sort by

70 publications mentioning hsa-mir-219a-1

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-219a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 142
To further validate the influence of miR-219-5p on CDH1, we overexpressed miR-219-5p in HepG2 cells and knocked down miR-219-5p in MHCC-97H cells, finding that miR-219-5p upregulation led to a significant decrease of CDH1 expression at both mRNA and protein levels (P < 0.01). [score:9]
In the present study, we found that miR-219-5p was upregulated in HCC tissues, was related to overall survival (OS) time of HCC patients, and promoted the proliferation and metastasis of HCC cells via downregulating CDH1. [score:7]
Upregulation of miR-219-5p in HepG2, which had a low endogenous expression level, by miR-219-5p mimic induced significant increases in the abilities of proliferation (Figure 2(a); Supplementary Figure 2(A)). [score:6]
Furthermore, miR-219-5p mimic transfection significantly suppressed the apoptosis of HepG2 cells compared with ctrl, while miR-219-5p downregulation induced by miR-219-5p antagomir markedly promoted the apoptosis of MHCC-97H cells (Figure 2(c)). [score:5]
These suggested that miR-219-5p is closely associated with negative regulation of CDH1 and CDH1 is a direct target of miR-219-5p. [score:5]
Results showed that miR-219-5p upregulation significantly enhanced the migration and invasion abilities of HepG2, and miR-219-5p knockdown induced by miR-219-5p antagomir led to reduced number of migrated and invaded cells (Figure 2(d); Supplementary Figure 2(C)). [score:5]
In the present study, we found that miR-219-5p expression levels were remarkably upregulated in HCC tissues compared with the nontumor liver tissues, and high miR-219-5p levels were significantly associated with metastasis and dismal prognosis of HCC. [score:5]
These indicated that miR-219-5p is closely associated with negative regulation of CDH1 and CDH1 is a direct target of miR-219-5p. [score:5]
Therefore, these results suggested that miR-219-5p upregulation can be a predictor of metastasis and dismal prognosis of HCC patients. [score:4]
CDH1 Is a Direct Target of microRNA-219-5p. [score:4]
These results indicated that miR-219-5p upregulation is correlated with HCC metastasis. [score:4]
On the other hand, knockdown of miR-219-5p in MHCC-97H (with a high endogenous miR-219-5p level) by miR-219-5p antagomir (Supplementary Figure 2(A)) significantly inhibited the proliferation of cells (Figure 2(a)). [score:4]
3.1. miR-219-5p Upregulation Is Associated with Metastasis and Dismal Prognosis of HCC. [score:4]
In conclusion, these data suggest that miR-219-5p upregulation is an independent prognostic indicator for HCC patients. [score:4]
Collectively, miR-219-5p promotes HCC growth and metastasis by downregulating CDH1 (Figure 4(f)). [score:4]
We identified CDH1 as a direct target of miR-219-5p and the potential binding sequence in CDH1 3′UTR (Figure 4(a)). [score:4]
And, miR-219-5p knockdown resulted in enhanced CDH1 expression (P < 0.01) (Figures 4(c) and 4(d)). [score:4]
The wild-type sequence containing the predicted target sites of miR-219-5p in the 3′UTR of CDH1 mRNA was synthesized by JIELI corporation (Shanghai, China). [score:3]
For example, miR-219-5p was reported to function as a tumor suppressor in colorectal and gastric cancers [17, 18]. [score:3]
In this study, we found the following: (1) Bioinformatic analysis indicated that CDH1 can be a potential downstream target of miR-219-5p. [score:3]
We carried out a dual-luciferase reporter assay to prove that CDH1 is a direct target of miR-219-5p. [score:3]
Kaplan–Meier analysis showed that miR-219-5p overexpression was associated with poorer overall survival and higher recurrence rates of patients after curative HCC resection (Figure 1(c)). [score:3]
Next, we searched for putative target genes of miR-219-5p in microRNA. [score:3]
Moreover, elevated miR-219-5p expression was found to be correlated with vascular invasion (P = 0.003) and worse differentiation (P = 0.011) of liver tumor, as well as severe liver cirrhosis (P < 0.001) (Table 1). [score:3]
Supplementary Figure 2: the relative expression levels of miR-219-5p in HepG2 and MHCC-97H cells were examined after the cells were treated with miR-219-5p mimic, antagomir, or negative control (A) for 48 h using RT-qPCR. [score:3]
The expression levels of miR-219-5p were remarkably higher in HCC patients with metastasis in comparison to those without metastasis (P < 0.001) (Figure 1(b)). [score:3]
Another significant finding of the present study is that CDH1 is identified as a downstream target of miR-219-5p. [score:3]
Supplementary Figure 1: (A) miR-219-5p expressions in six liver cancer cell lines. [score:3]
We analyzed the expression levels of miR-219-5p in 191 paired HCC tissues and corresponding noncancerous liver tissues by using qRT-PCR and found that miR-219-5p was significantly increased in HCC tissues compared with the nontumor liver tissues (P < 0.001) (Figure 1(a)). [score:2]
The analysis of distribution of cells with miR-219-5p mimic/antagomir was shown by histogram (B). [score:1]
These provided more evidence to support that miR-219-5p is an important promoter for HCC growth and metastasis. [score:1]
The reporter vector containing wild-type (CDH1-WT) or mutated-type binding sequence (CDH1-MT) was transfected into HEK293T cells along with miR-219-5p mimic or ctrl. [score:1]
The average volume of orthotopic tumors in the miR-219-5p antagomir group was significantly smaller than that in the antagomir NC group (P < 0.05) (Figure 3(c)). [score:1]
However, little is known of the possible mechanism of miR-219-5p involved in HCC metastasis. [score:1]
These results suggested that miR-219-5p plays a crucial role in promoting in vivo tumor growth and lung metastasis of HCC. [score:1]
Subcutaneous HCC mo del was established by injecting 5 × 10 [6] MHCC-97H cells (transfected with antagomir NC or antagomir miR-219-5p) into BALB/c nude mice (Shanghai SLAC Laboratory Animal Co. [score:1]
To further validate the role of miR-219-5p in HCC metastasis, we analyzed miR-219-5p in various HCC cell lines with different metastatic potentials and found that miR-219-5p levels in the HCC cells with high metastatic potentials were higher than those nonmetastatic cell lines (Supplementary Figure 1(A)). [score:1]
To further validate promoting roles of miR-219-5p in HCC progression, we established HCC xenografts mo dels by subcutaneous implantation of MHCC-97H cells (transfected with miR-219-5p antagomir or antagomir NC). [score:1]
miR-219-5p mimic, antagomir, and their corresponding negative controls were purchased from Ribobio (Shanghai, China). [score:1]
In our previous work, miR-219-5p is identified as one of the significant metastasis-related miRNAs in HCC [10]. [score:1]
To investigate the biological significance of miR-219-5p, we treated human HCC cell lines with miR-219-5p mimic or antagomir that would lead to different expression levels of miR-219-5p. [score:1]
Univariate analysis showed that miR-219-5p, tumor size, tumor encapsulation, and vascular invasion were related to overall survival (OS) (Table 2); miR-219-5p, HBsAg, tumor size, vascular invasion, and tumor number were associated with HCC recurrence (Table 3). [score:1]
Cell cycle arrest at the G1 to S transition was found in MHCC-97H cells after treated with miR-219-5p antagomir (Figure 2(b); Supplementary Figure 2(B)). [score:1]
Taken together, these data suggested that miR-219-5p can promote the proliferation, cell cycle transition of G1 into S phase, antiapoptotic potentials, and metastatic phenotype of HCC cells. [score:1]
The average tumor volume of the miR-219-5p antagomir -treated group was obviously smaller than that of antagomir NC group (P < 0.05) (Figures 3(a) and 3(b)). [score:1]
The Effects of miR-219-5p on In Vitro Proliferation and Invasion of HCC Cells. [score:1]
These results provide a clear understanding of the underlying mechanism by which miR-219-5p promotes HCC metastasis. [score:1]
Multivariate analysis showed that miR-219-5p, vascular invasion, and tumor size were independent prognostic indicators for overall survival and tumor recurrence. [score:1]
Moreover, the linear regression analysis showed a negative relevance between miR-219-5p and CDH1 in HCC tissues (R [2] = 0.4225; P < 0.001) (Figure 4(e)). [score:1]
In our previous study, miR-219-5p was found to be a promoter for HCC metastasis [10]. [score:1]
Effects of miR-219-5p on In Vivo Tumor Growth and Lung Metastasis of HCC Xenografts. [score:1]
HepG2 and MHCC-97H cells were transfected with miR-219-5p mimic (50 nM) and miR-219-5p antagomir (400 pmol/ml) according to the manufacturer instructions. [score:1]
Using gain- and loss-functional analyses, we found that miR-219-5p could promote in vitro proliferation, migration, and invasion of HCC cells. [score:1]
[1 to 20 of 53 sentences]
2
[+] score: 97
Other miRNAs from this paper: hsa-mir-122, hsa-mir-219a-2, hsa-mir-219b
Further studies showed that increased miR-219 levels caused a significant decrease in the SMC4 expression, and SMC4 inhibitor downregulated JAK2/Stat3 expression at both the mRNA and protein levels. [score:10]
MiR-219 has been found to be significantly downregulated in HCC, and exert tumor-suppressive effects in hepatic carcinogenesis through negative regulation of GPC3 expression [15], which is consistent with our experimental results in HCC cell lines and tissues. [score:8]
miR-219 has been shown to exert tumor-suppressive effects during hepatic carcinogenesis through negative regulation of GPC3 expression [15]. [score:6]
miR-219 overexpression caused a significant decrease in the JAK2/Stat3 expression in 97-H and HepG2 cell lines. [score:5]
After the miR-219 mimics, and miR-219 inhibitor were transfected into the 97-H and HepG2 cell lines, results showed that miR-219 silencing caused a significant increase in JAK2/Stat3 expression. [score:5]
In addition, inhibiting miR-219 expression increased SMC4 levels. [score:5]
Quantitative PCR analysis demonstrated that miR-219 was significantly downregulated, which was consistent with the data from HCC tissues and cell lines (Figure  3B). [score:4]
In the current study, we found that SMC4 is also a target of miR-219 in the regulation of the proliferation and invasion of HCC cells. [score:4]
After the miR-219 mimics and miR-219 inhibitor were transfected into the 97-H and HepG2 cell lines, real-time quantitative PCR, and assays showed that miR-219 silencing caused a significant increase in SMC4 expression. [score:4]
MiR-219 overexpression caused a significantly decrease in the SMC4 expression in 97-H and HepG2 cell lines (Figure  3C and 3D). [score:4]
analysis also showed that miR-219 resulted in significant changes in JAK2/Stat3 expression. [score:3]
Using five different bioinformatics software (TargetScan, miRDB, picTar, DIANA microRNA) to analysis 3’UTR of SMC4, we found that miR-219 has two binding sites (Figure  3A). [score:3]
The results also indicated that p-Stat3 (Tyr705) protein expression changed significantly after modulation with miR-219, while p-Stat3(Ser727) had no significant changes (Figure  4E). [score:3]
MiR-219 mimics and miR-219 inhibitor were purchased from Shanghai GenePharma Co. [score:3]
SMC4-Homo-830, miR-219 mimics and miR-219 inhibitor were then stably and transiently transfected into 97-H and HepG2 cells using Lipofectamine 2000 (Invitrogen). [score:3]
Stable miR-219 mimics and miR-219 inhibitor (97-H and HepG2) were transfected with the reporter constructs (Additional file 1). [score:3]
Previous studies have shown that miR-219 inhibited cell proliferation [29, 30]. [score:3]
The plasmids were transfected into empty vector and miR-219 stably expressing cells (97-H, HepG2). [score:3]
Figure 3 SMC4 is a downstream target of miR-219. [score:3]
p-Stat3 (Tyr705) protein expression also changed significantly after modulation with miR-219, but the p-Stat3(Ser727) had no significant changes. [score:3]
In summary, we have identified a novel miR-219/SMC4/JAK2/Stat3 signaling pathway whose function may contribute to the development of HCC. [score:2]
Regulation of SMC4 Transcription by miR-219. [score:2]
Quantitative PCR and analysis also demonstrated that miR-219 decreased SMC4 mRNA levels. [score:1]
Previous studies have reported on aberrant activation of various cellular pathways such as GSK-3 beta-C/EBP alpha-miR-122-Insulin Growth Factor 1 Receptor [11], HDGF-related protein-3 [12], FoxM1/ACP5 [13], JAK/STAT [14], miR-219-5p/glypican-3 [15] etc. [score:1]
Luciferase assays showed a negative regulatory relationship between miR-219 and SMC4. [score:1]
A previous study also showed that miR-219 was potentially involved in gastric cancer progression and metastasis [28]. [score:1]
Correlation analysis was used to analyze the relationship between miR-219 and SMC4. [score:1]
The programs were as follows: PCR mixtures were denatured at 95°C for 5 min, followed by 40 cycles of 94°C for 20 s, 61°C for 20 s, and 72°C for 20 s, and a final extension at 72°C for 5 min, 55°C for 10 s. miR-219 was analyzed as follows: PCR mixtures were incubated at 95°C for 5 min, followed by 40 cycles with incubation at 95°C for 10 s, 60°C for 20 s, 72°C for 10 s. Data were normalized to the geometric mean of the housekeeping gene, β-actin and U6 (Sangon Biotech, Shanghai, China) as the control. [score:1]
Using five different bioinformatics software to analyze the 3’UTR of SMC4, miR-219 was found to be involved. [score:1]
Luciferase reporter assays also confirmed a negative regulation relationship between miR-219 and SMC4 (Figure  3E). [score:1]
[1 to 20 of 30 sentences]
3
[+] score: 63
miR-219 expression is also upregulated during human OPC differentiation and correlates with the expression of PLP in human samples (de Faria et al., 2012). [score:8]
Within the adult human brain, miR-219 is highly expressed in OLs, with reduced but detectable expression in human A2B5 [+] and O4 [+] progenitors (Leong et al., 2014). [score:5]
Using in silico analysis, both miR-338 and miR-219 are predicted to target other genes including NeuroD1, Isl1, and Otx2, which are inhibitors of the transition from neural stem cell to OPC (Lee et al., 1995; Pfaff et al., 1996; Vernay et al., 2005; Zhao et al., 2010). [score:5]
The functional significance of elevated miR-219 expression has been attributed to the repression of Elovl7, a fatty acid elongation factor that can result in lipid accumulation and neurodegeneration when overexpressed (Shin et al., 2009). [score:5]
Strikingly, miR-219 and -338 are two of the most highly downregulated miRNAs in chronic MS lesions (Junker et al., 2009). [score:4]
Further studies comparing miRNA profiles of MS patient white matter to healthy control tissue has demonstrated an upregulation in miR-219 and -338 in MS patients (Noorbakhsh et al., 2011), suggesting an ongoing remyelination process in the MS brain. [score:4]
An analysis of miRNA profiles in normal CNS development and knockout mo dels has identified miR-219 as a critical miRNA involved in oligodendrocyte development (Shin et al., 2009; Dugas et al., 2010; Zhao et al., 2010) and has become a highly studied miRNA in the context of myelin biology. [score:4]
In addition to miR-219, miR-338 is also upregulated in mature vs. [score:4]
The mechanism of action of miR-219 has been attributed to repressing factors that inhibit oligodendrocyte differentiation, including Sox6, Hes5, Foxj3, Pdgfr-α, and Zfp238. [score:3]
miR-219 expression remains elevated following differentiation to OL (Figure 1). [score:3]
In the context of myelination and myelin repair, miR-219 has emerged as a potential target to enhance myelination. [score:3]
A2B5 [+]GalC [−] neuronal progenitor cells identified elevated miR-219 expression in mature oligodendrocytes (Lau et al., 2008). [score:3]
This effect was attributed to the presence of functional miR-219 within the exosomes, which was able to repress its target genes NeuroD1, Pdgfr-α, and Elovl7. [score:3]
Later reports show that miR-219 is a potent inducer of OL differentiation, while exogenous administration of miR-219 rescues deficits in myelination seen in knockouts both in vitro and in vivo (Dugas et al., 2010; Zhao et al., 2010). [score:2]
and miR-219 Are required for normal oligodendrocyte differentiation and myelination. [score:1]
miR-219, -338, -138. miR-23a. [score:1]
Youth and environmental enrichment generate serum exosomes containing miR-219 that promote CNS myelination. [score:1]
Due to the critical role of miR-219 and -338 in oligodendrocyte differentiation, this finding suggests a failure of OPCs to differentiate into mature OLs in chronic MS lesions. [score:1]
Notably, miR-138 is not as potent as other OL-promoting miRNAs such as miR-219 and miR-338 (Dugas et al., 2010). [score:1]
Thus, miR-219 is not only important for the transition of OPC to OL, but may also be important in the formation and maintenance of myelin. [score:1]
Furthermore, IFNγ-stimulated dendritic cells were also shown to generate exosomes containing miR-219, which subsequently improved remyelination (Pusic et al., 2014). [score:1]
[1 to 20 of 21 sentences]
4
[+] score: 52
This in silico analysis predicted miR- 125b-1* to target 3 mRNAs, miR-146a-5p to target 47 mRNAs, miR-181a-5p to target 14 mRNAs, miR-204-5p to target 12 mRNAs, miR-219a-5p to target 5 mRNAs, and miR-509-3p to target 1 mRNAs for a total 82 targets (see Table 2). [score:15]
Previous studies demonstrate that miR-219 is downregulated in medulloblastoma tumors and re-introduction of miR-219 inhibits proliferation and suppresses the invasiveness of D283-medulloblastoma cells [70]. [score:8]
In silico analysis using IPA analysis based on the research of targets experimentally validated in previously published studies indicated that miR-125b-1*, miR-146a-5p, miR-181a-5p, miR-204-5p, miR-509-3p and miR-219-5p were upregulated in SPARC expressed cells. [score:8]
Our studies also show that miR-219 is upregulated with SPARC expression. [score:6]
Previous data, in combination with our current findings, raise the possibility that induction of miR-219-5p expression may contribute to SPARC mediated suppression of cell proliferation, migration and invasion [20, 22, 23]. [score:5]
Validation of miR-125-b1*, miR-181a-5p, miR-146a-5p, miR-204-5p, miR-219-5p and miR-509-3p upregulation by quantitative real time PCR (qRT-PCR). [score:4]
We tested the expression of levels of six miRNAs (has-miR-125b-1*, has-miR-146a-5p, has-miR-181a-5p, has-miR-204-5p, has-miR-219-5p and has-miR-509-3p) which were found to be differentially regulated with. [score:4]
qRT-PCR was performed on miR-125b-1* (FC = 1.57), miR-181a-5p (FC = 2.21), miR-146a-5p (FC = 1.68), miR-204-5p (FC = 1.57), miR-509-3p (FC = 1.73) and miR-219-5p (FC = 1.57) in SPARC overexpressed medulloblastoma cells (pSPARC) compared to empty vehicle (pEV) treated control samples. [score:2]
[1 to 20 of 8 sentences]
5
[+] score: 41
Other miRNAs from this paper: hsa-mir-219a-2, hsa-mir-219b
Altogether these data show that dynamic miR-219 expression can regulate Sall4 expression in vivo and that perturbation of miR-219 expression leads to excessive collagen deposition, phenocopying the early Sall4 depletion phenotype (Figure 6i,j). [score:8]
Using this approach, combined with qRT-PCR and immunohistochemistry, we show transcription and translation of SALL4 are inhibited by miR-219 mimic in comparison to control mimics (Figure 6b–f). [score:5]
MiR-219 showed this pattern, as levels of Sall4 decrease, miR-219 levels increase, as would be expected if the microRNA is binding to the 3′ UTR of the gene and inhibiting its translation (Figure 6a). [score:5]
We identified a microRNA; miR-219, and have shown that it has a key active role in regulating the expression of SALL4 during wound healing. [score:4]
To determine if Sall4 is a direct target of miR-219, we performed a luciferase assay using the 3′ UTR of the axolotl Sall4 and confirmed that miR-219 can functionally repress Sall4 (Supplementary Figure 6). [score:3]
Importantly, we found that depleting Sall4 levels by modulation of miR-219 phenocopied our Sall4 knockdown experiments resulting in excessive collagen deposition (Figure 6g,h), further validating the Sall4 knockdown phenotype observed using Sall4 morpholino. [score:3]
To determine if Sall4 is a target of miR-219, HEK 293 cells were plated in a 96-well cell culture plate at a density of 1.2 × 10 [4] cells per well and were allowed to adhere overnight in d-MEM (Gibco, Waltham, MA, USA) with 10% FBS (Thermo Scientific, Waltham, MA, USA). [score:3]
SALL4 is regulated post-transcriptionally by miR-219. [score:2]
Using qRT-PCR we determined the relative levels of miR-219 during axolotl regeneration, looking for a pattern that would be opposing to that of Sall4. [score:1]
33– 36 Therefore, we examined the 3′ UTR of axolotl Sall4 and identified one highly conserved seed sequence for microRNA miR-219. [score:1]
[53] Briefly, miR-219 mimic or control was diluted to a final concentration of 10 μM in PBS plus Fast Green. [score:1]
HEK cells were then co -transfected with 135 ng per well pMIR-Report Vector (with or without Sall4 3′ UTR insert or seed sequence mutagenized SAll4 3′ UTR insert) and 45 ng per well pMIR-Report beta gal vector (Life Technologies) with 100 nmol/l miR-219 mimic or mimic control using Lipofectamine 2000 (Invitrogen). [score:1]
To functionally determine if miR-219 levels inversely affect Sall4 levels in vivo, a chemically synthesised mature form of miR-219 was injected and electroporated into the axolotl skin during regeneration. [score:1]
Microinjections of miR-219 mimics (Qiagen), morpholinos (Gene Tools, Philomath, OR, USA) or controls were carried out as previously described in Erickson and Echeverri. [score:1]
In addition, we have bioinformatically analysed the 3′ UTR of the human SALL4 gene and found that it does contain a miR-219 binding site. [score:1]
This gave one PCR fragment with the mutated miR-219 seed sequence. [score:1]
[1 to 20 of 16 sentences]
6
[+] score: 25
Another duo, miR-219 and its putative gene target Dazap1 were upregulated by prenatal stress in newborns, suggesting parallel regulatory interference in gene expression. [score:9]
Dazap1 is a gene related to mRNA surveillance, i. e. regulation of gene expression, which is a putative target for miR-219. [score:6]
Thus, stress through regulation of miR-219 may interfere with developmental neuronal plasticity and behaviour. [score:3]
Ptplb and Dazap1 are targets for miR-103 and miR-219, respectively. [score:3]
Disruption in NMDA receptor function through miR-219 regulation results in aberrant hyperlocomotor behaviour in mice [28]. [score:2]
miR-219 modulates excitatory synaptic plasticity through N-methyl-D-aspartate (NMDA) glutamate receptors [28], [75]. [score:1]
Notably, miR-219 may be implicated in the pathology of schizophrenia and bipolar affective disorders [30], both of which are closely linked to prenatal stress [20], [18] and altered HPA axis activity [74], [14], [16]. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 23
In addition, a significant reduction in 5-LO protein levels and LTB [4] production was found in human MΦ overexpressing the RvD1-regulated miR-219, translating findings in mouse peritonitis to the human MΦ cell system (Recchiuti et al., 2011). [score:6]
Quantitative PCR analysis of miRNAs isolated from peritoneal lavages collected 24 h post injection of zymosan showed that RvD1 significantly upregulated identified resolution miRs miR-208a and miR-219 in vivo (Recchiuti et al., 2011), whereas it does not appear to regulate miR-21, miR-146b, and miR-302d (Figure 9). [score:5]
In ALX/FPR2 [−/−] mice, RvD1 did not regulate PMN infiltration, consistent with recent results (Norling et al., 2012), nor did it significantly alter miR-208a or miR-219 expression at 24 h (Figure 9). [score:4]
RvD1-GPCR gene networks connecting target genes of miR-146b (A), miR-208a (B), and miR-219 (C). [score:3]
In addition to transcriptional regulation by cytokines and growth factors (Radmark et al., 2007), miR-219 can provide a rapid mean to balance the abundance of 5-LO protein in cells under dynamic conditions such as during inflammation. [score:2]
RvD1, administered in its pro-drug carboxy methyl ester form, significantly lowered the Ψ [max] (from 15.0 to 11.5 × 10 [6]), and accelerated or shortened the R [i] by ∼4 h. Quantitative real-time PCR analyses carried out with exudates from zymosan- and zymosan plus RvD1 -treated mice revealed that RvD1 temporally controls the specific sets of pro-resolving miRNAs miR-21, miR-146b, miR-208a, and miR-219 (coined resolution miRs) in exudates in vivo. [score:1]
The miR-219 network includes CD14 and 5-LO (Figure 8C), a key enzyme for the biosynthesis of LTs, and SPMs. [score:1]
In these studies, miR-21, miR-146b, miR-208a, and miR-219 were significantly regulated at 12 and 24 h compared to 4 h (Figure 7), suggesting a role in resolution. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 19
The third category had a high expression level on day 1 and down-regulated expression on day 7, and included miR-132, miR-186, miR-199, miR-338, and miR-219. [score:8]
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
| : | | | | | : | | | | | | | | |3′ CUUGUCCAUCAGACUUGUGACCCPosition 437–443 of Tip110 3′UTRHsa-miR-219a-1-3p5′. [score:1]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 17
The miR-219-5p MRE was of particular interest as this miRNA was immediately and robustly up-regulated on addition of RA. [score:4]
At 2, 4, 6 and 8 days RA versus NT2-undiff, miR-219-5p showed 7, 12, 40 and 54-fold up-regulation, respectively. [score:4]
Perhaps the most interesting was a highly conserved MRE in the REST 3′-UTR for miR-219-5p, the most strongly up-regulated of all miRNAs during the first 8 days of RA treatment. [score:4]
Six of these miRNAs, i. e., miR-184, miR-371-5p, miR-412, miR-219-5p, pred-MIR145 and pred-MIR207 were expressed only during the RA time-course (Fig. 5B). [score:3]
We identified MREs for two miRNAs conserved in human and dog (miR-135a and miR-371-5p), one conserved in human and mouse (miR-494) and four conserved in human, mouse and dog (miR-92a, miR-219-5p, pred-MIR145 and pred-MIR207; Fig. 5). [score:1]
Furthermore, using miRanda [40], we identified an MRE for dre-miR-219 in the zebrafish genomic sequence (danRer5), approximately 3 kbp downstream of the REST coding region (i. e. within the putative zebrafish REST 3′-UTR). [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 16
TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
0114627.g002 Figure 2. TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
Nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 7 days. [score:3]
nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were further quantitated by TaqMan miRNA assays (Applied Biosystems). [score:2]
Furthermore, we found that let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b were significantly increased in individual exosomal samples from human BMSCs. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
[1 to 20 of 2 sentences]
12
[+] score: 14
The expression of miR-219-5p was shown to be down-regulated in GBM and the overexpression of miR-219-5p in GBM cell lines inhibited the proliferation, anchorage independent growth and migration [24]. [score:10]
MiR-219-5p inhibited RAS-MAPK and PI3K pathways in GBM cell lines in concordance with its ability to repress EGFR by directly binding to its 3′-UTR. [score:3]
A significant negative correlation between miR-219-5p levels and total as well as phosphorylated forms of EGFR was found in GBM patient samples. [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 13
In SU-DHL-1cells, NPM/ALK induces the expression of ICOS, a T-cell growth-promoting costimulatory receptor that amplifies the signal generated by the antigen-specific TCR, and NPM/ALK -mediated activation of STAT3 suppresses the expression of the ICOS inhibitor miR-219 [40]. [score:9]
miR-21, miR-26a and miR-219 are also known to be repressed by an NPM/ALK/STAT3 -dependent mechanism, and their targeting could represent another way to improve therapeutic approaches. [score:3]
MiR-21, miR-26a and miR-219. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 13
Surprisingly, while we confirmed the inhibition of GPC3 by miR-219-5p (Figure 2A), this miRNA and miR-520c-3p [21, 22] were not retained in our screen using GPC3 5’- and 3’-UTRs as baits (Supplementary Table 1). [score:3]
While we cannot exclude the possibility that different miRNAs (including miR-219-5p and miR-1271-5p) play a role in HCC -associated GPC3 overexpression, our data suggest that miR-4510 is of particular importance in this cancer as it strongly and inversely correlated with GPC3 mRNA and protein levels in HCC tumors (Figure 5A-5B). [score:3]
However, miR-203a-3p and the control miR-219-5p had no significant inhibitory effect (Figure 2B). [score:3]
Contrarily to miRNA paralogs miR-96-5p and miR-1271-5p [11, 13], the previously described GPC3 -regulating miRNAs, miR-219-5p and miR-520c-3p [21, 22] were below the cut-off (Supplementary Table 1) and thus not selected in our screening. [score:2]
A siRNA against GPC3 and the miRNAs miR-96-5p and miR-219-5p were used as positive controls [11, 13, 22]. [score:1]
Only miR-1271-5p and miR-219-5p are decreased in HCC samples [11, 22] and we previously reported that GPC3 mRNA inversely correlates with miR-1271-5p in HBV -positive HCC subgroup [11]. [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 12
MiR-485 has been implicated in synaptic formation and maintenance and has been reported to be dysregulated in Alzheimer’s disease and Huntington’s disease [32], miR-124 is known as a neurodevelopmental regulator [33], miR-219 required for neural precursor differentiation in zebrafish [34] and promotes myelination in rats [35], miR-127 regulates cell proliferation and senescence by targeting BCL6 [36] while miR-136, miR-873 and miR-410 have all been studied in the context of glioma growth, invasiveness and apoptosis 37– 39. [score:11]
miRNAlog [2]FoldChange P-value Corrected P-value hsa-mir-577 −3,28 1,46E-10 3,87E-08 hsa-mir-182-5p −2,70 6,50E-15 3,44E-12 hsa-mir-485-5p −2,12 8,79E-05 8,45E-03 hsa-mir-124-3p −1,83 1,05E-05 1,85E-03 hsa-mir-218-5p −1,68 1,54E-04 1,16E-02 hsa-mir-183-5p −1,62 3,14E-04 2,08E-02 hsa-mir-873-5p −1,58 9,80E-04 3,25E-02 hsa-mir-133a −1,53 6,05E-04 2,29E-02 hsa-mir-487b −1,45 1,56E-03 4,59E-02 hsa-mir-219-5p −1,44 9,55E-04 3,25E-02 hsa-mir-409-3p −1,34 1,12E-03 3,48E-02 hsa-mir-889 −1,23 5,71E-04 2,29E-02 hsa-mir-136-3p −1,15 1,75E-03 4,87E-02 hsa-mir-410 −1,12 4,02E-04 2,29E-02 hsa-mir-127-3p −0,95 5,61E-04 2,29E-02 hsa-mir-148a-3p 1,23 4,99E-04 2,29E-02 hsa-mir-155-5p 1,82 9,56E-05 8,45E-03 hsa-mir-221-3p 2,10 4,82E-04 2,29E-02For each differently expressed miRNA we report the standard name according to MirBase database, the log [2] fold-change, the P-value and the corresponding corrected P-value as calculated by DESeq. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 9
Although miR-219-5p is known to be down-regulated in multiple cancer such as malignant astrocytoma [12] and hepatocellular carcinoma [13], the expression of miR-219-1-3p and miR-219-2-3p has not been studied. [score:6]
Processing of the precursor transcripts generates the same miR-219-5p and two unique miRNAs, 219-1-3p and 219-2-3p. [score:1]
Processing of the precursor transcripts by dicer generates three mature miRNAs: miR-219-5p from the 5′ ends of both precursors, and miR-219-1-3p and miR-219-2-3p from the 3′ end of pre-miR-219-1 and pre-miR-219-2, respectively. [score:1]
In human and mice, there are two genomic loci (miR-219-1 and miR-219-2) which encode miR-219 precursor transcripts. [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
[1 to 20 of 1 sentences]
18
[+] score: 9
The human homologues of mouse miRNAs -219a and -132 which exhibit rhythmic expression in mouse brain tissue and act as clock-transcription factor and light-regulated miRNAs, respectively [17] were included in our study but miR-219a was found not to be detectable in plasma, and miR-132 had a stable, non-cyclic expression. [score:6]
Post-transcriptional circadian regulation could, among other factors, be due to micro -RNA (miRNA) [13– 16], and in one example involving miRNAs interacting with clock genes Bmal1 and Clock in mice, miR-219 and miR-132 were demonstrated to be clock gene and light-regulated, respectively [17]. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 8
Other miRNAs from this paper: hsa-mir-98, hsa-mir-15b, hsa-mir-219a-2, hsa-mir-33b, hsa-mir-219b
In another study, it is further reported that SALL4 in CD34+ cells was downregulated by microRNAs miR-15b and miR-219-5p, and inhibition of miR-15b, −which activates SALL4 expression, significantly increased the number of CD34 [+] HSCs/HPCs in culture [47]. [score:8]
[1 to 20 of 1 sentences]
20
[+] score: 7
MiR-219 was described to be upregulated in AML with MLL-AF6 and MLL-AF9 versus other AML cases [41], while miR-589 was observed to be upregulated in MLL-rearranged AML versus normal controls [42]. [score:7]
[1 to 20 of 1 sentences]
21
[+] score: 7
In our amygdala data, the expression level of MIR219 was 1.4-fold higher in SCZ; however, it did not reach significance with a p value of 0.19. [score:3]
Murai K The TLX-miR-219 cascade regulates neural stem cell proliferation in neurodevelopment and schizophrenia iPSC mo delNat. [score:3]
MIR219, a brain-specific miRNA, was reported in both normally developing and SCZ patient iPSC-derived neural stem cells [56]. [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 7
Differential expression of a subset of 3 miRNAs (namely miR-338-3p, miR-219-5p and miR-487a) was validated in an extended cohort of patients (the ten original patients plus another 2 per group, indicated in roman numbers in Table 1 ) using qRT-PCR. [score:3]
Expression levels of all these miRNAs were apparently different in the two groups, confirming microarray findings, but data were dispersed for miR-338-3p and miR-219-5p, not reaching significance level (Fig. 3A and 3B ). [score:3]
Relative expression of miR-338-3p (A), miR-219-5p (B) and miR-487a (C), evaluated by qRT-PCR in patients without granule cell pathology (no GCP, blue bars) or with type-2 GCP (black bars). [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 7
High expression of miR-196a-2, which was seen in 75% of tumors, resulted in 2-year survival of 17% compared with 64% for low expression (P = 0.009), whereas median survival in patients with high expression of miR-219 was 13.6 months, compared with 23.8 months for those with low expression, with 2-year survivals of 25% and 49%, respectively (P = 0.07). [score:7]
[1 to 20 of 1 sentences]
24
[+] score: 6
Cell fate determination is clearly illustrated by the inhibition of transcription factor SOX9 by miR-124, encouraging the neurogenic precursor transition to neuroblasts [178] and the targeting by miR-219 and miR-338 of the transcription factors SRY-Box 6 (SOX6) and Hes family bHLH transcription factor 5 (Hes5), both involved with progenitor proliferation and stemness during oligodendrocyte differentiation [179, 180]. [score:5]
The absence of miR-219 will keep precursors in their proliferation stage, which indicates that this miRNA promotes cell cycle exit and differentiation [198]. [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 6
miR-219 was found downregulated in the AD human frontal cortex [170] and is thought to regulate tau mRNA directly. [score:6]
[1 to 20 of 1 sentences]
26
[+] score: 6
Resolvin D1 upregulates several micro RNAs (miRNAs; e. g., miR-146, miR-219, miR-208) that are involved in NFκB and IL-10 expression in resolution. [score:6]
[1 to 20 of 1 sentences]
27
[+] score: 6
For example, miR-219 has been reported to inhibit the proliferation, anchorage-independent growth and migration of glioma cells and to promote oligodendrocyte differentiation and myelination, while miR-124 has been shown to promote neurogenesis, inhibit proliferation of glioblastoma multiform cells and induce differentiation of brain tumor stem cells. [score:5]
Among them, miR-219, miR-124, miR-153, miR-128, miR-132 and miR-139 are known to be brain enriched or brain-specific in other species and to be involved in several brain-specific functions [28]. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
[1 to 20 of 1 sentences]
29
[+] score: 6
MicroRNA-219-5p suppresses GBM development through repressing EGFR expression by directly binding to its 3’-UTR [161]. [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 5
It has been observed in pancreatic cancer that high expression of miR-196a-2 and miR-219 can cause of a lower survival of the patients (14.3 months and 13.6 months) than the low expression (26.5 months and 23.8 months) [38]. [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
Most relevant gene targets identified by IPA were BACE1, REST for miR-103, MAPT for miR-219 and CDK5R1 for miR-375 (S4 Dataset). [score:3]
Moreover, we could also confirm the 9 informative miRNAs (miR-505-5p, miR-4467, miR-766, miR-375, miR-708, miR-3622b-3p, miR-296, miR-219 and miR-103) from set B as significant biomarkers by MANCOVA all reaching Bonferroni corrected significance. [score:1]
The MoR plot illustrates the 9 most informative miRNAs, hsa-miR-505-5p, hsa-miR-4467, hsa-miR-766, hsa-miR-375, hsa-miR-708, hsa-miR-3622b-3p, hsa-miR-296, hsa-miR-219 and hsa-miR-103, each reaching a MoR value ≥ 0.57 (critical MoR value on the information chain). [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 5
The underlying mechanism is unclear, although the regulation of miR-219 by CLOCK and BMAL1 genes in PC12 cells has been reported [126]. [score:2]
miR-219 plays an important role in the regulation of the circadian cycle speed. [score:2]
Experiments performed by Cheng et al. in murine mo dels showed that silencing miR-219 using intracerebroventricular infusion of antisense oligonucleotides, produces prolongation in the circadian cycle. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 5
Other miRNAs from this paper: hsa-mir-219a-2, hsa-mir-219b
Wang Q. Zhu L. Jiang Y. Xu J. Wang F. He Z. miR-219-5p suppresses the proliferation and invasion of colorectal cancer cells by targeting calcyphosinOncol. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 4
Conversely, among down-regulated miRNAs common to all three aberrations, miR-33a, miR-29c and miR-219-5p showed the highest fold changes. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 4
SMC4 transcription and expression is negatively regulated by miR-219 in human hepatocellular carcinoma 97-H, HepG2 cell lines [83]. [score:4]
[1 to 20 of 1 sentences]
36
[+] score: 4
Deletion of Dicer1 is also found to distort oligodendrocyte development, which could be re-established by over -expressing miR-219 and miR-338 [23]. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Increased miR-124, miR-128-1, miR-194, miR-219–5p, miR-220a and miR-320 expression are associated with increased risk in AML, however the role of microRNAs in the development of AML is unclear [101]. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
Interestingly, the only 2 miRNAs downregulated by prolactin, miR-219 and miR-31, exhibit antitumor effects [61– 63]. [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 4
miR-219 +miR-219 displayed dysregulated expression in human tongue carcinomas [50]. [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
They may also function in the normal physiological operation of the nervous system as suggested by evidence for involvement of miR-132 and miR-219 in circadian clock regulation [25] and miR-134 in control of dendritic translation [26, 27]. [score:4]
[1 to 20 of 1 sentences]
41
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In this context, Recchiuti et al. [113] verified that miR-21, miR-146b, miR-142 family, miR-203, miR-208a, miR-219, and miR-302d that are temporally and differentially expressed in resolving exudates, and Resolvin D1, which is biosynthesized in resolution, regulates miR-21, miR-146b, miR-208a, and miR-219. [score:4]
[1 to 20 of 1 sentences]
42
[+] score: 3
MiR-219 regulates PRKCI and accordingly inhibits the proliferation of human tongue squamous cell carcinoma [18]. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
In an analogy with metabolic regulation, microRNA can also mediate circadian systems in response to environment alteration; for example, miR-219 was found to interact directly with the CLOCK-BMAL1 dimer, affecting the circadian pacemaker [128]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Six candidate miRNAs that are predicted to target caspase-3 (let-7, miR-138, miR-30b, miR-129, miR-203, and miR-219-5p) and have an aggregate Pct greater than 0.2 were selected (Fig.   1c). [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
One of the brain-specific miRNAs, miR-219, described in a previous report [13] was also confirmed with our data, in which brain had 85 copies and merely 5 copies were found in PBMC, and no expression detected in the rest of the tissues. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
It was found that the level of miR-219-5p was higher in level 1 than that in level 2, which indicated the miR-129-5p level was negatively related to the expression of VCP (Figure 2G). [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
Overexpression of miR-219 and miR-338 as oligodendrocyte-specific miRNAs is sufficient to promote oligodendrocyte differentiation. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
For example, studies indicate that miR-219 may control circadian clock speed and timing as silencing miR-219 expression in the SCN lengthens the circadian rhythm period [113]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Dysregulation of microRNA-219 promotes neurodegeneration through post-transcriptional regulation of tau. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Curiously, miR-219-5p, miR-33a, miR-101, and miR-129-5p have been identified in at least one other cancer as tumor suppressors [47]– [50], and miR-146b-5p has been described as preventing invasiveness in glioma [51], but in CD133+ GSCs these miRs are increased. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
Among the first hundred miRNAs cloned, miR-7, -9/9*, -124a, -124b, -125a, -125b, -128, -132, -135, -137, -139, -153, -149, -183, and miR-219 were reported to be abundantly expressed in mouse and human adult brains [124]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
One study identified miR-132 and miR-219 as being clock regulated in the suprachiasmatic nucleus (SCN), the 'master clock' in mammals [52]. [score:2]
In addition, they also showed that miR-132 plays a role in circadian photic entrainment, whereas miR-219 modulates period length. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 2
In summary, based on the network topological analysis of the GBM Notch regulatory network and its subnetworks, we identified 32 human miRNAs that might be involved in the Notch signaling pathway, and six of them (miR-124, miR-137, miR-219-5p, miR-34a, miR-9, and miR-92b) might play important roles in this pathway. [score:2]
[1 to 20 of 1 sentences]
54
[+] score: 2
Clock-controlled mir-219 acts in the fine tuning of the length of the circadian period, and light -induced mir-132 was shown to be a negative regulator of the light -dependent resetting of the clock [13]. [score:2]
[1 to 20 of 1 sentences]
55
[+] score: 2
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ hybridization and immunostaining In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Wienholds et al. (2005) let-7a,b,c, miR-9, miR-34, miR-92b, miR-124, miR-128, miR-135c, miR-137,miR-138, miR-153a, miR-219, miR-222 Zebrafish ISH ? [score:1]
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
[1 to 20 of 2 sentences]
57
[+] score: 2
Third, we chose several miRNAs which had potentially problematic sequences or exhibited atypical behavior during the development of the Agilent microarray platform: two of these did not show as good a linear titration curve as other miRNAs tested in a previous study (miR-126*, miR-296) [26], and two other miRNAs were previously reported not to be labeled by enzymatic methods similar (but not identical) to that used with the Agilent microarray assay (miR-208, miR-219) [33]. [score:1]
Three miRNAs are found at consistently lower levels in TRIzol preps than in the other two preps: miR-29b, miR-33, and miR-219. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 1
The results emphasized the role of some miRNAs already validated in prostate cancer (miR-221, miR-222, mir-96 and mir-143), and identified novel miRNAs like miR-210, miR-542, miR-128 and miR-219 that do not have a known mode of action in prostate cancer. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
miR-219-5p was one of the singletons found in all the four samples suggesting that such sequences may not be due to experimental noise or a chance event. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
The results showed that EBV loads had negative correlation with hsa-miR-137 (r = −0.99, P < 0.05) and hsa-miR-219a-5p of B cells (r = −0.97, P < 0.05). [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
The miR-659-3p cluster also included miR-219-3p and miR-519-5p (Fig.   1b), which had less significant or no association with PFS (p = 0.036 and p = 0.12, respectively). [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Using the same analysis applied to domains and motifs, only one miRNA binding site was over-represented among ARGs in CP differentiation (hsa-miR-219) and only one for NP differentiation (hsa-miR-487a). [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
One miRNA, miR219, was shown to modulate NMDA-receptor -mediated neurobehavioral dysfunction and is implicated in the symptology of schizophrenia [34]. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
For instance, manipulation of schizophrenia -associated miRNAs such as miR-132/miR-121 and miR-219 has been reported to alter an activity -dependent neuronal maturation and plasticity at synapse (Nu delman et al., 2010; Tognini et al., 2011; Mellios and Sur, 2012). [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
These include miR-145, let-7d, miR-335, miR-98, miR-181a, miR-200a, miR-373*, miR-575, miR-335, miR-96-5p, miR-190a, miR-29c-3p, and miR-219-5p [7, 8, 13, 14]. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
These authors identified a large number of aberrant methylations involved in the transition between normal tissue and adjacent tissue with not further increase in cancer (ie, MMP14, miR-219, CIDEA, etc. ) [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, recent rodent studies demonstrated the roles of miR-219 [56], [57] and miR-338 [57] in controlling oligodendrocyte differentiation. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
For the ‘meningioma’ query, miRCancer retrieved 4 miRNAs (hsa-mir-128, hsa-mir-200a, hsa-mir-224, hsa-mir-335) and miRiaD retrieved 4 additional miRNAs (hsa-mir-145, hsa-mir-190, hsa-mir-219, and hsa-mir-29). [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Importantly, several miRNAs (e. g. miR-219, miR-132, miR-142 and miR-92a 22– 24) also exhibit robust rhythms. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
78769183:+ [1]“`”represents the antisense of miRNA precursor; the star sequence of miR-219-2 is miR-219-5p in miRBase (Release 19); [2]The top known miRNA precursor (miRBase Release 19) aligns to novel precursor with > 70 identity and > 75 sequence length; [3]The top known miRNA (miRBase Release 19) matches novel miRNA covering > 90 identity and > 90 sequence length; [4]Sequence here only shows the dominant one and the star sequence that was absent was predicted by miRDeep2. [score:1]
[1 to 20 of 1 sentences]