sort by

4 publications mentioning cel-mir-243

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-243. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 100
Other miRNAs from this paper: cel-mir-1, cel-mir-58a, cel-mir-58b, cel-mir-58c
Genes found to be upregulated (A) or downregulated (B) in mir-243 worms were considered separately. [score:6]
Although miR-243 is relatively depleted in ALG-1 immunoprecipitates (Figure 3), a mild level of upregulation was also detected in alg-1 mutant worms, while deletion of mir-1, the second miRNA targeting Y47H10A. [score:6]
However, our microarray analysis failed to detect a miR-243 seed signature in upregulated genes. [score:4]
A similar level of upregulation was observed in mir-243 mutant worms (Figure 5). [score:4]
In contrast, genes downregulated in mir-243 worms are mainly involved with cell-cycle-related processes (Figure 6B). [score:4]
5 gene was upregulated in the mir-243 mutant background. [score:4]
Y47 transcript is upregulated in RNAi– or miR-243–deficient worms. [score:4]
No specific miRNA signatures were revealed this way, preventing the identification of additional direct miR-243 targets. [score:4]
Additional miR-243 targets. [score:3]
Prediction programs, however, indicate that miR-243 can potentially target other genes for silencing, and therefore could also act as a canonical microRNA. [score:3]
Still, our microarray experiments indicate that miR-243 might have direct or indirect roles in many processes, most notably morphogenesis, transportation and cell-cycle. [score:3]
To probe for direct or indirect roles of miR-243, we performed microarray analysis comparing adult wild-type and mutant worms. [score:3]
We show that miR-243 is efficiently bound by RDE-1 and triggers regular RNAi on an endogenous target, implying that many RNA species, including miRNAs, are constantly being screened against the transcriptome using the canonical exogenous RNAi pathway. [score:3]
However, these results do indicate that miR-243 is an active gene with profound effects on gene expression. [score:3]
Yet, miR-243 does have predicted canonical miRNA-like targets. [score:3]
5 (Figure S2), promoter-GFP fusions showed that miR-243 is also highly expressed in intestinal cells [24]. [score:3]
Direct and indirect roles of miR-243. [score:3]
Around 19% of the genes present on the array were misregulated in mir-243 worms (fold change ≥2). [score:2]
Table S4List of genes misregulated in mir-243 worms. [score:2]
1000903.g006 Figure 6RNA extracted from wild-type and mir-243 adult worms were analyzed by microarray experiments. [score:1]
Thus, the interaction between miR-243 and the Y47 locus may represent a case of an emerging miRNA, going through the above described selection process. [score:1]
Furthermore, miR-243 precursor RNA has extensive base pairing in the stem [23], making it a good RDE-1 co-factor, as already suggested by the frequent cloning of miR-243 from RDE-1 immunoprecipitates (Figure 1B; Table S2). [score:1]
Together, our results show that miR-243, when loaded into RDE-1, can trigger the production of siRNAs and that the mechanism has similar genetic requirements to the exo -RNAi pathway. [score:1]
1000903.g003 Figure 3 RNAs from input extract (In), empty-beads supernatant (Sup EB), HA-beads supernatant (Sup HA), empty-beads immunoprecipitates (IP EB), or HA immunoprecipitates (IP HA) from HA::RDE-1 or HA::ALG-1 worms were extracted and checked by northern blot for the presence of miR-243 or miR-58. [score:1]
As also do not act in trans, we conclude that the miR-243-Y47 interaction should not be seen as an animal version of the plant tasiRNA pathway. [score:1]
These results show that miR-243 is required for the production of and that RDE-1, and not ALG-1, is the involved Argonaute protein. [score:1]
These siRNAs are then bound by other Argonaute proteins (WAGOs) that are likely responsible for the observed Y47 mRNA destabilization triggered by miR-243. [score:1]
Probes used in this study were: miR-243 – 5′ ATATCCCGCCGCGATCGTACCG 3′; miR-58 – 5′ TTGCCGTCTGCGTCTC 3′; Y47H10A. [score:1]
RNAs that changed at least 2-fold with a probability of p<0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243. [score:1]
We therefore wondered whether could be made through an endo -RNAi mechanism triggered by an RDE-1::miR-243 complex. [score:1]
5 paralogs, are not affected in mir-243 mutants, indicating that a single hit by a secondary siRNA is not sufficient to trigger mRNA decay. [score:1]
Genetic requirements for RDE-1::miR-243 triggered siRNAs. [score:1]
RNAs from input extract (In), empty-beads supernatant (Sup EB), HA-beads supernatant (Sup HA), empty-beads immunoprecipitates (IP EB), or HA immunoprecipitates (IP HA) from HA::RDE-1 or HA::ALG-1 worms were extracted and checked by northern blot for the presence of miR-243 or miR-58. [score:1]
These results indicate that the ALG-1::miR-243 complex also slightly destabilizes the Y47H10A. [score:1]
Here we show that C. elegans miR-243 is also able to trigger the generation of siRNAs reminiscent of plant tasiRNAs (Figure 4). [score:1]
5 is silenced by miR-243 in an RDE-1- and RRF-1 -dependent manner. [score:1]
We found that miR-243 is indeed enriched in RDE-1, but not in ALG-1 immunoprecipitates (Figure 3). [score:1]
5 sequence on miRBase revealed the presence of two microRNA binding sites within the 3′ UTR, one for miR-1 and one for miR-243. [score:1]
In contrast, were completely gone in rde-1 or mir-243 mutants (Figure 4A). [score:1]
Interestingly, levels of both miR-243 and were slightly elevated in alg-1 mutants, indicating that the RDE-1- and ALG-1 -mediated pathways are not fully separated, but may compete for small RNA co-factors. [score:1]
The miR-243 binding site is shown below the Y47H10A. [score:1]
The upper sequence is miR-243 and the lower sequence the 3′ UTR of the Y47H10A. [score:1]
Interestingly, miR-243 is not conserved in other nematode species like C. briggsae, while many microRNA genes have well conserved homologs in C. briggsae and some even up to mammals. [score:1]
Also, miR-243 does not have a typical bulged miRNA precursor structure [23], and is loaded poorly into ALG-1 (Figure 3). [score:1]
5 siRNAs (Y47 siRNAs) or miR-243. [score:1]
The alleles used in this study were alg-1(gk214), rde-1(pk3301), rde-1(ne300) rescued with rde-1::HA [16], alg-1::HA(pkIs2250) [17], mir-243(n4759); mir-1(gk276); rrf-1(pk1417); rrf-2(pk2040); rrf-3(pk1426). [score:1]
Our results so far implicate miR-243 in an RNAi-like circuitry that is rather unusual for miRNAs. [score:1]
First, we confirmed the apparent enrichment for miR-243 in RDE-1, as seen by sequencing (Figure 1B; Table S2), using Northern blot analysis. [score:1]
This miRNA, miR-243, binds to RDE-1 that in turn recognizes a perfectly matching sequence in the 3′UTR of the Y47H10A. [score:1]
As seed signatures are easily recognized in mammalian cell culture systems [37], this may indicate a lack of miR-243 activity. [score:1]
RNA extracted from wild-type and mir-243 adult worms were analyzed by microarray experiments. [score:1]
As shown in Figure 2D, miR-243 has full complementarity to its Y47H10A. [score:1]
[1 to 20 of 52 sentences]
2
[+] score: 5
We found that while miR-71 had the largest number of predicted targets (782), miR-243 has 34 targets. [score:5]
[1 to 20 of 1 sentences]
3
[+] score: 4
Other miRNAs from this paper: cel-lin-4, hsa-mir-20a
Loading specificity has functional consequences, as RDE-1-bound miR-243 functions as a primary siRNA, triggering secondary siRNA production and silencing of a gene that contains a near-perfect complementary target site (Correa et al., 2010). [score:3]
Interestingly, the precursor of the miRNA miR-243 has a higher-than-usual degree of complementarity, and a substantial fraction of miR-243 is misloaded onto RDE-1 rather than ALG-1, -2. miR-243 also possesses a 5′ cytosine, whereas most C. elegans miRNAs begin with a uracil, consistent with the notion that 5′ nucleotide identity is an important determinant of AGO small RNA specificity (Figure 1). [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 1
Other miRNAs from this paper: cel-mir-1, cel-mir-35, cel-mir-58a, cel-mir-58b, cel-mir-58c
This phenomenon is reminiscent of the trans-acting siRNA pathway in plants and the miR-243 pathway in C. elegans, in which one or more miRNAs or siRNAs trigger siRNA amplification from a distinct mRNA [50]– [53]. [score:1]
[1 to 20 of 1 sentences]