sort by

396 publications mentioning hsa-mir-222 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-222. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 370
Using mouse EOC mo dels, we demonstrated an inverse relationship between miR-222-3p expression and mouse tumor size, and in-vitro experiments showed that its overexpression decreased cell proliferation, affected cell cycle kinetics and inhibited migration, thereby acting as a tumor suppressor. [score:9]
Furthermore in S KOV3/DDP cells, GNAI2 was suppressed following overexpression of miR-222-3p (P = 0.0065; Figure 6D) and in S KOV3 (high miR-222 and low GNAI2) GNAI2 was increased when miR-222-3p was inhibited by its inhibitor (P < 0.0001; Figure 6E). [score:9]
Analogously, in gastrointestinal stromal tumors, Wiemer et al. [17] found in 2013 that overexpressing miR-222 significantly inhibits cellular proliferation, affects cell cycle kinetics and induces apoptosis by down -regulating its predicted target genes KIT and ETV1 in human gastrointestinal stromal tumors. [score:8]
Collectively, we demonstrated that GNAI2 mRNA expression was inversely correlated with the expression of miR-222-3p, suggesting that miR-222-3p could negatively regulate GNAI2 expression in human EOC. [score:8]
And then fourteen candidate genes were commonly predicted to be the possible targets of miR-222-3p by all of the three algorithms (Figure 6A); finally, we evaluated whether these predicted target genes would be down-regulated in vitro after overexpression of miR-222-3p in ovarian cancer cells using qRT-PCR. [score:8]
To identify the potential intermediary responsible for pAKT inhibition induced by miR-222-3p, firstly we performed an online bioinformatics prediction search for putative mRNA targets of miR-222-3p by using three online predicting algorithms (PicTar, TargetScan and miRDB). [score:7]
Moreover also we inhibited miR-222-3p expression using its inhibitor, we found that AKT phosphorylation at both residues was increased in S KOV3 cells, comparing to the control cells (both P < 0.0001; Figure 5C, 5D). [score:7]
Interestingly, it also can function as a tumor suppressor-miR in other cancer types, for example, in erythroblastic leukemia [16], and gastrointestinal stromal tumors [17, 18], miR-222 inhibits cell growth and induces apoptosis by targeting KIT [16, 17] and ETV1 [17]. [score:7]
Western blot analysis showed a reduction in pAKT levels (ser473, thr308), but no change in total AKT expression, suggesting that the target gene for miR-222-3p was not AKT expression. [score:7]
In prostate cancer, Seki et al. [44, 45] revealed that miR-222 was able to directly target Ecm29 so as to significantly suppress cancer cell migration and invasion, but many other researchers have reported opposing results where miR-222 promoted prostate cancer cell proliferation or migration [14, 46]. [score:6]
Furthermore, overexpression of miR-222-3p in S KOV3/DDP cells would block cellular migration (P = 0.0005; Figure 4I, 4J), while inhibition of miR-222-3p in S KOV3 cells would promote cellular migration (P = 0.0007; Figure 4K, 4L). [score:5]
miR-222 can play a role as an onco-miR in some cancer types, such as cervical cancer [13], prostate carcinoma [14], since it can target tumor suppressors, such as PTEN [13, 15], p27Kip1 [14], and TIMP3 [15], promoting the proliferation, migration and invasion of cancer cells. [score:5]
However, the observed decrease/increase of pAKT after transfection are not due to total AKT (tAKT) differences since we did not found changes on the expression levels of tAKT following miR-222-3p mimic/inhibitor transfection (both P > 0.05; Figure 5A–5D and Supplementary Figure S2). [score:5]
Our data showed that AKT phosphorylation at both Ser473- and Thr308- residues was inhibited after transfection of miR-222-3p mimic into Tara R182 cells (both P < 0.0001; Figure 5A, 5B); this effect was time dependent reaching maximal inhibition at 72 h (supplementary Figure S2). [score:5]
3 The relative expression levels of miR-222-3p (cutoff value = 1.60): 1) high, those who exhibited expression above 1.60; and 2) low, for those below 1.60. [score:5]
Interestingly, we found an inverse correlation between the cell proliferation rates of these six cell lines and their miR-222-3p expression levels, suggesting a potential role for miR-222-3p in inhibiting cell growth and proliferation (Figure 3B). [score:5]
In order to explore the effects of miR-222-3p on EOC cell proliferation, we transiently transfected miR222-3p mimic into the low -expressing miR-222-3p cell lines, and found that the cellular proliferation was inhibited significantly, which correlated with changes in the phosphorylation state of AKT. [score:5]
Therefore, whether miR-222 functions as an onco-miR or a tumor suppressor-miR mainly depends upon the cellular context of cancer cells and their target genes. [score:5]
EOC patients with high miR-222-3p expression (N = 33) had significantly longer overall survival than those with low miR-222-3p expression (N = 41) did (The mean overall survival time was 49.394 months vs. [score:5]
Figure 6(A) Schematic diagram of the predicted miR-222-3p -targeting genes by TargetScan, PicTar and miRDB. [score:5]
Figure 9 To determine whether miR-222-3p might be differentially expressed and associated with clinical outcome in patients with ovarian cancer we analyzed miR-222-3p expression by qRT-PCR in seventy-four EOC patients diagnosed at Xiangya Hospital of Central South University between September 2010 and December 2012. [score:5]
To determine whether miR-222-3p might be differentially expressed and associated with clinical outcome in patients with ovarian cancer we analyzed miR-222-3p expression by qRT-PCR in seventy-four EOC patients diagnosed at Xiangya Hospital of Central South University between September 2010 and December 2012. [score:5]
Our data demonstrates that miR-222-3p is a major regulator of GNAI2 expression and its function through its effect on the AKT pathway, a central regulator of cell proliferation and cell death. [score:5]
The relationships between miR-222-3p expression levels and different clinicopathologic factors are summarized in Table 3. But we did not observe any significant correlations between miR-222-3p expression and these clinicopathologic factors such as age, histologic type, FIGO stage, histologic differenciation, or histologic grade (all P > 0.05). [score:5]
hsa-miR-222-3p inhibitor: gcgauguagaccgaugacca; miRNA inhibitor NC: AAACAUGAUGUGUU UUCAUGAC. [score:5]
MiR-222-3p overexpression decreases EOC cell proliferation and migration in vitroTo further explore the potential role of miR-222-3p in EOC cells, we transiently transfected miR222-3p mimic into S KOV3/DDP and HO8910 cell lines (low expression of miR-222-3p). [score:5]
To further confirm that GNAI2 was the intermediary factor mediating miR-222-3p inhibition of AKT phosphorylation and EOC cells proliferation, a recombinant pEGFP-N1 plasmid containing a full-length GNAI2 ORF (Open Reading Frame) without 3′-UTR was constructed and transiently transfected into S KOV3, which expressed low levels of GNAI2. [score:5]
Additionally, we also transiently transfected miR-222-3p inhibitor into S KOV3 and HO8910-PM cell lines (high expression of miR-222-3p). [score:5]
Then the seventy-four cases were divided into two groups according to the relative expression levels of miR-222-3p (cutoff value = 1.60): 1) high, those who exhibited expression above 1.60; and 2) low, for those below 1.60. [score:5]
In the multivariate Cox proportional hazards analysis, which included miR-222-3p expression, histologic type, and histologic grade, miR-222-3p expression was found to be an independent prognostic factor for overall survival (P = 0.006; hazard ratio 0.347; 95% CI 0.164 to 0.734). [score:5]
Furthermore, our data showed a direct correlation between miR-222-3p expression and overall survival in ovarian cancer patients. [score:4]
Therefore, we might identify a novel regulatory axis in EOC cell lines, miR-222-3p/GNAI2/AKT and its potential application as a therapeutic target for EOC patients. [score:4]
miR-222-3p directly targets the 3'UTR of GNAI2. [score:4]
And by CCK-8 assay, we further confirmed that GNAI2 overexpression enhanced cells proliferation while the miR-222-3p mimic suppressed it (Figure 8G). [score:4]
Collectively, these results demonstrated that GNAI2 is a direct target gene of miR-222-3p. [score:4]
Thus, our results suggest that the target of miR-222-3p is not AKT but potentially a protein regulator of AKT-phosphorylation. [score:4]
miR-222-3p down-regulates GNAI2 mRNA and protein levels. [score:4]
The proliferation of S KOV3 transfected with miR-222-3p inhibitor was reduced, compared with that transfected with miR-control inhibitor. [score:4]
We described GNAI2 as a direct target of miR-222-3p that controls cell proliferation in ovarian cancer cells. [score:4]
MiR-222-3p inhibits GNAI2 expression. [score:4]
To verify that GNAI2 is a direct target of miR-222-3p the full-length 3′-UTR fragment containing the predicted miR-222-3p binding site (positions 837–843) was cloned downstream of the luciferase open reading frame of a psi-CHECK2™ vector. [score:4]
MiR-222-3p overexpression reduces ovarian cancer cell proliferation by inhibiting phosphorylation of AKT. [score:4]
For miRNA detection, the reverse transcribed cDNA was synthesized with the All-in-One™ miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia, Rockville, MD, USA), and the relative miR-222-3p expression levels were normalized against U6 small nuclear RNA expression, using the All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA) and their respective All-in-One™ miRNA qPCR Validation primer (GeneCopoeia, Rockville, MD, USA). [score:4]
Indeed, gene analysis identified GNAI2 as the potential target of miR-222-3p for regulating pAKT. [score:4]
Figure 9 In the present study we identify a novel target for miR-222-3p associated with AKT regulation and function. [score:4]
Contrary relationship between expression of miR-222-3p and proliferation, migration of human EOC cell lines. [score:3]
Using twenty EOC patients’ samples and ten normal ovary samples we examined miR-222-3p and GNAI2 expression by qRT-PCR. [score:3]
Thus, S KOV3/DDP and Tara R182 cells which exhibit high cell growth rate have low levels of miR-222-3p, while S KOV3 and HO8910-PM cells, which have a low cell growth rate, express high levels of miR-222-3p (Figure 3B). [score:3]
A Pearson correlational analysis of these thirty samples exhibited an inverse correlation between GNAI2 and miR-222-3p expression levels (r = −0.6103, P = 0.0003; Figure 9), which was consistent with the results found in the cell lines (r = −0.972, P = 0.0012; Figure 6C). [score:3]
Univariate survival analyses indicated that miR-222-3p expression (P = 0.010), histologic type (P = 0.019), histologic grade (P = 0.039) were associated with overall survival, while age (P = 0.247) and FIGO stage (P = 0.137) were not associated with overall survival. [score:3]
Collectively, these results suggest a predictive role for miR-222-3p in the prognosis of EOC patients; that is, the higher the mean expression level of miR-222-3p, the longer the median overall survival time of EOC patients. [score:3]
First, by measuring miR-222-3p expression in 74 EOC patients, we found that patients with high levels of miR-222-3p survived significantly longer than did the low expressing group, which indicated that miR-222-3p might constitute a better prognostic index for EOC patients. [score:3]
We observed a negative correlation between miR-222-3p and GNAI2 expression levels (r = −0.972, P = 0.0012; Figure 6C). [score:3]
Interestingly, one group announced that miR-222 promoted growth in H460, which is a human non-small cell lung cancer cell line [47]; however, almost simultaneously, Yamashita and associates [48], using six lung cancer cell lines, demonstrated that miR-222 promoted growth in two cell lines but suppressed growth in three lung cancer cells. [score:3]
Patient characteristics are shown in Table 1. The relative expression levels of miR-222-3p according to different clinicopathologic factors are shown in Table 2. Decreased miR-222-3p expression was found to be significantly associated with histologic grade (Grade 1+2 vs. [score:3]
Next, we detected miR-222-3p expression levels in a mouse mo del of EOC. [score:3]
Figure 3(A) Differential relative mRNA expression of miR-222-3p in six EOC cell lines. [score:3]
Figure 1Kaplan-Meier overall survival curves for EOC patients with high and low miR-222-3p expression. [score:3]
Inverse correlation between miR-222-3p and GNAI2 expression in ovarian cancer patient samples. [score:3]
Figure 4MiR-222-3p overexpression decreases EOC cell proliferation and migration in vitro(A) Transfection efficiency of miR-222-3p mimic in S KOV3/DDP by qRT-PCR 48h after transfection, using miR-control mimic as a negative control. [score:3]
These findings suggest that miR-222-3p/GNAI2/AKT axis, might constitute a potential new therapeutic target for ovarian cancer. [score:3]
The correlation between the expression of miR-222-3p and clinicopathological characters was assessed with the two-sample Student's t test. [score:3]
In conclusion, miR-222-3p might function as a tumor suppressor since it is negatively correlated with overall survival in EOC patients and chemo-response. [score:3]
In addition, our in-vivo experiments showed that chemo-sensitive tumors in the mice expressed relatively higher levels of miR-222-3p, supporting the clinical data. [score:3]
3 Relative miR-222-3p expression (Median values) with 25th–75th percentile in parentheses. [score:3]
MiR-222-3p directly targets the GNAI2 3′-UTR. [score:3]
Kaplan-Meier overall survival curves for EOC patients with high and low miR-222-3p expression. [score:3]
Correlation between miR-222-3p expression, proliferation and migration of human EOC cell lines. [score:3]
As shown in Figure 3A, S KOV3, HO8910PM and S KOV3-IP had higher levels of miR-222-3p, while HO8910, Tara R182 and S KOV3/DDP had relatively low expression levels of miR-222-3p. [score:3]
The Pearson's Correlation analysis clearly showed negative correlation between miR-222-3p and GNAI2 mRNA expression in tumor samples from EOC patients (n = 30, r = −0.6103, P = 0.0003). [score:3]
Quantification of miR-222-3p expression levels by qRT-PCR in the CTX343-CIS (P = 0.0081) and CTX347-PAC (P = 0.0012) mice revealed significant higher levels than those observed in the CTX270-control group (Figure 2B). [score:3]
To further explore the potential role of miR-222-3p in EOC cells, we transiently transfected miR222-3p mimic into S KOV3/DDP and HO8910 cell lines (low expression of miR-222-3p). [score:3]
miR-222-3p is highly expressed in the chemo-sensitive S KOV3 cells, but low in the chemoresistant S KOV3/DDP cells which correlates with our human data showing that patients that respond to chemotherapy have higher levels of miR-222-3p (Figure 1). [score:3]
First, we determined miR-222-3p expression by qRT-PCR analysis in six ovarian cancer cell lines (Tara R182, S KOV3, S KOV3/DDP, S KOV3-IP, HO8910 and HO8910-PM). [score:3]
Kaplan-Meier curves and survival curves showed that patients with high levels of miR-222-3p survived significantly longer than did the low -expressing group (the mean overall survival time was 49.394 months vs. [score:3]
These data showed a negative association between tumor growth after chemo-treatment and miR-222-3p expression levels. [score:3]
Negative correlation between miR-222-3p expression and mouse tumor size. [score:3]
Elevated expression of miR-222-3p is associated with improved overall survival of EOC patients. [score:3]
MiR-222-3p overexpression decreases EOC cell proliferation and migration in vitro. [score:2]
MiR-222-3p suppresses EOC cell proliferation via the GNAI2/AKT pathway. [score:2]
MiR-222-3p suppresses EOC cell proliferation via GNAI2/AKT pathway. [score:2]
The association between miR-222-3p and GNAI2 mRNA expression was assessed by means of Pearson's correlation analysis using the Pearson correlation coefficient r. All tests were two tailed and data were considered statistically significant if the P value was less than 0.05 (* P < 0.05; ** P < 0.01; *** P < 0.001). [score:2]
On the contrary, if we transfect miR-222-3p inhibitor into S KOV3, we observed an increase in cell proliferation demonstrated by a lower G0/G1 phase cell percentage and a higher percentages of cells in S and G2/M phases compared to the control cells (P < 0.0001; Figure 4G, 4H, Supplementary Figure S1G, and S1H). [score:2]
It has been shown that the phosphorylation status of AKT is closely correlated with cellular proliferation, thus, we tested the hypothesis that miR-222-3p could regulate cell proliferation by affecting the AKT pathway. [score:2]
MiR-222-3p expression and tumor growth in different EOC athymic nude mouse mo dels. [score:2]
We next performed a CCK-8 cell proliferation assay and data showed that the proliferation rates for S KOV3/DDP and HO8910 cells transfected with the miR222-3p mimic were lower than for cells transfected with the miRcontrol mimic (P < 0.0001, Figure 4C; P < 0.0001, Supplementary Figure S1C); In contrast, after transfecting miR-222-3p inhibitor into S KOV3 and HO8910-PM, the cell proliferation rate was increased compared with the control cells (P < 0.0001, Figure 4D; P < 0.0001, supplementary Figure S1D). [score:1]
The sequences of the above small molecules are as follows: hsa-miR-222-3p mimic: agcuacaucuggcuacugggu; miRNA mimic NC: UUUGUACUACACAAAAGUA CUG. [score:1]
Figure 7(A) Schematic diagram of the putative binding site in GNAI2 mRNA 3'UTR for miR-222-3p (The identical GNAI2 wild-type (WT) seed sequences AUGUAGC and mutant (Mut) 3'UTR sequences TACATCG for miR-221/222 as shown above). [score:1]
Initially, miR-222 was described as an oncogenic microRNA in gastric cancer [30], cervical cancer [13], bladder cancer [31], hepatocellular carcinoma [32], breast cancer [33], endometrial carcinoma [34], melanoma [35, 36], pancreatic cancer [37], glioblastoma [38], thyroid cancer [39], multiple myeloma [40, 41], chronic lymphocytic leukemia [42], and oral squamous cell carcinoma [43]. [score:1]
As stated above, miR-222 plays multiple roles in many cancer types. [score:1]
Similarly, the miR-222-3p high, chemosensitive S KOV3 cells have low migration capacity (P = 0.0003; Figure 3D, 3E). [score:1]
We then co -transfected the luciferase-3’-UTR construct (wild or mutant type) with miR-222-3p mimic into HEK-293T cells, and the ratio of Renilla/Firefly luciferase activities was determined. [score:1]
Our next objective was to investigate the role of miR-222-3p as a tumor suppressor-miR. [score:1]
Relative to the miR-control mimic, miR-222-3p mimic reduced the luciferase ratio of the wild-type 3’-UTR construct, but not that of the mutant (P < 0.0001; Figure 7C). [score:1]
Before co-transfection, the transfection efficiency of miR-222-3p mimic was confirmed by qRT-PCR in HEK-293T cells (P < 0.0001, Figure 7B), using miR-control mimic as negative control (NC). [score:1]
Association of miR-222-3p expression with clinicopathological characteristics of EOC patients. [score:1]
Therefore, to assess the functional role of miR-222-3p in EOC, we first investigated the basal expression levels of miR-222-3p in six EOC cell lines. [score:1]
Later, in 2015, Ihle et al. [18] further proved that miRNA-222 can induce apoptosis via a signaling cascade involving KIT, AKT and BCL2. [score:1]
A Cox proportional hazards analysis was used to further evaluate the potential of miR-222-3p expression as a prognostic biomarker (Table 4). [score:1]
Relative expression levels of miR-222-3p were characterized by their median ranges. [score:1]
However, no significant correlation was observed between miR-222-3p and other clinicopathologic variables such as age, histologic type, and FIGO stage (all P > 0.05). [score:1]
Figure 5(A) Tara R182 cell line was transfected with miR-222-3p mimic, Western blot analysis of AKT phosphorylation levels at both Ser473- and Thr308- residues and total AKT were detected. [score:1]
However, the role of miR-222 in ovarian cancer is not yet clear. [score:1]
The significant association of higher levels of miR-222-3p with good overall survival agrees with Figure 1. Table 4 Characteristics Univariate analysis Multivariate analysisHR [1]95% CI [2] P valueHR [1] 95% CI [2] P value Expression of miR-222-3p  (low vs. [score:1]
miR-222-3p relative expression levels according to different clincopathological characteristics of EOC patients. [score:1]
The significant association of higher levels of miR-222-3p with good overall survival agrees with Figure 1. Table 4 Characteristics Univariate analysis Multivariate analysisHR [1]95% CI [2] P valueHR [1] 95% CI [2] P value Expression of miR-222-3p  (low vs. [score:1]
[1 to 20 of 106 sentences]
2
[+] score: 285
Other miRNAs from this paper: hsa-mir-221
In addition, to determine whether the growth suppression by miR-221 or miR-222 that we observed in this study coincided with suppression of PTEN, we performed Western blots of PTEN in lung cancer cells transfected with either miRNA and found that not all but in several cases where cell growth was suppressed (e. g., H3255, HCC4006) PTEN expression was significantly suppressed (Fig. S15). [score:11]
We found that miR-221 and miR-222 only occasionally suppressed p27 [Kip1] and p57 expression in NSCLC cells (Fig. S14), suggesting that suppression of p27 [Kip1] and p57 expression may not be solely responsible for impaired G1/S checkpoints that lead to the increased S-phase population in cells transfected with miR-221 or miR-222 in NSCLC cells. [score:9]
Oncogenic roles of miR-221 and miR-222 have been shown in several types of human malignancies, especially in breast cancer 6– 9. miR-221 and miR-222 exert their oncogenic abilities in part through suppressing the cyclin -dependent kinase (CDK) inhibitors p27 [Kip1], and p57 or upregulating the epithelial-to-mesenchymal transition (EMT)-inducing gene ZEB2 through TRPS1 10– 12. [score:8]
These results show that miR-221 and miR-222 increased sensitivities of lung cancer cells to the S-phase targeting drugs cisplatin and gemcitabine in some cases but did not affect sensitivity to the M-phase targeting drug paclitaxel, suggesting their potential as chemosensitizers of S-phase targeting drugs. [score:7]
This showed that despite the inhibition of PTEN, miR-221 and miR-222 overexpression exert growth suppressive function in certain cellular context. [score:7]
Garofalo et al. demonstrated that miR-221 and miR-222 play oncogenic roles in lung cancer in part through suppressing the expression of PTEN and TIMP3 tumor suppressor genes 16. [score:7]
Upon introduction of miR-221 or miR-222, numerous genes were up- or downregulated, including several known target genes such as p27 [Kip1], p57, PTEN, Dicer1, and APAF1 (Figs. S6, S7, S8, and S9). [score:6]
Expression of two, EMT-inducing transcription factors, SIP1 (ZEB2), shown to be upregulated by miR-221 and miR-222 in mammary epithelial cells 9 and SLUG remain unchanged. [score:6]
In all cases except for miR-221 -transfected-HBEC4, when cells transfected with miR-221 or miR-222 showed both increased S-phase population in FACS analysis and growth suppression in liquid colony formation assay (enclosed by a dotted line in Fig. 3C), pChk1 and/or pChk2 levels were upregulated, suggesting that the S-phase increase due to miR-221 or miR-222 reflected intra-S phase arrest (Fig. 3C). [score:5]
To see whether miR-221 and miR-222 -induced apoptosis in NSCLC cells occurs through the same mechanism as in glioblastoma, we examined whether miR-221 and miR-222 suppressed p27 [Kip1] and p57 expression. [score:5]
After the introduction of miR-221 or miR-222, protein expression of E-CADHERIN, a hallmark epithelium marker did not significantly change in both Western blot and immunocytochemistry while protein expression of VIMENTIN, a marker for mesenchymal cells, increased in immunocytochemistry (Figs. S3 and S4). [score:5]
miR-221 and miR-222 enhance chemosensitivities to S-phase targeting drugs, cisplatin, and gemcitabine, but do not affect sensitivities to an M-phase targeting drug, paclitaxel, in lung cancer cells. [score:5]
To gain insight into possible molecular mechanisms underlying the striking difference in the responses to introduction of miR-221 and miR-222, especially to miR-222, between lung cancer cell lines, we performed microarray gene expression analysis on H3255, representing cell lines whose growths were suppressed by miR-222, and H1299, representing cell lines whose growth were promoted by miR-222, using a 3D-Gene Human Oligo chip 25 k (Toray Industries). [score:5]
Expression levels of each gene differentially expressed by miR-221 strongly correlated with those of miR-222 in both H1299 and H3255 (Spearman correlation coefficient values: 0.983 (P < 0.001) for H1299 and 0.987 (P < 0.001) for H3255) (Figs. S10 and S11). [score:5]
A previous study reported that introduction of miR-221 and miR-222 resulted in downregulation of p27 [Kip1] and p57, regulators of the G1/S transition, leading to premature S-phase entry, and subsequent apoptosis in glioblastoma cells 13. [score:5]
miR-221 suppressed growth in four cell lines (H3255, HCC4006, HCC4011, H1299) without affecting growth in one (H838), and miR-222 suppressed growth in three (H3255, HCC4006, HCC4011) but promoted growth in two (H838, H1299) (Fig. 2A and B). [score:5]
A prior study reported that miR-221 and miR-222 induced EMT in immortalized normal mammary epithelial cells through targeting TRPS1, which inhibits an EMT-inducing transcription factor, ZEB2 9. In addition, another study showed that miR-221 and miR-222 conferred invasiveness on a lung cancer cell line, suggesting that they function as onco-miRNAs in lung cancer cells 16. [score:5]
Consistent with this report, we found that miR-221 and miR-222 promoted growth in H460, while in other five cells lines miR-221 suppressed growth in four cell lines without affecting one and miR-222 suppressed growth in the three cell lines but promoted growth in two. [score:5]
Finally, our results showed that introduction of miR-221 or miR-222 enhanced sensitivities to the S-phase targeting drugs cisplatin and gemcitabine but did not affect an M-phase targeting drug, paclitaxel. [score:5]
They reported that miR-221 and miR-222 enhanced tumorigenic phenotypes of H460 lung cancer cells, including invasiveness and resistance to TRAIL -induced apoptosis, through suppressing PTEN and TIMP3, both tumor suppressor genes. [score:5]
However, in other five cell lines, effects of miR-221 and miR-222 on growth showed significant differences between cell lines; miR-221 suppressed growth in four cell lines with no effects in one, and miR-222 suppressed growth in three but promoted growth in two. [score:5]
miR-221 and miR-222 rather suppressed invasiveness in these cells, suggesting their tumor-suppressive roles in normal bronchial epithelial cells. [score:5]
We further show that growth inhibition in lung cancer cell lines by miR-221 and miR-222 overexpression occurred in part through intra-S cell cycle arrest and/or apoptosis. [score:5]
In addition, another paper reported that miR-221 and miR-222 are downregulated in Kaposi sarcoma -associated herpes virus -associated cancers, including primary effusion lymphoma and Kaposi sarcoma 14. [score:4]
Pathways with significant enrichment for genes more than twofold up- or downregulated after miR-222 introduction in H3255. [score:4]
Pathways with significant enrichment for genes more than twofold up- or downregulated after miR-222 introduction in H1299. [score:4]
Invasiveness was rather suppressed by miR-221 and miR-222 (Fig. 1B, right). [score:3]
Scatter plot of genes differentially expressed between H1299 cells transfected with miR-221 and those transfected with miR-222. [score:3]
By contrast, miR-221 or miR-222 mimics did not enhance sensitivity to the M-phase targeting drug paclitaxel in any cell line studied. [score:3]
miR-221 and miR-222 are encoded in tandem from a gene cluster located on chromosome Xp11.3 5. Both tumor-suppressive and oncogenic roles of miR-221 and miR-222 have been reported, suggesting they have a bimodal function in the tumorigenesis of human cancers. [score:3]
These increased levels of miR-221 and miR-222 were much higher than those endogenously expressed in a panel of lung cancer cell lines (Fig. S1). [score:3]
One paper reported that overexpression of miR-221 and miR-222 in malignant glioblastoma cells increases the population of cells in S-phase, resulting in massive apoptosis 13. [score:3]
Growth suppression by miR-221 or miR-222 occurred through S-phase arrest and/or apoptosis in part resulting from DNA DSBs. [score:3]
Figure 1miR-221 and miR-222 suppress invasiveness in immortalized normal bronchial epithelial cells. [score:3]
This suggests that it is unlikely that our finding that miR-221 and miR-222 showed tumor-suppressive roles in many lung cancer cell lines is attributable to experimental errors. [score:3]
Finally, introduction of miR-221 and miR-222 caused H1299 lung cancer cells, which did not exhibit apoptosis upon introduction of miR-221 and miR-222, to become more sensitive to S-phase targeting drugs, cisplatin, and gemcitabine. [score:3]
We hypothesized that the increase in S-phase populations by miR-221 and miR-222 improves sensitivities to S-phase targeting drugs in lung cancer cells. [score:3]
After introduction of miR-221 and miR-222 mimics into HBEC4, increased expression of these miRNAs was confirmed by qRT-PCR analysis (Fig. 1A). [score:3]
On the other hand, several studies reported tumor-suppressive functions of miR-221 and miR-222. [score:3]
Figure 3miR-221 and miR-222 suppress growth in lung cancer cells through intra-S arrest and/or apoptosis. [score:3]
In addition to reported oncogenic functions of miR-221 and miR-222, our findings indicate that they also function as tumor suppressors and can enhance chemosensitivity to cytotoxic drugs, suggesting their potential as therapeutics for lung cancer. [score:3]
Scatter plot of differentially expressed genes between H1299 cells transfected with miR-222 and those transfected with control. [score:3]
We examined the expression of γH2AX in the nucleus, a marker for DSB 32, 33. miR-221 and miR-222 treatment increased percentages of γH2AX-positve cells in H1299 and H3255 but not in HBEC4 or H460, suggesting the increase in unrepaired DSBs in H1299 and H3255 cells (Fig. 4). [score:3]
In conclusion, our results show that the effects of miR-221 and miR-222 introduction on lung cancer cells vary significantly between cell lines, but that they could be attractive therapeutics for lung cancer especially when efficient methods to predict whether they function as a tumor suppressor or not is developed. [score:3]
miR-221 and miR-222 suppress invasiveness in immortalized normal bronchial epithelial cells. [score:3]
miR-221 and miR-222 did not affect anchorage-independent growth but suppressed invasiveness in HBEC4 cells. [score:3]
Growth suppression by miR-221 and miR-222 in lung cancer cells occurs through intra-S arrest and/or apoptosis. [score:3]
On the other hand, our findings showing tumor-suppressive roles for miR-221 and miR-222 seem to contrast with a study reported by Garofalo et al. 16, 35. [score:3]
Collectively, these findings showed that miR-221- and miR-222 -induced growth suppression in NSCLC cells occurred in part through intra-S phase arrest and/or apoptosis. [score:3]
Scatter plot of genes differentially expressed between H3255 cells transfected with miR-221 and those transfected with miR-222. [score:3]
To analyze effects of overexpression of miR-221 or miR-222 on invasiveness in lung cancer cells they used one lung cancer cell line, H460, to represent lung cancer cells. [score:3]
To elucidate the molecular mechanisms of miR-221- and miR-222 -induced growth suppression in Non-small cell lung cancer (NSCLC) cells, we performed cell cycle and apoptosis analyses. [score:3]
Scatter plot of differentially expressed genes between H3255 cells transfected with miR-222 and those transfected with control. [score:3]
Our data exhibit concordance with findings of Medina et al. who reported that introduction of miR-221 and miR-222 impaired the G1/S checkpoint by suppressing p27 [Kip1] and p57, leading to a massive increase in the S-phase population and subsequent apoptosis 13. [score:3]
Collectively, our results suggest growth inhibitory effects of miR-221 and miR-222 in lung cancer cells. [score:3]
Expression of EMT markers in HBEC4 transfected with miR-221 or miR-222. [score:3]
These data were the first to demonstrate growth suppressive effects of miR-221 and miR-222 in lung cancer cells. [score:3]
Figure 2Effects of miR-221 and miR-222 on growth differ strikingly between lung cancer cell lines. [score:1]
Transfection of miR-221 or miR-222 improved sensitivities to cisplatin in H1299 and HBEC4 but not in H460, H3255, or H838 (Fig. 5). [score:1]
Western blot of PTEN in lung cancer and HBEC4 cells transfected with miR-221 or miR-222. [score:1]
Nevertheless, γH2AX staining did not exhibit typical foci pattern, usually seen in cells with DSBs, but instead cells were homogeneously stained by γH2AX, and thus, our data only suggest that increased DSBs induced by miR-221 and miR-222 may cause S-phase arrest and apoptosis. [score:1]
miR-221 and miR-222 introductions increased the number of H3255 and H1299 cells positive for nuclear γH2AX staining cells. [score:1]
These cell lines showed increased S-phase populations due to miR-221 and miR-222, but they differed in that H460 and H3255, but not H838 or H1299 exhibited apoptosis. [score:1]
Upon introduction of miR-221 or miR-222 mimics, a subset of cells changed to elongated spindle shapes, and these morphologic changes suggest the occurrence of EMT. [score:1]
Forty eight hours after the transfection of miR-221 and miR-222, a minority of cells underwent morphologic changes suggestive of EMT including switch to elongated spindle shape (Fig. S2). [score:1]
These results suggested that miR-221 and miR-222 only modestly caused immortalized normal bronchial epithelial cells to undergo EMT. [score:1]
The pathways affected by miR-221 greatly overlapped with those affected by miR-222 in H3255, while overlapping of only one pathway (Melanoma) was seen in H1299, which may be responsible for the opposite effects of miR-221 and miR-222 seen in H1299, but not in H3255. [score:1]
Figure 4Introduction of miR-221 and miR-222 results in increase in γH2AX-positve cells in lung cancer cell lines. [score:1]
of miR-221 and miR-222 resulted in increases in sub-G1 populations, which correspond to apoptotic cells, in H460, H3255 and HCC4006. [score:1]
Western blot of E-CADHERIN, SIP1(ZEB2), and SLUG (Fig. S3) and immunocytochemistry of E-CADHERIN and VIMENTIN (Fig. S4) in HBEC4 cells transfected with miR-221 or miR-222 mimics. [score:1]
A prior paper reported that miR-221 and miR-222 enhanced invasiveness in H460 16. [score:1]
We also observed that introduction of miR-221 and miR-222 resulted in increases in S-phase populations in five of six lung cancer cell lines. [score:1]
The prior report showed an approximately 40% increase of S-phase after miR-221 or miR-222 introduction 13, while we saw only 5–10% increase. [score:1]
This result suggests that unrepaired DSBs increased upon introduction of miR-221 and miR-222 in these cells. [score:1]
Consistent with a prior report 16, miR-221 and miR-222 enhanced growth in H460. [score:1]
Nevertheless, unexpectedly, the effects of miR-221 and miR-222 introduction in other five cancer cell lines significantly differed between cell lines. [score:1]
qRT-PCR analysis of p27 [Kip1] and p57 in lung cancer cell lines and HBEC4 transfected with miR-221 or miR-222 mimics. [score:1]
Cells were transfected with microRNA mimics (hsa-miR-221 and hsa-miR-222) or control microRNA (microRNA control, AC/eGFP). [score:1]
By contrast, in cells showing increase in S-phase and growth promotion by miR-221 or miR-222 exhibited increased BrdU incorporation, suggesting that in these cells S-phase increase reflected increased replication of DNA (enclosed by a solid line in Fig. 3B). [score:1]
miR-221 tended to increase S phase populations to a greater extent than miR-222 did. [score:1]
Effects of miR-221 and miR-222 on growth differ strikingly between lung cancer cell lines. [score:1]
Improved sensitivities to gemicitabine were seen in H1299 cells transfected with miR-221 or miR-222 mimics, but not seen in other cell lines. [score:1]
Figure 5miR-221 and miR-222 enhance chemosensitivities to cisplatin (A) and gemcitabine (B), but do not affect those to paclitaxel (C) in lung cancer cells. [score:1]
We also found that all the three pathways are significantly affected in both miR-221 and miR-222 treated H3255 cells but not in H1299 cells, suggesting that these pathways could contribute to the apoptosis induced by miR-221 or miR-222 in H3255 cells. [score:1]
HBEC4 cells transfected with miR-221 or miR-222 mimics. [score:1]
revealed that introduction of miR-221 and miR-222 resulted in increased S-phase populations in H460, H3255, HCC4011, H838, and H1299 cell lines (Fig. 3A and Fig. S12). [score:1]
Consistent with a prior report 16 miR-221 and miR-222 promoted growth in H460. [score:1]
We hypothesized that G1/S checkpoint impairment by miR-221 and miR-222 resulted in the accumulation of DNA damages, which led to intra-S arrest and further caused cells to undergo apoptosis, depending on the cellular capability for repairing DNA damages. [score:1]
We further asked what events triggered the intra-S phase arrest in miR-221- and miR-222 -transfected lung cancer cells. [score:1]
The next day, cells were transiently transfected with either 10 nmol/L predesigned microRNA mimics (hsa-miR-221 and hsa-miR-222) or control microRNA (microRNA control, AC/eGFP) purchased from Cosmo Bio (Tokyo, Japan), using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocol. [score:1]
Western blot of cleaved caspase-3 for lung cancer cell lines and HBEC4 transfected with miR-221 or miR-222- mimics. [score:1]
In the present study, we examined the effects of miR-221 and miR-222 on growth and drug sensitivity in lung cancer cells. [score:1]
Pathway analysis using NIH-DAVID 28, 29, a web interface functional annotation tool, revealed that several pathways were significantly affected by miR-221 or miR-222 (Tables S1, S2, S3, and S4) in H1299 and H3255. [score:1]
Efficient introduction of miR-221 and miR-222 into these cell lines was confirmed by qRT-PCR analysis (Fig. S5). [score:1]
We used the same cell line, H460 and obtained consistent results showing that both miR-221 and miR-222 promoted liquid colony formation in H460 (Fig. 2A). [score:1]
These results indicated that miR-221 and miR-222 induced EMT-like changes to a small extent in normal lung epithelial cells but did not enhance the EMT -associated phenotypes of anchorage-independent growth or invasiveness. [score:1]
qRT-PCR analysis of miR-221 and miR-222 in 22 non-small cell lung cancer and HBEC4 cell lines. [score:1]
qRT-PCR of miR-221 and miR-222 in lung cancer cell lines transfected with miR-221 or miR-222 mimics. [score:1]
EMT-like changes in HBEC4 transfected with miR-221 or miR-222. [score:1]
These findings prompted us to examine whether miR-221 and miR-222 are able to induce EMT in normal lung epithelial cells, and if so, to further test whether the induced- EMT is associated with acquisition of invasiveness or anchorage-independent growth, both well acknowledged EMT -associated malignant phenotypes 27. [score:1]
Flow cytometry of six lung cancer cell lines and HBEC4 transfected with miR-221 or miR-222 mimics. [score:1]
[1 to 20 of 101 sentences]
3
[+] score: 272
Since IL-24 inhibited HMGA1 expression and its downstream target AKT, we next raised the question of whether IL-24 -mediated AKT inhibition involves inhibition of miR-222 expression. [score:13]
Consistent with these findings, our results demonstrated that miR-222-3p expression decreased as a consequence of IL-24 [wt] -mediated HMGA1 expression, and was associated with upregulation of PPP2R2A expression. [score:10]
The possibility of non-specific inhibitory activity of miR-222-3p inhibitor was eliminated by using a control inhibitor (negative control) that did not show any activity on miR-222-3p or on AKT expression compared to miR-222-3p inhibitor (Supplementary Figure S9A). [score:10]
Zhang et al. [28] have demonstrated that HMGA1 regulates PPP2R2A expression, either directly by repressing PPP2R2A transcription, or indirectly through enhancing miR-222 expression. [score:8]
Figure 6Modulation of miR-222-3p enhances the inhibitory activity of IL-24 [wt] on HMGA1 signaling in H1299-IL24 [wt] cells A. Induction of IL-24 [wt] downregulates miR-222-3p and-5p expression in H1299-IL-24 [wt] cells (p<0.05). [score:8]
Modulation of miR-222-3p enhances IL-24 -mediated inhibition of HMGA1 signaling in H1299-IL24 [wt] cellsHMGA1 overexpression has recently been shown to correlate with the increased expression of oncogenic miR-222 [28]. [score:7]
Supporting our findings, other studies have shown that miR-222 repression upregulated PPP2R2A and its associated downregulation of p-AKT [28]. [score:7]
In addition, miR-222 overexpression has been shown to downregulate PPP2R2A in non-small lung cancer cells by directly binding to the 3'-UTR region, thereby activating AKT signaling [28]. [score:7]
F. IL-24 expression did not reduce miR-222-3p expression in cells overexpressing miR-222-3p mimic (p<0.05). [score:7]
Our results demonstrate that IL-24 [wt] is more effective in inhibiting the HMGA1/miR-222-3p/AKT axis when it is combined with miR-222-3p inhibitor and inefficient to override when miR-222-3p mimic is expressed. [score:7]
Studies using miR-222-3p inhibitor and mimic showed that IL-24 [wt] mediates AKT inhibition in lung cancer cells by regulating the HMGA1/miR-222 node. [score:6]
A. Induction of IL-24 [wt] downregulates miR-222-3p and-5p expression in H1299-IL-24 [wt] cells (p<0.05). [score:6]
Further, siRNA -mediated HMGA1 silencing significantly downregulated miR-222 expression. [score:6]
Further, they showed that HMGA1 silencing reduced miR-222 transcriptional activity, whereas forced HMGA1 expression increased miR-222 expression by directly binding with the proximal promoter of miR-222 in NSCLC cell. [score:6]
This showed that IL-24 [wt] -mediated HMGA1 inhibition repressed its direct downstream target miR-222 in H1299-IL-24 [wt] cells. [score:6]
However, IL-24 [wt] did not produce a significant reduction in miR-222-3p expression nor increased the expression of PPP2R2A in cells expressing miR-222-3p mimic when compared to IL-24 [wt] treatment alone. [score:6]
Negative controls used in our miR222-3p overexpression/downregulation studies, are chemically synthesized single stranded modified RNAs. [score:6]
B. IL-24 [wt] shows greater inhibition of miR-222-3p expression when combined with genetic knockdown of HMGA1 (p<0.05). [score:6]
HMGA1 overexpression has recently been shown to correlate with the increased expression of oncogenic miR-222 [28]. [score:5]
Supporting this, our results showed marked inhibition of HMGA1/miR-222/AKT signaling upon treatment with a combination of IL-24 [wt] with either HMGA1 siRNA or miR-222-3p inhibitor. [score:5]
E. IL-24 [wt] combined with miR-222-3p inhibitor exhibited a greater increase in PPP2R2A expression (p<0.05). [score:5]
We also observed a further reduction in miR-222-3p expression when IL-24 [wt] was added to miR-222-3p inhibitor -treated cells. [score:5]
D. Treatment of H1299-IL-24 [wt] cells with miR-222-3p inhibitor increased PPP2R2A protein expression. [score:5]
IL-24 [wt] treatment alone produced a marked decrease in pAKT [T308] and increase in PPP2R2A expression accompanied with reduced miR-222-3p expression (p<0.05; Figure 6F). [score:5]
We observed a significant reduction in miR-222-3p expression that was accompanied with a concomitant increase in PPP2R2A expression (p<0.0001; Figure 6D). [score:5]
Together, these data suggest that the observed IL-24 [wt] -mediated AKT inhibition occurs through suppression of the HMGA1/miR-222-3p node. [score:5]
MiR-222 has been reported to inhibit PPP2R2A protein expression in lung tumor cells by directly binding to its 3'UTR region [28]. [score:5]
In conclusion, our results showed that IL-24 [wt] inactivates AKT by suppressing the HMGA1/miR-222 axis and that the combination of IL-24 [wt] with HMGA1 silencing and miR-222 inhibitors was more effective in attenuating AKT and the associated lung cancer migration and invasion. [score:5]
Finally, we examined whether IL-24 [wt] could inhibit AKT when miR-222-3p is overexpressed using miR-222-3p mimic. [score:5]
A decrease in pAKT [T308] and increase in PPP2R2A protein expression was also observed in the cells treated with IL-24 [wt] plus miR-222-3p inhibitor compared with controls and those treated with either agent alone (p<0.05; Figure 6E). [score:4]
Further, we observed increased PPP2R2A expression after IL-24 [wt] treatment in miR-222-3p -overexpressing cells when compared with miR-222-3p mimic alone group (p<0.0001). [score:4]
We hypothesized that IL-24 inhibits AKT by regulating the HMGA1/miR-222 axis in non-small cell lung cancer (NSCLC). [score:4]
Further, IL-24 [wt] when combined with HMGA1 siRNA produced the highest inhibition of miR-222-3p expression when compared to individual treatments (p<0.001; Figure 6B). [score:4]
We demonstrated a significant decrease in miR-222-3p expression in cells transfected with miR-222-3p inhibitor compared with controls (p<0.05; Figure 6E). [score:4]
HMGA1 enhances its expression by directly binding with the proximal promoter of miR-222 [28]. [score:4]
We observed a marked increase in pAKT [T308] and decrease in PPP2R2A expression in miR-222-3p -overexpressing cells compared with controls (Figure 6F). [score:4]
To our knowledge, this is the first report to highlight that IL-24 [wt] attenuates AKT through suppression of the HMGA1/miR-222 axis in lung cancer cells. [score:3]
H1299-IL-24 [wt] cells induced with DOX showed a significant reduction in the expression of both miR-222-3p (predominant form) and miR-222-5p (less abundant form; p<0.05; Figure 6A). [score:3]
Modulation of miR-222-3p enhances IL-24 -mediated inhibition of HMGA1 signaling in H1299-IL24 [wt] cells. [score:3]
In non-small cell lung cancer, miR-222 expression is reported to be associated with cancer cell proliferation, metastasis, drug resistance, and poor survival [28, 54]. [score:3]
They revealed that overexpression of HMGA1 was significantly associated with increased levels of miR-222 in lung tumor specimens and cell lines [28]. [score:3]
Moreover, we theorized that IL-24 would exhibit enhanced anti-metastatic activity when combined with HMGA1 siRNA and miR-222-3p inhibitor. [score:3]
H1299-IL24 [wt] (1 X 10 [5]) cells were seeded in six-well plates and were transiently transfected with the miR-222-3p inhibitor and miR negative control (100 nM; Dharmacon) using DOTAP:Cholesterol liposome as previously described [37, 40]. [score:3]
Next, we treated H1299-IL24 [wt] cells with miR-222-3p inhibitor. [score:3]
Modulation of miR-222-3p enhances the inhibitory activity of IL-24 [wt] on HMGA1 signaling in H1299-IL24 [wt] cells. [score:3]
This finding indicates the IL-24 [wt] mediated the reduced expression of miR-222-3p in lung tumor cells, and is consistent with our RT-PCR data (Figure 6B). [score:3]
Based on the results we next examined the inhibitory effects of IL-24 [wt] in miR-222-3p mimic treated H1299-IL24 [wt] cells. [score:3]
Further, we have shown that the observed effects are specific to wild-type IL-24 as the mutant IL-24 protein did not demonstrate similar inhibitory activity on HMGA1, AKT or miR-222. [score:3]
Accumulating evidence has demonstrated that miR-222 is overexpressed in several types of cancers, including lung cancer [28, 49– 53]. [score:3]
The overexpression of miR-222-3p was confirmed by RT-PCR analysis. [score:3]
Next, we used a luciferase -based reporter assay to confirm that IL-24 [wt] represses miR-222-3p expression. [score:2]
C. The expression of IL-24 [wt] in the presence of miR-222-3p-Luc plasmid produced an increase in luciferase activity compared with the miR-222-3p-Luc plasmid alone group (p<0.0001). [score:2]
Our recent observation of IL-24 -mediated AKT inhibition in lung cancer cells [37] and results from another study indicating that the HMGA1/miR-222 axis is involved in AKT regulation prompted this line of investigation [28]. [score:2]
A slight increase in PPP2R2A expression was observed in the combination treatment group when compared to miR-222-3p mimic treated cells without IL-24 [wt] but was still lesser than the untreated control (Figure 6F). [score:2]
Increased miR-222-3p and pAKT [T308] expressing was observed in miR-222-3p mimic -treated cells compared to control mimic -treated and untreated cells (Supplementary Figure S9B). [score:2]
We used miRNA luciferase reporter, which has binding sites for miR-222-3p at 3'UTR downstream of the reporter luciferase gene. [score:1]
In addition, miR-222 is reported to be involved in the activation of various pathways, including AKT signaling, in cancer cells [55]. [score:1]
Prior to conducting the studies, we first tested the specificity of miR-222-3p mimic by transfecting H1299-IL24 [wt] cells and comparing with a control mimic. [score:1]
Since IL-24 [wt] attenuated HMGA1/miR-222-3p axis signaling, we next investigated the effect of a combination of IL-24 [wt] and miR-222-3p inhibitor on AKT signaling in H1299-IL-24 [wt] cells. [score:1]
After six hours, the medium was removed and cells were transiently transfected with miR-222-3p mimic and miR negative control (50 nM, Dharmacon) using DOTAP:Cholesterol liposome as previously described [37, 40]. [score:1]
[1 to 20 of 60 sentences]
4
[+] score: 263
Further study by immunoblotting assay showed that forced expression of miR-222 greatly inhibited the expression levels of PTEN, while blockade of endogenous expression of miR-222 upregulated PTEN levels for decreasing downstream signaling molecule activation of PTEN: p-AKT, p-ERK, and VEGF levels (Figure 4C). [score:11]
Figure 3Expression of anti-miR-222 inhibitor in cells decreases As-T cells -induced tumor growth in vivo(A) BALB/c nude mice (5–6 week old) were subcutaneously injected with 5 × 10 [6] As-T cells expressing anti-miR-NC or anti-miR-222 inhibitor. [score:9]
miR-222 directly targets ARID1A for inhibiting its expression. [score:8]
miR-222 directly targets PTEN for inhibiting its expression. [score:8]
Anti-miR-222 inhibitor treatment inhibits AKT activation and induces apoptosis through ARID1A expression. [score:7]
As-T cells stably overexpressing miR-222 inhibitor or anti-miR-control were generated by infecting As-T cells with lentivirus carrying miR-222 inhibitor and green fluorescence protein (GFP) or a negative control miRNA precursor and GFP (purchased from Shanghai Genechem Co. [score:7]
Treatment of cells using anti-miR-222 inhibitor induced apoptosis of As-T cells through inhibiting AKT activation and inducing ARID1A expression. [score:7]
In this study, we found anti-miR-222 inhibitor treatment in cells suppressed AKT activation and induced apoptosis through ARID1A expression in As-T cells. [score:7]
To test the effect of miR-222 in affecting ARID1A protein expression, we showed that miR-222 mimics markedly reduced ARID1A protein levels in both As-T cells and BEAS-2B cells using (Figure 6B and 6C), while anti-miR-222 inhibitor greatly increased ARID1A protein expression in both cells (Figures 6D and 5E). [score:7]
Our result showed that miR-222 expression was upregulated the most in As-T cells using miRNA microarray analysis (data not shown). [score:6]
miR-222 can increase migration and proliferation of tumor cell, and inhibit apoptosis by regulating different targets such as PTEN [9], p27 [10], and TIMP3 [11]. [score:6]
Anti-miR-222 inhibitor treatment significantly induced apoptosis, while the knockdown of ARID1A using the siRNAs reversed the effect of anti-miR-222 inhibitor in the cells (Figure 7B). [score:6]
miR-222 expression is upregulated in As-T cells. [score:6]
The results of the present study found that miR-222 inhibitor inhibited cell proliferation, migration, and tumor growth, indicating that miR-222 plays an important role in tumor development. [score:6]
In the parallel experiment, inhibition of miR-222 using anti-miR-222 inhibitor increased the luciferase activity of wild-type ARID1A 3′-UTR reporter, but not that of the mutant reporter in both As-T and A549 cells (Figure 5D and 5E). [score:5]
Expression of anti-miR-222 inhibitor in cells decreases As-T cells -induced tumor growth in vivo. [score:5]
The cells with green fluorescence represent stably overexpressing miR-222 inhibitor (As-T/Anti-miR-222) or negative control As-T/Anti-miR-NC. [score:5]
This result suggests that miR-222 inhibits PTEN expression through the seed sequence at its 3′-UTR region. [score:5]
showed that the luciferase activities of wild type PTEN 3′-UTR reporter were inhibited by 35% in As-T cells over -expressing miR-222. [score:5]
AKT activation (p-AKT level) is inhibited by anti-miR-222 inhibitor (Figure 7A). [score:5]
The present study addresses the following questions: (1) the expression and the role of miR-222 in cell proliferation, migration and tube formation in cells; (2) the role of miR-222 in tumor growth; and (3) the functional relevant target(s) of miR-222 in As-T cells. [score:5]
On the opposite, inhibition of miR-222 by its inhibitor increased the luciferase activities of wild type reporter by nearly 50% in As-T cells (Figure 4A and 4B). [score:5]
Furthermore, we used software to predict the potential targets of miR-222 and found that ARID1A was one of the putative targets of miR-222. [score:5]
To study the potential biological function of miR-222 in As-T cells, the cells stably overexpressing miR-222 inhibitor (As-T/Anti-miR-222) or negative control (As-T/Anti-miR-NC) were established, confirming the successful establishment of the stable cells (Figure 2A). [score:5]
It was reported that the reduction of miR-222 expression inhibited cell proliferation and induced mitochondrial -mediated apoptosis of A549 lung cancer and MCF-7 breast cancer cells [27]. [score:5]
The proliferation rates of As-T cells with forced expression of anti-miR-222 inhibitor were significantly decreased after 72 h post cell seeding compared with the control cells (Figure 2B). [score:4]
It is reported that miR-222 is an oncogene that is upregulated in many cancers including hepatocellular carcinoma, cervical cancer, and gastric carcinoma. [score:4]
To verify whether miR-222 directly targets PTEN, PTEN 3′-UTR sequences containing putative binding sites of wild type (WT) or the mutant one (mut) were cloned into pMIR-REPORTER vector. [score:4]
In addition, we found that ARID1A is a new direct target of miR-222. [score:4]
In this study, we found that miR-222 directly targets PTEN for inducing the activation of its downstream molecules AKT and ERK in arsenic-transformed cells. [score:4]
miR-222 directly targets PTEN for activating several downstream signal molecules. [score:4]
MiR-222 treatment inhibits ARID1A protein expression. [score:4]
The ARID1A siRNAs restored p-AKT level which was reduced by anti-miR-222 inhibitor (Figure 7A). [score:3]
Consistent with tumor size, the tumor weight of anti-miR-222 inhibitor group was decreased to 30% of control group (Figure 6B, tmiR-222 levels in As-T cells is sufficient to attenuate tumor growth in vivo. [score:3]
The tube formation was also significantly decreased by anti-miR-222 inhibitor treatment (Figure 2F). [score:3]
Figure 1The expression levels of miR-222 were determined using RT-PCR (A) and RT-qPCR (B) in As-T cells and BEAS-2B (B2B) cells. [score:3]
The tumor sizes of anti-miR-222 inhibitor group were much smaller than that of control group (Figure 3B, top). [score:3]
MiR-222 directly targets ARID1A through the seed sequence at its 3′-UTR region. [score:3]
It was found that miR-222 induced gastric carcinoma cell proliferation and radioresistance by targeting PTEN [9]. [score:3]
**indicates significant difference compared to cells without miR-222 overexpression and ARID1A knockdown. [score:3]
The expression levels of miR-222 were normalized to U6 snRNA levels. [score:3]
## indicates significant difference compared to ARID1A knockdown in miR-222 overexpressing cells. [score:3]
The result showed that cell migration was decreased by more than 2-fold in As-T cells transfected with anti-miR-222 inhibitor (Figure 2E). [score:3]
Neither miR-222 nor miR-222 inhibitor affected the luciferase activities of mutant reporters. [score:3]
These results indicate that miR-222 and its novel target ARID1A play an important role in tumor growth and apoptosis, which will be helpful for understanding new mechanism of arsenic in inducing carcinogenesis and for developing new treatment option for cancer(s). [score:3]
Figure 2(A) As-T cells were infected with lentivirus carrying anti-miR-222 inhibitor and GFP or a negative control and GFP according to the manufacturer's instruction. [score:3]
Treatment of cells using anti-miR-222 inhibitor decreases cell proliferation, migration, and tube formation. [score:3]
Overexpression of miR-222 is correlated with the poor prognosis of non-small cell lung cancer (MSCLC) and miR-122 may be used as a biomarker for selecting the patients who require especial attention [12]. [score:3]
Ten 5- to 6-week-old BALB/c nude mice per group were subcutaneously injected with 5 × 10 [6] As-T cells infected with lentiviruses carrying miR-NC or miR-222 inhibitor in special pathogen-free conditions. [score:3]
As-T cells were transiently cotransfected with 300 ng of wild type or mutant PTEN-3′-UTR reporter, or 300 ng of wild type or mutant ARID1A-3′-UTR reporter, 100 ng pGl4.74, and 20 nM miR-222 mimic or anti-miR-222 inhibitor using 1.5 μL Lipofectamine reagent (Invitrogen). [score:3]
Treatment of cells using anti-miR-222 inhibitor decreases cell proliferation, migration, tube formation, and tumor growth. [score:3]
The expression levels of miR-222 were determined using RT-PCR (A) and RT-qPCR (B) in As-T cells and BEAS-2B (B2B) cells. [score:3]
As-T cells were transfected using anti-miR-222 inhibitor with or without ARID1A siRNAs. [score:3]
Similarly, anti-miR-222 inhibitor treatment significantly decreased cell proliferation of NSCLC A549 cells, whereas miR-222 precursor significantly increased cell proliferation of BEAS-2B, the immortal normal bronchial epithelial cells (Figure 2C and 2D). [score:3]
Mimics of miR-222 significantly inhibited the luciferase activity of wild-type ARID1A 3′-UTR reporter in As-T cells and BEAS-2B cells, but did not affect that of ARID1A 3′-UTR mutant reporter with the mutant binding site (Figure 5B and 5C). [score:3]
Compared to the control group, the tumor volume of anti-miR-222 inhibitor group was significantly smaller by Week 2 (P < 0.05, Figure 3A). [score:2]
Stable cell lines, As-T/Anti-miR-NC and As-T/Anti-miR-222 cells were obtained and subcutaneously injected into posterior blanks of BALB/c nude mice, respectively. [score:1]
Figure 5(A) Putative seed-matching sites or mutant sites of ARID1A 3′-UTR region with miR-222. [score:1]
As-T cells were cotransfected with reporter plasmid (PTEN-WT or PTEN-mut) and miR-222 precursor or negative control (miR-NC). [score:1]
Similar results were confirmed using RT-PCR and RT-qPCR analysis, showing 4-fold higher levels of miR-222 in As-T cells than in B2B cells (Figure 1A and 1B). [score:1]
Figure 7(A) As-T/anti-miR-NC, As-T/anti-miR-222 cells, and As-T/anti-miR-222 cells transfected with ARID1A siRNAs or negative control siRNA were cultured for 48 h, and analyzed using specific antibodies as indicated. [score:1]
In this study, we focus on the role and mechanism of miR-222 in mediating tumorigenesis using transformed cells through chronic arsenite exposure. [score:1]
The seed sequence of miR-222 matched 3′-UTR region of ARID1A. [score:1]
As an oncogene, miR-222 increased cell migration and invasion of hepatocellular carcinoma [28]. [score:1]
[1 to 20 of 64 sentences]
5
[+] score: 247
Gastrin induces miR-222 expression in AGS [GR] cellsmiScript miRNA PCR Arrays were used to identify differentially expressed miRNAs between AGS [GR] cells treated with and without 10 nM G17 for 24 h. Three miRNAs showed increased expression and three miRNAs showed decreased expression beyond the 2-fold threshold (Figure 1A). [score:9]
miR-222 overexpression is also associated with reduced expression of VGLL4 in human gastric cancer cell lines and tissues suggesting that miR-222 inhibits the translation of VGLL4 and promotes YAP-TEAD activation, which is sufficient to increase tumor proliferation, epithelial-mesenchymal transition and invasion [45]. [score:9]
In parental AGS cells (not stably transfected with the CCK2R), gastrin treatment had no significant effect on miR-222 expression at concentrations of 0–100 nM for 2–48 h. However in AGS [GR] cells which express the CCK2R, miR-222 expression increased dose and time dependently following gastrin treatment and was maximal after administering 10 nM G17 for 24 h (Figure 1C and 1D). [score:7]
Gastrin -induced miR-222 overexpression decreases the expression of p27 in vitro and in vivo, via the PKC and PI3K pathwaysIn AGS [GR] cells, qPCR primer assays showed that p27 mRNA expression decreased in dose (Figure 4A) and time (Figure 4B) dependent manners following G17 treatment, which was maximal after 10 nM G17 for 24 h. s indicated that AGS [GR] cells incubated with G17 also showed dose (Figure 4C) and time (Figure 4D) dependent decreases in p27 protein expression. [score:7]
Figure 5(A) A chemically synthesised miR-222 mimic significantly reduced p27 mRNA and protein expression (B, D) whereas a chemically synthesised miR-222 inhibitor partially reversed the reduced p27 mRNA and protein expression that was caused by 10 nM G17 treatment for 24 h (C, E) in AGS [GR] cells. [score:7]
In the GI tract, miR-222 is upregulated in cancers of the esophagus, stomach, colon, liver and pancreas and shows decreased expression in cholangiocarcinoma and gastrointestinal stromal tumors (reviewed in [38]). [score:6]
The chemically synthesised miR-222 inhibitor at concentrations > 500 nM also partially reversed the decrease in p27 mRNA and protein expression caused by 10 nM G17 (Figure 5C and 5E). [score:5]
Activation of the CCK2 receptor by gastrin leads to increased miR-222 expression via the PKC and PI3K pathways in AGS [GR] cellsIn order to investigate the signalling mechanisms downstream of CCK2R that were responsible for the observed increase in miR-222 expression, we used known inhibitors of these pathways. [score:5]
Gastrin -induced miR-222 overexpression was almost fully reversed when AGS [GR] cells were pre -treated with Ro-32-0432 (1 μM), LY294002 (20 μM), YM022 (100 nM) and netazepide (100 nM) suggesting that miR-222 expression is increased via activation of the CCK2 receptor and subsequent PKC and PI3K pathways. [score:5]
miR-222 also targets the tumor suppressor PTEN in SGC7901 gastric cancer cells [46]. [score:5]
These data suggest that gastrin stimulates CCK2R activation leading to increased miR-222 expression which in turn decreases p27 mRNA and protein expression via the PKC and PI3K signalling pathways. [score:5]
Gastrin -induced miR-222 overexpression resulted in reduced expression and cytoplasmic mislocalisation of p27 [kip1], which in turn caused actin remo delling and increased migration in AGS [GR] cells. [score:5]
Gastrin -induced miR-222 overexpression decreases the expression of p27 in vitro and in vivo, via the PKC and PI3K pathways. [score:5]
However, there was only a partial reversal caused by the inhibitor of MAPK activation, indicating that this is not the major pathway for miR-222 expression (Figure 1E). [score:5]
Mature miR-222 inhibits the translation of p27 which increases cell migration and epithelial mesenchymal transition in AGS [GR] cells. [score:5]
Further investigation of downstream signalling was performed by pre-treating AGS [GR] cells with and without PKC and PI3K inhibitors followed by activation of PKC via PMA 100 nM for 24 h. The activation of PKC stimulated a significant increase in miR-222 expression which was also significantly, but not completely reversed by pre-treatment with the PI3K inhibitor. [score:5]
Several studies have suggested that miR-222 -induced inhibition of p27 influences tumor development. [score:4]
One of the upregulated miRNAs, miR-222, was further investigated using samples obtained from hypergastrinemic mice and humans and upstream and downstream signalling pathways were defined in AGS [GR] cells using various inhibitor compounds and siRNA approaches. [score:4]
Increased gastrin -induced miR-222 expression leads to increased migration and the extension of long processes in AGS [GR] cells, cellular events which are associated with gastric tumor development. [score:4]
Specifically in the stomach, increased miR-222 expression in H. pylori infected AGS cells post-transcriptionally regulates RECK and promotes cancer-cell growth and invasion [43, 45]. [score:4]
Gastrin -induced miR-222 upregulation appears to be functionally important. [score:4]
Chemically synthesised mimics and inhibitors were used to assess cellular phenotypical changes associated with miR-222 dysregulation. [score:4]
Chemically synthesised miR-222 mimic (MSY0000279), miR-222 inhibitor (MIN0000279), miR-1 mimic positive control (MSY0000416) and miScript negative control (1027271) were all from Qiagen (Sussex, UK). [score:3]
These data indicate that gastrin-CCK2 receptor activation increases miR-222 expression via both the PKC and PI3K pathways in AGS [GR] cells (Figure 1F). [score:3]
miR-222 expression did not significantly change following G17 treatment of untransfected AGS cells (C, D). [score:3]
Gastrin induces miR-222 expression in AGS [GR] cells. [score:3]
In order to investigate the signalling mechanisms downstream of CCK2R that were responsible for the observed increase in miR-222 expression, we used known inhibitors of these pathways. [score:3]
miR-222 expression is increased in the plasma of patients with gastric cancer relative to patients with chronic active gastritis and healthy controls. [score:3]
AGS [GR] cells transfected with a chemically synthesised miR-222 mimic showed a dose dependent decrease in p27 mRNA and protein expression (Figure 5B and 5D); this was significant at miR-22 mimic concentrations > 50 nM. [score:3]
miR-222 expression decreased whilst patients were taking netazepide and returned to baseline after cessation of treatment, in short (12 weeks, C and D) and long (1 year, E and F) term studies. [score:3]
Activation of the CCK2 receptor by gastrin leads to increased miR-222 expression via the PKC and PI3K pathways in AGS [GR] cells. [score:3]
Ro-32-0432 (1 μM) also completely reversed while LY294002 (20 μM) partially reversed the miR-222 overexpression induced by 100 nM PMA treatment of the same cell line for 24 h (F). [score:3]
AGS [GR] cells were transfected with either a chemically synthesised miR-222 mimic (MSY0000279) or inhibitor (MIN0000279), a miR-1 positive control (MSY0000416) or miScript negative control (1027271) for 24–72 h according to the manufacturer's instructions and with the use of HiPerfect transfection reagent (301704)(all from Qiagen). [score:3]
Chemically synthesised miR-222 inhibitors dose dependently reversed the extension of long processes induced by 10 nM G17 in AGS [GR] cells, which was significant after treatment with concentrations > 50 nM (Figure 3F). [score:3]
Increased miR-222 expression results in decreased abundance of p27 mRNA and protein and causes p27 mislocalisation into the cytoplasm. [score:3]
In summary we have demonstrated that miR-222 expression is increased in AGS [GR] cells following G17 treatment and that the abundance of this miRNA is also increased in the gastric mucosa and serum of hypergastrinemic mice and humans. [score:3]
miR-222 has several downstream mRNA targets including p27 [kip1], p57, PUMA, PTEN, Bim and MMP1 (reviewed in [44]). [score:3]
Overexpression of miR-222 occurs in several other malignancies including breast, lung, papillary thyroid, prostate and glioblastoma [33– 37]. [score:3]
miR-222 expression was therefore assessed in FVB/N and transgenic INS-GAS mice on the same genetic background. [score:3]
Whereas miR-222 inhibitors significantly reduced the migration (E) and extension of long processes (F) that were stimulated by 10 nM G17 treatment of AGS [GR] cells, in a dose dependent manner and statistical significance was determined using two-way ANOVA with Sidak post-hoc test. [score:3]
miR-222 expression increases with age in hypergastrinemic INS-GAS mice. [score:3]
miR-222 exerts these effects at least in part by decreasing p27 expression and causing this protein to be mislocalised in the cytoplasm (Figure 8). [score:3]
In conclusion, gastrin induced the expression of miR-222 in CCK2R bearing cells. [score:3]
Similarly, whilst patients were taking netazepide, serum miR-222 expression significantly decreased and returned towards baseline after cessation of treatment (Figure 2D and 2F). [score:3]
miR-222 expression is increased in the serum and gastric corpus of patients with hypergastrinemia and type 1 gastric neuroendocrine tumors, and is significantly reduced by netazepide treatment. [score:3]
miR-222 expression was increased in the serum and gastric corpus mucosa of hypergastrinemic INS-GAS mice and hypergastrinemic patients with autoimmune atrophic gastritis and type 1 gastric NETs; it decreased in patients following treatment with the CCK2R antagonist netazepide (YF476). [score:3]
We also assessed miR-222 expression in both gastric corpus biopsies and serum samples from patients with autoimmune atrophic gastritis, hypergastrinemia and type 1 gastric NETs who had been enrolled on a phase-2 clinical trial to assess the short and long term effects of the CCK2R antagonist netazepide [4]. [score:3]
Gastrin increased miR-222 expression in AGS [GR] cells, with maximum changes observed at 10 nM G17 for 24 h. Signalling occurred via CCK2R and the PKC and PI3K pathways. [score:3]
LY294002 (20 μM), YM022 (100 nM), netazepide (100 nM) and Ro-32-0432 (1 μM) all completely reversed while PD98089 (20 μM) partially reversed the miR-222 overexpression caused by 10 nM G17 treatment of AGS [GR] cells for 24 h (E). [score:3]
The pri(mary)-miR-222 transcript is cleaved by the RNAse II enzyme Drosha into a hairpin structure (pre-miR-222) which is transported from the nucleus to the cytoplasm via exportin-5. Pre-miR-222 is cleaved by a second RNase II enzyme, Dicer, into mature miR-222 which associates with RISC to target imperfect complementary mRNA sequences. [score:3]
miR-222 expression was significantly increased in mucosal scrapings taken from the gastric corpus (A) and in the serum (B) of 30 week old hypergastrinemic INS-GAS mice relative to 30 week old FVB/N mice, with significant differences also being observed between 12 week and 30 week old INS-GAS mice in the serum (n = 10 per group). [score:3]
There was a significant but small increase in miR-222 expression in the gastric corpus biopsies of hypergastrinemic patients before taking netazepide relative to normogastrinemic controls, which significantly decreased whilst patients were taking 50mg netazepide daily and returned to baseline after cessation of treatment, in both the short-term (12-week treatment with 12-week follow-up) and longer-term (12-month treatment) regimens (Figure 2C and 2E). [score:3]
miR-222 expression increased dose and time dependently in AGS [GR] cells and was maximal following treatment with 10nM G17 for 24h in serum free media. [score:3]
miR-222 overexpression increases migration and the extension of long processes in AGS [GR] cellsGastrin has previously been shown to increase the migration of AGS [GR] cells dose dependently after 8 h treatment with concentrations of 30 pM to 3 nM G17 [22]. [score:3]
By contrast, chemically-synthesised miR-222 inhibitors significantly reversed 10 nM G17 induced AGS [GR] cell migration at concentrations 50–100 nM and completely reversed gastrin-stimulated (10 nM) migration at concentration 500 nM (Figure 3E). [score:3]
miR-222 overexpression increases migration and the extension of long processes in AGS [GR] cells. [score:3]
miR-222 expression is also increased in gastric cancer tissue-derived mesenchymal stem cells [41] and in the stomachs of H. pylori infected individuals [42, 43]. [score:3]
miR-222 expression was also significantly increased in the serum of the same hypergastrinemic patients with a 5.7-fold increase in the short-term study and a 5-fold increase in the longer study, when compared to healthy controls. [score:2]
In AGS [GR] cells treated with 10nM G17 compared with untreated controls, miScript miRNA PCR arrays showed 3 miRNAs that increased and 3 miRNAs that decreased in expression beyond the 2-fold threshold, with only miR-222 and miR-376c proving significant. [score:2]
In both gastric corpus biopsies (C, E) and serum samples (D, F) from patients with hypergastrinemia and type 1 gastric neuroendocrine tumors (n = 8), miR-222 expression was significantly higher at baseline compared with normogastrinemic healthy controls who had a normal stomach at endoscopy (n = 10). [score:2]
miR-222 expression was significantly increased in both the gastric mucosal scrapings and serum of 30 week old INS-GAS mice compared with age-matched FVB/N wild-type. [score:2]
Among the miRNAs dysregulated in gastric cancer is miR-222. [score:2]
Chemically synthesised miR-222 mimics at concentrations 10–100 nM also significantly increased AGS [GR] cell migration dose dependently (Figure 3C). [score:1]
However, only miR-376c and miR-222 proved significant with fold changes of 5.2 (P < 0.01) and 2.3 (P < 0.0001) respectively. [score:1]
miR-221 and miR-222 are encoded in tandem from a gene cluster located on chromosome Xp11.3 [32]. [score:1]
Increased amounts of miR-222 were also detected in the gastric mucosa and sera of hypergastrinemic patients with type 1 gastric NETs. [score:1]
Our observation of cytoplasmic mislocalisation of p27 following gastrin treatment is therefore consistent with the increase in migration and change in morphology that was observed in AGS [GR] cells following treatment with gastrin and a miR-222 mimic. [score:1]
Figure 3Scratch wound assays were performed to assess cell migration (A) and scattering assays used to assess the expression of long processes (B) following G17 treatment of AGS [GR] cellsChemically synthesised miR-222 mimics significantly increased migration (C) and the extension of long processes (D) with statistical significance determined using one way ANOVA with Tukey post-hoc test. [score:1]
Chemically synthesised miR-222 mimics significantly increased migration (C) and the extension of long processes (D) with statistical significance determined using one way ANOVA with Tukey post-hoc test. [score:1]
miR-222 may also be a promising biomarker for monitoring gastrin induced premalignant changes in the stomach. [score:1]
Chemically synthesised miR-222 mimics dose dependently increased the extension of long processes in AGS [GR] cells and this was significant at concentrations > 10 nM (Figure 3D). [score:1]
Further work is however needed to investigate whether increased serum miR-222 abundance is specific to patients with type 1 gastric NETs or whether it is also increased in patients who have other causes for hypergastrinemia such as long-term proton pump inhibitor use. [score:1]
miR-222 has been shown to bind to the 3′ end of the p27 locus [48]. [score:1]
miR-222 transcription is increased via the PKC and PI3K pathways and partially via the MAPK pathway. [score:1]
One of the best characterised downstream targets of miR-222 is p27 [kip1] (p27). [score:1]
[1 to 20 of 75 sentences]
6
[+] score: 232
Furthermore, given the prominent inhibitory effect of miR-222-5p mimics on αSMA expression both at the gene expression and the protein levels, it was postulated that αSMA 3′-UTR might be directly targeted by miR-222-5p. [score:10]
Collectively, the evidence implies that miR-222-5p could directly target αSMA 3′-UTR and lead to down-regulation of αSMA both at the gene expression and the protein level. [score:9]
Dual transfection of the plasmid encoding αSMA 3′-UTR sequence and miR-222-5p mimics into HEK293 cells revealed that miR-222-5p mimics inhibited αSMA 3′-UTR, and the mutation of the target site within the 3′-UTR rescued the inhibition to a certain degree (Fig. 8 D). [score:8]
D, dual transfection of plasmids and miR-222-5p into HEK293 cells demonstrated the inhibition of miR-222-5p on the 3′-UTR of αSMA, and mutation of the predicted target site recovered the inhibition. [score:8]
After establishing that miR-222-5p mimics decreased ROCK2 expression and ROCK2 played a functional role in promoting SMC differentiation, we explored whether miR-222-5p could inhibit ROCK2 through direct targeting of ROCK2 3′-UTR. [score:8]
Thus far, we established that the up-regulation of miR-503 and the down-regulation of miR-222-5p both regulate MSC to SMC differentiation. [score:8]
However, the mutation of the target site complementary to the 5′-end of the miRNA did not consistently recover the inhibition of the miR-222-5p on plasmids containing αSMA 3′-UTR, implying that the site complementary to the 3′-end might also have some effect in inducing the complementary binding of miR-222-5p to αSMA 3′-UTR and promoting the inhibitory effect. [score:8]
Consistent with the microRNA array results, the up-regulation of miR-503-5p and the down-regulation of miR-222-5p were time -dependent (Fig. 3 A). [score:7]
Furthermore, target site mutation experiments confirmed that αSMA 3′-UTR might be a direct target of miR-222-5p. [score:7]
During SMC differentiation, miR-222-5p down-regulation might work together with miR-503 up-regulation. [score:7]
It was established in our study that miR-503 targets SMAD7 to promote MSC to SMC differentiation, and miR-222-5p targets ROCK2 to inhibit the differentiation process. [score:7]
Increased level of miR-222-5p prompted the down-regulation of SMC markers, including calponin and αSMA both in the mRNA expression by Q-PCR (Fig. 6 B) and at the protein level by and immunofluorescent staining (Fig. 6, C and D). [score:6]
The postulation that downstream targets of miR-222-5p may also regulate miR-503 expression would merit further examination. [score:6]
Q-PCR analysis showed the down-regulation of ROCK2 mRNA expression 1 day after miR-222-5p mimic treatment (Fig. 7 B). [score:6]
Furthermore, the mechanistic study implied that miR-503 mimics or miR-222-5p inhibitors carry the potential to improve the performance of these vascular grafts through enhancing SMC differentiation from MSCs while avoiding possible off-target effects from the use of TGFβ1. [score:5]
Although they target different pathways regulating SMC differentiation, whether miR-503 and miR-222-5p directly interact with each other merited further examination. [score:5]
This suggested that miR-222-5p could affect the expression of miR-503, but miR-503 does not interfere with the expression of miR-222-5p. [score:5]
Furthermore, the expression of miR-503 could be inhibited by miR-222-5p. [score:5]
Taken together, ROCK2 expression increased in a time -dependent manner during differentiation and could be inhibited by miR-222-5p mimic treatment. [score:5]
with insertions of either αSMA 3′-UTR sequence or mutated sequence at predicted complementary sites were then utilized to validate whether 3′-UTR of αSMA mRNA could be directly targeted by miR-222-5p. [score:4]
A, alignment of miR-222-5p and ROCK2 3′-UTR showed the postulated target -binding sites (red) and induced mutations (blue). [score:4]
Figure 8. 3′-UTRs of ROCK2 and αSMA were direct targets of miR-222-5p. [score:4]
The level of miR-222-5p was down-regulated in the differentiation process. [score:4]
However, only the mature strand was examined in the study, whereas the down-regulated miR-222-5p during SMC differentiation in our experimental system is the passenger strand, in which role has not yet been established. [score:4]
” It was revealed that ROCK2 contains two putative seed sites that strongly implied that it might be directly targeted by miR-222-5p. [score:4]
Therefore, we concluded that ROCK2 3′-UTR is a direct target of miR-222-5p. [score:4]
miR-222-5p mimic transfection resulted in miR-503 down-regulation. [score:4]
ROCK2 was shown to be a direct target of miR-222-5p in our study. [score:4]
B, alignment of miR-222-5p and the 3′-UTR of αSMA showed the postulated target -binding sites (red) and induced mutations (blue). [score:4]
3′-UTR segments of ROCK2 and αSMA are direct targets of miR-222-5p. [score:4]
miR-222-5p inhibits SMC differentiation. [score:3]
However, 24 h after transfection of the miR-222-5p mimic in MSCs, the level of miR-503 was significantly down-regulated as shown by TaqMan microRNA assay (Fig. 8 E). [score:3]
Thus, components of both pathways were examined for potential miR-222-5p targets. [score:3]
ROCK2 3′-UTR contains two target -binding sites (site 1 and site 2) of miR-222-5p, which were mutated alone (m1, m2) or together (m1+ m2). [score:3]
ROCK2 was also inhibited at the mRNA level with miR-222-5p mimic treatment in human adipose tissue-derived MSCs (Fig. S4 C). [score:3]
C, co-transfection of miR-222-5p mimics and reporter plasmid with WT ROCK2 3′-UTR showed reduced relative luciferase activity as compared with vector with empty plasmid, whereas mutation of both target -binding sites (m1+ m2) recovered the reduction. [score:3]
The results above demonstrated the capacity of miR-222-5p mimics in inhibiting SMC differentiation. [score:3]
B, miR-222-5p mimic treatment in αMEM with 1% FBS and 5 ng/ml TGFβ1 for 2 days inhibited the level of ROCK2 mRNA as shown by Q-PCR. [score:3]
The implication from our in vitro study is that miR-503 mimics and miR-222-5p inhibitors may have the potential to augment the performance of vascular grafts by promoting the differentiation of stem cells toward SMCs. [score:3]
Figure 7. ROCK2 3′-UTR is a potential target of miR-222-5p. [score:3]
Induction of SMC markers was also shown with miR-222-5p inhibitor treatment; however, the effect is moderate (Fig. S5), possibly due to the already significantly reduced level of miR-222-5p in the differentiation process. [score:3]
We also showed that miR-503 was regulated by miR-222-5p. [score:2]
The lack of complementary sequence between miR-503 and miR-222-5p suggests that they are unlikely to directly bind to each other (data not shown). [score:2]
E, level of miR-503 was inhibited by miR-222-5p mimic treatment after 1 day as shown with TaqMan microRNA assay. [score:2]
However, to date, there is no report available on the direct relation between miR-222 and the TGFβ1-signaling pathway. [score:2]
Finally, miRNA-centered mechanisms involved in the differentiation process into SMCs were elucidated with the identification of novel regulatory miRNAs (miR-503-5p and miR-222-5p). [score:2]
Data were obtained from at least three independent experiments and shown as mean ± S. D. *, p < 0.05; **, p < 0.01; and ***, p < 0.001. mim ctrl, miRNA mimic negative control; mim 222-5p, miR-222-5p mimic. [score:1]
C, and analysis of ROCK2 after miR-222-5p mimic treatment in αMEM with 1% FBS and 5 ng/ml TGFβ1 for 2 days. [score:1]
); miR-222-5p mimic (4464066 MC12656, Life Technologies, Inc. [score:1]
miR-222 participates in numerous physiological and pathophysiological conditions, including cancer progression (41), skeletal muscle regeneration (42), and vascular remo deling (43). [score:1]
Data were obtained from at least three independent experiments and shown as mean ± S. D. *, p < 0.05; **, p < 0.01, and ***, p < 0.001. mim ctrl, miRNA mimic negative control; mim 222-5p, miR-222-5p mimic, si ctrl, siRNA negative control; si ROCK2, siRNA ROCK2. [score:1]
miR-222, which belongs to the same miRNA family as miR-221, was identified as an important modulator in platelet-derived growth factor–induced SMC phenotypic change (23). [score:1]
To test this hypothesis, the sequence of miR-222-5p was aligned with αSMA mRNA, and complementarity was found at both the 5′- and 3′-end of miR-222-5p with the 3′-UTR of αSMA mRNA (Fig. 8 B). [score:1]
In our stem cell to SMC differentiation system, miR-222-5p, which is the passenger strand of miR-222, was examined. [score:1]
On the contrary, 24 h after transfection of miR-503 mimic in MSCs, the level of miR-222-5p was not affected (Fig. 8 F). [score:1]
In addition, the mature strand miR-222-3p was examined in most studies. [score:1]
Although the passenger strand of miR-222 (i. e. miR-222-5p) was wi dely accepted to be destined for degradation without any function after maturation, recent studies have begun to depict the pathological importance of passenger strands of miRNAs (24, 25). [score:1]
Interaction of miR-503 and miR-222-5p. [score:1]
The success of miRNA mimic transfection was confirmed by the significant increase of miR-222-5p levels (Fig. 6 A). [score:1]
3′-UTR sequences of selected genes were subjected to screening for the putative seed site of miR-222-5p, “CTACTGA. [score:1]
D, immunofluorescent staining showed the intensity of SMC markers (calponin and αSMA) after miR-222-5p treatment for 2 days. [score:1]
[1 to 20 of 61 sentences]
7
[+] score: 220
Other miRNAs from this paper: hsa-mir-221, hsa-mir-339, hsa-mir-590
Remarkably, knockdown of ADAR1 resulted in a 4-fold up-regulation of hsa-miR-222 (Figure 4A), while over -expression of ADAR1 reduced hsa-miR-222 expression by more than 2-fold (Figure 4B). [score:9]
Forced expression of miR-222 with ICAM1 UTR construct significantly inhibited the luciferase activity, while the inhibitory effect was abolished when the ICAM1 UTR MUT construct was tested (Figure 5I). [score:7]
Over -expression of ADAR1 reduced the activity of the miR-222 promoter (Figure 7D), suggesting transcriptional regulation of miR-222 expression. [score:6]
At the protein level, over -expression of miR-222 led to the down-regulation of ICAM1 (Figure 5E), but not of another adhesion molecule, CEACAM1 (Supplementary Figure S2B). [score:6]
Similar results were obtained when validating the expression of miR-222 by qRT-PCR in 22 melanoma tissues (CB, n = 7 and NB, n = 15), suggesting that miR-222 expression may be useful as a marker for prediction to response to ipilimumab. [score:5]
These results suggest that ADAR1 controls ICAM1 expression at the translation level via miR-222, and thereby the immune resistance phenotype of melanoma cells. [score:5]
We show that ADAR1 affects miR-221 and miR-222 expression but not miR-339 expression. [score:5]
Figure 4Expression levels of hsa-miR-222, hsa-miR-221 and hsa-miR-339 in ADAR1-KD and Scramble cells A, C, E. and ADAR1-p110 and Mock cells B, D, F. were assessed by qRT-PCR and normalized to U6 expression. [score:5]
B. Expression levels of hsa-miR-222 in ΔCAT-S and Mock cells were assessed by qRT-PCR and normalized to U6 expression. [score:5]
Since high concentrations of α-ICAM1 Ab led to reduced killing also in miR-222 OX cells, and as microRNAs can modulate the expression of hundreds of different mRNAs [49], it is reasonable to assume that miR-222 targets additional proteins that can potentially affect immune resistance, together with ICAM1. [score:5]
Interestingly, at this antibody concentration, blocking of ICAM1 yielded a similar inhibitory effect as miR-222 over -expression (Figure 5J). [score:5]
Expression levels of pri-miR-222 in ADAR1-KD and scramble cells (A); ADAR1-p110 and Mock cells (B); and ΔCAT-S and Mock cells (C) were assessed by qRT-PCR and normalized to HPRT expression. [score:5]
miR-222 suppresses ICAM1 expression at the protein level and enhances immune resistance. [score:5]
Expression levels of hsa-miR-222, hsa-miR-221 and hsa-miR-339 in ADAR1-KD and Scramble cells A, C, E. and ADAR1-p110 and Mock cells B, D, F. were assessed by qRT-PCR and normalized to U6 expression. [score:5]
These findings concur with a previous work showing that inhibition of miR-222 in glioma cells leads to recovery of ICAM1 expression and promotes their susceptibility to cytotoxic T-cells [28]. [score:5]
Recent reports indicate that miR-221, miR-222 and miR-339 directly target ICAM1 [28, 29, 43]. [score:4]
Expression levels of hsa-miR-222 were significantly lower (Figure 6B) and ICAM1 protein expression was higher (Figure 6C), as compared to control. [score:4]
We show that ADAR1, in an editing-independent manner, transcriptionally regulates the biogenesis of miR-222 and thereby Intercellular Adhesion Molecule 1 (ICAM1) expression, which consequently affects melanoma immune resistance. [score:4]
These results reinforce our previous results (Figure 5E, 5F), suggesting that ICAM1 is a direct target of miR-222 but not of miR-221. [score:4]
Discerning between two possible mechanisms may not be simplistic: a) lower miR-222 in patients benefiting from ipilimumab is secondary to primary tumor immunogenicity leading to a more inflammatory environment (e. g. IFN) that upregulates ADAR1, causing the reduction observed in miR-222. [score:4]
ADAR1 regulates miR-222 and miR-221 expression. [score:4]
Previous reports have shown that PLZF [47] and proto-oncogene ETS-1 [53] are transcriptional regulators of miR-222 in melanoma by direct binding to its putative regulatory region. [score:4]
ADAR1 regulates miR-222 expression. [score:4]
miR-222 expression predicts response to ipilimumab. [score:3]
Pri-miR-222 expression following immunoprecipitation was assessed by qRT-PCR. [score:3]
ICAM1 mRNA levels in miR-222 OX, miR-221 OX and pQCXIP cells were assessed by qRT-PCR and normalized to GAPDH expression. [score:3]
The expression of hsa-miR-222 in melanoma tissues of NB patients was 2.3-fold higher (p-value = 0.001) than in CB patients (Table 1). [score:3]
Moreover, we show that miR-222 expression in melanoma may serve as a biomarker for prediction to response to immunotherapy, such as ipilimumab. [score:3]
Others have shown that miR-222 expression increases along with melanoma progression, to induce a more tumorigenic phenotype [47]. [score:3]
Therefore our finding that low miR-222 expression pre-treatment is associated with benefit from ipilimumab fits the currently available data and provides a mechanistic insight with clinical relevance. [score:3]
Our system failed to show direct binding of ADAR1 to pri-miR-222 suggesting that ADAR1 affects the transcription of miR-222 indirectly. [score:3]
These observations were similar to the results of the mature miR-222 expression (Figures 4A, 4B). [score:3]
Together with the new mechanistic findings presented in this report, ADAR1 and miR-222 may serve as good targets for the treatment of melanoma. [score:3]
Our results show that ADAR1 affects miR-222 expression at the pri-miR stage (Figures 7A, 7B). [score:3]
Blocking of ICAM1 in miR-222-OX cell system suggests that at least part of the inhibitory effect conferred by miR-222 is mediated by ICAM1. [score:3]
This could probably further enhance ICAM1 and facilitate the inflammatory environment; b) primary lower miR-222 levels lead to better recognition of melanoma cells by infiltrating lymphocytes due to higher ICAM1 expression, leading to secondary enhanced inflammatory signature. [score:3]
Experiments conducted with ADAR1 construct lacking the catalytic domain (ΔCAT-S) show that ADAR1 affects pri-miR-222 and subsequently miR-222 expression independently of its editing properties. [score:3]
Indeed, miR-222 was expressed at significantly higher levels (2.3 folds) in tumors from patients who did not benefit from ipilimumab. [score:3]
miR-222 was the only miR, out of the 1105 tested, that was differentially expressed (fold change > = 2) in a statistically significant manner. [score:3]
After 48 h, RNA was extracted from one culture dish using Tri Reagent (Sigma-Aldrich) in order to assess ADAR1, CEACAM1 and pri-miR-222 expression by qRT-PCR as described above. [score:3]
Moreover, the expression of pri-miR-222 was lower in ΔCAT-S cells as compared to control (Figure 7C), suggesting an RNA-editing independent regulation. [score:3]
Thus, our conclusions and proposed mechanistic link between ADAR1-miR-222-ICAM1 and immune resistance are based on comparison to the appropriate controls using the same cells and vectors, dose -dependent antibody blocking and effector-to-target ratios. [score:3]
Moreover, it is suggested that despite identical seed region, miR-222 and miR-221 have distinct target gene profiles. [score:3]
ICAM1 protein expression in miR-222 OX (dotted line) (E), miR-221 OX (dotted line) (F) and pQCXIP (black line) cells was analyzed by extracellular flow cytometry staining. [score:3]
Three point mutations were inserted into the predicted binding site of miR-221 and miR-222 (ICAM1 UTR MUT) using QuikChange Site-Directed Mutagenesis Kit (Stratagene, cat#200518), according to manufacturer's protocol. [score:3]
Functionally, over -expression of miR-222, but not miR-221, rendered the melanoma cells more resistant to TIL mediated killing, as compared to control (Figures 5G, 5H). [score:2]
In the current work, dual luciferase assays showed that ICAM1 is indeed a target of miR-222 but not of miR-221 (Figure 5I), despite their shared seed region. [score:2]
ADAR1 transcriptionally regulates miR-222 processing at the pri-miR level. [score:2]
Taken together, these results support an important role for ICAM1 in the immune resistance conferred by ADAR1-regulated miR-222, but not by miR-221. [score:2]
In line with previous reports [28, 43], transfection of miR-222 precursor into melanoma cells reduced ICAM1 at the post-transcriptional level (Figure 5E) and enhanced the resistance to TIL -mediated killing (Figure 5G), similar to the effect of ADAR1 knockdown. [score:2]
Expression levels of pri-miR-222 were significantly higher in ADAR1-KD cells (Figure 7A) and lower in ADAR1-p110 (Figure 7B), as compared to controls. [score:2]
Nonetheless, our negative results could be a result of technical obstacles and thus direct binding of ADAR1 to pri-miR-222 cannot be completely excluded. [score:2]
It was previously suggested that ICAM1 is regulated by miR-222 and miR-339 in colorectal cancer cells and glioma cells [28] and by miR-221 in cholangiocytes [29]. [score:2]
Direct binding of ADAR1 to pri-miR-222 could not be demonstrated over wide range of experimental parameters of PCR amplification after immunoprecipitation of ADAR1 (data not shown). [score:2]
To confirm direct regulation of ICAM1 by miR-222 but not miR-221, we performed a set of dual luciferase assays. [score:2]
ADAR1 transcriptionally regulates miR-222. [score:2]
624mel cells were stably transfected with miR-222 precursor (miR-222 OX; Figure 5A), miR-221 precursor (miR-221 OX; Figure 5B) or empty vector (pQCXIP). [score:1]
However, we couldn't find any editing events in the pri-miR-222 sequence. [score:1]
miR-222 OX or miR-221 OX cells and pQCXIP cells were co-incubated in different E:T ratios with JKF6 or TIL52 for 5 h or overnight. [score:1]
Only when we used an even higher concentration of 10 μg/ml α-ICAM1, a reduction in killing rates was observed also in miR-222-OX cells (Figure 5J). [score:1]
I. 293T cells were co -transfected with miR-222, mir-221 or control (pQCXIP empty vector) constructs and with ICAM1 UTR or ICAM1 UTR MUT which is mutated at the predicted binding site of miR-221 and miR-222. [score:1]
We show that miR-222 retrospectively differentiates between patients that benefited from treatment with ipilimumab from patients that did not. [score:1]
These results suggest that miR-222 may serve as a reliable biomarker for the prediction of response to ipilimumab. [score:1]
Briefly, 293T cells were seeded in five 10cm culture dishes and transfected with ADAR1 or Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) constructs together with miR-222 precursor construct. [score:1]
293T cells were co -transfected with Turbofect (Fermentas) and with (a) 200 ng of miR-221, miR-222, or pQCXIP empty vector (as control); and (b) 20 ng of ICAM1 UTR, ICAM1 UTR MUT or psiCheck2-empty vector. [score:1]
The miR-222 and miR-221 precursors constructs were subcloned into pQCXIP. [score:1]
Several cell systems (e. g., ADAR1-KD, ADAR1-p110, miR-222 OX etc. ) [score:1]
624mel cells were transfected with miR-222 precursor, mir-221 precursor or control (pQCXIP) plasmid. [score:1]
A DNA fragment containing the putative promoter of miR-222 (∼2000bp upstream of pre-miR-222) was amplified and cloned into pGL4.14 vector (Promega). [score:1]
293T cells were co -transfected with miR-222, miR-221 or pQCXIP empty vector as control and with ICAM1 UTR, ICAM1 UTR MUT or psiCheck2 empty vector. [score:1]
J. miR-222 OX and pQCXIP cells were incubated with different concentrations of IgG1 control (isotype) or ICAM1 antibody. [score:1]
Sequencing of PCR-amplified pri-miR-222, from which the mature miR-222 is derived, did not reveal any A-to-I RNA editing sites or any sequence differences among the various ADAR1-manipulated cells. [score:1]
293T cells were transfected with Turbofect (Fermentas) according to manufacturer's instructions and (a) 180ng ADAR1-p110 or Mock construct; (b) 18ng of pGL4.14 empty or pGL4.14 containing miR-222 putative promoter and; (c) 4ng Renilla. [score:1]
[1 to 20 of 73 sentences]
8
[+] score: 190
Figure 3Determination of the expression of PUMA and Bcl-2 in UM1 cells with treatment of As-miR-222 and CDDP by immunofluorescence confocal microscopy; (A) Images showed that PUMA was overexpressed with treatment of As-miR-222 and CDDP in UM1 cells; (B) The expression of Bcl-2 exhibited an opposite trend compared with PUMA expression; (C) Relative expression of PUMA and Bcl-2; (D) miR-222 expression as control, detected by RT-PCR. [score:12]
To validate whether PUMA is a direct target of miR-222, we transfected PUMA 3'UTR and mutPUMA 3'UTR luciferase constructs into 293T cells with mimics NC, miR-222 mimics, inhibitor NC (negative control) or miR-222 inhibitor. [score:8]
Some studies found that MET up-regulated miR-222 expression by targeting PTEN and TIMP3, enhanced tumorigenicity and conferred resistance to Trail -induced cell death of liver and lung cancer cells [27]. [score:8]
In our study, up-regulation of PUMA and down-regulation of Bcl-2 in UM1 cells were observed with the treatment of As-miR-222 and CDDP. [score:7]
Analysis of our recent data showed that PUMA was a direct target of miR-222 in OSCC, and that miR-222 could regulate the cell biological behavior of UM1 and Tca8113 by targeting PUMA [13]. [score:7]
In contrast, the expression of Bcl-2 in the CDDP, As-miR-222 and As-miR-222/CDDP groups was down-regulated relative to that in the control and mixed groups. [score:6]
In this study, we chose the UM1 cell line due to its stable performance and demonstrated, for the first time, that the down-regulation of miR-222 expression by As-miR-222 contributed to sensitizing UM1 cells to CDDP. [score:6]
The results showed that As-miR-222/CDDP can up-regulate PUMA protein expression and lead to apoptosis in UM1 cells. [score:6]
Our results indicated that the down-regulation of miR-222 could improve the sensitization of oral squamous cell carcinoma UM1 cells to CDDP by boosting the expression of the PUMA gene. [score:6]
It is worth noting that CDDP alone also down-regulated the expression of miR-222, and that the lowest level of miR-222 was achieved by transfection with As-miR-222 in combination with CDDP therapy. [score:6]
These findings showed that inhibition of miR-222 might form a novel therapeutic strategy, not only to sensitize tumor cells to drug-inducing apoptosis but also to inhibit their proliferation, survival and invasive capabilities. [score:5]
Another study demonstrated that miR-222 could regulate cell invasion, growth and radiosensitivity of gastric cells through directly modulating PTEN expression [28, 29, 30]. [score:5]
In contrast, confocal images showed that the expression of Bcl-2 in the CDDP, As-miR-222 and As-miR-222/CDDP groups was significantly down-regulated compared with that in the control group (Figure 3B). [score:5]
In contrast, Bcl-2 exhibited an opposite trend; (B) Relative expressions of PUMA, Bcl-2, Bax and Bak were quantified by Image J Instrument software after normalization with the density of GAPDH; and (C) miR-222 expression as control detected by RT-PCR. [score:5]
These findings suggest that PUMA is a novel target of miR-222 and that miR-222 could be a critical therapeutic target for OSCC intervention. [score:5]
Jiang F. Zhao W. Zhou L. Zhang L. Liu Z. Yu D. miR-222 regulates the cell biological behavior of oral squamous cell carcinoma by targeting PUMA Oncol. [score:4]
In the present study, we identified miR-222 as a potent regulator of PUMA and aimed to explore whether suppression of miR-222 could enhance the chemotherapeutic effect of cisplatin (CDDP) on OSCC UM1 cells. [score:4]
As a member of oncomiRs, miR-222 was frequently up-regulated in various types of human malignancies and has been associated with cell proliferation, invasion, migration and apoptotic ability in a variety of tumors. [score:4]
These results indicated that the modulation of miR-222 activity could regulate the expression of PUMA gene and improve sensitization of OSCC cells to CDDP and might represent a novel approach for treating OSCC. [score:4]
As shown in Figure 1, the expression of miR-222 was verified by RT-PCR. [score:3]
We also found that PUMA 3'UTR mRNA existed in highly conserved miR-222 binding sites and further validated that PUMA was a direct target of miR-222 by luciferase reporter assay. [score:3]
Figure 4A shows that the CDDP concentration causing 50% growth inhibition (IC [50]) of UM1 cells was 0.725 μg/mL, whereas, in combination with As-miR-222, the IC [50] was 0.249 μg/mL. [score:3]
Figure 6 PUMA was identified as a target gene of miR-222. [score:3]
Zhang C. Z. Zhang J. X. Zhang A. L. Shi Z. D. Han L. Jia Z. F. Yang W. D. Wang G. X. Jiang T. You Y. P. MiR-221 and miR-222 target PUMA to induce cell survival in glioblastoma Mol. [score:3]
After immunofluorescence staining, confocal images of UM1 cells showed high red fluorescence of PUMA in the CDDP, As-miR-222 and As-miR-222/CDDP groups; however, the control and mixed groups exhibited relatively low red fluorescence, suggesting weaker expression of PUMA (Figure 3A). [score:3]
Figure 1RT-PCR analysis of miR-222 and PUMA expression in UM1 cells treated with CDDP and As-miR-222 combination. [score:3]
As-miR-222 and CDDP inhibit cancer cell proliferation and induce cancer cell apoptosis. [score:3]
As-miR-222 and CDDP altered apoptotic protein expression, and the expression of apoptosis-related proteins (PUMA, Bcl-2, Bax and Bak) was measured by Western blot to explore the molecular mechanism of miR-222 involvement in UM1 cell apoptosis. [score:3]
The results suggest that PUMA is directly regulated by miR-222 in OSCC cells. [score:3]
As-miR-222 and CDDP Alters Apoptotic Protein Expression. [score:3]
In the present study, the luciferase reporter assay validated that PUMA was a direct target of miR-222. [score:3]
Figure 2Expression of PUMA, Bcl-2, Bax and Bak in UM1 cells with treatment of As-miR-222 and CDDP. [score:3]
As a member of oncomiRs, miR-222 has been shown to drive the oncogenesis of several malignancies [10, 11, 12], and some results have indicated that suppression of miR-222 in human epithelial cancers leads to the repression of cell growth and increasing apoptosis, which could enhance the chemotherapeutic effects of cancer therapy [12]. [score:3]
Analysis of the data indicated that As-miR-222 and CDDP could induce UM1 cell apoptosis through activation of PUMA and passivation of Bcl-2. We performed immunofluorescence staining to determine the expression of PUMA and Bcl-2 in UM1 cells and examined cells using laser scanning confocal microscopy. [score:3]
We also found that the combination of As-miR-222 transfection with the treatment of CDDP could significantly inhibit the growth of UM1 cells by reducing proliferation and promoting apoptosis. [score:3]
As-miR-222 Increases the Cytotoxicity of CDDP on UM1 Cells and Inhibited Cell Proliferation and Invasion. [score:3]
2.1. miR-222 and PUMA Expression in UM1 Cells Treated with Combination Therapy. [score:3]
Apoptosis assays were used to test whether As-miR-222 or CDDP inhibited cell proliferation through the induction of cell apoptosis. [score:2]
2.6. miR-222 Acts Directly on PUMA mRNA 3'UTR. [score:2]
The 293T cells which obtained from American Type Culture Collection (Rockvill, MD, USA) were co -transfected with pMIR vectors containing PUMA 3'UTR or mut PUMA 3'UTR and miR-222 mimics. [score:1]
UM1 cells (1 × 10 [4]) were transferred to 8-μm-pore inserts after treatment with As-miR-222 and CDDP, and then placed in wells that contained medium with 10% FBS. [score:1]
Figure 4Effect of As-miR-222 on the chemosensitivity of UM1 cells to CDDP treatment and on cell proliferation and invasion. [score:1]
Figure 5As-miR-222 and CDDP induced UM1 cell apoptosis. [score:1]
These findings also provided new rationales for novel combinational therapies using As-miR-222 to cooperate synergistically with CDDP in patients with OSCC. [score:1]
The results suggested that As-miR-222 could increase UM1 cell sensitivity to CDDP treatment and decrease cell proliferation. [score:1]
After treatment for two days, cells were divided into five groups, including control, mixed, As-miR-222, CDDP and As-miR-222/CDDP, which were used for further analysis. [score:1]
Dose-response curves were performed for both single CDDP and in combination with As-miR-222. [score:1]
As shown in Figure 2, a significant increase of PUMA was observed in UM1 cells in the CDDP, As-miR-222 and As-miR-222/CDDP groups, especially in the As-miR-222/CDDP group. [score:1]
UM1 cells were seeded in 24-well plates with 12-mm-diameter cover slips and incubated for 24 h. Cells were then treated with As-miR-222 or CDDP for the indicated time. [score:1]
Several reports have indicated that miR-222 could be used as a therapeutic tool to modulate sensitivity or resistance to anti-cancer agents. [score:1]
Analysis of our dose-response data showed that As-miR-222 led to an increased sensitivity of UM1 cells to CDDP. [score:1]
As-miR-222 and CDDP Induced UM1 Cell Apoptosis. [score:1]
The oligonucleotides were modified by 2'-OMe to obtain the following sequences: As-miR-222, 5'-ACCCAGUAGCCAGAUGUAGCU-3'; and scramble sequences, 5'-CAGUACUUUUGUGUAGUACAA-3'. [score:1]
These findings suggested that a combination of As-miR-222 and CDDP could be an effective therapeutic strategy for the treatment of OSCC. [score:1]
After treatment with As-miR-222 and CDDP, both attached and floating cells were collected and washed with cold PBS and then re-suspended in buffer at a concentration of 10 [6]/mL. [score:1]
Once they were 60% confluent, As-miR-222 and mixed sequences were transfected with Lipofectamine™ RNAiMAX (Invitrogen, Carlsbad, CA, USA) according to the protocol. [score:1]
Meanwhile, CDDP could also increase the efficacy of As-miR-222. [score:1]
In As-miR-222, CDDP and As-miR-222/CDDP groups, a marked increase of PUMA was observed. [score:1]
[1 to 20 of 58 sentences]
9
[+] score: 182
Other miRNAs from this paper: hsa-mir-221, hsa-mir-143, hsa-mir-145
miR-221/miR-222 inhibition of p57 [KIP2] expression in LCLs requires EBNA3A and EBNA3CMiR-221 and miR-222 have been described as oncogenic miRs (oncomirs) because they are often expressed at high levels in cancer (see ). [score:7]
A well-established target of miR-221/miR-222 is the cyclin -dependent kinase (CDK) inhibitor p57 [KIP2], which, because it can inactivate various CDKs, can inhibit cell proliferation—but might have additional functions in B cells. [score:7]
For comparison we also analysed expression of the related CDKI, p21 [CIP1] (not known to be a miR-221/miR-222 target) and found no change when the miRs were inhibited. [score:7]
EBNA3A and EBNA3C both up-regulate miR-221 and miR-222 expression after their activation in the conditional LCLs. [score:6]
The activation of both EBNA3A and EBNA3C through addition of 4HT not only up-regulates the pri-miR-221/222, but also increases the expression of the mature miR-221 and miR-222 in these cells (S6 Fig). [score:6]
A relatively unbiased screen of human microRNAs (miRs) revealed that in EBV-transformed B cells, a miR cluster, miR-221/miR-222, that is frequently up-regulated in cancer, is induced by the latent EBV only if the viral nuclear proteins EBNA3A and EBNA3C are both expressed. [score:6]
In contrast to miR-143/miR-145, functions of the miR-221/miR-222 cluster is relatively well characterised, with wide agreement that two of the major targets are mRNAs for CIP/KIP CDKIs p57 [KIP2] and p27 [KIP1], the translation of which are robustly inhibited by these miRs in various types of cell (see ). [score:5]
In contrast to miR-221/miR-222, miR-143 and miR-145 are tumour suppressor miRs that have been reported to inhibit the proliferation of many cancer-and non-cancer-derived cell lines. [score:5]
MiR-221 and miR-222 are highly conserved, co-expressed miRs encoded as a cluster located on chromosome X and have been reported to be overexpressed in many types of cancer [43], including thyroid carcinoma [44], glioblastoma [45], prostate carcinoma [46, 47], bladder cancer [48], pancreatic cancer [49], hepatocellular carcinoma [50], acute myeloid leukemia [51] and diffuse large B cell lymphoma [52, 53, 54]. [score:5]
Here repression of protein expression is not directed at the transcription of the genes for p57 [KIP2] (CDKN1C) and p27 [KIP1] (CDKN1B), but is post-transcriptional and mediated by the miR-221/miR-222 cluster that is directly transactivated by EBNA3A and EBNA3C. [score:5]
Since intrinsic cell cycle inhibitors are emerging as important targets of EBNA3A and EBNA3C, we focused on the consequences of miR-221/miR-222 induction in LCLs. [score:5]
Consistently, failure to express EBNA3A resulted in a large reduction in miR-221 and miR-222 expression (Fig 1A and S1 Fig). [score:5]
It has been previously reported that EBV can induce expression of miR-221/miR-222 [80, 81] and that the latency -associated protein LMP1 can activate miR-221/miR-222 expression after single gene transfer into BL-derived cells [82]. [score:5]
This has revealed that both EBNA3A and EBNA3C –but not EBNA3B –are required for the transactivation of the oncomiRs miR-221 and miR-222, while concurrently silencing the expression of the tumour suppressor miR-143/miR-145 cluster. [score:5]
Taken together these data are consistent with increased miR-221/miR-222 expression occurring when EBNA3A and EBNA3C are expressed in an active form, bind chromatin at specific sites and alter the epigenetic profile of the locus. [score:5]
miR-221/miR-222 inhibition of p57 [KIP2] expression in LCLs requires EBNA3A and EBNA3C. [score:5]
Further characterisation revealed that up-regulation of miR-221/miR-222 –resulting from the transactivation of a 28kb long non-coding pri-miR—was associated with almost complete ablation of p57 [KIP2] expression in EBV-infected B cells. [score:4]
Here—following a relatively unbiased array screen for miRs regulated by EBNA3A and/or EBNA3C in the context of latent infection with EBV—we identified the oncogenic miR-221/miR-222 cluster as being activated and the tumor suppressor miR-143/miR-145 cluster as being repressed by EBNA3A together with EBNA3C. [score:4]
In our miR inhibition assay (Fig 10) we showed that p27 [KIP1] increased after miR-221 inhibition but not miR-222. [score:4]
MiR-221 and miR-222 have been described as oncogenic miRs (oncomirs) because they are often expressed at high levels in cancer (see ). [score:3]
1005031.g001 Fig 1(A) MiR-221 and miR-222 expression in four independent LCLs EBNA3A- KO and EBNA3A-REV (D1, D2, D3 and D4) as well as two p16 -null LCL 3CHT (A2 and C1) cultured for 29 days with (+HT) or without 4HT (Washed) were determined by real time quantitative RT-PCR (qPCR). [score:3]
MiR-221/miR-222 expression was normalized to RNU6B and is shown relative to each “wild type” cell LCL EBNA3A-REV (3A-REV) or p16 -null 3CHT cultured with 4HT (+HT). [score:3]
This well characterised oncogenic activity is likely to be related to the ability of miR-221/miR-222 to regulate cell cycle progression by directly targeting mRNA corresponding to CDKIs p57 [KIP2] (CDKN1C) and p27 [KIP1] (CDKN1B) [50, 56, 57, 58, 59]. [score:3]
Expression of miR-143/miR-145, miR-221/miR-222 and control RNA RNU48 are not affected by the treatment of LCL WT by 4HT. [score:3]
Positive leads that were of particular interest—because they have been reported in the literature to have either oncogenic activity (the miR-221/miR-222 cluster) or tumour suppressor activity (the miR-143/miR-145 cluster)–were chosen for more detailed analysis. [score:3]
Therefore, in order to determine whether the regulation of miR-221/miR-222 and/or miR-143/miR-145 might result from direct binding of either EBNA3A or EBNA3C –or both—to chromatin at the genomic locus of each miR cluster, genome-wide chromatin immunoprecipitation (ChIP) data sets were interrogated. [score:3]
We first determined whether p57 [KIP2] and p27 [KIP1] were miR-221/miR-222 targets in LCLs. [score:3]
These results suggest that miR-221 and miR-222 not only block translation, but might also enhance the degradation of p57 [KIP2] mRNA (both mechanisms of action have been described [33, 34]. [score:3]
LCLs 3A-REV were electroporated with 50 nM of LNA anti-miR-221 oligonucleotide (hsa-miR-221 miRCURY LNA, Exiqon), LNA anti-miR-222 oligonucleotide (hsa-miR-222 miRCURY LNA, Exiqon) or scrambled oligonucleotide (miRCURY LNA microRNA inhibitor control, Exiqon) using a Bio-Rad Gene Pulser I (270V, 960μF). [score:3]
Similarly using two independent LCLs conditional for EBNA3C function (3CHT, established in a p16 -null B cell background in order to allow the cells to proliferate in the absence of EBNA3C, as described in [30]), it was shown that removal of the activating ligand (4HT) resulted in a less substantial, but clearly significant reduction in both miR-221 and miR-222 expression (Fig 1A and S1 Fig). [score:3]
S6 Fig MiR-221 and miR-222 expression were determined by real time quantitative RT-PCR (qPCR) from EBNA3A-ERT2 LCLs established without the presence of 4HT (never HT) and 28 days after addition of 4HT to culture medium (+HT) and from p16 -null LCL 3CHT also established without the presence of 4HT (never HT) or 30 days after 4HT (+HT) was added to culture medium. [score:3]
The electroporation of anti-miR-221, anti-miR-222 or both was accompanied by an increase in p57 [KIP2] protein level, and p27 [KIP1] increased only when miR-221 was inhibited (Fig 10). [score:3]
Nevertheless taken together, the data established to our satisfaction that p57 [KIP2] and (to a lesser extent) p27 [KIP1] are targets of the miR-221/miR-222 cluster in EBV-transformed human B cells. [score:3]
Consistently on removal of 4HT (washed), miR-221 and miR-222 were expressed at a lower level (Fig 4B), whereas miR-143 and miR-145 were modestly induced (Fig 4C). [score:3]
Meta-analysis performed on over 1000 assorted human tumours, suggests that elevated expression of miR-221 and miR-222 is associated with poor overall survival of many cancer patients [55]. [score:3]
Fig 1A shows the results of qPCR assays for miR-221/miR-222 in extracts from four independent EBNA3A- KO LCLs and four LCLs established with revertant viruses (and therefore expressing all the latency -associated EBV proteins). [score:2]
Locked nucleic acid (LNA) knockdown of miR-221 and miR-222. [score:2]
MiR-221 and miR-222 have also been reported to regulate p27 [KIP1] in non-B cells. [score:2]
Sites BS2a and BS2b are spaced only 1kb apart at a location previously reported to be a cis-acting enhancer element involved in the regulation of both miR-221 and miR-222 [47]. [score:2]
Regulation of miR-221/miR-222 and miR-143/miR-145 in EBNA3A-ERT2 conditional LCLs. [score:2]
Expression of miR-221, miR-222, miR-143, miR-145 and two snRNAs, RNU6B and RNU48 were quantified by qPCR using the TaqMan MicroRNA Assay listed in S2 Table (Applied Biosystem). [score:2]
It is possible that EBNA3A and EBNA3C acting together play a role in reorganizing local chromatin in order to potentiate LMP1 and NF-kB -mediated transactivation of miR-221/miR-222. [score:1]
Analysis of the genomic locus including miR-221/miR-222 (chromosome Xq11.3) revealed a region located approximately 9kb downstream of the TSS for the 28kb pri-miR-221/222 that includes three binding sites for EBNA3C (sites BS2a, BS2b and BS3 in Fig 7A). [score:1]
EBNA3A and EBNA3C bind near the miR-221/miR-222 locus. [score:1]
ChIP-seq and ChIP-qPCR analysis of the miR-221/miR-222 and miR-143/miR-145 loci. [score:1]
The level of pri-miR-221/222 in those cells echoes the level of the mature miR-221/miR-222 detected (compare Figs 1 and 4 with Fig 6). [score:1]
1005031.g007 Fig 7(A) ChIP-seq data at miR-221/miR-222 cluster genomic locus generated from LCL 3A-TAP and LCL 3C-TAP [27] were displayed using UCSC Genome Browser. [score:1]
The effect of low levels of miR-221/miR-222 and high levels of p57 [KIP2] on the proliferation of these cells was surprisingly modest, rather less than has been reported previously in EBNA3A-conditional LCLs when EBNA3A was inactivated [10, 78]; we do not know the reason for this, but as we have indicated above, different lines can have different properties because of clonal variation. [score:1]
Interestingly, histone activation marks where higher (in particular H3K9ac and H3K27ac) at BS2a and BS2b sites, that is the region previously described as an enhancer for miR-221/miR-222, only when both EBV proteins are functional. [score:1]
Inactivation of miR-221 and miR-222 in LCLs with corresponding anti-miRs. [score:1]
1005031.g008 Fig 8(A) ChIP-seq data at miR-221/miR-222 cluster genomic locus generated from LCL 3A-TAP and LCL 3C-TAP were displayed using UCSC Genome Browser as in Fig 7A. [score:1]
EBNA3A and EBNA3C induce chromosome looping at the miR-221/miR-222 cluster locus. [score:1]
The induction of miR-221/miR-222 results from the activation of a long non-coding primary RNA (pri-miR) via long-range chromatin looping between enhancer elements that bind EBNA3A and EBNA3C and the transcription start site of the pri-miR. [score:1]
To do this EBNA3A-REV cells were electroporated with LNA anti-miR-221, anti-miR-222, both anti-miRs, or a negative control. [score:1]
MiR-221 and miR-222, which together form a cluster, are thought to both be processed from a common pri-miR. [score:1]
1005031.g006 Fig 6(A) Screen-shot of UCSC Genome Browser at miR-221/miR-222 cluster genomic locus shows the position of mature miR-221/miR-222 as well as RNA-seq data for GM12878 (LCL), h1-hESC, HeLa-S3, HepG2, HSMM, HUVEC, K562, NHEK and NHLF cell lines. [score:1]
Both EBNA3A and EBNA3C were shown by ChIP experiments to associate with multiple sites in a genomic region about 19kb upstream of the miR-221/miR-222 coding sequences and about 9kb downstream from the pri-miR TSS that is dominant in LCLs. [score:1]
EBNA3A and EBNA3C binding sites on miR-221/miR-222 locus can also bind multiple transcription factors. [score:1]
Comparison of miR-221 and miR-222 level across several independent LCLs. [score:1]
This mechanism would be consistent with the increase in acetylation seen on histone H3 lysine-27 (H3K27ac) at the enhancer binding sites and around the promoter when the miR-221/miR-222 locus is activated (Figs 7A and 8). [score:1]
We then performed ChIP analysis for marks of active chromatin (H3K4me3, H3K9ac and H3K27ac) across the miR-221/miR-222 cluster locus (Fig 8B and 8C). [score:1]
Active chromatin markers and RNA polymerase (Pol) II occupancy on the miR-221/miR-222 cluster genomic locus. [score:1]
[1 to 20 of 62 sentences]
10
[+] score: 178
Other miRNAs from this paper: hsa-mir-21, hsa-mir-214, hsa-mir-221
Based upon these findings, we confirmed PTEN as a target of miR-221 and miR-222, and demonstrated that co-suppression of the miR-221/222 cluster inhibits cell proliferation, induces cell apoptosis, inhibits cell invasion and enhances cell radiosensitivity by upregulating PTEN expression in SGC7901 gastric cancer cells. [score:14]
In our study, we found that knockdown of miR-221 and miR-222 in SGC7901 cells resulted in downregulation of pAkt expression, affecting the expression of several Akt-regulated proteins including cyclin D1, Bcl-2, and MMP2/9. [score:10]
We provide evidence that co-suppression of both miR-221 and miR-222 affects gastric cancer cell biology in vitro, and might represent a novel therapeutic strategy for gastric cancer through upregulation of PTEN expression. [score:8]
Upregulation of miR-221 and miR-222 induced the malignant phenotype of SGC7901 cells, whereas knockdown of miR-221 and miR-222 reversed this phenotype via induction of PTEN expression. [score:7]
As pAkt impacts cell proliferation, cell transit from the G0/G1 to the S phase, apoptosis, cell invasive ability, and cell radiosensitivity, downregulation of miR-221 and miR-222 expression have important biologic effects on the malignant phenotype of SGC7901 cells. [score:6]
Guo JM et al studied the microRNAs expression in primary gastric cancer tissues via microRNA microarray assay and were the first to demonstrate that PTEN was the target of miR-21 [41]; however, little is known regarding the impact of miR-221 and miR-222 on PTEN expression in gastric cancer. [score:6]
As PTEN is a target of miR-221 and miR-222, and has been described previously as an important regulator of radiation sensitivity [24, 55], these results suggest that increasing PTEN expression by silencing miR-221/222 could enhance the radiosensitivity of SGC7901 cells. [score:6]
These results demonstrate that miR-221 and miR-222 regulate radiosensitivity, and cell growth and invasion of SGC7901 cells, possibly via direct modulation of PTEN expression. [score:5]
We identified binding sites for miR-221 and miR-222 in the PTEN 3'-UTR by bioinformatics analysis, suggesting that increased expression of the miR-221/222 cluster might impact on PTEN expression. [score:5]
To confirm that PTEN is a target of miR-221 and miR-222, we cloned the PTEN 3'UTR fragment containing the putative miR-221/222 target site into pGL3-control vector with a luciferase reporter gene (pGL3-PTEN). [score:5]
pMSCV-miR-221/222 infection increased the expression of miR-221 and miR-222, while AS-miR-221/222 transfection efficiently silenced the expression of miR-221 and miR-222 in SGC7901 cells (Figure 1B). [score:5]
Infection of SGC7901 cells with pMSCV-miR-221/222 increased miR-221 and miR-222 expression, while transfection with AS-miR-221/222 efficiently silenced miR-221 and miR-222 expression in this cells (Figure 1B). [score:5]
The human gastric cancer cell line SGC7901 was transfected with AS-miR-221/222 or transduced with pMSCV-miR-221/222 to knockdown or restore expression of miR-221 and miR-222, respectively. [score:4]
Sequence analysis predicted that miR-221 and miR-222 would regulate PTEN expression. [score:4]
In addition, knockdonwn of miR-221 and miR-222 inhibited cell growth and invasion and increased the radiosensitivity of SGC7901 cells. [score:4]
MiR-221 and miR-222 were discovered to induce cell growth and cell cycle progression via direct targeting of p27 and p57 in various human malignancies. [score:4]
Here, we observed miR-221 and miR-222 upregulation in the human gastric cancer cell line SGC7901 compared with HEK293 epithelial cells, corroborating the findings of Young-kook et al [23]. [score:3]
Northern blot showing that expression of miR-221 and miR-222 in SGC7901 cells was greater than that in HEK293 cells (Figure 1A). [score:3]
revealed that the expression of miR-221 and miR-222 was greater in SGC7901 cells than in normal kidney epithelial HEK293 cells (Figure 1A). [score:3]
Our study suggests that inhibition of miR-221 and miR-222 might form a novel therapeutic strategy for human gastric cancer. [score:3]
Modulation of miR-221 and miR-222 expression in SGC7901 cell lines. [score:3]
Figure 1 miR-221 and miR-222 expression in SGC7901 and HEK293 cells. [score:3]
Moreover, TIMP3, as a target of miR-221 and miR-222, might also affect cell invasion[54]. [score:3]
These data suggest that miR-221 and miR-222 impact the phenotype of SGC7901 cell by modulating the expression of PTEN and Akt phosphorylation. [score:3]
miR-221 and miR-222 expression is abnormally increased in gastric cancer [42], however the mechanism by which miR-221 and miR-222 modulates tumor progression within the gut remains unknown. [score:3]
In the current study, we predicted that PTEN would be a target gene of the miR-221 and miR-222 cluster by computer-aided algorithm. [score:3]
In this study, we examined the impact of miR-221 and miR-222 on human gastric cancer cells, and identified target genes for miR-221 and miR-222 that might mediate their biology. [score:3]
Figure 3 PTEN is a target gene of miR-221 and miR-222. [score:3]
miR-221 and miR-222 targeting of the PTEN gene. [score:3]
In contrast, overexpression of miR-221 and miR-222 by infection with pMSCV-miR-221/222 resulted in significantly enhanced proliferation (Figure 2A). [score:3]
PTEN-3'UTR luciferase reporter assay confirmed PTEN as a direct target of miR-221 and miR-222. [score:3]
Deregulation of some miRNAs, including miR-221 and miR-222, have been observed in lymphoma, colorectal, lung, and breast cancers, papillary thyroid and hepatocellular carcinoma, glioblastoma [13- 21], and gastric cancer [22, 23]. [score:2]
The proliferation rates of SGC7901 cells with enhanced or silenced expression of miR-221 and miR-222 was determined via MTT assay. [score:2]
Hypothetical representation of the role of miR-221 and miR-222 in regulation of Akt phosphorylation and downstream signaling of proliferation, apoptosis, invasion, and radiosensitivity via PTEN. [score:2]
In this study, we demonstrated that miR-221 and miR-222 regulate gastric cancer cell viability, apoptosis, cell cycle progression and invasive ability. [score:2]
Indeed, we demonstrated that PTEN is a target gene of miR-221 and miR-222 by luciferase reporter assay. [score:2]
The malignant phenotype of the SGC7901 cells was reversed by knockdown miR-221 and miR-222, and cells were sensitized to radiation, corroborating the results of Garofalo et al [54]. [score:2]
To determine the role of PTEN in miR-221 and miR-222 co-regulation of the SGC7901 phenotype, cells were transfected with pcDNA-PTEN. [score:2]
However, the roles of miR-221 and miR-222 have not been reported in human gastric cancer. [score:1]
All the bases were 2'-OMe modified and had the following sequences: 2'-OMe-anti-miR-221 (AS-miR-221), 5'-AGCUACAUUGUCUGCUGGGUUUC-3'; 2'-OMe-anti-miR-222 (AS-miR-222), 5'-AGCUACAUCUGGCUACUGGGU-3'; scrambled oligonucleotide (Scr), 5'-UCUA CUCUUUCUAGGAGGUUGUGA-3'. [score:1]
miR-221 and miR-222 modulate a variety of biological functions in the SGC7901 cell, including cell proliferation, apoptosis, invasion, and radioresistance. [score:1]
R Agami, Division of Tumor Biology, the Netherlands Cancer Institute, Amsterdam, the Netherlands, for kindly providing the retroviral constructs of miR-221 and miR-222. [score:1]
To determine the biologic impact of miR-221 and miR-222 in the SGC7901 gastric cancer line, cells were transfected with AS-miR-221/222 or infected with pMSCV-miR-221/222 to reduce or increase miRNA levels, respectively. [score:1]
Figure 2 miR-221 and miR-222 affect phenotype of SGC7901 cells. [score:1]
Using bioinformatics analysis, we found that miR-221 and miR-222 contained specific binding sequences for the 3'UTR region of the PTEN gene. [score:1]
miR-221 and miR-222 co-modulate SGC7901 cell radiosensitivity. [score:1]
To determine whether miR-221 and miR-222 affected SGC7901 cell radiosensitivity, cells were transfected with AS-miR-221/222 or infected with pMSCV-miR-221/222 and colony formation was assessed following 0-6 Gy radiation (Figure 2E), Transfection of SGC7901 cells with AS-miRNA-221/222 significantly decreased survival following radiation exposure. [score:1]
miR-221 and miR-222 affect the phenotype of SGC7901 cell in a PTEN -dependent pattern. [score:1]
Moreover, we found binding sites for human miR-221 and miR-222 in the PTEN 3'-UTR. [score:1]
pGL3-PTEN construct containing PTEN 3'UTR was transfected into SGC7901 cells previously transfected with AS-miR-221 and/or AS-miR-222. [score:1]
These data demonstrated that the proliferation and survival rates of SGC7901 cells might be co-modulated by miR-221 and miR-222. [score:1]
Notably, the seed sequence of miR-221 and miR-222 matched the 3'UTR of PTEN, and introducing a PTEN cDNA without the 3'UTR into SGC7901 cells abrogated the miR-221 and miR-222 -induced malignant phenotype. [score:1]
The specific probes, end-labeled with DIG, were miRNA-221, 5'-GAAACCCAGCAGACAATGTAGCT-3'; miRNA-222, 5'-GAGACC CAGTAGCCAGATGTAGCT-3'; and U6, 5'-ATTTGCGTGTCATCCTTGCG-3'. [score:1]
miR-221 and miR-222 co-modulate SGC7901 cell invasion. [score:1]
Human full-length miR-221 and miR-222 in pMSCV vector were kindly provided by Reuven Agami (Division of Tumor Biology, The Netherlands Cancer Institute, Amsterdam, Netherlands). [score:1]
The recombinant retroviruses pMSCV-miR-221 and pMSCV-miR-222 were produced as previously described [34], and transfected into PT67, the packaging cells, using Lipofectamine 2000. [score:1]
These results suggested that miR-221 and miR-222 could co-modulate SGC7901 cell invasion. [score:1]
SGC7901 cells were grown to 70-80% confluence and transfected with pcDNA- PTEN and 2'-OMe-oligonucleotides using Lipofectamine 2000 or infected with pMSCV-miR-221 and/or pMSCV-miR-222 at a multiplicity of infection (MOI) of 50 at 37°C. [score:1]
miR-221 and miR-222 co-modulate SGC7901 cell proliferation. [score:1]
[1 to 20 of 59 sentences]
11
[+] score: 171
To demonstrate the function of miR-222 in ovarian cancer cells, miR-222 mimics or miR-222 inhibitors were transiently transfected into the S KOV3 cells to upregulate or downregulate the expression of miR-222, respectively. [score:11]
The data showed that P27 [Kip1] expression varied between carcinomas, and that when patients were divided into two groups according to miR-222 expression, the patients with high miR-222 expression levels presented with significantly lower P27 [Kip1] mRNA expression compared with patients with low miR-222 expression levels (P<0.01; Fig. 4B). [score:10]
Furthermore, the results also provided functional evidence concerning the possible role of miR-222 in ovarian cancer, as it was demonstrated that miR-222 upregulation is able to induce an enhancement of ovarian cancer cell proliferation potential, possibly by downregulating its target, P27 [Kip1]. [score:9]
miR-222 directly targets P27 [Kip1] by interacting with its 3′-UTRTo further investigate the molecular mechanism by which miR-222 promotes ovarian cancer proliferation, a TargetScan algorithm analysis was performed to identify the putative downstream target genes of miR-222, particularly those with tumor suppressive effects and the ability to regulate the cell cycle to promote tumor proliferation. [score:9]
Therefore, P27 [Kip1] mRNA expression was associated with the expression of miR-222, suggesting that miR-222 was able to negatively regulate P27 [Kip1] expression in human ovarian cancer. [score:8]
The Wilcoxon signed rank test was used to analyze the statistically significant upregulation of miR-222 expression in ovarian cancers. [score:6]
miR-222 expression is upregulated in ovarian cancer. [score:6]
To further investigate the molecular mechanism by which miR-222 promotes ovarian cancer proliferation, a TargetScan algorithm analysis was performed to identify the putative downstream target genes of miR-222, particularly those with tumor suppressive effects and the ability to regulate the cell cycle to promote tumor proliferation. [score:6]
To analyze the expression levels of miR-222, a qPCR analysis of miR-222 expression was conducted in several ovarian cancer cell lines (OV2008, C13 [*], A2780, S KOV3, CaOV3, ES2 and HO8910) and a human ovarian surface epithelial (HOSE) cell. [score:5]
Expression levels of miR-222 and P27 [Kip1] are inversely correlated in patients with ovarian cancerP27 [Kip1] mRNA expression was first evaluated using qPCR in the ovarian cancer cells to determine the association between the expression of P27 [Kip1] and miR-222. [score:5]
qPCR confirmed the increased or decreased expression of miR-222 in the miR-222 mimics or inhibitor transfectants, respectively (data not shown). [score:5]
In conclusion, the present study suggests that the over -expression of miR-222 may contribute to the growth and progression of ovarian cancer, at least in part by repressing P27 [Kip1] expression. [score:5]
Overall, the present results suggest that miR-222 upregulation in human ovarian cancer may promote ovarian cancer cell proliferation during ovarian carcinogenesis. [score:4]
miR-222 directly targets P27 [Kip1] by interacting with its 3′-UTR. [score:4]
By contrast, following transfection with the miR-222 inhibitor in the S KOV3 cells, the expression of P27 [Kip1] was clearly increased compared with the cells transfected with the negative control or blank (Fig. 3F). [score:4]
Together, these data indicate that P27 [Kip1] protein expression is regulated by miR-222 in ovarian cancer. [score:4]
In the present study, it was observed that miR-222 was frequently upregulated in ovarian cancer. [score:4]
A western blot analysis showed that the enforced expression of miR-222 significantly repressed endogenous P27 [Kip1] expression compared with the cells transfected with the negative control and blank (Fig. 3E). [score:4]
Just as P27 [Kip1] was demonstrated to be a target gene of miR-222, an inverse correlation was observed between P27 [Kip1] and miR-222 in the ovarian cancer cells (r=−0.841, P=0.018; Fig. 4A). [score:3]
Moreover, a Pearson correlation analysis of these patients revealed a significant inverse correlation between P27 [Kip1] and miR-222 expression (r=−0.489, P=0.001; Fig. 4C). [score:3]
miR-222 expression has been shown to induce cell growth, oncogenesis, invasion, migration and drug resistance in tumor cells (9– 11), and was also reported to be a significant marker of a poor prognosis (12). [score:3]
P27 [Kip1] mRNA expression was first evaluated using qPCR in the ovarian cancer cells to determine the association between the expression of P27 [Kip1] and miR-222. [score:3]
The Pearson correlation analysis was performed between the expression of miR-222 and P27 [Kip1]. [score:3]
Consistently, there was an inverse correlation between the P27 [Kip1] and miR-222 expression levels in the ovarian cancer cell lines and tissues. [score:3]
However, for miR-222, the possible roles and associated target genes in ovarian cancer remain poorly elucidated. [score:3]
Expression levels of miR-222 and P27 [Kip1] are inversely correlated in patients with ovarian cancer. [score:3]
Moreover, when miR-222 expression was measured in 11 normal ovarian tissues and 40 epithelial ovarian cancer tissues, qPCR showed that miR-222 was also overexpressed in tumor samples associate with the normal ovaries (P<0.05; Fig. 1A and B). [score:3]
miR-222 is overexpressed in various types of tumors (5– 8). [score:3]
A luciferase reporter assay demonstrated that P27 [Kip1] was a direct target of miR-222. [score:3]
miR-222 has been shown to be overexpressed in various types of cancer, such as pancreatic cancer, papillary thyroid carcinoma, glioblastoma and prostate carcinoma (5, 17– 19), and has been reported to an important marker of poor prognosis in ovarian cancers (14– 15). [score:3]
Luciferase reporter assays showed that the mutant 3′-UTRs of the P27 [Kip1] vector abrogated the repression of luciferase activity caused by miR-222 overexpression, indicating that such regulation was dependent on a specific sequence (Fig. 3D). [score:3]
However, the S KOV3 cells transfected with the miR-222 inhibitors exhibited significantly reduced growth (Fig. 2B). [score:3]
The expression of mature miR-222 was determined with the Bulge-Loop™ miRNA qPCR Primer Set (RiboBio) with SYBR-Green qPCR; U6 snRNA was used as an internal control. [score:2]
The results showed that miR-222 was overexpressed in all ovarian cancer cell lines compared with the HOSE cells (P<0.01). [score:2]
EdU incorporation was monitored by immunofluorescence microscopy following the transfection of the S KOV3 cells with miR-222 for 48 h. A quantitative analysis of the EdU -positive cells showed that the miR-222 overexpressing cells were 49% EdU -positive compared with 24% in the miR control (>100 cells were counted). [score:2]
Next, the present study investigated whether miR-222 was able to regulate the expression of the P27 [Kip1] protein levels. [score:2]
To investigate whether miR-222 is able to directly target P27 [Kip1] by interacting with its 3′-UTR in vitro, the wild-type 3′-UTRs of P27 [Kip1] were cloned and inserted downstream of a luciferase reporter gene (Fig. 3B). [score:2]
Subsequently, the miR-222 mimics or miR controls were cotransfected with wild-type 3′-UTR reporter vectors into the S KOV3 cells. [score:1]
Consequently, a cell cycle analysis was conducted in the S KOV3 cells transiently transfected with the miR-222 mimics. [score:1]
The results showed that the cells transfected with the miR-222 mimics exhibited an increased S phase with a decreased G [0]-G [1] phase (Fig. 2C). [score:1]
In the present study, the role of miR-222 on the carcinogenesis of ovarian cancer and the underlying mechanisms were examined. [score:1]
All these results indicated that miR-222 acts to promote ovarian cancer cell proliferation by increasing the population of cells in the S phase. [score:1]
It was observed that the miR-222 mimics decreased the relative luciferase activity of the wild-type 3′-UTR reporter vector by 37% (Fig. 3C). [score:1]
Effect of miR-222 on ovarian cancer cell proliferation in vitro. [score:1]
We propose that this fine-tuning regulatory action exerted by miR-222 on the levels of P27 [Kip1] protein present in the ovarian cancer cells may be considered as a sophisticated mechanism, which ensures a rapid response in P27 [Kip1] levels to any environmental and intracellular variations. [score:1]
A bioinformatic analysis showed that the 3′-UTR of the P27 [Kip1] mRNA contained the highly-conserved putative miR-222 binding site. [score:1]
Furthermore, the predicted binding site of miR-222 in the 3′-UTR was mutated using overlapping PCR (Fig. 3B). [score:1]
[1 to 20 of 47 sentences]
12
[+] score: 131
Other miRNAs from this paper: hsa-mir-17, hsa-mir-221, mmu-mir-17, mmu-mir-221, mmu-mir-222
MiR-221 and miR-222 are two highly homologous microRNAs whose upregulation has been recently described in several types of human tumors, for some of which their oncogenic role was explained by the discovery of their target p27, a key cell cycle regulator. [score:7]
As a first step to test this hypothesis, we pre -transfected PC3 cells, a high miR-221 and miR-222 expressing prostate carcinoma cell line [9], with LNA oligonucleotides targeting mir-221 and miR-222, in order to abolish their expression. [score:7]
We also checked if antagomir -mediated suppression of miR-221/222 resulted in a correspondent increase of p27 levels, as compared to untreated tumors; Fig. 3D shows a representative image of Western blot analyses of total protein extracts from the same tumors already tested for miR-221/222 expression: in all cases assayed, a high p27 expression was measured where miR-221 and miR-222 were kept low by antagomir action, whereas the lack of inhibition of the two microRNAs matched with a low level of p27 expression. [score:7]
In our work we aimed to demonstrate that the overexpression of miR-221 and miR-222, a couple of microRNAs that we had previously shown to be strongly upregulated in vitro in aggressive prostate carcinoma cell lines, is relevant to prostate carcinoma cell growth in vivo, both in mouse mo dels and in human tumor samples. [score:6]
The numerical values under each lane indicate the relative expression of miR-221 and of p27, where each p-221 transfected tumor is compared to its controlateral control (pCDNA3.1) tumor, whose miR-221 and p27 expression levels are set as  = 1. G p27 mRNA 3′UTR sites targeted by miR-221 and miR-222. [score:6]
We previously described that miR-221/222 expression is directly correlated with the aggressiveness of cell mo dels of prostate carcinoma, and that the forced overexpression of miR-221 or miR-222 in the poorly aggressive prostate carcinoma LNCaP cell line is sufficient to accelerate their proliferation and in vitro tumorigenicity [9]. [score:6]
When the values of p27 protein expression were plotted against miR-221 and miR-222 expression, an inverse correlation was evident (Fig. 4C, Spearman: p = 0.0164 for miR-221 and p = 0.0057 for miR-222). [score:5]
The reason accounting for the recognition of shared targets for both miR-221 and miR-222 is found in their “seed” sequences, short (∼7–8 nt) regions at their 5′ ends through which they bind their target sites in mRNA 3′UTRs: these “seeds” are identical in miR-221 and miR-222 and are also very well evolutionarily conserved, likely indicating the common involvement of these two microRNAs in the same pathways. [score:5]
In vivo intratumoral knockdown of miR-221 and miR-222 upregulates p27 and reduces tumor growth of PC3 xenografts. [score:5]
MiR-221 and miR-222 are highly expressed in human prostate carcinoma primary samples and their expression is inversely correlated to that of p27. [score:5]
Thus, our prostate carcinoma xenograft data demonstrate, as a whole, that miR-221 (and most likely miR-222, even if here we are not providing a direct evidence for this) is sufficient to strongly enhance prostate carcinoma growth and, consequently, that the inhibition of miR-221 and miR-222 is necessary, and in fact effective, to reduce the in vivo growth of this tumor. [score:4]
After approximately one week, when the tumors reached an average volume of ∼50 mm [3], the tumors were directly injected with a cocktail of antagomirs (Dharmacon, CelBio, Italy) targeting miR-221 and miR-222 on one flank, or with a control antagomir on the other. [score:4]
Once more, we show that treated tumors growing smaller than controls maintain reduced levels of miR-221 and miR-222 for the whole duration of the experiments, and that this produces a permanent upregulation of p27, otherwise low in control tumors. [score:4]
This observation led us to check the p27 status in transfected tumors, in search of the inverse correlation expected on the basis of the in vitro validated negative regulation of p27 by miR-221 [9], exerted by miR-221 and miR-222 via the specific recognition of two target sequences in the p27 3′UTR (Fig. 1G ). [score:4]
Real-time PCR showed a consistent upregulation of both miR-222 and miR-221 in about 80% of the tumor samples analyzed with respect to normal counterparts, even if no correlation was observed with Gleason and stage (Fig. 4A and Table 1). [score:4]
As shown in Fig. 2A, LNA oligoes efficiently depleted miR-221 and mir-222 from PC3 cells, to such an extent that miR-221/222 expression was almost undetectable by Northern blot. [score:3]
To assess the significance of our results in human tumor samples, we analyzed miR-221 and miR-222 expression in 21 patients with stage II–III prostate cancer. [score:3]
0004029.g002 Figure 2 In vitro inhibition of miR-221 and miR-222 reduces tumor growth of PC3 derived tumors in SCID mice. [score:3]
The intratumoral injection of anti-miR-221 and anti-miR-222 antagomirs into PC3-derived tumors reduces tumor growth and has long lasting effects on miR-221 and miR-222 endogenous expression. [score:3]
On the other hand, we sought to investigate if it is possible to inhibit miR-221 and miR-222 expression in mouse mo dels of established prostate carcinoma, in order to set up the premises for a future therapeutic approach. [score:3]
Altogether, these results indicate that intratumoral injection of antagomirs targeting miR-221 and miR-222 can effectively keep low the concentration of these two microRNAs for as long as 24 days (i. e. time elapsed from third and last antagomir injection to animal sacrifice), concomitantly increasing p27 amount and ultimately reducing the growth of PC3 xenografts. [score:3]
In vitro inhibition of miR-221 and miR-222 reduces tumor growth of PC3 derived tumors in SCID mice. [score:3]
However, of course, the great interest of this observation lies in its reverse implications: that inhibiting miR-221 and miR-222 in prostate carcinoma may be a way to reduce its growth potential. [score:3]
We have pre -transfected cells from the highly aggressive PC3 cell line with LNA antisense oligonucleotides targeting miR-221 and miR-222, and subsequently followed the growth of tumor xenografts obtained through the injection of pre -transfected cells into SCID mice. [score:3]
We have recently shown that miR-221 and miR-222 are positive regulators of in vitro prostate carcinoma growth through the repression of p27 [9]. [score:2]
The graph shows the log fold change of miR-221 and miR-222 expression as compared to the value obtained for non-tumoral control sample N1. [score:2]
To achieve this goal, we treated pre-established tumors induced by the s. c. injection of PC3 cells into SCID mice, with anti-miR-221 and anti-miR-222 “antagomirs”, cholesterol-conjugated antisense molecules previously shown to own a good bioavailability and stability in vivo [25], [26]. [score:1]
The specific probes, end-labeled with T4 polynucleotide kinase in the presence of γ- [32]P-ATP, were: miR-221, 5′-gaaacccagcagacaatgtagc-3′; miR-222, 5′-gagacccagtagccagat-3′; U6, 5′-cacgaatttgcgtgtcatccttgcgcaggggcc-3′. [score:1]
0004029.g003 Figure 3 A Tumor growth curves depicting the average±SEM values of PC3 derived tumors injected either with a negative control antagomir (ctrl) or with a mixture of anti-miR-221 and anti-miR-222 antagomirs (anti-miR221/222). [score:1]
C Quantitative real-time PCR of miR-221 (upper panel) or miR-222 (lower panel) in tumors excised from four representative mice (A10, D3, D10, E3) at the day of sacrifice, 24 days after the last antagomir injection. [score:1]
For the experiments with in vitro transfected PC3 cells, LNA oligonucleotides against miR-221 and miR-222, and a negative control oligonucleotide were obtained from Ambion Inc. [score:1]
Among oncomiRs, we and others previously found that miR-221 and miR-222 are involved in several different types of human neoplasms, such as glioblastoma [5]– [8], prostate carcinoma [9], non-small cell lung cancer [10], [11], hepatocellular cancer [12], [13], pancreatic cancer [14], and many others. [score:1]
The in vitro depletion of miR-221 and miR-222 renders PC3 cells less efficient in the establishment of in vivo xenografts. [score:1]
A Tumor growth curves depicting the average±SEM values of PC3 derived tumors injected either with a negative control antagomir (ctrl) or with a mixture of anti-miR-221 and anti-miR-222 antagomirs (anti-miR221/222). [score:1]
Antagomir sequences were 5′-g [s]a [s]aacccagcagacaaugu [s]a [s]g [s]c [s]u-Chol 3′ (anti-miR-221), 5′-g [s]a [s]gacccaguagccagaugua [s]g [s]u [s]c [s]u-Chol 3′ (anti-miR-222). [score:1]
C Average volume fold increase of tumors derived from PC3 cells transfected with anti-miR-221+anti-miR-222 LNA oligonucleotides (anti-221/222) or with a negative control LNA oligonucleotide (ctrl). [score:1]
0004029.g004 Figure 4 A MiR-221 and miR-222 expression measured by quantitative real-time PCR in primary cell lines from prostate carcinomas (T samples) or normal prostate (N samples). [score:1]
To answer this question, we performed Q-RT-PCR on total RNA extracted from excised tumors, and verified an effective and persistent reduction of miR-221 and miR-222 in treated tumors vs control ones (Fig. 3C ). [score:1]
40 µl of PBS containing 1 µg of each anti-miR-221 and anti-miR-222 antagomir, or control antagomir, were injected intratumorally at day 0, 5 and 9, for a total of three injections per tumor. [score:1]
C Spearman correlation analysis performed between miR-221, miR-222, and p27 levels in 18 primary cell lines derived from prostate carcinoma tissues. [score:1]
A Northern blot analysis of total RNA extracted from PC3 cells transfected in vitro with anti-miR-221+anti-miR-222 LNA oligonucleotides (anti-221/222). [score:1]
Both approaches clearly aimed at reducing miR-221 and miR-222 in the tumors but, while the first one theoretically conferred a delay to pretransfected cells that received the LNA oligoes, before they settled in the host environment and started assembling a true tumor, the second one more closely mimicked a “treatment”, as it was performed in already grown tumors, where cells had already formed their network of contacts within the host body. [score:1]
For each mouse, the tumor on one flank was injected with a mixture of anti-miR-221 and anti-miR-222 antagomirs, while the controlateral tumor was injected with a control antagomir. [score:1]
A MiR-221 and miR-222 expression measured by quantitative real-time PCR in primary cell lines from prostate carcinomas (T samples) or normal prostate (N samples). [score:1]
Our findings indicate that miR-221 and miR-222 are key modulators of prostate carcinoma also in vivo. [score:1]
Each animal received control cells on one flank and anti-miR-221+anti-miR-222 pre -treated cells on the other. [score:1]
On the other hand, we have injected anti-miR-221 and anti-miR-222 antagomirs into pre-established PC3 xenografts. [score:1]
[1 to 20 of 47 sentences]
13
[+] score: 120
By analyzing normal brain and glioblastoma tissues as well as ADAR2 -modified glioblastoma cells, we found that: 1) selected miRNAs undergo ADAR2 -mediated editing in normal brain, some of which is within the seed sequence; 2) editing within miRNAs is decreased (or lost) in glioblastoma, where ADAR2 activity is impaired, compared with normal brain; 3) glioblastomas have altered miRNA expression profiles when compared with normal brain; 4) the rescue of ADAR2 activity in glioblastoma cells restores the edited miRNA population and tends to rebalance the miRNA expression profile (onco-miRNAs versus tumor suppressor miRNAs) towards a state resembling normal brain tissue; 5) the most striking effect of ADAR2 rescue in glioblastoma cells is a general decrease in the levels of several onco-miRNAs (such as miR-221, -222, -21); 6) ADAR2 can edit miR-222/221 and miR-21 precursors and decrease the expression of the corresponding mature miRNAs both in vivo (mouse brain) and in human glioblastoma cells, and this has significant effects on cell proliferation and migration. [score:7]
Figure 1 Down-regulation of selected onco-miRNAs (miR-221, miR-222 and miR-21) in glioblastoma cell lines upon ADAR2 expression. [score:6]
Interestingly, we observed that the rescue of active ADAR2 in glioblastoma cells (U118) results in the down-regulation of a large number of miRNAs (Additional file 3), including three important onco-miRNAs (miR-221, miR-222 and miR-21), which play a pivotal role in cancer progression and are found particularly over-expressed in glioblastoma [26, 27]. [score:6]
In summary, miRNA-array data showed that ADAR2 activity restricts the expression of several well-known onco-miRNAs in glioblastoma (Additional file 2, ADAR2 versus ADAR2 E/A, column in dark gray), with mir-221, miR-21, miR-125b and miR-222 being the most down-regulated. [score:6]
Adar2 inhibits miR-221, miR-222 and miR-21 expression in vivo. [score:5]
Adar2 inhibits miR-221, miR-222 and miR-21 expression in vivoIn order to verify our observation in vivo, we took advantage of RNA samples extracted from Adar2 [-/-] and wild-type mouse brains. [score:5]
Recently, miRNAs have been shown to be differentially expressed in malignant astrocytomas and glioblastomas (also known as astrocytoma grade IV) compared with normal brain, with some miRNAs, such as miR-21, miR-221 and miR-222, being particularly over-expressed in cancers [6, 7]. [score:4]
Also of note, miR-222 decreases its expression during porcine brain development from embryonic to adult cortex [40]. [score:4]
Similarly, the A-to-G mutations of the pri-miR-222 at the -21 and +53 sites play a major role in inhibiting miR-222 maturation, while that at the -4 site does not (Figure  7b). [score:4]
Using an over -expressing cell system (HEK293T), we identified multiple editing sites (with editing levels ranging from 2% to 20%) within the stem-loop structure of pri-miR-222/221 and pri-miR-21, but not within the control pri-miR-223. [score:3]
Figure 2 ADAR2 silencing in U118 cell line increases miR-221, miR-222 and miR-21 expression levels. [score:3]
Figure 8 The ADAR2 -mediated anti-tumoral effect is reversed by miR-221, miR-222 and miR-21 expression. [score:3]
Among the onco-miRNAs down-expressed by ADAR2, we focused on miR-221, miR-222 and miR-21. [score:3]
Figure 5 Modulation of miR-221, miR-222 and miR-21 and their precursors in HEK293T cell lines upon ADAR2 and ADAR2 E/A expression. [score:3]
While the levels of mature miR-221, miR-222 and miR-21 decreased (Figure  1a, b), the corresponding precursors (pri- or pre-miRNAs) accumulated in both U118 and A172 cells upon ADAR2 expression (Figure  3). [score:3]
If Adar2 is important for the maturation of miR-221, miR-222 and miR-21 in physiological conditions, we would expect a substantial increase in expression of these three miRNAs in the absence of Adar2. [score:3]
The over -expression of miR-221 plus miR-222 caused a significant boost in cell proliferation and abolished the anti-tumoral effect of ADAR2. [score:3]
ADAR2 can edit miR-222/221 and miR-21 precursors and decrease the expression of the corresponding mature onco-miRNAs in vivo and in vitro, with important effects on cell proliferation and migration. [score:3]
RT-PCRs were designed to amplify over-expressed pri-miR-222/221, pri-miR-21 and pri-miR-223 (the latter was used as control) from ADAR2 or ADAR2 E/A HEK293T cells. [score:3]
In order to validate the deep-sequencing and microarray data and to explore the connection between ADAR2 activity and miR-221, miR-222 and miR-21, we used two glioblastoma cell lines (U118 and A172) stably over -expressing either ADAR2 or its inactive form ADAR2 E/A at similar levels (Figure S1 in Additional file 1 and data not shown). [score:3]
Figure 3 Modulation of miR-221, miR-222 and miR-21 precursors in glioblastoma cell lines upon ADAR2 and ADAR2 E/A expression. [score:3]
ADAR2 decreases proliferation and migration of glioblastoma cells by inhibiting miR-221, miR-222 and miR-21 maturation. [score:3]
Overall, our findings indicate a connection between ADAR2 -mediated editing of miR-222 and brain development. [score:2]
The expression levels were calculated as a relative-fold increase compared with untreated cells (ctrl) arbitrarily set to 1. Conversely, silencing of ADAR2 in U118 ADAR2 cells (Figure  2a) increased the expression levels of mature miR-221, miR-222 and miR-21 (Figure  2b). [score:2]
The expression levels were calculated as a relative-fold increase compared with untreated cells (ctrl) arbitrarily set to 1. Conversely, silencing of ADAR2 in U118 ADAR2 cells (Figure  2a) increased the expression levels of mature miR-221, miR-222 and miR-21 (Figure  2b). [score:2]
We examined the endogenous levels of miR-221, miR-222 and miR-21 and of their precursors by qRT-PCR and found that their mature miRNA are indeed significantly over-expressed in the Adar2 [-/-] mouse brain (+2.7-, +2.2- and +2.7-fold, respectively) compared with the wild type (Figure  4a). [score:2]
Interestingly, this editing position alone (which is located in the lower stem of pri-miR-222 in the extension of the pre-miRNA structure [39] and distant from the Drosha cleavage site) is able to hamper miR-222 maturation by more than 50% (Figure  7b). [score:1]
Investigating the miRNA maturation process of wild-type and the edited versions of pri-miR-222/221, we found that editing at the chosen positions did indeed affect miRNA processing, since both miRNA and miRNA* expression levels were impaired. [score:1]
We transiently transfected an equal amount (100 nM) of scramble or miR-221- plus miR-222 -mimic in U118 ADAR2 cells (Figures S5a in Additional file 1). [score:1]
The specific PCR products of pri-miR-221, pri-miR-222 and pri-miR-21 from different samples were gel purified, quantified and used in equimolar amounts. [score:1]
Here, we found that two miRNAs (miR-221 and miR-222) that act in the same molecular pathway (through p27 [Kip1]) are also modulated by ADAR2 activity, indicating that this pathway is particularly sensitive to epigenetic mechanisms such as RNA editing (Figure  9). [score:1]
Of note, the U118 ADAR2 E/A cells (which have a high level of both miR-221 and miR-222 and a high proliferative rate) did not show cell proliferation increases comparable to that observed in the ADAR2 cells when they were transfected with miR-221- plus miR-222 -mimic (Figures S7 in Additional file 1). [score:1]
Altogether, these data indicate that ADAR2 exerts its anti-proliferative and anti-migratory activity in glioblastoma also through the modulation of miR-221, miR-222 and miR-21. [score:1]
In order to verify whether the editing events detected in these three pri-miRs might have an effect on their maturation, we substituted guanosines (by site-specific mutagenesis) within these pri-miR-plasmids at the sites with the highest editing levels as detected by MiSeq analysis (for pri-miR-221: -1, +1, +64; for pri-miR-222: -21, -4, +53; for pri-miR-21: +16, +46, +51) (adenosines marked with circles in Figure  7). [score:1]
HEK293T cells seeded into a six-well plate were transiently co -transfected at 80% confluence using Lipofectamine 2000 (Invitrogen-Life Technologies) with either 2 μg of EGFP-ADAR2 or EGFP-ADAR2 E/A in the presence of 1.5 μg of pri-miR-222/221 or pri-miR-21 plasmid. [score:1]
Only site -21 within pri-miR-222 was found to be highly edited in different human brain samples, with editing increasing from child (4%) to adult (approximately 20%) brain. [score:1]
To further confirm that the reduction in mature miR-221 and -222 levels detected after transfection of the edited pri-miRNA plasmids was due to alterations in their processing, we also analyzed the levels of miR-221* and miR-222*, finding similar results (Figure  7a, b). [score:1]
All these positions showed extremely low percentages of A-to-G changes, ranging from 1.5 to 3% in the different RNA brain samples, with the only exception being site -21 within pri-miR-222, which was highly edited in different human samples: approximately 20% in adult brain (Clontech), approximately 15% in the adult brain pool (Ambion) and approximately 4% in pediatric brain. [score:1]
miRIDIAN miRNA mimics (small, chemically modified dsRNAs that mimic endogenous miRNAs; Dharmacon-GE Healthcare, Lafayette, CO, USA) miR-221, miR-222 or miR-21 (100 nM or 200 mM) were transfected into cells using Oligofectamine (Invitrogen-Life Technologies), according to the manufacturer’s instructions, and then tested for in vitro proliferation and motility. [score:1]
These data indicate that miR-221 and miR-222 are important mediators of the effects of ADAR2, through which this enzyme plays its anti-proliferative role in glioblastoma cells. [score:1]
It is conceivable that ADAR2 also exerts its anti-tumoral effects through miRNA modulation, such as of miR-221, miR-222 and miR-21. [score:1]
Oligonucleotide probes, corresponding to the antisense miRNA sequences used, were: miR-221 probe, 5′-gaaacccagcagacaatgtagc-3′; miR-222 probe, 5′-gagacccagtagccagat-3′; miR-21 probe, 5′-tcaacatgagtctgataagcta-3′; and U6 probe, 5′-cacgaatttgcgtgtcatccttgcgcaggggcc-3′. [score:1]
In order to explore this possibility, we reintroduced miR-221 and miR-222 into ADAR2 -modified glioblastoma cells (U118 and A172) and analyzed cell proliferation. [score:1]
Therefore, we tested the precursor levels of miR-221, miR-222 and miR-21 in the ADAR2 -modified cell lines. [score:1]
Specifically, A-to-G changes were found within pri-miR-221 (sites -15, +39 and +41), pri-miR-222 (sites -21 and +70) and pri-miR-21 (sites +12 and +41) (Figure  6, adenosines marked with red circles). [score:1]
Figure 6 ADAR2 -mediated editing events within pri-miR-221, pri-miR-222 and pri-miR-21 in HEK293T cells. [score:1]
The cells were transfected with the pri-miR-222/221 cluster or pri-miR-21, either alone or together with the ADAR2 or ADAR2 E/A plasmids (Figure S4 in Additional file 1). [score:1]
Figure 7 miRNA maturation of the wild-type and the edited versions of pri-miR-221, pri-miR-222 and pri-miR-21. [score:1]
Overall, our data demonstrate that ADAR2 is able to edit the pri-miR-222/221 and the pri-miR-21 transcripts both in vivo and in cell lines. [score:1]
Pri-miR-222 was found edited at nine sites: the most edited positions were -4 and +53, which were 20% and 9% edited, respectively (Figure  6b). [score:1]
Of note, the site -21 within pri-miR-222 was found highly edited in different human samples, with values increasing from children (4%) to adult (approximately 20%) brain. [score:1]
Specifically, we found that 28% of the pri-miR-221 clones, 18% of the pri-miR-222 clones and 25% of the pri-miR-21 clones had A-to-G changes. [score:1]
[1 to 20 of 52 sentences]
14
[+] score: 106
Other miRNAs from this paper: mmu-mir-222
We subsequently ran a pathway analysis (Ingenuity Pathway Analysis, IPA, Qiagen) from a microarray comparing NRVM with precursor-miRNA -mediated miR-222 overexpression to controls (pre-miR-222 and Ctr-pre) and found cell cycle regulators in general, and with subsequent analysis (Fig.   5f), TEAD2 specifically, to be upregulated with miR-222 expression, suggesting that they are not direct targets of miR-222’s effects in this context. [score:12]
We went on to specifically check CCNG2 expression in miR-222 overexpressing neonatal rat ventricular cardiomyocytes (NRVMs), and found an increase in CCNG2 expression, strongly suggesting that this is not a direct miR-222 target (Fig.   5c). [score:10]
In contrast, we did find that increased expression of CCNG2 (cyclin G2), a relevant cell cycle regulator, but could not find CCNG2 as a predicted miR-222 target (through Pictar and Targetscan). [score:8]
Next, we inhibited miR-222 upregulation by weekly injection of a sequence-specific locked nucleic acid inhibitor (LNA)-anti-miR-222, together with [15]N-thymidine administration during the 8-week voluntary exercise protocol. [score:8]
Error bars represent ± s. e. m To further explore the mechanisms by which miR-222 regulates exercise -induced cardiomyogenesis, we performed quantitative gene expression analysis from sedentary and exercised mouse hearts for relevant genes previously validated as direct targets of miR-222 [18]. [score:7]
Error bars represent ± s. e. mTo further explore the mechanisms by which miR-222 regulates exercise -induced cardiomyogenesis, we performed quantitative gene expression analysis from sedentary and exercised mouse hearts for relevant genes previously validated as direct targets of miR-222 [18]. [score:7]
e Exercised mouse hearts show downregulation of miR-222 target HIPK1. [score:6]
a miR-222 is upregulated after eight weeks of voluntary wheel running in young adult mice (n = 6 mice per group, * p = 0.01, Student’s t test). [score:4]
Fig. 5Hypoxia and hippo pathways are not directly targeted by miR-222. [score:4]
Taken together with our previously published data demonstrating that HIPK1 is a direct target of miR-222 with anti-proliferative effects in cardiomyocytes [18], these data strongly suggest that HIPK1 contributes to miR-222’s modulation of exercise -induced cardiomyogenesis. [score:4]
Inhibition of miR-222 blocks exercise -induced cardiac growth. [score:3]
First, we confirmed that voluntary wheel running induced miR-222 expression in the adult mouse heart (Fig.   4a). [score:3]
Mechanistically, we show that the exercise -induced increase in cardiomyocyte [15]N-thymidine labeling can be abolished by inhibition of miR-222, a microRNA increased by exercise in both animal mo dels and humans. [score:3]
Fig. 4Inhibition of miR-222 prevents exercise -induced cardiomyogenesis. [score:3]
miR-222 inhibition. [score:3]
f Gene expression signal specifically for CCGN2 and TEAD2 detected in a microarray conducted from neonatal rat ventricular myocytes (NRVM) treated with control precursor (ctl-pre) and miR-222 precursor (pre-miR-222), respectively (n = 4 individual samples per group, * p < 0.05, Student’s t test). [score:3]
Moreover, these studies indicate that miR-222, and potentially other miR-222-independent cell cycle regulators, are necessary for exercise -induced cardiomyogenesis and suggest that enhanced cardiac regeneration may contribute to the benefits of exercise after myocardial injury. [score:2]
The cardiac hypertrophic response was attenuated in exercised mice treated with LNA-anti-miR-222, confirming that miR-222 is necessary for exercise -induced cardiac growth even over longer duration (8 weeks) than previously examined [18]. [score:1]
Although our prior work had suggested a role for miR-222 in cardiomyocyte proliferation [18], these studies were based on work in neonatal rather than adult cardiomyocytes, and proliferation markers that could not unambiguously identify mitotic events in vivo [18]. [score:1]
However, these changes were not significantly affected by suggesting they do not contribute to miR-222’s modulation of cardiomyogenesis (Fig.   5b). [score:1]
f Contingency table showing the absolute numbers of [15]N-labeled mononucleate/diploid cells of total counted cardiomyocytes from each group (sedentary:exercise = 0.4%:2.7%, p = 0.004, Fisher’s exact test, OR = 6.931, CI 1.87–30.83) To explore the mechanism of the cardiomyogenic exercise response, we studied the role of miR-222, a microRNA (miRNA) that increases in response to exercise in both animal mo dels and humans, and plays an important role in the cardiovascular effects of exercise 18, 31. [score:1]
sedentary hearts (a) and hearts from mice treated with LNA-anti-miR222 or LNA-scr-miR undergoing voluntary wheel running (b) (n = 3–5 mice per group, * p < 0.05, Student’s t test). [score:1]
Liu X miR-222 is necessary for exercise -induced cardiac growth and protects against pathological cardiac remo delingCell Metab. [score:1]
We conclude that exercise stimulates cardiomyogenesis in the injured and uninjured adult mouse heart and that miR-222 is necessary for the cardiomyogenic response. [score:1]
sedentary hearts (d) and hearts from mice treated with LNA-anti-miR222 or LNA-scr-miR undergoing voluntary wheel running (e) (n = 3–5 mice per group, * p < 0.05, Student’s t test). [score:1]
However, exercised mice treated with LNA-anti-miR-222 demonstrate a reduced number of [15]N-thymidine -positive cardiomyocytes closer to sedentary baseline levels (800–1350 cells from four mice per group were counted * p = 0.0255, Fisher’s exact test). [score:1]
c p value from significantly differential pathways analyzed by ingenuity pathway analysis (IPA, Qiagen) of a microarray conducted from neonatal rat ventricular myocytes (NRVM) treated with control precursor (ctl-pre) and miR-222 precursor (pre-miR-222), respectively (n = 4 individual samples per group). [score:1]
Exercised mice injected with scrambled LNA-anti-miR (LNA-Ctr) and sedentary mice treated with LNA-anti-miR-222 served as controls. [score:1]
Further exploration of the role of the Hippo pathway in endurance exercise although apparently independent of miR-222 may be of interest for future studies. [score:1]
sedentary LNA-anti-miR-222, one-way ANOVA with Tukey’s post-test for multiple comparisons). [score:1]
miRNA-222 as well as control precursors (pre-miR) were purchased from Invitrogen. [score:1]
Two-month-old C57Bl/6 male mice were subcutaneously injected with 10 mg kg [−1] of LNA -modified anti-miR-222 (LNA-anti-miR-222) or scrambled control (LNA-Ctr) reconstituted in saline for three consecutive days after osmotic pump implantation and then weekly after pump exchanges throughout the experiment. [score:1]
b underwent simultaneous [15]N-thymidine infusion and LNA-anti-miR-222 or control LNA-anti-miR (LNA-Ctr) treatment for 8 weeks of sedentary activity or voluntary wheel running. [score:1]
[1 to 20 of 33 sentences]
15
[+] score: 85
Other miRNAs from this paper: hsa-mir-221, mmu-mir-221, mmu-mir-222, mmu-mir-1928
The animal treatment was initiated after the detection of palpable tumors, approximately 2 weeks following MM cells injection with 1mg/kg per mouse of miR-221 inhibitor or miR-222 inhibitor, or both miR-221/222 inhibitors, or NC as control (mirVana custom inhibitor, Life Technologies). [score:9]
Importantly, by q-RT-PCR analysis of tumor tissues retrieved from animals treated with miR-221 inhibitors, we found a >60% knocking down of both miR-221 and miR-222 expression (Fig. 7A), confirming the in vivo interaction between miR-221 and miR-222. [score:6]
Figure 3 In vitro anti-proliferative activity of miR-221 and miR-222 inhibitors on MM cell lines A-B) Cell growth analysis of OPM2 (A) and NCI-H929 (B) cells transfected with miR-221/222 inhibitors or scrambled oligonucleotides (NC). [score:5]
We then compared the activity of single inhibitors and we observed higher anti-tumor activity of miR-221 inhibitors as compared to miR-222 inhibitors (Fig. 6B). [score:5]
Subcutaneous OPM2 xenografts were repeatedly treated every 2 days, with 20 μg of NLE-miR-221 inhibitors, or NLE-miR-222 inhibitors, or NLE-NC. [score:5]
Conversely, we selected OPM2 and NCI-H929 cells, both t(4;14), which respectively express moderate and high levels of miR-221/222 to explore the anti-tumor activity of miR-221 and/or miR-222 inhibitors. [score:5]
Histogram bars indicate miR-221 or miR-222 expression values normalized by miRNA QC Tool (Affymetrix). [score:3]
A) Differential expression of miR-221 and miR-222 in immunoselected CD138+ cells from 3 healthy donors, 38 MM and 2 PCL, by microarray analysis. [score:3]
miR-221 and miR-222 expression in primary CD138+ normal plasma cells, primary MM and PCL cells and established MM cell lines. [score:3]
Figure 7 A) q-RT-PCR of miR-221 and miR-222 in retrieved tumors treated with unformulated-miR-221 inhibitors or unformulated-NC. [score:3]
Figure 1 A) Differential expression of miR-221 and miR-222 in immunoselected CD138+ cells from 3 healthy donors, 38 MM and 2 PCL, by microarray analysis. [score:3]
B) Effects of treatments with formulated miR-221 or miR-222 individual inhibitors. [score:3]
When OPM2 MM tumors became palpable, animals were randomized and treated with miR-221 and/or miR-222 inhibitors or controls. [score:3]
Figure 4 A) miR-221 and miR-222 q-RT-PCR 24 hours after transfection with miR-221/222 inhibitors and NC in OPM2 cells. [score:3]
A) q-RT-PCR of miR-221 and miR-222 in retrieved tumors treated with unformulated-miR-221 inhibitors or unformulated-NC. [score:3]
In vitro anti-proliferative activity of miR-221 and miR-222 inhibitors on MM cell lines. [score:3]
C-D) BrdU incorporation after transfection of synthetic miR-221 and/or miR-222 inhibitors or NC in OPM2 (C) and NCI-H929 (D) cells. [score:3]
miR-221 and miR-222 are reported as raw expression values. [score:3]
B) Differential expression of miR-221 and miR-222 in 16 MM cell lines by Affymetrix GeneChip® miRNA 1.0 Array. [score:3]
In vivo anti-tumor activity of miRNA-221/222 against MM xenograftsIn the light of translation of our findings in a therapeutic mo del, we investigated the effect of miR-221 and/or miR-222 inhibitors against MM xenografts in CB-17 severe combined immunodeficient non-obese diabetic (SCID/NOD) mice. [score:3]
A) miR-221 and miR-222 q-RT-PCR 24 hours after transfection with miR-221/222 inhibitors and NC in OPM2 cells. [score:3]
In the light of translation of our findings in a therapeutic mo del, we investigated the effect of miR-221 and/or miR-222 inhibitors against MM xenografts in CB-17 severe combined immunodeficient non-obese diabetic (SCID/NOD) mice. [score:3]
For cell proliferation analysis, 1.5x10 [5] MM cells were seeded in 24 well plates, electroporated with synthetic miR-221 and/or miR-222 or with miR -inhibitors or NC, and then harvested and counted at 24-hour intervals using a Trypan Blue viable cell-excluding assay. [score:2]
[1 to 20 of 23 sentences]
16
[+] score: 76
Other miRNAs from this paper: hsa-mir-21, hsa-mir-100, hsa-mir-223, hsa-mir-126
As a matter of fact, over -expressing miR-222, but not miR-223 led to a STAT5A level that was almost undetectable, miR-21 that was down-regulated as well as TGFβ expression and collagen production that were barely discernible. [score:8]
Interestingly, only miR-222 over -expression reduced STAT5A expression and activation, the consequent miR-21 level, TGFβ expression and collagen production in HG -treated MCs (Fig 4C–4H). [score:7]
This is particularly true for miR-222 which post-transcripionally regulates STAT5 expression and indirectly miPPR21 gene expression and miR-21 cellular content, via STAT5 transcriptional activity. [score:7]
In particular, we found that EVs that transfer miR-222 regulate STAT5A expression that in turn controls miR-21 and TGFβ expression as well as matrix protein synthesis. [score:6]
It has been shown that the STAT5 protein level is modulated by both miRs in different cellular contexts and that STAT5 is a direct miR-222 and miR-223 target [18– 20]. [score:4]
MC treated with MSC- and HLSC-derived EVs are protected from fibrogenic signals via the release of EV cargo; miR-222 post-transcriptionally regulates STAT5A which in turn controls miR-21 expression. [score:4]
microRNA-222 controls neovascularization by regulating signal transducer and activator of transcription 5A expression. [score:4]
Indeed, although both miRs increased in MCs that had been subjected to EV challenge, only miR-222 over -expression seems to be relevant in driving EV biological response in MCs. [score:3]
Of particular interest is the fact that miR-222 over -expression did not have an effect on LG-cultured MCs. [score:3]
miR-222 EV cargo drives STAT5A expression in HG-cultured MCs. [score:3]
Moreover, experiments into transcription blockades by alpha-amanitin suggested that miR-222 expression in MCs relied on the transfer of this specific miR from EVs into recipient cells. [score:3]
In the present study, we analyse the effects of EVs that were released from different stem cell sources on HG -induced collagen production and mitochondria damage, while paying particular attention to their effects on STAT5A, miR-21, miR-222, miR-100 and TGFβ expression. [score:3]
It has been reported that both miR-223 and miR-222 post-transcriptionally regulate STAT5 [18– 20], which led us to evaluate their expression in HG-cultured, EV treated MCs. [score:2]
Whereas miR-222 is down regulated upon HG treatment and increased upon EV treatment (Fig 4A), miR-223 increased upon both HG and EV treatment (Fig 4B). [score:2]
This highlighted a role that miR-222, miR-223 or both may play in the post-transcriptional regulation of STAT5A upon EV treatment. [score:2]
This occurs via the horizontal transfer of functional miR-222, and direct interference with damaging cues (Fig 7). [score:2]
Gain-of function experiments were performed in MCs transfected with pre-miR-222 or pre-miR-223 and cultured in LG or HG conditions (S1A and S1B Fig), in order to evaluate which miR was able to regulate STAT5 expression. [score:2]
On the other hand, STAT5 itself can be controlled by miRs, including miR-222 [18, 19], and miR-223 [20], which suggests that the overall scenario is extremely complex. [score:1]
The transfer of miR-222 into MCs by EVs was demonstrated by experiments performed in the presence of α-amanitin, using EVs that had either been pre -treated with RNAse or not at all (S1C Fig). [score:1]
RNA from cells was then reverse-transcribed either using a TaqMan microRNA RT kit, that is specific for miR-222 and miR-223, or a Syber Green microRNA RT Kit specific for miR-21 and miR-100. [score:1]
An analysis of EV miR content in both cellular sources identified miR-222 and miR-223 [27]. [score:1]
miR-222 and miR-223 expression was evaluated by qRT-PCR and normalized to RNU6B (five experiment performed in triplicate, n = 5) (p = 0.04, pre-miR-222 vs pre miR neg c in LG; p = 0.001, pre-miR-222 vs pre miR neg in HG in A; p = 0.012, pre-miR-223 vs pre miR neg c in LG; p = 0.004, pre-miR-223 vs pre miR neg in HG in B). [score:1]
S1 Fig. (A-B) Gain-of-function experiments were performed on MCs that had either been cultured in LG or HG medium for 48h, using pre-miR-222 (A) or premiR-223 (B) oligonucleotides. [score:1]
Relative luciferase activity is reported as mean±SEM (n = 4) (p = 0. 004, LG pre-miR neg c vs HG pre-miR neg c for pGL3-3’UTR-STAT5A; p = 0. 01, HG pre-miR-222 vs HG pre miR neg c). [score:1]
were performed in MCs cultured in LG or HG that had either been transfected with the pre-miR negative control or the pre-miR-222, pre-miR-223 or pre-miR-100 precursor oligonucleotides (Applied Biosystem), according to manufacturer’s instructions. [score:1]
Data were normalized to RNU6B (five experiments performed in triplicate, n = 5) (p = 0. 002, LG pre—miR neg c and LG pre-miR-222 vs HG pre-miR neg c; p = 0. 04, pre-miR-222 vs pre miR neg in HG). [score:1]
To analyse miR-222 transfer from EVs to MCs, miR transfer experiments were conducted as previously described by Yuan [34]. [score:1]
The luciferase assay further supports the role of miR-222 in driving STAT5 post-transcriptional regulation (Fig 4F). [score:1]
[1 to 20 of 28 sentences]
17
[+] score: 74
Conversely, miR-222-3p inhibitor induced a significant increase in SOD2 protein expression (Fig.   2I, left panel) not affected by Iso treatment (Fig.   2I, right panel). [score:5]
Figure 4 Summary of expression of miR-222-3p and one of its targets SOD2. [score:5]
We then used miR-222-3p mimic and inhibitor to analyze the impact of miR-222-3p on SOD2 expression in human Cytivia plus cardiomyocytes. [score:5]
To confirm this interaction, we cloned human SOD2 3′UTR (untranslated region) harboring two potential binding sites for miR-222-3p in HEK293 cells. [score:3]
We first validated the efficiency of transfection of miR-222-3p mimic and inhibitor (not shown). [score:3]
Here, we quantified an increase in miR-222-3p expression in HF-rats, in accordance with a previous study showing an increase in miR-222 during physiological hypertrophy at cell and plasma levels [22]. [score:3]
The specific miR-222 mimic and miR-222 inhibitor and negative control were used (miRVAna, Life Technologies). [score:3]
Cotransfection of miR-222-3p mimic with human SOD2 3′UTR induced a significant decrease in luciferase expression, suggesting that miR-222-3p binds to SOD2 3′UTR (Fig.   2G). [score:3]
We observed a significantly increased expression of the 4 other miRNAs in LV, at 7 days post-MI for miR-23a-3p (Fig.   1D), at 2 months post-MI for miR-21-5p (Fig.   1D) and miR-21-3p (Fig.   1A) and at both times for miR-222-3p (Fig.   1D). [score:3]
We observed that miR-222-3p mimic induced a significant decrease in SOD2 protein expression (Fig.   2H, top panel) counteracted by Iso treatment (Fig.   2H, lower panel). [score:3]
MiR-222 mimic, miR-222 inhibitor and their negative control (100 nmol/L) were transfected with the Lipofectamine 2000 (Life Technologies) reagent (4 µL) in OptiMEM (Life Technologies). [score:3]
Our data shows the potential of miR-21-5p, miR23a-3p and miR-222-3p, and their target SOD2, as new biomarkers of post-MI HF. [score:3]
In this study, we found i) the modulation of 3 miRNAs selected in silico to interact with SOD2 in LV and plasma of the experimental rat mo del of HF and a significant increase of SOD2 in LV of 2 months post-MI rats; ii) that the circulating levels of the 3 miRNAs were differentially modulated compared to LV at 7 days post-MI, suggesting that plasma expression does not completely reflect the heart specificity at early phase of LV remo deling; iii) how miR-222-3p modulated SOD2 in hypertrophied cardiomyocytes and iv) confirmed their potential as biomarkers of cardiac remo deling in human patients phenotyped for LV remo deling post-MI with gender specificity shown by significant modulation of miR-222-3p in men and of SOD2 in women (Fig.   4). [score:2]
Interestingly, SOD2 is regulated by 5 of 13 miRNAs selected by IPA, i. e. mir-21-3p, miR-21-5p, miR-23a-3p, miR-145-5p and miR-222-3p (Fig.   1A). [score:2]
We confirmed this interaction using luciferase reporter gene assays and transfection of miR-222-3p mimic and inhibitor in human cardiomyocytes. [score:2]
miR-222-3p is a post-transcriptional regulator of SOD2. [score:2]
We also identified direct interaction between miR-222-3p, SOD2 and other molecules in the REVE-2 network at baseline (Fig.   3B, details are provided Fig.   2 and Supplementary Table  3). [score:2]
Among the 3 miRNAs identified to interact with SOD2 in our experimental rat mo del of HF, only miR-222-3p was predicted to directly interact with SOD2 in human (Fig.   2G). [score:2]
MiR-222 has been described to induce cardiomyocytes proliferation and hypertrophy and inhibit apoptosis [22]. [score:2]
Our in silico analysis suggested that only miR-222-3p directly interacts with the 3′-UTR of SOD2. [score:2]
Quantification of luciferase activity in HEK293 cells after transfection of control (white) and miR-222-3p mimic (grey) (right panel). [score:1]
To understand why the levels of the 3 miRNAS and their target, SOD2 are modulated in the same way, we analyzed deeper the REVE-2 molecular network and found an interaction of miR-222-3p with the estrogen receptor 1, located in cluster 22 and characterized by a high betweeness (0.0096), indicating a potential central role of estrogen receptor with miR-222-3p in the REVE-2 network (Supplementary Table  3). [score:1]
miR-222-3p modulation. [score:1]
Our studies based on in vivo rat experimental mo del and in vitro cardiomyocyte mo dels prompted us to assess levels of circulating SOD2 and interacting miRNAS (miR-21-5p, miR-23a-3p and miR-222-3p) in patients with high LV remo deling following MI. [score:1]
The scatter plots show the correlation between SOD2 and miR-222-3p plasma levels at 3 month post-MI for all REVE-2 population (n = 246) (left panel), for men (n = 200) (middle panel) and women (n = 46)(right panel). [score:1]
Interestingly, miR-21-5p, miR-23a-3p and miR-222-3p were significantly decreased in the plasma of 7 days MI-rats and significantly increased at 2 months post-MI (Fig.   1E) without any modulation of SOD2 in plasma of HF-rats (not shown). [score:1]
The circulating levels of miR-222-3p and SOD2 were quantified in plasma of REVE-2 patients (n = 224) respectively at baseline, 3 months, 1 year post-MI and 3 months and 1 year post-MI. [score:1]
Cells were then treated with Isoproterenol (Iso, 10 µM) in serum-free medium for 24 h and 48 h. Human SOD2 3′UTR (824 bp) harboring two potential binding sites for miR-222-3p was cloned into SpeI and HindIII cloning site of pMIR-REPORT vector (Ambion). [score:1]
The resulting construct (20 ng) was co -transfected with control mirVana mimic or mirVana mimic miR-222-3p (each 30 nM, ThermoFisher Scientific) and 20 ng of β-galactosidase control plasmid (Promega) into 48well-plated HEK293 reporter cells by the use of Lipofectamine 2000 (Invitrogen). [score:1]
Here, we focused on 3 miRNAs, miR-21-5p, miR-23a-3p and miR-222-3p and their target SOD2, detected in plasma that we characterized for their potential as biomarkers of HF. [score:1]
Conversely, the significant increase of circulating levels of miR-222-3p is only found in men at 3 months post-MI (Fig.   3C, right panel). [score:1]
Interestingly, the REVE-2 molecular network previously built with 23 circulating molecules quantified in blood samples of REVE-2 patients, shows that these 3 miRNAs were highly central molecules with the highest betweeness centrality for miR-21-5p and miR-222-3p [17], indicating that they are crucial molecules to maintain functionality and coherence of signaling mechanisms in the REVE-2 network. [score:1]
In this study, we showed for the first time, that levels of circulating miR-21-5p, miR-23a-3p and miR-222-3p decrease in patients with high remo deling at baseline and increase at 3 months post-MI. [score:1]
Detailed information are provided as Fig.   2 and Supplementary Table  3. (C) Quantification by RT-qPCR of miR-222-3p in plasma extracted from REVE-2 patients at baseline and after 3 months and 1 year post-MI for all the population (left panel). [score:1]
miR-222-3p and SOD2 were quantified in LV and plasma of experimental mo del of MI rat at 7 days (n = 9) and 2 months (n = 9) after MI (n = 18) or sham (n = 18) surgery. [score:1]
Moreover, we observed a significant correlation between circulating levels of SOD2 and of miR-222-3p quantified at 3 months post-MI in the whole REVE-2 population and men population but not in women population (Fig.   3D). [score:1]
[1 to 20 of 36 sentences]
18
[+] score: 73
This mechanism may be relevant in affecting miRNA expression; however, we suggest that an aberrant miRNA expression, i. e. up-regulation of miR-21, miR-148a and miR-222 in NRs, may be important in establishing resistance independently from p53, protecting cells from apoptosis. [score:8]
Indeed, miR-222 can target the cell growth suppressive cyclin -dependent kinase inhibitors p27 and p57 and the c-KIT receptor (source: Tarbase) thus promoting cell cycle progression [23, 32]. [score:7]
Among the various miRNAs differentially expressed between NR versus CR patients, miR-21, miR-222 and miR-148a emerged as significantly up-regulated in two different cohorts of refractory patients, both before and after fludarabine administration. [score:6]
Importantly, inhibition of miR-21 and miR-222 by anti-miRNA oligonucleotides induced a significant increase in caspase activity in fludarabine -treated p53-mutant MEG-01 cells, suggesting that miR-21 and miR-222 up-regulation may be involved in the establishment of fludarabine resistance. [score:6]
In this study, we found that some miRNAs, namely miR-222, miR-148a and miR-21 were differentially expressed between NR and CR CLLs both before and after fludarabine treatment and were all up-regulated in the NR group. [score:6]
An higher expression of miR-222 has been associated with poor survival in pancreatic cancer [36] and the enforced expression of miR-221/222 improved the growth of prostate carcinoma xenografts in mice [37]. [score:5]
Here, we report that inhibition of miR-222 and miR-21 in the MEG-01 human cells using an anti-miRNA oligonucleotide increases susceptibility to fludarabine, as shown by the significant increase in caspase activity. [score:3]
Interestingly, after validation by quantitative PCR of the most significant miRNAs (miR-21, miR-222 and miR-148a) in an independent population, the prediction of response to therapy for pre-therapy samples was impressive: a predictive score based on miRNA expression levels reached an overall accuracy of 100%. [score:3]
Indeed, inhibition of miR-21 and miR-222 may increase sensitivity to fludarabine in vitro in a p53-mutant cell line. [score:3]
Inhibition of miR-21 and miR-222 increases caspase activity after fludarabine treatment. [score:3]
The inhibition of miR-21 and miR-222 sensitizes the cells to fludarabine action, leading to an increased caspase activation when fludarabine 1 μM is added after 24 hours. [score:3]
Among the identified microRNAs, miR-148a, miR-222 and miR-21 exhibited a significantly higher expression in non-responder patients either before and after fludarabine treatment. [score:3]
LNA knockdown probe anti-miR-2 and Scramble-miR control were from Exiqon, Negative control, anti-miR-148a and anti-miR-222 were from Ambion. [score:2]
Our findings suggest a direct role of miR-222 and miR-21 in conferring resistance to fludarabine chemotherapy independently from the p53 pathway, which is dysfunctional in this human cell line [48]. [score:2]
To verify whether the three validated miRNAs (miR-21, miR-148a and miR-222) might be able to predict the efficacy of fludarabine treatment and might therefore become useful in directing patients therapy, we collected a new cohort of 12 patients (test set). [score:2]
MiR-21 has a well-established role in protection from apoptosis and drug-response modulation [22] and miR-222 is an important cell cycle regulator through its action on p27 [23, 24]. [score:2]
classified as NRs displayed a significantly (p < 0.05 at two-tailed t-test) increased expression of miR-21, miR-148a and miR-222 if compared to patients sensitive to treatment. [score:2]
A significant (p < 0.01) increase of caspase 3/7 activity was detected for miR-21 and miR-222 (Figure 5A, B) while no difference was observed for miR-148a (Figure 5C). [score:1]
For miR-21, miR-222 and miR-148a, a CR vs NR threshold value was determined by calculating and selecting the first integer number above the 98th percentile of expression values (as described in quantitative RT-PCR method) distribution in CR group. [score:1]
Cells were cultured in 96-well plates the day before LNA-anti-miR-21, anti-miR-222, anti-miR-148a and control transfections (50 nmol). [score:1]
validation for miR-222, miR148a and miR-21 in CLL patients. [score:1]
Figure 3 validation for miR-222, miR148a and miR-21 in independent CLL patients. [score:1]
We hereby concluded that the high miR-21 and miR-222 levels may be responsible for a weaker apoptotic effect of fludarabine in refractory patients, while the mechanism of action of miR-148a remains to be established. [score:1]
LNA-anti-miR-21 and anti-miR-222, but not anti-miR-148a, were able to induce increase apoptosis in MEG-01 cells, which harbor a mutant p53 protein. [score:1]
[1 to 20 of 24 sentences]
19
[+] score: 68
The MET oncogene is involved in miR-221/222 activation through the c-Jun transcription factor FOXO3A Breast cancerThe miR-221/222 cluster targets FOXO3A to suppress p27 [kip1] also at a transcriptional level KIT Endothelial cells Interaction between miR-222 and c-Kit is likely to be part of a complex circuit that controls the ability of endothelial cells to form new capillaries ESR1 Breast cancer Modulation of ERα is associated with antiestrogen therapy PUMA Glioblastoma miR-221/222 directly regulate apoptosis by targeting PUMA in glioblastoma TRSP1 Breast cancer miR-221/222 promote EMT and contribute to the more aggressive clinical behavior of basal-like breast cancers PTPμ Glioblastoma miR-221/222 regulate glioma tumorigenesis at least in part through the control of PTPμ protein expression DICER Breast cancer Dicer is low in ERα -negative breast cancers, since such cells express high miR-221/222 APAF1 Non-small cell lung cancer miR-221/222 are modulated by both epidermal growth factor (EGF) and MET receptors, and, by targeting APAF1, miR-221/222 are responsible for gefitinib resistance miR-155 SOCS1 Breast cancer miR-155 is an oncomiR in breast cancer, and it has been suggested that miR-155 may serve as a bridge between inflammation and cancer CEBPB, PU. [score:16]
Interestingly, ectopic expression of miR-221 and miR-222 rendered the parental cells resistant to tamoxifen, and the effect was partially related to the down-regulation of the cell cycle inhibitor p27 [kip1], a known target of miR-221 and miR-222. [score:10]
Recently, we also reported that the hepatocyte growth factor receptor (MET) oncogene, through c-Jun transcriptional activation, up-regulates miR-221 and miR-222 expression, which, in turn, by targeting PTEN and TIMP3, confers resistance to TRAIL -induced cell death and enhances tumorigenicity of lung and liver cancer cells (82). [score:8]
We also demonstrated that gefitinib resistance could be overcome by MET inhibitors, which down-regulate miR-221 and miR-222 and sensitize lung cancer cells to gefitinib, or by anti-miR-221 and anti-miR-222, which strongly increase gefitinib sensitivity in vitro and in xenograft mouse mo dels in vivo (10). [score:6]
For example, miR-221 and miR-222 have been shown to activate cell proliferation by repressing a series of tumor suppressors, all of which are involved in cell cycle inhibition, like p27 (5), its activator FOXO3a (6), p57 (7), BMF (8), PTEN (9), and APAF1 (10). [score:5]
Up-regulation of miR-221 and miR-222 has also been implicated in resistance to drugs such as fulvestrant (82) and cisplatin (83) in breast cancer, castration-resistant prostate cancer (84), TRAIL-resistant non-small cell lung cancer cells (80), and radiation-resistant gastric carcinoma cells (85). [score:4]
In our most recent manuscript, we explored the involvement of MET-modulated miR-221 and miR-222 in the development of de novo and acquired resistance of lung cancer cells to tyrosine kinase inhibitors, such as gefitinib, the first line of treatment for EGFR -positive lung cancer patients (10). [score:4]
This result supports well the involvement of miR-221 and miR-222 in determining the TRAIL-resistant/sensitive phenotype in NSCLC cells mainly by miR-221 and miR-222 interfering with p27 [kip1] expression and TRAIL -induced caspase machinery. [score:3]
Specifically, we demonstrated that silencing p27 [kip1] but not Kit, both functional targets of miR-221 and miR-222, increased resistance to TRAIL (80). [score:3]
Many other miRNAs have been reported to act as oncogenes (Table II) by inducing tumor growth, aggressiveness, and resistance to chemotherapy when expressed ectopically in vitro or in vivo: miR-155, miR-221, and miR-222 cluster, miR-9 and miR-103/107 family. [score:3]
In 2005, our lab addressed the implication of miRNAs in TRAIL-resistance of non-small cell lung carcinoma, and we found that miR-221 and miR-222 were markedly up-regulated in TRAIL-resistant and semi-resistant cells compared to TRAIL-sensitive NSCLC cells. [score:3]
Majumder's group demonstrated in 2008 that miR-221 and miR-222 are the most modulated miRNAs in cells with acquired resistance to tamoxifen (81). [score:1]
Another interesting application of miR-221 and miR-222 on drug resistance has been described in tamoxifen resistance in breast cancer. [score:1]
In this regard, the first story that we would like to illustrate came from our laboratory and describes the involvement of the miR-221 and miR-222 cluster in TNF-related apoptosis-inducing ligand (TRAIL)- and gefitinib-resistance of non-small cell lung cancer (NSCLC) (10,80,9). [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 68
Other miRNAs from this paper: hsa-mir-21, hsa-mir-146a
With the understanding that recognition of mRNA targets is speculative, we explored miR-222, miR-21, and miR-146a targets and examined whether these targeted genes are overrepresented in pathways annotated in the KEGG database. [score:7]
In noncurrent smokers, miR-222 expression was up-regulated in response to chromium (β = 37.09; 95% CI, 13.72 to 60.46; p = 0.003), lead (β = 0.19; 95% CI, 0.03 to 0.34; p = 0.020), and cadmium (β = 141.34; 95% CI, 7.32 to 275.36; p = 0.039), whereas in current smokers we observed no significant association. [score:6]
The results stratified by age showed that in subjects 25–45 years of age miR-222 was up -regulated in association with lead (β = 0.21; 95% CI, 0.08 to 0.34; p = 0.003), whereas miR-146a expression was down- regulated in association with lead (β = −0.38; 95% CI, −0.59 to −0.17; p = 0.001). [score:5]
In postexposure samples, miR-222 expression was positively correlated with lead exposure (β = 0.41, p = 0.02), whereas miR-21 expression was associated with blood 8 -hydroxyguanine (β = 0.11, p = 0.03) but not with individual PM size fractions or metal components. [score:5]
Associations of individual exposure levels to PM and PM metal components with miR-222, miR-21, and miR-146a expression. [score:3]
jp/kegg), a pathway analysis database, to the target genes identified for miR-21, miR-222, and miR-146a using miRanda. [score:3]
of the present study show that associations of metals with miR-222 and miR-146a expression were limited to nonsmokers. [score:3]
miR-222 expression has been related with nitric oxide (Suarez et al. 2007) and redox signaling (Sen et al. 2009). [score:3]
A total of 1,056 target genes were annotated for miR-222, 1,065 for miR-21, and 1,038 for miR-146a. [score:3]
miR-222 expression exhibited a positive association with the levels of lead exposure [unadjusted analysis: β [std] = 0.33; 95% confidence interval (CI), 0.07 to 0.76; p = 0.02; multivariable regression: β [std] = 0.41; 95% CI, −0.01 to 0.67; p = 0.06, adjusting for age, BMI, current smoking, number of cigarettes per day, and percent granulocytes]. [score:3]
Associations of miR-222, miR-21, and miR-146a expression with 8-OH-dG. [score:3]
Differences in miR-222, miR-21, and miR-146a expression between baseline (time 1) and postexposure (time 2). [score:3]
Target mapping and functional analysis: potential interactions of miR-222, miR-21, and miR-146a with signal transduction pathways. [score:3]
do) to predict the target genes of miR-222, miR-21, and miR-146a. [score:3]
Expression of miR-222 and miR-21 (using the 2−ΔΔC [T] method) was significantly increased in postexposure samples (miR-222: baseline = 0.68 ± 3.41, postexposure = 2.16 ± 2.25, p = 0.002; miR-21: baseline = 4.10 ± 3.04, postexposure = 4.66 ± 2.63, p = 0.05). [score:3]
An up-regulation of miR-222, as measured in our study, may suggest an increased proliferation rate of blood leukocytes in response to environmental stimuli that are able to induce inflammation responses. [score:2]
We found that miR-222 and miR-21 expression was increased in postexposure samples collected after 3 workdays, compared with baseline samples. [score:2]
We found two pathways related to miR-222, seven related to miR-21, and six related to miR-146a (Table 4). [score:1]
miR-222 expression in postexposure samples was positively associated with the mean lead exposure measured in the PM [10] fraction of the PM mass during the 3 workdays, whereas we found no significant association of miR-21 expression with the exposures levels we evaluated. [score:1]
We measured miR-222, miR-21, and miR-146a expression in blood leukocyte RNA on the first day of a workweek (baseline) and after 3 days of work (postexposure). [score:1]
To find signal transduction pathways related to miR-222, miR-21, and miR-146a, we used LitInspector (http://www. [score:1]
Using LitInspector, we scanned PubMed for co-occurrence of the user input gene (miR-222, miR-21, or miR-146a) and the general pathway key words in the same sentence. [score:1]
miR-222 and miR-146a were not associated with 8-OH-dG (Table 2). [score:1]
A total of 150 KEGG pathways were annotated for miR-222, 153 for miR-21, and 160 for miR-146a. [score:1]
Two LitInspector pathways were annotated for miR-222, seven for miR-21, and six for miR-146a. [score:1]
[1 to 20 of 25 sentences]
21
[+] score: 61
For example, the up-regulation of miR-34a and miR-195 was associated with a down-regulation of BCL2 and SGK1 protein levels, respectively; whereas the down-regulation of miR-193b, miR-221, miR-222 and miR-7 was associated with an up-regulation of MCL1, BCL2L11 (Bim), CDN1B (p 27) and VDAC1 protein levels, respectively (Figure 9A). [score:13]
Among the 22 differentially expressed microRNAs, 13 microRNAs were up-regulated (e. g. miR-34a, miR-100) and 9 microRNAs were down-regulated (e. g. miR-221, miR-222) by Par-4. Unsupervised hierarchical clustering based on the 22 microRNAs confirmed the segregation between empty vector- and Par-4 -transfected cells (Figure 8B). [score:9]
Moreover, miR-221, miR-222 and miR-134 are up-regulated in lymphocytic leukemia, pancreatic, liver, esophagus, or thyroid cancers [57- 59], whereas miR-34a and miR-100 are down-regulated in neuroblastoma [60], esophagus and ovary cancers [8, 58]. [score:7]
For example, miR-221, and miR-222 are up-regulated, while miR-34a, miR-18a, miR-30d and miR-34b are down-regulated in colon cancer [54- 56]. [score:7]
Our qRT-PCR results showed that miR-18a, miR-193, miR-221, miR-222 and miR-7 were down-regulated, whereas miR-195, miR-30d and miR-34a were up-regulated in Par-4 -transfected cells when compared with empty vector -transfected cells (Figure 8C). [score:6]
The Par-4-down-regulated microRNAs miR-221, miR-222 and miR-7 were predicted to target the pro-apoptotic genes BCL2L11 (Bim), CDN1B (p27) and VDAC1, respectively (Figure 8B and 8C; see Additional file 8). [score:6]
To the best of our knowledge, the predicted target mRNAs of miR-193b, miR-195 and miR-7 have yet to be functionally validated; whereas BCL2, BCL2L11 (Bim) and CDN1B (p 27) have been functionally validated (by Western blot or qRT-PCR analysis) as target mRNAs of miR-34a, miR-221 and miR-222 in human neuroblastoma, prostate cancer and rat PC12 cell lines [40- 42]. [score:5]
Eleven (miR-30d, miR-10b, miR-34a, miR-195, miR-222, miR-221, miR-31, miR-7, miR-663, miR-193b and miR-18a) out of 22 deregulated microRNAs accounted for the 283 predicted target mRNAs linked to cell death (e. g. pro- or anti-apoptotic genes) (see Additional file 8). [score:4]
Note that both miR-221 and miR-222 are predicted to target BCL2L11 (encoding Bim) and CDKN1B (p27). [score:3]
Fold changes for miR-18a, miR-193b, mi-195, miR-221, miR-222, miR-30d, miR-30d, miR-34a and miR-7 are indicated. [score:1]
[1 to 20 of 10 sentences]
22
[+] score: 58
Moreover, Silber et al. also found that the expression of miR-124 and miR-137 was associated with neuronal-like opposed to astrocyte-like differentiation, while the most up-regulated miRNAs in our study (miR-21, miR-29a, miR-29b, miR-221 and miR-222) are associated to the GBM subclass showing a miRNA expression profile evocative to that of astrocytic precursors, according to the five subgroups of GBM defined by Kim et al. based on miRNA expression profiles [34]. [score:10]
Expression changes were also validated by q-RT-PCR for seven miRNAs: 5 up-regulated (hsa-miR-21, hsa-miR-29a, hsa-miR-29b, hsa-miR-221 and hsa-miR-222) and 2 down-regulated (hsa-miR-93 and hsa-miR-106a) (Figure 3B-H). [score:9]
Similar results were observed for TUJ1 expression, which was decreased after inhibition of miR-221 (0.66±0.22 fold, p=0.012; Figure 4C) and showed a tendency to decrease after miR-222 inhibition (0.77±0.40 fold, p=0.168; Figure 4D). [score:7]
mRNA results were validated at the protein level by immunofluorescence (Figure 4E) and subsequent quantification (Figure 4F): Nestin expression increased in GN1C cells after inhibition of miR-221 (106383.4±8380.7 Mean Fluorescence Intensity (MFI), p=0,037) and miR-222 (112897.7±1819.4 MFI, p<0.001) compared to cells transfected with an anti-miR negative control (94505.4±13043.5 MFI), GFAP levels decreased in GN1C cells transfected with anti-miR-221 (43122.5±3114.4 MFI, p<0.001) and anti-miR-222 (44499.5±2202.2 MFI, p<0.001) compared to control cells (71093.5±9864.8 MFI), and TUJ1 levels were reduced upon miR-221 inhibition (66062.5±2774.7 vs. [score:5]
Analysis of mRNA expression of progenitor and differentiation markers resulted in an increase in Nestin levels for both miR-221 (1.48±0.23 fold, p=0.001; Figure 4C) and miR-222 inhibition (1.25±0.13 fold, p=0.005; Figure 4D), in comparison to control cells. [score:5]
98468.3±7645.5 MFI, p<0.001) but not after inhibiting miR-222 (Figure 4E-F). [score:3]
The expression of miR-221 and miR-222 was normalized with respect to RNU6B as 2 [-ΔCt]. [score:3]
In addition, a decrease in GFAP mRNA levels was observed after inhibiting either miR-221 (0.77±0.16 fold, p=0.012; Figure 4C) or miR-222 (0.60±0.14 fold, p<0.001; Figure 4D). [score:3]
In order to unveil the potential role of these miRNAs in GIC differentiation, we separately inhibited miR-221 and miR-222 in GN1C cells during 14 days of differentiation (Figure 4A-B). [score:3]
miR-221 and miR-222 inhibition in GN1C cells growing in differentiation medium was carried out with specific anti-miRs and was confirmed by q-RT-PCR 14 days after transfection, compared to cells transfected with anti-miR negative control (anti-C-) (A, B). [score:2]
Cells were assayed for the expression of miR-221 (B), miR-222 (D) or miR-21 (F) by q-RT-PCR. [score:2]
0077098.g004 Figure 4miR-221 and miR-222 inhibition in GN1C cells growing in differentiation medium was carried out with specific anti-miRs and was confirmed by q-RT-PCR 14 days after transfection, compared to cells transfected with anti-miR negative control (anti-C-) (A, B). [score:2]
Validation of the differential expression of miR-29a (B), miR-29b (C), miR-221 (D), miR-222 (E), miR-21 (F), miR-93 (G) and miR-106a (H) was carried out by q-RT-PCR using specific TaqMan microRNA assays, normalizing their expression values with respect to RNU6B levels and to the NS state by calculating 2 [-ΔΔCt]. [score:2]
NSs were disaggregated with Accutase solution (Sigma-Aldrich) and 1-2x10 [5] cells were transfected with 100 nM pre-miRNA or anti-miRNA oligonucleotides specific for miR-21, miR-29a, miR-29b, miR-221 and miR-222 or pre/anti-miRNA negative controls 1 (Ambion) using Nanojuice (Novagen) following the manufacturer´s instructions. [score:1]
G52 cells transfected with anti-miR-221 (anti-221), anti-mir-222 (anti-222) and anti-miR negative control 1 (anti-C-) were cultured for 14 days in differentiation medium (A- D). [score:1]
[1 to 20 of 15 sentences]
23
[+] score: 57
Other miRNAs from this paper: hsa-mir-22, hsa-mir-221
However, expression of PUMA largely abrogated miR-221/222 effects on cell apoptosis (Fig. 3C), suggesting that PUMA is a critical target of miR-221 and miR-222 involved in cell apoptosis. [score:5]
Previous studies have documented miR-221 and miR-222 regulation of cell cycle progression and cell proliferation by targeting p27 and p57 [16- 18]. [score:4]
MiR-221 and miR-222 (miR-221/222) are frequently up-regulated in various types of human malignancy including glioblastoma. [score:4]
To determine the mechanism by which miR-221 and miR-222 regulate cell apoptosis, we performed miRNA target search using Pictar and found 3'UTR of PUMA containing the highly conserved putative miR-221 and miR-222 binding sites (Fig. 2A). [score:4]
Having demonstrated PUMA as a direct target of miR-221 and miR-222, we next examined the importance of PUMA in miR-221/222 -mediated cell survival. [score:4]
Since H4 expressed low level of miR-221/222, we transfected PUMA lacking 3'UTR together with and without miR-221 and miR-222 into the H4 cells (Fig. 3A). [score:3]
Annexin V analysis showed that expression of miR-221 and/or miR-222 significantly reduced cell apoptosis induced by serum starvation (Fig. 3B). [score:3]
The retroviruses expressing miR-221 or miR-222 were obtained by transfection of pMSCV-miR-221 and -miR-222 into PT67 packaging cells and selected with blasticidin S (10 μg/ml) for six weeks. [score:3]
As initial step, we carried out Northern blot analysis of miR-221 and miR-222 expression in a panel of glioma cell lines. [score:3]
PUMA is a target for miR-221 and miR-222. [score:3]
Since collapse of the mitochondrial membrane potential is one of the early events in apoptosis [20], we next examined if miR-221 and miR-222 regulate mitochondrial membrane potential. [score:2]
Since miR-221 and miR-222 are frequently elevated in glioblastoma and play an important role in cell survival, we further examined the effects of knockdown of miR-221/222 on tumor growth. [score:2]
In addition, caspase 3/7 activity was also considerably elevated in miR-221 and miR-222 knocked down cells (Fig. 1E). [score:2]
Fig. 1A showed that U251, TJ866 and TJ899 cells expressed higher levels of miR-221 and miR-222 compared to other cell lines. [score:2]
200 pmol As-miR-221 and/or As-miR-222 were transfected using Lipofectamine 2000 (Invitrogen). [score:1]
To examine biological significance of miR-221 and miR-222 in glioma, U251 and LN229 cells were treated with As-miR-221 and/or As-miR-222 (Fig. 1B). [score:1]
These findings indicate that miR-221 and miR-222 play an important role in initiation of cell apoptosis. [score:1]
The sequences are: 2'-OMe-As-miR-221 (As-miR-221), 5'-AGCUACAUUGUCUGCUGGGUUUC-3'; 2'-OMe-As-miR-222 (As-miR-222), 5'-AGCUACAUCUGGCUACUGGGU-3'. [score:1]
Following the UV cross-linked, he membrane was hybridized with digoxigenin (DIG)-labeled miR-221 and miR-222 probes overnight in a buffer containing 5× SSC, 20 mmol/L Na [2]HPO [4 ](pH 7.2), 7% SDS, 1× Denhardt's solution and 0.2 mg/mL salmon sperm DNA. [score:1]
MiR-221 and miR-222-LNA oligonucleotides contained locked nucleic acids at five locations (underlined): 5'-GAA A CC C AG C AG AC A ATG TA G CT-3' (miR-221); 5'-GAG A CC C AG TA G CCA GAT G TA GCT-3' (miR-222). [score:1]
Sequence alignment of miR-221, miR-222 and the conserved binding sites among the different vertebrate species (Red, G:C pair or A:U pair; Blue, G:U pair). [score:1]
Interestingly, annexin V-labeling revealed that knockdown of miR-221 and miR-222 significantly increased cell apoptosis compared to the cells treated with scramble oligonucleotide (Fig. 1C). [score:1]
The cells with depletion of miR-221 and miR-222 were stained with cationic dye JC-1. FACSCalibur analysis showed that the mitochondrial membrane potential was largely damaged when miR-221 and miR-222 were depleted (Fig. 1F). [score:1]
Once cells grew to 60% confluence, cells were infected with pMSCV-miR-221 and/or pMSCV-miR-222 at a multiplicity of infection (MOI) of 50. [score:1]
Human pMSCV-miR-221 and -miR-222 were kindly provided by. [score:1]
R Agami, Division of Tumor Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands, for kindly providing the retroviral constructs of miR-221 and miR-222. [score:1]
When the tumor volume reached 50 mm [3], the mice were randomly divided into three groups (ten mice per group) which were treated with 200 pmol scramble oligo, As-miR-221 and As-miR-222 in 10 μl Lipofectamine or PBS through local injection of xenograft tumor in multiple sites. [score:1]
[1 to 20 of 27 sentences]
24
[+] score: 55
Here, we chose three miRNAs (miR-100, miR-222 and miR-30a) with the significantly increased expression in both A/exo and D/exo for prediction because all these miRNAs displayed a consistent up-regulation in both MCF-7/Adr and MCF-7/Doc as we previously reported [15]. [score:6]
Although PTEN was present at lower level in miR-222 mimics -treated MCF-7/S relative to MCF-7/S (Fig. 8B; ** P<0.05), its expression did not show a trend for lower expression in MCF-7/S receiving A/exo. [score:5]
Here we chose miR-100, miR-222 and miR-30a for further study because all these miRNAs displayed a consistent up-regulation in A/exo, D/exo, MCF-7/Adr and MCF-7/Doc [15]. [score:4]
So far, there is no direct evidence as to the involvement of exosome- delivered miR-100, miR-222 and miR-30a in actually modulating the targets within recipient sensitive cells. [score:4]
In the present study, we showed that miR-222-rich D/exo could alter PTEN expression in acquired cells. [score:3]
To preliminarily assess the contribution of exosome-contained miRNAs, we chose miR-222 and its target gene PTEN. [score:3]
Additionally, PTEN in MCF-7/S transfected with miR-222 mimics was strikingly decreased compared with that in control MCF-7/S, suggesting that miR-222 could regulate drug resistance by targeting PTEN (Fig. 8C; ** P<0.05). [score:3]
After target gene prediction and KEGG pathway analysis, we found one pathway for miR-100, five pathways for miR-222 and eleven pathways for miR-30a. [score:3]
PTEN, one of the most altered tumor suppressor genes in BCa which functions to antagonize the activity of PI3K and block cell proliferation, was inversely correlated with miR-222 as Garofalo et al. reported [42]. [score:3]
In particular, both miR-100 and miR-222 were significantly related to “pathways in cancer”, suggesting that increased expression of these two miRNAs may serve as potential biomarkers for BCa. [score:3]
Compared to S/exo, the levels of miR-100, miR-17, miR-222, miR-342-3p and miR-451 were significantly up-regulated in A/exo and D/exo using qRT-PCR. [score:3]
Then, miR-222 and its target gene PTEN were picked to preliminarily assess the contribution of exosome-contained miRNAs. [score:3]
Likewise, the co-culture of MCF-7/S with A/exo resulted in significantly fold higher expressions of miR-100, miR-222, miR-30a and miR-17, as compared to MCF-7/S (not shown). [score:2]
This was based on miR-222 mimics transfection experiment and further confirmed by qRT-PCR analysis of PTEN within D/exo -treated MCF-7/S. [score:1]
In selected experiments, miR-222 mimics (15 nM) or control mimics were transfected into MCF-7/S (MCF-7/S + miR-222 mimics and MCF-7/S + control mimics) using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instruction. [score:1]
Perhaps the impaired reduction of PTEN in acquired cells was attributed to the low level of miR-222 observed in A/exo. [score:1]
At 24 h after transfection, the cells were reseeded in 6-well plates for another 48 h. Then, total RNA was extracted and pooled as per manufacturer's protocols from i) MCF-7/S, ii) MCF-7/S + A/exo or MCF-7/S + D/exo, iii) MCF-7/Adr or MCF-7/Doc, iv) A/exo or D/exo, v) MCF-7/S + miR-222 mimics, and vi) MCF-7/S + control mimics. [score:1]
MCF-7/S + miR-222 mimics; # P<0.05, MCF-7/S vs. [score:1]
Our results of increased G1/G2 phase and decreased S phase in MCF-7/S after A/exo or D/exo co-culture might be due to the transfer of miR-222. [score:1]
In the present study, both MCF-7/S and resistant sublines as well as their exosomes carried several miRNAs, namely, miR-100, miR-222, miR-30a and miR-17. [score:1]
Five miRNAs were selected for validation, all of which (miR-100, miR-17, miR-222, miR-342-3p and miR-451) were elevated in both A/exo and D/exo. [score:1]
0095240.g008 Figure 8(A) miR-100, miR-222, miR-30a and miR-17 were analyzed in D/exo, MCF-7/Doc, the recipient MCF-7/S before and after D/exo incubation. [score:1]
qRT-PCR analysis showed that both MCF-7/S and MCF-7/Doc as well as D/exo carried miR-100, miR-222, miR-30a and miR-17 (Fig. 8A; ** P<0.05). [score:1]
[1 to 20 of 23 sentences]
25
[+] score: 52
In contrast, it has been shown that simultaneous targeted inhibition of miR-221-3p and miR-222-3p affects multiple pro-oncogenic pathways, reverses the aggressive HCC phenotype, and suppresses tumor growth [24, 29, 32]. [score:7]
Importantly, several of the identified miRNAs, including miR-34a, miR-93-5p, miR-221-3p, and miR-222-3p, were also significantly over-expressed in human HCC suggesting that aberrant expression of these miRNAs may serve as an indicator of the hepatocarcinogenic process. [score:5]
Several reports have demonstrated over -expression of miR-221-3p and miR-222-3p in human HCC, which is associated with inhibition of apoptosis, activation of the TGF-β, Wnt/β-catenin, and mTOR signaling pathways, cell migration, invasion, and the formation of a more aggressive tumor phenotype [27– 31]. [score:5]
We also demonstrated that over -expression of miR-25-3p, miR-93-5p, miR-106b-5p, miR-221-3p, and miR-222-3p was accompanied by the reduced protein levels of their targets, including E2F1, PTEN, and CDKN1A. [score:5]
Among the miRNAs distinctively over-expressed in NASH-derived HCC, miR-221-3p and miR-222-3p, which exhibited a carcinogenesis stage -dependent increase in expression, and miR-25-3p, miR-93-5p, and miR-106b-5p, which are members of the oncogenic miR-106b∼25 cluster, are of special interest. [score:5]
Additionally, it has been demonstrated that miR-221-3p and miR-222-3p also target PTEN and CDKN1A [44, 45], indicating that the oncogenic activity of miR-93-5p, miR-221-3p, and miR-222-3p may be attributed to the silencing of these key cancer-related genes and consequent impairment in cell-cycle arrest and inhibition of apoptosis. [score:5]
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Figure 3 shows that the expression of four miRNAs, miR-34a-5p, miR-93-5p miR-221-3p, and miR-222-3p, that were over-expressed in mouse NASH-derived HCC was also significantly greater in human HCC (n = 358) as compared to non-tumor liver tissue samples (n = 50). [score:4]
The statistical analyses of miR-34a-5p, miR-93-5p, miR-221-3p, and miR-222-3p expression datasets in human HCC samples were conducted by the Mann-Whitney Rank Sum test. [score:3]
Among these 19 differentially expressed miRNAs in HCC (20 weeks), 10 of the miRNAs were significantly different from that in NASH-fibrotic livers (12 weeks), among which miR-221-3p, miR-222-3p, and miR-223-3p showed a progressive stage -dependent increase (Figure 2A). [score:3]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
Importantly, five of these miRNAs (miR-34a-5p, miR-93-5p, miR-106b-5p, miR-221-3p, and miR-222-3p) were in common with those in the 10-miRNA set in our study. [score:1]
Levels of miR-34a-5p, miR-93-5p, miR-221-3p, and miR-222-3p in human HCC samples. [score:1]
[1 to 20 of 13 sentences]
26
[+] score: 49
Other miRNAs from this paper: hsa-mir-221
The expression level of miR-221 and miR-222 were examined by qRT-PCR in 4 TNBC lines: MDA-MB-231, Hs-578T, BT-20, and MDA-MB-468; 2 HER2 positive lines: SKBR3 and MDA-MB-361; and 3 ER positive lines: T47D, ZR75–1, and MCF-7. In comparison to the expression level in normal breast tissue (RNA acquired from Applied Biosystems), miR-221 is up-regulated in all the TNBC lines while down-regulated in the non-TNBC lines (Figure 1A). [score:11]
In breast cancer, miR-221/miR-222 have been shown to be involved in regulation of ERα expression, suppression of ERα -mediated signaling, as well as drug resistance mechanisms [23]– [27]. [score:6]
These results indicate that although miR-221/miR-222 are both down-regulated in non-TNBC cells, miR-221 is specifically over-expressed in the TNBC cell lines in comparison to normal breast tissue. [score:6]
Surprisingly, although clustered with miR-221, the expression level of miR-222 is only up-regulated mildly (1–1.5 fold) in Hs-578-T and BT-20 (compared to normal breast tissue), but down regulated in MDA-MB-468 and the other non-TNBC lines tested (Figure 1B). [score:6]
However, the relative expression level of miR-221 versus normal breast tissue is higher in the comparison to miR-222, and since miR-221, but not miR-222, was specifically over expressed in the TNBCs tested, we focused our experiments on miR-221. [score:5]
Since miR-221 and miR-222 are highly homologous and contain identical seed sequences, one might expect them to regulate the same target genes and play similar biological functions in cancer cells [17]. [score:4]
miR-221 and miR-222 are encoded in tandem from a gene cluster located on chromosome X and have been shown to be up-regulated in a panoply of cancer types. [score:4]
More recently miR-221/miR-222 have been shown to be over-expressed in triple -negative primary breast cancers or cell lines [28]– [30]. [score:3]
TaqMan miRNA assays (Life Technologies, CA) were used to quantify the expression levels of mature miR-221 and miR-222 as well mRNAs p27, Snail, Slug, vimentin and E-Cadherin. [score:2]
qRT-PCR was performed to quantitatively measure RNA expression levels of miR-221 (A) and miR-222 (B) in a panel of breast cancer cell lines. [score:1]
0062170.g001 Figure 1 qRT-PCR was performed to quantitatively measure RNA expression levels of miR-221 (A) and miR-222 (B) in a panel of breast cancer cell lines. [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 47
MicroRNA Variation * Targets Function miR-16-5p down-regulated FEAT (faint expression in normal tissues, aberrant overexpression in tumors) Tumor, suppressor[31, 32, 33] CCND1 (Cyclin D1) BCL2 (B-cell lymphoma 2) RPS6KB1 (Ribosomal protein S6) miR-29a-3p up-regulated TTP (tristetraprolin) MetastamiR, OncomiR (drug resistance)[34, 35] PTEN miR-126-3p down-regulated VEGF Tumor, suppressor, MetastamiR[36, 37, 38, 39, 40, 41] PIK3R2 (phosphoinositide-3-kinase regulatory subunit 2) IRS-1 (Insulin receptor substrate 1) adapter molecule Crk SDF-1α (stromal cell-derived factor-1 alpha) KRAS miR-222-3p up-regulated ERα OncomiR (drug resistance)[35, 42, 43]p27 [Kip1] (cyclin -dependent kinase inhibitor 1B) p57 (cyclin -dependent kinase inhibitor 1C) TIMP3 (tissue inhibitor of metalloproteinase-3) * As compared with normal tissue or parental cell lines in case of preclinical data. [score:29]
miR-126-3p expression was associated with HER2 status and miR-222-3p expression with PR status. [score:5]
Especially altered expression of miR-29a-3p, miR-126-3p, and miR-222-3p, but also of miR-16-5p can be involved in breast cancer development, tumor spread, proliferation and drug resistance (Table 3). [score:4]
Despite the stable expression of miR-16-5p, miR-29a-3p miR-126-3p, and miR-222-3p in our patient cohort, these microRNAs have distinct functions in breast cancer. [score:3]
Out of the 12 candidates miR-222-3p (p = 0.008) and miR-146a-5p (p = 0.006) showed even significant different expression between the breast cancer subtypes (Table S4, Supplementary Material). [score:3]
As illustrated by boxplots (Figure 2 for miR-16-5p, miR-29a-3p miR-126-3p, miR-222-3p and Figure S1 (Supplementary Material) for all other housekeeper candidates), median C [t]-values of miR-16-5p were most consistent between different subgroups (i. e., primary tumor, metastasis, hormone receptor positive, HER2 positive, triple negative). [score:1]
Expression levels of four of these microRNAs (miR-16-5p, miR-29a-3p, miR-126-3p, and miR-222-3p) showed also a high correlation with the median of all measured microRNAs (rho ≥ 0.8) and, therefore, might be well suited as endogenous controls. [score:1]
A combination of six microRNAs (miR-126-3p, miR-146a-5p, miR-29a-3p, miR-222-3p, miR-191-5p and miR-16-5p) seems to be most reliable for normalization according to this analysis. [score:1]
[1 to 20 of 8 sentences]
28
[+] score: 42
Interestingly, the miR-221 cluster is downregulated by androgen treatment [41], which may explain why miR-221 and miR-222 were downregulated in the results shown with the majority of prostate tumor samples tested here (see Additional file 4) and by others [16, 41]. [score:7]
We did not observe a significant difference in miR-221 or miR-222 expression in the three matched pairs of androgen dependent and androgen independent xenograft lines (LuCaP 23.1/23.1 AI, 35/35V, and 96/96AI, see Additional file 4); however, reported expression levels for miR-221 and miR-222 in patient biopsy cores, metastatic lymph node specimens, and non-malignant prostate tissues suggest that these miRNAs could be associated with invasive prostate cancer [25, 40]. [score:5]
MiR-221 and miR-222 are overexpressed in PC-3 cells that exhibit an androgen-independent, highly metastatic phenotype. [score:3]
Identification of miR-21, miR-182, miR-221 and miR-222 targets for assay development. [score:3]
According to our data, the miRNAs miR-221, miR-222, miR-182, and miR-21 were expressed at relatively high levels in prostate cancer xenograft specimens. [score:3]
Four of these miRNAs, miR-221, miR-222, miR-21 and miR-182, were selected for further study based on the known biological functions of their predicted mRNA targets [25- 32]. [score:3]
B) Specificity of the miR-221 assay using the corresponding synthetic miR-221 target as compared to synthetic miR-222, miR-30b, and miR-802 targets. [score:3]
In contrast, miR-221 and miR-222 are expressed at relatively low levels in LNCaP and 22R v1 cells that exhibit slow-growing, non-metastatic phenotypes. [score:3]
Capture of mature miRNAs was performed using the following chimeric hairpin target capture oligonucleotides (TCO) [20]: for miR-21 (TTTTTTTTTTTTUCAACAUCAGUCUGAUAAGCUAAAAAAAAAAAAA), for miR-182 (TTTTTTTTTTTTAGUGUGAGUUCUACCAUUGCCAAAAAAAAAAAAAAA), for miR-221 (TTTTTTTTTTTTGAAACCCAGCAGACAAUGUAGCUAAAAAAAAAAAA), for miR-222 (TTTTTTTTTTTTACCCAGUAGCCAGAUGUAGCUAAAAAAAAAAAA), and for miR-802 (TTTTTTTTTTTTACAAGGAUGAAUCUUUGUUACUGAAAAAAAAAAAA). [score:3]
Here we describe research prototype assays that detect a number of miRNA sequences with high analytical sensitivity and specificity, including miR-21, miR-182, miR-221 and miR-222, which were identified through expression profiling experiments with prostate cancer specimens. [score:2]
Click here for file Validation of miR-21, miR-182, miR-221 and miR-222 expression levels in human adjacent-normal and prostate tumor xenograft tissues using a commercial quantitative RT-PCR assay. [score:2]
Validation of miR-21, miR-182, miR-221 and miR-222 expression levels in human adjacent-normal and prostate tumor xenograft tissues using a commercial quantitative RT-PCR assay. [score:2]
Research prototype assays for miR-21, miR-182, miR-221 and miR-222 provided analytical sensitivities ranging from 50 to 500 copies of target per reaction in sample transport medium. [score:2]
Based on these and other observations, miR-221 and miR-222 appear to be promising biomarker candidates for discriminating metastatic subtypes. [score:1]
[1 to 20 of 14 sentences]
29
[+] score: 37
Other miRNAs from this paper: hsa-mir-221
miRIDIAN hairpin inhibitor, human hsa-miRNA221, hsa-miRNA222, and miRNA hairpin inhibitor control with Dy 547 and Dharmafect 1 transfection reagent were purchased from Thermo Fisher Scientific (Lafayette, CO, USA). [score:5]
HMGB1 Increases Expression of miRNA221 and miRNA222 and Decreases Expression of PTEN in CAL62 and BCPAP Cells. [score:5]
Following our previous study demonstrating that HMGB1 increases miR221 and miR222 expression in short term primary cultures of papillary cancer cells compared with normal cells obtained from contralateral thyroid lobe and with cells from patients with nonneoplastic lesions, we report here that HMGB1 induces miRNAs 221 and 222 hyperexpression in both differentiated (BCPAP) and anaplastic (CAL62) thyroid cancer cell lines. [score:4]
Figure 4 shows that cotransfection of antagomiRs 221 and 222 in CAL62 was able to reduce expression of miRNA221 by 44.5% and miRNA222 by 25%. [score:3]
In order to demonstrate that miRNA221 and miRNA222 were linked with PTEN function in CAL62 and BCPAP cells we delivered specific antagomiRs and determined miRs expression. [score:3]
In order to show if the above effect was mediated by HMGB1-RAGE binding, cells were treated with anti-RAGE antibody and then stimulated with HMGB1 for 24 h. Figure 2 shows that when RAGE is blocked by anti-RAGE, the presence of HMGB1 does not significantly increase miR221 and miR222 expression in both CAL62 cells and BCPAP. [score:3]
Reduction of miR221 and miR222 expression in BCPAP cells was, respectively, of 66.6% and 30%. [score:3]
Among others, miR221 and miR222 are overexpressed in thyroid papillary cancer and in long term cell lines deriving from human papillary cancer [3, 4]. [score:3]
The next set of experiments was designed to show if the action of HMGB1 on miR221/222 cluster was functional on PTEN, which is a known target of miR221 and miR222. [score:3]
In order to investigate a possible mode of thyroid cancer cell proliferation induced by extracellular HMGB1, expression of miRNA221 and miRNA222 in CAL62 and BCPAP cells was assessed by PCR after addition of HMGB1 for 24, 48, and 72 h. The concentration of 10 nM HMGB1 was chosen according to our previous studies [3] and to internal dose-response controls performed on different cell lines and in primary cultures obtained from papillary cancer and nonneoplastic lesions (6). [score:1]
Mature miRNA221 sequence was AGCUACAUUGUCUGCUGGGUUUC; mature miRNA222 sequence was CUCAGUAGCCAGUGUAGAUCCU. [score:1]
To our knowledge this is the first time it has been shown that the newly identified pathway HMGB1/RAGE/miR221/miR222 may connect immune system with cancer. [score:1]
For the detection of mature miRNA221 and miRNA222, 50 ng of total RNA was reversely transcribed using High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). [score:1]
Overall the results indicate that induction of miR221 and miR222, the latter at a minor extent, is RAGE dependent. [score:1]
[1 to 20 of 14 sentences]
30
[+] score: 37
In different muscle lineage cells, miR-221 and miR-222 show similar effects by activating regenerative properties through targeting key cell cycle regulators p21 [Waf1/Cip1], p27 [Kip1], and p57 [Kip2] involved in induction of expression of contractile proteins. [score:6]
Knockdown of miR-221 and miR-222 reduces VSMC proliferation in vitro and inhibits neointimal hyperplasia -induced intimal thickening in rat carotid artery after vascular injury [103]. [score:4]
Since miR-221 and miR-222 target two of them (p27 [Kip1] and p57 [Kip2]), and this miRNA cluster may have a profound impact in the regulation of the role of VSMCs in proatherogenic neointimal hyperplasia [24, 127]. [score:4]
In consistence with this, senescent human aortic ECs were shown to express higher levels of antiangiogenic miR-221 and miR-222 [93] associated with reduced synthesis and activity of eNOS and increased production of caveolin-1, a negative eNOS regulator [30]. [score:4]
ApoE was found to downregulate miR-221 and miR-222 in a Cox-2 (prostaglandin-endoperoxide synthase)/prostacyclin/inositol monophosphate -dependent manner [146]. [score:4]
In addition to the direct regulation of function and development of vascular cells, miR-221 and miR-222 exhibit their effects on nonvascular tissues. [score:4]
miR-221 and miR-222 could be upregulated in the vascular epithelium and VSMCs in angiotensin II dependent manner [32, 39]. [score:4]
The miR-221 and miR-222 genes are separated by a distance of 726 bp (Figure 1). [score:1]
Interestingly, when VSMCs were transfected with miR-221 and miR-222 mimics, an increase in calcium deposition was observed in combined treatment but not in individual miR treatments suggesting for synergistic effects of miR-221/222 on vascular calcification [151]. [score:1]
In the nucleus, the common pri-miR-221/222 transcript then is spliced and split by the “microprocessor” complex Drosha/DiGeorge syndrome critical region gene 8 (DGSR8) [40] with formation of the individual pre-miR-221 and pre-miR-222 precursors that both have the length of 110 nucleotides (nt). [score:1]
EPCs transfected with miR-221/miR-222 loose capacity to do wound healing and tube formation [63]. [score:1]
The promoter region contains two canonical TATA boxes located on 550 and 190 base pairs (bp) upstream of pre-miR-222. [score:1]
For miR-222, generating two mature 21nt-long miRNAs (miR-222-5p and miR-222-3p) is possible (Figure 1). [score:1]
Human miRNA- (miR-) 221 and its paralogue miR-222 show notable activities in the vascular network by influencing angiogenic properties of ECs [25] and phenotypic changes in VSMCs [26]. [score:1]
[1 to 20 of 14 sentences]
31
[+] score: 35
Other miRNAs from this paper: hsa-mir-221
miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. [score:5]
The inhibition of the highly expressed miR-221 and miR-222 impairs the growth of prostate carcinoma xenografts in mice. [score:5]
MicroRNAs (miR)-221 and miR-222, both overexpressed in human thyroid papillary carcinomas, regulate p27Kip1 protein levels and cell cycle. [score:4]
Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. [score:4]
Figure S1 Expression levels of miR-221 and miR-222 in transient and stable cell clone. [score:3]
MiR-221 and miR-222 target PUMA to induce cell survival in glioblastoma. [score:3]
The enforced expression of miR-221 did not alter the level of miR-222. [score:3]
No expression changes were detected for the related miR-222 (Figure S1). [score:3]
However, by sharing the same seed sequence, it is possible that many of the discovered genes could potentially be targets of miR-222 too. [score:3]
For example, the regulation of c-kit by both miR-221 and miR-222 induced anti-angiogenic effects and the reduction of cell proliferation of herythroleukemic cells (Felli et al., 2005), suggesting that miR-221 effects could also depend on cellular context. [score:2]
[1 to 20 of 10 sentences]
32
[+] score: 35
Class Cell lines or biological samples (location) Assessment/modification Identified gene targets Dose (range) DNA methylationMaternal Tibia (Mexico, n = 103) Global/hypomethylation – 10.5 ± 8.4 (μg/g)Pilsner et al., 2009a DNA methylationPeripheral blood leukocytes (Greece, n = 19) Targeted/hypermethylation TP16 6–100 (ug/dL)Kovatsi et al., 2010 DNA methylationPatella (USA, n = 2280) Global/hypomethylation – 27.4 ± 19.7 (g/g)Wright et al., 2010 DNA methylationPeripheral blood leukocytes (San Francisco, California, n = 41) Targeted/hypomethylation COL1A2 0.3–8.8 (μg/L)Hanna et al., 2012 DNA methylation A431 (epidermoid carcinoma cells) Targeted/hypomethylation↑ COX-2 [*] 0.1–10 μM for 0.5–2 hTsai et al., 2014 mi -RNA Peripheral blood leukocytes Targeted/ - 3 d lead PMBollati et al., 2010 ↑ miR-222(Brescia, Italy, n = 63) ↓ miR-146a ↑, increased; ↓, decreased; *, functionally validated at the expression level; –, not functionally validated at the expression level; Global refers to global methylation patterns; Genome-wide refers to high throughput gene-specific assays; DMGs, differentially methylated genes. [score:14]
miR-222, which had increased expression due to lead exposure has been shown to regulate the tumor suppressor, Cyclin -dependent kinase inhibitor 1B (p27Kip1), and down regulation of p26Kip1 has been linked to increased cell proliferation and higher incidences of various cancers (Le Sage et al., 2007). [score:9]
The study, conducted on peripheral blood leukocytes exposed via inhalation, found miR-222 expression showed a positive association with lead exposure, while miR-146a expression was negatively correlated with lead exposure (Bollati et al., 2010). [score:5]
Regulation of the p27Kip1 tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. [score:4]
In human lymphoblasts, arsenic altered the expression of five miRNAs; miR-221, miR-222, miR-210, miR-34a, and miR-22 (Marsit et al., 2006b). [score:3]
[1 to 20 of 5 sentences]
33
[+] score: 35
In breast cancer cell lines, miR-222 overexpression has been reported to be associated with tamoxifen resistance through targeting the cell cycle inhibitor p27 (Kip1) [40]. [score:7]
miR-222 has also been reported to increase proliferation of ERα -negative cells while reducing the expression of various tumor suppressor proteins [41], and expression of miR-222 has been reported to increase cell migration in the epithelial-to-mesenchymal transition acting downstream of the RAS-RAF-MEK oncogenic pathway [42]. [score:7]
Using qRT-PCR on a small, independent sample of 5 cases and 5 controls we verified overexpression of the 3 highest expressing miRNAs among cases, miR-18a, miR-181a, and miR-222; the differences were not statistically significant in this small set. [score:5]
One used sequencing by oligonucleotide ligation and detection (SOLiD) of serum samples obtained prior to surgery from 13 breast cancer cases compared with samples from 10 healthy controls and found 26 miRNAs that were overexpressed in cases, including miR-222 and miR-181a; overexpression of miR-222 was validated in an independent group of 50 cases and 50 controls by using qRT-PCR [20]. [score:4]
Using qRT-PCR on a small independent replication set of five cases and five controls, we further examined the three miRNAs (miR-18a, miR-181a, and miR-222) with the highest expression in cases. [score:3]
Interestingly, two recent case control studies have provided evidence that both miR-222 and miR-181a are overexpressed in the serum of patients with breast cancer. [score:3]
That study also found overexpression of miR-222 [21]. [score:3]
miR-18a, miR-181a, and miR-222 showed the highest percentage difference between cases and controls in our study; qRT-PCR of these miRNAs in a small independent replication set of cases and controls, though not statistically significant, replicated the direction of change for all three. [score:2]
Serum levels of five cases and five controls were examined by using qRT-PCR for miR181a, miR18a, and miR-222. [score:1]
[1 to 20 of 9 sentences]
34
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
In breast cancer cells, over -expression of miR-221, miR-222, let-7 and miR-20b is associated with reduced of ERα protein content, signaling and expression of ERα target genes [47- 49]. [score:7]
Ovarian follicle expression of miR-221 and miR-222 has been reported to be repressed by androgens [42- 44] which regulates cell proliferation by targeting p27/kip1 [44, 45]. [score:6]
In the cystic follicle, expression of miR-222 becomes restricted to theca only, suggesting that miR-222 modulates AR expression and hereby paracrine regulation. [score:6]
In situ localization shows specific expression of miR-222 in the theca cells (Figure  5) where it may be involved in regulation of the ERα. [score:4]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
For example, rno-miR-96, rno-miR-31 and rno-miR-222 were exclusively expressed in the theca of cystic follicles. [score:3]
Here we observed higher expression of miR-222 in the DHT -induced PCOS rats, a response most evidenced in both theca and granulosa of early stage follicles. [score:3]
These include rno-miR-195, rno-miR-125a-5p, rno-let-7a, rno-miR-16, rno-miR-30b-5p, rno-let-7c, rno-let-7b, rno-miR-125b-5p, rno-miR-221, rno-miR-222, rno-miR-26a, rno-miR-322, rno-miR-23a, rno-miR-191, rno-miR-30 family, rno-miR-21, rno-miR-126, rno-miR-23b, rno-miR-145 and rno-miR-494. [score:1]
These included rno-miR-24, rno-miR-31, rno-miR-96, rno-miR-183, rno-miR-222, rno-miR-489, U6 snRNA (positive control) and scrambled miRNA (negative control). [score:1]
[1 to 20 of 9 sentences]
35
[+] score: 34
Two of the upregulated miRNAs (miR-222-3p, miR-138-5p) and two of the downregulated miRNAs (miR-125b-5p, miR-99a-5p) were confirmed to be significantly differentially expressed between iDCs and 27DCs (Figure 3). [score:9]
Among them, 12 miRNAs (let-7e-5p, miR-151a-3p, miR-21-5p/-3p, miR-221-5p/-3p, miR-222-3p, miR-424-3p, miR-450a-5p, miR-450b-5p, miR-503-5p, and miR-99b-5p) were up-regulated by IL-27 and two miRNAs (miR-99a-5p and miR-125b-5p) were down-regulated. [score:7]
JAK2 is targeted by miR-221-5p, and JAK3 is targeted by miR-221-3p and miR-222-3p. [score:5]
Interestingly, the relatively highly expressed miRNAs (miR-21-5p, miR-21-3p, miR-221-3p, miR-222-3p, let-7e-5p, miR-99a-5p, and let-7c-5p) targeted Human herpesvirus and other viruses. [score:5]
Among them, four miRNAs (miR-125b-5p, miR-138-5p, miR-222-3p, and miR-99a-5p), which potentially target genes involved in ErbB, Wnt, TGF-β, MAPK, and PI3K signaling pathways, were validated by RT-qPCR. [score:3]
In the present study, the aforementioned miRNAs (miR-21-3p/-5p, let-7e-3p/-5p, miR-99b-3p/-5p, miR-125a-3p, miR-221-3p/-5p, and miR-222-3p/-5p) affecting DC functions were differentially regulated by IL-27 based on the sequencing results, suggesting that they may play a role in IL-27 regulation of DC function. [score:3]
Four of these were confirmed by RT-qPCR (miR-99a-5p, miR-222-3p, miR-138-5p, and miR-125b-5p). [score:1]
In addition, both miR-221 and miR-222 influence DC subset differentiation [47]. [score:1]
[1 to 20 of 8 sentences]
36
[+] score: 31
MiR-29a and miR-30b expression were down-regulated by almost all the tested polyphenols; miR-222 was down-regulated by caffeic acid (300 mg/d for 2 weeks) and hesperidin (30 mg/d for 2 weeks); miR-181a was down-regulated by curcumin (30 mg/d for 2 weeks) and hesperidin and up-regulated by naringin (30 mg/d for 2 weeks), quercetin (30 mg/d for 2 weeks) and proanthocyanidin (300 mg/d for 2 weeks); miR-132 was up-regulated by naringin [(] [88] [)]. [score:18]
Shi Z, Zhao C, Guo X, et al (2014) Differential expression of microRNAs in omental adipose tissue from gestational diabetes mellitus subjects reveals miR-222 as a regulator of ERalpha expression in estrogen -induced insulin resistance. [score:6]
In GDM women, the up-regulation of miR-222 has been found to be associated with reduced protein levels of both oestrogen receptor (ER)- α and GLUT4 in omental AT, obtained at the time of caesarean delivery, and with increased serum estradiol levels [(] [76] [)]. [score:4]
A longer EGCG (100 μ m for 24 h) treatment reduced miR-181d and miR-222 expression as well, in HepG2 cells [(] [95] [)]. [score:3]
[1 to 20 of 4 sentences]
37
[+] score: 30
The third inner circle represents the number of miRNA-target gene pairs for which both miRNA and the target gene were reportedly expressed in neuronal cells and were associated with brain plasticity (synaptogenesis/neurogenesis) or with psychiatric diseases (note that the five pairs include both miR-221 and miR-222). [score:9]
In a separate study, ITGB3 (coding for integrin beta-3, also known as platelet glycoprotein IIIa and CD61) as well as miR-221 and the closely related miR-222, both predicted by bioinformatics tools to target ITGB3, exhibited the most consistent expression level changes following chronic (21 days) paroxetine exposure of human LCLs (Oved et al., 2013). [score:5]
The microRNAs miR-221, miR-222, and miR-151-a-3p, along with their binding sites, were explored in silico using miRBase (Griffiths-Jones et al., 2008) [3], TargetScan [4], microRNAviewer (Kiezun et al., 2012) [5], and the UCSC Genome Browser (Multiz Alignment of 100 Vertebrates) [6] In compiling the data in Figure 1, we first compiled a list of 224 candidate biomarker SSRI response genes and miRNAs identified in our earlier studies using genome-wide searches (Morag et al., 2011; Oved et al., 2012, 2013). [score:3]
Using Ilumina sequencing, miR-221 and miR-222 were identified among the top 40 highly expressed miRNAs in post-mortem human brains (Shao et al., 2010); both were induced by nerve growth factor in rat pheochromocytoma PC12 cells (Terasawa et al., 2009; Hamada et al., 2012) and were shown to play a role in neurite guidance (Cheng et al., 2014). [score:3]
Additionally, ITGB3 and miR-221/miR-222 exhibited opposite expression level changes (Oved et al., 2013). [score:3]
ITGB3 was down-regulated by miR-221/222 in HEK-293T cells 24 h following co-transfection with either miR-221 or miR-222 in combination with the consensus ITGB3 3′UTR construct; this was compared to the mutant ITGB3 3′UTR construct co-transfection. [score:3]
The miRNA expression vectors, miRVec-221 and miRVec-222, which contain the genomic regions of human pre-miR-221 and pre-miR-222, respectively, were provided by Prof. [score:3]
MicroRNAs, miR-221 and miR-222, which are clustered genes located in an intergenic region on the X chromosome in humans and have the same seed sequence, were found to be broadly conserved among vertebrates (89/100 with the conserved seed region), and highly conserved among primates (12/12 with the conserved mature miRNA region) (Figures 2A,B, and Supplementary Figures S1A,B). [score:1]
[1 to 20 of 8 sentences]
38
[+] score: 30
Key findings of the present study were that expression of the DNMT1, DNMT3A and DNMT3B genes are abundantly expressed only in GE of cancerous ovaries as compared to normal ovaries of laying hens, and that expression of DNMT3A and DNMT3B genes are post-transcriptionally regulated by miR-1741, miR-16c, miR-222, or miR-1632, respectively. [score:7]
These results indicate that miR-1741, miR-16c, miR-222, or miR-1632 directly bind to the DNMT3A or DNMT3B transcript, respectively, and post-transcriptionally regulate expression of those genes. [score:5]
These results indicate that miR-1741, miR-16c, miR-222, or miR-1632 directly bind to DNMT3A or DNMT3B transcripts, respectively, and post-transcriptionally regulate expression of the DNMT3A and DNMT3B genes. [score:5]
Similarly, the presence of miR-16c, miR-222, or miR-1632 for DNMT3B, the percentage of GFP -expressing cells was decreased (P<0.01). [score:3]
In addition, as shown in Figure 4, in the presence of miR-16c, miR-222, or miR-1632 for DNMT3B, there was a decrease (P<0.01) in the percentage of GFP -expressing cells (100% in control vs. [score:3]
For the dual fluorescence reporter assay, the fusion contained the DsRed gene and either miR-148a or miR-1612 for DNMT1; miR-1596, miR-1687, miR-1741, or miR-1749 for DNMT3A; and miR-16c, miR-222, or miR-1632 for DNMT3B, and each was designed to be co-expressed under control of the CMV promoter (pcDNA-DsRed-miRNA). [score:2]
0061658.g004 Figure 4[A] Diagram of miR-16c, miR-222, and miR-1632 binding sites in the DNMT3B 3′-UTR. [score:1]
85.3% in miR-16c, 40.3% in miR-222, and 25.9% in miR-1632). [score:1]
[C and D] After co-transfection of pcDNA-eGFP-3′-UTR for the DNMT3B transcript and pcDNA-DsRed-miRNA for the miR-16c, miR-222, and miR-1632, the fluorescence signals of GFP and DsRed were detected using FACS [C] and fluorescent microscopy [D]. [score:1]
org/miRDB/) revealed putative binding sites for miR-148a and miR-1612 (for DNMT1) ; miR-1596, miR-1687, miR-1741, and miR-1749 (for DNMT3A) ; and miR-16c, miR-222, and miR-1632 (for DNMT3B). [score:1]
[A] Diagram of miR-16c, miR-222, and miR-1632 binding sites in the DNMT3B 3′-UTR. [score:1]
[1 to 20 of 11 sentences]
39
[+] score: 30
We found that c-Myc downregulation led to decreased expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 (Fig. 5B), which were consistent with the effects of NC shown in Fig. 5A. [score:6]
We also observed that a specific group of miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were activated by c-Myc and executed part of c-Myc functions in leukemia development [11, 20, 21, 22], was markedly downregulated. [score:5]
The expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, which were reported to be dependent on c-Myc transcriptional activity [27, 48, 49, 50] and contribute the development of leukemia [11, 20, 21, 22], was examined in K562 cells treated with NC. [score:4]
We next examined the effects of NC on the expression of c-Myc activated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were typically increased in leukemia and triggered to the development of leukemia [11, 20, 21, 22]. [score:4]
We next explored the effects of c-Myc inactivation on the expression of the tumor associated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells. [score:3]
The relative expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 was detected by real-time qRT-PCR. [score:3]
To determine the expression level of mature miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells, All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used following manufacturer’s protocol. [score:3]
Our results revealed that NC treatment decreased the relative levels of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, among which miR-17 and miR-20a showed the sharpest decrement by 65.0 ± 0.6% and 62.6 ± 2.6%, respectively (Fig. 5A). [score:1]
0116880.g005 Fig 5(A) K562 cells were treated with 0, 4 or 8 μM NC for 2 days, the relative levels of mature miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 were detected by real-time qRT-PCR. [score:1]
[1 to 20 of 9 sentences]
40
[+] score: 30
For the up-regulated miRNA miR-222-3p the according mRNA target (MGMT) was down-regulated. [score:9]
We used miScript Primer Assays for 9 miRNAs (miR-744-5p, miR-648, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-222-3p, miR-423-3p and miR-766-3p) and QuantiTect Primer assays for 9 target genes (CDKN1A, MYC, PTEN, ESR1, ETS1, SOD2, MGMT, KRAS and HNF4A) (Qiagen, Hilden, Germany) to validate the different expression levels of the miRNA and their target genes, which are determined by miRTargetLink prediction software. [score:5]
Deregulation of a number of miRNAs in our study have been previously reported in right and left atrial appendages of patients with rheumatic mitral valve disease (RMVD), including miR-222-3p, miR-4484 and miR-940 in left atrial appendage [41], miR-5190 and miR-23c in right atrial appendages [42] and miR-143-3p in both, in the LAA and RAA of patients with RMVD [43]. [score:4]
With the exception of miR-222-3p, the remaining eight miRNAs showed the same direction of expression changes in the RT-PCR and in the microarray analysis. [score:4]
In neonatal cardiomyocytes, miR-222 induces cellular hypertrophy and proliferation and inhibits apoptosis after ischemic injury [45]. [score:3]
In addition, miR-222 increases cell proliferation and inhibits cardiomyogenic differentiation in right ventricular outflow tract (RVOT) myocardial tissues from infants with nonsyndromic tetralogy of fallot (TOF) [46]. [score:3]
Our finding for miR-222 also suggests that this miRNA protects cardiac structure and functions after corrective surgery by CPB. [score:1]
MiR-222 has a documented function in regulating cell proliferation and is involved in the vascular smooth muscle cells differentiation [38, 44]. [score:1]
[1 to 20 of 8 sentences]
41
[+] score: 29
We initially focused on promoter hypermethylation to explain downregulation of this gene in our sample series of T-LBL, but despite a substantial reduction in the levels of mRNA in almost all samples in the exploratory cohort (7/8), only two samples (840 and 521) (2/8) exhibited significant hypermethylation density (Fig. 4), and six out of eight (including tumor 840 with promoter hypermethylation) exhibited upregulation of one or two miRNAs selected for CDKN1C regulation (miR-211–3p and miR-222-3p). [score:8]
reported here are in line with those reported in the literature describing miR-25, miR-221 and miR-222 as direct regulators of CDKN1C expression in a wide variety of solid tumours, showing a new mechanism responsible for CDKN1C downregulation in carcinogenesis [43– 45]. [score:8]
There were only two significant deregulated miRNAs controlling CDKN1C expression, which are up-regulated in practically all the samples (miR-221–3p and miR-222-3p). [score:7]
In this context, our findings suggest that aberrant expression of miR-221 and miR-222 may have an oncogenic function in T-LBL development by targeting CDKN1C. [score:6]
[1 to 20 of 4 sentences]
42
[+] score: 27
They confirmed the correlation of the miR-222 expression with the Ras/MAPK pathway and showed that its inhibition induced the expression of p27 (cell cycle inhibitor) and muscle-specific proteins, facilitating cell fusion and the assembly of contractile structures [45]. [score:9]
All the aforementioned miRNAs have manifested upregulation during myogenic differentiation, except the downregulated miR-222, both in the above-cited papers [11, 25] and in our study (Table 2). [score:7]
In recent studies, they also found that the overexpression of miR-222 and the consequent silencing of Rbm24 resulted in the inhibition of myoblast fusion [46]. [score:5]
Furthermore, it was found that miR-222 negatively contributes to myoblast differentiation, taking part in the regulatory axis that includes mTOR and IGF-II [47]. [score:2]
A few high-throughput studies have confirmed some of the identified miRNAs (miR-1, miR-128, miR-133a, miR-133b, miR-206, miR-222, and miR-503) as common for skeletal muscle development in mouse, human, pig, common carp [11], and cattle [25]. [score:2]
The last miRNA in this group is miR-222. [score:1]
Cardinali et al. [45] reported miR-222 decrease in the differentiated quail myotubes. [score:1]
[1 to 20 of 7 sentences]
43
[+] score: 26
Figure 3miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation Both gain- and loss-of-function in vivo studies of miR-126 in mouse mo dels demonstrated that either enforced expression or knockout of miR-126 substantially promoted development of t(8;21) AML in mice [75]. [score:10]
miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation. [score:6]
The miR-222/221 gene cluster, also a RUNX1 target, regulates the kitproto-oncogene protein (KIT) receptor by targeting its 3′-UTR [73]. [score:6]
In (CBF)-AML samples with reduced miR-221 and miR-222 there is a concomitant up-regulation of KIT and KIT -induced proliferation [74]. [score:4]
[1 to 20 of 4 sentences]
44
[+] score: 25
Other miRNAs from this paper: hsa-mir-21, hsa-mir-192, hsa-mir-215, hsa-mir-221
Collectively, the present study is the first demonstration that human IL-21 mRNA is down-regulated by miR-21, miR-192, miR-215, miR-221, and miR-222, suggesting a novel regulatory mechanism of IL-21 expression in immune responses. [score:7]
In addition, the identification of the long 3′ UTR of human IL-21 mRNA and transfection studies revealed that human IL-21 mRNA with the long 3′ UTR is down-regulated by miR-21, miR-192, miR-215, miR-221, and miR-222, which were in the top 25 miRNAs up-regulated by. [score:7]
In this study, we have shown that the expression of human IL-21 in T cells was repressed by transduction of miR-21, miR-192, miR-215, miR-221, and miR-222. [score:3]
Previously the expression of miR-21, miR-221, and miR-222 was reported to be increased in EVs from patients infected with HBV 24, 25 and miR-215 was also shown to increase in the serum derived from patients infected with HBV [37]. [score:3]
s revealed that miR-21, miR-192, miR-215, miR-221, and miR-222 repressed the expression of the reporter gene with the long 3′ UTR of human IL-21 mRNA (Fig.   3A). [score:3]
In the long 3′UTR of human IL-21 cDNA we identified, there are multiple conserved miRNA binding sites for miR-21, miR-192, miR-215, miR-221, and miR-222, (Fig.   2D and Fig.   S4). [score:1]
Interestingly, it was reported that miR-21, miR-192, miR-215, miR-221, and miR-222 were enriched in exsosomes derived from sera of cancer patients and supernatants of cancer cells 42– 47. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 25
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
In a review, Gramantieri et al. (2008) show miRNAs aberrantly expressed in HCC compared to non-tumorous liver tissue (up -expression of miR-33, miR-130, miR-135a, miR-210, miR-213, miR-222, miR-331, miR-373, miR-376a, and down -expression of miR-130a, miR-132, miR-136, miR-139, miR-143, miR-145, miR-150, miR-200a, miR-200b, miR-214). [score:6]
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
Bollati et al. (2010) found an increased expression of miR-146a related to inhalation of Cd-rich air particles in steel workers, and induced rapid changes in the expression of two inflammation-related miRNAs, miR-21 and miR-222. [score:5]
Expression of microRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significance. [score:3]
Inhibition of caspases 3, 6, 7, and 8Volinia et al., 2006; Gramantieri et al., 2007, 2008, 2009; Meng et al., 2007; Fornari et al., 2008; Jiang et al., 2008; Li et al., 2008, 2011; Wang et al., 2008; Wong et al., 2008; Chen, 2009; Garofalo et al., 2009; Huang et al., 2009; Liu et al., 2009; Pogribny et al., 2009; Pineau et al., 2010; Wang et al., 2010; Kerr et al., 2011; Karakatsanis et al., 2013 miR-222 Enhanced AKT pathway. [score:3]
MiR-222 overexpression confers cell migratory advantages in hepatocellular carcinoma through enhancing AKT signaling. [score:2]
[1 to 20 of 6 sentences]
46
[+] score: 25
Down-regulated miRNAs included miR-222 that has been previously suggested to play a role in tumorigenesis by targeting cell cycle inhibitor p27, which leads to deregulation of cell cycle control in several cancer types [124, 125]. [score:9]
Furthermore, MMP1 and SOD2 independent knockdown by siRNA evidenced that the reduced MMP1 and SOD2 levels are associated with reduced cell invasion, which suggested that hsa-miR-222 regulates TSCC invasion by targeting MMP1 and SOD2 mRNA. [score:5]
DICER1 and PTEN genes have been identified as target genes for miR-107 and miR-222, respectively [113, 114]. [score:3]
In addition, a targeting site for hsa-miR-222 was identified in the 3′-UTR of the matrix metalloproteinase 1 (MMP1) and manganese superoxide dismutase 2 (SOD2) mRNA sequences by in silico analysis and confirmed by luciferase reporter gene assays. [score:2]
Other microRNAs, such as miR-221 and miR-222, are able to deregulate PTEN. [score:2]
Deregulation of others miRNAs, such as miR-622, miR-107, miR-221, and miR-222, has been described in GC. [score:2]
Transfection of UM1 cells with the hsa-miR-222 mimic did not modify apoptosis or cell cycle, but led to a significant decrease in cell invasion (p < 0.05). [score:1]
Ectopic transfection of hsa-miR-222 induced a decrease in MMP1 and SOD2 levels in UM1 cells. [score:1]
[1 to 20 of 8 sentences]
47
[+] score: 25
Overexpression of miR-222 inhibited proliferation and caused cell cycle arrest and apoptosis in leukemic cells by directly suppressing ETS1 expression [32]. [score:10]
It was also discovered that miR-222 inhibited proliferation, caused cell cycle arrest and apoptosis in leukemic cells by directly inhibiting the expression of the proto-oncogene ETS1 through in vitro studies, which has been shown to be concomitant with the poor prognosis of ETP-ALL. [score:8]
Their results included two of the most upregulated (miR-221 and miR-222) and six downregulated miRNAs (miR-151-3p, miR-19a, miR-20b, miR-342-3p, miR-363, and miR-576-3p). [score:7]
[1 to 20 of 3 sentences]
48
[+] score: 25
Interestingly, a recent paper demonstrated that cardiac miR-222 expression increased after endurance exercise training, an activity required for physiological cardiomyocyte growth in adult hearts, and that miR-222 expression protected against adverse cardiac remo delling 44. miR-221 and miR-222 target the identical RNA sequence, and miR-221/222 overexpression in mice antagonized pressure overload -induced pathological cardiac remo delling 45. [score:9]
Relative luciferase activity in NRCMs harbouring the reporter and transfected with control pcDNA3.1 vector or miR-221, miR-222, miR-211, miR-204 or miR-135a expression vectors. [score:3]
Deletion of the miR-221/222 binding site in the Angptl2-3′UTR reporter (Fluc-Angptl2-3'UTR-Δ 221/222) was performed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer's instructions miR-221, miR-222, miR-211, miR-204 or miR-135a overexpression vectors were constructed by inserting sequences including the full-length mature microRNA sequences into pBApo-CMV (Takara Bio). [score:3]
Here, we found that expression of both miR-221 and miR-222 markedly increased in pressure overload -induced cardiac stress following TAC (Supplementary Fig. 5b). [score:3]
We observed that miR-221 or miR-222 overexpression in NRCMs significantly attenuated activity of a luciferase reporter fused to the Angptl2-3′UTR (Fig. 4b), an activity blocked by deletion of miR-221/222 binding sequences from the UTR (Fig. 4c). [score:3]
We confirmed that miR-221 and miR-222 expression levels in heart of these were significantly decreased relative to control miR-221/222 [Flox/y] mice (Supplementary Fig. 5a). [score:3]
org database identified five candidates, including miR-135a, miR-204, miR-211, miR-221 and miR-222, predicted to bind to the Angptl2 mRNA 3′UTR. [score:1]
[1 to 20 of 7 sentences]
49
[+] score: 24
Moreover, miR-222/221 overexpression can promote cell migration and growth by downregulating the protein tyrosine phosphatase μ (PTPμ) in glioblastoma (47, 95, 96). [score:6]
At the same time, the antitumor activity of miR-221 inhibitors was higher than that of miR-222 inhibitors (50). [score:5]
In the specimens of pancreatic cancer tissue, miR-221 and miR-222 were confirmed to be significantly upregulated, thereby suggesting that these two miRNAs had the potential to be used as diagnostic biomarkers for pancreatic cancer (80, 81). [score:4]
In addition, elevated expression of miR-222 has been reported to be an independent predictor of poor prognosis of pancreatic cancer (29). [score:3]
The expression of miR-222/221 is significantly higher in gastric tumor samples compared to the corresponding normal tissues, and miR-222/221 can enhance gastric tumor growth in the mouse xenograft mo del (34). [score:2]
miR-222 in exosome can mediate transfer and sufficiently increase MML malignancy (55). [score:1]
Furthermore, miR-222 in plasma is significantly correlated with clinical stages, lymph nodes metastasis, and overall survival (38). [score:1]
miR-221 and miR-222, encoded in tandem from a gene cluster located on X chromosome (Xp11.3), contain identical seed sequences separated by 727 bases and are highly conserved in vertebrates (10). [score:1]
Zhang et al. also reported that the plasma miR-221/222 family levels were found to be significantly upregulated in glioma patients, and high positive plasma miR-221 and miR-222 were both correlated with poor survival rate, which should be considered as a new additional tool to better characterize glioma (97). [score:1]
[1 to 20 of 9 sentences]
50
[+] score: 24
We selected mir-222, mir-16 and mir-210 based on previous studies showing their involvement in the regulation of HbF expression [42]– [44] as well as their involvement in PE [38]– [41]. [score:4]
There is an interesting connection between mir-222 and PE, it has been shown to be up-regulated in the PE placenta [38]– [41] but also present in circulating EVs from healthy controls [55]. [score:4]
Also, mir-222 labelling was found in vesicles expressing both CD63 and TF. [score:3]
However, the analysis of the gold signal for mir-222 displayed a down regulation after Hb perfusion (Table 2, and Figure 1B and 1C). [score:2]
The mir-222 regulates fms-like tyrosine kinase-1 (Flt1) [43], which is an anti-angiogenic factor, well described in PE [4]. [score:2]
The TEM analysis showed that mir-222 was down regulated in both 10K and 150K STBMs. [score:2]
There were no significant differences between the 10K and 150K fraction when comparing the four markers CD63, TF, Hb and mir-222. [score:1]
All miRNAs (mir-517a, mir-517b, mir-518b, mir-205, mir-210, mir-222, mir-141, mir-16 and mir-424) analysed in this study were present in both 10K and 150K STBMs. [score:1]
Furthermore, mir-222 plays a role in the human haemoglobin switch, i. e. when the newborn baby switches from HbF to HbA production, which takes place during the peri/post-natal period [43]. [score:1]
In the first preparation, STBMs shown in panels (B, control) and (C, Hb perfusions), were treated with antibodies against TF, CD63 and hsa-mir-222 labelled with colloidal gold of different sizes; CD63 (30 nm colloidal gold), TF (15 nm) and mir-222 (5 nm). [score:1]
To our knowledge, no previous studies have described mir-222 in STBMs. [score:1]
The 150K control STBMs (B) contain more mir-222 than 150K Hb STBMs (C). [score:1]
Since previous data have shown an increased production of HbF in PE placentas [5], and elevated levels of s-Flt [4], the role of mir-222 needs further exploration. [score:1]
[1 to 20 of 13 sentences]
51
[+] score: 24
miR-221 and miR-222 induce cell cycle progression and suppression of apoptosis by targeting cell cycle inhibitors p27 and p57, and Bcl-2 homology 3 (BH3)-only Bcl-2 family member PUMA [128, 129, 130]. [score:7]
miR-221 and miR-222 regulate cell cycle progression, apoptosis, cell migration and stemness by targeting cell cycle inhibitors CDKN1B (p27 [Kip1]) and CDKN1C(p57 [Kip2]), PUMA, FOXO3, PTEN, Bim, c-Kit, TIMP3, ER-α and DNA methyltransferase DNMT3b [82, 84, 87]. [score:6]
Upregulation of miR-221 and/or miR-222 is observed in CSCs isolated from pancreas and glioblastoma cancer cells [88, 89]. [score:4]
Zhang C. Z. Zhang J. X. Zhang A. L. Shi Z. D. Han L. Jia Z. F. Yang W. D. Wang G. X. Jiang T. You Y. P. miR-221 and miR-222 target PUMA to induce cell survival in glioblastoma Mol. [score:3]
Shah M. Y. Calin G. A. MicroRNAs miR-221 and miR-222: A new level of regulation in aggressive breast cancer Genome Med. [score:2]
The miR-222-221 cluster, which is composed of miR-221 and miR-222, is located in tandem on human chromosome Xp11 and is transcribed as a single RNA precursor with RNA polymerase II [80]. [score:1]
miR-221 and miR-222 have the same seed sequence, and they mostly function as oncogenes in human epithelial tumors [84, 85]. [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 24
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
These miRNAs were chosen as representative of the different patterns that were observed: up-regulation (miR-21-5p) or down-regulation (miR-222-3p) during latency; up-regulation (miR-181c-5p) or down-regulation (miR-500-3p) in the chronic period; up-regulation (miR-146a-5p) or down-regulation (miR-551b-3p) in the entire course of the disease. [score:21]
Another subgroup of miRNAs displayed an opposite pattern, i. e. decreased expression during latency: miR-7a-1-3p, miR-107-3p, miR-138-5p, miR-139-3p, miR-186-5p, miR-204-5p, miR-222-3p, miR-324-3p and miR-505-3p were significantly decreased during latency (peak at 4 days after SE), then gradually returned to control levels (Fig. 2, Supplementary Fig. S2). [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 23
miRNA-222, the expression of which is decreased in OA chondrocytes, is known to downregulate MMP-13 via targeting of histone deacetylase 4 (HDAC-4), and in mice where the osteoarthritic phenotype is surgically induced through destabilization of the medial meniscus (DMM), the overexpression of miRNA-222 in the knee in these animal mo dels restrains cartilage damage [92]. [score:10]
First, the expression patterns of several miRNAs (miRNA-221, miRNA-222, and miRNA-365) display mechanoresponsiveness [71, 72], while a mechanoregulatory protein, integrin alpha-5, the levels of which are correlated with BMI, was identified as a target of miRNA-25 that is down-regulated in OA specimens [70]. [score:9]
Song J. Jin E. H. Kim D. Kim K. Y. Chun C. H. Jin E. J. MicroRNA-222 regulates MMP-13 via targeting HDAC-4 during osteoarthritis pathogenesis BBA Clin. [score:3]
For instance, lentiviral delivery of miRNA-222 into the knee of a surgical DMM mouse mo del of OA yielded encouraging results [92]. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 23
Similarly, pred-MIR222 is in an intron of FOXP2 (forkhead box P2), a transcription factor expressed during embryogenesis and thought to be involved in development of motor-related circuits in mammalian brain [46]. [score:4]
Both pred-MIR191 and pred-MIR222 are associated with host genes suggesting that, potentially, their expression could be co-regulated. [score:4]
The remaining 10 miRNAs, including 5 known (miRNAs 24, 92a, 135a, 214, and 494) and 5 predicted (pred-MIR112, pred-MIR166, pred-MIR189, pred-MIR191, and pred-MIR222) continued to be expressed in fully differentiated NT2-N neurons and/or NT2-A astrocytes (Fig. 5A). [score:3]
In addition we also tested the expression of the predicted miRNAs, pred-MIR191 and pred-MIR222, and the associated host genes, SLAIN1 and FOXP2, and demonstrated that they followed the same kinetics. [score:3]
We also confirmed the co -expression of FOXP2 and pred-MIR222 at day 0 and day 8 of RA (Fig. 9; NT2-8D/NT2-undiff: FOXP2 - 2.1-fold, p0.02 and pred-MIR222 - 1.4-fold, p0.1). [score:3]
Finally, we confirmed the existence of two predicted miRNAs; pred-MIR191 and pred-MIR222 associated with SLAIN1 and FOXP2, respectively, and provided some evidence of their potential co-regulation. [score:2]
The mature sequences of these miRNAs were determined to be: pred-MIR191; 5′-AGCAGGTGCGGGGCGGCG-3′ and pred-MIR222; 5′-CAGTGCAAGTGTAGATGCCGA-3′. [score:1]
Pred-MIR191 was determined to be 18 nt, omitting 4 nt at the 5′ end and pred-MIR222 was 21 nt, missing 1 nt at the 3′ end. [score:1]
The PCR amplified bands, observed for both pred-MIR191 and pred-MIR222, were cut from the gel and the sequences were then validated by cloning and sequencing of the amplicons. [score:1]
The predicted miRNAs, pred-MIR191 and pred-MIR222, were submitted to miRBase (http://www. [score:1]
[1 to 20 of 10 sentences]
55
[+] score: 22
Similar to miR-17, miR-221 and/or miR-222 are highly upregulated, often without concurrent upregulation of miR-17 ~ 92, in various cancers including glioblastoma [53], liver cancer [54], pancreatic cancer [55- 58], bladder cancer [59], gastric cancer [60, 61], ovarian cancer [62], urothelial carcinoma [63], nodal marginal zone lymphoma [64], and papillary thyroid carcinoma [65]. [score:7]
Assuming that the expression of either the agonists or the antagonists would differentiate two patient populations, we performed a one-by-one regression analysis for each of the 10 agonists with either miR-221 or miR-222 in each cancer (Additional file 13: Table S12). [score:3]
Our data suggest that while it cannot be excluded that agonists and antagonists act in the same cells or in different areas of the tumor, patients express different ratios of agonists/antagonists, and the predominance of the miR-221/miR-222 oncogenic miRNAs results in poorer outcome than does predominance of miR-17 family members. [score:3]
A group that was directly antagonistic to the agonists in all three primary cancers contains miR-221 and miR-222. [score:2]
One group (the "agonists") is dominated by members of the miR-17 gene clusters, the other (the "antagonists") contains miR-221 and miR-222. [score:1]
The highly related miR-222 was found in 5 of the 6 analyses (Additional file 9: Table S8-2). [score:1]
In contrast, miR-221 and miR-222 were found in the antagonistic miRNA group in all three cancers. [score:1]
For OvCa this was miR-222/miR-20a; for GBM it was miR-222/miR-19a, and for KIRC it was miR-221/miR-93. [score:1]
In GBM, a high miR-93/miR-221 or a high miR-19a/miR-222 ratio was predictive of better overall survival. [score:1]
Specifically, we analyzed the effect of the two most significantly inversely correlated miRNA pairs (miR-93/miR-221 and miR-19a/miR-222, see Additional file 13: Table S12-2). [score:1]
However, two miRNAs, miR-221 and miR-222, were found in this antagonistic group in all three primary cancers pointing at differences between cell lines and primary cancers. [score:1]
[1 to 20 of 11 sentences]
56
[+] score: 22
Another study also demonstrated that miR-221 and miR-222 both directly target estrogen receptor alpha (ERα) and that overexpression of these miRNAs in breast cancer aid in the progression of the more aggressive basal-like breast cancer [119]. [score:6]
Further insight revealed that miR-221 and miR-222 are differentially expressed and that both miRNAs are overexpressed in estrogen receptor negative (ER−) breast cancer [119]. [score:5]
The miR-221 and miR-222 repress their target tricho-rhino-phalangeal syndrome type 1 protein (TRPS1), which in turn increases the EMT-promoting protein zinc finger E-box -binding homeobox 2 (ZEB2) [118]. [score:3]
In addition, inhibiting miR-221 and miR-222 in the metastatic MDA-MB-231 breast cancer cell lines induced a reverse phenotype. [score:3]
The miR-221 and miR-222 have both been identified as basal-like subtype-specific miRNAs, expressed in a basal-like subtype of breast cancer [118]. [score:3]
Transfections of miR-221 and miR-222 synthetic mimetics into a nontransformed mammary cell line MCF10A resulted in induced EMT-like phenotypes, increased invasion and migration, and increased the levels of the mesenchymal marker vimentin. [score:1]
4.6. miRNA-221 and miRNA-222. [score:1]
[1 to 20 of 7 sentences]
57
[+] score: 22
Koelz M. Lense J. Wrba F. Scheffler M. Dienes H. P. Odenthal M. Down-regulation of miR-221 and miR-222 correlates with pronounced Kit expression in gastrointestinal stromal tumors Int. [score:6]
1. Galardi S. Mercatelli N. Giorda E. Massalini S. Frajese G. V. Ciafre S. A. Farace M. G. MiR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27kip1 J. Biol. [score:5]
Among the many miRNAs already identified as regulators of neoplastic transformation, invasion, and metastasis, miR-221 and miR-222 (miR-221/222) have emerged as key miRNAs deregulated in many cancers, such as gastrointestinal cancers, breast cancer, prostate cancer, thyroid cancer, and glioma [1, 2, 3, 4, 5]. [score:3]
Karakatsanis A. Papaconstantinou I. Gazouli M. Lyberopoulou A. Polymeneas G. Voros D. Expression of microRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significance Mol. [score:3]
2013.09.003 24035906 8. Wang X. Han L. Zhang A. Wang G. Jia Z. Yang Y. Yue X. Pu P. Shen C. Kang C. Adenovirus -mediated shrnas for co-repression of miR-221 and miR-222 expression and function in glioblastoma cells Oncol. [score:3]
MiR-221 and miR-222 are encoded in tandem from a gene cluster located on chromosome Xp11.3. [score:1]
Ihle M. A. Trautmann M. Kuenstlinger H. Huss S. Heydt C. Fassunke J. War delmann E. Bauer S. Schildhaus H. U. Buettner R. MiRNA-221 and miRNA-222 induce apoptosis via the kit/akt signalling pathway in gastrointestinal stromal tumours Mol. [score:1]
[1 to 20 of 7 sentences]
58
[+] score: 21
They confirmed that two KSHV-encoded latent proteins, LANA, and Kaposin B, downregulate the miR-221/miR-222 cluster through direct interactions with the miR-221/miR-222 promoter resulting in upregulation of ETS1/2 -induced EC mobility [65]. [score:8]
As we discussed previously, KSHV itself suppresses expression of human miRNAs serving as tumor suppressors, including miR-221 and miR-222. [score:7]
First, they found that the transcription factors ETS2 and ETS1 are downstream targets of cellular miR-221 and miR-222, respectively. [score:3]
In KS and PEL tumors, tumor-suppressor miRNAs, including miR-221, miR-222, and let-7 family members, are underrepresented [62]. [score:3]
[1 to 20 of 4 sentences]
59
[+] score: 21
Indeed, Fzd7 was subsequently shown to be a direct target of miRNA-222, thus revealing induction of miRNA-222 negatively regulates intestinal regeneration through suppressing the expression of Fzd7 [140]. [score:9]
Intestinal regeneration was significantly impaired in a novel miRNA-222 overexpressing transgenic mouse, which was associated with impaired Wnt activation, through downregulation of Fzd7 [140]. [score:6]
Chung H. K. Chen Y. Rao J. N. Liu L. Xiao L. Turner D. J. Yang P. Gorospe M. Wang J. Y. Transgenic Expression of miR-222 disrupts intestinal epithelial regeneration by targeting multiple genes including Frizzled-7 Mol. [score:5]
Recent research has identified several miRNAs, including miRNA-222, that influence intestinal epithelial biology [139]. [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 21
More importantly, the miRNAs analyzed in this study not only included the miRNAs like Let-7a, miR-15b, miR24, miR-100 and miR-125 which may suppress the expression of cyclins A and B, and miRNAs such as Let-7a, miR24 and miR-125 which may regulate activity of CDK1, but also miRNAs such as miR-181a, miR-221 and miR-222 which can target CDK inhibitors [30– 32]. [score:10]
To investigate whether miRNAs have a role in the cell cycle regulation of splenocytes following aniline exposure, the expression of miRNAs, including Let-7a, miR-15b, miR24, miR-100, miR-125, miR-181a, miR-221 and miR-222 which are known to mainly control G2/M phase regulators [30– 32], was analyzed by using real-time PCR and the results are presented in Fig 7. Aniline exposure led to significantly decreased expression of Let-7a (decreased 82%), miR-15b (decreased 62%), miR24 (decreased 78%), miR-100 (decreased 63%), miR-125 (decreased 86%), whereas miR-181a, miR-221 and miR-222 increased by 155%, 78% and 56%, respectively, in comparison to controls (Fig 7). [score:5]
Real-time PCR analysis of miRNAs Let-7a, miR-15b, miR24, miR-100 and miR-125 (A), and miRNAs miR-181a, miR-221 and miR-222 (B) expression in rat spleens following aniline exposure. [score:3]
Therefore, greater decreases in Let-7a, miR-15b, miR24, miR-100 and miR-125 expression and significant increases in miR-181a, miR-221 and miR-222 levels in the spleens following aniline treatment may be mechanistically important in generalizing that aniline exposure leads to increased cyclin A, cyclin B, CDK1, and decreased p21, p27, thus triggering the splenocytes to go through G2/M transition. [score:3]
[1 to 20 of 4 sentences]
61
[+] score: 21
For example, miRNA-205 increased NPC cells radioresistance by directly targeting PTEN [15], miRNA-221 and miRNA-222 regulated gastric carcinoma cells radioresistance by targeting PTEN [16], downregulation of miRNA-210 expression enhanced radiosensitivity in hypoxic human hepatoma cells [17], overexpression of miRNA-421 lead to a pronounced DSB repair defect and clinical hypersensitivity in SKX squamous cell carcinoma [18], silencing of miRNA-21 increased radiosensitivity through inhibiting a PI3K/AKT pathway and enhancing autophagy in malignant glioma cells [19], and upregulation of NF-κB -dependent miRNA-125b promoted cell survival by targeting p38α upon ultraviolet radiation [20]. [score:21]
[1 to 20 of 1 sentences]
62
[+] score: 20
Actually, miR-222 was also expressed in multiple adult cell lines [16], forebrain and midbrain [45], and hippocampus [46]; it was upregulated in the differentiation process of undifferentiated hES cells to neural progenitor cells and then declined upon further differentiation [25]; it was also downregulated in erythropoietic culture of cord blood CD34+ progenitor cells [47]. [score:9]
Tumor suppressor let-7b/7i, miR-221, miR-222 and miR-181a were expressed at the highest levels in adult cells (panel C). [score:5]
We also confirmed that miR-222 was more highly expressed in adult cells, although it was reported to be enriched in hES cells [17]. [score:3]
We also confirmed that let-7b, let-7i, miR-221, miR-222 and miR-181a were much more highly expressed in adult cells (Figure 6, panel C). [score:3]
[1 to 20 of 4 sentences]
63
[+] score: 19
An example is represented by miR-222/221 cluster that is overexpressed in breast, lung, or liver cancers where targets important tumor suppressors such as PTEN, p27, p57, while the same cluster is downregulated in erythroblastic leukemias where target c-KIT oncogene (Garofalo et al., 2012). [score:12]
Indeed, miR-145 was downregulated in serous and clear-cell carcinomas, while miR-222 was downregulated in both endometrioid and clear-cell carcinomas. [score:7]
[1 to 20 of 2 sentences]
64
[+] score: 19
Since it has been demonstrated that miR-222 can target p27 [kip1], a critical regulator of cell cycle (49), and the phosphatase 2A subunit B (PPP2R2A), which inhibits Akt phosphorylation (48), we can assess that HMGA overexpression contributes to NSCLC progression by dysregulating cell cycle and Akt signaling (48) (Figure 1B). [score:9]
Indeed, it has been reported that at least HMGA1 is able to directly regulate the expression of miR-222 in NSCLC cells (48). [score:5]
HMGA1 is able to induce the expression of miR-222, which in turn can target p27 [kip1] and PPP2R2A, then activating the AKT signaling. [score:5]
[1 to 20 of 3 sentences]
65
[+] score: 19
On the other hand, TNFα induced the expression of both miR-221 and miR-222, which were also found to be downregulated during adipogenesis and upregulated in obese mice [30]. [score:9]
Indeed, concomitantly with weight loss and improved AT inflammation (Additional file 2: Table S2), current data pointed decreased AT expression of miRNAs which detection inside isolated cells (for example, miR-146b, miR-376c, miR-411) and/or in the SN (miR-221, miR-222, miR-155, miR-223, miR-19a/b) rose in differentiated adipocytes upon inflammatory stimuli (Table  2). [score:3]
Among them, increased expression of miR-221 (2-fold, P = 0.002), miR-222 (2.5-fold, P = 0.04), and miR-155 (5-fold, P = 0.015, Figure  3) was found in inflamed adipocytes, as well as in the SN (15-, 6-, and 4-fold changes, respectively, all with P values under 0.001, Figure  3), when compared to control. [score:2]
Although no significant variations were identified in miR-222, modulation of miR-19a (0.5-fold, P = 0.032, and 2-fold, P = 0.034) and decreased miR-145 in both cells and SNs (0.2-fold, P = 0.005, and 0.14-fold, P = 0.032) were shown in M1 macrophages reacting to LPS (Table  2). [score:1]
Figure 3Bars representing the mean ± standard error for miR-221, miR-222, and miR-155. [score:1]
Interestingly, miR-221 (2-fold, P = 0.002), miR-222 (2.5-fold, P = 0.04), and miR-155 (5-fold, P = 0.015) were increased in inflamed adipocytes and in their SNs (15-, 6-, and 4-fold, respectively, all P < 0.001). [score:1]
Indeed, some miRNAs became undetectable (miR-1274B, miR-572, and miR-766), while others appeared de novo in cells (miR-140-5p, miR-222*, miR-376c, miR-411, and miR-146a) and their SNs (miR-146a, miR-146b, miR-19a, miR-223*, miR-425, and miR-9*) upon MCM -induced inflammation (Figure  2). [score:1]
Bars representing the mean ± standard error for miR-221, miR-222, and miR-155 in differentiated adipocytes and their SN at the baseline and upon MCM-conditioned inflammation (striped bars) and in human AT before (striped bars)-after massive weight loss. [score:1]
[1 to 20 of 8 sentences]
66
[+] score: 18
Elevated levels of GAS5 decreased the expression of miR-222 through directly targeting in glioma cells; meanwhile, tumor suppressor Bcl-2-modifying factor (bmf), as the downstream target of miR-222, was up-regulated, and thus inhibited glioma cell proliferation [7]. [score:15]
MiR-21, miR-103, miR-222, were identified as the downstream targets of GAS5 [7, 19, 20]. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 18
Since miR-21, miR-221 and miR-222 up-regulation has been associated with breast cancer aggressiveness and resistance to antineoplastic therapies [16– 19], NCL exerts a critical pro-tumorigenic function by regulating their biogenesis at the post-transcriptional level, thus enhancing their maturation from pri- to pre-miRNAs [11]. [score:5]
The critical role of NCL in microRNA biology was recently revealed by the finding that NCL regulates the maturation and expression of specific miRNAs, including miR-21, miR-221, miR-222, that are involved in the diverse phases of breast cancer development, and drug resistance [11, 30– 33]. [score:5]
Consistent with its involvement in RNA processing, we previously reported that NCL promotes the maturation of a specific set of microRNAs (miRNAs), namely, miR-21, miR-221 and miR-222, whose up-regulation is involved in breast tumorigenesis, metastasis formation, and drug resistance [16– 19]. [score:4]
Nucleolin is also a member of the rRNA nucleolar-processing complex [10, 40] and is directly involved in miRNA biogenesis [41], including that of miR-10a, miR-21, miR-103, miR-221 and miR-222. [score:2]
Notably, oncogenic miR-21, miR-221 and miR-222 were previously demonstrated to be released by colon cancer cells and transferred to other cancer cells, thereby mediating their aggressiveness [37]. [score:1]
As shown in Figure 6A, Real-Time PCR analysis revealed that 4LB5-HP-RNase dose -dependently reduced the levels of the mature miR-21, miR-221 and miR-222 with a relevant effect already at the lowest concentration tested. [score:1]
[1 to 20 of 6 sentences]
68
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Analyzing the gene expression profile reveals that miR-148a, miR-222 and miR-21 may cause fludarabine resistance through inhibiting the activation of p53-responsive genes. [score:5]
For example, Glioma Tumor Suppressor Candidate Region Gene 1 (GLTSCR1), Synaptotagmin (STY1), neuronatin (NNAT) and Synaptic Ras GTPase-activating protein 1 (SYNGAP1) are putative targets of miR-126, miR-222, miR-198 and miR-633, respectively [76]. [score:5]
On the other hand, overexpression of miR-21, miR-148a, miR-155 and miR-222 in CLL patients was associated with poor therapeutic response and prognosis [15– 17, 23, 24]. [score:3]
Plasma miR-511, miR-222, and miR-34a were up-regulated in B-ALL patients compared with normal controls, whereas plasma miR-199a-3p, miR-223, miR-221, and miR-26a were lower in B-ALL patients [167]. [score:3]
Expression of miR-126, miR-345, miR-222, and miR-551a were reduced in ALL patients with central nervous system (CNS) relapse compared to non-CNS-relapsed ALL patients [76]. [score:2]
[1 to 20 of 5 sentences]
69
[+] score: 17
In addition, our results indicate that several microRNAs (miRs), specifically miR-222, miR-223, miR-1626, miR-1699, miR-1744, miR-1787, miR-1798 and miR-1812 interact with sites in the 3′-UTR of the cell cycle genes and regulatory factors affecting cell cycle genes including CCND1, CCNE2, CDK1, CDK3, CDKN1A and CDKN1B to influence post-transcriptional regulation of its expression in laying hens. [score:5]
In addition, our miR target validation assay demonstrated that miR-1626 regulates CDKN1A expression and miR-222, miR-1787 and miR-1812 influence post-transcriptional modification of transcripts of the CDKN1B gene. [score:5]
In addition, for CDKN1B, in the presence of miR-222, miR-1787 and miR-1812, the intensity and percentage of GFP-CDKN1B -expressing cells (29.0% in control vs. [score:3]
[C and D] After co-transfection of pcDNA-eGFP-3′UTR for the CDKN1B transcript and pcDNA-DsRed-miRNA for the miR-222, miR-1787 and miR-1812, the fluorescence signals of GFP and DsRed were detected using FACS [C] and fluorescent microscopy [D]. [score:1]
[A] Diagram of miR-222, miR-1787 and miR-1812 binding sites in the 3′-UTR of the CDKN1Bgene. [score:1]
This analysis revealed putative binding sites for several chicken miRNAs (miR-1798 for CCND1; miR-1699 for CCNE2; miR-223 for CDK1; miR-1744 for CDK3; miR-1626 for CDKN1A; and miR-222, miR-1787 and miR-1812 for CDKN1B), but not for the other four genes of interest. [score:1]
15.6% in miR-1787, 12.6% in miR-1812, 9.8% in miR-222) were decreased (P<0.01) (Figure 8). [score:1]
[1 to 20 of 7 sentences]
70
[+] score: 17
Ultimately, according to the miRNAs’ fold change and expression level, five up-regulated miRNAs (miR-630, miR-222-5p, miR-210-3p, miR-34a-5p and miR-34b-5p) and two down-regulated miRNAs (miR-335-3p and miR-15b-3p) were chosen for microarray validation by RT-PCR (Table  1). [score:9]
b Quantitative real-time RT-PCR validation of five up-regulated and two down-regulated miRNAs (mean ± SD, n = 3) Table 1 Fold change of the seven selected miRNAs and their forward primer sequences used for RT-PCR miRNA Name Fold Change Forward Primer for RT-PCR miR-630 4.14 GCGAGTATTCTGTACCAGGGAAGGT miR-222-5p 3.84 CGCTCAGTAGCCAGTGTAGATCCT miR-210-3p 3.23 CTGTGCGTGTGACAGCGG miR-34a-5p 2.59 CTGGCAGTGTCTTAGCTGGTTGT miR-34b-5p 2.44 GCGTAGGCAGTGTCATTAGCTGATTG miR-335-3p 0.45 CGGCGTTTTTCATTATTGCTCCTGACC miR-15b-3p 0.33 CGGGCGAATCATTATTTGCTGCTCTA To identify the connections between the grading of nuclear opacity and expression levels of miRNAs, Pearson correlation coefficient was introduced (Fig.   3). [score:7]
However, for miR-222-5p, miR-210-3p, miR-34b-5p and miR-15b-3p, the relations were moderate (R = 0.436, 0.428, 0.398, 0.489) and statistically insignificant (P > 0.05). [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 17
Other miRNAs from this paper: hsa-mir-221, rno-mir-221, rno-mir-222
While miR-222 RNA was also downregulated in the aortas of Tg rats, the reduced level of expression was not significant compared to controls. [score:5]
Overexpression of miR-221 or miR-222 inhibits monocyte adhesion induced by Tat in HUVECs. [score:5]
Intriguingly, homogenates of the aorta and heart also demonstrated increased expression of ICAM-1 when assessed by real-time RT-PCR and Western blot as shown in Figs. 7B and C. Furthermore, consistent with the in vitro findings, expression of miR-221, but not miR-222, was decreased in aorta isolated from HIV Tg rats, compared with the WT rats (Fig. 7D). [score:4]
0060170.g006 Figure 6Transfection of HUVECs with miR-221 or miR-222 precursor abrogated Tat -induced monocyte adhesion. [score:1]
HUVECs transfected with miR-221 or miR-222 precursor or a precursor control for 24 h were exposed to Tat (14.4 nM) for 12 h followed by western blot analysis for ICAM-1. All the data are presented as mean ± SD of three independent experiments. [score:1]
Transfection of HUVECs with miR-221 or miR-222 precursor abrogated Tat -induced monocyte adhesion. [score:1]
[1 to 20 of 6 sentences]
72
[+] score: 17
Other miRNAs from this paper: hsa-mir-152
Expression of miR-222 was significantly up-regulated in rat rhabdomyosarcomas induced by an intramuscular injection of nickel subsulfide as well as in nickel-transformed 16HBE cells [66]. [score:6]
miR-222, which is able to target several important tumor suppressor genes including p27, p57 and PTEN, has been found to be increased in many human cancers. [score:5]
Thus, deregulated miR-222 and reduced expression of p27 and p57 may contribute to accelerated cell growth observed in Ni -induced tumors as well as transformed cells [66]. [score:4]
Zhang J. Zhou Y. Ma L. Huang S. Wang R. Gao R. Wu Y. Shi H. Zhang J. The alteration of MiR-222 and its target genes in nickel -induced tumor Biol. [score:2]
[1 to 20 of 4 sentences]
73
[+] score: 17
P-values for chosen candidates were as follows: miR-17(1.92E [−09]), miR-18a(2.62E [−09]), miR-29c(4.71E [−09]), miR-106a(1.84E [−08]), miR-135a(8.26E [−09]), miR-135b(1.99E [−08]), miR-221(9.19E [−05]), miR-222(2.04E [−05]) (see Supporting Table S2) Expression profiles of these candidates can be found in Figure 2. Three out of eight miRNAs exhibited decreasing expression during brain development (miR-17, miR-18a (belonging to the same cluster), miR-106a) [24]. [score:6]
This might potentially explain why miR-221 and miR-222 are highly expressed in the cortex during early fetal life, when neuron terminal differentiation in the cortex and cerebellum is abundant. [score:3]
The last two miRNAs: miR-221 and miR-222, which belong to the same cluster, constitute the fourth group of expression pattern observed. [score:3]
Numerous developmental stage or tissue-specific microRNAs including, miR-17, miR-18a, miR-29c, miR-106a, miR-135a and b, miR-221 and miR-222 were found by microarray analysis. [score:2]
The correlation coefficient values (R [2]) for particular miRNAs include: miR-17 (R [2] = 0.84), miR-18a (R [2] = 0.94), miR-29c (R [2] = 0.92), miR-106a (R [2] = 0.81) and miR-135a (R [2] = 0.89) miR-135b (R [2] = 0.95), miR-221 (R [2] = 0.91) and miR-222 (R [2] = 0.88). [score:1]
For instance, the interesting candidate miR-221 which is a cluster member with miR-222 would have been discarded by using more stringent cutoff of. [score:1]
Eight different candidate miRNAs: hsa-miR-17, hsa-miR-18a, hsa-miR-29c, hsa-miR-106a, hsa-miR-135a hsa-miR-135b, hsa-miR-221 hsa-miR-222 and two reference miRNAs: hsa-miR-103 and hsa-miR-191 were profiled by. [score:1]
[1 to 20 of 7 sentences]
74
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
MiRNA expression profiling in sputum of subjects exposed to ozone inhalation revealed significantly up-regulated expression of 10 miRNAs: miR-132, miR-143, miR-145, miR-199a-3p, miR-199b-5p, miR-222, miR-223, miR-25, miR-424 and miR-582-5p [94]. [score:8]
[1 to 20 of 2 sentences]
75
[+] score: 17
Mechanistically, the up-regulation of Gas5 increases the expression of tumor suppressor bmf (Bcl-2-modifying factor) and Plexin C1 via directly reducing the expression of miR-222 (Zhao X. et al., 2015). [score:11]
Gas5 exerts tumor-suppressive functions in human glioma cells by targeting miR-222. [score:5]
In this regard, recent studies have demonstrated that lncRNAs in gliomas can serve as molecular decoys, which move proteins or RNAs away from a specific location, like a “sponge” to miRNAs (e. g., HOTAIR/miR-326, CASC2/miR-21, XIST/miR-152, and Gas5/miR-222). [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 16
miR-221 and miR-222, which together form a cluster located in chromosome band Xp11.3, were chosen for further analyses because i) according to our array data they were among the most strongly overexpressed miRNAs in AML (Additional file 3: Table S3); ii) they are two of only a few miRNAs consistently reported to be overexpressed in AML [12, 24, 25, 44]; and iii) they had been implicated as oncogenes in a number of other malignancies [38, 45- 49]. [score:5]
For miR-222, a trend towards differential expression was observed (Figure  1B). [score:3]
However, neither blasticidin resistant HL60 clones obtained after transfection with miR-Vec-221/222 [38], nor GFP positive HL60, KG1, or KG1a cell populations sorted after infection with pEZX-MR03-miR-221 exhibited increased expression of mature miR-221 or miR-222 (Additional file 5: Figure S1A, and data not shown). [score:3]
To study the biological effects of miR-221 and miR-222 in human myeloid cells, we introduced suitable expression vectors into the cell lines HL60, KG1, and KG1a. [score:3]
*, p < 0.05; n. s., not significant (miR-222, p = 0.064). [score:1]
All three transcripts would terminate at the same position and contain the sequences for mature miR-221 and miR-222 around 3 and 4 kb, respectively, from their 3’-ends (Figure  5A). [score:1]
[1 to 20 of 6 sentences]
77
[+] score: 16
In contrast, miR-222, another member of the miR-221/222 cluster but with a different sequence to miR-221 (Supplementary Fig. 3A), did not show a knockdown effect by the miR-221 zipper (Supplementary Fig. 3B), indicating the sequence specificity of small RNA zipper binding to target miRNAs. [score:4]
To validate the sequence specificity of binding between a small RNA zipper and target miRNA, miR-222 was tested in MDA-MB-231 cells transfected with miR-221 zipper. [score:3]
Owing to the unaffected expression of miR-222 in the miR-221 zipper -treated cells, the increased level of luciferase activity by miR-221 zipper was not as high as that by mutated p27 3′-UTR. [score:3]
The increased level of luciferase activity was not as high as that in mutated p27 3′-UTR cells mainly due to the unaffected expression of miR-222 in miR-221 zipper treated cells. [score:3]
miR-221 and miR-222, two members of a miRNA cluster, which is located on chromosome X, share the same ‘seed' sequence but the rest of the sequence is different (Supplementary Fig. 3A). [score:1]
However, miR-222 did not show a response to either low or high concentrations of miR-221 zipper (Supplementary Fig. 3B). [score:1]
This was further confirmed when the miR-221 zipper and Δzipper were applied, to determine the effect on the abundance of miR-221 and miR-222 (Fig. 3c,d). [score:1]
[1 to 20 of 7 sentences]
78
[+] score: 16
More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55]. [score:16]
[1 to 20 of 1 sentences]
79
[+] score: 16
Two miRs, hsa-miR-204 (up-regulated in hypoxia) and hsa-miR-222 (down-regulated in hypoxia), displayed correlated expression patterns in prostate tumors (Pearson R = 0.66, p < 0.0001), and showed statistically significant inverse correlations with tumor T stage, N stage and Gleason score (Table 5). [score:9]
The top 20 miRNAs significantly up- or down-regulated in Exo [Hypoxic] compared to Exo [Normoxic] are listed in Table 1. Nine miRNAs were expressed at a significantly lower level in Exo [Hypoxic] compared to Exo [Normoxic]: miR-521 (Fold change = 0.0005), miR-27a (Fold change = 0.24), miR-324 (Fold change = 0.446), miR-579 (Fold change = 0.448), miR-502 (Fold change = 0.396), miR-222 (Fold change = 0.232), miR-135b (Fold change = 0.325), miR-146a (Fold change = 0.456) and miR-491(Fold change = 0.482). [score:4]
Among these, 15 miRNAs (miR-143, miR-146a, miR-181a, miR-204, miR-222, miR-27a, miR-335, miR-433, miR-491, miR-502, miR-521, miR-92a, miR-127, miR-135b and miR-451) target 211 mRNAs when the confidence limit was set as “Experimentally Observed” only. [score:3]
[1 to 20 of 3 sentences]
80
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-149, hsa-mir-184, hsa-mir-186, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-339, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Indeed, key PIK3CA effectors were overexpressed (AKT1, PIK3CB, PIK3CD, PTK2, KRAS, CD19, HSP90AA1 and the integrins ITGA1, ITGA5, ITGA8, ITGB4, ITGB6 and ITGB8), and the PTEN -targeting miRNAs miR-21, miR-222 and the AKT downstream targets MDM2, NOS3, YWHAZ were up-regulated. [score:10]
Although regulators of invasiveness such as Snail, Slug and Twist were not found deregulated, molecular markers like MMP9 and Fibronectin and miRNA related to invasion (miR-222) were up-regulated, while CDH1 was repressed. [score:6]
[1 to 20 of 2 sentences]
81
[+] score: 16
Other miRNAs from this paper: hsa-mir-221
0071309.g002 Figure 2 A: The relative miRNA levels in AsPC-1 cells treated with vehicle or PDGF-BB (20 ng/ml, 24 hr) B, C: Time-course expression of the relative expression of miR-221-3p, miR-221-5p, miR-222-3p and miR-222-5p (B), and miR-221 transcripts (Pri-miR-221), Pre-miR-221 or mature miR-221 (C) normalized to GAPDH (for Pri-miR-221 or Pre-miR-221), or U6 small nuclear RNA (for miR-221-3p, miR-221-5p, miR-222-3p, miR-222-5p and mature miR-221) in AsPC-1 cells treated with vehicle or PDGF-BB (20 ng/ml, 24 hr). [score:5]
A: The relative miRNA levels in AsPC-1 cells treated with vehicle or PDGF-BB (20 ng/ml, 24 hr) B, C: Time-course expression of the relative expression of miR-221-3p, miR-221-5p, miR-222-3p and miR-222-5p (B), and miR-221 transcripts (Pri-miR-221), Pre-miR-221 or mature miR-221 (C) normalized to GAPDH (for Pri-miR-221 or Pre-miR-221), or U6 small nuclear RNA (for miR-221-3p, miR-221-5p, miR-222-3p, miR-222-5p and mature miR-221) in AsPC-1 cells treated with vehicle or PDGF-BB (20 ng/ml, 24 hr). [score:5]
A time-course of the expression of miR-221-3p, miR-221-5p, miR-222-3p and miR-222-5p was examined after PDGF-BB treatment in AsPC-1 cells. [score:3]
Figure S1 miR-222 does not involved in the PDGF -mediated EMT phenotype and cancer cell migration and proliferation. [score:1]
MiR-221 and miR-222 share the same seed sequence, indicating a great degree of functional overlap between these two mRNAs. [score:1]
However, our result indicated that miR-222 does not involved in the PDGF -mediated EMT phenotype and cancer cell migration and proliferation (Figure S1). [score:1]
[1 to 20 of 6 sentences]
82
[+] score: 15
For example, miR-222* was up-regulated in response to HCHF diet in low LDL-C baboon livers but down-regulated in high LDL-C responders while mature sequences were down-regulated in both LDL-C phenotypes. [score:10]
miR-221 and miR-222 were significantly down-regulated in response to HCHF diet in both low and high LDL-C baboons. [score:4]
miR-221 and miR-222, which share an identical seed region, are associated with arterial smooth muscle angiogenesis [41]. [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 15
They proposed that seven upregulated miRNAs (gga-mir-221, gga-mir-222, gga-mir-1456, gga-mir-1704, gga-mir-1777, gga-mir-1790, and gga-mir-2127) might play a tumorigenic role, whereas downregulation of five other miRNAs (gga-let-7b, gga-let-7i, gga-mir-125b, gga-mir-375, and gga-mir-458) was associated with loss of tumor suppressive functions (143). [score:9]
Similarly, Dai et al. found that miR-221 and miR-222, which were upregulated in the liver of ALV-J-infected chickens, can act as tumorigenic agents by targeting BCL-2 modifying factor (146). [score:6]
[1 to 20 of 2 sentences]
84
[+] score: 15
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
For example, Lee EJ 2007 et al. [44] showed that the miRNAs miR155, miR21, miR222, Let7, miR376a, miR301, miR100, miR125, miR142 and others are overexpressed significantly in human PC. [score:3]
[1 to 20 of 2 sentences]
85
[+] score: 15
In line with this, we also found a significant inverse correlation between the expression levels of these ER-regulated miRNAs and mRNA expression levels of their functionally validated target genes - for instance, hsa-miR-221and hsa-miR-222 have been shown to target the CDKN1B and ESR1genes (see Table S20 in Additional file 1). [score:10]
Among the 87 most-variable expressed miRNAs across the entire panel, a group of 15 miRNAs (hsa-miR-130a, hsa-miR-886-5p, hsa-miR-886-3p, hsa-miR-222, hsa-miR-21*, hsa-miR-29a, hsa-miR-23a, hsa-miR-24, hsa-miR-30a, hsa-miR-27a, hsa-miR-22, hsa-miR-532-3p, hsa-miR-100, hsa-miR-125b, hsa-miR-221) was significantly higher expressed in the minor cluster as opposed to other miRNAs (Figure 2, top red box). [score:5]
[1 to 20 of 2 sentences]
86
[+] score: 15
Changes in miRNA expression at 3 h ranged from 11-fold down-regulation (miR-224) to 3.8-fold up-regulation (miR-367), and at 24 h from 7-fold down-regulation (miR-222) to 20.6-fold up-regulation (miR-135a*; Figure 2). [score:15]
[1 to 20 of 1 sentences]
87
[+] score: 14
For example, all libraries generated frequent alignments to miR-222 which is highly expressed in ECs, [23] whereas there were no or only single alignments to miR-124 which is expressed predominantly in brain tissue [25] (Fig 1A). [score:5]
miRNAs selected for validation studies spanned a range of expression from high to single alignments, and included miR-21, miR-30, miR-98/Let7 family members, miR-221, miR-222, miR-622, miR-664, miR-1248 and miR-1291. [score:3]
MicroRNA-222 controls neovascularization by regulating signal transducer and activator of transcription 5A expression. [score:3]
To assess endothelial specificity, transcript profiles were compared across 10 mRNAs, and 10 miRNAs, pre-selected due to strong expression in either endothelial cells (miR-222, [23] miR-221, miR-126, miR-100, miR-21, PECAM1, VWF, ENG, VE-Cadherin [24] and VE-Statin) or recognition as non endothelial cell markers (miR-134 [25], miR-124-1, miR-128-1, miR-326 miR-17, Neurog2, TAGLN, SOX10, CDX2 and CUBN). [score:2]
Endothelial: miR-222, [23] and VE-cadherin (CDH5, [24], final exon illustrated). [score:1]
[1 to 20 of 5 sentences]
88
[+] score: 14
Eight miRNAs (miR-183, miR-193a-5p, miR-222, miR-516b, miR-524-5p, miR-601, and miR-629, 99b) were upregulated and five miRNAs (miR-124, miR-32, miR-574-5p, miR-744, and miR-96) were downregulated. [score:7]
miR-184, miR-524-5p, miR-629, and miR-766 were upregulated, while miR-124, miR-222, miR-32, miR-744, and miR-765 were downregulated [28]. [score:7]
[1 to 20 of 2 sentences]
89
[+] score: 14
Here, 37 miRNAs (miR-16, miR-23a, miR-23b, miR-143, miR-145, miR-195,miR-221, miR-222, miR-497 et al. ) were found to be downregulated in hormone-refractory late-stage prostate carcinomas, whereas 14 miRNAs were upregulated in hormonerefractory carcinomas. [score:7]
Schaefer et al. [8] validated that ten microRNAs (hsa-miR-16, hsa-miR-31, hsa-miR-125b, hsa-miR-145, hsa-miR-149, hsa-miR-181b, hsa-miR-184, hsa-miR-205, hsa-miR-221, hsa-miR-222) were downregulated and five miRNAs (hsa-miR-96, hsa-miR-182, hsa-miR-182, hsa-miR-183, hsa-375) were upregulated in prostate cancer. [score:7]
[1 to 20 of 2 sentences]
90
[+] score: 14
Over -expression of the oncogenic miR-221 and miR-222 in non-small cell lung cancer, hepatocarcinoma and gastric cancer cells suppress PTEN expression in vitro and in vivo experiments leading to activation of the oncoprotein AKT and promotion of cell migration and growth [138, 139]. [score:7]
Conversely, knockdown of miR-221 and miR-222 are able to increase PTEN expression and decrease cell migration and invasion [139]. [score:4]
In glioma cells, overexpression of miR-221 and miR-222 increases cell proliferation and invasion in vitro and induces glioma growth in xenograft tumour mouse mo dels via activation of Akt [141]. [score:3]
[1 to 20 of 3 sentences]
91
[+] score: 14
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-210, hsa-mir-221
This study has determined that 197 of 217 genes are targeted and downregulated by only four of the miRNAs: miR-24, miR-210, miR-221, and miR-222 in which miR-24 was the most important because numerous target genes, represented in Tables 2 and 3, are controlled and regulated by miR-24. [score:9]
Moreover miR-210, miR-221, and miR-222 were significantly proficient to regulate more than one target gene which were associated with pancreatic cancer in this network. [score:4]
In addition, miR-24, miR-210, miR-221, and miR-222 are the most important among miRNAs. [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 14
Human endothelial cells from advanced neovascularized atherosclerotic lesions showed that miRNA-222 expression was negatively correlated to signal transducer and activator of transcription 5A (STAT5A) expression and diminished proliferation and vessel formation ability [95]. [score:5]
Knockdown of miRNA-221 and miRNA-222 suppressed vascular smooth muscle cell (VSMC) proliferation and neointimal lesion formation after carotid angioplasty [96]. [score:4]
Dentelli P. Rosso A. Orso F. Olgasi C. Taverna D. Brizzi M. F. microRNA-222 controls neovascularization by regulating signal transducer and activator of transcription 5A expression Arterioscler. [score:4]
Liu X. Cheng Y. Zhang S. Lin Y. Yang J. Zhang C. A necessary role of miR-221 and miR-222 in vascular smooth muscle cell proliferation and neointimal hyperplasia Circ. [score:1]
[1 to 20 of 4 sentences]
93
[+] score: 14
Furci et al. (2013) studied Mtb -induced miRNA expression profile in primary human macrophages infected with virulent Mtb H37Rv and avirulent M. bovis BCG and showed that macrophages differentially expressed miRNAs, including miR-155, miR-146a, miR-145, miR-222 [∗], miR-27a, and miR-27b. [score:5]
In general, this approach of direct delivery should be implemented for those miRNAs that are downregulated during TB infection, including miR-155, miR-146a, miR-145, miR-222 [∗], miR-27a, or miR-27b (Spizzo et al., 2010; Belver et al., 2011; McGregor and Choi, 2011; Graff et al., 2012). [score:5]
In this study, miR-222 [∗], miR-27a, and miR-27b, which have been reported to control inflammatory response and lipid metabolism (McGregor and Choi, 2011; Graff et al., 2012) were significantly downregulated. [score:4]
[1 to 20 of 3 sentences]
94
[+] score: 13
These 49 miRNAs, which represent the basis of the core miRNA response to bacterial infection in DCs, comprised 27 miRNAs that were upregulated upon infection, 21 that were downregulated and one, miR-222-5p, which was upregulated at 4h but downregulated at later time points. [score:13]
[1 to 20 of 1 sentences]
95
[+] score: 13
We found 12 miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i) that were consistently up-regulated in the senescent cells of all donors (Fig. 1A), whereas only three miRNAs of the 17–92 cluster were down-regulated (Fig. 1A). [score:7]
We identified 12 miRNAs to be up-regulated in senescence, comprising hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i. [score:4]
Probe name Sequence anti-hsa-miR-21 TCAACATCAGTCTGATAAGCTA anti-hsa-miR-29a AACCGATTTCAGATGGTGCTA anti-hsa-miR-222 GAGACCCAGTAGCCAGATGTAGCT anti-hsa-miR-31 CAGCTATGCCAGCATCTTGCC For quantification of miRNA expression, 10 ng of total RNA was reverse transcribed with the TaqMan MicroRNA Reverse Transcription Kit using specific primer according to the manufacturer's instructions (Applied Biosystems, Life Technologies Ltd, Paisley, UK). [score:2]
[1 to 20 of 3 sentences]
96
[+] score: 13
Other miRNAs from this paper: hsa-mir-221
Epstein-Barr virus proteins EBNA3A and EBNA3C together induce expression of the oncogenic microRNA cluster miR-221/miR-222 and ablate expression of its target p57KIP2. [score:7]
In addition, EBNA3A and EBNA3C directly repress transcription of the p16 [INK4a]-related CDKI, p15 [INK4b] [21] and—by inducing precursors of oncogenic microRNAs miR-221 and miR-222—inhibit expression of CIP/KIP family CDKIs, p57 [KIP2] and p27 [KIP1] [19]. [score:6]
[1 to 20 of 2 sentences]
97
[+] score: 13
And they showed miR-221 (not miR-222) was downregulated (not upregulated) in high-risk MDS patients [14]. [score:7]
Pons et al. detected miRNA expression in 25 MDS patients (high risk group = 3, low risk group = 22) and found that miR-155, miR-181a and miR-222 were upregulated in high risk patients [13]. [score:6]
[1 to 20 of 2 sentences]
98
[+] score: 13
Bazot Q. Paschos K. Skalska L. Kalchschmidt J. S. Parker G. A. Allday M. J. Epstein-Barr Virus Proteins EBNA3A and EBNA3C Together Induce Expression of the Oncogenic MicroRNA Cluster miR-221/miR-222 and Ablate Expression of Its Target p57KIP2 PLoS Pathog. [score:7]
Moreover, EBNA-3A and -3C were shown to induce miRNA cluster miR-221/miR-222 to down-regulate p57 [Kip2] expression in B-cells [61]. [score:6]
[1 to 20 of 2 sentences]
99
[+] score: 12
Remarkably, hsa-miR-222-3p was also significantly upregulated in the CD34 [+] subset, but its expression is further increased in immature T-ALLs (Fig.   4c). [score:6]
For example, 4 miRNAs (hsa-miR-222-3p, hsa-miR-146a-5p, hsa-mir-221-3p and hsa-miR-126-5p) from the top 10 immature T-ALL specific miRNAs (Fig.   2c) also showed significant higher expression in CD34 [+] vs. [score:3]
From the top ten immature specific miRNAs, three miRNAs (hsa-miR-21-5p, hsa-miR-222-3p and hsa-miR-101-3p) were significantly upregulated in the immature samples compared to the healthy control CD34 [+] samples. [score:3]
[1 to 20 of 3 sentences]
100
[+] score: 12
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-16-2, hsa-mir-223, hsa-mir-126
Non-normally distributed variables (fold changes of miR-222 and miR-223) were normalised prior to analysis using natural logarithmic (ln) transformation. [score:1]
These include miR-16, miR-17, miR-126, miR-222 and miR-223[8– 11]. [score:1]
For miR-16, miR-17, miR-126 and miR-222, no significant change was found over 12 weeks in the HP or NP group. [score:1]
Fig 1 and Table 2 show the fold changes of HDL -associated miR-16, miR-17, miR-126, miR-222 and miR-223 from overweight and obese subjects over 12 weeks of HP or NP weight loss diet. [score:1]
We aim to determine if HDL -associated miR-16, miR-17, miR-126, miR-222 and miR-223 levels are altered by diet -induced weight loss in overweight and obese males. [score:1]
Changes of HDL -associated miR-16, miR-17, miR-126, miR-222 and miR-223 levels over 12 weeks of weight loss diet (n = 47). [score:1]
The present study also examined other HDL -associated miRNAs (miR-16, miR-17, miR-126, miR-222) that are associated with obesity and/or weight loss but they were not significantly altered with diet. [score:1]
miR-16, miR-17, miR-126, miR-222 and miR-223 were present on HDL from overweight and obese subjects at baseline and after 12 weeks of the HP and NP weight loss diets. [score:1]
For example, circulating levels of miR-16-1 and miR-222 are decreased following gastric bypass bariatric surgery, but not affected by diet -induced weight loss[11]. [score:1]
It has recently been demonstrated that HDL transport multiple miRNAs, including miR-16, miR-17, miR-126, miR-222 and miR-223[6]. [score:1]
Morbidly obese individuals also have markedly increased circulating levels of miRNAs such as miR-222[11]. [score:1]
As there are no reports of changes in HDL -associated miRNA levels with diet -induced weight loss in the literature, we have examined the effects of weight loss on HDL levels of miR-16, miR-17, miR-126, miR-222 and miR-223, all of which have a known association with obesity and are HDL -associated[6]. [score:1]
[1 to 20 of 12 sentences]