sort by

3 publications mentioning cel-mir-231

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-231. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 191
Other miRNAs from this paper: cel-mir-360
The expression of smk-1 gene was significantly higher in the loss-of-function mir-231(n4571) mutant than in wild-type nematodes (Fig. 5a), implying that mir-231 may suppress the expression of smk-1 gene in nematodes. [score:7]
Bioinformatics analysis for targeted gene prediction of mir-231The corresponding targeted genes for mir-231 were predicted using TargetScan version 6.2 (http://www. [score:7]
smk-1 might act as a potential targeted gene for mir-231 in nematodesWe identified 93 putative mir-231 targeted genes including smk-1 using the TargetScan tool. [score:7]
In addition, mutation of smk-1 gene reversed the GO-resistant property of mir-231 mutants (Fig. 6), and overexpression of smk-1 lacking its 3′-UTR prevented the increased GO sensitivity of nematodes overexpressing mir-231 (Fig. S3). [score:6]
Overexpression of mir-231 in the intestine induced a susceptible property to GO toxicity in nematodesTo confirm the intestine-specific activity of mir-231 in positively regulating GO toxicity, we constructed the transgenic strain Ex(P ges-1-mir-231) which overexpresses mir-231 specifically in the intestine. [score:6]
The inhibited expression of mir-231 can lead to the activation of function of the SMK-1-DAF-16 signaling cascade, which in turn reduces GO toxicity in nematodes. [score:5]
In the intestine, mir-231 increased the effects of GO toxicity by suppressing the function of its target gene smk-1. SMK-1 acted upstream of DAF-16 in the insulin signaling pathway to protect against GO toxicity. [score:5]
At the same time, GO exposure can activate a protection mechanism in nematodes by inhibiting the expression of mir-231. [score:5]
The corresponding targeted genes for mir-231 were predicted using TargetScan version 6.2 (http://www. [score:5]
We identified 93 putative mir-231 targeted genes including smk-1 using the TargetScan tool. [score:5]
In contrast, expression of mir-231 in the intestine significantly suppressed the resistant property to GO toxicity on lifespan and locomotion behavior in mir-231(n4571) mutant nematodes (Fig. 3). [score:5]
The biological functions of the predicted targeted genes for mir-231 were either unknown or associated with the development in nematodes. [score:4]
Therefore, we discovered a new dual regulation mechanism between the mir-231 and the SMK-1-DAF-16 signaling cascade in the control of GO toxicity in the intestine, the primary targeted organ of GO in nematodes. [score:4]
However, it is possible that mir-231 can regulate longevity through other yet to be identified targeted genes with different functions from smk-1 in nematodes. [score:4]
To confirm the intestine-specific activity of mir-231 in positively regulating GO toxicity, we constructed the transgenic strain Ex(P ges-1-mir-231) which overexpresses mir-231 specifically in the intestine. [score:4]
First, we observed that the expression of smk-1 was increased in loss-of-function mutation of mir-231 (Fig. 5a). [score:4]
Previous study has also suggested that mir-231 expression was increased during late developmental stages in adult nematodes 24, implying its involvement in the anti-aging protection mechanism in nematodes. [score:4]
In addition, loss-of-function mutation of daf-16 gene did not affect mir-231 expression under normal conditions or in response to 100 mg/L GO (Fig. S2). [score:4]
GO exposure could decrease the expression of mir-231::GFP in all these tissues, especially in the intestine (Fig. 2). [score:3]
These results suggest that mir-231 overexpression in the intestine can induce a susceptible property to GO toxicity in nematodes. [score:3]
Overexpression of mir-231 in this transgenic strain was confirmed by assessing the levels of mir-231 transcription (Fig. S1). [score:3]
mir-231::GFP is expressed in pharynx, intestine, neurons, and hypodermis (Fig. 2). [score:3]
In this study, we raised several lines of evidence to demonstrate that smk-1 may be a targeted gene for mir-231 that functions to protect nematodes against GO toxicity. [score:3]
Effect of GO exposure on spatial expression of mir-231 in nematodes. [score:3]
Effect of GO exposure on spatial expression of mir-231 in nematodesUsing transgenic strain of maIs218, we investigated the effect of GO exposure on spatial expression of mir-231::GFP in nematodes. [score:3]
In nematodes, GO exposure caused the decrease in both the transcriptional expression of mir-231 18 and the mir-231::GFP in the pharynx, intestine, neurons, and hypodermis (Fig. 2). [score:3]
Especially, mir-231::GFP is predominantly expressed in intestine (Fig. 2). [score:3]
Surprisingly, under normal condition, we found that the long-lived phenotype of nematodes overexpressing smk-1 was not observed in mir-231 mutant nematodes. [score:3]
Overexpression of mir-231 in the intestine induced a susceptible property to GO toxicity in nematodes. [score:3]
Effects of mir-231 overexpression in intestine on GO toxicity in nematodes. [score:3]
Bioinformatics analysis for targeted gene prediction of mir-231. [score:3]
Effects of GO exposure on mir-231::GFP expression in nematodes. [score:3]
In nematodes, mir-231 is expressed in several tissues including the intestine, pharynx, hypodermis, and neurons 21. [score:3]
smk-1 might act as a potential targeted gene for mir-231 in nematodes. [score:3]
The increased sensitivity to GO toxicity in nematodes overexpressing mir-231 in the intestine further confirmed this possibility (Fig. 4). [score:3]
Therefore, mir-231 may inhibit the ability of smk-1 to protect against GO toxicity in nematodes. [score:3]
These data imply that mir-231 may not act downstream of the transcriptional factor DAF-16 to regulate biological events in nematodes. [score:2]
This identified dual regulation mechanism implies that mir-231 could be a potential candidate gene for the design of chemical modification or the selection of certain loaded drugs for GO for the aim of reducing the GO toxicity. [score:2]
It has been shown that loss-of-function mutation of mir-231 induced a resistant property of nematodes to GO toxicity (Fig. 3) 18. [score:2]
Genetic interaction between mir-231 and smk-1 in regulating GO toxicity in nematodes. [score:2]
To analyze the transcriptional expression of mir-231, the primer used for the transcription of mir-231 was GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACAAG. [score:2]
Tissue-specific activity of mir-231 in regulating GO toxicity in nematodes. [score:2]
How to cite this article: Yang, R. et al. A mir-231-Regulated Protection Mechanism against the Toxicity of Graphene Oxide in Nematode Caenorhabditis elegans. [score:2]
Genetic interaction between mir-231 and smk-1 in regulating GO toxicity in nematodesTo assess the interaction between mir-231 and smk-1 in regulating GO toxicity, we compared the GO toxicity in double mutant of mir-231(n4571) ;smk-1(mn156) with that in single mutant of mir-231(n4571) or smk-1(mn156). [score:2]
Rescue assay by expression of mir-231 in the neurons, pharynx, or hypodermis did not significantly affect the resistant property to GO toxicity on lifespan and locomotion behavior in mir-231(n4571) mutant nematodes (Fig. 3). [score:2]
mir-231 was predicted to act as an upstream regulator for smk-1 by binding its 3′-UTR. [score:2]
Loss-of-function mutation of mir-231 induced a resistant property to GO toxicity on lifespan and locomotion behavior in nematodes (Fig. 3). [score:2]
Considering the extensive conservation of microRNAs in biology 30, our results may lead to the discovery of important functions of mir-231 and its homologues in regulating nanotoxicity in organisms. [score:2]
We first identified the intestine-specific activity of mir-231 in the regulation of GO toxicity. [score:2]
Therefore, mir-231 may act in the intestine to positively regulate GO toxicity in nematodes. [score:2]
Moreover, GO (10 mg/L) exposed transgenic strain of Ex(P ges-1-mir-231) exhibited more severe reduction in lifespan, decrease in locomotion behavior, and induction of intestinal ROS production than GO (100 mg/L) exposed wild-type nematodes (Fig. 4). [score:1]
After exposure to GO (100 mg/L), the lifespan, locomotion behavior, and induction of intestinal ROS production in double mutant of mir-231(n4571) ;smk-1(mn156) were similar to those in single mutant of smk-1(mn156) (Fig. 6), indicating that the GO resistance of the mir-231(n4571) mutant could be reversed by the loss of smk-1 in nematodes. [score:1]
Tissue-specific activity of mir-231 in regulating GO toxicity in nematodesUsing tissue-specific promoters, we next investigated the tissue-specific activity of mir-231 in regulating GO toxicity in nematodes. [score:1]
C. elegans strains and exposureNematodes used were wild-type N2, mutants of mir-231(n4571), smk-1(mn156), daf-16(mu86), and mir-231(n4571) ;smk-1(mn156), and transgenic strains of maIs218[mir-231::GFP], Ex(P ges-1-mir-231), mir-231(n4571) Ex(P ges-1-mir-231), mir-231(n4571) Ex(P myo-2-mir-231), mir-231(n4571) Ex(P unc-14-mir-231), mir-231(n4571) Ex(P dpy-7-mir-231), Is(P ges-1-smk-1), smk-1(mn156) Ex(P ges-1-smk-1), smk-1(mn156) Ex(P myo-2-smk-1), smk-1(mn156) Ex(P myo-3-smk-1), smk-1(mn156) Ex(P unc-14-smk-1), smk-1(mn156) Ex(P dpy-7-smk-1), and Ex(P ges-1-mir-231) ;Is(P ges-1-smk-1). [score:1]
C. elegans mir-231 an ortholog of human miR-99 and miR-556 30. [score:1]
Nevertheless, the potential functions of mir-231 in the pharynx, hypodermis, and neurons are still unclear in nematodes. [score:1]
To assess the interaction between mir-231 and smk-1 in regulating GO toxicity, we compared the GO toxicity in double mutant of mir-231(n4571) ;smk-1(mn156) with that in single mutant of mir-231(n4571) or smk-1(mn156). [score:1]
Our data imply that mir-231 may be involved in the control of intestinal signaling pathways in GO exposed nematodes. [score:1]
Furthermore, in contrast to the phenotypes in GO-exposed mir-231 mutant nematodes, GO-exposed smk-1 mutants presented with increased GO sensitivity (Fig. 5b–d). [score:1]
smk-1/F41E6.4a cDNA or mir-231 was amplified by PCR, and inserted into corresponding entry vector carrying the ges-1, unc-14, myo-3, dpy-7, or myo-2 promoter sequence. [score:1]
A diagram showing the mir-231 -mediated molecular signaling in the control of GO toxicity in nematodes. [score:1]
These results imply that mir-231 might encode an important molecular signaling in nematodes to protect against potential GO toxicity. [score:1]
Using transgenic strain of maIs218, we investigated the effect of GO exposure on spatial expression of mir-231::GFP in nematodes. [score:1]
Moreover, the more sharp reduction in fluorescence intensity of mir-231::GFP was observed in intestine of GO (100 mg/L) exposed nematodes (Fig. 2). [score:1]
mir-231(n4571) mutant had a normal lifespan and locomotion behavior (Fig. 3). [score:1]
Transgenic strain of Ex(P ges-1-mir-231) had the similar phenotypes of lifespan, locomotion behavior, and intestinal ROS production to those in wild-type nematodes (Fig. 4). [score:1]
Tissue-specific activity assays indicated that mir-231 acted in the intestine to regulate the GO toxicity on lifespan and locomotion behavior in nematodes (Fig. 3). [score:1]
Nematodes used were wild-type N2, mutants of mir-231(n4571), smk-1(mn156), daf-16(mu86), and mir-231(n4571) ;smk-1(mn156), and transgenic strains of maIs218[mir-231::GFP], Ex(P ges-1-mir-231), mir-231(n4571) Ex(P ges-1-mir-231), mir-231(n4571) Ex(P myo-2-mir-231), mir-231(n4571) Ex(P unc-14-mir-231), mir-231(n4571) Ex(P dpy-7-mir-231), Is(P ges-1-smk-1), smk-1(mn156) Ex(P ges-1-smk-1), smk-1(mn156) Ex(P myo-2-smk-1), smk-1(mn156) Ex(P myo-3-smk-1), smk-1(mn156) Ex(P unc-14-smk-1), smk-1(mn156) Ex(P dpy-7-smk-1), and Ex(P ges-1-mir-231) ;Is(P ges-1-smk-1). [score:1]
[1 to 20 of 68 sentences]
2
[+] score: 14
Induction of miR-784, miR-231, miR-86, miR-53, miR-47, and miR-34 by HSF-1 during HS is predicted to have the largest impact on the suppression of genes encoding proteins involved in the regulation of transcription and behavior, as these processes have enrichment scores of 5.49 and 4.93, respectively (S7A Fig). [score:4]
Through this method of data analysis, we found that miR-784, miR-231, miR-86, miR-53, miR-47, and miR-34 are normally upregulated by HSF-1 during HS. [score:4]
miR-231 is strongly expressed at all stages of development in wild-type worms, however the precise function of miR-231 is unknown. [score:4]
While the functions of miR-784, miR-231, miR-86, miR-53, and miR-47 are currently unknown, miR-34 encodes a microRNA that is highly conserved with orthologues in Drosophila, mouse, and human [30]. [score:1]
miR-231 0.67 miR-231 may have a potential ortholog in C. briggsae. [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 2
Other miRNAs from this paper: cel-let-7, cel-mir-259
Yang R-L Ren M-X Rui Q Wang D-YA mir-231-regulated protection mechanism against the toxicity of graphene oxide in nematode Caenorhabditis elegansSci. [score:2]
[1 to 20 of 1 sentences]