined using 1 and 10 femtomole let-7 standards run alongside the fractions on Northern blots.

Affinity purification with this oligo showed similar levels of bound Ago2, PTB and let-7, indicating that our purification was indeed dependent upon the let-7 binding and thus specific (Fig. 2C).

Proteins that are specifically pulled down with the let-7 oligo are labeled next to the stained gels.

The amount of RNA was used for Northern blotting is indicated on the top of the panel and the U6/ let-7 ratios are presented at the bottom of the panel.

Since let-7 loss-of-function is lethal [43], we used a C. elegans strain that carries a thermosensitive (ts) allele of the let-7 gene ((let-7(n2853)); [43].

This experiment again showed that let-7 specifically associated with PTB (Fig. 3C).

To confirm the association between PTB and the let-7 programmed RISC, we first carried out immunoprecipitation experiments with antibodies raised against PTB.

PTB association with the let-7 bead depends of the let-7 seed complementary sequences.

First, we tested if we could detect let-7 and human Ago2, the components of the let-7 programmed minimal RISC, in the bound fraction purified with the biotinylated let-7 complementary oligo from HeLa cell lysates.

We found several proteins that co-purified with the let-7 complementary oligo, but the only protein that we identified in at least two independent affinity purifications was PTB (Fig. 1C, the two panels show the result of the two independent affinity purifications).

RNAs were purified from the indicated genotypes and probed for let-7 and U6 RNAs.

The quantity of let-7 miRNA associated with the indicated oligos was quantified using Northern hybridization and normalized to the amount of miRNA pulled down with the wild-type let-7 oligo.

Next we used the seed mismatched oligo in affinity purification experiments to see how its affinity to the component of the let-7 programmed miRISC and PTB is affected.

0033144.g001 Figure 1Affinity purification of let-7 associated complexes.

Figure S2 PTB and let-7 co-fractionate in human cells.

Next we asked whether other miRNAs are associated with PTB or its association is specific to let-7. When we re-hybridized the RNAs derived form PTB IPs with a probe detecting miR-21, we observed its presence in the PTB containing bound fractions (Figure S3A and B).

The affinity purification showed that both Ago2 and let-7 were bound to the let-7 specific oligo but they were not detectable in the bound fraction of the affinity purification carried out with a non-specific 2′- O-Methyl oligo (Fig. 1B).

We found that Ago2 and let-7 co-immunoprecipitate with the GFP::PTB but not with GFP alone (Fig. 3B).

Quantification of bound let-7 showed that the seed mismatched oligo bound only half the amount of let-7 that was affinity purified with the let-7 complementary oligo (Fig. 2B).

38

Importantly, since direct targeting of the let-7 miRNAs in adult erythroblasts causes more robust effects in the reactivation of HbF levels, the results shown here suggest that HMGA2 expression is not sufficient to fully explain the downstream effects of the LIN28- let-7 circuit in the regulation of HbF levels.

Additional studies demonstrated that the let-7 miRNAs, as well as LIN28A and LIN28B (proteins that bind and inhibit let-7 miRNAs) regulate HbF expression levels to >30% of the total hemoglobin produced in cultured erythroblasts from adult humans [17].

Over -expression of HMGA2 did not significantly affect the levels of LIN28 or any of the let-7 family members, suggesting that the effects were not mediated by feedback regulation within the let-7 regulatory circuit.

In erythroid cells, the let-7 family of microRNAs (miRNAs) is highly regulated during the fetal-to-adult developmental transition, where let-7 family members are consistently up-regulated in adult blood compared to cord blood reticulocytes [16].

Of note, over -expression of HMGA2 transcripts, possibly due to disruption of the let-7 miRNAs binding sites at the HMGA2 locus, accompanied an increased expression of endogenous HbF in a patient receiving lentiviral beta-globin gene therapy for the treatment of severe transfusion -dependent beta-thalassemia [27].

To prevent degradation in the adult CD34(+) cells, the 3’-untranslated region (UTR) of the gene where the let-7 miRNAs binding sites are located was excluded, and only the open reading frame from the HMGA2 variant 1 was used in the over -expression lentivirus transgene, keeping intact the region encoding the DNA -binding AT-hook domains.

Overall, the data showed here supports the notion that the LIN28- let-7 pathway regulates HbF, at least in part, by targeting of the erythroblast HMGA2 transcripts.

Despite the high HMGA2 protein levels detected in each donor’s cells, HbF was increased to levels lower than those observed in previous studies directly targeting LIN28 or let-7 miRNAs performed under similar culture conditions [17].

These results demonstrate that upon high-level erythroblast expression of HMGA2 there is no feedback loop that regulates LIN28 transcripts or the let-7 miRNAs.

To determine if HMGA2-OE acts via known regulators of gamma-globin, Q-RT-PCR analyses were performed for expression of the LIN28 genes, the let-7 family of miRNAs as well as several erythroid-related transcription factors.

Lentiviral constructs were designed for let-7 resistant expression of HMGA2 variant 1 (HMGA2-OE) driven by the erythroid specific gene promoter region of the human SPTA1 gene (GRCh38/hg381; chromosome 1: 158,686,528–158,687,488), with a matched empty vector control.

Finally, our studies on HMGA2 add to recent efforts aimed toward developing an experimental bridge that connects the ancient and well-conserved LIN28- let-7 developmental timing circuit with the abundant knowledge of globin gene regulation during human ontogeny.

For each let-7 family member, standard curves were constructed on the basis of the synthetic targeted mature miRNA oligonucleotide of known concentration (1:10 serial dilutions, n = 6).

Importantly, HMGA2 had only modest effects in the activation of HbF, so these results are unable to fully explain the more robust HbF effects of let-7 miRNA suppression by LIN28 in the same culture mo del [17].

We report here that erythroid-specific- let-7-resistant HMGA2 over -expression had only minor effects in ex vivo erythropoiesis and enucleation.

High Mobility Group AT-hook 2 (HMGA2) is a member of the HMGA non-histone chromatin protein family known as ‘architectural transcription factors’ and are downstream targets of the let-7 miRNAs.

Here we expressed a let-7-resistant HMGA2 variant 1 driven by the erythroid specific gene promoter region of the human SPTA1 gene.

Our data support that the LIN28- let-7 heterochronic pathway increases HbF, in part, by the targeting of erythroblast HMGA2 transcripts.

Our results demonstrate that HMGA2, a downstream target of the let-7 miRNAs [37], plays a moderate role in the modulation of gamma-globin and HbF levels.

Effects in the expression levels of the let-7 family of miRNAs were analyzed in HMGA2-OE and empty vector control transductions.

Due to a modest effect on HbF with HMGA2-OE, additional factors are being sought that may act in combination with HMGA2 for the activation of HbF in adult erythroblasts, such as other downstream mRNA targets of the let-7 family of miRNAs.

Recently, the heterochronic LIN28- let-7 pathway that has been associated with developmental timing events in C. elegans has been reported to be involved in the modulation of HbF levels [17, 19].

HMGA2 mRNA is negatively-regulated by the binding of let-7 miRNAs to the 3’-UTR region [20, 21].

Since the LIN28 RNA -binding proteins negatively regulate the let-7 family of miRNAs [36] and the let-7 miRNAs are negative regulators of HMGA2 [21], we investigated the role of HMGA2 in the regulation of HbF.

HMGA2 does not regulate the let-7 family of miRNAs.

Here we focus on recent discoveries that highlight the interplay between the heterochronic LIN28- let-7 pathway and the regulation of HbF.

0166928.g004 Fig 4HMGA2 does not regulate the let-7 family of miRNAs.

HMGA2 variant 1 was chosen because it is the only HMGA2 variant with let-7 binding sites in its 3’ UTR [20, 21].

Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation.

39

b. Genes related to EMT were detected, and results showed that let-7 inhibited the EMT of HCC cells through regulating E-cadherin, N-cadherin and Snail, of which, E-cadherin was up-regulated, whereas, the mesenchymal biomarker N-cadherin and Snail were decreased.

d. Wnt1 mRNA expression in tissues from 20 patients were tested, and there is inverse correlationship between let-7a miRNA and Wnt1 mRNA was found, Pearson = −0.722, p < 0.01 Let-7 is a family consisting of 13 members located on nine different chromosomes whose expression is usually lost, reduced, or deregulated in most human malignancies [21].

a. Gene expression levels of let-7 targeted genes, which were implicated in cell apoptosis and cell cycle regulations.

Tumor suppressive let-7 miRNAs are universally down-regulated in human hepatocellular carcinoma (HCC) versus normal tissues; however, the roles and related molecular mechanisms of let-7 in HCC stem cells are poorly understood.

a. The expression levels of let-7 miRNAs in HCC cells were detected after lentivirals infection, and results showed that we successfully constructed let-7 overexpressing HCC cells.

Let-7 functions are detailed explored in many kinds of tumors, and let-7 acted through post-transcriptional regulations of the targeted genes [30].

In HCC, it has been reported that aberrant expression of let-7 miRNAs contributed to the development and progression of HCC [5, 6].

d. The results of immunofluorescence showed that β-catenin was decreased due to let-7 overexpression in HCC stem cells We used the RNA interference assay to suppress Wnt1 activity in HCC cells by three independent siRNA.

Overall, our results suggest that overexpression of let-7a could be used as a therapeutic agent and prognostic indicator in the management of HCC via repression of Wnt signaling activation in stem cells, and to help understand the mechanisms through which let-7 regulates HCC stem cells.

Our results suggest that overexpression of let-7a could be used as a therapeutic agent and prognostic indicator in the management of HCC against Wnt activation, and help to understand the mechanisms through which let-7 regulated HCC stem cells.

The lentivirals vectors infected cells were red when observed under Inversed Fluorescent Microscope Fig. 2The inhibitory effects let-7 on HCC cells.

Growing evidence suggests that the restoration of let-7 expression effectively repressed cell proliferation, invasion, metastasis, and resistance to therapy.

Let-7 miRNAs, especially let-7a, will be a promising therapeutic strategy in the treatment of HCC through eliminating HCC stem cells, which could be achieved by their inhibitory effect on the Wnt signaling pathway.

Wnt/β-catenin transactivation of let-7 in breast cancer further suggested the regulatory roles of let-7 in stem cells’ regulations [31].

The suppression of EMT signaling factors in HCC cells contributed to let-7’s induced tumor viability repression and Wnt activation repression.

We further identified that repressed Wnt1/Frizzled/β-catenin signaling in a CSC-enriched population was attributed to enforced let-7 and let-7 enhanced cis-platinum functions, helping to inhibit the self-renewal of stem-like cells.

The relative expression of let-7 family members was normalized to U6 expression, and then calculated using the formula 2 [−ΔΔCt] method, versus the scramble control.

However, the underlying mechanism by which let-7 works to inhibit CSCs in HCC remains largely unknown.

What’s more, the therapeutic trial of let-7 mimics showed suppressed effects on tumor growth in pre-clinical studies [4].

Fig. 1The construction of let-7 miRNAs overexpressing HCC cells.

Functioning as tumor suppressors, let-7 miRNAs were found to repress Ras, Bcl-xl, MAPK, c-Myc, cyclin D1 and other oncogenes in HCC [8, 9].

a. After let-7 miRNAs were successfully overexpressing in HCC cells, the effects of let-7 on cell proliferation were detected by MTT assay.

We examined the inhibitory effect of let-7 miRNAs on the proliferation of MHCC97-H and HCCLM3 hepatic cancer cells by using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, which was further confirmed by apoptosis and cell cycle studies.

Let-7 and Wnt1 expression in clinical tissues.

Especially, nanoparticle -based let-7 replacement therapy had been successfully applied in vivo, together with other delivery methods, including lentivirus -mediated pre–let-7 s, adenovirus -mediated hairpin sequences of mature let-7, cationic liposome–mediated pre–let-7, and electroporation of synthetic let-7 [8, 26].

The function of let-7 miRNAs in HCC cells.

The findings of let-7 repression on CSC self-renewal indicated that let-7 restoration may be a useful therapeutic option in HCC and stem-like cells, which was more crucial for curing the cancer [8, 22– 24].

For the first time, we identified the let-7 controlled Wnt signaling activity, which was accused for maintaining of cell pluripotency.

However, there is no research focused on the relationship between let-7 and the Wnt signaling pathway.

However, the roles of let-7 in HCC stem-like cells are less involved.

Let-7 miRNAs Hepatocellular carcinoma Cancer stem-like cells EMT Wnt signaling Hepatocellular carcinoma (HCC) is one of the most aggressive malignancies worldwide, being recognized as the third leading cause of cancer-related deaths [1, 2].

40

Among the potential pathways predicted from miRNAs differentially expressed between dormant and activated blastocysts, the Wnt pathway may be relevant to the observed action of let-7. Two miRNAs target gene prediction softwares, TargetScan and PicTar show that Kremen1 and Wnt1 are target genes of let-7. Wnt1 is predominantly expressed in the inner cell mass of mouse blastocyst [69], while Kremen1 is detected primarily in the trophectoderm of dormant blastocysts and is translocated into the nuclei of trophodermal cells in activated blastocysts [47].

The evidence include (a) Let-7a bound to the 3′UTR region of the integrin-β3; (b) forced -expression of let-7a reduced the expression of integrin-β3; and (c) forced -expression of integrin-β3 partially rescued the suppressive effect of let-7 on blastocyst implantation, attachment and outgrowth.

Down-regulation of let-7 in the activated blastocysts would enable up-regulation of let-7-response genes, many of which are oncogenes or cell cycle checkpoint genes, leading to cell cycle progression, DNA synthesis and cell division.

In view of the high level of let-7 in dormant embryos, we postulated that up-regulation of let-7 suppress blastocyst implantation.

The expression of let-7 is dynamically regulated during oogenesis and early embryonic development [7].

Apart from the possible compensatory function of integrins, the inability of forced -expression of integrin-β3 in completely nullifying the inhibitory action of let-7 precursor on blastocyst outgrowth could be due to the involvement of other pathway(s) mediating the action of of let-7 on embryo implantation.

The high level of let-7 during dormancy relative to the normal blastocyst and the down-regulation of let-7 in the activated blastocysts suggest that a low level of let-7 is beneficial for implantation.

Similar to the report in mouse [9], a continuous decrease of expression levels of let-7 family members was found during preimplantation development of human embryos (Fig. 1d ).

Here, we studied the let-7 function by forced expression of precursor of let-7 in embryos using electroporation as described for studying the roles of specific genes in mouse preimplantation embryo development [27], [28].

The knowledge gained may be applied to humans as a continuous down-regulation of let-7 is also observed in the human preimplantation embryos.

Several of the let-7 members are upregulated in the delayed implantating mouse uterus after activation [70] and in the implantation site relative to inter-implantation site [71].

The present study showed that the expression level of let-7 family in human blastocysts is also low, consistent with a similar role of the miRNA in preimplantation embryo development.

Precursor of let-7 inhibits embryo implantation in vivo.

Expression of let-7 family members (in Ct values) in dormant and activated blastocysts.

Whether let-7 modulates the expression of integrin-β3 in the uterine luminal epithelium remains to be determined.

0037039.g003 Figure 3Precursor of let-7 inhibits embryo implantation in vivo.

Both the luminal epithelium and the stroma of endometrium express let-7 members with unknown function [71], [72].

Let-7 family is wi dely demonstrated as a tumor suppressor.

The results showed that let-7 is involved in the regulation of blastocyst activation.

Other than integrin-β3, let-7 is known to regulate RAS [66], HMGA2 [67] and Dicer [68].

Nine members of the let-7 family were analyzed in the profiling experiment.

The let-7 family consists of 11 members, which are conserved in invertebrates and vertebrates, including humans [48], [49].

Several members of the let-7 family (let-7a, -7d, -7e, -7f, -7g) were also found in the list.

Let-7 controls cellular proliferation by negatively regulating RAS and cell cycle-related genes such as cyclin D2, CDK6 and CDC25A [53].

To determine whether a low level of let-7 also occurred in human blastocysts, donated human embryos cryopreserved at the 2–4-cell stage were thawed and cultured to blastocysts.

41

and exhibit increased expression in p53 wild-type radiation sensitive tissues which is similar to the let-7 expression pattern, but do not exhibit increased expression in radiation insensitive tissues, or tissues from p53 knock-out mice (other transcription factors mediate minimal expression of Puma in the absence of p53).

This is in part explained by the fact that let-7 family members have been shown to target expression of proteins involved in cell proliferation such as Ras [7] and cell cycle regulation such as Cdc25A and cyclin D1 [8], [9], which contribute to its tumor suppressor phenotype.

Furthermore, after irradiation let-7a and let-7b expression decreased in ATM [+/+] fibroblasts but not ATM -deficient fibroblasts (Fig. 2B and C) suggesting that ATM -dependent p53 activation is necessary for radiation -induced changes in let-7 expression.

Similar to the response of let-7 expression, both and showed a much greater change in expression in radiation-sensitive tissues compared to radiation- resistant tissues (Fig. 5A and B, respectively) which may suggest that let-7a and let-7b regulation by p53 may be associated with the p53 mechanisms that induce apoptosis.

Deletion or mutation of let-7 family expression is highly associated with the development of cancer [5], while the presence of increased let-7b decreases lung tumor growth in mice [6] and sensitizes lung cancer cells to radiation [2].

ATM [+/+] and ATM [−/−] fibroblasts were also collected after irradiation and expression of let-7a (B) and let-7b (C) decreased in the ATM [+/+]cells but not in ATM [−/−] cells suggesting that ATM -dependent p53 activation is necessary for radiation -induced changes in let-7 expression.

These results suggest that p53 plays an important role in stress -induced miRNA expression changes and is required for the observed decrease in let-7 expression signaled by DNA damage.

Expression of let-7 remained either unchanged or increased in all tissue types collected from p53 knock-out mice.

Basal let-7 expression is greater in radiation sensitive tissues, especially lung.

However, the mechanism underlying the decrease in let-7 expression after irradiation has not yet been elucidated, and a greater understanding may allow for manipulation of these pathways for therapeutic intervention.

To further study this interaction between p53 and let-7 expression, an in silico analysis was performed which identified a possible p53 binding site approximately 450 bp upstream of the let-7a3/let-7b gene.

let-7a and let-7b account for about 60% of overall let-7 expression in HCT116 cells [18] and about 70% in AG01522 cells [3].

A recent study has shown that p53 can interact directly with the miRNA processing enzyme Drosha [23], and it is therefore possible that this may also play a role in the p53 -mediated repression of the let-7 family, in addition to transcriptional regulation.

p-value determined by Student's t. let-7a and let-7b account for about 60% of overall let-7 expression in HCT116 cells [18] and about 70% in AG01522 cells [3].

Studies have shown that over -expression of let-7 increases sensitivity of cells to radiation [2] and cisplatin [24].

Reduced expression of the let-7 miRNA family has been shown to be activated in response to irradiation [2], [3].

Our results confirm a radiation -induced decrease in let-7 expression in both HCT116 p53 [+/+] colon cancer cells and ATM [+/+] fibroblasts.

In contrast, radiation resistant tissues from the wild-type mice did not exhibit a decrease in let-7 expression (Fig. 4E and F).

Therefore it is logical to suggest that higher expression of let-7 may contribute to radiation sensitivity.

This differential response in let-7 expression closely mimics the difference we observed between HCT116 p53 [+/+] and p53 [−/−] cells suggesting a similar mechanism might be responsible.

We hypothesized that, since p53 is activated by both oxidative stress and DNA damage, p53 could be involved in the mechanism underlying the observed let-7 expression changes.

The in vivo response of let-7 to DNA damage was determined by treatment of C57BL/6J wild-type and p53 knock-out mice with 2.0 Gy total body irradiation (TBI).

These genotoxic stressors similarly resulted in a decrease of both let-7 species that was observed only in the p53 [+/+] cells.

These observations taken together display significant potential of let-7 mimics as adjuvant cancer therapeutics.

In addition to sensitizing to cytotoxic agents, it has been previously observed that let-7 can significantly slow tumor growth in vivo [6] and suppress stem cell characteristics in tumors [25].

Several previous studies have shown that the let-7 family of miRNA is repressed following exposure to radiation in multiple cell lines [2], [3], [19], [20], [21].

Furthermore only let-7a and let-7b have been reported to decrease at both high and low doses of radiation, thus we chose to focus on those two members of the let-7 family.

42

Furthermore, let-7c expression is downregulated in clinical PCa specimens compared to their matched benign tissues, while the expression of Lin28, a master regulator of let-7 miRNA processing, is upregulated in clinical PCa specimens.

A tumor suppressor role has been attributed to the let-7 family of miRNAs and appears to be undisputed except in rare cases, such as let-7a, which has been reported to target caspase-3 in human cancers [34], thus suppressing susceptibility of cancer cells to chemotherapeutic -induced cell death.

Several reports have established the important role of let-7, showing that members of the let-7 family are downregulated in lung cancers and that this downregulation is correlated with poor survival [8].

LNCaP-IL6+ and LNCaP-S17 cells (autocrine IL-6 signaling) showed reduction in let-7c levels, consistent with the report that IL-6 reduces let-7 expression in PCa cells and that let-7 regulates IL-6 expression [18].

Lin28, a highly conserved RNA -binding protein and a master regulator of let-7 miRNA processing, is overexpressed in primary human tumors [17], [18] and is postulated to be one of the embryonic stem cell factors that promote oncogenesis and proliferation of cancer cells, by repression of the let-7 family of tumor suppressors [19].

Let-7 expression was found to be downregulated in localized PCa tissues relative to benign peripheral zone tissue [11], [12].

Therapeutic strategies are being developed targeting let-7, using either lenti-or adeno-viral-encoded overexpression of let-7 or transient transfection of double-stranded precursors of let-7 [15], [16].

Recent reports showed that expression of let-7 family of miRNAs is regulated by Lin28, a master regulator of miRNA processing [18], [20].

Expression of let-7 in lung cancer cell lines reduced cell proliferation [5] and inhibited tumorigenesis of breast cancer cells while also reducing metastases [6].

There is an evident link between loss of let-7 expression and development of poorly differentiated and aggressive cancers [10].

Earlier reports showed that IL-6 and let-7 exhibit reciprocal regulation of expression.

This Lin28/let-7/c-Myc loop may play an important role in the deregulated miRNA expression signature observed in many cancers [24].

Let-7 members have been shown to regulate expression levels of oncogenes like HMGA2 [5], RAS [13] and Myc [14] along with genes involved in cell cycle and cell division regulation.

Overexpression of let-7 also decreased lung cancer cell resistance to radiation therapy [7].

Reduced expression of let-7 in human lung cancers has been associated with shortened post-operative survival, suggesting that let-7 may be an important prognostic marker in lung cancer [8].

In this study, we demonstrate that let-7c, one of the members of the let-7 family, suppresses PCa growth in vitro and in vivo.

Even though members of the let-7 family may exhibit some redundant functions, individual components may be subject to differential and tissue-specific regulation in different cell types.

Our results imply that prostate tumor growth is regulated by let-7c and that reconstitution of let-7 may have beneficial effects in PCa by decreasing survival and proliferation of tumor cells.

These conflicting data on deregulation of let-7 in various human cancers show that individual let-7 family members may have distinct and varying activities in different cells and do not simply exhibit redundant functions.

Thus, let-7 shows promise as a molecular marker in certain cancers and as a potential therapeutic in cancer treatment.

Let-7 encodes an evolutionarily conserved family of 13 homologous miRNAs located in genomic locations frequently deleted in human cancers [4].

Lin28 also derepresses c-Myc by repressing let-7 and c-Myc transcriptionally activates Lin28 [22], [23].

Lin28 binds to the terminal loops of the precursors of let-7 family miRNAs and blocks their processing into mature miRNAs [20], [21].

43

We found that Gal-3 negatively regulates expression of the miRNA let-7, which itself down-regulates K-Ras expression [3] (Figure 5).

In normal cells, let-7 miRNAs act as tumor-suppressor genes that downregulate Ras expression [2].

A variant allele in the K-Ras 3-untranslated region, which arises in the let-7 miRNA complementary site (K-Ras-LCS6) and leads to increased K-Ras expression in lung cancer [36], was shown to significantly reduce survival time in squamous cell carcinoma of the head and neck, suggesting that this variant may alter the phenotype or therapeutic response of the disease [37].

However, the dual control over K-Ras expression and activity that we describe here indicates that let-7, even without oncogenic mutation, can regulate Ras activity and that this might be a general phenomenon related to the interactions between tumor suppressor genes (e. g. let-7) and proto-oncogenes (e. g. K-Ras) or oncogenes (e. g. K-Ras G12V or G12D).

The results indicate that Gal-3 negatively regulates let-7 expression, which in turn leads to increased expression of K-Ras.

In the latter case, as in many human tumors, Gal-3 acts as a negative regulator of let-7 expression, leading to an increase in K-Ras expression levels associated with increased stability and activity of K-Ras.

Binding of let-7 to the K-Ras 3′-untranslated region in the let-7 miRNA complementary site (K-Ras-LCS6) results in a decrease in the transcription and/or degradation of K-Ras mRNA [36], with consequent reduction in K-Ras expression.

Ras genes and oncogenes are regulated by members of the let-7 miRNA family by virtue of the possession by these genes of let-7 complementary sites in their 3′-untranslated regions (UTRs) [3].

Control of K-Ras expression by the let-7 family of miRNAs has been well documented.

Low levels of let-7 expression in human tumors correlate with high levels of K-Ras [36]– [38].

Here we examined the possibility that Galectin-3 (Gal-3) interacts with active K-Ras [10], [11] and may modulate let-7 expression.

To determine whether this negative regulation might be associated with the positive regulation of K-Ras by Gal-3, we first examined a possible correlation in the Gal-3 [-/-] cells between the levels of K-Ras transcripts and let-7 transcripts, particularly let-7a and let-7c (the abundant miRNAs of the let7 family).

Reduction of let-7 has been reported in several human cancers including melanoma, colon and lung [4]– [6] and their expression has been shown to attenuate cancer cell proliferation and tumorigenicity [7], [8].

Yet another study described a SNP in a let-7 miRNA in the complementary site in the KRAS 3′-untranslated region that reduces the binding of let-7 and correlates with increased risk of NSCLC [9].

In another study, genetic modulation of the let-7 miRNA binding to the KRAS 3′-untranslated region was found to correlate with survival of metastatic colorectal cancer patients who underwent salvage cetuximab-irinotecan therapy [38].

Loss of nuclear Gal-3 expression is associated with tumor progression [20], just as loss of let-7 leads to progression of many human tumors [23].

The significance of this control mechanism has been highlighted in a number of studies that report a correlation between let-7 expression and cancer.

Ras transcription is negatively regulated by the let-7 miRNA family of small RNAs [3].

This dual mode of regulation of K-Ras by Gal-3/let-7 suggests a new signaling pathway (see scheme in Figure 6).

The above results suggest that Gal-3 regulates the transcriptional level of let-7, and show for the first time that Gal-3 mediates K-Ras transcription through let-7c.

Our results showing that Gal-3, through its negative regulation over let-7, is highly carcinogenic are consistent with that study.

Recently a single-nucleotide polymorphism (SNP) was detected in a let-7 miRNA complementary site in the KRAS 3′UTR in non-small cell lung carcinoma (NSCLC) and was found to be correlated with increased risk for NSCLC [9].

These findings led us to postulate that loss of Gal-3 might be related to the increase in let-7 and decrease in K-Ras stability.

44

Comparison of the overall microarray expression profiles of bpa-miR-5364 with the B. pahangi let-7 family miRNAs reveals a related but distinct pattern: while the expression profiles of all three miRNAs mirror each other, bpa-miR-5364 is found at a much higher level than bpa-let-7 and bpa-miR-84 and is up-regulated a minimum of 24 hours earlier (Figure  2B).

Similarly, in a detailed analysis of miRNA expression following dauer or continuous development, let-7 family members showed increased expression post-dauer [54].

We chose to focus on bpa-miR-5364 for the following reasons: its expression profile is particularly striking as it is up-regulated ~12 fold (Log [2] 3.64) within 24 hours of infection of the mammalian host and doubles again over the period to day 10 p. i. (Table  1); bpa-miR-5364 shares sequence similarity with the let-7 miRNA family and appears to be specific to clade III parasitic nematodes (as described below); it is one of the most abundant miRNAs with only bpa-lin-4 and bpa-miR-71 found at higher levels at day 10 p. i. (Additional file 1).

Here we show that bpa-miR-5364, which is specific to clade III parasitic nematodes and related to the let-7 family, is highly up-regulated to coincide with transmission to the mammalian host and may be involved in the infection event by targeting specific mRNAs.

possess three let-7 family members, let-7, miR-84 and miR-5364, all of which are up-regulated post-infection, with expression of miR-5364 increasing first, within 24 hours, and rising to a significantly greater level than either let-7 or miR-84, suggesting that in Brugia spp.

Predicted miRNA target sites for the three target genes in both parasite species are shown in Additional file 9. Interestingly, conserved sites for let-7 and miR-84 are found for Bm1_27305 with almost identical positioning in each species.

One of these, bpa-miR-5364, was selected for further study as it is upregulated ~12-fold at 24 hours post-infection, is specific to clade III nematodes, and is a novel member of the let-7 family, which are known to have key developmental functions in the free-living nematode Caenorhabditis elegans.

C. elegans let-7 was the second miRNA to be identified and acts from the L3 stage onwards to regulate the transition from L4 to adult by down -regulating a number of targets, including LIN-41 [3, 11].

In mammalian cells, HMGA2 is abundant during early development and levels decrease during later stages of development and differentiation, via let-7 regulation [61].

In this paper we show that a novel member of the let-7 miRNA family, bpa-miR-5364, is highly up-regulated to coincide with the transition of the L3 from mosquito to mammalian host.

In a recent study, four C. elegans miRNAs were found to be up-regulated in samples of mixed stages compared to dauers, two of which are the let-7 family members miR-241 and miR-795 [26].

In addition, the C. elegans ortholog of Bm1_27305, C33A11.4 (Table  2) also known as tag-97, has predicted binding sites for let-7 family miRNAs using PITA (results not shown) and TargetScan [53] (http://www.

This suggests that similar mechanisms of autoregulation to those described for let-7 and lin-4 in C. elegans might exist for mir-5364 in the parasite.

In addition, autoregulation of let-7 has been identified in C. elegans, in which binding of let-7 to its own 3′UTR acts to increase processing of the pri-miRNA by argonaute, leading to higher levels of the mature miRNA [21].

bpa-miR-5364 is a novel member of the let-7 miRNA familyIn the free-living nematode C. elegans, the let-7 miRNA family controls developmental transitions and consists of seven members of which only two (let-7 and miR-84) are found in Brugia spp.

In C. elegans, let-7 is autoregulated via a let-7 binding site situated at the 3′ end of the primary transcript approximately 500 bp downstream of the sequence encoding the mature miRNA [21].

In C. elegans, an important function of let-7 is the negative regulation of LIN-41 [3, 11], which contains a ubiquitin ligase domain.

Importantly, this set included the let-7 miRNA family members bpa-let-7 and bpa-miR-84, suggesting that other B. pahangi miRNAs with important developmental functions could potentially be identified by this analysis.

In the free-living nematode C. elegans, the let-7 miRNA family controls developmental transitions and consists of seven members of which only two (let-7 and miR-84) are found in Brugia spp.

bpa-miR-5364 is a novel member of the let-7 family, consistent with the function of other members of that family in nematode development.

let-7 is the founding member of a family of C. elegans miRNAs that share identity in the seed sequence (5′ nucleotides 2–7).

In addition to bpa-let-7 and bpa-miR-84, the three other miRNAs that met the criteria were bpa-miR-5364, cel-miR-789 and bpa-miR-5853.

bpa-miR-5364 is a novel member of the let-7 miRNA family.

Figure 2 miR-5364 is a novel member of the let-7 miRNA family.

While let-7 is involved in specifying larval-adult cell fate, miR-48, miR-84 and miR-241 are co-activated at an earlier time point where they co-ordinate the L2-L3 transition [4].

Therefore mir-5364 may have diverged from the let-7 family during the evolution of clade III nematodes, an event that occurred 350–540 million years ago [65].

Similarly, using PITA the C. elegans ortholog of Bm1_05425 (T22C1.1) has a site for the let-7 family member miR-794 (results not shown).

B. Abundance of bpa-miR-5364, bpa-let-7 and bpa-miR-84 increase in parallel from mosquito-derived (MD) L3 to adult as determined by microarray analysis (log [10] scale).

A. CLUSTAL alignment comparing miRNA sequences from the C. elegans let-7 family with bpa-miR-5364, bpa-let-7 and bpa-miR-84.

Given the sequence similarity between miR-5364 and the let-7 family (Figure  2A) this might be expected; however, the binding sites for miR-5364 and let-7/miR-84 are not identically positioned (see Additional file 9).

45

Carrier DiseaseTarget miRNA (s) and role in cancer Viruses Adeno -associated viruses(AAV8)Hepatocellular cancer miR-26 tumor suppressor[140] Adenoviruses Lung cancer let-7 tumor suppressor[141] Adenoviruses Glioblastoma miR-145 tumor suppressor [144] Adenoviruses Glioblastoma miR-221-222 oncogene[145] Lentiviruses Prostate cancer miR-15-16 tumor suppressor[142] Lentiviruses Pancreatic cancer miR-21 oncogene [143] Lipid -based nanoparticles Cationic liposomes Breast cancer miR-34a tumor suppressor[124] Cationic liposomes Pancreatic cancer miR-34a, miR-143-145 tumor suppressors[146] Neutral lipid emulsion © Lung cancer miR-34a, let-7 tumor suppressors[147] Stable nucleic acid lipid particles Glioblastoma miR-21 oncogene[148] Polymer -based nanoparticles Polyurethane Glioblastoma miR-145 tumor suppressor[149] Poly(lactic-co-glycolic acid) Lymphoma miR-155 oncogene[96] Polyamidoamine Glioblastoma miR-21 oncogene[150]Viral vectors have also been applied in miRNA -based therapeutic strategies towards GBM.

Carrier DiseaseTarget miRNA (s) and role in cancer Viruses Adeno -associated viruses(AAV8)Hepatocellular cancer miR-26 tumor suppressor[140] Adenoviruses Lung cancer let-7 tumor suppressor[141] Adenoviruses Glioblastoma miR-145 tumor suppressor [144] Adenoviruses Glioblastoma miR-221-222 oncogene[145] Lentiviruses Prostate cancer miR-15-16 tumor suppressor[142] Lentiviruses Pancreatic cancer miR-21 oncogene [143] Lipid -based nanoparticles Cationic liposomes Breast cancer miR-34a tumor suppressor[124] Cationic liposomes Pancreatic cancer miR-34a, miR-143-145 tumor suppressors[146] Neutral lipid emulsion © Lung cancer miR-34a, let-7 tumor suppressors[147] Stable nucleic acid lipid particles Glioblastoma miR-21 oncogene[148] Polymer -based nanoparticles Polyurethane Glioblastoma miR-145 tumor suppressor[149] Poly(lactic-co-glycolic acid) Lymphoma miR-155 oncogene[96] Polyamidoamine Glioblastoma miR-21 oncogene[150] Viral vectors have also been applied in miRNA -based therapeutic strategies towards GBM.

The role of let-7 as tumor suppressor was clearly demonstrated in lung cancer, following the observation that downregulation of let-7 in lung tissues led to the constitutive overexpression of Ras and high-mobility group AT-hook 2 (HMGA2), both being oncoproteins that contribute to the pathogenesis of cancer [44, 45, 46].

In addition to miR-15a/miR-16-1 and let-7, miR-29 family members (miR-29a, b, c) were shown to function as tumor suppressor miRNAs, their downregulation being associated with the development and progression of several human malignancies, including CLL, lung cancer, invasive breast cancer and hepatocellular carcinoma [36, 37, 43, 48].

The transient overexpression of let-7a and let-7f, two dominant isoforms of the let-7 family in A549 lung adenocarcinoma cells, suppressed tumor cell proliferation [125].

Similarly, members of the let-7 family of miRNAs were reported to map in genomic regions which are deleted in different human malignancies [32], and their downregulation is commonly observed in lung, breast and colon cancer [37, 42, 43].

Lee Y. S. Dutta A. The tumor suppressor microrna let-7 represses the hmga2 oncogene Genes Dev.

Reduced let-7 expression was also shown to enhance c-Myc signaling in Burkitt lymphoma (BL) cells [47].

Takamizawa J. Konishi H. Yanagisawa K. Tomida S. Osada H. Endoh H. Harano T. Yatabe Y. Nagino M. Nimura Y. Reduced expression of the let-7 micrornas in human lung cancers in association with shortened postoperative survival Cancer Res.

Similarly, overexpression of let-7 in these cells and HepG2 liver cancer cells repressed cell cycle progression and cell division [126].

Akao Y. Nakagawa Y. Naoe T. Let-7 microrna functions as a potential growth suppressor in human colon cancer cells Biol.

Let-7 overexpression was also reported to induce apoptosis and cell cycle arrest in colon cancer and Burkitt's lymphoma (BL) cell lines [41, 46].

A different lipid -based formulation was also employed for the delivery of miR-34a and let-7 to a Kras -driven NSCLC mouse mo del.

Johnson C. D. Esquela-Kerscher A. Stefani G. Byrom M. Kelnar K. Ovcharenko D. Wilson M. Wang X. Shelton J. Shingara J. The let-7 microrna represses cell proliferation pathways in human cells Cancer Res.

Similarly, the intranasal administration of adenovirally-coded let-7 significantly reduced tumor burden in an orthotopic mouse mo del of NSCLC [141].

46

Increased tumorigenicity and invasion with increased LIN28A expression can be explained mechanistically by down-regulation of let-7 microRNAs and up-regulation of let-7 targets such as HMGA2, a chromatin modifying gene that is associated with numerous cancers [11, 12].

Figure 5Expression of mature let-7g can reverse the pro-invasive phenotype of LIN28A expressing GBM14 cellsGBM14 LIN28A expressing cells were nucleofected with either GFP or let7g expression plasmids and 48 hours later were placed into a Boyden transwell migration chamber.

The let-7 regulated, pro-invasion factor HMGA2 is also downregulated, but the neural stem cell factor SOX2 is not affected by suppression of LIN28A knockdown.

The corresponding decrease in expression of let-7b and let-7g after LIN28A expression suggests that increased LIN28A suppresses let-7 microRNAs and de-represses HMGA2, which is then able to activate a program of increased pro-invasion genes, such as SNAI1.

The primary known targets of LIN28A and the related protein LIN28B are the let-7 family of tumor suppressing microRNAs.

HMGA2, a known let-7 target, was upregulated in GBM14-LIN28A (Figure 4F, G) compared to GBM14-GFP.

Consistent with these results, overexpression of let-7g can inhibit the proliferation of GBM neurosphere cell lines in vitro [39].

Expression of mature let-7g can reverse the pro-invasive phenotype of LIN28A expressing GBM14 cells.

A. High power view (200X) of migrated cells 48 hours after plating in the upper chamber shows decreased migration in GBM14/LIN28A/ let-7g expressing cells (right) compared to GBM14/LIN28A/GFP expressing cells left.

Transduction of GBM14-LIN28A cells with mature let-7g led to reversal of the invasive phenotype and a corresponding downregulation of HMGA2 (Figure 5A-D).

E. qPCR showing that let-7b and let-7g, but not let-7a, are downregulated in JHH-GBM14-LIN28A compared to JHH-GBM14-GFP control.

By increasing the expression of multiple oncogenes simultaneously through repression of the let-7 microRNAs, LIN28A can activate oncogenic programs that enhance glioblastoma aggressiveness.

Over-activation of LIN28A or LIN28B is one mechanism by which cancer cells can eliminate let-7 microRNAs and allow for increased expression of pro-oncogenic signals [5].

In our studies, expression of mature let-7g in LIN28A transduced GBM cells led to a decrease in HMGA2 and reversed the LIN28A -mediated invasive phenotype in vitro.

To investigate the potential mechanisms of LIN28A -induced tumorigenicity, we detected the expression levels of let-7 microRNA and known let-7 targets in JHH-GBM14-LIN28A and JHH-GBM14-GFP.

C. qPCR showing increased expression of let-7g in let-7g­-nucleofected cells compared to GFP-nucleofected cells.

D. qPCR showing decreased expression of HMGA2 in let-7g­-nucleofected cells compared to GFP-nucleofected cells.

Asterisk = p<0.01, Student's t-test GBM14/LIN28A/ let-7g versus GBM14/LIN28A/GFP.

Human tall stature is associated with polymorphisms in HMGA2 [43], suggesting a link between LIN28A, let-7 microRNAs, and HMGA2 and generalized growth.

Asterisk = p<0.0005 Student's t-test GBM14/LIN28A/ let-7g versus GBM14/LIN28A/GFP.

47

Western blot analysis of TF-1a cells that transfected with let-7a and let-7b mimics further confirmed that IGF2BP1 could be downregulated by let-7a and let-7b, in addition to simultaneously reduced LIN28B expression as there is a feedback regulatory loop between LIN28B and let-7 miRNAs (Fig.   5d) [8].

Studies in stem cell, growth and metabolic disorders, and cancers uncover LIN28/LIN28B as a central regulator of cellular metabolism through let-7 -dependent or let-7-independent manner, where LIN28/LIN28B directly binds mRNA of glycolysis and mitochondrial OxPhos enzymes and enhances their translation [37– 40].

The high expression of LIN28B-pDsRed might result in further repression of let-7, thus inhibiting let-7 function might explain the increase of endogenous LIN28B protein.

Bioinformatics predictions from DIANAmT, miRDB, miRwalk, PICTAR5, and Targetscan databases revealed IGF2BP1 as a potential target for the let-7 family miRNAs (Table  1).

As let-7 miRNA family concurrently regulates several pivotal oncogenic pathways, there is of great interest in re -expression of let-7 miRNAs as a therapeutic option for cancer.

LIN28B is a stem cell reprogramming factor, downregulating let-7 microRNAs (miRNAs), where this occurs primarily at a post-transcriptional level [8].

In sum, these results uncover a novel mechanism of an important regulatory signaling, LIN28B/let-7/IGF2BP1, in leukemogenesis and provide a rationale to target this pathway as effective therapeutic strategy.

However, the repression of let-7 miRNAs in cancer stem cells (CSCs) may be due to overexpression of LIN28B [13, 14].

The Pearson r values and p values were determined with GraphPad Prism software We and others reported previously that overexpression of LIN28B contributes to tumor aggressiveness and metastasis through let-7 -dependent mechanisms [16, 18].

Overexpression of LIN28B has been associated with advance human malignancies [16], including leukemias [17, 18], and there are increasing evidences of its role in formation of CSCs and LSCs through either let-7 dependent or independent mechanisms [14, 15, 19].

Strategies using viral vector, to overexpress let-7 miRNAs or by introducing artificial double-stranded miRNA (mimic of let-7 miRNAs), hold great promising for novel anti-AML therapy.

IGF2BP1 was confirmed to be a novel downstream target of LIN28B via let-7 miRNA in AML.

Numerous human malignancies such as ovarian cancer, lung cancer, hepatocellular carcinoma, and melanoma have been shown to have repression of multiple members of the let-7 family of miRNAs, thus promoting oncogenesis by depressing targets such as c-Myc, Ras, and HMGA2 [10, 34].

The repression of members of let-7 miRNAs could well elicit the de-repression of several oncogenes such as K-Ras, c-Myc, and HMGA2 [30– 32], in turn, promoting disease progression.

IGF2BP1 is a novel target gene of let-7 miRNAs.

Thus, targeting LIN28B or let-7 may be an effective therapeutic option for AML patients.

Cells with high level of LIN28B are regarded to have low expression of let-7 miRNA and vice versa.

The Pearson r values and p values were determined with GraphPad Prism software We and others reported previously that overexpression of LIN28B contributes to tumor aggressiveness and metastasis through let-7 -dependent mechanisms [16, 18].

In agreement with the results from HEL cells, silencing of IGF2BP1 or supplying let-7 miRNA mimics significantly suppressed the growth rates of TF-1a cells (Additional file 5: Figure S3).

The reciprocal regulations between LIN28B and let-7 have been confirmed in many studies [16, 25, 26].

The most well-studied molecular mechanism of LIN28B in oncogenesis is its ability in regulating let-7 miRNA biogenesis through a TUTase-independent mechanism by sequestering pri-let-7 miRNAs in the nucleoli [29].

IGF2BP1 is a downstream effector of LIN28B through let-7 miRNA.

Cells were allowed to grow in MyeloAim medium complex containing 10 nM of let-7 miRNA mimic, 400 μl of serum free medium, and 40 μl of MyeloidAim reagent at 37 °C overnight before replacing the medium complex with complete growth medium and continued to culture for another 48 h. Plasmids pEGFP and LIN28B-pEGFP were transfected into TF-1 cells by Neon transfection (electroporation).

Increased let-7 miRNAs promote stem cell differentiation [9].

To examine the functional importance of IGF2BP1 in LIN28B -mediated leukemogenesis, we used HEL AML cell line with endogenous LIN28B to study loss-of-function phenotype by way of depletion of IGF2BP1 or addition of let-7 mimics.

MyeloAim In Vitro Transduction reagent (BIOO Scientific, TX, USA) was used to transfect let-7 miRNA mimics to TF-1a cells.

In summary, our findings demonstrate a pivotal role of LIN28B/let-7/IGF2BP1 in progression of AML and indicate the essential changes in metabolic pathways by LIN28B.

We next applied similar approaches to examine the effects of silencing IGF2BP1 or additional let-7 miRNA mimics in a different cell line, TF-1a cell line.

Let-7 miRNA family consists of 13 members located in genomic locations, which are often mutated in human cancers [10– 12].

In this study, IGF2BP1 has been increased by LIN28B through repression of let-7 miRNA.

Fig. 5Characterization of IGF2BP1 as downstream target of LIN28B via let-7 microRNA.

In fact, loss-of-IGPF2BP1 or additional let-7 mimics led to about a 1.8-fold or 1.5-fold reduction in proliferation, respectively (Fig.   5f, p < 0.01 or p < 0.05, respectively).

48

miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84].

miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84].

Multiple members of let-7 family were also found upregulated in experimental asthma mo del and the pro-inflammatory role of let-7 miRNAs on the allergic cytokine expression was confirmed [91].

Expression profiling study in the rats exposed to environmental cigarette smoke revealed 24 downregulated miRNAs (especially let-7 family, miR-10, -26, -30, -34, -99, -122, -123, -124, -125, -140, -145, -146, -191, -192, -219, -222, and -223) when compared to control group [96].

Recently, it was reported that miRNAs may play pivotal regulatory role also in the fibrotic processes ongoing in the lung: the downregulation of let-7 d in idiopathic pulmonary fibrosis (IPF) resulted in the pro-fibrotic effects [109].

Altered expression of miR-155 and let-7 has been reported in lung adenocarcinoma and expression of let-7 related to patient survival [99].

Moreover, several miRNAs crucial for lung development and homeostasis such as let-7, miR-155 or miR-19-72 cluster have been identified to be deregulated in pulmonary allergy, asthma or lung cancer.

Other miRNAs found to be involved in the pulmonary homeostasis are members of let-7 family [78], miR-29 [79], miR-15 and miR-16 [80, 81], which function as tumor suppressors in lung cells.

Several miRNAs such as miR-155, miR-26a, let-7, miR-29, miR-15/miR-16, miR-223, miR-146a/b and the miR-17-92 cluster have been shown to be involved in homeostasis and in the lung development (Table 4).

In bronchial epithelial cells stimulated with IL-4 and TNFα, let-7, miR-29a and miR-155 have been involved in the regulation of allergic inflammation [90].

The first non-coding RNA identified in humans was let-7, which has been found involved in the control of developmental timing in humans and animals [2, 3].

Moreover, it has been shown that let-7 may also play a role in lung cancer progression [99- 101].

49

LIN28 proteins are known regulators of the let-7 family of miRNAs [3, 23– 25], and over -expression of LIN28 in CD34(+) cells from healthy volunteers has been shown to strongly down-regulate several let-7 family members [11].

Extensive research performed in the nematode C. elegans identified several factors involved in early embryonic development, including the RNA binding protein named lin-28 and its main microRNA (miRNA) target, let-7. Mutations in C. elegans lin-28 cause precocious development during larval growth, while loss of let-7 results in recapitulation of larval cell fates in adult worms [1].

Since the phenotypic effects of let-7 expression are highly dependent upon the transcriptome of the cell in which it is expressed, LIN28 is thus predicted to be functionally pleomorphic with tissue- and cell-type specificity.

In humans, a defined pattern of the let-7 miRNA expression during ontogeny is clearly observed in the erythroid lineage throughout the fetal-to-adult transition with significant increased expression of the let-7 miRNAs in adult cells [20].

In contrast to its role in promoting stem cell self-renewal, our data suggest that erythroblast regulation by the LIN28/ let-7 pathway does not require stem cell reprogramming to increase fetal hemoglobin expression [2, 36].

LIN28A over -expression mediated by KLF1 or SPTA1 promoter regulates the let-7 family of miRNAs.

Studies are now being focused upon erythroid-specific features of LIN28 expression with particular interest upon identifying a mechanistic bridge between the LIN28/ let-7 pathway and globin gene regulation.

0144977.g002 Fig 2 LIN28A over -expression mediated by KLF1 or SPTA1 promoter regulates the let-7 family of miRNAs.

A novel mechanism of LIN-28 regulation of let-7 microRNA expression revealed by in vivo HITS-CLIP in C. elegans.

As shown in Fig 2B, the total levels of let-7 miRNAs in the LIN28A-OE samples with KLF1 or SPTA1 promoters was significantly down-regulated when compared to the respective control transductions [KLF1-Empty vector control: 2.0E+07 ± 5.3E+06 copies/ng; KLF1-LIN28A-OE: 5.6E+06 ± 5.6E+05 copies/ng, p = 0.046; SPTA1-Empty vector control: 1.7E+07 ± 3.9E+06; SPTA1-LIN28A-OE: 4.6E+06 ± 6.2E+05 copies/ng, p = 0.040].

Altogether, these results demonstrate that erythroid-specific LIN28A-OE produces a functional LIN28A protein capable of erythroid suppression of the let-7 family of miRNAs.

Let-7 family of miRNAs quantitative PCR analysisAbsolute quantification for each let-7 family member was determined by constructing a standard curve prepared on the basis of the respectively synthetic targeted mature miRNA oligonucleotide of known concentration (1:10 serial dilutions, n = 6) that was run in parallel with biological samples.

RNA samples from erythroblasts cultured on day 14 were examined for (A) LIN28A over -expression and (B) the total levels of let-7 miRNAs using Q-RT-PCR.

Absolute quantification for each let-7 family member was determined by constructing a standard curve prepared on the basis of the respectively synthetic targeted mature miRNA oligonucleotide of known concentration (1:10 serial dilutions, n = 6) that was run in parallel with biological samples.

During ontogeny, loss of LIN28 expression results in a concomitant increase in let-7 miRNAs in most tissues.

In contrast to stem cells, reduced expression of let-7 miRNAs in nonmalignant muscle cells and hepatocytes enhances differentiation of the cells [4, 5].

Additional data support the notion that the LIN28/ let-7 axis is involved in fetal hemoglobin regulation as part of the developmental switching phenomenon [11].

The LIN28/ let-7 regulatory pathway remains exquisitely well conserved throughout vertebrate evolution.

The RNA -binding mechanism of action for LIN28 proteins is highly directed by recognition of the conserved RNA quadruplet GGAG-motif, which binds to the pri- or pre- let-7 as well as to several other RNAs throughout the cellular transcriptome [27, 28].

Genetic manipulation of Lin28/ let-7 in mice also regulates glucose metabolism [6].

To determine if LIN28A-OE driven by KLF1 or SPTA1 promoters produced a functional protein, KLF1-LIN28A-OE and SPTA1-LIN28A-OE samples were investigated for the expression of let-7 miRNAs.

Let-7 family of miRNAs quantitative PCR analysis.

Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing.

The sequences of the mature let-7 miRNAs are identical in most animal species including human.

Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA.

50

Comparison of the expression of the most regulated miRNAs and the expression of their putative target genes using a dedicated algorithm revealed a significant negative correlation for several miRNAs, identified as the most active miRNAs in either the embryonic or the adult liver, and facilitated the identification of a novel miR-target couple, let-7 and TGFBR1.

Furthermore, our algorithm facilitated the identification of TGFβ-R1 as a novel target gene of let-7. Our results uncover multiple regulated miRNAs and genes throughout human liver development, and our algorithm assists in identification of novel miRNA targets with potential roles in liver development.

We illustrated this point by choosing the regulated miRNA let-7, which showed the best anti-correlation to its predicted target genes, and one of its predicted targets, TGFBR1, for validation of miR-target relationships.

According to a likely scenario, in the embryo, where let-7 is expressed at a relatively low level, it may allow enhanced TGF-β signaling activity that is necessary for hepatocyte proliferation and organization, whereas in the adult, let-7 is expressed higher and may assist in inhibiting TGF-β signaling until it becomes necessary upon specific states, such as liver regeneration.

We calculated a total score summarizing the probability for let-7/98 predicted targets to be increasingly downregulated according to the number of target sites, by summing the (–log) of all the p-values.

Among adult liver-enriched miRNAs, we confirmed a statistically-significant downregulation of transcripts that have predicted binding sites for the let-7/98, miR-22 and miR-23 seeds, which correspond to the miRNAs identified previously as expressed higher in the adult liver than in the embryo: let-7a, let-7b, let-7c, miR-22, and miR-23b.

The type I receptor gene TGFβ-R1 (TGFBR1), which mediates the action of TGF-β, is a predicted target gene of the let-7/98 family according to TargetScan 4.2 (containing conserved sites for let-7a-g and i, and for miR-98).

We observe that this score increases when targets of let-7/98 and miR-23 and miR-22 are considered together, suggesting that many genes are downregulated in the adult by the combined repression of several miRNA species.

To exemplify the targets' behavior trends, we will use the let-7/98 seed, which corresponds to the seed of several miRNAs (let-7a, let-7b and let-7c) that are upregulated in adult compared to embryonic livers.

Looking further for probe-sets detecting transcripts carrying at least 1 binding site for let-7/98, we find that among the 811 probe-sets detecting such transcripts, the percentage of downregulation increases to 56.60% (p<5.75•10 [−14] by a hypergeometric test).

These results suggest that let-7c, and presumably additional members of the let-7 family, may regulate the expression of TGFBR1 in the liver.

Regulation of TGFBR1 by let-7, which is suggested by our results, may further fine tune the TGF-β signaling activity to the necessary level at each developmental stage.

Regarding the adult liver-enriched miRNAs, similar to let-7, miR-23b is capable of inhibiting cell proliferation [44], and may mediate cell cycle arrest in mature hepatocytes.

Let-7 family members have been shown to target proliferation-promoting genes, such as HMGA2 [37] and IGF2BP1 [39], and as such, may mediate cell cycle arrest in the adult liver.

Another pattern, which contained miRNAs that were expressed higher in the adult liver compared to the embryonic liver, included members of the let-7 family.

51

The let-7 targets are mechanistically linked to metastasis of carcinomas, and thereby their downregulation enhances the process by which RKIP exerts its tumor suppressor abilities [3, 65].

Inhibition of MAPK resulted in decreased transcription of LIN28, which led to the downregulation of let-7 targets.

Elevated levels of let-7 family members results in the downregulation of its targets, such as HMGA2, which are mechanistically linked to metastasis of cancer cells.

Overexpression of let-7 family members in ER -positive cells resulted in downregulated ER-alpha activity, reduced cell proliferation and induced apoptosis.

Mimics of certain tumor suppressors, such as let-7 and miR-34a, which are both downregulated in lung cancer, were injected into mice mo dels with non-small cell lung cancer (NSCLC) and resulted in reduced tumors.

Their study showed that signaling through let-7 regulates the repressive action of Raf kinase inhibitory protein (RKIP) on metastasis of breast cancer cells [62].

The let-7 family miRNAs were found to be downregulated in human breast cancer cells at stages of ductal carcinoma in situ (DCIS) and invasive ductal carcinoma (IDC) in comparison to the benign stage.

Recent analysis reported that there is an inverse association between the expression of ER-alpha and various members of the let-7 family [67].

Thus, in accordance, higher levels of let-7 are expressed in cells that are more differentiated, exhibit an epithelial phenotype and represent less advanced cancer.

The research suggests that let-7 affects self-renewal ability of cancer cells, so cancer therapy by targeting let-7 in breast cancer patients could be beneficial and could serve as a novel treatment option.

There was reduced expression of let-7 in BT-IC, but the level of let-7 increased with differentiation [61].

Furthermore, it was found that let-7 family members target similar genes and have similar functions.

An earlier study investigated the expression of let-7 in breast cancer cells and demonstrated that let-7-fl is expressed in multiple breast cancer cell lines [60].

However, the mechanism of let-7 deregulation and its role in tumorigenesis is currently not fully understood.

let-7 also regulates apoptosis and CSCs differentiation, which suggests that it has high potential of being utilized in cancer therapy [59].

Lethal-7 (let-7), one of the first mammalian miRNAs to be identified, was initially discovered to play a role in the developmental timing of Caenorhabditis elegans and is conserved throughout the animal phyla [4, 7, 56].

Studies have shown that let-7 is often absent in cells that are less differentiated, exhibit a mesenchymal phenotype and represent more advanced cancer [58].

An in vivo study of let-7 showed that its administration was effective against lung and breast cancers in mice and further computational analysis suggested that let-7 would be effective in estrogen receptor positive (ER+) metastatic breast cancer [6].

Studies surrounding let-7 suggest that it can be used as a future cancer therapeutic.

Another proposed role for let-7 is its involvement in signaling through estrogen receptor.

On the other hand, when let-7 was silenced, non-T-IC experienced higher self-renewal ability.

Administration of let-7 in BT-IC also resulted in reduced proliferation and reduced metastasis in vivo.

The let-7 family consists of 12 members: let-7-a1, let-7-a2, let-7-a3, let-7-b, let-7-c, let-7-d, let-7-e, let-7-f1, let-7-f2, let-7-g, let-7-i and miR-98 [3, 57].

Previous research revealed that estradiol (E2) may encourage increased levels of eight members of the let-7 family [66].

Dangi-Garimiella et al. proposed a role for let-7 in the metastasis of breast cancer.

It is now wi dely accepted that let-7 levels are high in normal cells and reduced in invasive cancer cell lines.

Further studies on the molecular mechanisms behind let-7 activity in cancer would improve treatment plans for therapeutic applications.

52

The direct targets and relevant mediators downstream of miR-146 and miR-34a implicate the Notch and Wnt signaling pathways, while regulators remain to be delineated downstream of Let-7, excepting recent insights into a Let-7 target, Hmga2, which is discussed later in this Review.

MiRNAs also modulate inflammatory pathways mediated by the transcription factors NFΚB and STAT3 by directly inhibiting IL-6 (via Let-7 miRNAs, which are inhibited by LIN28B) or the IL-6 receptor (via miR-34 and miR-125b).

Many functional studies of Let-7 in CRC have uncovered important roles for these miRNAs through overexpression of the specific and potent Let-7 inhibitors LIN28A and LIN28B.

Despite these hurdles, we recently depleted all Let-7 miRNAs in the mouse intestine epithelium by tissue-specific expression of LIN28B in conjunction with an intestine-specific knockout of the Mirlet7c2/ Mirlet7b cluster (Madison et al., 2013, 2015).

Although studies of some cancers, such as lung and breast cancer, have demonstrated that Let-7 miRNAs directly repress KRAS mRNA (Esquela-Kerscher et al., 2008; Iliopoulos et al., 2009; Johnson et al., 2005), KRAS has not been found to be a Let-7 target in studies of CRC (King et al., 2011b; Madison et a