sort by

289 publications mentioning hsa-mir-214 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-214. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 491
Because miR-214 directly regulated COP1 expression, we hypothesized that down-regulation of miR-214 induced up-regulation of COP1 in HSA. [score:11]
The result implies that miR-214 down-regulation possibly leads to COP1 overexpression in HSA; therefore, miR-214 -dependent COP1 overexpression is a key event for dysregulated p53 expression in HSA patients. [score:11]
Hence, the discovery that miR-214 regulated p53 signals by targeting COP1 provides a new important target to block the inhibition of apoptosis, and it may well contribute to the development of novel therapeutics for malignant endothelial proliferative diseases. [score:11]
Furthermore, miR-214-knockdown by the inhibitor up-regulated COP1 expression in normal EC (Fig 4E), suggesting that miR-214 is a key regulator of COP1. [score:10]
Our results showing that miR-214 was capable of inducing apoptosis to HSA cells by targeting COP1 suggest that miR-214 down-regulation, as well as COP1 overexpression, play essential roles in functional p53 inactivation and apoptotic inhibition in HSA cells. [score:10]
Therefore, we examined the mRNA expression levels of p53-regulated genes by mRNA qRT-PCR to elucidate the effects of miR-214 on the function of p53 and found that the introduction of miR-214 significantly increased the p53-regulated gene expression in all HSA cell lines although the degree of up-regulation differed between each line; while these effects were slight in control EC (Fig 3). [score:10]
As miR-214 directly targets COP1, the up-regulation of miR-214 provokes apoptosis by inhibiting COP1 -dependent degradation of p53. [score:9]
To get insight into the mechanisms by which miR-214 controlled the expression of p53-regulated genes, we searched for putative p53-related mRNA targets of miR-214 by using TargetScan [47] and miRDB [48, 49]. [score:8]
Thus, our experiments indicated that miR-214 expression was down-regulated in HSA cells as well as in clinical samples from dogs with HSA and that the restoration of its expression by transfection of HSA cells with synthetic miR-214 resulted in apoptosis in these cells. [score:8]
The expression of p53-regulated genes was up-regulated dose -dependently in all HSA cell lines transfected with 1 nM or 10 nM of siR-cop1 as same manner as miR-214-transfection although siR-cop1 slightly or hardly increased these p53-regulated genes. [score:8]
Our data showed that the ectopic expression of miR-214 down-regulated COP1 expression at both mRNA (Fig 4C) and protein (Fig 4D) levels. [score:8]
As a result, ectopic expression of miR-214 induced a dose -dependent growth inhibition in these HSA cell lines; whereas miR-214 was only slightly inhibitory toward the growth of the normal control EC at 72 hours post-transfection (Fig 2A and S2 Fig). [score:7]
Taken together, these results demonstrated that miR-214 directly targeted COP1 mRNA through binding to the predicted seed sequence in the 3'UTR of COP1 mRNA and thereby negatively regulated COP1 expression at both mRNA and protein levels. [score:7]
Knockdown of miR-214 up-regulated COP1 expression in control EC. [score:7]
S1 Fig (A) Computer target and target site prediction of miR-214 in dogs by TargetScan 6.2. [score:7]
miR-214 down-regulation and COP1 overexpression might be one of the cause of p53 dysregulation in HSA. [score:7]
The expression of p53-regulated genes was up-regulated dose -dependently in all HSA cell lines transfected with 1 nM or 10 nM of miR-214; however, only slight effects were observed in normal EC. [score:7]
Although we failed to determine whether intrinsic or extrinsic apoptosis signaling was induced by miR-214 because of the lack of appropriate antibodies specific for canine molecules, we found that miR-214 increased the expression of direct transcriptional targets of p53 such as CDKN1A, FAS, BAX and THBS1; and, therefore, p53 was suggested to play important roles in miR-214 -induced apoptosis. [score:6]
COP1 knockdown provoked expression of p53-regualted genes expressions just as did miR-214-transfection. [score:6]
Thereby, we identified COP1 E3 ubiquitin protein ligase (also known as RFWD2), a negative regulator of p53, as a possible target of miR-214, which target site is conserved in both human and canine (S1A and S1B Fig). [score:6]
This apoptosis occurred through p53-regulated gene activation as a consequence of the direct targeting of COP1, a negative regulator of p53, by miR-214. [score:6]
COP1 protein expression was also dose -dependently down-regulated in the HSA cell lines transfected with miR-214. [score:6]
Our results showed that miR-214 induced apoptosis and that miR-214 directly targeted COP1, which was overexpressed in HSA cell lines. [score:6]
In this study, we examined the expression and function of miR-214 in HSA and found that miR-214 was significantly down-regulated in both HSA clinical samples and cell lines. [score:6]
As we expected, miR-214 was able to bind to a COP1 3'UTR site; and treatment of HSA cells with miR-214 down-regulated the expression of both COP1 mRNA and its protein. [score:6]
The fact that miR-214 evokes transcriptional activation of p53-regulated genes suggests that the direct target of miR-214 possibly regulated p53 transcriptional activity. [score:6]
COP1 mRNA expression was down-regulated dose -dependently by miR-214-transfection. [score:6]
From the result of computer target prediction of miR-214, we hypothesized that COP1 E3 ubiquitin protein ligase, which is a critical negative regulator of p53 as well as MDM2, would be a possible conserved target of miR-214. [score:6]
Thus, COP1 knockdown induced apoptosis in HSA cells by up -regulating p53-regulated gene expression, similar to the results obtained using miR-214-transfection. [score:6]
Clarification of the regulation and pathobiological function of miR-214 should contribute to a better understanding of the detailed molecular pathogenesis and to the development of new therapeutics for those endothelial proliferative diseases. [score:5]
These results indicate that the ectopic expression of miR-214 induced apoptosis in HSA cells and that miR-214 had a slight growth inhibiting effect on normal EC, suggesting that miR-214 could function as an anti-oncomir in HSA cells. [score:5]
miRNA-214 (1 or 10 nmol/L; mirVana miRNA mimic; Ambion), miRNA-214 inhibitor (1 nmol/L; mirVana miRNA inhibitor; Ambion) or 10 nmol/L of non-specific control miRNA (sequence: 5'-GUA GGA GUA GUG AAA GGC C-3', Hokkaido System Science Co. [score:5]
We identified COP1 as a novel conserved target of miR-214, which was an oncogene overexpressed in HSA cell lines. [score:5]
Furthermore, we demonstrated that miR-214 induced apoptosis by directly targeting COP1, thereby positively regulating p53 transcriptional activity in HSA cell lines. [score:5]
miR-214 exerted up-regulation of p53-regulated genes in HSA cells. [score:5]
Consistent with the results obtained with the cell lines, miR-214 was also significantly down-regulated in splenic HSA tissues compared with its expression in the normal splenic tissues (Mann-Whitney test; p = 0.00328; Fig 1B). [score:5]
microRNA-214 functions as a tumor suppressor in human colon cancer via the suppression of ADP-ribosylation factor-like protein 2. Oncol Lett. [score:5]
org/ [48, 49]) were used to identify potential miR-214 target genes and target sites. [score:5]
Thus, we demonstrated that p53 was the molecule responsible for miR-214-COP1 -mediated apoptosis and up-regulation of p53-regulated genes (Fig 9). [score:5]
The importance of miR-214 and COP1 expression in HSA suggests that this miR-214-COP1-p53 axis could likely be an effective target and recovering the function of inactivated p53 is a key to establish novel therapeutics for HSA. [score:5]
Judging from our results that miR-214 controlled p53-regulated genes including THSB1, miR-214 might control angiogenesis by targeting not only growth factor release but also THBS1 in a p53 -dependent manner in HSA. [score:4]
The expression of p53-regulated genes including CDKN1A, FAS, BAX and THBS1 in miR-214 transfected samples was assessed by qRT-PCR. [score:4]
Here, we identified miR-214 as a novel anti-oncomir, which was down-regulated in both clinical samples and cell lines of HSA. [score:4]
However, siR-cop1 induced slight growth inhibition without apoptosis or significant activation of p53-regulated genes except BAX in control EC similar to miR-214-transfection in control EC (Figs 6A, 6B, 6C, 6D and 7). [score:4]
These results indicate that miR-214 was down-regulated in HSA, suggesting broad and essential roles of miR-214 in the pathogenesis of HSA. [score:4]
miR-214 is down-regulated in HSA cell lines and clinical samples. [score:4]
miR-214 was down-regulated in HSA cell lines and clinical samples. [score:4]
However, the regulation and function of miR-214 in the malignant endothelial proliferative diseases are not well understood. [score:4]
Presently, we found that miR-214 was significantly down-regulated in clinical samples of splenic HSA and in HSA cell lines, suggesting that nullification of miR-214 in HSA could contribute to continuously activated angiogenesis, and subsequent accelerated growth of neoplastic endothelial cells. [score:4]
We found that miR-214 was significantly down-regulated in all HSA cell lines tested regardless of the primary sites of origin of the cell lines (Fig 1A). [score:4]
To investigate whether miR-214 was able to regulate COP1 expression, we conducted mRNA qRT-PCR and immunoblotting for determining the expression of COP1 mRNA and protein in miR-214 -transfected HSA cell lines. [score:4]
Therefore, we explored the possibility that miR-214 targeted some molecule regulating p53. [score:4]
COP1 was a direct target of miR-214. [score:4]
0137361.g003 Fig 3The expression of p53-regulated genes including CDKN1A, FAS, BAX and THBS1 in miR-214 transfected samples was assessed by qRT-PCR. [score:4]
miR-214 is one of the miRNAs that induces apoptosis and is down-regulated in various tumors including cervical cancer [19, 51], hepatocellular carcinoma [20], glioma [25], rhabdomyosarcoma [30], bladder cancer [28], and colon cancer [24]. [score:4]
Based on these reports, our findings suggest that down-regulation of miR-214 is one of the key genetic events leading to tumorigenesis and continuous angiogenesis in HSA. [score:4]
Furthermore, we found the overexpression of COP1 and the specific knockdown of COP1 by its siRNA induced apoptosis and recovered p53 transcriptional activity in HSA cells just like miR-214. [score:4]
miR-214 is down-regulated and works as an anti-oncomir in breast cancer [17], cervical cancer [18, 19], hepatocellular carcinoma [20], hepatoma [21], cholangiocarcinoma [22], colorectal carcinomas [23, 24], glioma [25], multiple myeloma [26], prostate cancer [27], bladder cancer [28, 29], and rhabdomyosarcoma [30]. [score:4]
Moreover, miR-214 is down-regulated and has been implicated in tumorigenesis of certain human cancers [17, 22, 26, 30]. [score:4]
COP1 is a direct target of miR-214. [score:4]
In conclusion, we demonstrated that miR-214 played essential roles in the regulation of apoptosis by targeting COP1 in HSA. [score:4]
miR-214 was able to repress the luciferase activity of Ud6 cells transfected with the wild-type vector although it failed to show repression when mutant-1 and mutant-2 vectors were used for the co-transfection, indicating that miR-214 directly targeted COP1 mRNA through binding to the predicted seed sequences in 3'UTR of COP1 mRNA. [score:4]
Furthermore, we identified COP1 E3 ubiquitin ligase as a novel direct target of miR-214, which ligase is the molecule responsible for miR-214 -mediated apoptosis. [score:4]
Furthermore, we showed that THBS1 (thrombospondin), which is a strong angiogenesis inhibitor, was induced by miR-214 in HSA cell lines. [score:3]
However, the function of miR-214 in malignant endothelial proliferative diseases had not yet been reported. [score:3]
COP1 mRNA target sites of miR-214 are conserved among species including human and canine and show high affinity for miR-214. [score:3]
Ectopic expression of miR-214 induced apoptosis in HSA cell lines. [score:3]
miR-214 expression levels of HSA cell lines and CnAOEC after miR-214-transfection. [score:3]
Moreover, mutant 1 and 2 vectors, which contained a mutated target sequence complementary to the miR-214 seed region (Fig 4A), relieved the repressive effect of miR-214 on the luciferase activity (Fig 4B). [score:3]
S2 Fig miR-214-transfection successfully increased intracellular expression of miR-214 in all cell lines used in this study although the efficiency differed in each cell line. [score:3]
miR-214 is highly expressed in main vascular types of endothelium and controls angiogenesis negatively by blocking the release of angiogenic growth factors such as VEGF, bFGF and PDGF [16]. [score:3]
Previously, Mil et al. reported that miR-214 is able to increase THBS1 expression in EC [16]; however, the mechanism still remains unclear. [score:3]
The result that p53 knockdown abolished miR-214-COP1 -mediated apoptosis indicates that p53 played an indispensable role in the apoptosis caused by the introduction of miR-214 or the knockdown of COP1. [score:3]
In this study, we examined miR-214 expression in HSA cell lines and its function by introducing miR-214 into HSA cells. [score:3]
p53 knockdown by its siRNA abolished the apoptotic effects of miR-214-transfection and COP1 knockdown. [score:3]
The wild-type COP1 3'UTR luciferase reporter, containing a conserved target site (Fig 4A), showed significantly reduced luciferase activity after co-transfection with miR-214 (Fig 4B). [score:3]
Moreover, miR-214 is abundantly expressed in EC, negatively controlling angiogenic function in main vascular cell types and tissue with abundant vasculature [16, 31, 32]. [score:3]
0137361.g001 Fig 1 (A) Quantitative measurement of miR-214 revealed that miR-214 expression was significantly down-regulated in HSA cell lines (JuB2, Re12 and Ud6) compared with that in normal EC (CnAOEC). [score:3]
The above results showed that miR-214 exhibited its growth inhibitory effect mainly by inducing apoptosis in HSA cells. [score:3]
Next, we examined the expression of miR-214 in clinical samples of splenic HSA (n = 7) and normal splenic tissues (n = 7), also by miRNA TaqMan qRT-PCR. [score:3]
However, such apoptotic changes were hardly (Fig 2B and 2E) or slightly (Fig 2C and 2D) observed in the miR-214 -transfected control EC, which finding indicates that miR-214 had growth inhibitory effects on rather than induced apoptosis in normal EC. [score:3]
All data are presented as the mean of triplicate experiments with error bars indicating the s. d. (Two-tailed t-test; **p<0.01 for comparisons to miR-214 expression of CnAOEC). [score:3]
We first assessed the expression levels of miR-214 in HSA cell lines established from diverse primary sites (JuB2 from hepatic HSA, Re12 from atrial HSA, and Ud6 from splenic HSA) and in normal primary EC (CnAOEC) by performing miRNA TaqMan qRT-PCR. [score:3]
The intracellular miR-214 levels after transfection did not correspond to the degree of decreased viable cells and induction of apoptosis, indicating that the responses to miR-214-transfection was not dependent on the efficiency of transfection but the primary levels of miR-214 or COP1 expression. [score:3]
These results indicate that miR-214 played a role in cell growth, death and angiogenesis by up -regulating p53-regulated genes in HSA cell lines. [score:3]
miR-214 provoked expression of p53-regualted genes. [score:3]
Moreover, co-knockdown of p53 by its siRNA abolished miR-214-COP1 -mediated apoptosis, indicating that p53 is the molecule responsible for the miR-214-COP1 mediated apoptosis. [score:2]
miR-214 functions as an anti-oncomir in various tumors [17, 22, 26, 30] and also negatively regulates angiogenesis [16, 32]. [score:2]
The relative expression of mature miR-214 level was normalized to the RNU6B endogenous control (AB Assay ID 001093, Applied Biosystems) [44, 45] and determined by the 2 [-ΔCt] method. [score:2]
For further exploration of miR-214 -induced apoptosis, we focused on p53, because the dysregulation of p53 in HSA and AS patients was suggested in previous reports [36, 37]. [score:2]
COP1 knockdown increased both early and late-phase apoptosis in HSA cell lines as same manner as miR-214-transfection but not in control EC. [score:2]
Next, in order to clarify the relationship between p53 and the miR-214-COP1 axis, we introduced miR-214 or siR-cop1 alone or with knockdown of p53 by siR-tp53 in Ud6 cells. [score:2]
COP1 knockdown increased the number of cells with fragmented nuclei (white arrow heads) dose -dependently among cells of all HSA cell lines just as did miR-214-transfection. [score:2]
For detection of the mature miR-214 expression levels (sequence: 5'-ACA GCA GGC ACA GAC AGG CAG U-3'), a miRNA quantitative reverse transcription polymerase chain reaction (miRNA qRT-PCR) assay was performed. [score:2]
miR-214 is one of the miRNAs regulating both tumorigenesis and angiogenesis [15, 16]. [score:2]
miR-214 plays important roles in regulating the angiogenic function of endothelial cells [16, 32]. [score:2]
COP1 knockdown decreased the number of viable cells and induced apoptosis in HSA cell lines just as did miR-214-transfection. [score:2]
COP1 knockdown increased the amounts of active-form of caspase-3 and cleavage of PARP proform in HSA cell lines as same manner as miR-214-transfection but not in control EC. [score:2]
As a result, the single treatment with miR-214 or siR-cop1 induced apoptosis in these cells; however, miR-214 or siR-cop1 treatment of cells subjected to p53 knockdown failed to induce apoptosis in Ud6 cells (Fig 8B). [score:2]
Taken together, the above data indicate that miR-214 induced apoptosis through transcriptional activation of p53-regulated genes. [score:2]
We hypothesized that miR-214 plays important roles in HSA and contributes to the tumorigenesis of HSA. [score:1]
miR-214 increased the number of cells with fragmented nuclei (white arrow heads) dose -dependently in HSA cell lines, whereas it caused no morphological changes in the nuclei of the control EC. [score:1]
The miR-214-COP1-p53 axis was likely to be inactivated and relate to tumorigenesis in dogs with HSA. [score:1]
Our data indicated that miR-214 exerted apoptosis through transcriptional activation of p53. [score:1]
Consistent with our hypothesis, transfection of these cells with miR-214 induced typical apoptotic changes such as nuclear fragmentation, an increase in the number of Annexin-V positive cells, activation of caspase-3 and cleavage of the PARP proform in HSA cell lines. [score:1]
miR-214 increased both early and late-phase apoptosis in HSA cell lines. [score:1]
miR-214 increased the amount of the active form of caspase-3 and cleavage of PARP proform dose -dependently in HSA cell lines (JuB2, Re12 and Ud6) although significant changes were not observed in control EC (CnAOEC) transfected by miR-214. [score:1]
Subsequently, mature miR-214 expression levels were assessed by performing TaqMan MicroRNA Assays (AB Assay ID 002306, Applied Biosystems). [score:1]
Role of microRNA-214 in ginsenoside-Rg1 -induced angiogenesis. [score:1]
miR-214: a potential biomarker and therapeutic for different cancers. [score:1]
Schematic diagram of miR-214-COP1-p53 axis in HSA. [score:1]
However, miR-214 hardly induced apoptosis in the control EC. [score:1]
The sequence region including the putative binding sites of miR-214 (21–23 and 31–38 in the 3'UTR of COP1 mRNA, XM573181.4) was inserted in the pMIR-REPORT Luciferase vector as wild type. [score:1]
Biochemically, immunoblotting showed cleaved caspase-3 and cleavage of the PARP proform, which is the substrate of activated caspase-3, in the miR-214 -transfected HSA cells (Fig 2D), indicating the activation of caspase-3 in the apoptotic processes. [score:1]
miR-214 increased the sub-G fraction and decreased S and G [2]/M fractions in all HSA cell lines, indicating that miR-214 induced apoptosis in HSA cell lines; however, only slight decrease of S fraction were observed in control EC. [score:1]
miR-214-COP1 axis elicited apoptosis through p53. [score:1]
The sequence region including the putative binding sites of miR-214 (21–23 and 31–38 in the 3'UTR of COP1/RFWD2 mRNA, XM_537181.4) was amplified by RT-PCR with TaKaRa Ex Taq (Takara) and TaKaRa PCR Thermal Cycler Dice (Takara). [score:1]
showed increased nuclear-fragmentation in miR-214 -transfected HSA cells (Fig 2B). [score:1]
Additionally, Annexin V/ PI double staining revealed an increased percentage of Annexin V/ PI (+/-) and (+/+) cells, indicating an increase in the number of early- and late-phase apoptotic cells in miR-214 -transfected HSA cells (Fig 2C). [score:1]
miR-214-transfection decreased the number of viable cells in HSA cell lines and that of control EC. [score:1]
revealed that increased sub-G fraction, which indicates nuclear fragmentation by apoptosis in miR-214 -transfected HSA cells (Fig 2E). [score:1]
In order to examine whether miR-214 induced cell death of HSA cells and EC, we conducted 4 different experiments, i. e.,, immunoblotting for Caspase-3 active form and PARP, Annexin V/ PI double staining, and cell cycle analysis, to assess this possibility. [score:1]
The histograms show the representative data of each cell line transfected by 10 nM of miR-214 or control RNA in the triplicated analysis. [score:1]
The cells were transfected with 0.1 μg of the above vectors and co -transfected with 10 nM miR-214 or control RNA by use of Lipofectamine RNAiMAX. [score:1]
Co-transfection of Ud6 cells with miR-214 or siR-cop1 and control RNA induced apoptosis; however, when siR-tp53 replaced the control RNA, apoptosis was hardly or only slightly induced in the cells. [score:1]
The cells were transfected with miR-214 or control RNA as described above. [score:1]
For functional assessment of miR-214, we transfected HSA cell lines with this miRNA. [score:1]
These results suggest that COP1 was an essential molecule responsible for miR-214 -mediated apoptosis in HSA cells. [score:1]
miR-214 decreased the number of viable cells and induced apoptosis in HSA cell lines. [score:1]
[1 to 20 of 129 sentences]
2
[+] score: 450
c Twist1 overexpression upregulated miR-214 expression and downregulated SUFU expression, and (d) the protein levels of profibrotic markers FN and α-SMA was upregulated by Twist1 in HSCs. [score:16]
e Twist1 overexpression upregulated miR-214 expression and downregulated SUFU expression, and f the protein level of profibrotic markers FN was upregulated by Twist1 in LX2. [score:16]
Importantly, Sufu expression was upregulated in response to antagomiR-214 treatment (Fig.   7g, h), suggesting that miR-214 suppression can modulate the expression of Sufu for the treatment of liver fibrosis and indicating miR-214 has a potential to be used as a therapeutic target in clinical studies for liver fibrosis. [score:12]
Relative expression levels are shown as the means ± s. e. m obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and **P < 0.01) To explore the mechanism by which miR-214 regulates HSC activation and to identify the relevant target genes of miR-214, we conducted bioinformatics analyses using the commonly used software including TargetScan, miRBase, and miRanda, and found that Sufu, a downstream factor of Hedgehog signaling, could be a potential target of miR-214. [score:10]
Thus, increasing the expression of mature miR-214 which targets the 3′-UTR of Sufu to suppress its translation. [score:9]
In this study, we took advantage of rat primary HSCs and human LX2 cells for in vitro studies, and found that the knockdown of miR-214 expression in HSCs and LX2 cells using antagomiR-214 resulted in cell morphological changes, decreased expression of profibrotic genes, and inhibition of cell proliferation. [score:8]
Relative expression levels are shown as the means ± standard deviation obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and ** P < 0.01) To study the functional relevance of miR-214 in fibrogenesis, we knocked down the expression of miR-214 using antagomiRs or overexpressed miR-214 using mimics in activated rat primary HSCs and human HSC cell line (LX2). [score:8]
Indeed, Sufu expression was reduced in the clinical cirrhosis tissues (Fig.   5j) and was negatively correlated with miR-214 expression, indicating that miR-214 regulates fibrogenesis by targeting Sufu to modulate the Hedgehog signal pathway. [score:8]
Both Lakner et al. [17] and Maubach et al. [26] took advantage of microarray technology to identify that miR-214 is upregulated during HSC activation, whereas Chen et al. [27] showed that miR-214 is downregulated. [score:7]
Moreover, luciferase assay indicated that miR-214 inhibited Sufu expression by directly targeting the 3′-UTR of Sufu mRNA (Fig.   4e, f). [score:7]
Functional studies demonstrated that miR-214 plays a pivotal role in hepatic fibrosis by regulating Sufu expression, and knockdown of miR-214 expression by antagomiRs effectively alleviate liver fibrosis in CCl [4] -treated mice. [score:7]
This indicated that Twist1 regulates the expression of miR-214, which indirectly affects Sufu levels and profibrotic markers expression in vitro. [score:7]
Intriguingly, miR-214 was one of the most significantly upregulated miRNA in aHSCs and its upregulation was further validated by real-time quantitative PCR (RT-qPCR) analysis (Fig.   1e). [score:7]
As expected, Twist1 overexpression resulted in a significant increase in miR-214 expression accompanied by a reduction in Sufu expression in HSCs (Fig.   6c) or LX2 cells (Fig.   6e). [score:7]
For example, miR-214 expression is upregulated in the renal fibrosis, and genetic deletion of miR-214 significantly attenuated kidney interstitial fibrosis induced by unilateral ureteral obstruction [30]. [score:6]
miR-214 expression is upregulated in different liver injury mo dels. [score:6]
To determine whether Twist1 regulates miR-214 expression in HSCs and in liver fibrosis mo dels, we overexpressed Twist1 in rat HSCs (Fig.   6a) or LX2 (Fig.   6b) using lentiviral vectors containing GFP. [score:6]
Conversely, the constructs with the mutated forms of 3′-UTR resulted in no significant change in luciferase activity in HEK 293T cells (Fig.   4f, g) or HSCs (Supplementary Fig.   3a and 3b), indicating that miR-214 influences Sufu expression by directly targeting the 3′-UTR of Sufu mRNA. [score:6]
In summary, we found that miR-214 expression is significantly upregulated during HSC activation and liver injury samples. [score:6]
Mechanistically, miR-214 enhances HSC activation by suppressing Sufu expression and thus regulates the Hedgehog signaling pathway. [score:6]
Twist1 was found to be upregulated during fibrosis 28, 29, which further supports that miR-214 expression increased during liver fibrosis. [score:6]
In this rat mo del of liver fibrosis, miR-214 expression was found to be upregulated in a manner dependent on the severity of liver fibrosis (Fig.   2c). [score:6]
Therefore, we overexpressed Twist1 to verify whether Twist1 also regulates miR-214 expression in HSCs. [score:6]
Moreover, we also showed that the expression of miR-214 was upregulated with the progression of hepatic fibrosis in CCl [4] -treated rat or mouse mo del, an HFD -induced NASH mouse mo del and in patients with cirrhosis (Fig.   2). [score:6]
These findings indicate that miR-214 has great potential to be used as a biomarker of hepatic fibrosis and a therapeutic target for treating liver diseases (Fig.   8). [score:5]
Furthermore, we observed high expression of Twist1 in clinical cirrhosis samples (Fig.   6g), which was positively correlated with miR-214 expression. [score:5]
Most importantly, we observed reduced Sufu expression in clinical cirrhosis liver samples, which was negatively correlated with miR-214 expression (Fig.   5). [score:5]
miR-214 regulates Sufu expression by direct binding to the 3′-UTR of its mRNA. [score:5]
Relative expression levels are shown as the means ± s. e. m obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and **P < 0.01) a HSCs were transfected with either antagomiR-214 or NC-miR for 48 h, and the expression of miR-214 was detected by and b protein levels of FN and α-SMA were examined using Western blotting. [score:5]
All of these data suggested that Twist1 can indirectly affect fibrogenesis by upregulating miR-214. [score:5]
Following treatment, Sufu expression was upregulated due to decreased miR-214 level in the CCl [4]/antagomiR-214 group when compared with that in the CCl [4]/NC-miR group. [score:5]
The 3′-UTR region of rat and mouse Sufu mRNA containing the potential miR-214 binding site was cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA). [score:5]
In this study, we compared miRNA expression profiles between activated and quiescent HSCs (qHSCs) using microarray analysis and identified miR-214 as a significantly upregulated miRNA during HSC activation. [score:5]
However, qRT-PCR analysis demonstrated negligible effects of miR-214 on Sufu mRNA level (Fig.   4c, d), indicating that miR-214 may repress Sufu expression at the translational level. [score:5]
CCl [4] treatment induced miR-214 overexpression in mouse livers, which was markedly suppressed by antagomiR-214 (Fig.   7b). [score:5]
On the contrary, miR-214 overexpression promoted cell proliferation and induced profibrotic gene expression (Fig.   3 and Supplementary Fig.   2), thereby confirming that miR-214 takes part in the hepatic fibrogenesis. [score:5]
Using bioinformatics analysis, we identified Sufu, a well-known negative regulator of the Hedgehog pathway, as the potential target of miR-214. [score:4]
Mo del representing miR-214 regulates Sufu expression to participate in liver fibrogenesis. [score:4]
n. s. nonsignificant Based on the above data, we hypothesized that miR-214 affects fibrogenesis by regulating Sufu expression. [score:4]
To evaluate the therapeutic potential of miR-214 repression for anti-fibrosis in vivo, chemically synthesized antagomiR-214 oligos were injected into CCl [4] -treated mice to downregulate miR-214 expression in the liver. [score:4]
To investigate whether miR-214 directly target Sufu expression, we cloned the 3′-UTR sequences of rat or mouse Sufu mRNA into the luciferase reporter vector. [score:4]
miR-214 regulates fibrotic gene expression and promotes HSC cell proliferation. [score:4]
Sufu is a direct target of miR-214. [score:4]
In this study, we found that miR-214 was the most significantly upregulated miRNA during HSC activation (Fig.   1). [score:4]
Upregulation of miR-214 in different liver injury mo dels. [score:4]
As shown in Fig.   4a, b, Sufu expression clearly decreased in the cells transfected with miR-214 mimics compared with that in the control cells, while transfection with antagomiR-214 increased Sufu protein expression. [score:4]
This confirmed the regulation of miR-214 expression by Twist1 via the E-box element. [score:4]
Moreover, we conducted sited-directed mutagenesis to destroy the potential miR-214 binding site to further validate target specificity (Fig.   4e). [score:4]
Moreover, miR-214 expression is regulated by the transcriptional factor Twist1 through its binding to E-box element within the miR-214 promoter. [score:4]
Therefore, miR-214 plays a pivotal role in liver fibrosis by regulating Hedgehog signaling and may be used as a potential therapeutic target. [score:4]
Similar results were obtained in human LX2 cells by the knockdown (Supplementary Fig.   2a and 2b) or overexpression of miR-214 (Supplementary Fig.   2d and 2e). [score:4]
However, whether miR-214 regulates Sufu expression in HSCs and in liver fibrosis mo dels has not yet been examined. [score:4]
b data for miR-214 expression in livers from olive oil -treated, CCl [4]/NC-miR -treated, CCl [4]/antagomir-214 -treated mice (n = 5 per group). [score:3]
As expected, we found Twist1 induced the expression of miR-214 in HSCs and LX2 cells, respectively (Fig.   6c–f). [score:3]
Increased expression of miR-214 in activated HSCs. [score:3]
Since NASH has been recognized as a major cause of liver fibrosis [21], we examined miR-214 expression in the early stages of liver fibrosis. [score:3]
Taken together, our data clearly demonstrate that miR-214 has an important role in HSC activation and hepatic fibrosis through affecting Sufu expression. [score:3]
Fig. 3 a HSCs were transfected with either antagomiR-214 or NC-miR for 48 h, and the expression of miR-214 was detected by and b protein levels of FN and α-SMA were examined using Western blotting. [score:3]
GANT-61 is an inhibitor for Gli -induced transcript Transcription of miR-214 gene is induced by the binding of Twist1 with the E-box element in the promoter region of the miR-214 gene. [score:3]
In contrast, the overexpression of miR-214 via mimics increased the protein level of FN and α-SMA (Fig.   3c, d). [score:3]
Mutations within potential miR-214 binding sites were introduced by QuikChange Site-Directed Mutagenesis Kit (Life Technologies, Grand Island, NY, USA). [score:3]
Whether miR-214 expression increases or decreases during HSC activation is controversial. [score:3]
Luciferase activity was significantly repressed by the constructs harboring the wild-type rat or mouse miR-214 target sequence. [score:3]
Twist1 acts on an E-box elements to promote miR-214 expression in HSCs and LX2 cells. [score:3]
miR-214 expression was found to be significantly higher in human cirrhotic liver samples (Fig.   2f), and this was accompanied by high levels of FN protein (Supplementary Fig.   1e and 1f). [score:3]
miR-214 expression is increased during HSC activation. [score:3]
n. s. nonsignificant a, b Inverse correlation between miR-214 and Sufu expression in (a) rat primary HSCs and b human LX2 cells transfected with miR-214 mimics or antagomiR-214. [score:3]
n. s. nonsignificant To further confirm that miR-214 expression is driven by Twist1, we analyzed miR-214 promoter sequences and noted that the promoter contains E-box elements, which are known to be bound by Twist1 homodimers [24]. [score:3]
In addition, luciferase reporter assay results confirmed that Twist1 regulate miR-214 expression through the E-box element within the promoter (Fig.   6h, i). [score:3]
In contrast, overexpression of miR-214 could significantly promote cell growth in HSCs (Fig.   3g) and LX2 cells (Supplementary Fig.   2f). [score:3]
In this study, we identified that miR-214 effectively repressed Sufu expression in HSCs and LX2 cells (Fig.   4a, b). [score:3]
miR-214 -mediated fibrogenesis depends on Sufu expression. [score:3]
Masson’s trichrome and H&E staining clearly demonstrated that antagomiR-214 treatment effectively ameliorate liver fibrosis, implying that miR-214 is a therapeutic target for hepatic fibrosis treatment (Fig.   7). [score:3]
As expected, miR-214 expression was successfully reduced by antagomiR-214 in HSCs (Fig.   3a). [score:3]
The protein level of FN and α-SMA were significantly repressed following the inhibition of miR-214 in HSCs (Fig.   3b). [score:3]
HEK 293T cells were co -transfected with vectors containing either the wild-type (wt) or mutant (mut) target sites of Sufu and either miR-214 mimics or negative control (NC). [score:3]
Furthermore, cell growth was suppressed after the repression of miR-214 by antagomiR-214 in rat primary HSCs (Fig.   3e, f) and human LX2 (Supplementary Fig.   2c), which was accompanied by the decrease of cell numbers and the change of cell morphology (Supplementary Fig.   2g and 2h) in HSCs and LX2, respectively. [score:3]
c HSCs were transfected with miR-214 mimics or NC-miR for 48 h, and the expression of miR-214 was detected by and d the protein levels of FN and α-SMA were detected by Western blotting. [score:3]
Most importantly, Twist1 was high expression in patients with cirrhosis which was positively correlated with miR-214 level (Fig.   6g). [score:3]
Fig. 4 a, b Inverse correlation between miR-214 and Sufu expression in (a) rat primary HSCs and b human LX2 cells transfected with miR-214 mimics or antagomiR-214. [score:3]
Moreover, miR-214 expression is controlled by the transcription factor Twist1, which binds to E-box elements within the miR-214 promoter. [score:3]
n. s. nonsignificantTo further confirm that miR-214 expression is driven by Twist1, we analyzed miR-214 promoter sequences and noted that the promoter contains E-box elements, which are known to be bound by Twist1 homodimers [24]. [score:3]
miR-214 promotes expression of profibrotic markers and cell proliferation in HSCs and LX2 cells. [score:3]
e Differential expression of miR-214 in primary rat HSCs was validated using. [score:3]
These results indicated an increasing expression of miR-214 in aHSCs and suggested a key role of miR-214 in HSC activation. [score:3]
Twist1 affects liver fibrogenesis by regulating miR-214. [score:2]
The mutant miR-214 promoter containing 2-base point mutation (CATCTG → CACGTG) in the E-box site was generated and verified by DNA sequencing. [score:2]
Compared with that in the control mice, miR-214 expression was significantly increased in the mice with HFD -induced liver samples (Fig.   2e), similar to what was observed in the rat mo del of CCl [4] -induced liver fibrosis. [score:2]
Through luciferase assay and, we demonstrated that Twist1 bound to the E-box element within the promoter and induced miR-214 expression (Fig.   6). [score:2]
For the miR-214 knockdown study, HSCs and LX2 cells were transfected with antagomiR-214 or negative control (NC). [score:2]
Moreover, miR-214 has been reported to target the 3′-UTR of Sufu mRNA in human lung adenocarcinoma cells by luciferase assay [23]. [score:2]
Indeed, knockdown of miR-214 significantly increased the percentage of cells in the G1 phase and reduced the percentage of cells in S and G2 phases, indicating that miR-214 can influence cell cycle distribution in HSCs (Supplementary Fig.   2i–k). [score:2]
n. s. nonsignificant According to the above data, miR-214 plays a vital role in fibrogenesis in vitro. [score:1]
Values represent the means ± standard deviation (SD), * P < 0.05 and ** P < 0.01 In a systematic approach to identify the involvement of miR-214 in liver fibrosis, we employed a well-established rodent mo del of carbon tetrachloride (CCl [4]) -induced liver fibrosis [20]. [score:1]
However, further studies are needed to elucidate the overall function of miR-214 and the associated mechanisms in liver fibrosis. [score:1]
Several reports showed that miR-214 participated in fibrosis. [score:1]
However, the role of miR-214 in liver fibrosis is controversial according to the literatures. [score:1]
However, in accordance with miR-214 reduction, liver damage was obviously ameliorated in the CCl [4]/antagomiR-214 group mice (Fig.   7c, d), which was accompanied by a reduction in COL1α1 mRNA level (Fig.   7e) and decreased α-SMA levels, which as detected by immunohistochemistry (Fig.   7f). [score:1]
These results suggest that miR-214 may play a crucial role in the HSC activation and liver fibrosis. [score:1]
The level of miR-214 in liver tissues was examined via. [score:1]
The miR-214 promoter region was amplified by PCR from the genomic DNA of primary rat HSCs, and the resultant fragments were cloned into pGL4.27 vector (Promega, Madison, WI, USA) at XhoI and HindIII (New England Biolabs, Ipswich, MA, USA) sites. [score:1]
b The mRNA level of α-SMA and COL1α1 and c miR-214 level was detected in CCl [4] -treated rat liver sections at different time points. [score:1]
The analyses were performed on BD LSR flow cytometer (BD Biosciences, San Jose, CA, USA) For examining whether miR-214 directly target Sufu mRNA, pMir-Report-sufu reporter plasmids were co -transfected with miR-214 mimics or scramble into HEK 293T cells using Lipofectamine 2000 for 24 h. After transfection, both firefly and Renilla luciferase activities were measured by Dual-Luciferase Assays Kit (Promega, Madison, WI, USA). [score:1]
In the cardiac tissues, miR-214 is a sensitive marker of cardiac stress, and miR-214- deletion leads to increased fibrosis after ischemic injury [31]. [score:1]
Therefore, miR-214 likely plays a crucial role in the initiation or/and progression of liver fibrosis. [score:1]
Fig. 8Transcription of miR-214 gene is induced by the binding of Twist1 with the E-box element in the promoter region of the miR-214 gene. [score:1]
For investigating whether Twist1 binds to the promoter of miR-214 gene, the recombinant pGL4.27 plasmid containing wild-type or mutant miR-214 gene promoter was co -transfected into HEK 293T cells with Twist1 expression plasmid and pRL-TK containing Renilla luciferase reporter gene. [score:1]
These results demonstrated the functional relevance of miR-214 in fibrogenesis in vitro. [score:1]
To further understand the differences, we found that Chen et al. [27] normalized miR-214 expression to GAPDH mRNA while we normalized miR-214 levels to U6 RNA, a noncoding small nuclear RNA commonly used for miRNA measurement. [score:1]
c, d analyses of Sufu mRNA levels after transfection of miR-214 mimics or antagomiR in HSCs (c) and in LX2 cells (d). [score:1]
To this end, we transfected miR-214 mimics or antagomiR-214 into rat primary HSCs and human LX2 cells. [score:1]
AntagomiR-214 ameliorates liver fibrosis induced by CCl [4] in miceAccording to the above data, miR-214 plays a vital role in fibrogenesis in vitro. [score:1]
The sequence of mature miR-214 is identical in human, rat, and mouse, and bioinformatics analysis revealed that Sufu mRNAs have the potential miR-214 binding sites (Fig.   4e). [score:1]
Blue shading indicates the seed sequence of miR-214. [score:1]
f miR-214 expression in the liver of cirrhosis or healthy controls was measured by. [score:1]
e Potential miR-214 binding sites were predicted in the 3′-UTR of rat or mouse Sufu mRNAs. [score:1]
[1 to 20 of 116 sentences]
3
[+] score: 417
In addition, the overexpression or knock-down of miR-214 in LAD cells could decrease or increase Sufu expression, respectively, which consistence with that miR-214 expression was inversely correlated with Sufu expression in tumors from the patients with LAD. [score:10]
Importantly, in human LAD tumor tissues, miR-214 expression was significantly associated with EMT-related markers; a high expression level of miR-214 significantly associated with low E-cadherin expression and high vimentin expression, which supports the loss- and gain- of function studies performed in this report by using LAD tumor cell lines. [score:9]
To confirm that Sufu acts as a miR-214 target, we examined the Sufu expression in miR-214 knockdown or over -expression LAD cells. [score:8]
On the other hand, miR-214 can also suppress tumor development, and its expression is correlated with poor clinical outcomes in hepatocellular carcinoma, promoting apoptosis and angiogenesis by suppressing HDGF [20]. [score:8]
To test whether the miR-214-enhanced EMT process is dependent on Sufu inhibition, we used hypoxia as the EMT induction mo del and compared EMT -associated changes after hypoxia treatment among miR-214 overexpression, Sufu overexpression, Sufu&miR-214 overexpression and vector -transfected A549 cell groups. [score:8]
Tumors with a high level of miR-214 expression showed lower Sufu expression, whereas the reverse results were shown in low miR-214 expression groups (p < 0.001, Figure 5H). [score:7]
On the one hand, miR-214 is highly expressed in melanoma and promotes tumor cell migration by up -regulating ALCAM and miR-148b down-regulation [19]. [score:7]
These findings suggest that miR-214 regulates the EMT by directly suppressing Sufu expression. [score:7]
We found that the ectopic expression of miR-214 dramatically increased the migratory and invasive abilities of both miR-214 high expressing cells (NCI-H1650 and A549 cells) and miR-214 low expressing cells (SPC-A1) (Figure 2A–2C). [score:7]
Importantly, previous studies have shown that miR-214 expression has been associated with high grade and cancer progression in LAD [21– 23], our studies not only confirmed that the expression of miR-214 was elevated in LAD, but also found that increased miR-124 expression correlated with LAD metastasis and epithelial-mesenchymal transition (EMT). [score:7]
Moreover, we found that miR-214 directly bound with the 3′UTR region of Sufu and suppressed Sufu expression. [score:6]
The down-regulation of miR-214 suppresses the EMT and migration ability in LAD cells. [score:6]
Moreover, overexpression of miR-214 greatly promoted the EMT in LAD cells, and knocking down miR-214 by shRNA inhibited EMT. [score:6]
In this study, we demonstrated the function of miR-214 in LAD and found that miR-214 strongly activates the EMT, and it ultimately promotes LAD metastasis by targeting suppressor-of-fused (Sufu), a negative regulator of the Hedgehog signaling pathway. [score:6]
For the overexpression of the Sufu gene, Sufu cDNA (lacking the miR-214 target site in the 3′UTR) was cloned into a lentiviral shuttle vector (GeneChem, Shanghai, China, (vector information: http://www. [score:5]
We thought Sufu would be the functional target gene of miR-214 after we performed a prediction with miRanda and Targetscan databases. [score:5]
Interestingly, this over -expression of miR-214 -associated phenotype changes could be partially rescued by Sufu over -expression (Figure 6D–6E, Supplementary Figure S6). [score:5]
More importantly, an inverse correlation was found between miR-214 expression and Sufu expression in 18 cases of clinical LAD tissues (p < 0.0001, R = −0.76, Figure 5G). [score:5]
To investigate the roles for the target gene of miR-214 in the EMT process and metastasis in LAD, we first performed a miRNA target gene prediction with miRanda and Targetscan databases. [score:5]
The Sufu promoted effects were inhibited when miR-214 was over-expressed (Supplementary Figure S7). [score:5]
D. The expression of EMT markers in miR-214-over -expression A549 cells under hypoxia treatment were quantitated by real-time PCR. [score:5]
The inverse correlation between miR-214 and Sufu expression in miR-214 over -expression cells were determined by real-time PCR (C) and western blots (D) in three LAD cells (A549, NCI-H1650, and SPC-A1). [score:5]
To demonstrate the miR-214 expression in LAD, we first examined the miR-214 expression levels in 22 primary and 13 para-cancerous LAD tissues using quantitative real-time PCR (qRT-PCR). [score:5]
Under Lipofectamine-2000 (Invitrogen), the A549 cells were transfected with luciferase vectors (an empty luciferase vector, a luciferase vector containing the wild-type target gene's 3′-UTR, and a luciferase vector containing the mutant-type target gene's 3′-UTR) for Sufu, and together with miR-214 or the negative control. [score:5]
More importantly, tumor tissues from LAD patients with high miR-214 expression showed high levels of vimentin and low levels of E-cadherin, whereas the reverse results were shown in miR-214 low expression groups (Figure 3E, n = 6 paired). [score:5]
As shown in Figure 7C–7E, miR-214 over -expression caused EMT-related marker changes in the A549 cell line, whereas co-transfection with a Sufu over -expression vector partially abolished these changes at both the mRNA and protein levels. [score:5]
C. The expression of EMT markers was analyzed by immunofluorescent staining in miR-214-over-expressed A549 cells and NCI-H1650. [score:5]
We observed that Sufu over -expression significantly decreased A549 cell migration and invasion in vitro, whereas miR-214 over -expression in A549 cells led to a dramatic increase in migration and invasion (Figure 6D–6E, Supplementary Figure S6). [score:5]
Figure 3 A. The expression of EMT markers as analyzed in miR-214-over-expressed A549 cells and NCI-H1650 by real-time PCR. [score:5]
Consistent with the in vitro results, the over -expression of Sufu could partially abolish the pro-metastatic roles of miR-214 over -expression (Figure 6F–6H, n = 6). [score:5]
A. The expression of EMT markers as analyzed in miR-214-over-expressed A549 cells and NCI-H1650 by real-time PCR. [score:5]
In the in vivo xenograft mouse mo del, we found that the lungs from the mice carrying miR-214 over -expressing A549 cells displayed more visible metastatic nodules than the vector control, and the Sufu over -expressing A549 cells displayed less visible metastatic nodules than the vector control. [score:5]
LAD cells were stably infected with the pre-microRNA expression construct known as the lenti-miR expression plasmid, which contained the full-length miR-214 in H1-MCS-CMV-EGFP vector (GeneChem, Shanghai, China; vector information: http://www. [score:5]
Most of the tumors with metastases (83.3%) exhibited high miR-214 expression (only 16.7% showed low miR-214 expression). [score:5]
E. An immunofluorescence analysis of vimentin and E-cadherin expression in patients with lower (n = 6) and higher miR-214 expression levels (n = 6). [score:5]
The fold changes in the EMT markers detected by real-time PCR or western blots in Sufu-over-expressed or Sufu and miR-214-co -overexpressed A549 cells. [score:5]
miR-214 is up-regulated in LAD and positively associated with metastasis. [score:4]
Reciprocally, the miR-214 knockdown was accompanied by an increase in the Sufu expression in A549 and NCI-H1650 cells (Figure 5E–5F). [score:4]
To test whether Sufu is functionally regulated by miR-214 in LAD metastasis, we generated stable Sufu and miR-214 and Sufu-over -expressing A549 cells (Supplementary Figure S5). [score:4]
Taken together, our results suggest that miR-214 promotes LAD metastasis by directly targeting Sufu. [score:4]
Sufu is a direct target of miR-214 in LAD cells. [score:4]
Sufu was a direct functional target of miR-214 in LAD metastasis. [score:4]
In LAD, miR-214 expression was significantly higher than it was in normal tissue [21] and was associated with advanced tumor stage, poor overall survival and higher recurrence rates [22– 23], which suggest that miR-214 is important for LAD development. [score:4]
Therefore, we decided to identify the functional target gene for miR-214 that was involved in LAD metastasis regulation. [score:4]
The expression of EMT markers analyzed in sh-miR-214 -transfected A549 cells (C) and NCI-H1650 (D) by real-time PCR. [score:3]
To confirm this hypothesis, we first used miR-214-over -expressing A549 and NCI-H1650 cells to analyze the EMT hallmark changes in both the mRNA and protein levels. [score:3]
These observations suggest that miR-214 can be a therapeutic target for preventing LAD metastasis. [score:3]
The relative level of Sufu in LAD patients with lower or higher miR-214 expression as tested by real-time PCR and immunofluorescence. [score:3]
Inversely, most of the tumors from metastasis-free patients (64.3%) showed low miR-214 expression (Figure 1B). [score:3]
Although, miR-214 influences the formation of slow muscle cell types by targeting Sufu in zebrafish had been reported [33]. [score:3]
G. The inverse correlation between miR-214 and Sufu expression in 20 clinical samples was determined by Pearson's correlation coefficient (R = −0.76, p < 0.0001). [score:3]
We then detected the miR-214 expression level in these three cell lines after hypoxia exposure. [score:3]
These observations indicate that the miR-214 -induced EMT process is dependent on Sufu inhibition. [score:3]
Here, we found miR-214 to be highly expressed in tumor cells that are proceeding with the EMT process accompanied by gaining mesenchymal markers and losing epithelial markers. [score:3]
In addition, Sufu over -expression can significantly rescue the miR-214 promoted EMT and metastasis. [score:3]
B. EMT markers in three miR-214 over-expressed LAD cell lines as analyzed by western blots. [score:3]
For the first time, we revealed a positive correlation between miR-214 expression and LAD metastasis, providing novel insights into how miR-214 correlates with advanced tumor stages, poor overall survival and higher recurrence rates in lung cancer [22– 23]. [score:3]
Collectively, our data suggested that miR-214 overexpression significantly enhanced the migratory and invasive abilities of LAD cells in vitro and markedly promoted LAD metastasis in vivo. [score:3]
The miR-214 -mediated EMT process in LAD cells depends on Sufu inhibition. [score:3]
We first generated LAD cell lines with stable miR-214 over -expression (A549 and NCI-H1650) using lentivirus transfection. [score:3]
Collectively, all these results demonstrated that miR-214 promotes LAD metastasis by targeting Sufu. [score:3]
Luciferase assays were performed to obtain direct evidence that Sufu is a target of miR-214. [score:3]
Furthermore, there was also an inverse relation between the Sufu and miR-214 expression levels in primary and metastatic tissues (P < 0.005, R = −0.495, Figure 6C). [score:3]
As shown in Supplementary Figure S3A, the miR-214 expression exhibited a 2 ~ 5-fold increase in all three LAD cells under hypoxic conditions than under normoxia. [score:3]
F. The expression of EMT markers in sh-miR-214 -transfected A549 cells under hypoxia treatment were quantitated by real-time PCR. [score:3]
D. miR-214 expression was detected among five LAD cell lines in a descending order of metastatic potential. [score:3]
As anticipated, the migratory and invasive capabilities of both A549 and NCI-H1650 cells were significantly reduced by miR-214 inhibition (Figure 4A–4B). [score:3]
Previously, miR-214 has reportedly been aberrantly expressed in different types of tumors. [score:3]
Figure 1 A. The quantitation of miR-214 expression in human primary LAD cancer tissues (n = 22) and paracancerous tissues (n = 13). [score:3]
As shown in Figure 3A–3C, the epithelial marker E-cadherin was significantly decreased after miR-214 overexpression. [score:3]
We found that the Sufu expression in both A549 and NCI-H1650 cells was significantly decreased after exposure to hypoxia (Figure 7A–7B), which is consistent with the results in which miR-214 was increased by hypoxia (Supplementary Figure S3A). [score:3]
This is the first time to demonstrate that miR-214 directly regulates the Sufu signaling pathway in LAD cells. [score:3]
C. The correlation between miR-214 and Sufu expression in primary and matched metastasis (n = 30, P = 0.005, R = −0.495). [score:3]
This finding is consistent with a previous report showing that miR-214 is highly expressed in melanoma and promotes tumor cell migration [19]. [score:3]
As shown in Supplementary Figure S3D, the miR-214 expression levels were much higher in E-cadherin [low] cells than E-cadherin [high] cells in both A549 and NCI-H1650 cells. [score:3]
An infection efficiency >90% was verified by fluorescent microscopy and confirmed for miR-214 or Sufu expression. [score:3]
Moreover, in vivo, tumors derived from lower metastatic potential cells (SPC-A1, HCC827) expressed lower levels of miR-214 than that the tumors derived from higher metastatic potential cells (A549 and NCI-H1650) (Figure 1E), suggesting that the metastatic potential was positively associated with endogenous miR-214 levels. [score:3]
A. The quantitation of miR-214 expression in human primary LAD cancer tissues (n = 22) and paracancerous tissues (n = 13). [score:3]
We found that almost all (100%) LAD patients with advanced stage III &IV cancer showed high miR-214 expression, whereas those with early stage I (75%) showed low miR-214 (Figure 1B). [score:3]
#means compared with the miR-214 overexpression group. [score:2]
The Sufu expression was decreased at both the mRNA (Figure 5C) and protein levels (Figure 5D) in A549, NCI-H1650 and SPC-A1 cells after being transfected with miR-214, compared with the vector transfection. [score:2]
To confirm the correlation between miR-214 and metastasis, we compared the miR-214 expression levels in primary tumors with their matched metastatic tissues in 15 LAD patients. [score:2]
In vivo xenograft experiments showed that miR-214-over -expressing A549 cells displayed more visible metastatic nodules in the lungs compared with those from mice that were carrying the vector at 30 days after tail vein injection (Figure 2E–2G, n = 10). [score:2]
Furthermore, under hypoxic conditions, the miR-214 over -expressing cells had more decreased E-cadherin and increased vimentin compared with the vector control cells (Figure 3D). [score:2]
By contrast, the mesenchymal markers vimentin, MMP-9 and snail were increased in miR-214 over-expressed cells compared with the vector cells. [score:2]
But there was no direct evidence to show the relationship between miR-214 and Sufu in cancer cells. [score:2]
miR-214 controls EMT and metastasis by directly silencing Sufu. [score:2]
However, none of the previous studies have systematically investigated the role of miR-214 in the development of metastatic disease in LAD. [score:2]
We found that the miR-214 expression was significantly higher in metastatic tumors compared with the matched primary tumors (p < 0.002, Figure 1C). [score:2]
Figure 2miR-214 enhances LAD cell migration and invasion in vitro and promotes their metastasis in vivo A, B. and C. The migration and invasion abilities of A549 (A), NCI-H1650 (B) and SPC-A1 cells (C) when transfected with the miR-214 over -expression vector or an empty vector as assessed by Transwell migration and Matrigel invasion assay for 24 hours. [score:2]
Our results indicated that the miR-214 expression was significantly higher in tumor tissues compared with paracancerous tissues (p < 0.001, Figure 1A), which is consistent with previous reports [21– 23]. [score:2]
As expected, the luciferase activity was decreased by miR-214 over -expression when the Luc-Sufu-wt was present, compared with the luciferase activity in the Luc-Sufu-mu, suggesting that miR-214 reduced the luciferase activity of Luc-Sufu-wt but had no effect on Luc-Sufu-mu (Figure 5B). [score:2]
D. A wound-healing assay performed with miR-214-over-expressed A549 cells at 0, 24, and 48 hours, and the average wound-healing area. [score:2]
B. Dual-luciferase assays showing the repression of wild-type UTR (Sufu-3′UTR) or mutant UTR (Sufu-3′UTR mut) following the transfection of the vector or miR-214 over -expression vector. [score:2]
A, B. and C. The migration and invasion abilities of A549 (A), NCI-H1650 (B) and SPC-A1 cells (C) when transfected with the miR-214 over -expression vector or an empty vector as assessed by Transwell migration and Matrigel invasion assay for 24 hours. [score:2]
A. A schematic representation of putative miR-214 binding in the 3′ UTR of Sufu at 1956–1962 nt. [score:1]
The sh-miR-214 sequence (ACTGCCTGTCTGTGCCTGCTGT) was cloned into the H1-MCS-CMV-EGFP (GeneChem, Shanghai, China; vector information: http://www. [score:1]
The current study established a novel function of Sufu-miR-214 signaling axis in controlling EMT and metastasis of LAD. [score:1]
Having shown that miR-214 overexpression could enhance the EMT process in LAD cells, we next employed a loss-of-function approach by using shRNA (Supplementary Figure S1C) to investigate its role in the EMT process. [score:1]
In view of these findings, we focused on miR-214 for further metastatic functional studies. [score:1]
aspx?zt=GV159) to generate H1-MCS-CMV-EGFP-sh-miR-214 (GeneChem, Shanghai, China). [score:1]
Taken together, these results demonstrate that miR-214 enhances the EMT process in LAD cells. [score:1]
These results showed that miR-214 was increased in the EMT cells of LAD, suggesting that miR-214 might activate the EMT process in LAD. [score:1]
In addition, miR-214 over-expressed A549 cells migrated more rapidly to close the scratched wounds, compared with cells with the control vector, as tested by using a scratched wound-healing assay (Figure 2D). [score:1]
As described above, we found that miR-214 was positively associated with LAD metastasis. [score:1]
To understand the potential roles of miR-214 in LAD, we analyzed the correlation between the miR-214 levels and the clinical pathological parameters in LAD patients. [score:1]
This is the first time, to our knowledge, that miR-214 has been shown to enhance the EMT process in LAD and any cancer types. [score:1]
Collectively, our study has significant implications for understanding the underlying mechanisms of how miR-214 contributes to tumor progress and poor clinical outcomes in LAD. [score:1]
We demonstrated that miR-214 enhanced the migratory and invasive abilities of LAD cells in vitro with three different cell lines and with both gain-of-function and loss-of-function experiments and that it promoted A549 cell-bearing tumor metastasis in a xenograft mouse mo del. [score:1]
miR-214 enhances LAD cell migration and invasion in vitro and promotes their metastasis in vivo. [score:1]
E. EMT markers in sh-miR-214 -transfected A549 and NCI-H1650 cells and analyzed by western blotting. [score:1]
Meanwhile, we tested the miR-214 levels in five LAD cell lines (A549, NCI-H1650, H322, SPC-A1 and HCC827) with different metastatic potentials [24, 25]. [score:1]
Figure 5 A. A schematic representation of putative miR-214 binding in the 3′ UTR of Sufu at 1956–1962 nt. [score:1]
C. miR-214 levels in primary lung tumors and matched lymph node metastases by real-time PCR (n = 15). [score:1]
miR-214 enhances LAD cell migration and invasion in vitro and promotes their metastasis in vivoAs described above, we found that miR-214 was positively associated with LAD metastasis. [score:1]
Collectively, our findings indicate a strong positive correlation between miR-214 and LAD metastasis. [score:1]
However, our results are in contrast to Salim's publication [31] in which miR-214 could decrease the invasiveness of non-small cell lung carcinoma (NSCLC) cells including U-1810 (lung squamous carcinoma) and H23 (LAD). [score:1]
Primary tumors were collected to investigate miR-214 expression levels by qRT-PCR (n = 6). [score:1]
The findings from this study suggest that interfering with miR-214 and Sufu could be a viable approach to treat late stage metastatic LAD patients. [score:1]
For the xenograft experiments, A549 cells infected with lentivirus carrying a GFP-vector, miR214 and/or Sufu were injected into the tail veins. [score:1]
The Pearson's correlation coefficient was used to assess the correlation between miR-214 and Sufu level (G) * P < 0.05, ** P < 0.01, ns, not significant. [score:1]
Similar to B–C, the Sufu levels were detected by real-time PCR and western blots in miR-214-silenced cells. [score:1]
B. The correlation between the miR-214 levels and clinical pathological parameters in LAD patients. [score:1]
Moreover, we demonstrated that miR-214 enhanced the EMT of LAD cell, an important process for metastasis, supporting miR-214 as the promoting function in LAD metastasis. [score:1]
We found that Sufu exhibited miR-214 -binding sequences in its 3′-UTR regions (nucleotides 1956–1962, Figure 5A). [score:1]
miR-214 is increased in LAD and positively associated with metastasis. [score:1]
miR-214-promoted LAD metastasis is mediated by the EMT. [score:1]
U6 was used as a loading control for miR-214. [score:1]
Among the five LAD cell lines with a descending order of metastatic potentials, their endogenous level of miR-214 was correspondingly decreased (Figure 1D). [score:1]
miR-214 promoted LAD metastasis is mediated by the EMT. [score:1]
The present study identified miR-214 to promote LAD metastasis. [score:1]
[1 to 20 of 131 sentences]
4
[+] score: 402
In the Fig. 1B, we demonstrated that miR-214 was significantly suppressed in samples of HCC patients with early recurrent disease, and high miR-214 expression was significantly associated with early recurrent disease and a relative poorer disease-free survival rate (Fig. 1C). [score:11]
Besides miR-214 expression, it was observed that the upregulation of EZH2 and CTNNB1 and the down-regulation of CDH1 significantly associated with early recurrent HCC disease and poor survival. [score:11]
Further analysis of HCC tissues, using qRT-PCR, of an independent cohort of 50 HCC patients of whom 29 with early recurrent disease (≤2 years) and 21 with late recurrent disease demonstrated that miR-214 was significantly suppressed in samples of HCC patients with early recurrent disease, P<0.01, (Fig. 1B). [score:9]
Using the median expression value obtained for miR-214 of the 50 samples studied as the cut-off point, Fisher’s exact test and Kaplan-Meier analysis demonstrated that low miR-214 expression was significantly associated with early recurrent disease and a relative poorer disease-free survival rate (Fig. 1C). [score:9]
The suppressive effect of P-miR-214 was abrogated with the pGL3-EZH2-3′UTR-mut and pGL3-CTNNB1-3′UTR-mut constructs which contained mutation introduced in the predicted miRNA-target interactions sequences, confirming that EZH2 and CTNNB1 were indeed direct downstream functional targets of miR-214 (Fig. 4A). [score:9]
In ovarian cancer, miR-214 was shown to induce cell survival and cisplatin resistance by targeting the 3′-untranslated region (UTR) of PTEN to suppress its expression and resulting in the activation of the PI3K/Akt signaling pathway [29]. [score:9]
The reduction in the expression level of miR-214 during hepatocarcinogenesis resulted in the up-regulation of EZH2 and β-catenin and the down-regulation of E-cadherin. [score:9]
To study the potential prognostic significance of CTNNB1, EZH2, the direct targets of miR-214 and CDH1, a downstream target in HCC recurrence, we further analyzed the expression level of EZH2, CTNNB1, and CDH1 in this dataset. [score:8]
In the present study, we have validated these observations and further demonstrated that suppression of miR-214 expression in HCC can modulate the β-catenin signalling pathway by activating CTNNB1 and EZH2 and down -regulating CDH1 expression. [score:8]
Overexpression of miR-214 also inhibited the protein expression of EZH2 and CTNNB1 (Fig. 4B). [score:7]
Moreover, stably overexpressing miR-214 in SK-HEP-1 cells resulted in the significant reduction in soft agar colony formation (Fig. 3C) indicating the overexpression of miR-214 inhibited cell anchorage-independent growth of SK-HEP-1 cells in soft agar. [score:7]
0044206.g007 Figure 7Expression of EZH2, CTNNB1, and CDH1, downstream targets of miR-214, is associated with early recurrent disease and survival of patients with HCC. [score:7]
These data suggest that the expression of miR-214 and its downstream targets are clinically useful indicators correlated with early recurrent HCC disease and survival. [score:7]
The ectopic expression of miR-214 in HCC cell lines suppressed cell growth, invasion and stem-like traits in vitro and tumorigenicity in vivo through the inhibition of β-catenin signaling. [score:7]
In cervical cancer, the ectopic expression of miR-214 could inhibit the proliferation, migration and invasive ability of HeLa cells by targeting MEK3, JNK1 and Plexin-B1 [30], [31]. [score:7]
With an integrated target prediction tool (miRecords), CTNNB1 was predicted to be a potential target of miR-214 by miRanda, PITA, RNAhybrid and TargetScan. [score:7]
Expression of EZH2, CTNNB1, and CDH1, downstream targets of miR-214, is associated with early recurrent disease and survival of patients with HCC. [score:7]
Fisher’s exact test and Kaplan-Meier analysis were used to demonstrate that high miR-214 expression was significantly associated with early recurrent disease and a relative poorer disease-free survival rate. [score:7]
EZH2 and CTNNB1 are downstream targets of miR-214 and both are upregulated in human HCC tissue samples. [score:6]
This finding extends earlier reports demonstrating the frequent down-regulation of miR-214 expression in human HCC tissues and cell lines [9], [10], [11], [12], [13]. [score:6]
Interestingly, the expression of miR-214 was apparently more down-regulated in cell lines possess higher reported capability of invasion and metastasis (such as HLE and SK-HEP-1) than cell lines with lower invasion and metastasis capability (such as HepG2 and PLC/PRF/5) [17] (Fig. 2A). [score:6]
Since EpCAM is a direct transcriptional target of the wnt-β-catenin canonical signaling pathway [26], [27], we have demonstrated that mR-214 can directly or indirectly modulate the expression of CTNNB1 through EZH2, we decided to investigate the effect of silencing miR-214 on the EpCAM [+] HCC tumor cell population. [score:6]
0044206.g004 Figure 4 EZH2 and CTNNB1 are downstream targets of miR-214 and both are upregulated in human HCC tissue samples. [score:6]
Re -expression of miR-214 Significantly Inhibits Cell Growth and Invasion in vitro and Tumorigenic Properties in vivo of HCC Cells. [score:5]
In this study, we have characterized CTNNB1 and EZH2 as two functional downstream targets of miR-214 and to decipher the possible roles of these downstream targets in early recurrent HCC disease. [score:5]
Since miR-214 can regulate the β-catenin pathway directly or indirectly via EZH2 to target β-catenin [48], we have investigated the potential role of miR-214 in regulating hepatic EpCAM [+] CSCs. [score:5]
Moreover, expression of E-cadherin, which often complexes with CTNNB1, was induced following the overexpression of miR-214 (Fig. 4B). [score:5]
These data suggested that the overexpression of miR-214 in human HCC cells can significantly inhibit their growth and invasion in vitro and tumorigenicity in vivo. [score:5]
The predicted target sequences of miR-214 and EZH2-3′UTR or CTNNB1-3′UTR was analyzed by RNAhybrid 2.2 or TargetScan and these sequences are shown in Figure S3. [score:5]
Most recently and in agreement with our present results, it has been reported that the reduction of miR-214 expression in breast cancer cells associated with increase in cell proliferation, invasion, and accumulation of the polycomb EZH2 methyltransferase [32] and that EZH2 protein expression can be a sensitivity diagnostic biomarker for HCC [40]. [score:5]
Re -expression of miR-214 significantly inhibits cell growth in vitro and tumorigenic properties of HCC cells. [score:5]
These data indicate that miR-214 inhibits cell invasion by inhibiting EZH2 and CTNNB1. [score:5]
Despite several reports have implicated the aberrant activation and mutation of CTNNB1, to the best of our knowledge, there has been no report to suggest that CTNNB1 to be a direct target of miR-214 in HCC [41], [42]. [score:5]
Additionally, our clinical data showed that low-level of miR-214 and CDH1 and high-level of EZH2 and CTNNB1 were significantly associated with early recurrent HCC disease and can be predictors of comparatively reduction in disease-free survival (Fig. 7). [score:5]
In summary, our data showed that miR-214 can provide tumor suppression function in hepatocarcinogenesis through modulating the expression of EZH2, CTNNB1 and CDH1. [score:5]
So we transfected HLE and SK-HEP-1 cells, which express miR-214 at a low level, with the pLL3.7-Pre-miR-214 (P-miR-214) or pLL3.7-miR-control vector (P-miR-control) in order to overexpress miR-214. [score:5]
The down-regulation of miR-214 has previously been observed in human HCC. [score:4]
Consistent with the data obtained from human HCC tissue samples, the down-regulation of miR-214 in these human liver cancer cell lines was observed (Fig. 2A). [score:4]
The MTS assay showed that overexpression of miR-214 significantly inhibited the growth of HLE and SK-HEP-1 cells at 72 h post-transfection, while P-miR-control had no effect (Fig. 3A and 3B). [score:4]
The regulation of the expression of the polycomb protein EZH2 by miR-214 was firstly observed in skeletal muscle and embryonic stem cells (29). [score:4]
In the current study, we have demonstrated the down-regulation of miR-214 is associated with the invasion and early recurrence of HCC. [score:4]
Subsequent flow cytometric analysis showed that knocked-down of miR-214 or functional overexpressing EZH2 induced an enrichment of EpCAM [+] HLE cells (Fig. 6D (i) and (ii) respectively). [score:4]
For this study, we firstly employed the construct miRZip-214 (System Biosciences) to knockdown miR-214 expression in miR-214-stable transfected HLE cells. [score:4]
While the down-regulation of miR-214 in HCC have been reported [9], [10], [11], [12], [13], its molecular roles in recurrent HCC remain largely unknown. [score:4]
The ability to knockdown of miR-214 expression by miRZip-214 construct was verified by qRT-PCR (Fig. 6A). [score:4]
In this study, we have demonstrated that CTNNB1 and EZH2 are direct targets of miR-214. [score:4]
Downregulation of miR-214 is associated with the early recurrence of human HCC. [score:4]
miR-214 can Regulate the Canonical wnt Signaling Pathway in HCC by Targeting CTNNB1, its Key Downstream Component. [score:4]
Re -expression of miR-214 in HLE and SK-HEP-1 cells expressing low basal level of miR-214 significantly reduced the invasiveness and motility ability of HLE and SK-HEP-1 cells compared to transfection with the P-miR-control (Fig. 2B and 2C). [score:4]
Subsequently, functional overexpression of miR-214 in HLE and SK-HEP-1 cells also significantly inhibited cell proliferation according to the MTS -based CellTiter 96 cell proliferation assay (Fig. 3A and 3B) and colony formation (Fig. 3C). [score:4]
Downregulation of miR-214 is Associated with the Early Recurrence of Human HCC. [score:4]
0044206.g001 Figure 1The level of expression of miR-214 was analyzed by qRT-PCR and normalized to U6. [score:3]
Figure S4 Re -expression of EZH2 and CTNNB1 rescues miR-214-related functions. [score:3]
To validate EZH2 and CTNNB1 were indeed direct targets of miR-214, we tested the ability of miR-214 to recognize the 3′-UTR of EZH2 and CTNNB1 mRNA using a dual-luciferase reporter assay. [score:3]
The expression level of miR-214, EZH2, CTNNB1 or CDH1 was calculated using the expression ratios miR-214/U6, EZH2/HPRT1, CTNNB1/HPRT1 and CDH1/HPRT1 (i. e. 2 [–ΔCt]) [10], [15]. [score:3]
The median expression value obtained for miR-214 of the 50 samples studied was employed as the cut-off point. [score:3]
Next, we overexpressed EZH2 by transfecting the vector pLVTHM-EZH2 [16] to miR-214-stable transfected HLE cells. [score:3]
In this study, we firstly validated the suppression of miR-214 in human HCC by qRT-PCR in paired tumor and non-tumor liver tissues from 20 HCC patients, as well as in 10 samples of histologically normal liver tissues from colorectal cancer patients with liver metastases (Fig. 1A and Figure S1). [score:3]
Knocked-down of miR-214 by miRZip-214 specifically increased the expression of EZH2 and β-catenin compared with miRZip-control transfection (Fig. 6B). [score:3]
These examples illustrate the importance of the proper execution of miR-214 for maintenance of cellular homeostasis and the optimal performance of cellular processes and miR-214 expression is often perturbed in human cancer. [score:3]
Furthermore, SK-HEP-1 cells stably overexpressing miR-214 following transfection with P-miR-214 (SK-miR-214) showed reduced tumorigenesis in nude mice. [score:3]
Co-transfection of P-miR-214 with pGL3-EZH2-3′UTR-wt or pGL3-CTNNB1-3′UTR-wt in SK-HEP-1 cells significantly suppressed luciferase activity (Fig. 4A). [score:3]
The average expression level of miR-214, analyzed by qRT-PCR, was lower in HCC patients with early recurrence (≤2 years) (n = 29) than patients with no recurrence in the same time period (n = 21). [score:3]
In addition, EZH2 was predicted to be a potential target of miR-214 by RNAhybrid [19]. [score:3]
Hence, restoration the expression of miR-214 in HCC can be explored as an alternative therapeutic strategy against HCC. [score:3]
It can be demonstrated by flow cytometric analysis that silencing of miR-214 or functional overexpressing EZH2 induced an enrichment of EpCAM [+] HCC cells and suggesting that miR-214 can modulate EpCAM [+] stem-like cells by activating the β-catenin pathway. [score:3]
Figure S2 Expression of miR-214 in transfected or stable cells. [score:3]
To corroborate the role of EZH2 and CTNNB1 in miR-214 -mediated tumor cell invasion, we rescued the expression of EZH2 and CTNNB1 in miR-214 stable transfected HLE cells by transfecting a plasmid carrying wild-type EZH2 (pLVTHM-EZH2) [16] or CTNNB1 (pCI-CTNNB1, Addgene) [20]. [score:3]
The cell invasion was partially rescued in miR-214 stable transfected HLE cells by reexpression of EZH2 or CTNNB1 (Figure S4). [score:3]
The transfection efficiency and overexpression effects of miR-214 were shown in Figure S2. [score:3]
0044206.g002 Figure 2(A) The expression of miR-214 in liver tumor cell lines was significantly lower than in the normal liver tissues (NN1 and NN2) (* P<0.05). [score:3]
The expression of miR-214 was confirmed by real-time qRT-PCR, as described above. [score:3]
The level of expression of miR-214 was analyzed by qRT-PCR and normalized to U6. [score:3]
In order to elucidate the molecular roles of miR-214 in HCC, we have identified its potential molecular targets using computational algorithms. [score:3]
Studies have also reported that miR-214 contributes to the progression and metastasis of melanoma through the suppression of TFAP2C [33], [34]. [score:3]
0044206.g003 Figure 3(A and B) Growth of HLE (A) and SK-HEP-1 (B) cells in vitro at different time points following the re -expression of miR-214 mediated by transfection with P-miR-214, * P<0.05. [score:3]
The 3′-UTR sequence of EZH2 and CTNNB1 predicted to interact with miR-214 or a mutated sequence within the predicted target sites was synthesized and inserted into the XbaI and FseI sites of the pGL3 control vector (Promega, Madison, WI) (Figure S3). [score:3]
Next, we studied the expression of miR-214 in a panel of human liver cancer cell lines including HepG2, Hep3B, Huh-7, PLC/PRF/5, MHCC97-L, HCCLM3, MHCC97-H, SK-HEP-1, HLE, SNU-449 and SNU-475. [score:3]
Previous study has shown that the polycomb protein EZH2 was regulated by miR-214 in skeletal muscle and embryonic stem cells [18]. [score:2]
Figure S1 Expression of miR-214 in 20 paired of HCC tumor tissues was significantly lower compared to 20 matched histologically normal tissues (P <0.01). [score:2]
MiR-214 inhibits the invasion of HCC cells. [score:2]
Besides HCC, miR-214 has also been shown to be deregulated in human ovarian, cervical, and breast cancers [29], [30], [31], [32]. [score:2]
Figure S3 (A) The modified pLL3.7 plasmid structure and the insert sequence of hsa-miR-214. [score:1]
A fragment containing human miR-214 was PCR-amplified from normal genomic DNA and subcloned into the pLL3.7 vector to get pLL3.7-Pre-miR-214 (P-miR-214) (Figure S3). [score:1]
Multivariate Cox regression analysis indicated that tumor recurrence, low-level of miR-214 and CDH1, and high-level of EZH2 and CTNNB1 were prognostic factors for early HCC recurrence and poor survival (Table S2). [score:1]
Silencing of miR-214 Increase EpCAM [+] Stem-like Cell Population by Activating β-catenin PathwayPrevious studies have implicated that epithelial cell adhesion molecule (EpCAM) is an biomarker of HCC tumor-initiating cells with stem/progenitor cell features and EpCAM [+] HCC cells were correlated with tumor progression and invasiveness [25]. [score:1]
The stable HLE cells was transfected with anti-miR-214 construct (miRZip-214; System Biosciences, Mountain View, CA) or pLVTHM-EZH2 [16]. [score:1]
The 3′-UTR sequence of EZH2 and CTNNB1 predicted to interact with miR-214 were synthesized and inserted into the XbaI and FseI sites of the pGL3 control vector (Promega, Madison, WI). [score:1]
These results suggest that miR-214 can modulate EpCAM [+] stem-like cells by activating the β-catenin pathway in HCC cells. [score:1]
Both HLE and SK-HEP-1 cells were either transfected with the pLL3.7-Pre-miR-214 (P-miR-214) or pLL3.7-control vector (P-miR-control) using the GenJet™ Plus DNA in vitro transfection reagent (SignaGen, MD). [score:1]
The cells were either transfected with pLL3.7-Pre-miR-214 (P-miR-214) or pLL3.7-miR-control (P-miR-control) vectors using the GenJet™ Plus DNA in vitro tranfection reagent (SignaGen, MD), according to manufacturer’s instructions. [score:1]
0044206.g006 Figure 6Further silencing of miR-214 in HLE cells with miRZip-214 increases EpCAM [+] stem-like cell population by activating the β-catenin pathway. [score:1]
Silencing of miR-214 Increase EpCAM [+] Stem-like Cell Population by Activating β-catenin Pathway. [score:1]
Further silencing of miR-214 in HLE cells with miRZip-214 increases EpCAM [+] stem-like cell population by activating the β-catenin pathway. [score:1]
[1 to 20 of 94 sentences]
5
[+] score: 387
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2
E2F2, CDK3 and CDK6 were each directly targeted for inhibition by miR-214, and restoring their expression reversed miR-214 inhibition of cell-cycle progression. [score:10]
Furthermore, the inhibition effect of miR-214 on E2F2, cyclin -dependent kinase (CDK) 3 and CDK6 expression was assessed in HCC cell lines with miR-214 mimics/inhibitors to increase/decrease miR-214 expression. [score:9]
As shown in Figure 4B, western blot confirmed that miR-214 mimics suppressed protein expression of E2F2, CDK3, and CDK6, while anti-miR-214 upregulated these genes protein expression, as compared with corresponding control cells. [score:9]
These in vivo data strongly supported the notion that miR-214 functions biologically as a cell-cycle inhibitor and tumor suppressor, and that downregulation of miR-214 contributes to the development and progression of HCC tumors. [score:9]
By conducting the current study, we have provided compelling biologic as well as clinical evidence that miR-214/199a/199a* expression is markedly downregulated in HCC, consistent with previous observations from profiling of miRNAs expression in HCC. [score:8]
Moreover, miR-214 down-regulation correlates with poor prognosis of patients with HCC, suggesting that miR-214 might act as a tumor-suppressor miRNA in the development and progression of HCC. [score:7]
Overexpression of miR-214 suppressed HCC cell proliferation by inhibiting the G1–S transition. [score:7]
The results showed that restoration of E2F2, CDK3, or CDK6 significantly rescued the G1-S transition impaired by miR-214 (Figure 4F), suggesting that downregulation of E2F2, CDK3, and CDK6 is functionally important for the inhibitory effect of miR-214 on HCC cell proliferation. [score:6]
miR-214 suppresses expression of cell-cycle regulators CDK3, CDK6 and E2F2. [score:6]
In particular, miR-214 down-regulation was associated with ER stress [24] and its enforced or inhibited expression was investigated in “ in vivo” and “ in vitro” mo dels [25]. [score:6]
And that miR-214 alone acts to suppress the proliferation of HCC cells both in vitro and in vivo through direct manipulation of cell cycle regulatory proteins. [score:5]
Overexpression of miR-214 in HCC cells inhibited proliferation by inducing G1-S checkpoint arrest. [score:5]
The relationship between expression of miR-214 and its targets was confirmed in HCC tumor xenografts and clinical specimens. [score:5]
Consistently, phosphorylation of Rb was found to be decreased in miR-214–overexpressing cells but increased in the miR-214 -inhibited cells. [score:5]
All HCC patients were divided into 2 groups based on miR-214/199a/199a* expression level, namely, the low or high expression group (less or more than the mean value), for clinical survival analysis. [score:5]
To this end, our studies have found that miR-214 expression correlates with the clinical pathologic features and patient survival in HCC makes it a reasonable candidate biomarker for the determination of disease prognosis. [score:5]
To explore the effect of miR-214 on cell growth, two HCC cell lines with moderate levels of miR-214 expression were forced to stably overexpress miR-214 to generate Hep3B-miR-214 and QGY-7703-miR-214 cell lines respectively. [score:5]
Furthermore, we found that miR-214 mimicking oligonucleotides dose -dependently abrogated the expression of luciferase activity of pGL3-E2F2, CDK3, CDK6-3′-UTR in HCC cells, and such suppressive effects could be reversed by anti-miR-214 oligonucleotides (Figure 4C–4E). [score:5]
Thus, our data suggests that miR-214 inhibits the G1–S transition of cell-cycle progression and consequently inhibited the proliferation of HCC cells. [score:5]
Overexpression of miR-214 inhibited cell proliferation and arrested cell cycle in HCC cells. [score:5]
Experimental overexpression of miR-214 in HCC cells leads to suppression of E2F2, CDK3, and CDK6, cell-cycle arrest at the G1–S checkpoint, and disrupted proliferation of the cancer cells. [score:5]
These data suggest that the inhibitory effect of miR-214 on its targets E2F2, CDK3, and CDK6, is clinically relevant in human HCC. [score:5]
Collectively, our antagonism experiments indicated that endogenous miR-214 might function as a cell-cycle suppressor, capable of abrogating the entry of HCC cells into the S-phase and thus suppressing cell proliferation. [score:5]
The current study has demonstrated that miR-214 is a new tumor-suppressive miRNA in HCC that targets multiple cell-cycle stimulated gene (E2F2, CDK3, and CDK6) promoters. [score:5]
Clinical relevance of miR-214 expression and E2F2, CDK3, and CDK6 expression in human HCC tissues. [score:5]
Our results demonstrate that miR-214 has tumor-suppressive activity in HCC through inhibition of E2F2, CDK3 and CDK6. [score:5]
miR-214 directly inhibited E2F2, CDK3, and CDK6 cell-cycle regulators. [score:5]
By analyzing published miRNA expression profiles obtained from 96 primary HCC tissues and adjacent non-tumor tissues (NCBI/GEO/GSE22058), miR-214/199a/199a* was identified to be significantly downregulated in HCC tissues compared with adjacent non-tumor tissues (Figure 1A). [score:5]
Likewise, suppress miR-214 either alone or in association with E2F2, CDK3, and CDK6 in HCC cell lines, the growth promoting effects resulting from miR-214 inactivation can be blunted by concomitant suppression of E2F2, CDK3, and CDK6. [score:5]
Taken all together, these results suggested that overexpression of miR-214 suppressed the proliferation ability of HCC in vitro. [score:5]
Immunohistochemistry and also consistently showed that the expression of E2F2, CDK3, and CDK6 in miR-214 -overexpressing cell-line tumor mo dels were lower than those in the vector-control tumors (Figure 6E). [score:5]
Thus, low miR-214 expression seems to be a risk factor predicting poor survival (Table 3), suggesting that lower expression of miR-214 contributes to HCC pathogenesis and might represent a prognostic biomarker for human HCC. [score:5]
Figure 1 (A) expression profiling of miRNAs in 96 primary HCC tissues and 96 adjacent non-tumor tissues (NCBI/GEO/GSE22058) (B) miR-214/199a/199a* expression was analyzed in immortalized human hepatocyte epithelial cell line THLE3, and indicated human HCC cell lines using qRT-PCR. [score:5]
To elucidate the mechanism underlying the strong suppressive effect of miR-214 on HCC cell proliferation, we further evaluated the predicted target genes of miR-214 using Target Scan and studied the 3 genes (Figure 4A). [score:5]
Notably, higher miR-214 expression, as well as the other members of the cluster miR-199a/199a*, is significantly associated with improved survival in patients with HCC, further suggesting a tumor-suppressive function of the molecule. [score:5]
Patients with lower miR-214/199a/199a* expression had a shorter survival time, whereas patients with higher miR-214/199a/199a* expression had a longer survival time (P < 0.001; Figure 1D–1F). [score:5]
miR-214 was also found significantly reduced in HCC tissues consistent down-regulation of both miR-199a and miR-199a*. [score:4]
Notably, miR-214 was of particular interest as our informatics analysis predicted potential binding sites for miR-214 in the 3-untranslated regions (3′-UTR) of E2F2, CDK3, and CDK6, 3 key regulators of the cell cycle. [score:4]
Clinical relevance of miR-214 downregulation in human HCC. [score:4]
In rhabdomyosarcoma, miR-214 regulatory loop suppresses cell growth and xenograft tumorigenesis [23]. [score:4]
To understand the role of endogenous miR-214 in the regulation of cell proliferation, anti-miR-214 oligonucleotides were used to silence endogenous miR-214 expression. [score:4]
To evaluate whether downregulation of miR-214/199a/199a* correlates with clinical HCC progression, we examined miR-214/199a/199a* expression in 135 archived human HCC specimens. [score:4]
Since the main cause of HCC is HBV infection, it would be of great interest to further investigate whether miR-214 downregulation in HCC can be attributed to HBV inhibition with human hepatocytes. [score:4]
miR-214 deregulated expression was assessed as a contributor to tumor angiogenesis [26], invasion and early recurrence in HCC patients [27– 29]. [score:4]
While miR-214 was down-regulated in HCC serum as same as in HCC tissue. [score:4]
Our current study has identified three central cell-cycle regulators, namely, E2F2, CDK3, and CDK6, as targets of miR-214. [score:4]
Downregulation of miR-214/199a/199a* in HCC is correlated with poor patient survival. [score:4]
The role of miR-214 in regulating HCC cell proliferation was studied with miR-214 mimics/inhibitor -treated cells. [score:4]
In chronic lymphocytic leukemia, miR-214 can negatively regulate the expression of PTEN [22]. [score:4]
miR-214 has been shown to have tumor-suppressive effects in other human cancers. [score:3]
We reintroduced open reading frames (ORF) of the 3 genes into miR-214 -overexpressing cells and assessed their cell-cycle distribution. [score:3]
Thus, it remains important to thoroughly understand the molecular mechanisms mediating the differential biologic effects and targets of miR-214 in HCC and other cancer types. [score:3]
In analyzing HCC clinical specimens and cell lines, we discovered a uniform decrease in miR-214/199a/199a* expression in comparison with noncancerous tissue or normal liver epithelial cell lines. [score:3]
These results confirm the important role of miR-214 in the cluster as a tumor-suppressive miRNA in HCC. [score:3]
miR-214 inhibited tumor growth of HCC cell xenografts in vivo. [score:3]
Each experimental mouse was subcutaneously injected with miR-214 -overexpressing or control HCC cells, on the right- or left-side dorsal thigh. [score:3]
miR-214 inhibits HCC tumor growth in vivoConsidering the important role of miR-214 in HCC cell cycle and proliferation in vitro, we addressed the question of whether the miRNA acted as an endogenous antitumor factor in vivo. [score:3]
Figure 6miR-214 inhibited tumor growth of HCC cell xenografts in vivo (A) QGY-7703/vector-luc cells and QGY-7703/miR-214-luc cells were injected into the groins of mice, and tumor growth of the indicated cells was monitored weekly by in vivo bioluminescence imaging. [score:3]
Reduced expression of miR-214/199a/199a* correlates with HCC progression and poor prognosis. [score:3]
Direct binding of miR-214 to the 3′-untranslated regions of E2F2, CDK3, and CDK6 was verified by dual-luciferase reporter assay. [score:3]
In addition, the growth promoting effects resulting from mir-214 inactivation can be blunted by concomitant suppression of E2F2, CDK3, and CDK6 (Figure 5C and 5D). [score:3]
Univariate and multivariate analyses revealed that clinical stage and miR-214 expression were each recognized as independent prognostic factors in HCC (Table 2). [score:3]
Importantly, miR-214 expression in HCC cells is markedly reduced, resulting in unrestricted cell-cycle progression and consequently increased cell proliferation. [score:3]
Hep3B and QGY-7703 cells were treated with miR214 inhibitor and then transfected with indicated siRNAs. [score:3]
Collectively, these results indicate that miR-214/199a/199a* expression is reduced in HCC. [score:3]
All the evidence proved miR-214 had a significant role in HCC metastasis and angiogenesis, however, the mechanism of cell cycle inhibition reported in these studies is not clearly identified. [score:3]
miR-214/199a/199a* had significantly different expression levels between the HCC and control cirrhosis groups (data not show). [score:3]
Suppression of E2F2, CDK3, and CDK6 was functionally important for the biological effects of miR-214. [score:3]
However, mutating 4 nucleotides in the seed sequence of miR-214 completely abolished their binding to the target 3′-UTRs. [score:3]
In this study, we show that miR-214 causes cell-cycle arrest by inhibiting E2F2, CDK3, and CDK6. [score:3]
Hence, identification of miR-214 as an efficient suppressor of E2F2, CDK3, and CDK6 provides new insights in our quest to develop more efficient approaches to treating HCC. [score:3]
Kaplan–Meier correlation analysis between miR-214 (D) miR-199a* (E) and miR-199a (F) levels and overall survival of patients with HCC with high and low miR-214 expression. [score:3]
To verify whether the biological effects of miR-214 on HCC cell proliferation were the same in clinical samples, we examined the correlation of miR-214 expression with the protein levels of E2F2, CDK3, and CDK6 in clinical specimens of HCC paired with adjacent noncancerous tissues. [score:3]
As shown in Figure 2D, both miR-214–overexpressing Hep3B and QGY-7703 cells displayed a remarkable increase in the percentages of cells in G1-phase but decreased proportions of S-phase cells. [score:3]
miR-214 inhibits HCC tumor growth in vivo. [score:3]
Importantly, statistical analyses revealed that miR-214 expression inversely correlated with TNM classification (P = 0.019) in patients with HCC (Table 1). [score:3]
The sizes and weights of dissected tumors at the end of experiment also confirmed the growth inhibitory effect of miR-214 (Figure 6C and 6D). [score:3]
Furthermore, our animal experiments and studies using clinical samples showed an inverse correlation between miR-214 levels and expression of E2F2, CDK3, and CDK6, as well as tumor progression. [score:3]
As shown in Figure 7A, significantly lower expression of miR-214 was found in the HCC lesions, in conjunction with elevated levels of E2F2, CDK3, and CDK6. [score:3]
Furthermore, real-time PCR analysis revealed that miR-214/199a/199a* was downregulated in all 14 tested HCC cell lines compared with the immortalized normal liver epithelial cell line THLE3 (Figure 1B) and in 8 HCC samples compared with the matched adjacent nontumor tissues (Figure 1C). [score:2]
We used qRT-PCR assay to confirm the expression of miR-214/199a/199a* that were selected from the previous step from an independent cohort of 16 serum samples which including 8 HBV related cirrhosis and 8 HCC. [score:2]
Furthermore, the colony forming capabilities of both cell lines were robustly suppressed by miR-214 transduction as compared with corresponding control cells (Figure 2B). [score:2]
On the other hand, the mechanism by which miR-214 is down-regulated in HCC remains uninvestigated. [score:2]
Taken together, we concluded that miR-214 was able to directly bind the 3′-UTRs of E2F2, CDK3, and CDK6. [score:2]
The expression levels of miR-214/199a/199a* were quantified with the miRNA-specific TaqMan miRNA Assay Kit (Applied Biosystems). [score:2]
To understand the underlying mechanism of the alterations in cell proliferation caused by miR-214, fluorescence-activated cell sorting (FACS) was used to analyze the changes of DNA content throughout various phases of the cell cycle. [score:1]
Spearman analysis of correlation between miR-214 and clinicopathological factors. [score:1]
Correlation between miR-214 expression and clinicopathologic characteristics of liver cancer patients. [score:1]
Considering the important role of miR-214 in HCC cell cycle and proliferation in vitro, we addressed the question of whether the miRNA acted as an endogenous antitumor factor in vivo. [score:1]
Figure 4 (A) Predicted binding of miR-214 to 3-UTRs of E2F2, CDK3, and CDK6. [score:1]
These results demonstrated that E2F2, CDK3, and CDK6 were functionally important for miR-214 -induced cell proliferation in HCC cell lines. [score:1]
Conversely, RNA interference–mediated silencing of miR-214 promoted cell-cycle progression and accelerated the proliferation of HCC cells. [score:1]
Clinicopathological characteristics of clinical samples and expression of miR-214/199a/199a* in liver cancer. [score:1]
Higher miR-214 levels were related with improved patient survival. [score:1]
The X [2] test was used to analyze the relationship between miR-214 expression and clinicopathologic characteristics. [score:1]
A DNA fragment containing the hsa-miR-214 precursor with 300 bp flanking sequence of each side was amplified into retroviral transfer plasmid pMSCV-puro (Clontech, Palo Alto, CA). [score:1]
Antagonism of miR-214 accelerated proliferation of HCC cells by promoting cell-cycle progression. [score:1]
By measuring the bioluminescence signal through quantifying the mean photon radiance, the miR-214 -overexpressing QGY-7703 cells were found to exhibit a lower intensity of emanated bioluminescence than the control group cells after the first week, and the difference continued to be significant through the experimental endpoint (Figure 6A and 6B). [score:1]
E2F2, CDK3, and CDK6 are functionally involved in miR-214–induced proliferation of HCC cell lines. [score:1]
Kaplan-Meier and Cox proportional regression analyses were used to determine the association of miR-214/199a/199a* cluster levels with the survival of HCC patients. [score:1]
In parallel, antagonizing miR-214 significantly decreased the proportion of G1-phase HCC cells but increased the percentages of cells in the S-phase (Figure 3D). [score:1]
Next, using the DIANA-mirPath program, we investigated the mechanism by which miR-214/199a/199a* activates hepatitis B signaling, pathways in cancer and cell cycle, and found that 3 central cell-cycle promoting genes, E2F2, CDK3 and CDK6 was strikingly enriched in these predicted targets pathway. [score:1]
As shown in Figure 2A, an MTT cell viability assay indicted that overexpression of miR-214 significantly slowed down growth of both Hep3B and QGY-7703 cells compared with their corresponding controls. [score:1]
Based on the important role of E2F2, CDK3, and CDK6 in cell cycle progression, the effect of miR-214 on the cell-cycle was analyzed by flow cytometry. [score:1]
To identify the clinical and functional association of miR-214/199a/199a* cluster in human hepatocellular carcinoma (HCC) and to clarify the mechanism of miR-214. [score:1]
miR-214 mimics, anti-miR-214 oligonucleotides and their relative control oligonucleotides were purchased from Invitrogen. [score:1]
To explore the functional significance of E2F2, CDK3, and CDK6 in the proliferation of HCC cell lines and cell cycle activation induced by miR-214, we studied the effects of their depletion using specific siRNAs. [score:1]
We wonder what is the role of miR-214 in the cluster in HCC. [score:1]
Our study proved that miR-214, as a member of the miR-214/199a/199a* cluster, had important effect on HCC prognosis. [score:1]
miR-214 was recently reported to promote hepatic fibrosis [30]. [score:1]
Antagonizing miR-214 accelerated HCC cell proliferation. [score:1]
[1 to 20 of 111 sentences]
6
[+] score: 371
As expected, expression of Cyclin E1, a downstream target of c-MYC, was also downregulated by sulforaphane and partially rescued by miR-214 inhibitor (Figure 3A). [score:10]
E. Either SFN or miR-214 downregulated expression of the EGFP-c- MYC-Flag fusion protein whereas inhibition of miR-214 partially rescued the suppressive effect of SFN as detected by Western blot analyses with either Flag or c-MYC antibody. [score:10]
Figure 1 c-MYC is a direct target of miR-214 A. SFN downregulated the expression of c-MYC. [score:9]
In the present study, we show that SFN potently inhibited c-MYC expression through upregulating miR-214. [score:8]
Figure 2SFN negatively regulates the expression of c-MYC through miR-214 A. miR-214 suppressed exogenously expressed 3'UTR-less c-MYC in NIH3T3 and H460 cells. [score:8]
SFN exerted these functions through upregulation of miR-214 expression, which in turn targeted c-MYC, β-cantenin, and EZH2. [score:8]
SFN negatively regulates the expression of c-MYC through miR-214Since miR-214 targets c-MYC potentially at its CDS instead of its 3'UTR, we examined if miR-214 represses exogenously expressed 3'UTR-less c-MYC. [score:8]
In this regard, direct and indirect inhibition of c-MYC can be considered as a crucial function of miR-214 as a tumor suppressing regulator in NSCLC cells. [score:7]
Since c-MYC is a known target of β-catenin [43], thus in addition to direct regulation by miR-214, c-MYC can be indirectly regulated by miR-214 through β-catenin. [score:7]
Compared with control group, miR-214 mimic markedly suppressed the luciferase activity of psi- c-MYC-CDS whereas miR-214 inhibitor upregulated its activity. [score:7]
G. Fluorescence microscopic examination of EGFP expression showed that SFN or miR-214 repressed the fusion protein and the inhibitory effect of SFN was partially rescued by inhibiting miR-214. [score:7]
Taken together, these results strongly suggested that SFN represses c-MYC expression through upregulating miR-214. [score:6]
c-MYC is an authentic target of miR-214We next performed luciferase reporter assays to determine whether miR-214 could inhibit activity of the luciferase reporter gene by binding to the predicted target sites. [score:6]
We found that EZH2 was upregulated following mir-214 inhibition in H460 cells, in agreement with previous reports. [score:6]
Comparison of the miRNA expression profiles between the control and SFN treated samples revealed a number of miRNA including miR-214, miR-145, miR-199a, and miR-199b that were significantly upregulated in SFN -treated H460 cells and were reported to be involved in tumorigenesis and progression (Supplementary Figure 3A & 3B). [score:6]
We next examined whether inhibition of miR-214 could rescue SFN -induced downregulation of endogenous c-MYC protein. [score:6]
We further showed that EZH2 level was downregulated by SFN and this effect was partially blocked by co-treatment with miR-214 inhibitor. [score:6]
B. Doxorubicin -induced c-MYC protein expression was also suppressed by SFN or miR-214. [score:5]
Figure 4 A. Treatment with cisplatin boosted c-MYC protein expression that was suppressed by either SFN or miR-214. [score:5]
Expression levels of c-MYC, β-catenin, Cyclin E, EZH2, and Survivin were increased by miR-214 inhibitor and reduced by sulforaphane treatment. [score:5]
B. SFN suppressed luciferase activities of psi-c-MYC-CDS (left panel) and psi-CTNNB1-3'UTR (right panel) in H460 cells and these effects were rescued by inhibiting miR-214. [score:5]
A. miR-214 suppressed exogenously expressed 3'UTR-less c-MYC in NIH3T3 and H460 cells. [score:5]
A. Treatment with cisplatin boosted c-MYC protein expression that was suppressed by either SFN or miR-214. [score:5]
Since miR-214 targets c-MYC potentially at its CDS instead of its 3'UTR, we examined if miR-214 represses exogenously expressed 3'UTR-less c-MYC. [score:5]
miR-214 mimic markedly suppressed luciferase activity and miR-214 inhibitor elevated luciferase activity. [score:5]
Importantly, inhibition of miR-214 partially rescued the suppressive effects induced by SFN (Figure 2E). [score:5]
This finding was substantiated by our observations that plasmid or lentiviral vector -mediated expression of 3'UTR-less c-MYC cDNA and chemotherapeutic drug cisplatin- or doxorubicin -induced endogenous c-MYC accumulation was also suppressed by either SFN or miR-214. [score:5]
The results showed that luciferase activity of psiCHECK2 vector containing the target sequence of CTNNB1-3'UTR (psi-CTNNB1-3'UTR WT) was significantly decreased by miR-214 mimic and increased by miR-214 inhibitor. [score:5]
Suppressive effects of SFN were attenuated by miR-214 inhibitor. [score:5]
Strikingly, these inhibitory effects of SFN were totally blocked in the presence of miR-214 inhibitor, indicating that miR-214 mediates the repressing effect of SFN on β-catenin. [score:5]
Effects of miR-214 on regulation of endogenous c-MYC protein were examined in H460 cells transfected with miR-214 mimic or inhibitor. [score:4]
E. miR-214 downregulated endogenous c-MYC and β-catenin protein levels. [score:4]
In view of recent finding that c-MYC is a crucial regulator of CSCs [13] and chemoresistance [28] in various malignancies, we examined the biological consequences of SFN/miR-214 -mediated inhibition c-MYC in NSCLC. [score:4]
F. Inhibitory effects of either SFN or miR-214 on the fusion protein were abolished when pEGFP-c-MYC-Flag was replaced with pEGFP-c-MYC-Flag Mut, which harbors the mutations of miR-214 binding sites. [score:4]
Interestingly, a recent study found that the β-catenin gene CTNNB1 is a direct target of miR-214 in human hepatocellular carcinoma [25]. [score:4]
These results indicate that miR-214 directly binds to the two predicted target sites. [score:4]
Similarly, we showed that Survivin was downregulated by SFN/miR-214 signaling. [score:4]
Taken together, these results strongly suggested that c-MYC is a direct target of miR-214. [score:4]
We next performed luciferase reporter assays to determine whether miR-214 could inhibit activity of the luciferase reporter gene by binding to the predicted target sites. [score:4]
SFN negatively regulates the expression of c-MYC through miR-214. [score:4]
In the present study, we provided strong evidences demonstrating that SFN, a natural compound derived from broccoli and other cruciferous vegetables, upregulated miR-214 that, in turn, repressed c-MYC by binding to its CDS. [score:4]
SFN/miR-214 signaling downregulates multiple oncoproteins. [score:4]
c-MYC is a direct target of miR-214. [score:4]
We found that either SFN or miR-214 repressed expression of the fusion protein detected by antibody against either Flag or c-MYC. [score:3]
SFN/miR-214 inhibited CSC properties and enhanced chemotherapeutic drug -induced cytotoxicity. [score:3]
For this purpose, a luciferase reporter vector psiCHECK2 containing the full length c-MYC CDS was constructed (named psi- c-MYC-CDS) and co -transfected into 293T cells together with a negative control (NC) irrelevant miRNA -mimic, miR-214 -mimic, or miR-214 inhibitor. [score:3]
Apoptosis-inducing effect of SFN was diminished by miR-214 inhibitor while the effect of cisplatin was enhanced by c-MYC siRNA, respectively (Figure 5C). [score:3]
A. H460 cells were treated with SFN, miR-214 inhibitor, or both of them for 48 hours. [score:3]
The results showed that luciferase activity of psi-c-MYC-CDS was reduced by SFN and this effect is attenuated by miR-214 inhibitor (Figure 3B, left panel). [score:3]
H. SFN and miR-214 did not affect the expression of EGFP encoded by pEGFP-c-MYC-Flag Mut. [score:3]
293T cells were co -transfected with pEGFP-c-MYC-Flag plus NC -mimic, miR-214 mimic, or treated with SFN in the absence of presence of miR-214 inhibitor. [score:3]
The oncogene Survivin is another target of miR-214 [27]. [score:3]
If miR-214 targets c-MYC at its CDS, we expect to see an obvious decrease in the c-MYC level after co-transfection with lv-ef1a-c-MYC and miR-214 mimic. [score:3]
Our results showed that treatment with either cisplatin or doxorubicin stimulated c-MYC accumulation that was effectively repressed by co-treatment with SFN or by ectopic expression of miR-214. [score:3]
On the other hand, when pEGFP-c-MYC-Flag was replaced with pEGFP-c-MYC-Flag Mut that harbors mutant miR-214 binding sites, neither SFN nor miR-214 affected expression of the fusion protein (Figure 2F). [score:3]
Sulforaphane or miR-214 suppressed cisplatin-enriched ALDH+ population. [score:3]
The effect of SFN was attenuated by miR-214 inhibitor while cisplatin sensitivity was enhanced by c-MYC siRNA (Figure 5B). [score:3]
H460 cells were treated with SFN, miR-214 inhibitor, or both for 48 hours. [score:3]
Similarly, either SFN or miR-214 repressed doxorubicin -induced c-MYC expression (Figure 4B). [score:3]
D. Sulforaphane or miR-214 suppressed cisplatin-enriched CD133+ population. [score:3]
Importantly, repressive effect of SFN on cell viability was substantially compromised in the presence of miR-214 inhibitor, suggesting that function of SFN is mediated by miR-214. [score:3]
c-MYC is an authentic target of miR-214. [score:3]
The oligonucleotide primers were designed to introduce the mutations of miR-214 target sites without affecting amino acid sequences. [score:3]
It has been reported that the enhancer of zeste homologue 2 gene (Ezh2) was targeted by miR-214 in mouse skeletal muscle and embryonic stem cells [26] and in human hepatocellular carcinoma [25]. [score:3]
We next examined the role of SFN/miR-214/c-MYC signaling in tumor spheroid formation and CD133 surface marker expression that are surrogates for CSCs of NSCLC [23, 29]. [score:3]
Western blot analyses showed that c-MYC protein was reduced by miR-214 mimic and elevated by miR-214 inhibitor (Figure 1E). [score:3]
Expression of PTEN was unaffected by miR-214. [score:3]
To further validate that c-MYC is an authentic target of miR-214, we subcloned the full length c-MYC coding region cDNA, again devoid of its 3'UTR, and a Flag epitope tag sequence into the pEGFP-C1 vector to create pEGFP-c-MYC-Flag that encodes an EGFP-c-MYC-Flag fusion protein (Figure 2B). [score:3]
To test this, luciferase reporter assay was performed to determine whether miR-214 could directly target the 3'UTR of CTNNB1. [score:3]
Further, cisplatin -induced c-MYC accumulation was potently suppressed by co-treatment with either SFN or miR-214. [score:3]
Intriguingly, the effect of SFN on repressing c-MYC was severely compromised in the presence of miR-214 inhibitor (Figure 3A). [score:3]
Similar effects of SFN and miR-214 on the EGFP-c-MYC-Flag fusion protein were also revealed by fluorescence microscopic examination of EGFP expression (Figure 2G & 2H). [score:3]
The miR-214 mimic, negative control, and miR-214 inhibitor were purchased from GenePharma (Suzhou, China). [score:3]
Figure 3 A. H460 cells were treated with SFN, miR-214 inhibitor, or both of them for 48 hours. [score:3]
Similar to c-MYC, β-catenin was reduced by miR- 214 mimic and elevated by miR-214 inhibitor (Figure 1E). [score:3]
Cells were co -transfected with a luciferase reporter containing the full length c-MYC CDS (psi-c-MYC-CDS) with NC -mimic control, miR-214 mimic, or miR-214 inhibitor. [score:3]
SFN/miR-214 signaling inhibits multiple oncoproteins. [score:3]
Here we demonstrated that similar to c-MYC, β-catenin is also regulated by SFN via miR-214 in NSCLC cells. [score:2]
These luciferase reporters were then individually co -transfected into 293T cells with miR-214 inhibitor followed by luciferase assays. [score:2]
In view of the fact that c-MYC is a crucial regulator of CSCs [13] and SFN possesses the capability in suppressing CSCs in pancreatic [4] and breast [5] cancers, we investigated functional impact of the SFN/miR-214/c-MYC pathway on CSCs in NSCLC. [score:2]
Compared with the control group, the levels of c-MYC were increased by miR-214 inhibitor and reduced following SFN treatment. [score:2]
To confirm that miR-214 directly interacts with these two binding sites, double-stranded oligonucleotides of approximate 60bp containing the wild-type or mutated binding sites were synthesized, inserted into the psiCHECK2 vector, and named psi-1405 WT, psi-1405 Mut, psi-1683 WT and psi-1683 Mut, respectively. [score:2]
Based on these observations, we presume that regulation of β-catenin by SFN is also mediated by miR-214 in NSCLC cells. [score:2]
SFN/miR-214/c-MYC pathway regulates CSCs in NSCLC. [score:2]
H460 cells were treated with cisplatin (5 μmol/L), cisplatin (5 μmol/L) plus sulforaphane (10 μmol/L), or cisplatin (5 μmol/L) plus miR-214 mimic for 48 hours and subjected to flow cytometric analysis with a CD133 antibody. [score:1]
Next, we evaluated whether inhibition of miR-214 could rescue the SFN -induced repression of the c-MYC fusion protein. [score:1]
To generate the psi-1405 WT, psi-1405 Mut, psi-1683 WT and psi-1683 Mut luciferase reporters, double-strand oligonucleotides containing the wild-type or mutant miR-214 binding sites were synthesized and cloned into the Xho I and Pme I sites of the psiCHECK-2 dual luciferase reporter. [score:1]
B. Computational analyses with RNA22 and RNAhybrid algorithms predicted two miR-214 binding sites within the c-MYC CDS. [score:1]
To this end, we firstly examined capabilities of SFN and miR-214 in modulation of c-MYC accumulation in response to cisplatin, which is a commonly prescribed chemotherapeutic drug for patients with lung cancer and is capable of inducing CSC phenotypes in NSCLCs [23]. [score:1]
C. Cisplatin increases the formation of tumor spheroids, while combination of cisplatin with SFN or miR-214 decreased tumor spheroid formation. [score:1]
Similar to CD133+, ALDH+ population enriched by cisplatin was reduced by either SFN or miR-214. [score:1]
However, the effect of cisplatin was totally blocked by SFN and partially reversed by miR-214. [score:1]
Based on RNA22 and RNAhybrid algorithms, two potential miR-214 binding sites were identified at nucleotide1405 and 1683 of the c-MYC CDS (Figure 1B). [score:1]
Sequence alignments of miR-214 and the c-MYC are shown. [score:1]
D. H460 cells were co -transfected with a luciferase reporter containing a wild type or mutated miR-214 binding site (pWT1405, pMut1405, pWT1683, or pMut1683) together with NC or miR-214 mimic. [score:1]
Next, flow cytometric analysis with a CD133 antibody showed that CD133+ population was enriched by cisplatin and this effect was partially blocked by either SFN or miR-214 (Figure 4D). [score:1]
NIH3T3 and H460 cells were co -transfected with pLv-ef1a-c-MYC plus NC -mimic control or miR-214 mimic followed by Western blot analysis with c-MYC antibody. [score:1]
[1 to 20 of 97 sentences]
7
[+] score: 311
Also miR-214 exhibited a heterogeneous expression pattern, and analysis of serial sections indicated that Dio3 and miR-214 were co-expressed in cardiomyocytes, suggesting either that Dio3 and miR-214 are independently upregulated or that the expression of miR-214 and Dio3 expression is mechanistically linked. [score:12]
Having confirmed the suppressive effect of miR-214 on Dio3 expression, it was unexpected that the expression of miR-214 was increased in the post-MI mouse heart, given the marked upregulation of cardiac Dio3 activity in this mo del (8, 25). [score:10]
Our results show that Dio3 is a target of miR-214 and suggest that a negative feedback mechanism exists, in which the upregulation of miR-214 dampens the MI -induced upregulation of Dio3, limiting the reduction of cardiac T3 signaling. [score:9]
However, this miR-214-3p (hereafter referred to as miR-214) was upregulated in MI, implying suppression of Dio3 expression. [score:8]
This implies that expression of miR-214 is negatively regulated by T3, and this was confirmed by the finding that treatment of hypothyroid mice with T3 markedly suppressed miR-214 expression levels in the LV. [score:8]
Second, the results indicate a novel negative feedback mechanism regulating Dio3 expression in the post-MI mouse heart, in which a Dio3 -mediated decrease of T3 levels results in increased expression miR-214, which subsequently reduces Dio3 expression. [score:8]
The decreased level of T3 stimulates the expression of miR-214, which adds to the effects of other MI -induced regulatory pathways on miR-214 expression (the dotted arrow indicates that the relationship between T3 and miR-214 is inferred from indirect evidence). [score:7]
Upregulation of Hif-1α after MI is generally observed in the infarct or peri-infarct zone, but Hif-1α -dependent transcription activity was found in the remote LV at day 5 post-MI (Pol, unpublished results), which may contribute to miR-214 upregulation. [score:7]
To further explore the possible interaction between Dio3 and miR-214 expression, we analyzed miR-214 expression at 3, 5, 7, 14, 28, and 56 days post-MI surgery in the same set of LV samples that was previously used for analysis of Dio3 mRNA expression and Dio3 activity (8). [score:7]
Based on the finding that miR-214 targets Dio3, we expected cardiomyocytes expressing a high level of Dio3 protein to have a low expression level of miR-214, and vice versa. [score:7]
We show that Dio3 mRNA is a target of miR-214, and that this miRNA may play a role in a negative feedback mechanism regulating Dio3 expression in the post-MI heart, thereby limiting the decrease of cardiac T3 levels. [score:6]
In contrast to the apparently unfavorable effects of miR-214 in cardiac hypertrophy and heart failure, miR-214 has been shown to protect the heart from ischemic injury in a knock-out mo del, by suppressing the expression of the sodium calcium exchanger Ncx1 and consequently preventing Ca [2+] overload of cardiomyocytes and subsequent cell death (22). [score:6]
Upregulated expression of the highly conserved miR-214 in cardiac hypertrophy and heart failure has been demonstrated in several cardiac miRNA profiling studies in both human and experimental animal mo dels (21, 24– 26). [score:6]
The suggested regulation of miR-214 expression by increased Dio3 expression would most likely be mediated by a local reduction in T3 levels induced by Dio3. [score:6]
The observed 30% reduction of reporter expression is comparable to the in vitro effects of miR-199b and miR-214, targeting Dyrk1a and Ncx1, respectively, which have been shown to modify cardiac performance (22, 24). [score:5]
It has been shown that elevated expression levels of miR-214 induce hypertrophy (21, 27) by suppressing peroxisome proliferator-activated receptor δ (Pparδ) (27). [score:5]
We hypothesize that the documented local decrease of T3 levels stimulates the expression of miR-214, which dampens Dio3 expression. [score:5]
Increased miR-214 expression in turn decreases Dio3 expression, thereby dampening the reduction of T3 levels by Dio3. [score:5]
Total RNA isolated from the LV of hypothyroid (−T3) and hypothyroid mice treated with T3 for three days (+T3) was analyzed by qPCR for miR-214 expression using U6 snRNA as correction factor (A), and for Dio3 mRNA expression using Hprt as correction factor (B). [score:5]
In conclusion, this study first shows that miR-214 is able to target both the human and the mouse 3′UTR of DIO3, affecting mRNA and protein expression. [score:5]
These data indicate that the increase in Dio3 mRNA expression and Dio3 activity precede miR-214 induction, suggesting that any mechanistic link between the two involves an effect of Dio3 activity on the expression of miR-214. [score:5]
Our data suggest that in the post-MI heart, Dio3 expression may at least be additionally modulated by T3 via changes in miR-214 expression. [score:5]
Dio3 Expression Precedes miR-214 Expression in the Post-MI LV. [score:5]
Taken together, the result of the present study support the involvement of miR-214 in a negative feedback mechanism regulating Dio3 expression. [score:4]
Further research is needed to elucidate the mechanism of interaction of miR-214 in regulating DIO3 expression. [score:4]
Given the observed role of miR-214 in cardiac remo deling, we tested its possible relevance for the regulation of Dio3 expression. [score:4]
Here, we validated the increased expression level of miR-214 in the post-MI heart using quantitative RT PCR analysis with U6 snRNA as correction factor, showing a significant threefold increase in miR-214 expression in the LV tissue 7 days post-MI surgery compared to sham-operated mice (Figure 2). [score:4]
These findings suggest that reduced T3 levels may play a role in a negative feedback mechanism regulating Dio3 expression that involves miR-214. [score:4]
In silico analysis revealed that of all miRNAs that were shown to be differentially regulated in the post-MI mouse heart (25), miR-214 was predicted to have the highest potential to target Dio3. [score:4]
Furthermore, the expression of miR-214 expression reached a maximum level at day 7 post-MI, by which time the Dio3 mRNA and Dio3 activity levels appeared to go down, but still remained elevated compared to sham. [score:4]
However, the substantially greater relative reduction of DIO3 protein expression compared to the effect on the DIO3 mRNA level does suggest an additional effect of miR-214 on translation efficiency. [score:4]
T3 Decreases Cardiac miR-214 Expression. [score:3]
Therefore, we examined the effect of T3 on miR-214 expression in LV tissue of hypothyroid (−T3) and hypothyroid mice treated with T3 for 3 days (+T3) mice. [score:3]
These luciferase reporter experiments support the in silico prediction that binding of miR-214 to the Dio3 3′UTR results in repression of Dio3 protein expression. [score:3]
The indicated area shows a group of cardiomyocytes expressing both Dio3 protein and miR-214, with adjoining cells negative for both. [score:3]
The expression of miR-214 remained, however, unchanged up to at least 56 days post-MI. [score:3]
In silico analysis predicts a target sequence for miR-214 in the stem of SECIS element of the 3′UTR of Dio3 in mice, which is highly conserved among species. [score:3]
Left-ventricular samples from a previous study were used to assess miR-214 expression (30). [score:3]
Surprisingly, miR-214 in situ hybridization revealed a similar heterogeneous pattern, with the majority of miR-214 positive cardiomyocytes co -expressing Dio3 (Figure 5). [score:3]
Validation of Dio3 as a Target of miR-214. [score:3]
MiR-214 expression is likely to be regulated by other mechanisms associated with the remo deling process in addition to the decreased T3 levels. [score:3]
Dio3 and miR-214 Are Co-Expressed in Adult Cardiomyocytes. [score:3]
We hypothesized that interference of miR-214 with the SECIS element of DIO3 would result in increased levels of the truncated protein, and this was tested by analyzing the protein expression of full-length human DIO3 in COS-7 cells co -transfected with miR-214 using Ab 677 to detect the full-length 36 kDa DIO3 protein and Ab 675 to detect the 18 kDa truncated form of DIO3. [score:3]
Figure 3 Dio3 is targeted by miR-214. [score:3]
These data suggest a mechanistic link between miR-214 and Dio3 expression, which could involve the Dio3 -mediated reduction of cardiac T3 levels. [score:3]
Figure 1Conserved miR-214 target site in the 3′-UTR of Dio3. [score:3]
While Dio3 mRNA levels and Dio3 activity were already increased to high levels at days 3–5 post-MI, miR-214 expression was still only modestly elevated. [score:3]
Analysis of the 3′UTR of Dio3 showed the presence of a highly conserved miR-214 target site in the SECIS element (Figure 1), which is present in both mouse and human DIO3. [score:3]
The results indicate that binding of miR-214 results in a decreased DIO3 mRNA stability, and although the reduction of DIO3 protein levels is larger than that of DIO3 mRNA, it cannot be inferred from these data that DIO3 translation efficiency is also affected by miR-214. [score:3]
Figure 5 Dio3 protein and miR-214 are co-expressed. [score:3]
Analysis of the Role of miR-214 in the Translation of DIO3 in Transfected COS Cells and the Involvement of the SECIS Element. [score:3]
For the sake of clarity, the miR-214 data are shown in separate panels in combination with Dio3 mRNA expression (A) and Dio3 activity (B). [score:3]
An interesting feature of the conserved miR-214 target site in the 3′UTR of Dio3 is that it is located within the SECIS element, which is a secondary, double-stranded RNA structure. [score:3]
Since the SECIS element is essential for the incorporation of selenocysteine in DIO3, it led us to the question whether miR-214 might also interfere with DIO3 translation at this level. [score:3]
Although miR-214 significantly affected DIO3 protein expression, the levels of both full-length and truncated protein were equally reduced, indicating that miR-214 does not interfere with the insertion of Sec. [score:3]
The increase of miR-214 over time is in line with previous results in a mouse MI mo del (26), showing increasing miR-214 expression levels over time in remote myocardium (26). [score:3]
The latter option was supported by comparison of the temporal changes in miR-214 expression in the remo deling LV from the onset of MI up to 56 days later, with those of Dio3 mRNA and Dio3 activity as previously determined in the same samples. [score:3]
Figure 6Time course of miR-214 expression, Dio3 mRNA and Dio3 activity after MI. [score:3]
In Silico Analyses: Dio3 Is a Bona Fide Target of miR-214. [score:3]
Sequence analysis of the mouse Dio3 3′UTR predicted the presence of a miR-214 target site in the SECIS element, which was found to be highly conserved among species. [score:3]
Figure 2 Increased miR-214 expression in the post-MI LV. [score:3]
To explore the possible interplay between miR-214 and Dio3, their expression in cardiomyocytes was studied in sections of LV tissue. [score:3]
This may be a direct effect on transcription or processing of miR-214, but perhaps more likely involves components of the signal transduction pathways that drive physiological rather than pathological hypertrophy, and which are triggered by the effect of T3 on cardiac hemodynamic load (14, 30). [score:2]
Exposure of the heart to high systemic levels of T3 resulted in a 50% reduction of miR-214 expression in the LV compared to the LV of hypothyroid mice (Figure 7). [score:2]
Co-transfecting the wtD3 plasmid with mimic miR-214 caused a ~13% reduction in mRNA expression when compared to cells co -transfected with negative control miR-1 (Figure 4C). [score:2]
Figure 8 Proposed mechanism of Dio3 regulation by miR-214. [score:2]
Figure 5 shows that miR-214 expression levels did not increase significantly until day 5 following MI compared to sham-operated mice, and reached a plateau at post-MI day 7, which was maintained for at least 56 days without significant changes. [score:2]
MiR-214 Expression Is Increased in the Remo deling LV of the Post-MI Heart. [score:2]
Mir-214 expression levels were determined by quantitative RT PCR analysis in remote LV tissue from sham and MI animals isolated at day 7 post surgery. [score:2]
MiR-214 was identified as having a high potential to target the 3′UTR of Dio3. [score:2]
Expression levels of miR-214-3p were analyzed using miRCURY LNA miRNA primers and normalized against U6 snRNA (Exiqon, Vedbæk, Denmark). [score:2]
Transfection experiments using a construct with a Renilla luciferase reporter gene containing the mouse Dio3 3′UTR demonstrated functional interaction of miR-214 with Dio3 mRNA. [score:1]
These included Pre-miR-214 (100 nM); a combination of Pre-miR-214 (50 nM) and Anti-miR-214 (50 nM); or negative control miR#1 (100 nM) (Ambion, Foster City, CA, USA). [score:1]
The addition of Anti-miR-214 to the transfection mix containing miR-214 abolished the repression (Figure 3). [score:1]
In a previous study, we identified miR-214 as a differentially regulated miRNA in the remo deling LV of the post-MI mouse heart compared to the LV of sham-operated mice, using TaqMan Megaplex array analysis of all 641 mouse miRNAs known at the time. [score:1]
The results show a 30% reduction in RLuc activity when co-transfecting the reporter construct for 24 h with Pre-miR-214, relative to the “no-miR. [score:1]
A site complementary to the seed region of miR-214, which is highly conserved among species, was found to be located in the SECIS element, which is a secondary RNA structure (Figure 1). [score:1]
It was shown that Hif-1α, which is a key determinant of progression in the remo deling LV (41), activates the locus dinamin 3 opposite site (Dnm3os) harboring miR-214 (27). [score:1]
To increase the accuracy of the determination of miR-214 -dependent luciferase activity, cells were transfected with 50 ng of a single dual-luciferase reporter plasmid containing the Dio3 3′-UTR downstream of the Renilla luciferase gene (RLuc). [score:1]
To investigate whether miR-214 targets Dio3, we performed in vitro luciferase reporter experiments. [score:1]
Figure 7 Effect of T3 treatment on the levels of miR-214 and Dio3 mRNA. [score:1]
This suggests that binding of miR-214 to the DIO3 3′UTR does not interfere with selenocysteine incorporation. [score:1]
Representative images of immunohistochemical staining for Dio3 (A) and miR-214 in situ hybridization (B) in sequential sections of LV tissue 7 days post-MI. [score:1]
Values are means ± SEM, miR-214 (n = 5), Dio3 mRNA (n [3d] = 7, n [5d] = 6, n [7d] = 16, n [28d] = 10, n [56d] = 16) and Dio3 activity (n [3d] = 8, n [5d] = 9, n [7d] = 16, n [28d] = 6, n [56d] = 6). [score:1]
Therefore, we performed miR-214 in situ hybridization and Dio3 immunohistochemistry on serial sections of post-MI LV tissue. [score:1]
A dual-luciferase construct containing the complete Dio3 3′UTR downstream of the Renilla luciferase gene was used to analyze the interaction between miR-214 and the 3′UTR of Dio3. [score:1]
No-miR: control without co-transfection; ctrl-miR: + negative control/scrambled miR-1; P214: + Pre-miR-214; PA214: + Pre-miR-214 and Anti-miR-214. [score:1]
[1 to 20 of 87 sentences]
8
[+] score: 305
Using chemically synthesized microRNA mimics and precursor microRNA (pre-miRNA) expression vectors, we demonstrate that miR-214 is a potent growth inhibitor and a suppressor of RMS tumorigenesis, acting on human N -ras, a conserved target of the miR-214 myogenic and tumor suppressor functions. [score:11]
Like all microRNAs, miR-214 either suppresses the protein product translation or induces messenger RNA degradation of a wide range of target genes by forming imperfect base-pairing between its seed sequence and recognition sequences in the mRNA target 3'-UTR [47]. [score:9]
To determine if human N -ras is also a direct target of miR-214 -mediated translational regulation, we cloned the 3'-UTR of human N -ras in the pGL-3p vector and made various mutant constructs lacking miR-214 recognition sites (Fig. 5A). [score:7]
To further demonstrate that human N-ras is a major target gene that mediates the tumor suppressor activity of miR-214 in RD cells, we infected the P2GM and P-214 stable RD cells with adenoviruses that express N-ras from a microRNA-resistant, 3'-UTR-less cDNA. [score:7]
To further demonstrate its tumor suppression function, we asked if forced expression of miR-214 inhibits the ability of RD cells to form anchorage -dependent or independent foci in culture or xenograft tumors in nude mice. [score:7]
Here, we show that miR-214 expression is significantly down-regulated in a number of RMS cell lines relative to normal human skeletal muscles and fibroblasts. [score:6]
So, despite having a different set of targets and regulating muscle differentiation by a different mechanism, miR-214 is also a potent suppressor of RMS cell growth. [score:6]
Inverse correlation of miR-214 and N-ras expression in lung and prostate cancers RT-qPCR quantification of miR-214 expression in human. [score:5]
Human N-ras is a conserved tumor suppression target of miR-214. [score:5]
MiR-214 was also noted to promote cell cycle exit, a prerequisite of cell differentiation [32], and through global gene expression profiling, N -ras was identified as a target that mediates the miR-214 myogenic function [33]. [score:5]
The results indicated that the full length 3'UTR of N-ras afforded a 60% inhibition of the pGL3-p luciferase activity that could be attributed to the miR-214 over -expression in the P-214 stable RD cells (Fig. 5C). [score:5]
In xenograft tumors formed by the MSCV-P2GM vector-bearing RD cells that did not express miR-214, N -ras exhibited robust expression. [score:5]
When re-introduced back into RD cells, miR-214 ostensibly blunted N -ras expression and suppressed the xenogaft tumor growth (Fig. 6A). [score:5]
These results argue that N -ras is likely a major target of miR-214, and call for further scrutiny of miR-214 expression in primary human RMS samples. [score:5]
Although not required for embryonic development in mammals [29, 30], miR-214 is capable of regulating the differentiation of myogenic progenitor cells through many of its evolutionarily conserved targets and by many mechanisms. [score:5]
Our results indicate that miR-214 exerts its tumor suppressor function by targeting proto-oncogene N -ras in both mouse and human cells. [score:5]
The results indicated that expression of miR-214 was drastically down-regulated in both types of lung cancers as compared to normal lung tissues (Fig. 7A, 7B). [score:5]
Since miR-214 was reported to be one of the up-regulated microRNAs during cardiac hypertrophy [38], we also examined the role of miR-214 in the adult heart by the transverse aortic constriction procedure [39]. [score:4]
Negativecontrol:UUCUCCGAACGUGUCACGUTT MiR-214 mimic: ACAGGUAGUCUGAACACUGGGUU InhibitorNC :CAGUACUUUUGUGUAGUACAA MiR-214 inhibitor:ACUGCCUGUCUGUGCCUGCUGU Total RNAs from cultured cells, human skeletal muscles, and tumors were extracted using the RNAiso reagent and the cDNA was synthesized in reverse transcription reactions using the PrimeScript RT reagent kit (from a TAKARA distributor, China). [score:4]
The myogenic function of miR-214 was first reported in zebrafish [28], in which its downregulation by morpholino -mediated RNA silencing led to a loss of the slow muscle cells due to interruption of normal Hedgehog signaling. [score:4]
To determine if the miR-214 and N-ras regulatory loop also applies to other types of tumors, we examined the expression of these two genes in adenocarcinomas and squamous carcinomas of the lung as well as prostatic carcinomas by qPCR and IHC staining, respectively. [score:4]
Negativecontrol:UUCUCCGAACGUGUCACGUTT MiR-214 mimic: ACAGGUAGUCUGAACACUGGGUU InhibitorNC :CAGUACUUUUGUGUAGUACAA MiR-214 inhibitor:ACUGCCUGUCUGUGCCUGCUGU Total RNAs from cultured cells, human skeletal muscles, and tumors were extracted using the RNAiso reagent and the cDNA was synthesized in reverse transcription reactions using the PrimeScript RT reagent kit (from a TAKARA distributor, China). [score:4]
The tumor suppressor function of miR-214 is directly related to its normal role in promoting cell cycle exit, a prerequisite to myogenic differentiation. [score:4]
Having demonstrated the growth inhibitory function of miR-214 through N -ras, we sought to determine if this regulatory loop actually is associated with tumorigenesis. [score:4]
Dysregulation of miR-214 in RMS cell lines correlates with its growth inhibitory property. [score:4]
Figure 1(A) Schematic representation of the miR-214 genomic locus and the conditional knockout targeting construct. [score:4]
We further compared miR-214 expression in RD and Rh30 cells to that in primary human fibroblasts and HEK293 cells and found that tumor miR-214 levels were also reduced (Fig. 2B), suggesting that the reduction of miR-214 expression in RMS cells cannot be simply attributed to adaptation to cell culture, rather it is probably an intrinsic property of cancer cells. [score:4]
Our current investigation further extended miR-214 function to tumor suppression and revealed a likely causal correlation between marked up-regulation of N -ras and human RMS tumorigenesis. [score:4]
miR-214 inhibits RD cell growth and differentiation through N-ras. [score:3]
Using the stem-loop RT-PCR and by comparing to endogenous U6 snRNA, we observed a noticeable reduction of miR-214 expression in both RD and Rh30 cells relative to its level in the normal human skeletal muscle (Fig. 2A). [score:3]
3), suggesting that miR-214 inhibits cell proliferation. [score:3]
6C, 6D), albeit miR-1 exhibited more potent activity in suppressing the anchorage-independent colony formation than miR-214. [score:3]
Forced expression of N-ras also reversed the anti-proliferative effect of miR-214 (Fig. 5G). [score:3]
After plating approximately 500 stably transfected cells in a 60 mm petri dish and culturing for 14 days, we observed about 68 colonies of RD cells carrying the P2GM vector, and below 40 colonies of RD cells expressing either miR-1 or miR-214 (Fig. 4A and 4B). [score:3]
We also tested the anti-proliferative activity of miR-214 in prostate tumor lines, DU-145 and PC3, by over -expressing miR-214 from a MSCV -based viral vector P2GM [42] and observed similar growth retardation (Supplementary sFig. [score:3]
In light of miR-214 roles in promoting myogenic differentiation and cell growth control, we speculated that it might possess a tumor suppressor function. [score:3]
Since RMS is a cancer of dysregulated myogenic precursors, we sought to determine if miR-214 regulates RMS cell growth. [score:3]
As expected, genomic ablation of miR-214 did not alter the expression of the cistronic miR-199a or Dnm3os, the noncoding primary RNA (Fig. 1D). [score:3]
The reduction in miR-214 expression was even more pronounced when RNA levels were examined using the Taqman real time PCR (Fig. 2B). [score:3]
Moreover, the average sizes of miR-1 and miR-214 -expressing colonies were much smaller than that of the vector cells (Fig. 4A). [score:3]
Stem-loop RT-PCR confirmed the ectopic expression of miR-1 and miR-214 in their respective tumors (Fig. 4G). [score:3]
The miR-214 specific inhibition is defined in the text. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
On histological sections, xenograft tumors expressing pre-miR-1 or pre-miR-214 showed decreased staining for Ki67 but increased staining for MHC (Fig. 4F), suggesting a benign growth relative to the vector-bearing tumors. [score:3]
Thus, N -ras is a conserved target of miR-214 in human cells as well. [score:3]
miR-214 suppressed colony formation and xenograft tumorigenesis. [score:3]
For these purposes, we generated stable RD cells expressing pre-miR-214 or pre-miR-1 from the constitutive P2GM vector. [score:3]
miR-214 is a suppressor of human RMS cell growth. [score:3]
So, despite both miR-1 and miR-214 are able to induce RD cells to undergo myogenic differentiation (Fig. 3D, 3E) and suppress their tumorigenic activities (Fig. 4A-4E), only miR-214 reached these outcomes through blocking N-ras. [score:3]
Examination of the liver, lung, heart, and muscle by stem-loop PCR detection showed a robust miR-214 expression in the control B6 mice, but miR-214 is absent from those tissues in the homozygously deleted mice or at a reduced level in the heterozygotes (Fig. 1C). [score:3]
Each of the three miR-214 recognition sites exhibited inhibitory activity with site 1 showing the strongest while site 2 the weakest (Fig. 5C). [score:3]
To address this possibility, we examined miR-214 expression in two human RMS cell lines, RD and Rh30, which are derived from tumors of the embryonal and alveolar origin, respectively. [score:3]
Sequences of miR214 inhibitor or mimics as well as nonspecific control are as follows. [score:3]
However, our data on the contrary showed that miR-214 is engaged in tumor suppression in vivo. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
Thus, miR-214 likely possesses an anti-tumor function in suppressing RMS tumorigenesis through N-ras. [score:3]
This observation likely explains why miR-214 is effective in suppressing RMS tumorigenesis. [score:3]
During the 5-day span of differentiation, total level of miR-214 in the transfected RD cells was maintained at a higher level than the ns control by the mimic (Fig. 3G), suggesting a causal relationship between miR-214 overexpression and accelerated exit from the mitosis. [score:3]
miR-214 inhibits colony formation and xenograft tumor growth. [score:3]
We previously identified N -ras as a target of miR-214 that mediates its myogenic function in mouse myoblasts, and found the miR-214 recognition sequences in both mouse and human N -ras [33], thus the sequence basis for the functional conservation in these two species. [score:3]
Taken together, these results indicate that miR-214 is a growth inhibitor of different types of tumor cells. [score:3]
Germline deletion of the miR-214 locus was achieved by crossing miR-214 [cko] to EIIa-cre driver mice that express the cre recombinase ubiquitously. [score:3]
After switching the cells to differentiation medium and incubation for 5 days, we found that forced expression of N-ras neutralized the pro-myogenic effect of miR-214 in RD cells, which was determined by immunofluorescence staining of MHC (Fig. 5D), and RT-PCR detection of myogenin (Fig. 5E) and MHC (Fig. 5F) mRNAs [33]. [score:3]
In mouse C2C12 myoblasts, miR-214 was reported to form a negative feedback loop with a polycomb group component Ezh2 that controls the expression of miR-214 as well as myogenic transcription factors MyoD and Myogenin through epigenetic modifications of the chromatin structure [31]. [score:3]
miR-214 inhibits the proliferation of murine embryonic fibroblasts. [score:3]
MiR-214 is part of this network, although its function is not required during embryonic development as miR-214 null embryos were carried to full term and the pups grew healthy and fertile [29, 30]. [score:2]
We then compared the luciferase activities of these constructs in the vector control P2GM and pre-miR-214 -expressing stable RD cells, and calculated miR-214-specific inhibition, which is defined as the ratio of luciferase activities between these two pools of RD cells normalized for the value elicited from the pGL3-p vector in the P2GM carrying RD cells. [score:2]
MiR-214 inhibits embryonic cell proliferation. [score:2]
MiR-214 is a ubiquitously expressed microRNA with important muscle function. [score:2]
Compared to the vector-bearing control RD cells, those that expressed pre-miR-1 or pre-miR-214 grew much slower (Fig. 4C, and 4D), and reached to smaller terminal sizes (Fig. 4E). [score:2]
Several recent studies identified other genes that are regulated by miR-214, such as Ezh2 and Pten [26, 31, 40]; however, we did not detect any change in these two protein levels in miR-214 [−/−] MEFs. [score:2]
When assayed for anchorage-independent growth in top agar plates, stable RD cells expressing pre-miR-1 or pre-miR-214 also formed fewer foci than the P2GM RD cells (Supplementary sFig. [score:2]
48 hours after transfection, 20 μM EdU was added for 1 hour, and MEFs from wt and miR-214 knockout mice were incubated with 20 μM EdU for 4 hours or 6 hours. [score:2]
Homozygous miR-214 [−/−] mice were born healthy at the expected Men delian ratio and exhibited no overt developmental abnormally. [score:2]
These findings strongly support the relevance of miR-214 and N- ras regulatory loop in RMS etiology. [score:2]
Thus, although miR-214 is not essential for embryonic development and loss of miR-214 by itself is not sufficient to cause cancer in mice, it normally exerts a negative control on cell growth. [score:2]
For these reasons, miR-214 is likely a good candidate for the development of an anti-RMS therapeutic antagomiR. [score:2]
In the presence of 10% FBS, RD cells did not undergo apoptosis and neither miR-1 nor miR-214 were able to induce such (Fig. 3C). [score:1]
In contrast, the levels of N -ras mRNA transcript and protein increased markedly in miR-214 [−/−] MEFs (Fig. 1D, 1E), in keeping with our previous observation in C2C12 cells [33]. [score:1]
To determine if miR-214 plays a role in the homeostatic maintenance of the muscle function in the adult, we created the muscle injury mo del in miR-214 [−/−] and the control B6 mice by cardiotoxin III injection in the tibia calf [37]. [score:1]
In this study, we investigated the roles of miR-214 in suppressing RMS cell growth and xenograft tumor formation. [score:1]
Once again, no statistic significant difference was observed in a range of parameters between miR-214 [−/−] and the control B6 mice (Supplementary sFig. [score:1]
Human genomic DNA fragments containing pre-miR-1 or pre-miR-214 sequences were amplified by PCR and inserted at the NotI and PmeI site in the MSCV-P2Gm vector. [score:1]
To further characterize the tumor suppression properties of miR-214, we examined the ability of RD cells to undergo apoptosis and differentiation after they received miR-214mi or controls through transfection. [score:1]
MiR-214 is encoded along with miR-199a in a 7.8 kb bi-cistronic primary microRNA transcription unit, Dynamin 3 opposite strand (Dnm3os), which is embedded on the reverse strand in an intron of the Dynamin 3 (Dnm3) gene [33]. [score:1]
Figure 2 (A) RT-PCR detection of miR-1, miR-133a, and miR-214 in RD and Rh30 cells, as well as in normal skeletal muscles (SKM). [score:1]
Flow cytometry analyses indicated that after serum depletion for 3 days, about 32% of RD cells transfected with the ns control became double positive for Annexin V and PI, an indication of late stage of cell death [44], but this percentage increased to 56.9% and 52.8% when the cells were transfected with miR-1mi and miR-214, respectively (Fig. 3B and 3C). [score:1]
Figure 5 (A) Predicted miR-214 recognition sites in the 3'-UTR of human N-ras and schematic representation of human N-ras 3'UTR reporter constructs. [score:1]
Figure 6 (A) IHC staining of N-ras in xenograft tumors derived from RD stable cells carrying P2GM, P2GM-miR-1, and P2GM-miR-214 constructs. [score:1]
Nevertheless, immunofluorescence staining of Ki67 indicated a progressive increase in the rate of ribosomal RNA transcription after removing one (heterozygotes) or both (homozygotes) alleles of miR-214 (Fig. 1F, supplementary sFig. [score:1]
miR-214 promotes apoptosis and myogenic differentiation of RD cells. [score:1]
Full length or fragments of the N-ras 3'-UTR containing miR-214 recognition sequences were inserted behind the luciferase coding sequence at the XbaI site in the pGL3-promoter vector (Promega, WI, USA). [score:1]
To determine if miR-214 exerts any physiological control on cell growth and differentiation, we isolated the primary murine fibroblasts (MEFs) from miR-214 [−/−] and control B6 embryos. [score:1]
During the process of tumorigenesis, pre-cancerous cells endure enormous selective pressure to reorganize their metabolic program and miR-214 becomes engaged to counter tumor growth. [score:1]
Once again, miR-214 is not a sufficient inducer of apoptosis on its own. [score:1]
The node defined by miR-214 likely reacts to stress cues as it has been demonstrated to protect the mouse heart from ischemic injury by controlling Ca [2+] overload and death [29]. [score:1]
In contrast, both the messenger RNA and protein levels of N -ras increased dramatically when miR-214 was lost completely. [score:1]
Mouse N -ras contains two miR-214 recognition sites in its 3'-UTR, whereas human N -ras has one site that matches to the 7-nucleotide seed sequence of miR-214 and two imperfect sites (Fig. 5A). [score:1]
Figure 4 (A) 500 stable RD cells carrying constitutive P2Gm vector, P2Gm-miR-1, or P2Gm-miR-214 were cultured in 60 mm petri dishes in the presence of 10 μg/ml puromycin for 14 days. [score:1]
For generating the stable cell lines, P2GM, P2GM-miR-1(P-1) or P2GM-miR-214(P-214) plasmids were transfected into RD cells using Lipofectamie according to the manufacturer's procedure (Invitrogen). [score:1]
[1 to 20 of 100 sentences]
9
[+] score: 277
In summary, our findings revealed that ER stress suppresses the expression of the miR-199a/214 cluster by activating NFκB to upregulate pro-survival XBP-1 expression, which suggested a novel UPR/NFκB/miR-214/XBP-1 regulatory circuitry whose dysfunction may contribute to tumor survival and progression of HCC. [score:11]
To start unraveling the regulatory mechanisms of miR-199a2/214 expression under UPR conditions in greater detail, we further found that UPR activated NFκB with concomitant suppression of miR-199a2/214 transcription, and this suppression was reversed by NFκB inhibitor PDTC in HepG2 cells, which suggested that NFκB is a potential negative regulator of the miR-199a-2/miR-214 cluster. [score:11]
Putative miR-214 targets were predicted using target prediction programs, miRBase and TargetScan. [score:7]
We further identified that NFκB activated by unfolded protein response (UPR) suppresses miR-199a2/214 transcription, and demonstrated that activation of UPR and endoplasmic reticulum (ER) stress represents an important mechanism responsible for miR-214 and miR-199a-3p/5p down-regulation in HCC development. [score:7]
Restored XBP-1 expression reduced miR-214 overexpression induced HCC tumor suppression in vitro and in vivo. [score:7]
Moreover, we found that the expressions of Ezh2 and plexin-B1 were not negatively correlated with miR-214 in miR-214 -downregulated HCC tumor samples (data not shown). [score:6]
Together, these studies indicated that down-regulated miR-214 in HCC cancer induces the over -expression of XBP-1, which in turn accelerates tumorigenesis. [score:6]
In our study, we showed that NFκB and XBP-1 were predominantly expressed but miR-214 was significantly reduced in human HCC tissues, miR-214 directly targets XBP-1, and UPR or hypoxia induced-NFκB activation negatively controls the miR-199a/214 cluster transcription in HCC cells. [score:6]
The real-time RT-PCR results showed that miR-214 expression was significantly down-regulated in HepG2 cells after TG and TM treatment for 24 h (Figure 5A). [score:6]
Decreased miR-214 expression was observed in 65% of HCC (15 of 23 cases), and consistent down-regulation of both miR-199a-3p and miR-199a-5p also were detected in as much as 73% of HCC (17 of 23 cases) (Figure 1A and B). [score:6]
Thus, miR-199a and miR-214 expression levels are down-regulated by UPR under various physiological and pathological conditions. [score:6]
Result show that miR-214 and miR-199a-3p/5p was significantly down-regulated in HepG2 cells after TG and TM treatments or anoxia, further suggesting that UPR activated XBP-1 or mTOR and ERK pathway to protect tumor cell survival though suppression of the miR-199a2/214 cluster in HCC. [score:6]
These data suggest that miR-214 directly recognizes the 3′UTR of XBP-1 mRNA and inhibits XBP-1 translation. [score:6]
Result show that pre-miR-199a2 and pre-miR-214 expression were markedly decreased in HepG2 cells, while pre-miR-199a1 expression is not altered compared with that in human normal liver, which suggest that pri-miR-199a2 transcription is mainly suppressed in HCC. [score:6]
Furthermore, the suppressive effect of miR-214 in HCC tumor formation and growth was studied in vitro and in vivo, and reintroduction of XBP-1s attenuated miR-214 -mediated suppression. [score:5]
Furthermore, ectopic expression of miR-214 dramatically suppressed the ability of HCC cells to form colonies in vitro and to develop tumors in a subcutaneous xenotransplantation mo del of the BALB/c athymic nude mice. [score:5]
As the UPR transcription factor XBP-1 was identified as a target of miR-214 and recent studies have revealed the important functions of miR-199a/b-3p in HCC carcinogenesis and progression by targeting mTOR and c-Met or PAK4/Raf/MEK/ERK Pathway in HCC cells [5], [21], we decided to further investigate the correlation between UPR activation and miR-199a/214 down -expression. [score:5]
It will be interesting now to determine whether over -expression of miR-214 or modulation of its targeting could provide a new treatment modality for miR-214 -deficient tumor, such as HCC, cervical cancer and breast cancer. [score:5]
But in cervical cancer [27], [29] and breast cancer [35], miR-214 expression was reduced, suggesting a tumor suppressor gene-like function. [score:5]
Re -expression of miR-214 in HCC cell lines (HepG2 and SMMC-7721) inhibited proliferation and induced apoptosis. [score:5]
It is consistent with recent reports that miR-214 is down-regulated in human cervical cancer and negatively regulates Hela cell proliferation [27], [29]. [score:5]
Figure S3 The NFKB and XBP-1s protein expression in miR-214-underexpressed HCC tissues were analyzed by western blotting. [score:5]
0031518.g005 Figure 5(A) HepG2 cells treated with Thapsigargin(TG, 5 µmol/L) and tunicamycin (TM, 5 µg/ml) for 24 h were analyzed by western blotting for GRP94 and XBP1 expression levels and analyzed by real-time RT-PCR for miR-199a-3p/-5p and miR-214 expression. [score:5]
Therefore, a new UPR/NFκB/miR-214/XBP-1 regulatory circuitry was suggested in HCC progression, in which NFκB was activated by UPR and participated in the negative regulation of miR-199a/214 to regulate HCC progression (Figure 7). [score:4]
Further, we tested whether upregulated miR-214 induces HCC cell apoptosis and cell death, by determining the number of early and late apoptotic HepG2 cells following treatments with miR-214 mimics by flow cytometric analysis. [score:4]
These results suggest that miR-214 targets XBP-1 by directly binding the 3′ UTR of XBP-1. 10.1371/journal. [score:4]
miR-214 directly targets XBP-1 by interaction with the 3′-UTR. [score:4]
These results suggest that miR-214 targets XBP-1 by directly binding the 3′ UTR of XBP-1. 10.1371/journal. [score:4]
To further verify a potent role for the miR-214/XBP-1 pathway in mediating tumor cells survival and in regulating HCC tumor growth, we re-expressed XBP-1 in miR-214 treated HCC cells. [score:4]
Our study suggest that modulation of miR-214 levels may provide a new therapeutic approach for cancer treatment and revealed that UPR may offer a new explanation for why the miR-199a/214 cluster were down-regulated in the progression in HCC. [score:4]
XBP-1 was shown to be a direct target of miR-214 by interaction with the 3′-UTR. [score:4]
As miR-214 targets XBP-1 and XBP-1 is a key effector of UPR and ER stress [31], [32], we further investigated whether there might be a link between miR-214 down -expression and the activation of UPR in HCC in hepatoma cells. [score:3]
showed that these miRNAs were all significantly down-regulated and miR-199a-3p>miR-199a-5p>miR-214 compared with adjacent nontumorous liver tissues. [score:3]
In the present study, we showed that miR-199a-3p, miR-199a-5p and miR-214 expression was significantly reduced in HCC tissues. [score:3]
To validate the impact of UPR on miR-214 expression in HCC cells, two classic UPR inducer thapsigargin (TG) and tunicamycin (TM) was used to induce activation of the UPR in HepG2 cells. [score:3]
Moreover, western blot analysis showed that XBP-1 protein level was increased in miR-214 -downregulated human HCC tissues compared with adjacent nontumorous liver tissues (Figure S3). [score:3]
However, the current knowledge about miR-214 expression and function in HCC is still rather unclear. [score:3]
These results indicate a growth -inhibitory role of miR-214 in HCC. [score:3]
In our study, we further identified XBP-1 as a new target of miR-214 by binding its 3′-UTR in HCC cells. [score:3]
Our analysis revealed that XBP-1 was a potential target of miR-214. [score:3]
To confirm that XBP-1 is a putative target of miR-214, we constructed two luciferase reporter vectors with wild-type XBP-1 3′UTR and mutated XBP-1 3′UTR (the complementary sequence in the seed region of miR-214 binding site was mutated). [score:3]
Based on those observations, we assumed that XBP-1, but not Ezh2 and plexin-B1, is the “primary” target of miR214 in HCC, depending on the different cellular context. [score:3]
Therefore, we next searched for the target genes of miR-214 in HCC. [score:3]
Moreover, reintroduction of XBP-1s attenuated miR-214 -mediated suppression of HCC cells proliferation, colony and tumor formation. [score:3]
These results suggest that miR-214 may function as a putative tumor suppressor in HCC cells. [score:3]
Figure S7 pre-miR-199a1, pre-miR-199a2 and pre-miR-214 expression were detected by qRT-PCR in human normal liver and HepG2 cells. [score:3]
The expression levels of miR-199a and miR-214 were also lower in HCC cells exposed to anoxia induced by CoCl [2] (100 µmol/L) (Figure 5B). [score:3]
Similarly, we found that XBP-1 protein level was increased in miR-214-downexpressed human HCC tissues. [score:3]
HepG2 and SMMC-7721 cells were transfected with miRNA/siRNA negative control (miR-con and siR-con), miR-214 mimics or siRNA targeting human NFκB/p65 (RiboBio, Guangzhou, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. [score:3]
These data indicated that NFκB is a potential negative regulator of the miR-199a-2/miR-214 cluster. [score:2]
miR-214 regulates HCC tumor formation and growth in vitro and in vivo. [score:2]
In parallel, in HCC cell lines HepG2 and SMMC-7721, miR-199a-3p/5p and miR-214 expression was markedly decreased compared with that in human normal liver (Figure 1C). [score:2]
miR-214 regulates HCC cell proliferation and apoptosis. [score:2]
When co -transfected with miR-214 mimics into HepG2 cells, the relative luciferase activity of a XBP-1 3′UTR luciferase reporter was significantly suppressed by ∼50% compared with the transfection of negative control. [score:2]
NFκB is a potential negative regulator of the miR-199a-2/miR-214 gene. [score:2]
As shown in Figure S7, miR-199a2 and miR-214 were regulated as a cluster from pri-miR-199a2 within the human Dnm3os genes; we next examined the miR-199a2 promoter region for transcription factor binding sites, and identified 3 potential putative NFκB binding sites in a 1.2-kb DNA fragment upstream to the pre-miR-199a2 (Figure S8). [score:2]
The results of the in vitro assays indicated that exogenous miR-214 significantly inhibited the proliferation of hepatoma cell lines. [score:2]
miR-214 negatively regulates XBP-1 through binding to 3′-UTR of the XBP-1.. [score:2]
Similar results were also found in HepG2 cell xenografts trandfected with miR-214 mimics in vivo (Figure S4 and S5). [score:1]
Interestingly, at the 3′-end of the pri-miR-199a2 transcript, there is the precursor sequence for another miRNA pair hsa-mir-214 and hsa-mir-214* [24]. [score:1]
The miR-214, miR-199a-3p and miR-199a-5p level was quantified by real-time quantitative-PCR using TransStartTM SYBR Green qPCR Supermix (TransGen Biotech, Beijing, China), and with U6 small nuclear RNA as an internal normalized reference. [score:1]
Interestingly, similar result of miR-214 -mediated XBP-1 repression was also attained in Hela cells. [score:1]
The miR-214/XBP-1 pathway was shown in this work, while miR-199a-3p/mTOR and miR-199a-5p/DDR1 pathways were reported by other studies. [score:1]
HepG2 cells were plated at low density (200 cells/well) after transfection by miR-control, miR-214 mimics. [score:1]
Furthermore, the miPPR-199a2 region is shown here to be the authentic miR-199a2 promoter that produces the primary transcript harboring the miR-199a-3p, miR-199a-5p and miR-214 sequences as a cluster [25]. [score:1]
0031518.g007 Figure 7 The miR-214/XBP-1 pathway was shown in this work, while miR-199a-3p/mTOR and miR-199a-5p/DDR1 pathways were reported by other studies. [score:1]
HepG2 cells were transiently transfected with indicated plasmids with miR-control, miR-214 mimics. [score:1]
To study the role of the miR-199a/214 cluster in the HCC, levels of miR-214 and miR-199a-3p/5p were determined in 23 pairs of HCC and adjacent benign tissues using real-time PCR. [score:1]
Figure S5 Effect of miR-214 on tumour formation in nude mouse HepG2 xenograft mo del. [score:1]
We found that sequence alignment of hsa-miR-214 with 3′-UTR of the human XBP-1 gene identified a miR-214 binding site (Figure 2A). [score:1]
Consistently, similar effects were also detected in SMMC-7721 cells treated with cholesterol-conjugated 2′-O-methyl -modified miR-214 mimics (agomir-214) (Figure 3D). [score:1]
We further found that transient transfection of HepG2 and SMMC-7721 cells with miR-214 efficiently reduced XBP-1 protein levels detected by western blotting analysis (Figure 2C), which was independent of ATF6 and IRE1 signaling (Figure S1). [score:1]
Several miR-214 targets have been characterized in various tumor types (ovarian cancer, cervical cancer and melanoma) including MEK3, JNK1 [29], PTEN [28], [36], Plexin-B1 [27], Ezh2 [35], [37], and TFAP2C [26] and so on. [score:1]
miR-199a2 and miR-214 have been reported to be produced from a single intron-less transcript of Dynamin 3 opposite (Dnm3os) that is embedded in the opposite strand within an intron of Dynamin in mouse and human [23], [24]. [score:1]
0031518.g002 Figure 2(A) Sequence alignment of human miR-214 with 3′-UTR of XBP-1. The seed sequence of miR-214 matches 3′-UTR of XBP-1 for creating the XBP-1 3′-UTR or mutant luciferase reporter construct. [score:1]
HepG2 and SMMC-7721 cells (3000 per well) were transfected with miR-214 or miR-control in 96-well culture plates. [score:1]
Figure S2 Western blot showing XBP-1protein in Hela cells transfected with miR-control and miR-214 mimics, β-actin as loading controls. [score:1]
Increased level of miR-214 was found in ovarian cancer [28], gastric cancer [34] and melanoma [26], inducing chemotherapy resistance or tumor metastasis. [score:1]
To determine the impact of the miR-214 on HCC cell proliferation, HepG2 and SMMC-7721 cells, were respectively transfected with miR-214 mimics or miR-control and analyzed for cell growth. [score:1]
Figure S1 Western blot showing P-IRE1 and ATF6 protein in HepG2 cells transfected with miR-control and miR-214 mimics, GAPDH as loading controls. [score:1]
The expressions of pre-miR-199a1, pre-miR-199a2, and pre-miR-214 were measured by quantitative RT-PCR, as described previously [59], [60]. [score:1]
To further explore the role of miR-214 in hepatocarcinogenesis, we disclosed that the ER stress -induced pro-survival factor XBP-1 is a target of miR-214 by using western blot assay and luciferase reporter assay. [score:1]
Although miR-199a-3p and miR-199a-5p have been reported to contribute to liver carcinogenesis [5], [21], [22], the role of miR-214 in HCC tumorigenesis has not been elucidated. [score:1]
Figure S4 Effect of miR-214 on colony formation of hepatoma cell lines. [score:1]
The above findings prompted us to explore the biological significance of miR-214 in HCC tumorigenesis in vivo. [score:1]
miR-214 mimics and miR-con transfected HepG2 cells (1×10 [6]), or agomir-214 and agomir-NC treated SMMC-7721 cells (1×10 [6]) transfected with pCMV-XL5-XBP-1s plasmid individually, and were suspended in 100 µL PBS and then injected s. c. into either side of the posterior flank of the same female BALB/c athymic nude mouse at 5 to 6 weeks of age, as described previously [6], [16], [20], [62], [63], [64]. [score:1]
miR-con and miR-214 in Fig. S5 indicate the flanks injected with miR-control -transfected and miR-214 mimics -transfected HepG2 cells, respectively. [score:1]
As expected, few Annexin V -positive cells were detected in the miR-control -treated or untreated cells, whereas miR-214 restoration increased the percentage of apoptotic cells (∼20% in HepG2) as judged by Annexin V staining (Figure 3C). [score:1]
More and more studies documented that miR-214 is involved in human ovarian cancer, cervical cancer and melanoma tumour progression [26], [27], [28], [29]. [score:1]
[1 to 20 of 89 sentences]
10
[+] score: 266
This conclusion was based upon the following findings: (i) inhibition of miR-214 ameliorated high glucose -induced expression of hypertrophic marker genes in human MCs; (ii) in vivo studies in db/db mice further confirmed that inhibition of miR-214 significantly reduced the expression of SM22, α-SMA and collagen IV, markedly restored PTEN level, and attenuated albuminuria and mesangial expansion; (iii) miR-214 was identified to target PTEN. [score:11]
The results demonstrated that overexpression of miR-214 inhibited the expression of PTEN and activated the expression of α-SMA, SM22 and collagen IV. [score:9]
In vivo study further confirmed that inhibition of miR-214 markedly downregulated the expression of SM22, α-SMA in isolated glomeruli and attenuated the mesangial expansion in db/db mice. [score:8]
In addition, co-transfection of human MCs with lentiviral vectors expressing miR-214 and CDS of PTEN induced an increase in PTEN expression and a decrease in expression of hypertrophic-related genes. [score:7]
In addition, our data showed that miR-214 targeted the same sites as previously reported 26, however, we found that inhibition of miR-214 reduced the expression of SM22, α-SMA, restored PTEN level, as well as attenuated albuminuria and mesangial expansion in db/db mice. [score:7]
More importantly, we transfected human MCs with lentiviral vectors expressing miR-214 and coding sequence (CDS) of PTEN in high glucose -treated human MCs to confirm whether miR-214 regulated mesangial hypertrophy by targeting PTEN. [score:6]
We found that miR-214 directly targeted PTEN, which was consistent with PTEN being a target of miR-214 in monocytes in vitro as previously reported 26. [score:6]
Moreover, inhibition of miR-214 also reduced mRNA and protein expression of hypertrophic markers α-SMA, SM22 and collagen IV in diabetic glomeruli (Fig. 5B–D). [score:5]
These data conclusively demonstrated that inhibition of miR-214 ameliorated glomerular hypertrophy in db/db mice and this effect was associated with the restoration of PTEN expression. [score:5]
Treatment with miR-214 inhibitor attenuated glomerular hypertrophy, accompanied by restoration of PTEN expression in db/db mice. [score:5]
However, inhibition of miR-214 significantly restored the mRNA and protein expression of PTEN in diabetic glomeruli (Fig. 5B–D). [score:5]
In this study, we showed that inhibition of miR-214 significantly ameliorated glomerular hypertrophy under diabetic conditions by targeting PTEN in vivo and in vitro. [score:5]
Moreover, human MCs were infected with lentiviral vectors expressing miR-214 and coding sequence (CDS) of PTEN, thus inducing overexpression of miR-214 and PTEN in the cells. [score:5]
Finally, in vivo studies further confirmed that treatment with miR-214 inhibitor restored protein and mRNA expression of PTEN in kidney tissue from db/db mice. [score:5]
We performed sequence alignment of PTEN 3′-untranslated region (UTR) by using five species including human, rat, mouse, cow and dog, and then listed miR-214 target sites region (Fig. 3D). [score:5]
Inhibition of miR-214 attenuated glomerular hypertrophy via targeting PTEN in db/db mice. [score:5]
First, we listed candidate miRNA genes and target genes on degree level, and used the degree to take miR-214 as the strongest candidate gene and take PTEN as the strongest target gene (data shown in supplementary Tables S1 and S2). [score:5]
These results suggest that inhibition of miR-214 might ameliorate glomerular hypertrophy under diabetic condition by targeting PTEN. [score:5]
Control: MCs cultured in high glucose served as control; ScRNA: MCs transfected with scramble control; miR-214: MCs infected with lentiviral vectors expressing miR-214; miR-214+PTEN: MCs infected with lentiviral vectors expressing miR-214 and CDS of PTEN. [score:5]
MiR-214 contributed to diabetic MC hypertrophy in vitro by targeting PTENTransfection of anti-miR-214 reduced the mRNA expression of miR-214, α-SMA, SM22 and collagen IV in high glucose -treated human MCs (Fig. 3A). [score:5]
However, inhibition of miR-214 significantly reduced expression of hypertrophic markers α-SMA, SM22 and collagen IV, and partially restored PTEN protein level in high glucose-stimulated human MCs. [score:5]
In contrast, inhibition of miR-214 significantly restored the expression of PTEN in diabetic kidneys (Fig. 5A). [score:5]
We found that inhibition of miR-214 reduced the expression of α-SMA and SM22, accompanied by an increase in the protein level of PTEN. [score:5]
These results indicated that miR-214 contributed to MC hypertrophy, and inhibition of miRNA-214 ameliorated high glucose -induced expression of hypertrophic marker genes and significantly restored PTEN protein level in human MCs. [score:5]
The cells were infected with miR-214 inhibitor -expressing lentivirus at a dose of 5 × 10 [6] TU as published previously 37, while the cells cultured in serum-free DMEM with 5 mmol/L of glucose and 20 mmol/L of mannitol served as a control as previously described 38. [score:5]
In this study, we showed that miR-214 was markedly upregulated in isolated glomeruli in db/db mice. [score:4]
Overexpression of PTEN could ameliorate miR-214 -mediated MC hypertrophy while knockdown of PTEN mimicked the MC hypertrophy. [score:4]
To further explore the mechanisms by which miR-214 regulated diabetic glomerular hypertrophy, we examined the expression of PTEN in the kidneys. [score:4]
Taken together, overexpression of PTEN markedly attenuated miR-214 -mediated MC hypertrophy while knockdown of PTEN mimicked miR-214 -mediated MC hypertrophy. [score:4]
miR-214 contributed to human MC hypertrophy by directly targeting PTEN in vitro. [score:4]
These results indicated that the lentivirus-packed miR-214 inhibitor significantly knocked down the endogenous miR-214 and the delivery procedure was effective (Fig. 4B). [score:4]
Thus, miR-214 regulated mesangial hypertrophy by targeting PTEN. [score:4]
These results strongly indicated that targeting miR-214 might be an attractive strategy to attenuate diabetic kidney injury. [score:3]
These results have demonstrated that inhibition of miR-214 significantly ameliorates functional (UAE) and morphological glomerular defects in db/db mice. [score:3]
Furthermore, we examined the ultrastructure of mesangial area by electron microscopy and found that inhibition of miR-214 also attenuated ECM deposition in db/db mice (Fig. 4E). [score:3]
We did not examine the effects of miR-214 inhibition on diabetic podocytes. [score:3]
Recent study has demonstrated that deletion of miR-214 inhibits tubulointerstitial lesions in a unilateral ureteral obstruction (UUO) mouse mo del 33. [score:3]
A mutant of the 3′UTR with a mutation of complementary sequences for the seed sequence of miR-214 was developed by the QuikChange II Site-Directed Mutagenesis Kit (Stratagene, CA). [score:3]
Diabetic mice were then randomly divided into three groups (n = 10/each group): (1) untreated db/db group (db/db); (2) db/db group infected with scrambled control and (3) db/db group treated with miR-214 inhibitor (Invitrogen, CA). [score:3]
Treatment with miR-214 inhibitor also markedly reduced the miR-214 level in isolated glomeruli from db/db mice. [score:3]
In contrast, treatment with miR-214 inhibitor significantly ameliorated mesangial expansion in db/db mice (Fig. 4C,D). [score:3]
db/m, db/m control mice; db/db, diabetic db/db mice; ScRNA, db/db mice treated with miR-214 scramble; anti-miR-214, db/db mice treated with miR-214 inhibitor. [score:3]
To test the role of miR-214 in the pathogenesis of MC hypertrophy, we transfected a miR-214 inhibitor (System Bioscience) into cultured human MCs. [score:3]
Transfection of anti-miR-214 reduced the mRNA expression of miR-214, α-SMA, SM22 and collagen IV in high glucose -treated human MCs (Fig. 3A). [score:3]
As shown in supplementary Tables S1 and S2, we used the degree to take miR-214 as the strongest candidate gene among all the candidate miRNAs while PTEN has the highest degree value among all the potential target genes. [score:3]
To examine the effect of miR-214 on DN in vivo, we delivered lentivirus-packed miR-214 inhibitor at a dose of 1 × 10 [7] TU into diabetic mice by tail vein injections every 2 weeks. [score:3]
After mutating the nucleotides of seeding sequence in the 3′ UTR of PTEN, the inhibitory effect of miR-214 mimics on luciferase reporter activity were largely abolished (Fig. 3F). [score:3]
LG + Osm, low glucose (5 mmol/L) supplemented with mannitol (20 mmol/L); HG, high glucose (25 mmol/L); ScRNA, HG with scramble control; anti-miR214, HG with transfection of miR-214 inhibitor. [score:3]
These results clearly demonstrated that inhibition of miR-214 attenuated glomerular hypertrophy under diabetic conditions in vivo and in vitro. [score:3]
We also demonstrated that miR-214 promoted human MC hypertrophy and overexpression of collagen IV proteins in the presence of high glucose. [score:3]
However, treatment with miR-214 inhibitor significantly decreased UAE in db/db mice (Fig. 4A). [score:3]
Aberrant expression of miR-214 was identified in a wide range of human tumors such as nasopharyngeal carcinoma, breast cancer, ovarian cancer, colorectal cancer etc. [score:3]
Treatment with miR-214 inhibitor ameliorated the glomerular mesangial expansion in db/db mice. [score:3]
Inhibition of miR-214 ameliorated albuminuria and glomerular mesangial expansion in db/db mice. [score:3]
We also used a luciferase assay in HEK293 cells to identify whether PTEN as the target of miR-214. [score:2]
These results demonstrated a direct binding of miR-214 to the 3′ UTR of PTEN. [score:2]
We further demonstrated that exogenous PTEN markedly ameliorated miR-214 -mediated MC hypertrophy while knockdown of PTEN mimicked the MC hypertrophy. [score:2]
MiR-214 contributed to diabetic MC hypertrophy in vitro by targeting PTEN. [score:2]
However, the potential role of miR-214 in the development of DN has not been fully explored. [score:2]
Our results showed that knockdown of miR-214 significantly attenuated UAE and glomerular mesangial expansion, which was accompanied by restoration of the PTEN level in diabetic db/db mice. [score:2]
We further revealed the mechanisms underlying the regulation of miR-214 on MC hypertrophy. [score:2]
In summary, these results suggest that the regulatory effects of miR-214 on PTEN are likely to be accountable for its action against diabetic MC hypertrophy. [score:2]
Our study showed that miR-214 promoted diabetic MC hypertrophy via PTEN and provided an understanding of the role of miRNA in the pathophysiology of DN. [score:1]
In conclusion, cross talk between miR-214 and PTEN attenuated glomerular hypertrophy under diabetic conditions in vivo and in vitro. [score:1]
Second, we examined the role of miR-214 in the pathogenesis of MC hypertrophy in vitro. [score:1]
miR-214 mimics were co -transfected with either WT or mutant-PTEN-psi-CHECK-2 Vector into HEK 293 cells, respectively. [score:1]
To further support our findings, in vivo experiments were performed to investigate the role of PTEN as a downstream target of miR-214 in diabetic MC hypertrophy. [score:1]
We constructed a wild type (WT) or mutated (MU) PTEN-psi-CHECK-2 vector (the mutated complementary sequences of 3′ UTR of PTEN for the seed sequence of miR-214) (Fig. 3E). [score:1]
How to cite this article: Wang, X. et al. Cross talk between miR-214 and PTEN attenuates glomerular hypertrophy under diabetic conditions. [score:1]
Thus, the effects of miR-214 inhibition on the morphology of human MCs and podocyte injury in diabetes need to be further investigated in future studies. [score:1]
The 3′ UTR of human PTEN (Gene ID: 5728) containing complementary sequences for the seed sequence of miR-214 was amplified by PCR and cloned into the psi-CHECK-2 Vector (Promega, WI) (a wild type of psi-CHECK-2-PTEN-3′UTR, WT). [score:1]
These findings suggest that miR-214 may represent a novel therapeutic approach for DN. [score:1]
miR-214+PTEN. [score:1]
Our study demonstrated that cross talk between miR-214 and PTEN attenuated glomerular hypertrophy under diabetic conditions in vivo and in vitro. [score:1]
[1 to 20 of 74 sentences]
11
[+] score: 247
Some studies have reported that miR-214 was up-regulated and contributed to disease progression and distant metastases in malignant melanoma [18, 19], whereas others have indicated that miR-214 was down-regulated and had a tumor-suppressive effect in cervical cancer [20], breast cancer [21] and human hepatocellular carcinoma [22]. [score:11]
We detected the expression level of miR-214 in 106 pairs of human bladder cancer frozen tissues and matched adjacent normal specimens by qRT-PCR and discovered that miR-214 was significantly underexpressed in bladder cancer tissues (P < 0.001) with the median expression level ten-fold lower than that of the noncancerous specimens (median expression = 0.084 and 0.864, respectively) (Fig. 1A). [score:9]
In conclusion, this is the first report elaborating that miR-214, whose attenuated expression in bladder cancer tissues is associated with worse prognosis, functions as a tumor suppressor by negatively regulating oncogene PDRG1 expression. [score:8]
miRNA expressing profiling studies showed that miR-214 was down-regulated in malignant bladder tissue samples and significantly differentially expressed between NMIBC and MIBC [23, 24]. [score:8]
As shown in Fig. 4B, miR-214 significantly suppressed the relative luciferase activity of the reporter containing wild-type 3′-UTR but not the mutant reporter, signifying that PDRG1 is a direct downstream target for miR-214 in bladder cancer cells. [score:6]
These findings manifest that miR-214 may play a tumor-suppressive role in bladder cancer and its downregulation be embroiled in cancer progression. [score:6]
Altogether, the suppressive effects on bladder cancer cell growth and metastasis combined with proapoptotic role of miR-214 might make for the poor prognosis of bladder cancer patients with low expression of miR-214. [score:5]
Kaplan-Meier survival curve revealed that bladder cancer patients with low miR-214 expression underwent significantly shorter RFS (log-rank test = 26.207; P < 0.0001) and OS (log-rank test = 45.174; P < 0.0001) than those with high expression (Fig. 1D), while multivariate Cox regression analysis showed that miR-214 was neither independent prognostic variable of RFS (P = 0.269) nor OS (P = 0.397) for bladder cancer patients. [score:5]
Restoration of miR-214 lowered PDRG1 expression in both mRNA and protein levels, suggesting that miR-214 reduce PDRG1 expression by degrading its mRNA. [score:5]
Integrated bioinformatics analysis (targetScan, picTar, PITA and miRanda) recognizes PDRG1 as miR-214 target gene. [score:5]
For instance, miR-214 suppressed growth and invasiveness of cervical cancer cells by targeting UDP-N-acetyl-α-D-galactosamine [20]. [score:5]
In vitro functional studies demonstrated that reexpression of miR-214 in bladder cancer cells induced phenotypes consistent with decreased cellular proliferation, migration and invasion concomitant with increased apoptosis, confirming the tumor-suppressive role of miR-214 in bladder cancer. [score:5]
Taken together, our results forcefully verify that miR-214 negatively regulates PDRG1 expression by directly binding to its 3′-UTR complimentary sequences. [score:5]
We further assessed the correlation between miR-214 expression in bladder cancer tissues and clinicopathologic features (Table 1) and observed that the attenuated miR-214 expression was significantly associated with higher tumor stage (P < 0.001), higher lymph node status (P < 0.001), higher grade (P < 0.001), multifocality (P = 0.003) and history of NMIBC (P = 0.033). [score:5]
Consistent with this, depressed endogenous expression of PDRG1 in both mRNA and protein levels were observed in miR-214 reexpressed bladder cancer cells (Fig. 4C and 4D). [score:5]
miR-214 negatively regulated PDRG1 expression by directly binding to its 3′-UTR complimentary sequences. [score:5]
Thus far, miR-214 -mediated regulation of PDRG1 has not been reported before and is a discovery of particular importance as the rarely studied PDRG1 could involve in regulating cellular stress response, cancer development and progress [38]. [score:4]
PDRG1 knockdown recapitulated the effects of miR-214 overexpression, further illustrating that the anti-tumor role of miR-214 may be mediated primarily via oncogene PDRG1. [score:4]
Furthermore, the oncogene PDRG1 was verified for the first time as a direct downstream target of miR-214 in bladder cancer. [score:4]
Nevertheless, miR-214 serving as oncogene had been found up-regulated in other human cancers such as ovarian, stomach, pancreatic, cervical, lung, nasopharyngeal and oral mucosal cancers and malignant melanomas [18, 19, 29– 32]. [score:4]
To sum up, these findings suggest that miR-214 regulate PDRG1 to exert its tumor-suppressive effects. [score:4]
miR-214 regulated enhancer of zeste homolog 2 and inhibited migration and invasion in human esophageal squamous cell carcinoma [28]. [score:4]
Downregulation of miR-214 contributed to tumor angiogenesis by inducing secretion of the hepatoma-derived growth factor in human hepatoma [22]. [score:4]
This report implicated a tumor suppressor role and regulatory mechanisms for miR-214 in bladder cancer. [score:4]
Above all, PDRG1 knockdown through siRNA technique mimicked the effects induced by enforced expression of miR-214, further indicating that PDRG1 may serve as a downstream functional mediator for miR-214. [score:4]
Oncogene PDRG1 is a direct downstream target of miR-214. [score:4]
PDRG1 knockdown recapitulates the effects of miR-214 reexpression in bladder cancer cells. [score:4]
In the process of assessing the prognostic significance of miR-214, we discovered that bladder cancer patients with low miR-214 expression had a significantly higher recurrence and shorter overall survival after surgery and multivariate analysis identified miR-214 as an independent prognostic factor for RFS and OS in patients with MIBC. [score:3]
revealed that PDRG1 had a miR-214 binding site in its 3′ UTR and PDRG1 was inversely related to miR-214 expression in bladder cancer clinical specimens. [score:3]
In this study, we assessed expression level of miR-214 in human bladder cancer tissues, analyzed its feasible prognostic relevance and performed relevant functional experiments. [score:3]
miR-214 reintroduction suppresses oncogenicity in vitro. [score:3]
We discovered that miR-214 could inhibit bladder cancer cell proliferation, migration, invasion and exert essential proapoptotic function. [score:3]
The cut-off point was the median miR-214 expression level in the bladder cancer tissue samples. [score:3]
Integrated bioinformatics analysis (targetScan, picTar, PITA and miRanda) demonstrates that PDRG1 contains one potential complimentary miR-214 -binding site on its 3′-UTR (Fig. 4A). [score:3]
miR-214 reintroduction inhibited cell proliferation and promoted apoptosis in vitro. [score:3]
0118086.g001 Fig 1 (A) Expression level of miR-214 was determined by means of qRT-PCR and normalized against U6 RNA, an endogenous control, in 106 pairs of human bladder cancer tissues (BC) and matched adjacent normal tissues (NT). [score:3]
miR-214 expression was frequently attenuated in bladder cancer tissues and associated with poor progonosis. [score:3]
Target gene search for miR-214. [score:3]
Attenuation of miR-214 expression was assessed in approximately 74% of bladder cancer tissues and associated with higher tumor stage, higher lymph node status, higher grade, multifocality and history of NMIBC, suggesting that miR-214 may be embroiled in cancer progression. [score:3]
Moreover, there was an inverse correlation between miR-214 and the PDRG1 expression in bladder cancer tissues (Fig. 4E). [score:3]
The expression levels of miR-214 and PDRG1 were quantified by way of qRT-PCR using Realtime PCR Master mix kit (TOYOBO, Osaka, Japan) and ABI 7500 real-time PCR system (Applied Biosystems, Foster city, USA) with snRNA U6 as their endogenous reference gene. [score:3]
Clinicopathologic parameters and expression of miR-214 and PDRG1 in bladder cancer. [score:3]
In our study, attenuated miR-214 expression resulting from genomic loss or other mechanisms coupled with increased PDRG1 level may provide new prognostic biomarkers for the intervention of bladder cancer. [score:3]
Kaplan-Meier survival analysis revealed that decreased expression of miR-214 was significantly associated with poorer prognosis in terms of both RFS (log-rank test = 14.214; P = 0.0002) and OS (log-rank test = 13.797; P = 0.0002) (Fig. 1E). [score:3]
The cut-off point was the median miR-214 expression level in the MIBC tissue samples. [score:3]
It is noticeable that functional disparities of miR-214 in different types of cancer may result from its diverse target genes or distinction among tissue types and cellular circumstances. [score:3]
miR-214 was significantly down-regulated in tumorigenic bladder cancer cell lines compared with nonmalignant immortalized bladder epithelial cell line. [score:3]
To identify potential target genes of miR-214, we took advantage of an integrated bioinformatics analysis, starBase v 2.0 (http://starbase. [score:3]
miR-214 restoration inhibited cell migration and invasion in vitro. [score:3]
These observations demonstrate that miR-214 reintroduction suppresses the oncogenicity of bladder cancer cells in vitro. [score:3]
Relative miR-214 expression in T24 and 5637 cells transfected with miR-214 mimic was 22319 and 10276 times higher than that transfected with miR-NC mimic confirmed by way of real-time PCR 24 hours posttransfection (Fig. 2B). [score:3]
0216) N2 13 0.0122(0.0012–0.1145) 0.0127(0.0001–0.0262) N3 9 0.0042(0.0029–0.0419) 0.0109(0.0043–0.0243) (A) Expression level of miR-214 was determined by means of qRT-PCR and normalized against U6 RNA, an endogenous control, in 106 pairs of human bladder cancer tissues (BC) and matched adjacent normal tissues (NT). [score:3]
The Wilcoxon test was used to compare miR-214 expression in paired bladder cancer tissues and adjacent normal tissues. [score:3]
As shown in Fig. 3C, transwell invasion assay with matrigel coating presented that miR-214 reexpression also significantly impaired the invasion ability of both cell lines. [score:2]
What’s more, apoptotic cell fractions were significantly increased upon PDRG1 knockdown in comparision with control as observed upon miR-214 reintroduction (Fig. 5D). [score:2]
So far, there have been little published papers involving the functional analysis and molecular network of miR-214 in bladder cancer, though a few miRNA profiling studies showed that miR-214 was dysregulated in bladder cancer [23, 24]. [score:2]
Our findings presented that miR-214 dysregulation could serve as a novel prognostic biomarker for MIBC, just as it can be prognosticator in human hepatoma [22]. [score:2]
In the NMIBC group, after a median follow-up of 59 months (range, 42–79months), 54.8% of NMIBC patients (17/31) presented recurrence, but miR-214 neither predicted RFS nor OS when deregulated by Kaplan-Meier analysis. [score:2]
miR-214 mimic and miR -negative control (miR-NC) mimic were used in the gain-of-function experiments, whereas si-PDRG1 and si -negative control (si-NC) were used in the loss-of-function experiments. [score:1]
The above evidence points out that miR-214 may play pivotal and diverse roles in oncogenesis of various tumor types, yet potential mechanisms of miR-214 are still not completely unraveled. [score:1]
A limitation to this study was that we were unable to carry out an in vivo study and further mouse xenograft mo del will be conducive to inspecting the therapeutic value of miR-214 in bladder cancer. [score:1]
As indicated in Fig. 2C, significant proliferation inhibitions were observed in miR-214-enhanced cells compared with control by Cell Counting Kit-8 assay. [score:1]
Here we demonstrated that miR-214 restoration markedly induced apoptosis, verifying the important proapoptotic role of miR-214. [score:1]
Bladder cancer cells in 96-well plates were co -transfected with miR-NC/miR-214 mimics and WT- PDRG1 3′-UTR vector/MUT- PDRG1 3′-UTR vector using Lipofectamine 2000 (Invitrogen). [score:1]
0118086.g004 Fig 4(A) Sketch of the presumptive miR-214 binding sequences in PDRG1 3′-UTR and structure of wild-type or mutant PDRG1 pmiR-REPORT vectors. [score:1]
Decreased miR-214 levels in breast cancer cells coincided with increased cell proliferation, invasion and accumulation of the Polycomb Ezh2 methyltransferase [21]. [score:1]
We also observed that apoptotic cell proportion was significantly increased upon miR-214 restoration compared with miR-NC by flow cytometry (Fig. 2D), indicating a proapoptotic role of miR-214 in regulating carcinogenesis. [score:1]
Nevertheless, no significant correlation was found between miR-214 expression and other clinicopathological characteristics. [score:1]
Moreover, bladder cancer cells overexpressing miR-214 displayed a significant reduction in migration ability in comparison with the controls by the wound healing assay (Fig. 3A) and transwell migration assay (Fig. 3B). [score:1]
miR-214 is frequently attenuated in bladder cancer which is embroiled in cancer progression. [score:1]
miR-214 serves as an independent prognostic predicator for patients with MIBC. [score:1]
However, the interaction between miR-214 and PDRG1 has not been reported. [score:1]
In addition, urinary levels of cell-free miR-214 have been reported to be an independent prognostic parameter for NMIBC recurrence [35]. [score:1]
Multivariate Cox regression analysis including age, history of NMIBC, tumor stage, lymph node status and miRNA-214 showed that stage, lymph node status and miRNA-214 were independent prognostic predicators of RFS and OS for MIBC (Table 2). [score:1]
In addition, at least one copy of the miR-214 alleles was found to be deleted in 24% of primary breast tumors [21]. [score:1]
[1 to 20 of 75 sentences]
12
[+] score: 234
Other miRNAs from this paper: hsa-mir-101-1, hsa-mir-30d, hsa-mir-101-2
Co -expression of UCP2-3’UTR constructs with miR-214 mimics in MCF7 cells resulted in an inhibition of the relative luciferase activity by 83.7 ± 1.1 % (P < 0.01) as compared with negative control miRNA mimics; whereas miR-214 mimics did not significantly inhibit luciferase activity in the cells expressing mutant UCP2-3’UTR. [score:8]
As shown in Fig.   3c, the level of LC3-II was significantly reduced in MCF7 cells overexpressing miR-214, whereas miR-214 inhibitors stimulated the expression of cleaved LC3-II (Fig.   3c). [score:7]
The potential regulatory target of miR-214 was determined by prediction tool, target protein expression and luciferase reporter assay. [score:7]
Upregulation of miR-214 led to the inhibition of breast cancer growth and invasion [22]. [score:6]
Further study showed that miR-214 might exert its inhibitory effect on autophagy by targeting UCP2. [score:5]
We thus concluded that miR-214 inhibited the TAM/FUL induced autophagy through suppression of UCP2. [score:5]
The formation of autophagosomes (GFP-LC3 dots) was significantly inhibited in the miR-214 overexpressing cells (Fig.   3e up). [score:5]
By contrast, the downregulation of this miR has been associated with cancer progression and metastasis in some other caner types, such as breast cancers, suggesting that tight regulation of miR-214 is important for cellular function [21, 22]. [score:5]
MCF7 cells grown in 6-well plate were transfected with 2 μg UCP2 expression plasmid, 200 nM UCP2 siRNA or 100 nM miR-214 mimics and inhibitors as well as corresponding negative control for 24 h. Cells were then treated with 5 μM 4-OHT for additional 48 h in 5 % DCC-FBS/DMEM. [score:5]
These results suggested that miR-214 might directly bind to the 3’UTR of UCP2 and modulate UCP2 expression. [score:4]
MiR-214 was found to downregulate UCP2 by targeting the site in 3’UTR of UCP2 gene determined by dual luciferase reporter assay (Fig.   4f). [score:4]
The inhibitory effect of miR-214 on the expression of UCP2 protein was also analyzed by immunofluorescence assay. [score:4]
In our pilot study, miR-214 was found downregulated in human breast cancer tissue specimens. [score:4]
UCP2 was identified to be a direct target of miR-214. [score:4]
The upregulation of endogenous miR-214 has been linked with increased proliferation, migration, invasion, extravasation and metastasis in specific cancer types, such as pancreatic, cervical, hepatocellular, gastric, prostate and ovarian cancer [20]. [score:4]
MiR-214 increased the sensitivity of breast cancers to TAM and FUL through inhibition of autophagy by targeting UCP2. [score:4]
On the other hand, miR-214 enhanced the cisplatin -induced cytotoxicity through down-regulation of Bcl2l2 in cervical cancer cells [38]. [score:4]
Further study showed that miR-214 might reduce autophagy by directly targeting UCP2. [score:4]
UCP2 is a direct target of miR-214. [score:4]
e MCF7 cells were transfected with 100 nM miR-214 mimics or inhibitors for 48 h. The expression and location of the Rhodamine-labeled UCP2 were determined by the immunofluorescence assay. [score:4]
In this study, miR-214 was found downregulated in human breast cancer tissues and decreased in response to 4-OHT/FUL. [score:4]
MiR-214 increased the sensitivity of breast cancer cells to TAM and FUL through inhibition of autophagy by targeting UCP2. [score:4]
c and d) MCF7 cells were transfected with 100 nM miR-214 mimics (214 m) or inhibitors (214i) for 24 h, then were treated with or without 5 μM 4-OHT or 1 μM FUL for 48 h. Western blotting was performed to analyze LC3-II normalized to β-actin. [score:3]
To evidence this hypothesis, we analyzed the expression of miR-214 and UCP2 in human breast cancer tissue specimens. [score:3]
When cells were exposed to 4-OHT or FUL, miR-214 mimics and inhibitors had opposite effects on autophagy. [score:3]
c, d) MCF7 cells were transfected with 100 nM miR-214 mimics, then RT-qPCR was performed to analyze the expression of miR-214 and UCP2 mRNA. [score:3]
Based on the observation of relevance between UCP2 and miR-214, we hypothesized that miR-214 might increase the 4-OHT -induced apoptosis through inhibition of UCP2. [score:3]
Importantly, miR-214 increased the TAM/FUL -induced apoptosis while inhibited autophagy. [score:3]
In this study, miR-214 was found to sensitize breast cancer cells to 4-OHT or FUL by inhibition of autophagy. [score:3]
a RT-qPCR was performed to analyze the expression of miR-214 relative to RNU6 in 20 pairs of breast cancer tissues. [score:3]
The level of UCP2 mRNA was significantly reduced in the miR-214 overexpressing cells (Fig.   4c, d). [score:3]
These results indicated that miR-214 inhibited autophagy at the basal level. [score:3]
negative control (NC)To identify the target gene of miR-214, MCF-7 cells were transfected with miR-214 mimics or negative control. [score:3]
However, miR-214 inhibitor did not significantly affect the viability of MCF7 cells treated with 4-OHT/FUL. [score:3]
To our interest, UCP2, a mitochondrial protein that has been implicated in the production of intracellular Reactive oxygen species (ROS), might be targeted by miR-214. [score:3]
Fig. 4UCP2 was identified the target gene of miR-214. [score:3]
On the contrary, the number of GFP-LC3 dots in the MCF7 cells transfected with miR-214 inhibitors was obviously increased. [score:3]
e MCF7 cells were co -transfected with GFP-LC3 and 100 nM miR-214 mimics or inhibitors for 48 h in the presence or absence of 5 mM 3-MA. [score:3]
MiR-214 was found downregulated in breast cancers [22]. [score:3]
Lower level of miR-214 was observed in most of cancer tissues (15/20, 75.0 %), while UCP2 mRNA was significantly upregulated (17/20, 85.0 %) as compared with the matched normal tissues (P = 0.0013 and P = 0.0022, respectively) (Fig.   4a, b). [score:3]
The expression of miR-214 and uncoupling protein 2 (UCP2) was determined by RT-qPCR and Western blot in breast cancer cells and human breast cancer tissue specimens. [score:3]
transfection of miR-214 inhibitors (214i), n = 10). [score:3]
MCF7 cells seeded in 6-well plate were transfected with 100 nM negative control or miR-214 mimics and inhibitors for 24 h. Cells were trypsinized into 96-well plates at a density of 8 × 10 [3] cells/well and then treated with 5 μΜ 4-OHT, or 1 μM FUL for 72 h.. [score:3]
These autophagic markers were dramatically augmented in the MCF7 cells transfected with miR-214 inhibitors (Fig.   3d, bottom). [score:3]
Using ER [+] breast cancer cell lines, miR-214 increased the sensitivity of cancer cells to TAM and FUL through inhibition of autophagy. [score:3]
Our results showed that reduction of miR-214 was associated with elevated autophagy and endocrine resistance, while overexpression of miR-214 represses both basal and the 4-OHT/FUL -induced autophagy. [score:3]
negative control (NC) To identify the target gene of miR-214, MCF-7 cells were transfected with miR-214 mimics or negative control. [score:3]
Since autophagy plays a prosurvival role and contributes to drug resistance, it is likely that miR-214 mimics might enhance the sensitivity of breast cancer cells to the 4-OHT/FUL -induced apoptosis by the inhibition of autophagy. [score:3]
On one hand, high level of miR-214 enhanced the stemness and chemoresistance in ovarian cancers by targeting p53/Nanog [35]. [score:3]
MCF7 or MCF7/LCC9 cells were transfected either with 200 nM UCP2 siRNA or 100 nM miR-214 mimics/inhibitors for 48 h. Corresponding negative control was concurrently used in all experimental system. [score:3]
b The expression of miR-214 was analyzed by RT-qPCR. [score:3]
The binding of miR-214 to the target site in the 3’UTR of UCP2 was identified by cloning the wild-type (WT) and mutant UCP2 3’UTR behind the luciferase gene in pISO vector. [score:3]
These results implied that miR-214 might play important roles in the regulation of the 4-OHT/FUL -induced autophagy. [score:2]
MiR-214 increased the sensitivity of breast cancer cells to the 4-OHT/FUL -induced apoptosis through inhibition of autophagy. [score:2]
MiR-214 mimics and inhibitors were also purchased from GenePharma (Shanghai, China). [score:2]
Based on currently available information, we have proposed a schematic mo del between miR-214, UCP2, beclin-1, LC3-I/II, Bax, Caspase-9, PARP, and Akt/mTOR in the regulation of autophagy and apoptosis after TAM/FUL treatment (Fig.   7). [score:2]
a MCF7 cells were transfected with 100 nM miR-214 mimics (214 m) or inhibitors (214i) for 24 h. Cells were then treated with 5 μM 4-OHT or 1 μM FUL for 72 h. Cell viability was estimated by the MTT assay. [score:2]
When MCF7 cells were transfected with miR-214 mimics, the percentage of inhibition by 4-OHT or FUL was significantly increased as compared to negative control cells (33.3 ± 2.1 % by 4-OHT, and 47.8 ± 1.1 % by FUL, respectively, P < 0.01). [score:2]
In contrast, MCF7 cells transfected with miR-214 inhibitors produced a significant increase of 1.8 ± 0.3 fold in the fluorescence intensity of UCP2 as compared with negative control cells (P < 0.01 vs. [score:2]
Further evidence was found by Western blotting assay in MCF7 cells transfected with miR-214 mimics or inhibitors. [score:2]
MiR-214 inhibits both basal and the 4-OHT/FUL -induced autophagy. [score:2]
In this study, miR-214 increased the sensitivity of breast cancer cells to the TAM/FUL -induced apoptosis. [score:1]
This result was confirmed by our observation in human breast cancer tissue specimens that the levels of miR-214 were negatively correlated with UCP2. [score:1]
As shown in Fig.   3d, in response to 4-OHT or FUL, the miR-214 mimics -transfected MCF7 cells demonstrated lower levels of LC3-II than negative control cells (Fig.   3d, above). [score:1]
A potential correlation of miR-214 and UCP2 was observed in 20 pairs of human breast cancer tissues and matched normal tissues. [score:1]
Cells transfected with miR-214 mimics had higher levels of apoptotic proteins than negative control cells in response to 4-OHT or FUL exposure (Fig.   2c, P < 0.01 vs. [score:1]
b MCF7 cells were transfected with 100 nM miR-214 mimics (214 m) or negative control (NC). [score:1]
Further analysis showed that the level of miR-214 was negatively correlated with the elevation of UCP2 mRNA (Pearson γ = -0.49, P = 0.028). [score:1]
MiR-214 is often dysregulated in various cancers and its functions vary largely with tissue types. [score:1]
In this study, we examined the effects of miR-214 on sensitivity of breast cancer cells to TAM and FUL in the ER [+] and estrogen/TAM-sensitive MCF7 cells and antiestrogen-resistant MCF7/LCC9 cells. [score:1]
MiR-214 was thus considered as a tumor suppressor in many cancers. [score:1]
The fluorescence intensity was significantly reduced by 33.1 ± 7.6 % in the miR-214 mimics -transfected cells (P < 0.01 vs. [score:1]
Data represent mean ± SD of three experiments Having established a link between miR-214 and autophagy, we further investigated the mechanism of miR-214 by identifying its downstream targets. [score:1]
RT-qPCR was performed to analyze the level of miR-214 (c). [score:1]
Fig. 7 A summary of the relationships between miR-214, UCP2, beclin-1, LC3-II, Bax, Caspase-9, PARP, and PI3K-Akt-mTOR after TAM/FUL treatment. [score:1]
f MCF7 cells were transfected with luciferase constructs and miR-214 mimics. [score:1]
Accumulating studies have shed light on the potential of miR-214 as the therapeutic strategy for cancers. [score:1]
In addition, miR-214 has been shown to induce apoptosis in some cancer types [23]. [score:1]
There was a significant difference in the percentage of apoptotic cells between the miR-214 -transfected cells and negative control cells in response to 4-OHT treatment (Fig.   2b, P < 0.05). [score:1]
These results indicated that MCF7 cells transfected with miR-214 mimics exhibited higher sensitivity to 4-OHT/FUL than the cells transfected with negative control miRNA. [score:1]
Cells transfected with miR-214 mimics demonstrated higher levels of apoptosis than negative control cells (P < 0.05). [score:1]
We analyzed the specific autophagy marker LC3 in the miR-214 mimics -transfected cells. [score:1]
[1 to 20 of 82 sentences]
13
[+] score: 233
These results indicated that down-regulation of PTEN expression could significantly attenuate the inhibitory effect of anti-miR-214 on cell proliferation, migration and invasion, suggesting that the anti-miR-214 inhibits the proliferation, migration and invasion of gastric cancer cells through the PTEN -mediated signal pathway. [score:10]
miR-214 post-transcriptionally down-regulates PTEN expression by targeting the 3’ untranslated region of PTEN. [score:10]
A recent study determined the relationship between miRNA expression and progression of gastric cancer, which showed that 22 microRNAs were up-regulated, and 13 were down-regulated in gastric cancer, including miR-214 [10]. [score:9]
Here, we have demonstrated that knockdown of miR-214 could inhibit proliferation, migration and invasion capacity of gastric cancer cells by negatively regulating tumor suppressor PTEN at the post-transcriptional level via binding to non-coding regions of PTEN. [score:7]
In the present study, we found that the expression level of miR-214 was up-regulated in gastric cancer tissue compared with matched normal tissue, and miR-214 expression level was significantly associated with clinical progression and poor prognosis. [score:7]
The expression level of miR-214 is up-regulated and inversely correlated with PTEN mRNA in gastric cancer tissues. [score:6]
Down-regulation of PTEN could significantly attenuated the inhibitory effects of anti-miR-214 on the proliferation, migration and invasion of gastric cancer cell lines. [score:6]
In addition, miR-214 expression was elevated in pancreatic cancer tissues compared with matched benign pancreatic tissues, and overexpression of miR-214 could decreased the sensitivity of the pancreatic cancer cells to gemcitabine by targeting ING4 mRNA [18]. [score:6]
In summary, we have demonstrated that miR-214 is overexpressed in gastric cancer, and knockdown of miR-214 can significantly inhibit the proliferation, migration and invasion capacity of gastric cancer cell through the PTEN -mediated signal pathway, which has not been documented in previous studies. [score:6]
Figure 2 Down-regulation of miR-214 inhibits the proliferation, migration and invasion of BGC-823 gastric cancer cell lines. [score:6]
Figure 3 miR-214 post-transcriptionally regulates PTEN expression by targeting the 3’-UTR of PTEN. [score:6]
Meanwhile, miR-214 is down-regulated in human cervical cancer tissue compared with normal tissue and that it negatively regulates HeLa cell proliferation by targeting the noncoding regions of MEK3 and JNK1 mRNAs [19]. [score:6]
Specially, we found that the proliferative, migratory and invasive capacity of gastric cancer cells transfected with anti-miR-214 was significantly lower than that of cells transfected with control anti-miRNA, suggesting that repressing miR-214 expression could inhibit the proliferative and progressive capacity of gastric cancer cells. [score:5]
Then, 1 × 10 [6] cells were cotransfected with 50 pmol of miR-214 inhibitor (or control miRNA), 1 μg of pGL3-PTEN (or pGL3-PTEN-mut) plasmid, and 1 μg of a Renilla luciferase expression construct pRL-TK (Promega, WI) using Lipofectamine 2000. [score:5]
BGC-823 and SGC-7901 gastric cancer cell lines were transfected respectively with the Renilla luciferase expression construct pRL-TK and pGL3-PTEN-3’-UTR firefly luciferase expression construct, along with either anti-miR-214 or control anti-miRNA. [score:5]
Whereas, the expression of PTEN mRNA in gastric cancer tissues is lower than that in normal gastric mucosa tissues (C), in addition, we found an inverse correlation between the expression of miR-214 and the level of PTEN mRNA in gastric cancer tissues, but not in normal tissues (D, E). [score:5]
Furthermore, the expression of miR-214 is significantly associated with invasion, metastasis and TNM stage according to the clinicopathologic data from the gastric cancer patients (Table  1), and clinical relevance was confirmed by the observation that miR-214 overexpression correlated with poor prognosis (Figure  1F). [score:5]
Kaplan-Meier survival curves for 120 gastric cancer cases, low expression of miR-214 (red) was defined as long survival, and high expression (green) was defined as short survival (F). [score:5]
In addition, we observed a highly significant negative correlation between miR-214 and PTEN expression in tumor tissues, suggesting that miR-214 could be involved in the regulation of PTEN in gastric cancer. [score:4]
Figure 4 Down-regulation of PTEN attenuates the effects of anti-miR-214 on BGC-823 gastric cancer cell proliferation, migration and invasion. [score:4]
Our study results show that overexpression of miR-214 is significantly associated with metastasis and invasion and poor prognosis in gastric cancer, moreover, it could negatively regulates PTEN by binding to their 3’-UTR regions to affect gastric cancer cell proliferation, migration and invasion. [score:4]
In addition, knockdown of miR-214 could significantly inhibit proliferation, migration and invasion of gastric cancer cells. [score:4]
These findings indicated that miR-214 regulated the proliferation, migration and invasion by targeting PTEN post-transcriptionally in gastric cancer. [score:4]
Both SGC-7901 and BGC-823 cells express higher levels of miR-214 compared with normal gastric mucosa epithelial cell lines GES-1 (A), the expression of miR-214 in gastric cancer tissues is higher than that in normal gastric mucosa tissues (B). [score:4]
These results provide strong evidence that knockdown of miR-214 could inhibit the proliferation, migration and invasion of gastric cancer cells. [score:4]
Knockdown of miR-214 could inhibit the proliferation, migration and invasion of gastric cancer cell lines. [score:4]
Figure 1 Expression of miR-214 and PTEN in gastric cancer cell and tissue specimens. [score:3]
It was reported that the 3’-UTR of PTEN contains the miR-214 target sequence [13]. [score:3]
1×106 cells cultured in a well of 6-well cell culture plate were transiently transfected with 50 pmol of miR-214 inhibitor (or control microRNA) and PTEN siRNA oligonucleotide duplexes (or control siRNA) using Lipofectamine 2000 (Invitrogen, US) according to the manufacturer’s protocol, respectively. [score:3]
Across all specimens tested, we found an inverse correlation between the expression of miR-214 and the level of PTEN mRNA (Figure  1D, r=−0.349, P=0.027), but not in normal tissues (Figure  1E, r=−0.026, P=0.641). [score:3]
showed that the expression level of PTEN mRNA exhibited no significantly difference between cells transfected with anti-miR-214 and those transfected with control anti-miRNA. [score:3]
It was previously reported that miR-214 is involved in the murine aging process [16], modulates Hedgehog signaling to specify muscle cell fate [17], and induces cell survival and cisplatin resistance by targeting PTEN in human ovarian cancer [7]. [score:3]
The expression level of miR-214 is significantly associated with clinical progression and poor prognosis according to the analysis of the clinicopathologic data. [score:3]
Considering the different miRNA have different roles and target genes in different tumors, so we have choosed two gastric cancer cell lines as a mo del to validated the regular effects of miR-214 on PTEN gene. [score:3]
The sequence used were: 5’-ACUGCCUGUCUGU GCCUGCUGU-3’ (miR-214 inhibitor oligonucleotide); 5’-CAGUACUUUUGUGUAGUAC AA-3’ (control oligonucleotide). [score:3]
miR-214 was noted to be highly overexpressed in gastric cancer tissues and cell lines using qRT-PCR. [score:3]
Pearson’s correlation was used to estimate the relationship between expression levels of miR-214 and PTEN mRNA. [score:3]
We further determined the expression of PTEN protein and mRNA by and qRT-PCR in gastric cancer cells transfected with anti-miR-214 (or control anti-miRNA). [score:3]
The quantitative RT-PCR detection results showed that the expression levels of miR-214 were significantly higher in gastric cancer cell lines in comparison with the normal gastric mucosa epithelial cell lines (Figure  1A). [score:3]
These results indicate that the 3’-UTR of PTEN mRNA is a functional target of miR-214 in gastric cancer cells. [score:3]
Combining with the target reporter assays, we further have demonstrated that miR-214 post-transcriptionally regulates PTEN via binding the 3’-UTR of PTEN mRNA. [score:3]
miR-214 and PTEN expression was determined in gastric cancer and matched normal tissues, and human gastric cancer cell lines by quantitative real-time PCR. [score:3]
At 48 hr posttransfection, revealed that the expression level of PTEN in cells cotransfected with anti-miR-214 and PTEN siRNA plasmid was significantly lower than that in cells cotransfected with anti-miR-214 and control plasmid (Figure  4A and B). [score:3]
In the meantime, miR-214 overexpression is also observed in gastric cancer tissues compared to normal gastric mucosa tissues (Figure  1B). [score:2]
These data suggest that miR-214 may be involved in the regulation of PTEN in gastric cancer. [score:2]
As shown in Figure  3C and 3D, the expression of PTEN protein was significantly increased in cells transfected with anti-miR-214 as compared to the cells treated with control anti-miRNA at 48 hr post-transfection. [score:2]
showed that the expression level of PTEN protein was significantly lower in cells co -transfected with anti-miR-214 and siRNA-PTEN as compared to the cells transfected with anti-miR-214 and control siRNA. [score:2]
To investigate whether miR-214 directly can alter the expression of PTEN in gastric cancer cells, a fragment of the 3’-UTR of PTEN mRNA, containing the putative miR-214 binding sequence, was cloned into a firefly luciferase reporter construct, and cotransfected with a control Renilla luciferase reporter construct into gastric cancer cells along with either anti-miR-214 or control anti-miRNA. [score:2]
Moreover, we demonstrate that PTEN is regulated negatively by miR-214 through a miR-214 binding site within the 3’-UTR of PTEN at the posttranscriptional level in gastric cancer cells. [score:2]
However, the reporter activity of cells co -transfected with anti-miR-214 and pGL3-PTEN-mut plasmid showed no significant difference with that of cells cotransfected with control microRNA and pGL3-PTEN-mut plasmid. [score:1]
Thus, we investigated the relationship between expression level of miR-214 and clinic pathological feature and prognosis in gastric cancer, and further studied the possible function of miR-214 in the gastric cancer cell line. [score:1]
In addition, cells treated with anti-miR-214 had a significantly longer population doubling time, lower proliferative index and colony forming efficiency than cells transfected with control anti-miRNA (Figure  2B-F). [score:1]
showed that the proliferative capacity of cells co -transfected with anti-miR-214 and siRNA-PTEN was significantly higher than that of cells co -transfected with anti-miR-214 and control siRNA. [score:1]
However, the specific role and molecular mechanism of miR-214 in gastric cancer cells remains unknown. [score:1]
To further evaluate the contribution of PTEN to biological effects of miR-214, we assessed the impact of PTEN silencing by RNA interference, and hence PTEN expression on anti-miR-214 dependent cell proliferation, migration and invasion in BGC-823 gastric cancer cell lines. [score:1]
All these evidence indicated that miR-214 may be involved in gastric cancer carcinogenesis. [score:1]
Our study data suggest that miR-214 may be useful as a novel potential therapeutic approach for the treatment of gastric cancer. [score:1]
showed that number migrating across the membrane with or without matrigel of cells transfected with anti-miR-214 was significantly less than that of cells transfected with control anti-miRNA. [score:1]
showed that the colony forming efficiency (CFE) of cells transfected with anti-miR-214 was significantly lower than that of cells transfected with control anti-miRNA. [score:1]
We also found that the miR-214 levels are inversely correlated with PTEN in tumor tissues. [score:1]
The full-length 3’-UTR segments of PTEN mRNA containing the miR-214 binding site was amplified by PCR and inserted into the Xba1-site of pGL3 vector (Promega, WI) and named pGL3-PTEN. [score:1]
showed that cells co -transfected with miR-214 and pGL3-PTEN plasmid exhibited a significant increase of reporter activity in comparison with those co -transfected with the control anti-miRNA and pGL3-PTEN plasmid. [score:1]
Meanwhile, it showed that cell number migrating across the membrane with or without matrigel of cells transfected with anti-miR-214 was significantly less than that of cells transfected with control anti-miRNA (Figure  2G-H). [score:1]
showed that the PDT of cells transfected with anti-miR-214 was significantly longer than that of cells transfected with control anti-miRNA. [score:1]
As shown in Figure  3A, BGC-823 and SGC-7901 cell lines cotransfected with anti-miR-214 and pGL3-PTEN plasmid showed a significant increase of reporter activity in comparison with those cotransfected with the control anti-miRNA and pGL3-PTEN plasmid. [score:1]
Our data suggest that miR-214 is possible to become a potential therapeutic agent for gastric cancer. [score:1]
The roles of miR-214 in cell proliferation, migration and invasion were analyzed with anti-miR-214 transfected cells. [score:1]
showed that proliferative index (PI) of cells transfected with anti-miR-214 was significantly lower than that of cells transfected with control anti-miRNA. [score:1]
Detection of miR-214 and PTEN mRNA by qRT-PCR using U6 snRNA for normalization. [score:1]
showed that MTT value of cells transfected with anti-miR-214 was significantly lower than that of cells transfected with control anti-miRNA after 48 hr post-transfection. [score:1]
Subsequent studies showed that the effect of anti-miR-214 in decreasing both cell proliferation, migration as well as cell invasion was prevented by the presence of siRNA to PTEN in gastric cancer cell lines (Figure  4C-H). [score:1]
As shown in Figure  2A, MTT value of cells transfected with anti-miR-214 was significantly lower than that of cells transfected with control anti-miRNA after 48 hr post-transfection. [score:1]
[1 to 20 of 72 sentences]
14
[+] score: 228
Combined with the results of previous studies, we identified a new pathway in hPDLSC osteogenesis in which miR-214 suppressed ATF4 protein expression and accordingly repressed activation of OCN by decreasing the expression of RUNX2 (Figures 5(a) and 5(b)), thus downregulating osteogenesis. [score:10]
To confirm whether miR-214 indeed downregulates ATF4 expression, we examined the ATF4 expression level in hPDLSCs-miR-214 by qPCR and Western blot analysis. [score:8]
Protein processes of ATF4 follow transcriptional, translational, and posttranslational mechanisms [44, 45]; therefore, these data suggest that miR-214 posttranscriptionally modulates the gene expression of ATF4. [score:7]
Notably, overexpression of miR-214 apparently suppressed the expression level of these marker genes (Figure 5(c)). [score:7]
3.4. miR-214 Downregulates ATF4 Protein Expression. [score:6]
Our study seems to obtain a different result from the others, but because a microRNA could target different genes, and one gene could be regulated by different microRNAs, overexpressing miR-214 may activate other pathways to promote the adipogenesis of hPDLSCs, which should be further studied. [score:6]
In this study, we found changes in the miR-214 expression levels before and after osteogenic induction in hPDLSCs and used miRbase bioinformatic analysis to predict the direct target of miR-214. [score:6]
In summary, our data add a new layer of regulation to osteogenic differentiation from hPDLSCs by miRNAs and indicate that miR-214 suppresses osteogenic differentiation of hPDLSCs by targeting ATF4. [score:6]
The miR-214 expression level in hPDLSCs-miR-214 was confirmed by real-time PCR, and the result demonstrated that miR-214 expression was higher by approximately 24-fold in hPDLSCs-miR-214 than that in control cells (Figure 4(b)). [score:5]
In this study, we found that miR-214 suppressed osteogenesis in hPDLSCs and thus is a potential target for osteoregenerative therapy. [score:5]
Interestingly, gene expression analysis revealed no significant differences in ATF4 mRNA level (Figure 4(c)), while Western blot analysis showed decreased ATF4 protein level when miR-214 was overexpressed in hPDLSCs (Figure 4(d)). [score:5]
Transfection of hsa-miR-214 Inhibitor (Inhibitor-214). [score:5]
Our data showed that miR-214 suppressed hPDLSC osteogenic differentiation (Figures 5(a) and 5(b)), and the protein level of ATF4, its target gene, was decreased (Figure 5(d)). [score:5]
One study demonstrated that miR-214 targeted Osterix to inhibit osteogenic differentiation in C2C12 myoblast cells [26]. [score:5]
Next, we evaluated the influence of transfection with inhibitor-214 in hPDLSCs, and the osteogenic marker genes such as RUNX2, ALP, and OCN showed stronger expression levels after inhibited miR-214 (Figure 2(d)). [score:5]
One study showed that miR-214 inhibited osteoblast activity by targeting activating transcription factor 4 (ATF4) [27]. [score:5]
Another study suggested that osteoblast activity was suppressed by exosomal miR-214-3p derived from osteoclast in vitro and bone formation was inhibited in vivo [28]. [score:5]
This study found a regulatory role for miR-214 in the osteogenic differentiation of hPDLSCs by targeting ATF4. [score:4]
We found that during osteogenic differentiation, miR-214 was significantly downregulated. [score:4]
This study postulated a regulatory role for miR-214 in the osteogenic differentiation of hPDLSCs by targeting ATF4. [score:4]
However, it remains unclear whether the expression of miR-214 changes after osteogenic induction in hPDLSCs and, if so, what its regulation function may be. [score:4]
In general, ATF4 has been proved to be a vital regulator of insulin sensitivity and the target of miR-214. [score:4]
3.2. miR-214 Is Downregulated after Osteogenic Induction. [score:4]
miR-214 plays an important role in cancer networks [51] and functions in cell self-renewal by directly targeting catenin beta interaction protein 1 and a number of Wnt signaling pathway molecules [52]. [score:4]
These suggest that miR-214 directly targets the ATF4 3′UTR. [score:4]
These results suggest that miR-214 directly targets ATF4 through the predicted recognition sequence in the 3′UTR. [score:4]
It was reported that miR-214 suppresses glucose production in an ATF4 -dependent manner in vivo, and researchers suggested that miR-214 may also regulate gluconeogenesis via AMP-activated protein kinase [55]. [score:4]
The results showed that the expression level of miR-214 was decreased after osteogenic induction. [score:3]
3.5. miR-214 Suppresses Osteogenic Differentiation. [score:3]
In vitro, miR-214 expression was decreased during osteogenesis of hPDLSCs (Figure 2(c)). [score:3]
Western blotting showed similar outcomes, with RUNX2 expression level decreased significantly in hPDLSCs-miR-214 at both 7 and 14 days (Figure 5(d)). [score:3]
We also assessed the absolute and relative expression level of miR-214 by qRT-PCR, which was reduced after induction (Figure 2(c)). [score:3]
Here, we found that after osteoblast induction, miR-214 acts as a suppressor in bone formation of hPDLSCs. [score:3]
Alizarin red staining after 21 days of osteogenic induction also showed that miR-214 markedly suppressed osteogenic differentiation (Figure 5(b)). [score:3]
These data indicate that after osteogenic induction, miR-214 expression level decreased markedly, which agreed with the results of our miRNA array analysis. [score:3]
Cells overexpressing miR-214 were cultured and osteogenically induced to evaluate the expression change of ATF4. [score:3]
First, 4.5  μg pSIF/pSIF-miR-214 microRNA expression vector or control vector, 4.5  μg pFIV-34N lentiviral gag-pol packaging vector, and 0.57  μg pVSV-G envelope vector were transfected into HEK293T cells using the calcium phosphate transfection method. [score:3]
To gain a better understanding of the endogenous relationship between miR-214 and ATF4, we constructed plasmid pSIF-miR-214 to establish a stable cell line overexpressing miR-214, referred to as hPDLSCs-miR-214 (Figure 4(a)); an empty vector was used as a control (hPDLSCs-control). [score:3]
Identification of miR-214 Target. [score:3]
To gain further insight into how miR-214 influences the osteogenic differentiation of hPDLSCs, computational miRNA target prediction analyses were conducted. [score:3]
Accordingly, computational miRNA target prediction analysis suggested a potential miR-214 binding site in the 3′UTR of ATF4; therefore, ATF4 was further analyzed. [score:3]
As the target gene of miR-214, ATF4 showed a decreased protein level (Figure 5(d)). [score:3]
When the miR-214 target site was deleted from the 3′UTR-ATF4 reporter vector, luciferase reporter activity was restored (Figure 3(c)). [score:3]
The staining results showed that at 2 weeks after induction, cells overexpressing miR-214 showed stronger adipogenesis (Figure 6(a)). [score:3]
Furthermore, when the miR-214 target site was deleted from the ATF4 3′UTR reporter vector (ATF4-3′UTR-Mut), the activity was restored and the reporter was no longer responsive to mimic-214 (Figure 3(c)). [score:3]
We found that overexpression of miR-214 promoted adipocyte differentiation according to the results of qRT-PCR and Oil red O staining (Figure 6). [score:3]
Recently, an increased number of studies have reported that miR-214 also participates in the regulation of osteoblast function [26– 28] and osteoclastogenesis [42]. [score:2]
This is the first study to reveal that the miR-214-ATF4 axis is a novel pathway involved in regulating hPDLSC osteogenic differentiation. [score:2]
Taken together, these findings suggest that miR-214 regulates ATF4 via modification of protein synthesis. [score:2]
So it is reasonable to speculate that miR-214-ATF4 axis is involved in regulating insulin sensitivity; further studies are needed to confirm this. [score:2]
Based on these findings, miR-214 negatively regulates the osteogenic differentiation of hPDLSCs. [score:2]
Our data suggest that miR-214 negatively regulates osteogenesis in hPDLSCs. [score:2]
The results revealed no change between hPDLSCs-miR-214 and hPDLSCs-control at the ATF4 mRNA level, but protein level of hPDLSCs-miR-214 was significantly reduced (Figure 4(c)), which is similar to the results observed in osteoblasts [27, 28]. [score:1]
Previous studies showed that miR-214 is involved in the osteoblast differentiation of mesenchymal stem cells [27, 28, 41– 43], but whether miR-214 affects osteoblast differentiation of hPDLSCs remained unclear. [score:1]
As adipogenic differentiation is an important part of hPDLSC differentiation, we also assessed the adipogenesis of hPDLSCs-miR-214. [score:1]
hPDLSCs and hPDLSCs-miR-214/hPDLSCs-control were collected and fixed using 4% paraformaldehyde after 21 days of culture in osteogenic medium and then incubated with 40 mM Alizarin red S (Sigma) for 15 min with gentle shaking. [score:1]
To confirm that ATF4 binds miR-214 at this site, the 3′UTR containing the recognition sequence of ATF4 was cloned into a luciferase reporter vector (pMIR), and the suitable mutant type with its seed sequence deletion was inserted into the same reporter vector (Figure 3(a)). [score:1]
Among the candidates, a miR-214 binding site was detected in the 3′UTR of ATF4. [score:1]
Next, we constructed the plasmid pSIF-miR-214 to develop a stable cell line named as hPDLSCs-miR-214. [score:1]
This analysis revealed a potential miR-214 binding site in 3′UTR of ATF4. [score:1]
We measured the mRNA levels of the osteogenic marker genes RUNX2, ALP, and OCN in hPDLSCs-miR-214 and found that expressions were significantly decreased. [score:1]
Yan Yuan, University of Pennsylvania) between EcoRI and BamHI sites; this plasmid was referred to as pSIF-miR-214. [score:1]
3.6. miR-214 Promotes Adipogenic Differentiation. [score:1]
Successfully infected cells were named as hPDLSCs-miR-214, while control cells were named as hPDLSCs-control. [score:1]
The miRNA-214 level was approximately 340-fold higher in mimic-214 -transfected cells than in mimic-NC -transfected cells (Figure 3(b)). [score:1]
Mimic-214, a chemically modified double-stranded RNA that mimics endogenous miR-214, was transfected into HEK293T cells, and qPCR was performed at 36 h posttransfection. [score:1]
Numerous studies have examined the role of miR-214 in bone formation [26– 28]. [score:1]
HEK-293T cells were cotransfected with hsa-miR-214 mimic (mimic-214, micrON™ miRNA mimic, Ribobio) and ATF4-3′UTR-WT/Mut (and their controls) by Lipofectamine LTX (Life Technologies) according to the manufacturer's protocol. [score:1]
To confirm the function of miR-214 in adipogenesis, hPDLSCs-miR-214 was adipogenic -induced, and Oil red O staining and qRT-PCR were performed. [score:1]
miR-214 is encoded within a larger noncoding RNA, Dnm3 opposite strand (Dnm3os) [50]. [score:1]
[1 to 20 of 70 sentences]
15
[+] score: 226
In summary, we have demonstrated that the expression of miR-98 and miR-214 was significantly lower in ESCC tissues than in matched normal tissues and that down-regulation of miR-98 and miR-214 was correlated with the up-regulated EZH2 protein expression, poor pathological grade, advanced tumor stage and lymph node metastasis in ESCC. [score:11]
It was reported that miR-214 was down-regulated in breast and cervical cancer and acted as a tumor suppressor gene in these tumors since its overexpression inhibits cell proliferation and invasion [26, 33]. [score:10]
In the present study, we found that miR-98 and miR-214 expression were both inversely correlated with EZH2 protein expression in human ESCC, and that down-regulation of miR-98 and miR-214 expression was significantly correlated with pathological grading, tumor stage and lymph node metastasis. [score:10]
In Eca109 cells, overexpressing miR-98 and miR-214 was found to significantly suppress cell migration and invasion through inhibition of EZH2 expression. [score:9]
Moreover, overexpression of miR-98 or miR-214 could significantly inhibit ESCC cell migration and invasion, which was reversed by over -expressing EZH2. [score:7]
In Eca109 cells, miR-98 and miR-214 overexpression significantly inhibited cell migration and invasion by repressing EZH2 protein expression. [score:7]
It was found that 75% (30/40), 62.5% (25/40), and 85% (34/40) of samples showed downregulation of miRNAs (i. e. miR-98, miR-101 and miR214) with upregulation of EZH2 protein in tumor versus normal tissues, respectively. [score:7]
Using luciferase assay and western blot, we further demonstrated that miR-98, miR-101 and miR-214 could target the 3’-URT of EZH2 and suppress EZH2 expression in ESCC cells. [score:6]
MiR-98, miR-101 and miR-214 posttranscriptionally down-regulates EZH2 expression in ESCC cell line. [score:6]
MiR-98, miR-101 and miR214 expression is down-regulated in. [score:6]
Overexpression of EZH2 reverses the inhibition of migration and invasion of ESCC cells by miR-98 and miR-214. [score:5]
Moreover, the expression of miR-98 (or miR-214) was inversely correlated with EZH2 protein but not mRNA expression in tumor tissues (Figure 3A-D). [score:5]
Figure 6 Re -expressing EZH2 significantly attenuates the effect of miR-98 and miR-214 on the inhibition of ESCC cell migration and invasion. [score:5]
In Eca109 cells, overexpression of miR-98 and miR-214 significantly inhibited the migration and invasion of ESCC cells, which was reversed by transfection of EZH2. [score:5]
On the other hand, the expression and function of miR-214 appears to be cell type- and disease-specific. [score:5]
On the other hand, it was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 could inhibit the expression of EZH2 in some tumors. [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 inhibit the expression of EZH2 in nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma, respectively [21- 26]. [score:5]
By contrast, other studies showed that miR-214 was over-expressed in pancreatic and ovarian cancers and its overexpression promotes cell survival and chemotherapy resistance [34, 35]. [score:5]
These results show that overexpression of EZH2 could reverse the inhibitory effect of miR-98 and miR-214 on cell migration and invasion. [score:5]
Similarly, the expression of miR-214 was inversely correlated with EZH2 protein (C) but not mRNA expression (D). [score:5]
These findings suggest that miR-98 and miR-214 may play an important role in inhibiting the metastasis of ESCCs by targeting EZH2. [score:5]
Through clinical investigation, we found that miR-98 and miR-214 expression was significantly lower in ESCC tissues than in matched normal tissues, and the expression level of miR-98 and miR-214 was inversely correlated to EZH2 protein expression and the clinical features such as pathological grade, tumor stage and lymph node metastasis in ESCC. [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 were involved in the regulation of EZH2 expression in some human tumors such as nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma [21- 26]. [score:4]
These data suggest that miR-98 and miR-214 may play an important role in regulating the expression of EZH2 protein in human ESCC. [score:4]
Considering that the expression and function of miRNAs may vary in different types of tumors, here we set out to investigate whether these miRNAs (miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214) regulate tumor metastasis via altering EZH2 expression in human ESCC. [score:4]
showed that the expression of miR-98 (A), miR-101 (B) and miR-214 (C) were significantly decreased in tumor tissue compared with the matched normal tissue; while that of miR-138 (D) was significantly increased in tumors tissue, and there was no significantly difference in the expression of miR-26a (E) and miR-124 (F) between the two groups. [score:4]
In 77.5% (31/40) of samples, miR-214 was found to be downregulated. [score:4]
MiR-26a, miR-98, miR-101, miR-124,miR-138 and miR-214 were reported to be decreased in some human tumors and posttranscriptionally regulate the expression of EZH2 [21- 26]. [score:4]
We found that expression levels of miR-98, miR-101 and miR-214 were significantly lower in tumor than in normal tissues. [score:3]
In the present study, we first examined the expression levels of MiR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 in clinical samples of ESCC and matched normal tissues using qPCR. [score:3]
In the present study, we show that miR-98 and miR-214 expression in ESCC tissue are inversely correlated with the clinical features such as pathological grade, tumor stage and lymph node metastasis. [score:3]
We further investigated the relationship of the expression level of miRNAs (miR-98, miR-101 and miR214) with EZH2 expression. [score:3]
We further detected the expression of EZH2 protein and mRNA by western blot and qRT-PCR in Eca109 cells transfected with miRNAs (miR-98, miR-101 or miR-214). [score:3]
We further analyzed the relationship of miR-98, miR-101 and miR214 expression with the clinical features including age, gender, pathological grade, tumor location, tumor stage and lymph node metastasis in ESCC. [score:3]
These results indicate that miR-98, miR-101 and miR-214 could inhibit the migration and invasion of ESCC cells. [score:3]
These findings suggest that decreased expression of miR-98 and miR-214 might promote metastasis of human ESCC by inducing accumulation of EZH2 protein. [score:3]
We propose that miR-98 and miR-214 are tumor suppressor genes in ESCC. [score:3]
It was found that the expression of miR-98 (or miR-214) was significantly correlated with pathological grade, tumor stage and lymph node metastasis (Table 1). [score:3]
Figure 2A-C shows the mean expression levels of miR-98, miR-101 and miR-214, which were significantly lower in tumor tissues than in matched normal tissues. [score:3]
These results indicate that the 3'-UTR of EZH2 mRNA is a functional target of miR-98, miR-101 and miR-214 in ESCC cells. [score:3]
Figure 5 MiR-98, miR-101 and miR-214 inhibits the migration and invasion of ESCC cells. [score:3]
Figure 3 MiR-98 and miR-214 expression is inversely correlated with that of EZH2 protein. [score:3]
MiR-98, miR-101 and miR-214 inhibit the migration and invasion of ESCC cell line. [score:3]
Overexpression of EZH2 reverses the inhibition of migration and invasion of ESCC cells by miR-98 and miR-214To investigate the functional connection between miRNAs (miR-98, miR-101 and miR-214) and EZH2 in the regulation of ESCC metastasis, we further evaluated the migration and invasion capacity of cells cotransfected with these miRNAs and pcDNA-EZH2 (or empty pcDNA) plasmid. [score:2]
Combining these findings, we propose that miR-98, miR-101 and miR-214 regulate the accumulation of EZH2 protein in ESCC. [score:2]
Figure 2 MiR-98, miR-101 and miR-214 expression is decreased in as compared to matched normal tissues. [score:2]
showed that the level of EZH2 protein (D) was significantly decreased in cells transfected with miRNAs (including miR-98, miR-101 and miR-214) as compared to the cells transfected with control microRNA, while the expression level of EZH2 mRNA (E) exhibited no significantly difference between cells transfected with miRNAs and those transfected with control microRNA. [score:2]
showed that cells transfected with miR-98 + Luc-EZH2 (A), miR-101 Luc-EZH2 (B), miR-214 Luc-EZH2 (C) exhibited a significant decrease of reporter activity in comparison with those cotransfected with control microRNA + Luc-EZH2 plasmid. [score:1]
Through clinical investigation and cellular experiments using ESCC cell line, we demonstrate that decreased expression of miR-98 and miR-214 induce accumulation of EZH2 protein and might thereby promote the metastasis of human ESCC. [score:1]
As shown in Figure 4A-C, cells cotransfected with miRNAs (ie, miR-98, miR-101 or miR-214) and Luc-EZH2 plasmid showed a significant decrease of reporter activity in comparison with those cotransfected with control microRNA and Luc-EZH2 plasmid. [score:1]
These results suggest that the miR-98, miR-101 and miR214 might be involved in metastasis of ESCC. [score:1]
MiR-98, miR-101 and miR214 are correlated with pathological grade, tumor stage and lymph node metastasis. [score:1]
Mutant EZH2 3 [′]-UTR, which carried a substitution of four nucleotides (AGGU to UCCA for miR-98, UACU to AUGA for miR-101, and CAGC to GUCG for miR-214) within the core binding sites of EZH2 3 [′]-UTR, was obtained using overlapping extension PCR. [score:1]
The sequences of miR-98 were: Sense: 5 [′]- UGAGGUAGUAAGUUGUAUUGUU −3 [′], Anti-sense: 5 [′]- AACAAUACAACUUACUACCUCA −3 [′], The sequences of miR-101 were: Sense: 5 [′]- UACAGUACUGUGAUAACUGAA −3 [′], Anti-sense: 5 [′]- UUCAGUUAUCACAGUACUGUA −3 [′], The sequences of miR-214 were: Sense: 5 [′]- ACAGCAGGCACAGACAGGCAGU −3 [′], Anti-sense: 5 [′]- ACUGCCUGUCUGUGCCUGCUGU −3 [′], A scrambled microRNA with no homology to any known human microRNA was used as negative control: Sense: 5 [′]-GUUGAACUGUUAAGAACCACUGG-3 [′], Anti-sense: 5 [′]-CCAGUGGUUCUUAACAGUUCAAC-3 [′], All microRNA mimics were synthesized by Genephama Biotech (Shanghai, China). [score:1]
The sequences of miR-98 were:Sense: 5 [′]- UGAGGUAGUAAGUUGUAUUGUU −3 [′],Anti-sense: 5 [′]- AACAAUACAACUUACUACCUCA −3 [′], The sequences of miR-101 were:Sense: 5 [′]- UACAGUACUGUGAUAACUGAA −3 [′],Anti-sense: 5 [′]- UUCAGUUAUCACAGUACUGUA −3 [′], The sequences of miR-214 were:Sense: 5 [′]- ACAGCAGGCACAGACAGGCAGU −3 [′],Anti-sense: 5 [′]- ACUGCCUGUCUGUGCCUGCUGU −3 [′], A scrambled microRNA with no homology to any known human microRNA was used as negative control:Sense: 5 [′]-GUUGAACUGUUAAGAACCACUGG-3 [′],Anti-sense: 5 [′]-CCAGUGGUUCUUAACAGUUCAAC-3 [′], All microRNA mimics were synthesized by Genephama Biotech (Shanghai, China). [score:1]
MiR-98, miR-101 and miR-214 inhibit the migration and invasion of ESCC cell lineTo investigate the role of miR-98, miR-101 and miR-214 in ESCC metastasis, we detected the migrant and invasive capacity of Eca109 cells transfected with miRNA mimics or control miRNA. [score:1]
qPCR analysis confirmed that Eca109 cells transfected with miRNA mimics (i. e miR-98, miR-101 or miR-214) exhibited significantly higher mature miRNA level than those treated with controls 48 hr posttransfection (Additional file 2: Figure S2). [score:1]
[1 to 20 of 57 sentences]
16
[+] score: 220
n = 6. *P < 0.05 compared with control In the early phase of cardiac hypertrophy, the expression trend of miR-30a* and miR-214 were opposite, while XBP1 was increased, so we treated cardiomyocyte with miR-214 mimics and miR-30a* inhibitors (anti-30a*) to further test if down expression of miR-30a* reverses suppressive effect of miR-214 upregulation in XBP1 expression. [score:13]
Our results have indicated that reduced miR-30* is required for XBP1 activation in the early stages of hypertrophic hearts in vivo and the upregulation of miR-30* and miR-214 inhibit the expression of XBP1 by targeting XBP1 3′ UTR, resulting in VEGF suppression in the maladaptive heart phage. [score:12]
Furthermore, experiments in H9c2 (2-1) cells showed that ectopic expression of miR-214 caused a significant decrease in the expression of XBP-1 s, while inhibition of endogenous miR-214 by synthetic miR-214 inhibitor resulted in the upregulation of XBP-1s (Fig.   2b). [score:12]
These results suggest that ectopic expression of miR-214 and miR-30* led to a decrease in XBP1 expression, sequentially inhibited the expression of its targets. [score:11]
Together, these results of upregulated miR-214 and reduced miR-30* expression in several forms of heart failure raise the intriguing possibility that disbalance between miR-214 and miR-30* actually cause accumulation of XBP-1 protein in the early phase of cardiac hypertrophy and thereby contribute to impairment of cardiac XBP1 expression in the maladaptive diseased heart. [score:10]
However, along with increasing expression of miR-214 in late stage of hypertrophy, the inhibitory effects of miR-214 become dominant which results in the suppression of XBP-1. In another hand, we also found that XBP1 is a potential target of the miR-30* family. [score:9]
Moreover, the time-course change in the ratio of miR-30a*/miR-214 during cardiac hypertrophy and heart failure (Additional file 1: Fig. S1) show that down-regulation of miR-30a* may minimize the role of increased miR-214 in regulation of XBP-1 in the early phase of cardiac hypertrophy, while increased expression of both miR-214 and miR-30* synergistically lead to suppression of XBP1 in the maladaptive heart. [score:9]
These results provide the first clear link between miRNAs and direct regulation of XBP1 in heart failure and reveal that miR-214 and miR-30* synergistically regulates cardiac VEGF expression and angiogenesis by targeting XBP1 in the progression from adaptive hypertrophy to heart failure. [score:8]
Previous studies have shown that induces expression of miR-214 that actively downregulate several mitochondrial and cardiac targets including PPARδ, provoking a switch toward a glycolytic metabolic profile that contributes to heart failure [36]. [score:8]
Hence, upregulated of miR-214 under prolonged cardiac stress maybe contribute to XBP1 downexpression in maladaptive cardiac diseases. [score:8]
miR-214 inhibits XBP1 expression and is upregulated in hypertrophic and failing heart. [score:8]
Surprisingly, as a competent regulator of XBP1, why expression of miR-214 was enhanced while expression of XBP-1 still was increased during the early phase of cardiac hypertrophy? [score:6]
In our previous study, we found that miR-214 is an important regulator of angiogenesis in endothelial cells regulating the expression of XBP1 in the control of cardiac angiogenesis [15]. [score:5]
The western blot results show that XBP1 reintroduction by transfection of miRNA-30a* inhibitors into miR-214 mimics -transfected cardiomyocyte ablated the effects of miR-214 on XBP1s expression (Fig.   5a). [score:5]
These data show that dynamic expression of miR-30* and miR-214 caused opposite expression of XBP1 and VEGF in hypertrophic and failing heart. [score:5]
miR-214 and miR-30* reduce the expression of XBP1’s targets in cardiomyocyte. [score:5]
Moreover, we found that miR-30* was significantly reduced in the early phase of cardiac hypertrophic animal mo del and in human failing hearts, while both miR-214 and miR-30* were increased in the maladaptive diseased heart, thereby contribute to impairment of cardiac XBP1 and VEGF expression. [score:5]
Duan Q Yang L Gong W Chaugai S Wang F Chen C Wang P Zou MH Wang DW MicroRNA-214 is Up-Regulated in Heart Failure Patients and Suppresses XBP1-Mediated Endothelial Cells AngiogenesisJ Cell Physiol. [score:5]
The VEGF-A suppressing effect of miR-214 and miR-30* over expression was similar to what was measured after down regulation of XBP1 in H9c2 (2-1) cells (Additional file 1: Fig. S2). [score:4]
Next, to investigate the potential involvement of miR-214 in cardiac XBP1 expression, we performed real time PCR to analyze the changes in myocardial miR-214 expression during development in two established hypertrophy mo dels. [score:4]
Now, we further found that miR-214 regulates XBP1 expression in cardiomyocytes. [score:4]
Our study has for the first time established that XBP1 is an important angiogenic factor to maintain normal cardiac function in the early stage of hypertrophy and deregulation of of mir-214 and miR-30* in the hypertrophic and failing hearts inhibits XBP1 and XBP1 -induced angiogenesis results in the transition of hypertrophic hearts into heart failure. [score:4]
Indeed, miRNA microarray analysis shows that expression of miR-214 is significant unregulated in TAC- and calcineurin A -induced mouse heart hypertrophy mo dels, as well as in idiopathic end-stage failing human hearts [22, 31]. [score:4]
The inhibitory effects of miR-214 on XBP-1 are likely overwhelmed by activated ATF6 or/and IRE1 caused by UPR in hypertrophic hearts. [score:3]
a Expression of the miR-214 and miR-30* family in normal mice heart tissue. [score:3]
Interestingly, a more significant decrease in XBP1 expression were observed in miR-214 and miR-30a* co -transfected cells (Fig.   5b). [score:3]
Importantly, miR-214 overexpression appeared to be capable of inducing hypertrophic growth in cardiomyocytes [31]. [score:3]
As shown in Fig.   2c, d, miR-214 expression was significantly increased in both ISO- and AAC -induced cardiac hypertrophy. [score:3]
a Western blot analysis of XBP1 in H9C2 (2-1) cells co -transfected with miR-30a* inhibitors (antimiR-30a*) and miR-214 mimics. [score:3]
These data suggest that XBP1 also is a target of miR-214 in cardiomyocyte. [score:3]
d Real-time PCR analysis of VEGF expression in untreated and TG -treated H9C2 (2-1) cells transfected with or without miR-30a* or miR-214 mimics or miR-NC (100 nM). [score:3]
Interestingly, in early stage of hypertrophic heart, miR-214 was mildly induced in the early adaptive phase whereas XBP-1 was unregulated instead of being down regulated. [score:3]
We found that both miR-214 and miR-30a* mimics decreased VEGF mRNA expression in response to ER stress (Fig.   5d). [score:3]
Real-time PCR analysis confirmed that miR-214 showed a striking increase in expression in the border zone of the infarct, both in the murine and human myocardial infarction hearts [32, 33]. [score:3]
Interestingly, we further found that XBP1 and its downstream target VEGF were attenuated by miR-30* and miR-214 in cardiomyocyte. [score:3]
To further test the relationship of these miRNAs and XBP1, we performed western blot analysis and found that the protein levels of VEGF and EDEM were diminished by miR-214 or miR-30a* overexpression in H9c2 (2-1) cells (Fig.   5b). [score:3]
n = 6. *P < 0.05 compared with controlOur previous data have shown that XBP1 is a target of miR-214 in hepatocyte and endothelial cell [15]. [score:2]
These reports indicate that distinct miR-214 was regulated during heart failure, suggesting the possibility that it might function as modulators of this process. [score:2]
Then we further established the essential roles of miR-214 in hypertrophic and failing heart by down -regulating XBP-1 mediated angiogenesis [15]. [score:2]
n = 6. *P < 0.05 compared with control Our previous data have shown that XBP1 is a target of miR-214 in hepatocyte and endothelial cell [15]. [score:2]
Furthermore, this discrepancy of miR-214 and XBP-1 levels can be explained by relative low levels of miR-214 and high activity of ATF6, and IRE1 in early stage of hypertrophic hearts. [score:1]
miR-214 is also unregulated following renal ischemia reperfusion injury compared with sham controls [34, 35]. [score:1]
c Real-time PCR analysis of VEGF and EDEM mRNA in H9C2 (2-1) cells transfected with or without miR-30a* and miR-214 mimics or miRNA negative control oligonucleotides (100 nM). [score:1]
Non-specific negative control oligonucleotides, antimiRNA, mimics, for miR-214 and miR-30* (miR-30a*, miR-30b*, miR-30c-2*, miR-30d*, miR-30e*) and specific siRNA against rat XBP-1 were obtained from RiboBio (Guangzhou, China). [score:1]
10.1186/s12967-015-0725-4 Real-time PCR analysis of the ratio of miR-30a*/miR-214 in mice heart and VEGF and EDEM mRNA in siRNA-XBP1treated H9C2 cells and representative immunostaining of CD31 in hearts are presented. [score:1]
b Western blot analysis of XBP1, VEGF and EDEM in H9C2 (2-1) cells transfected with or without miR-30a* and miR-214 mimics or miRNA negative control oligonucleotides (100 nM). [score:1]
b Western blots of XBP1 s in untreated and miR-214 -treated H9C2 (2-1) cells. [score:1]
c Real-time PCR analysis of miR-214 in rat heart after AAC treatment. [score:1]
n = 6. d Real-time PCR analysis of miR-214 in rat heart after ISO infusion. [score:1]
[1 to 20 of 49 sentences]
17
[+] score: 219
These results clearly suggest a close correlation between miR-214-5p expression in the liver, fibrosis development, and fibrosis-related mRNA expression. [score:6]
Conversely, the overexpression of miR-214-5p in LX-2 cells did not alter the expression of MAPK/Erk kinase 3 (MEK3), transcription factor AP-2 gamma (TFAP2C) [29], Plenxin-B1 [30], c-Jun N-terminal kinase 1 (Jnk1) [34], phosphatase and tensin homolog (PTEN) [35], enhancer of zeste homolog 2 (Ezh2) [36], and Quaking mRNA [24], which had been reported to be targets of miR-214 (MEK3: 0.72- to 0.77-fold, Jnk1: 1.05- to 1.20-fold, PTEN: 0.97- to 1.12-fold, Plenxin-B1: 0.99-fold, Ezh2: 0.96-fold, TFAP2C: 0.94-fold, and Quaking: 0.88- to 1.18-fold change compared with cells transfected with control miRNA). [score:6]
These data and the upregulation of Twist-1 in MCDD -induced mouse liver fibrosis (Figure 4) suggest that Twist-1 controls the expression of the miR-214/199a cluster in the liver. [score:6]
The present study showed that miR-214 expression is upregulated in a fibrosis progression -dependent manner in the livers of patients with chronic HCV infection and in mice with diet -induced steatohepatitis (Figures  1 and 2). [score:6]
The results are expressed relative to the expression of miR-214-5p in HepG2. [score:5]
The present study revealed that miR-214-5p overexpression in LX-2 cells significantly increased MMP-2, MMP-9, α-SMA, and TGF-β1 mRNA expression. [score:5]
The results are expressed relative to the expression of miR-214-5p at day 1. * P < 0.05. [score:5]
The results are expressed relative to the expression of miR-214-5p at 5 weeks of the MCCD. [score:5]
Figure 5 Effect of miR-214 overexpression on mRNA expression in LX-2 cells. [score:5]
The overexpression of miR-214-5p in LX-2 cells increased the expression of fibrosis-related genes, such as matrix metalloproteinase (MMP)-2, MMP-9, α-smooth muscle actin, and transforming growth factor (TGF)-β1. [score:5]
The results are expressed relative to miR-214 expression in cells that did not receive TGF-β1 treatment. [score:5]
The results are expressed relative to the expression of miR-214-5p in the livers of rats fed the methionine- and choline-control diet (MCCD) for 10 weeks. [score:5]
The results are expressed relative to the expression of miR-214-5p in hepatocytes. [score:5]
TGF-β induces miR-214 expression in rat tubular epithelial cells and mesangial cells [23], and miR-214 interacts with Quaking to inhibit angiogenesis [24]. [score:5]
The effect of miR-214 overexpression on gene expression in stellate cells. [score:5]
miR-214-5p was upregulated in human and mouse livers in a fibrosis progression–dependent manner. [score:4]
miR-214 expression in stellate cells is regulated by TGF-β and possibly by the transcription factor Twist-1. These results should be pursued further to identify the role of miR-214-5p in liver fibrogenesis and to develop a biomarker that reflects the stage of liver fibrosis more accurately than a pathological staging score. [score:4]
A transcription factor, Twist-1, binds to the E-box region, regulating miR-214 and miR-199a expression [22]. [score:4]
The overexpression of miR-214 significantly increased the expression of matrix metalloproteinase-2 (MMP-2), MMP-9, α-SMA, and TGF-β1 compared to cells transfected with control microRNA (1.7-, 2.8-, 1.7- and 2.0-fold, respectively; P < 0.01) (Figure 5). [score:4]
Here, we report the upregulation of miR-214-5p in a fibrosis progression–dependent manner in HCV-infected human livers and in the livers of a rodent fibrosis mo del. [score:4]
Twist-1 may regulate miR-214-5p expression in the liver, particularly in stellate cells. [score:4]
Figure 6 Regulation of miR-214-5p expression. [score:4]
miR-214-5p was overexpressed in LX-2 cells by transfection with an miR-214 precursor. [score:3]
miR-214 expression in a rat resolution mo del of liver fibrosis. [score:3]
Expression of miR-214-5p in methionine- and choline -deficient diet (MCDD) -induced liver fibrosis and recovery phase in rats. [score:3]
miR-214-5p was localized to non-parenchymal cells and hepatic stellate cells but expressed at negligible levels in hepatocytes (Figure 4D). [score:3]
In contrast, the expression of the miR-214/199a cluster is controlled by the transcription factor Twist-1 [22]. [score:3]
miR-214 expression in a mouse mo del of liver fibrosis. [score:3]
miR-214-5p expression in hepatic stellate cells. [score:3]
Figure 4 miR-214-5p expression in liver cells, including stellate cells. [score:3]
As expected, the induction of miR-214-5p was accompanied by an increase in the expression of α-SMA, Col1a1, PDGFR-β, and FN1 mRNA (Figure 4B). [score:3]
We investigated the effect of miR-214-5p overexpression on fibrosis-related gene expression in stellate cells to clarify the role of this miRNA in stellate cell activation. [score:3]
miR-214-5p expression was significantly higher in the livers of MCDD-fed mice than in control mice (2.1-fold, P < 0.01 at 5 weeks; and 4.8-fold, P < 0.01 at 15 weeks) (Figure 2C). [score:3]
We assessed the stimulatory effect of TGF-β on miR-214-5p expression in LX-2 cells. [score:3]
TGF-β [1] induces miR-214 expression in rat tubular epithelial cells and mesangial cells [23]. [score:3]
Induction of miR-214 expression by TGF-β1. [score:3]
The miR-214-5p expression in Hc, the NPC fraction, and the HSC fraction was analyzed using real-time PCR. [score:3]
Further studies will be needed to clarify the possible involvement of Twist-1 in the expression of miR-214-5p in LX-2 cells. [score:3]
In addition, miR-214-5p expression was markedly higher in LX-2, a wi dely used human hepatic stellate cell line, than in human liver cancer cell lines such as HepG2 and Huh7 (108- and 39-fold, respectively) (Figure 4C). [score:3]
The expression of miR-214-5p and genes that are involved in liver fibrosis were analyzed in hepatitis C virus-infected human livers, rodent fibrotic livers, a human stellate cell line (LX-2), and the cells from intact mouse livers using real-time PCR. [score:3]
Figure 3 miR-214-5p expression in rat livers with fibrosis induced by a methionine- and choline -deficient diet. [score:3]
Therefore, the mRNA targets of miR-214-5p in LX-2 cells are not identical to those in previous reports. [score:3]
In addition, we quantitatively confirmed the miR-214-5p expression levels in 35 HCV patients with individual stages of liver fibrosis (Figure 1A) using real-time PCR. [score:3]
miR-214-5p expression in the livers of 35 hepatitis C virus (HCV)-infected patients was analyzed using real-time PCR. [score:3]
TGF-β [1] (3 and 10 ng/ml) significantly stimulated miR-214-5p expression in LX-2 cells after 24 hours (1.75-fold, P < 0.05)(Figure 6A). [score:3]
miR-214 expression in chronic hepatitis C patients. [score:3]
We found that miR-214-5p expression increased according to the stage of fibrosis (P = 0.000108) (Figure 1B) and was significantly higher in patients with advanced liver fibrosis than in those with mild fibrosis (F1/F2 versus F3/F4: 3.2-fold, P < 0.05; F1 versus F2-4: 3.1-fold, P < 0.05) (Figure 1C,D). [score:3]
We also found that miR-214-5p overexpression had a negligible effect on LX-2 proliferation and migration. [score:3]
Figure 2 miR-214-5p expression in mouse livers with fibrosis induced by an methionine- and choline -deficient diet. [score:3]
miR-214-5p expression was significantly greater in the livers of rats that received MCDD for 10 weeks than in those that received MCCD for 10 weeks. [score:3]
miR-214 expression was quantitated using real-time PCR. [score:3]
Figure 1 miR-214-5p expression in the livers of patients with chronic hepatitis C virus infection. [score:3]
miR-214-5p expression increased during the culture -dependent activation of mouse primary stellate cells and was significantly higher in stellate cells than in hepatocytes. [score:3]
miR-214-5p expression increased during the culture -dependent activation process in mouse stellate cells (2.7-fold increase at day 7 compared to day 1, P < 0.05) (Figure 4A). [score:2]
We report an increase in miR-214-5p in liver fibrosis in humans and mice and the possible association of miR-214-5p with stellate cell activation. [score:1]
miR-214-5p may play crucial roles in the activation of stellate cells and the progression of liver fibrosis. [score:1]
These results indicate the strong participation of miR-214 in the activation of stellate cells. [score:1]
TGF-β stimulation induced miR-214-5p in LX-2 cells. [score:1]
These results suggest that miR-214 induction in fibrotic livers reflects the number and activation status of hepatic stellate cells. [score:1]
miR-214-5p is a product of the 110 bp miR-214 gene in the intron of the Dynamin-3 gene on human Chromosome 1-NC_000001.10, which produces a mature miRNA with a sequence of ugccugucuacacuugcugugc [22]. [score:1]
The role of miR-214-5p in hepatic stellate cell activation is also discussed. [score:1]
The present study clarified the role of miR-214-5p in hepatic fibrogenesis using human clinical tissue samples, livers from rodent mo dels, and cultured hepatic stellate cells. [score:1]
We next isolated individual hepatocytes, non-parenchymal cells, and hepatic stellate cells from intact mouse livers to verify the cellular source of miR-214-5p. [score:1]
miR-214 has previously been predicted to be a key molecule in proliferation in breast [27] and ovarian cancer cells [28], tumor progression in melanoma [29], and growth in HeLa cells [30]. [score:1]
We assessed the contribution of activated hepatic stellate cells to the increase in miR-214-5p in fibrotic mouse livers. [score:1]
These results suggest that the miR-214/199a cluster plays a primary role in stellate cell activation. [score:1]
miR-214-5p precursors and negative control miRNA were transfected into LX-2 cells using Lipofectamine 2000 (Invitrogen) at a final concentration of 50 nM, as described previously [20, 25]. [score:1]
However, the pathophysiological roles of miR-214 remain largely unknown. [score:1]
miR-214 and miR-199a are encoded in a region that contains an E-box DNA promoter sequence [22]. [score:1]
This is the first report to show that miR-214-5p is involved in organ fibrogenesis, specifically in the liver. [score:1]
The effect of miR-214-5p overexpression in LX-2 cells on cell function was investigated. [score:1]
[1 to 20 of 71 sentences]
18
[+] score: 218
Other miRNAs from this paper: mmu-mir-214
To address the function of miR-214 in NPC carcinogenesis, an inhibitor -mediated knockdown approach was employed to suppress the expression of endogenous miR-214, and subsequently determine the effect on cell growth. [score:8]
The results showed that miR-214 was overexpressed in human NPC and knockdown of miR-214 increased apoptosis and suppressed cell growth in vitro as well as in vivo. [score:6]
In addition, knockdown of miR-214 in NPC cells could increase apoptosis and suppress cell growth, proliferation in vitro and suppress tumour growth in vivo. [score:6]
We predicted potential direct targets of miR-214 by at least three of TargetScan6.2, PicTar5, miRWalk, miRDB, DIANAmT and miRanda 3.0 programs. [score:6]
MiR-214 is upregulated in several human tumors, such as ovarian cancer [10], gastric cancer [11], Sézary syndrome [12] and melanoma [13], but downregulation in cervical cancer [14], [15], [16], pancreatic cancer [17], hepatocellular carcinoma [18], [19] and breast cancer [20]. [score:6]
qRT-PCR and Western blot showed that knockdown of miR-214 using LNA-antimiR-214 led to upregulation of endogenous Bim and BAX in both CNE2 and SUNE1 cells, respectively. [score:5]
In addition, miR-214 induces cell survival and cisplatin resistance by binding to 3′-UTR of PTEN leading to inhibition of PTEN translation and activation of Akt pathway [21]. [score:5]
However, miR-214 expression was reduced in cervical cancer [14], [15], [16], pancreatic cancer [17], hepatocellular carcinoma [18], [19] and breast cancer [20], suggesting a tumor suppressor gene-like function. [score:5]
TargetScan6.2, PicTar5, miRWalk, miRDB, DIANAmT and miRanda 3.0 programs were used to predict putative targets of miR-214 respectively. [score:5]
We further tested whether miR-214 could directly repress the identified mRNA targets through 3′ UTR interactions (Figure 5A). [score:4]
Knockdown of miR-214 suppresses tumorigenesis in vivo To address the potential effects of miR-214 on the growth of nasopharyngeal carcinoma cells in vivo, CNE2 cells transfected with LNA-antimiR-214 or LAN-control were subcutaneously injected into nude mice. [score:4]
was performed to identify Bim as a direct target of miR-214 in NPC cells. [score:4]
In brief, these results indicated that Bim was a direct target of miR-214. [score:4]
The results showed that knockdown of miR-214 led to remarkable inhibition of cell growth and proliferation in both CNE2 and SUNE1 cells. [score:4]
Bim is a direct target of miR-214 in NPC cell lines. [score:4]
With respect to the relationship of miR-214 and Bim, further studies on knockdown of Bim in vivo and in vitro might give us more information for better understanding the roles of Bim expression affected by miR-214 on proliferation and apoptosis in nasopharyngeal carcinoma. [score:4]
Knockdown of miR-214 results in cell growth suppression. [score:4]
0086149.g004 Figure 4Knockdown of miR-214 inhibits tumor growth in nude mice: in vivo functional studies. [score:4]
Furthermore, we identified Bim (Bcl-2-interacting mediator of cell death) as a direct target of miR-214. [score:4]
Knockdown of miR-214 could suppress cell proliferation in vitro and in vivo, and induced apoptosis in vivo. [score:4]
Knockdown of miR-214 suppresses tumorigenesis in vivo. [score:4]
Knockdown of miR-214 inhibits tumor growth in nude mice: in vivo functional studies. [score:4]
Moreover, some other genes implicated in cell proliferation, invasion and apoptosis, were direct targets of miR-214, including Ezh2 [20], HDGF [19], Lactoferrin [24], and so on. [score:4]
Overexpression of miR-214 resulted in a significant decrease in luciferase expression in pMIR-report-Bim 3′UTR -transfected cells, but not in pMIR-report-mut-Bim 3′UTR -transfected cells, compared with the miR-control. [score:4]
In our study, we found that knockdown of miR-214 could increase endogenous Bim protein expression in NPC cells (CNE2 and SUNE1). [score:4]
QRT-PCR was performed to confirm miR-214 expression of CNE2 and SUNE1 cells transfected with LNA-antimiR-214 (50 nM) after 48 hours transfection. [score:3]
MiR-214 has also been identified to be involvement of cervical cancer development by targeting MEK3, JNK1 [14], GALNT7 [15] and Plexin-B1 [16]. [score:3]
Previous study reported that miR-214 induces cell survival and cisplatin resistance of ovarian cancer primarily through targeting the PTEN [21]. [score:3]
MiR-214 expression in xenograft tumors of LNA-control group was higher than that of the LNA-antimiR-214 group (P = 0.017; Figure 4D, 4F). [score:3]
These findings suggested that miR-214 was overexpressed in NPC cell lines and tissues. [score:3]
It was concluded that miR-214 acted as different biological function through different target gene in NPC. [score:3]
0086149.g002 Figure 2(A) Forty-eight hours post-transfection, miR-214 expression levels (normalized to U6 RNA) were significantly decreased by 82% (P<0.01) in CNE2/LNA-antimiR-214 and 87.7% (P<0.01) in SUNE1/LNA-antimiR-214 cells, relative to the LNA-control. [score:3]
At present, several targeted genes of miR-214 have been identified in various tumor types. [score:3]
Silencing of miR-214 suppresses cell proliferation in NPC cells. [score:3]
Our findings suggest that miR-214 could play an important role in NPC carcinogenesis, and might be a better way of being prognostic or potentially therapeutic target for NPC patients. [score:3]
Bim is the target gene of miR-214. [score:3]
We performed fluorescence in situ hybridization (FISH) on 5 NPC patients and 5 healthy controls (HCs) to examine the expression of miR-214. [score:3]
Li and his colleagues' study, lactotransferrin was identified as a target gene of miR-214 [23]. [score:3]
The expression of mature miR-214 was determined by SYBR Green quantitative real time PCR amplification on an ABI 7500HT instrument (Applied Biosystems). [score:3]
MiR-214 is upregulated in several human tumors, such as ovarian cancer, gastric cancer, Sezary syndrome, and melanoma [10], [11], [12], [13]. [score:3]
The prediction of potential targets of miR-214. [score:3]
Furthermore, elevated expression of miR-214 was associated with chemotherapy resistance [21] or tumor metastasis [13]. [score:3]
These results suggest that miR-214 inhibition can induce apoptosis in CNE2 and SUNE1 cells. [score:3]
In conclusion, we report that miR-214 expression was increased in NPC tissues and NPC cells. [score:3]
The miR-214 showed higher expression in NPC patients relative to HCs (Figure 1B, P = 0.001, n = 5). [score:3]
Expression of miR-214 in NPC tissues and NPC cell lines. [score:3]
In this study, miR-214 was identified to be significantly higher expression in NPC compared to control. [score:2]
Relative qRT-PCR analysis shows that CNE2, SUNE1, and HONE1 cells express higher levels of miR-214 compared with NPEC2 Bmi-1 cells. [score:2]
MiR-214 could contribute to melanoma tumour progression through suppression of TFAP2C. [score:2]
Knockdown of miR-214 induces apoptosis in vitro. [score:2]
MiR-214 is overexpressed in NPC tissues and cell lines. [score:2]
The colony formation assay (A) and MTT assay (B) showed that knockdown of miR-214 in CNE2 and SUNE1 cells resulted in inhibition of cell growth in vitro. [score:2]
Cell culture and knockdown of miR-214. [score:2]
0086149.g001 Figure 1(A) Representative picture of fluorescence density for miR-214 expression in 5 NPC patients compared to adjacent normal tissues (400× magnification). [score:2]
Obviously, the overexpression of miR-214 was observed in NPC tissues compared to normal adjacent tissue (NATs). [score:2]
MiR-214 positive signals detected by FISH are in green, which is upregulated in NPC tumor cells compared to the adjacent epithelial cells. [score:2]
Knockdown of miR-214 induces apoptosis in vitro CNE2 and SUNE1 cells were transfected with LNA-antimiR-214 or LNA-control. [score:2]
Fluorescence in situ hybridization (FISH) of miR-214 was performed on 5 µm tissue sections of NPC following the manufacturer's instructions. [score:1]
Also, quantitative RT-PCR (qRT-PCR) was utilized to test the miR-214 level in NPC patients and HCs. [score:1]
J Hepatol 20 Derfoul A, Juan AH, Difilippantonio MJ, Palanisamy N, Ried T, et al (2011) Decreased microRNA-214 levels in breast cancer cells coincides with increased cell proliferation, invasion and accumulation of the Polycomb Ezh2 methyltransferase. [score:1]
Validation of tumor growth-promoting activity of miR-214 in an animal mo del. [score:1]
Two genes (Bim and BAX) were predicted to have at least one potential binding site at their 3′-UTRs for miR-214 (Figure 5A). [score:1]
To address the potential effects of miR-214 on the growth of nasopharyngeal carcinoma cells in vivo, CNE2 cells transfected with LNA-antimiR-214 or LAN-control were subcutaneously injected into nude mice. [score:1]
These findings suggested that miR-214 could promote NPC progression due to partially repressing endogenous Bim. [score:1]
Fors, 293T cells were seeded in 12-well plates and transfected with wide type or mutant reporter constructs (50 ng) together with miR-214 or miR-control (50 nM, GenePharma, Shanghai, China) and Renilla plasmid (10 ng) using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
However, the role of miR-214 in nasopharyngeal carcinoma (NPC) is still unknown. [score:1]
For data analysis, cycle threshold (Ct) for U6 (reference) and miR-214 (sample) were determined in triplicate (shown as arithmetical mean). [score:1]
These plasmids and pCMV-Renilla (internal control) and miR-214 or miR-control were transiently transfected into 293T cells. [score:1]
Following a post-fixation step in 4% paraformaldehyde (PFA), LNA-miR-214 detection probe (Exiqon, Vedbek, Denmark) or LNA-control (Exiqon, Vedbek, Denmark) was hybridized to the sections at 58°C for 4 hours carried out in a Hybrite (Abbott Laboratories, Shanghai, China). [score:1]
Pairing of miR-214 with Bim 3′UTR region and BAX 3′UTR region. [score:1]
We further investigated the effect of miR-214 on the expression of Bim and BAX by qRT-PCR as well as Western blot. [score:1]
Li and his colleagues' study showing high-level of miR-214 in NPC [23]. [score:1]
In order to completely understand the role of miR-214 in clinical practice, the levels of miR-214 in the FFPEs sample would be analyzed to determine whether miR-214 is a hallmark for prognosis and diagnosis. [score:1]
Silencing of miR-214 induces apoptosis in NPC cells. [score:1]
[1 to 20 of 74 sentences]
19
[+] score: 189
Other miRNAs from this paper: mmu-mir-214
MiR-214-3p directly targets Traf3 to regulate osteoclast activity in vitroWe next sought to understand how osteoclastic miR-214-3p regulates the osteoclast activity and bone resorption during the development of OBM. [score:7]
In addition, the TRAF3 protein levels in osteoclasts were downregulated after transfection with agomir-214 but not the nonsense agomir control or mutant agomir-214, whereas no differences in the Traf3 mRNA levels were found among different treatments, suggesting a role of miR-214-3p in the posttranscriptional regulation on TRAF3 protein expression. [score:7]
We used miRBase (version 21) and TargetScan (release version 6.2) to predict the candidate target genes of miR-214-3p, wherein we found that Traf3 mRNA contains a miR-214-3p binding site in its 3′ untranslated region (3′UTR) (Fig. 4a). [score:7]
Given that the osteoclastic miR-214-3p could transfer to osteoblast to inhibit bone formation 24, the current strategy of inhibiting osteoclastic miR-214-3p may also exert anabolic effect on bone formation. [score:5]
Given that a recent study reported that miR-214-3p targets phosphatase and tensin homolog (PTEN) to promote osteoclastogenesis 17, we also examined the protein expression of PTEN in the bone specimens. [score:5]
Osteoclast -targeted inhibition of miR-214-3p attenuates osteolytic bone metastasis. [score:5]
Elevated miR-214-3p in osteoclast targets Traf3 to promote osteoclastic bone resorption in vivoNext, we investigated the role of osteoclastic miR-214-3p in regulating bone resorption in vivo using our previously established osteoclast-specific miR-214-3p knock-in (OC-214) mice that overexpressing miR-214-3p under the control of Cre -mediated recombination driven by the Ctsk promoter 23 24. [score:5]
MiR-214-3p directly targets Traf3 to regulate osteoclast activity in vitro. [score:4]
Moreover, the luciferase activity of the WT Traf3 3′ UTR was notably upregulated after the endogenous levels of miR-214-3p were reduced by antagomir-214-3p treatment (Fig. 4f). [score:4]
We further found that miR-214-3p could target TRAF3 to stimulate the osteoclastic bone resorption during the development of OBM. [score:4]
The results showed that osteoclast -targeting antagomir-214-3p treatment could dramatically diminish bone metastatic lesions in BCX nude mice, respectively, which could be explained by the decreased bone resorption after knocking down the miR-214-3p level within osteoclasts by antagomir-214. [score:4]
In this study, we found that elevated miR-214-3p within osteoclast could target TRAF3 to promote osteoclastic bone resorption during the development OBM. [score:4]
Given that our data from breast cancer patients also showed that the intraosseous PTEN protein expression seemed to be not affected under pathological conditions of OBM, we next sought to elucidate the mechanisms by which miR-214-3p regulates osteoclastic bone resorption. [score:4]
These data suggest that the metastatic breast cancer cells could stimulate miR-214-3p expression in osteoclast precursors to promote osteoclast formation during the development of OBM. [score:4]
To determine whether miR-214-3p could directly target Traf3, the RAW264.7 cells were transfected with luciferase reporters containing either a wild-type (WT) Traf3 3′UTR or a mutant Traf3 3′UTR (Fig. 4d). [score:4]
Considering the distinct role of miR-214-3p described here, we also evaluated the therapeutic effect of inhibiting miR-214-3p within osteoclasts on the development of OBM in BCX nude mice using antagomir-214-3p encapsulated in our established osteoclast -targeting delivery system 25. [score:4]
The data from OBM patients as well as murine mo dels concordantly showed a close association between the aberrantly elevated osteoclastic miR-214-3p expression and the increased bone resorption during the progression of OBM. [score:3]
In brief, a cassette containing the following components was constructed to target the Rosa26 locus: FRT-LoxP-stop codons-three SV40 poly(A) sequences- LoxP-mmu-miR-214-3p-WPRE-bGH poly(A)-AttB-PGK promoter- FRT-Neo-PGK poly(A)-AttP. [score:3]
The elevated miR-214-3p within osteoclast targets TRAF3 to promote osteoclastic bone resorption in vivo. [score:3]
Collectively, it indicates that the elevated miR-214-3p in osteoclast could target Traf3 to promote osteoclastic bone resorption in vivo. [score:3]
These data suggest that therapeutic inhibition of miR-214-3p within osteoclast could attenuates osteolytic bone metastasis. [score:3]
Six weeks after the first treatment, the intraosseous miR-214-3p level in BCX nude mice treated with AMO was significantly lower than that in BCX nude mice without AMO treatment (Supplementary Fig. 6a,b), suggesting the efficient inhibition of miR-214-3p in BCX nude mice after AMO treatment. [score:3]
Notably, the time -dependent increase in the expression of miR-214-3p, Ctsk and Trap were more pronounced in the presence of CM from breast cancer (Supplementary Fig. 4a). [score:3]
On the other hand, it has been proved that miR-214-3p could target p53 to enhance the invasion ability of breast cancer cells 27, while depletion of miR-214-3p could block the dissemination of breast cancer cells 28, suggesting an important role of miR-214-3p in mediating breast cancer metastasis. [score:3]
Collectively, it strongly suggests that miR-214-3p could regulate the amount of TRAF3 proteins to contribute to the excessive osteoclastic bone resorption during the development of OBM. [score:3]
Elevated miR-214-3p in osteoclast targets Traf3 to promote osteoclastic bone resorption in vivo. [score:3]
Next, we investigated the role of osteoclastic miR-214-3p in regulating bone resorption in vivo using our previously established osteoclast-specific miR-214-3p knock-in (OC-214) mice that overexpressing miR-214-3p under the control of Cre -mediated recombination driven by the Ctsk promoter 23 24. [score:3]
Moreover, we examined the effect of miR-214-3p on the protein expression level of NFATc1, NIK and p65 (RelA) in RAW 264.7 undergone RANKL -induced osteoclast differentiation. [score:3]
How to cite this article: Liu, J. et al. Osteoclastic miR-214 targets TRAF3 to contribute to osteolytic bone metastasis of breast cancer. [score:3]
We next sought to understand how osteoclastic miR-214-3p regulates the osteoclast activity and bone resorption during the development of OBM. [score:3]
All these data suggest that the elevated expression of miR-214-3p within osteoclast could promote osteoclastic bone resorption in OC-214 mice. [score:3]
In this study, we further found that the CM from breast cancer cells could dramatically stimulate the expression of miR-214-3p and induce the osteoclast differentiation in vitro, which could be blocked/promoted by antagomir-214-3p/agomir-214-3p treatment. [score:3]
These data suggest that the highly expressed intraosseous miR-214-3p were closely associated with the elevated bone resorption in OBM patients. [score:3]
The targeted ES clones were microinjected into C57BL/6 blastocysts, and male chimeras were mated to C57BL/6 females to obtain miR-214-3p  flox-neo/+ mice, which were then intercrossed with flp- deleter mice (JAX, 009086) to remove neo cassette in order to generate miR-214-3p  flox/+ mice. [score:3]
On the other hand, a recent study shows that miR-214-3p could promote osteoclastogenesis and increase osteoclast activity by targeting PTEN during osteoclast differentiation from bone marrow monocytes (BMMs) 17. [score:3]
Our results suggest that therapeutic inhibition of miR-214-3p in osteoclasts may be a potential therapeutic strategy for OBM with dominant osteoclastic bone resorption. [score:3]
Thereafter, we crossed the Rosa26-PCAG-STOP [fl]- mmu-miR-214-knock-in mice with heterozygous Ctsk-cre mice to obtain OC-miR-214 mice. [score:2]
High miR-214-3p in osteoclasts correlates with elevated bone resorption during the development of OBM. [score:2]
Collectively, these data imply a close association between the elevated osteoclastic miR-214-3p level and the excessive bone resorption during the development of OBM. [score:2]
For miRNA expression, the TaqMan primer-probe combinations for miRNA-214-3p and RUN6B were products of Ambion. [score:2]
Firstly, we generate the Rosa26-PCAG-STOP [fl]- mmu-miR-214-3p-knock-in mice. [score:2]
The optimal dosage of antagomir-214-3p was determined in our pilot study, in which almost 80% knockdown efficiency of osteoclastic miR-214-3p was achieved at a dose of 10 mg/kg. [score:2]
Then, the mice were intercrossed with nude mice to obtain the miR-214-3p flox/− nude mice, which were then crossed with the Ctsk-Cre mice to generate the osteoclast-specific miR-214-3p knockout nude mice (Ctsk; miR-214-3p flox/ flox, hereafter C KO mice) and the relative controls (miR-214-3p flox/ flox, hereafter WT mice). [score:2]
Thereafter, the chimeric mice were intercrossed with C57BL/6 mice to obtain F1 heterozygote mice and then backcrossed with C57BL/6 mice to expand the enough number of heterozygote Rosa26-PCAG-STOP [fl]- mmu-miR-214-knock-in mice. [score:2]
Impressively, we found that osteoclast-specific ablation of miR-214-3p could substantially prevent the development of OBM, as evidenced by the low level of CTX-I and bone resorption-related parameters as well as the diminished metastasis to bone in the C KO nude mice after BCX. [score:2]
More importantly, the evidences from the luciferase reporter assay and the gain- and loss-of-function experiments indicate that TRAF3 could be a functional target of miR-214-3p. [score:2]
MiR-214-3p targets Traf3 to functionally promote osteoclast differentiation in vitro. [score:2]
We then transfected the RAW264.7 cells with WT Traf3 3′ UTR to block the binding of endogenous miR-214-3p to Traf3. [score:1]
In addition, we have previously shown that miR-214-3p could promote osteoclast differentiation in vitro. [score:1]
Elevated miR-214-3p level associates with increased bone resorption in bone specimens from breast cancer patients. [score:1]
However, the limitation of this study was that we didn’t examine the effect of miR-214-3p agomir or antagomir on osteoclast differentiation from human peripheral blood mononuclear cells. [score:1]
We observed a gradual increase in the miR-214-3p levels together with a decrease in the amount of TRAF3 protein in RAW 264.7 cells during RANKL -induced osteoclastogenesis (Fig. 4b). [score:1]
On the other hand, the OC-miR-214-3p mice were generated according to our published protocols 24. [score:1]
Consistently, we observed a time -dependent decrease in the TRAF3 protein level, which was accompanied by a gradual increase in the miR-214-3p level, during osteoclastogenesis in vitro. [score:1]
Genetic ablation of osteoclastic miR-214-3p prevents osteolytic bone metastasis in BCX nude mice. [score:1]
To examine the effect of osteoclast-specific miR-214-3p depletion on osteolytic bone metastasis, the C KO mice and WT controls were grafted with human breast cancer cells through intraventricular injection and sacrificed at 8 weeks after xenografts. [score:1]
To investigate whether the elevated miR-214-3p within osteoclasts could promote osteoclastic bone resorption via targeting Traf3 in vivo, we evaluated the degree of bone resorption in the OC-214 mice weekly administrated with or without TRAF3 3′UTR-containing plasmid (20 μg per mice) encapsulated in the our previously developed osteoclast -targeted delivery system 25. [score:1]
The female miR-214-3p  flox/+ mice in C57BL/6 background were intercrossed with the male BALB/c nu/nu mice to obtain the miR-214-3p flox/+ nude mice. [score:1]
Note: miR-214-3p levels were normalized to U6 and osteoclast marker genes mRNA levels were normalized to Gapdh. [score:1]
The relative quantification of miR-214 expression was calculated using the 2 [−∆∆CT] method. [score:1]
Moreover, the correlation analysis indicated that the osteoclastic miR-214-3p level was positively correlated with Oc. [score:1]
The levels of miR-214-3p were normalized to the mean value of control group. [score:1]
Thereafter, the miR-214-3p  flox/+ nude mice were crossed with the Ctsk-cre nude mice to obtain the Ctsk;miR-214-3p  flox/ flox (C KO) nude mice and the miR-214-3p  flox/ flox (wild-type, WT) controls. [score:1]
Loss of miR-214-3p within osteoclasts prevents osteolytic bone metastasis. [score:1]
Thus, the above findings suggest that loss of miR-214-3p within osteoclasts could prevent osteolytic bone metastasis. [score:1]
The correlation analysis further revealed that the miR-214-3p level was positively correlated with the mRNA levels of bone resorption marker genes in bone specimens pooled from breast cancer patients with/without OBM (Fig. 1c). [score:1]
Elevated osteoclastic miR-214-3p level associates with increased bone resorption in bone specimens from BCX nude mice. [score:1]
S/BS and between osteoclastic miR-214-3p level and serum CTX-I levels was performed, respectively. [score:1]
Among the osteoclastogenic miRNAs, the intraosseous miR-214-3p level in OBM patients was significantly higher than that in breast cancer patients without OBM and cancer-free individuals, respectively (Fig. 1a). [score:1]
OC-214: OC-miR-214-3p mice; WT: age-matched littermates; BS: mice that were sacrificed before treatment as baseline; PBS: mice treated with PBS as blank control; Veh: mice treated with (D-Asp) [8]-liposome alone; 3′UTR-Mut: mice treated with (D-Asp) [8]-liposome-mutant Traf3 3′UTR plasmid; 3′UTR: mice treated with (D-Asp) [8]-liposome- Traf3 3′UTR plasmid. [score:1]
Since we have previously demonstrated that the osteoclast could secrete exosomal miR-214-3p to the bone microenvironment 24, it was reasonable to expect that the aberrant elevated miR-214-3p levels in osteoclasts may, in turn, contribute to affect the colonized cancer cells at the bone metastatic site. [score:1]
Traf3 mRNA 3′UTR containing the miR-214-3p -binding sequences for the mouse Traf3 gene was amplified by PCR from mouse genomic DNA. [score:1]
The osteoclastic miR-214-3p level within OSCAR [+] cells, the value of Oc. [score:1]
As expected, the miR-214-3p level and the mRNA levels of Ctsk and Trap gradually increased during the osteoclast differentiation. [score:1]
Q-PCR analysis of the miR-214-3p levels (a) and the TRAP and CTSK mRNA levels (b) in osteoclasts and non-osteoclasts isolated from bone marrow cells by MACS. [score:1]
The miR-214-3p  flox/− mice were generated as previously reported 21. [score:1]
We next evaluated the therapeutic effect of inhibiting osteoclastic miR-214-3p on osteolytic bone metastasis. [score:1]
[1 to 20 of 77 sentences]
20
[+] score: 188
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-199b
Here, we found that the proliferation of human glioma cells is inhibited by PPAR α overexpression, which promotes transcription of DNMO3os, thereby increasing miR-214 levels and consequently decreasing translation of its target E2F2 mRNA. [score:9]
PPAR α Inhibits the Proliferation of Human Glioma Cells via MiR-214-Mediated Regulation of E2F2Having shown that PPAR α promotes miR-214 transcription and that miR-214 overexpression reduces E2F2 protein levels in glioma cells, we next asked whether the inhibitory effects of PPAR α on proliferation were mediated through miR-214 and E2F2. [score:8]
These experiments showed that miR-214 expression could suppress luciferase activity driven by the WT E2F2 3′-UTR but not by the mutant 3′-UTR, confirming that E2F2 is a direct target of miR-214 (Figure 5(b)). [score:8]
Overexpression of miR-214 reduced E2F2 protein expression and inhibited cell proliferation. [score:7]
These results confirmed that E2F2 is a target of miR-214 in the human glioma cells U87 and U251 and that miR-214 overexpression inhibits tumor growth in vivo. [score:7]
To determine whether miR-214 overexpression inhibited the growth of glioma cells in vivo as well as in vitro, we injected nude mice subcutaneously with U87 cells expressing either miR-214 or a control miRNA and analyzed tumor growth after 8 weeks. [score:7]
Consistent with this, miR-214 overexpression inhibited cell proliferation by targeting E2F2. [score:7]
To determine whether the inhibition of proliferation induced by PPAR α overexpression was related to miR-199a and miR-214 transcription, we examined the activity of DNMO3os in control and PPAR α -overexpressing cells. [score:7]
To identify potential mRNA targets of miR-214, we performed bioinformatic analysis using TargetScan and PicTar algorithms, which predict target mRNA based on complementarity between miRNA seed sequences and the mRNA 3′-UTR sequences. [score:7]
We also demonstrated that expression of miR-214, which is encoded by the DNMO3os transcription unit, correlated positively with PPAR α levels and that miR-214 inhibits E2F2 expression. [score:7]
CCK-8 assays demonstrated that miR-214 overexpression not only inhibited the proliferation of U87 and U251 cells (Figure 4(b)) but also increased the proportion of cells in G0/G1, as was observed in PPAR α -overexpressing cells. [score:6]
MiR-214 was the most significantly upregulated miRNA in PPAR α -overexpressing cells, and correlation analysis showed a positive association between miR-214 and PPAR α levels (Figures 3(c)– 3(e)). [score:6]
Our study extends these findings by showing that miR-214 targeting of E2F2 inhibits the proliferation of human brain glioma cells through a PPAR α-regulated pathway. [score:6]
Consistent with this, cells overexpressing miR-214 showed reduced expression of E2F2 at the protein level compared with cells expressing a control miRNA (Figure 5(c)). [score:6]
Having shown that PPAR α promotes miR-214 transcription and that miR-214 overexpression reduces E2F2 protein levels in glioma cells, we next asked whether the inhibitory effects of PPAR α on proliferation were mediated through miR-214 and E2F2. [score:5]
Overexpression of PPAR α in glioma cells promoted transcription of DNMO3os, leading to increased expression of miR-214. [score:5]
Our results thus suggest that PPAR α inhibits human glioma cell proliferation through a miR-214- and E2F2 -dependent pathway and identify novel potential molecular targets for the treatment of human gliomas. [score:5]
Indeed, basal transcription level was induced in U87 and U251 cells after overexpression of PPAR α (Figure 3(a)), and consistent with this, miR-214, miR-199a-3p, and miR-199a-5p levels were higher in PPAR α -expressing cells than in the control cells (Figure 3(b)). [score:5]
Taken S that PPAR α inhibition of glioma cell growth is mediated by the sequential effects on miR-214 transcription and E2F2 expression. [score:5]
Notably, overexpression of E2F2 partially restored the proliferation of miR-214 -overexpressing cells, suggesting that the miR-214 effect was mediated by E2F2 (Figure 5(d)). [score:5]
MiR-214 Inhibits the Proliferation of Glioma Cells by Targeting E2F2. [score:4]
Western blot analysis of the excised tumors showed that E2F2 expression was lower in tumors derived from miR-214 -expressing cells compared with control cells, as expected (Figure 5(g)). [score:4]
Importantly, glioma cell proliferation (Figure 6(a)) and E2F2 protein expression (Figure 6(b)) were both increased in PPAR α -overexpressing cells infected with AS-miR-214 compared with PPAR α sequence. [score:4]
PPAR α cDNA was cloned into the GFP -expressing pWPXLd plasmid using BamHI and PacI restriction sites, and miR-214 cDNA was cloned into the pGLV3/H1 plasmid using BamHI and MluI sites. [score:3]
To determine whether PPAR α -mediated transcription of miR-214 is involved in the reduced proliferation of PPAR α -overexpressing human glioma cells, we first investigated the effect of lentiviral -mediated overexpression of miR-214. [score:3]
We selected stably infected U87 and U251 cell lines and verified the expression of miR-214 by quantitative real-time PCR (Figure 4(a)). [score:3]
This analysis identified E2F2 mRNA as a putative target of miR-214 (Figure 5(a)). [score:3]
Wang et al. found that miR-214 inhibits the proliferation of hepatocellular carcinoma cells by reducing E2F2 mRNA levels [10]. [score:3]
As shown in Figures 5(e)- 5(f), tumor growth was reduced by miR-214 overexpression. [score:3]
PPAR α Inhibits the Proliferation of Human Glioma Cells via MiR-214-Mediated Regulation of E2F2. [score:3]
Lentiviruses expressing control protein (GFP), GFP-PPAR α, control miRNA, or miR-214 were added to U87 and U251 cells. [score:3]
The cells were cotransfected with control or miR-214 overexpression plasmids. [score:3]
MiR-214 regulates tumor progression by targeting mRNAs encoding proteins such as poly(rC) binding protein-2 (PCBP2), E2F transcription factor 2 (E2F2), and the SUMO-conjugating enzyme UBC9 [12– 14]. [score:3]
PPAR α is known to regulate transcription of the DNMO3os, which encodes miR-199a and miR-214 [8, 16]. [score:2]
To confirm this, we performed luciferase reporter assays in human glioma cells expressing luciferase driven by WT human E2F2 3′-UTR or a mutant construct in which the miR-214 binding site is deleted. [score:2]
Collectively, these data suggest that PPAR α is involved in the regulation of miR-214 transcription. [score:2]
PPAR α Promotes Transcription of DNMO3osPPAR α is known to regulate transcription of the DNMO3os, which encodes miR-199a and miR-214 [8, 16]. [score:2]
Thus, the proportion of cells in various phases of the cell cycle was as follows: U87/control cells: 53.3 ± 2.13% in G0/G1, 23.6 ± 1.25% in S, and 23.1 ± 1.02% in G2/M; U87/miR-214 cells: 75.6 ± 1.19% in G0/G1, 13.4 ± 0.78% in S, and 11.1 ± 1.24% in G2/M; U251/control cells: 52.8 ± 1.85% in G0/G1, 22.2 ± 1.92% in S, and 24.9 ± 2.41% in G2/M; and U251/miR-214 cells: 71.3 ± 1.67% in G0/G1, 17.8 ± 1.59% in S, and 10.9 ± 1.30% in G2/M (Figure 4(c)). [score:1]
AS-miR-214 also decreased the proportion of cells in G0/G1 phase of the cell cycle (Figure 2(c)), consistent with the improved cell proliferation. [score:1]
PPAR α promotes transcription of the dynamin-3 gene opposite strand (DNMO3os), which encodes a miR-214 and miR-199 cluster [8– 10]. [score:1]
In U87/control cells, 59.4 ± 1.08% of cells were in G0/G1, 27.1 ± 1.23% were in S, and 13.5 ± 1.65% were in G2/M; for U87/AS-miR-214 cells, the corresponding numbers were 58.1 ± 2.40% in G0/G1, 22.3 ± 1.59% in S, and 19.5 ± 1.00% in G2/M. [score:1]
In brief, stably infected U87/Control or U87/miR-214 cell lines (2 × 10 [6] cells/0.1 mL) were injected subcutaneously into the upper-left quadrant of the dorsal skin of nude mice. [score:1]
To test this, we examined cells transfected with miR-214 antisense (AS-miR-214). [score:1]
The DNMO3os transcription unit includes miR-199a and miR-214 [23]. [score:1]
A mutant vector (pmirGLO-MT-E2F2-Luc) was constructed by deleting the miR-214 binding site (CCUGCUG) in the WT E2F2 3′-UTR. [score:1]
Thus, we have elucidated a PPAR α-miR-214-E2F2 signaling pathway in human glioma cells. [score:1]
Correlation analysis showed that PPAR α have a positive correlation with miR-214. [score:1]
[1 to 20 of 47 sentences]
21
[+] score: 183
miR-214 is down-regulated in HCC samplesQuantitative real-time PCR showed that miR-214 expression was up-regulated in HLE cells and suppressed in HuH6 cells (Figure 2A). [score:11]
miR-214 expression is inversely correlated with UCP2 levels and HCC diseaseGiven that our experiments indicated that UCP2 is a bona fide target of miR-214, we hypothesized that suppression of miR-214 expression might be an underlying feature of human prostate cancer. [score:11]
Figure 2 miR-214 expression is down-regulated in HCCSteady state expression of miR-214 in indicated cell lines (A) or paired tumour and adjacent non-tumour tissue (B) were determined. [score:8]
Quantitative real-time PCR showed that miR-214 expression was up-regulated in HLE cells and suppressed in HuH6 cells (Figure 2A). [score:8]
Given that our experiments indicated that UCP2 is a bona fide target of miR-214, we hypothesized that suppression of miR-214 expression might be an underlying feature of human prostate cancer. [score:7]
The ones with high miR-214 expression corresponded to N0, N1 cases (non-metastatic) whereas those with low miR-214 expression corroborated to highly metastatic disease. [score:7]
Our experiments have cumulatively shown that UCP2 transcript is post-transcriptionally regulated by miR-214 in normal hepatic cells and that down-regulation of miR-214 in HCC induces UCP2 expression in these HCC cells. [score:7]
It has been shown that during progression from adaptive hypertrophy to heart failure, miR-214 and miR-30* together regulate cardiac vascular endothelial growth factor (VEGF) expression and angiogenesis by targeting X-box -binding protein-1 (XBP1), a key transcription factor of the unfolded protein response in mammalian cells [26]. [score:6]
miR-214 expression is down-regulated in HCC. [score:6]
Our results indicated a dynamic and inverse correlation between down-regulation in the levels of miR-214 and the observed increase in the expression of UCP2 in HCC tissue specimens (Figure 4A) (P<0.005, Pearson correlation, r=−0.9792). [score:6]
It will be important to confirm if miR-214 levels are also down-regulated in these cells or UCP2 expression is controlled by additional mechanism. [score:6]
UCP2 is a direct target of miR-214 in HCC cellsWe next determined if UCP2 is a bona fide target of miR-214 in HCC cell lines. [score:6]
Elucidating the underlying mechanism regulating miR-214 expression will help explain the differential functional readouts of miR-214 in malignant proliferative disease and HCC. [score:6]
Evaluation of miR-214 expression in 25 paired HCC and adjacent normal tissue specimens showed that miR-214 expression was significantly down-regulated in HCC tissue (median, 6.39; range, 1.25–9.01) compared with normal counterparts (median, 68.87; range, 38.17–91.42) (P<0.001) (Figure 2B). [score:5]
We determined miR-214 and UCP2 expression in 20 HCC patients, ten with high miR-214 and ten with low miR-214 expression. [score:5]
miR-214 expression is inversely correlated with UCP2 levels and HCC disease. [score:5]
This led us to examine whether overexpression via transfection of miR-214 mimic in HuH6 cells and suppression via transfection of miR-214 antagomir in HLE cells would impact proliferation rates. [score:5]
Our prediction of miR-214 targeting UCP2 mRNA was based on the TargetScan algorithm. [score:5]
However, along with miR-126, miR-214 has been shown to be overexpressed in malignant endothelial proliferative disease [27]. [score:5]
UCP2 is a bona fide target of miR-214, expression level of which control cell viability. [score:5]
Modulating miR-214 levels impacted proliferation in the HCC cellsSince UCP2 can inhibit ROS -induced apoptosis [19], we rationalized that altering UCP2 transcript levels by modulating miR-214 expression might affect proliferation rates. [score:5]
Since UCP2 can inhibit ROS -induced apoptosis [19], we rationalized that altering UCP2 transcript levels by modulating miR-214 expression might affect proliferation rates. [score:5]
miR-214 is down-regulated in HCC samples. [score:4]
UCP2 is a direct target of miR-214 in HCC cells. [score:4]
The miR-214 binding mutant UCP2 3’ UTR reporter did not show any difference in relative luciferase activity between HLE and Huh cells (Figure 3B), confirming that UCP2 mRNA was being targeted by the miR-214 in these cells. [score:3]
We next determined if UCP2 is a bona fide target of miR-214 in HCC cell lines. [score:3]
To confirm that the effects observed was due to miR-214 targeting the UCP2 3’ UTR, we generated and tested a miR-214 binding mutant of the UCP2 3’ UTR reporter, in which both the putative binding sites between 6–16 nucleotides were deleted. [score:3]
UCP2 transcript is targeted by miR-214. [score:3]
In situ prediction using TargetScan platform [18] showed that miR-214 have two putative and adjacent binding sites in the 3’ UTR of UCP2 (Figure 1D). [score:3]
Our results suggest that in the context of HCC, miR-214 functions as a tumour suppressor (Figure 4B). [score:3]
Steady state expression of miR-214 in indicated cell lines (A) or paired tumour and adjacent non-tumour tissue (B) were determined. [score:3]
Whereas miR-214 mimic inhibited UCP2 3’ UTR reporter (P<0.05) in HuH6 cells, miR-214 antagomir rescued reporter activity in the HLE cells (P<0.05) (Figure 3C). [score:3]
Figure 3 UCP2 is a bona fide target of miR-214, expression level of which control cell viability(A) Cell viability was measured in HLE and HuH6 cells at 24, 48 and 72 h after transfection with miR-214 antagomir or mimic respectively, by the MTT assay. [score:2]
To make the UCP2 3’ UTR mutant construct, site-directed mutagenesis was used to delete 6–16 region, corresponding to the hsa-miR-214 -binding site. [score:2]
Where indicated, cells were transfected with the miR-214 mimic or antagomir (Life Technologies) along with the UCP2 3’ UTR constructs. [score:1]
Our prediction of miR-214 was through one of these five algorithms. [score:1]
Figure 4 UCP2 mRNA and miR-214 are inversely correlated in patients with HCC(A) Pearson correlation demonstrating the inverse relation between UCP2 and miR-214 in paired samples (P<0.005, Pearson correlation, r=−0.9792). [score:1]
Modulating miR-214 levels impacted proliferation in the HCC cells. [score:1]
UCP2 mRNA and miR-214 are inversely correlated in patients with HCC. [score:1]
Vice versa, miR-214 antagomir induced significantly more cell proliferation in HLE cells at the indicated time points (P<0.05 in each case) (Figure 3A). [score:1]
According to the manufacturer's instructions, miRNA from tissues and cells was extracted using the mirVana miRNA isolation kit (Life Technologies) and the expression levels of hsa-miR-214 and U6 small nuclear RNA (RNU6B) were detected by TaqMan miRNA assays (Life Technologies) (TaqMan Assay IDs: 002306 and 001093 respectively). [score:1]
[1 to 20 of 41 sentences]
22
[+] score: 166
As for the signaling pathway, the miR-214 not only could suppress the upstream signaling molecule RAS in MAPK pathways [17], it might directly suppress the expression of JNK and ERK [31, 32]. [score:8]
a Decreased miR-214 expression in Jurkat cells after transfection with miR-214 inhibitor versus scramble oligonucleotides; (b) in Jurkat cells transfected miR-214 inhibitor or controls, the apoptotic rate was increased after cultured with TNF-α (20 ng/mL) for 24 h compared with those cultured with medium alone. [score:6]
Among the nine T-cell miRNAs affected by TNF-α and downregulated in RA T cells, the expression levels of miR-139-3p, miR-204, miR-214, and miR-760 were increased in patients using biologic agents. [score:6]
First, we successfully transfected miR-214 inhibitor into Jurkat cells and the expression levels of miR-214 were modest but significantly lower in Jurkat cells transfected with miR-214 inhibitor compared with the controls (Fig.   3a). [score:6]
Tian X Zeng G Li X Wu Z Wang L Cantharidin inhibits cell proliferation and promotes apoptosis in tongue squamous cell carcinoma through suppression of miR-214 and regulation of p53 and Bcl-2/BaxOncol Rep. [score:6]
Each scatter spot representing average normalized expression level of miRNA in three repeats of each treatment; (b) 13 miRNAs exhibiting aberrant expression in Jurkat cells cultured with TNF-α (20 ng/mL) for 7 days; (c) decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 in RA T cells miRNA, compared with normal T cells. [score:6]
Among various systemic autoimmune diseases, decreased expression of miR-214 was found in patients with multiple sclerosis [33]. [score:5]
It has been reported that miR-214 could inhibit the protein expression of Ras [19], an upstream activator of ERK and JNK. [score:5]
The expression levels of 12 miRNAs, including miR-139-3p, miR-204, miR-760, miR-432, miR-524-5p, miR-136, miR-548d-3p, miR-206, miR-214, miR-383, miR-224, and miR-887 were significantly lower, whereas the expression level of miR-146a was significantly higher, in Jurkat cells after being cultured with TNF-α for 7 days (fold change > 4, p < 0.05, Fig.   1b). [score:5]
Jindra PT Bagley J Godwin JG Iacomini J Costimulation -dependent expression of microRNA-214 increases the ability of T cells to proliferate by targeting PtenJ Immunol. [score:5]
Huang HJ Liu J Hua H Li SE Zhao J Yue S MiR-214 and N-ras regulatory loop suppresses rhabdomyosarcoma cell growth and xenograft tumorigenesisOncotarget. [score:5]
Initially, our studies showed that among the expression of T cell miRNAs affected by TNF-α in Jurkat cells, the expression levels of miR-139-3p, miR-204, miR-760, miR-383, miR-524-5p, miR-136, miR-548d-3p, and miR-214 were significantly decreased in RA T cells. [score:5]
It has been found that increased expression of miR-214 in T cells upon activation [34] and increased miR-214 expression could promote the release of inflammatory cytokines, such as TNF-α and interleukin (IL)-6 in murine macrophages [35]. [score:5]
Zhang ZC Li YY Wang HY Fu S Wang XP Zeng MS Knockdown of miR-214 promotes apoptosis and inhibits cell proliferation in nasopharyngeal carcinomaPLoS One. [score:4]
Expression levels of miR-139-3p, miR-204, miR-214, and miR-760 were correlated with the use of biologic agents. [score:3]
The transfection of miR-214 mimic suppressed TNF-α -mediated apoptosis of Jurkat cells. [score:3]
We speculated that the decreased expression of miR-214 might contribute to the activation of ERK and JNK. [score:3]
The apoptotic rate was similar in Jurkat cells transfected with miR-214 mimic cultured either in the presence or absence of TNF-α (Fig.  2c) Fig. 3Effects of miR-214 inhibitor (miR-214i) transfection in Jurkat cells apoptosis. [score:3]
The expression levels of miR-139-3p, miR-204, miR-214, and miR-760 increased in RA patients receiving biologic agents. [score:3]
The transfection of miR-214 reversed the TNF-α -mediated cells apoptosis and inhibited the phosphorylation of ERK and JNK in Jurkat cells. [score:3]
The relative expression level of miRNA was defined as (39 – Ct) after adjusting with an internal control (U6 small nuclear RNA) Fig. 2Effects of miR-214 mimic transfection in Jurkat cells apoptosis. [score:3]
Jurkat cells were transfected with miR-214 mimic, miR-214 inhibitor or scramble oligonucleotides (all from Ambion, Austin, TX, USA) using the conditions previously described [16], and then cultured with TNF-α (20 ng/mL) at 37 °C for 24 h or 48 h for further analysis of cell apoptosis or Western blot analysis, respectively. [score:3]
The expression levels of miR-214 showed a significant correlation with the serum CRP levels and the use of biologic agents. [score:3]
Transfection of miR-214 inhibitor did not affect survival of Jurkat cells. [score:3]
Transfection of miR-214 mimic suppressed TNF-α -mediated apoptosis of Jurkat cells. [score:3]
Since the expression levels of miR-214 were statistically significant correlated with the serum CRP levels and the use of biologic agents. [score:3]
Transfection of Jurkat cells with miR-214 mimic suppressed both the basal and TNF-α -mediated ERK and JNK phosphoryation. [score:3]
The expression levels of miR-139-3p, miR-204, miR-214, and miR-760 increased in RA patients using biologic agents. [score:3]
Decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 were noted in RA T cells. [score:3]
Whether cultured with TNF-α or not, the apoptotic rate of Jurkat cells was not different between those transfected with miR-214 inhibitors and the controls Fig. 4Comparison of ERK and JNK protein phosphorylation in T-cell lysates from RA and control groups as detected by Western blot analysis. [score:3]
Then, we transfected miR-214 inhibitor and controls into Jurkat cells and cultured in the presence or absence of TNF-α for 24 hours. [score:3]
Therefore, the pathologic role of decreased expression of miR-214 in T cells from patients with RA might be an insufficient negative feedback to stop the inflammatory response similar to the role of miR-146a in the immunopathogenesis of RA [5]. [score:3]
The apoptotic rates of Jurkat cells were both significantly elevated in Jurkat cells transfected with miR-214 inhibitor and controls. [score:3]
Wang F Liu M Li X Tang H MiR-214 reduces cell survival and enhances cisplatin -induced cytotoxicity via down-regulation of Bcl2l2 in cervical cancer cellsFEBS Lett. [score:3]
We found that miR-214 could suppress both the basal level and TNF-α -induced ERK and JNK phosphorylation and apoptosis in Jurkat cells. [score:3]
Increased (a) ERK and (b) JNK phosphorylation in nine patients with RA and six healthy controls, normalized to actin expression; (c) ERK and JNK protein phosphorylation in T cell lysates of three patients with RA and two healthy controls as representative tests Fig. 5Effect of miR-214 on ERK and JNK protein phosphorylation in Jurkat cells. [score:3]
Moreover, RA patients with each 1 mg/dL increment of CRP levels had a significant 0.65-fold decrease (p = 0.025; 95% CI 0.45–0.94) and the use of biologic agents had a significant 2.44-fold increase (p = 0.032; 95% CI 1.08–5.48) in miR-214 expression levels. [score:3]
Zhao L Liu YW Yang T Gan L Yang N Dai SS The mutual regulation between miR-214 and A2AR signaling plays an important role in inflammatory responseCell Signal. [score:2]
The impact of dysregulated miR-214 for cell apoptosis is still controversial [27– 30]. [score:2]
The fold changes of expression levels for these miRNAs were 0.42-fold for miR-139-3p, 0.43-fold for miR-204, 0.13-fold for miR-760, 0.32-fold for miR-524-5p, 0.45-fold for miR-136, 0.19-fold for miR-548d-3p, 0.37-fold for miR-214;0.36-fold for miR-383, and 0.14-fold for miR-887, compared with controls. [score:2]
The expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 was found to be significantly lower in RA T cells (p < 0.05), compared with controls (Fig.   1c). [score:2]
e In Jurkat cells after transfection with miR-214 mimic or scramble oligonucleotides cultured with TNF-α (20 ng/mL) for 48 h, the phosphorylation ratio of ERK and JNK decreased in those transfected with miR-214 mimic compared with the control groups and (f) a representative case Expression profiles of 270 miRNAs in Jurkat cells cultured in the presence or absence of TNF-α (20 ng/mL) for 7 days are displayed in Fig.   1a, with each scatter spot represents the average of three adjusted miRNA levels from each group. [score:2]
Whether cultured in the presence or absence of TNF-α, there were no significant differences in the apoptotic rates of Jurkat cells transfected with miR-214 inhibitor compared with the controls (Fig.   3b). [score:2]
We further surveyed the functional effects of miR-214 in T cells. [score:1]
Transfection of miR-214 into Jurkat cells. [score:1]
a Remarkable elevation of miR-214 expression levels in Jurkat cells after transfection with miR-214 mimic versus controls (transfected with scramble oligonucleotides); (b) increased Jurkat cells apoptosis after cultured with TNF-α (20 ng/mL) for 7 days, compared with culture medium alone; (c) in Jurkat cells transfected scrambled oligonucleotides, the apoptotic rate of Jurkat cells was increased after cultured with TNF-α (20 ng/mL) for 24 h compared with those cultured with medium alone. [score:1]
The transfection of miR-214 mimic reversed the TNF-α mediated cell apoptosis as well as ERK and JNK phosphorylation and thus appeared to be involved in the immunopathogenesis of RA. [score:1]
In contrast, the apoptotic rate was similar in Jurkat cells transfected with miR-214 mimic after cultured in the presence or absence of TNF-α (Fig.   2c). [score:1]
Then, we transfected miR-214 mimic and controls into Jurkat cells and cultured them in the presence or absence of TNF-α for 24 hours. [score:1]
Since the expression levels of miR-214 were significantly correlated with the serum CRP levels and the use of biologic agents, we further investigated the functional effects of miR-214 in T cells. [score:1]
First, we successfully transfected miR-214 mimic into Jurkat cells (Fig.   2a). [score:1]
[1 to 20 of 51 sentences]
23
[+] score: 163
miR-214 was found to inhibit ARL2 expression by ~60%, similar to the inhibitory effect of siRNA on ARL2 expression (Fig. 3C and D). [score:9]
These results confirm that ARL2 is a direct target gene of miR-214 and that miR-214 negatively regulates its expression. [score:7]
To analyze the molecular mechanisms underlying the regulation of miR-214 in colon cancer growth, Targetscan and Pictar software was used to predict the target of miR-214. [score:6]
In conclusion, we hypothesize the following explanation for the regulation mechanism of miR-124 in colon cancer: miR-214 suppresses cell growth and promotes cell apoptosis by targeting ARL2. [score:6]
The analysis showed that miR-214 expression was downregulated in colon cancer. [score:6]
In addition, miR-214 is downregulated in hepatoma and inhibits tumor angiogenesis by inducing hepatoma-derived growth factor (14). [score:6]
miR-214 expression was found to be downregulated in colon cancer. [score:6]
However, miR-214 has also been shown to be downregulated in ovarian cancer and to induce cell survival and cisplatin resistance by targeting the phosphate and tensin homolog 3′UTR (15), indicating that it may function as an oncogene. [score:6]
A previous study showed that miR-214 expression is decreased in human cervical cancer and that it inhibits cell proliferation, migration and invasion (13). [score:5]
To validate whether ARL2 is a direct target of miR-214, a point mutation was generated with binding sites and cloned into the downstream region of the luciferase reporter gene. [score:5]
Therefore, the inhibition of cell proliferation may be responsible for the inhibitory role of miRNA-214 in cell growth. [score:5]
miR-214 overexpression inhibits colon cancer cell viability and colony formation. [score:5]
These results indicated that miR-214 negatively regulates ARL2 expression by directly binding to its 3′UTR. [score:5]
It was identified that miR-214 inhibited the expression of ARL2 protein and mRNA (Fig. 4C and D), similar to the function of ARL2 siRNA. [score:5]
miR-214 overexpression inhibits colon cancer cell proliferation. [score:5]
In addition, miR-214 has been found to be upregulated in gastric carcinoma (16), melanoma (17, 18) and hepatocellular carcinoma (19), playing an important role in the promotion of tumor malignancy. [score:4]
As shown in Fig. 1A, miR-214 was found to be downregulated in colon cancer. [score:4]
The results from the luciferase reporter assay indicated that miR-214 lead to the inhibition of the luciferase intensity of ARL2 3′UTR, whereby this inhibition was eliminated in the mutant ARL2 3′UTR (Fig. 4B). [score:4]
ARL2 is a direct target gene of miR-214 in colon cancer. [score:4]
miR-214 downregulation in human colon cancer. [score:4]
miR-214 overexpression promotes colon cancer cell apoptosis. [score:3]
Based on the analysis of miRNAmap2.0, qPCR was performed to detect miR-214 expression in 24 paired normal and colon cancer tissues (Fig. 1B). [score:3]
These results indicate that the different roles of miR-214 may be tissue or cell-specific, and the main target genes of miR-214 may be responsible for its diverse functions. [score:3]
In addition, miR-214 inhibited the ARL2 protein and mRNA levels. [score:3]
Accordingly, miR-214 inhibited the cell viability of the SW620 cells (Fig. 2C). [score:3]
In certain cancers, miR-214 has been shown to function as a tumor suppressor (13, 14), consistent with the results of the present study. [score:3]
Consistent with the effect of miR-214 on cell viability, miR-214 inhibited the number of SW480 and SW620 cell colonies by ~75 and 60%, respectively (Fig. 2D). [score:3]
The overexpression of miR-214 in the SW480 and SW620 colon cancer cells treated with miR-214 mimics was confirmed (Fig. 2A). [score:3]
These results indicate that miR-214 inhibits cell growth partly through promoting cell apoptosis. [score:3]
Based on the results reported in previous studies and the binding sites of miR-214 in the ARL2 3′UTR, in the current study, ARL2 was selected as a candidate target of miR-214. [score:3]
However, the inhibitory function of miR-214 in the mutant 3′UTR of ARL2 was eliminated. [score:3]
These results indicate that the abnormal expression of miR-214 may be significant in colon cancer. [score:3]
In agreement with these results, the present study analyzed the expression of miR-214 in various normal and cancer tissues, including colon cancer tissues, using miRNAmap2.0. [score:3]
The function of ARL2 in cell proliferation, as shown in previous studies, indicated that ARL2-knockdown may provide a phenocopy of the effect of miR-214 on colon cancer cells. [score:2]
The results from the showed that miR-214 led to the inhibition of SW480 cell viability by 20–30% at various time-points compared with the miR-214 control cells (Fig. 2B). [score:2]
The results of the present study indicate that miR-214 may present a novel biomarker for the evaluation of colon cancer progression, and may present a potential miRNA -based therapeutic target for colon cancer patients. [score:1]
To investigate the functional role of miR-214 downregulation in colon cancer, cell viability and colony formation assays were performed to analyze cell growth. [score:1]
miR-214 mimics and controls were purchased from Shanghai GenePharma Co. [score:1]
A binding site for miR-214 was identified in the 3′UTR of ARL2, and the binding sites were conserved among species (Fig. 4A). [score:1]
Controversy remains with regard to the function of miR-214 in tumor progression. [score:1]
As shown in Fig. 3A and B, the cells treated with miR-214 mimics exhibited a higher apoptotic rate than the cells with the miR-214 control. [score:1]
It was found that miR-214 increased the number of cells in the G [1] phase, while reducing the number of cells in the S phase, leading to G [1]/S arrest in the SW480 and SW620 cells (Fig. 3D). [score:1]
During the investigation of the function of miR-214 in ARL2 protein and mRNA expression, the siRNA of ARL2 was used as a positive control. [score:1]
However, the function of miR-214 in colon cancer has not yet been identified. [score:1]
These results indicate that miR-214 may exhibit a key function in colon cancer growth. [score:1]
However, additional confirmed target genes of miR-214 may also mediate its function in colon cancer, although this requires further investigation. [score:1]
The cells were then co -transfected with miR-214 mimics and wild-type or mutant ARL2 3′UTRs. [score:1]
Ltd) was used as an internal control for the normalization of miR-214. [score:1]
[1 to 20 of 48 sentences]
24
[+] score: 161
MiR-15a suppresses cell viability by regulating WNT3A and FGF7, and miR-214 potentially downregulates ING4 to inhibit apoptosis induced by GEM. [score:9]
MiR-214 was upregulated more than 14-fold in BxCP-3 cells after transfection, whereas miR-15a was upregulated about 6-fold (Figure 2A); this result indicated better transfection efficiency of miR-214. [score:7]
In vitro experiments showed that overexpression of miR-15a inhibited the viability of pancreatic cancer cells, whereas overexpression of miR-214 decreased the sensitivity of the cells to gemcitabine (GEM). [score:7]
MiR-15a downregulation and miR-214 upregulation in human pancreatic cancer. [score:7]
Downregulation of miR-15a might contribute to proliferation of pancreatic cancer cells, whereas upregulation of miR-214 in pancreatic cancer specimens might be related to the poor response of pancreatic cancer cells to chemotherapy. [score:7]
MiR-15a was frequently downregulated in the cancer samples relative to the benign tissues samples, whereas miR-214 was upregulated. [score:7]
MiR-15a and miR-214 were found to be aberrantly expressed in human pancreatic cancer and to play different roles in the development of the disease. [score:6]
Furthermore, we identified WNT3A and FGF7 as potential targets of miR-15a and ING4 as a target of miR-214. [score:5]
MiR-15a inhibited the activity of WNT3A and FGF7 3'-UTR reporters, whereas miR-214 inhibited the activity of the ING4 3'-UTR reporter. [score:5]
Expression levels of miR-214 could potentially serve as prognostic markers; however, the utility of miR-214 as a therapeutic target in human pancreatic cancer remains to be determined. [score:5]
In the present study, we found that ING4 is a potential target of miR-214, which was overexpressed in pancreatic cancer and could modulate the sensitivity to GEM -induced apoptosis in BxCP-3 cells. [score:5]
Among the four upregulated miRNAs, miR-214 was previously reported to be associated with mouse pancreas development [14]. [score:5]
We detected the expression patterns of miRNAs in 10 pancreatic cancer tissues and their adjacent benign tissues by quantitative real time-PCR (qRT-PCR) and found that miR-15a and miR-214 were dysregulated in the tumor samples. [score:4]
We found that miR-214 was dramatically downregulated after treatment with GEM. [score:4]
In pancreatic cancer, miR-15a directly regulates WNT3A and FGF7, and miR-214 might regulate ING4. [score:4]
To further study the mechanisms of both miR-15a and miR-214 in pancreatic cancer cells, we predicted and validated potential targets for both miRNAs. [score:3]
Documented evidence indicates that miR-214 functions as either an oncogene or a tumor suppressor in different cancers. [score:3]
Among the miRNAs studied, we found that four miRNAs were frequently overexpressed in the cancer tissues studied: miR-100, miR-125b, miR-200a and miR-214 (Table 1 and Figure 1A). [score:3]
Figure 1 Expression patterns of miR-15a and miR-214. [score:3]
Figure 3 Target validation of miR-15a and miR-214. [score:3]
Next, we detected the expression pattern of miR-214 in cells treated with GEM. [score:3]
We also identified ING4 as a potential target of miR-214. [score:3]
MiR-15a overexpression reduces cell viability, whereas miR-214 decreases sensitivity to GEM in pancreatic cancer cells. [score:3]
Using the same methods, seven candidates: RASSF5, PIM1, BAX, BIK, NEO1, ACVR1B and ING4, were predicted as the putative targets of miR-214 and chosen for experimental validation (Table 3). [score:3]
In addition, we found that overexpression of miR-15a could reduce the viability of pancreatic cancer cells, whereas miR-214 counteracted the pro-apoptotic effect of gemcitabine (GEM) in BxCP-3 cells. [score:3]
Aberrant expression of miRNAs such as miR-15a and miR-214 results in different cellular effects in pancreatic cancer. [score:3]
qRT-PCR was performed to detect (A) miR-214 and (B) miR-15a expression in 10 pancreatic cancer tissues and their adjacent benign pancreatic tissues. [score:3]
In particular, miR-214 expression was elevated in 8 of 10 (80%) cancer specimens. [score:3]
This is the first time that miR-214 has been identified as aberrantly expressed in pancreatic cancer. [score:3]
However, we observed no obvious effect of miR-214 overexpression on cell viability (p > 0.05) (Figure 2B), which implies that miR-214 might have other roles in pancreatic cancer. [score:3]
Because overexpression of miR-214 was observed in pancreatic cancer tissues, we questioned whether this phenomenon might be related to tumor cell survival and drug resistance in pancreatic cancer. [score:3]
The detailed mechanisms and signaling pathways regulated by miR-15a and miR-214 in pancreatic cancer deserve further study. [score:2]
MiR-214 is another miRNA that is dysregulated in pancreatic cancer. [score:2]
To identify dysregulated miRNAs, we used qRT-PCR to measure the expression of seven mature miRNAs (miR-15a, miR-27a, miR-100, miR-125b, miR-181a, miR-200a and miR-214) in 10 pancreatic cancer tissues and their adjacent benign tissues. [score:2]
This is the first report implicating the dysregulation of miR-214 in pancreatic cancer. [score:2]
In this study, we demonstrated that miR-15a and miR-214 were significantly dysregulated in pancreatic cancer specimens. [score:2]
However, there are no reports on the function of miR-214 in human pancreas development or in the chemoresistance of pancreatic cancer. [score:2]
It was also reported that miR-214 negatively regulates HeLa cell proliferation and increases the ability of T cells' viability [19, 20]. [score:2]
These results suggest that miR-214 might be involved in the chemoresistance of pancreatic cancer cells. [score:1]
Transient transfection was performed in 293T cells with 100 nM miR-15a or miR-214 mimics and 0.1 μg of psi-CHECK-control or psi-CHECK-3'UTR fluorescence reporter constructs. [score:1]
To address this issue, we investigated the expression patterns of miR-214 in BxCP-3 cells treated with GEM. [score:1]
In addition, miR-214 repressed the luciferase activity of the ING4 reporter construct by 13% (Figure 3B and 3C). [score:1]
Figure 2 MiR-15a and miR-214 have different roles in pancreatic cancer cells. [score:1]
Therefore, miR-214 and miR-15a were chosen for further study. [score:1]
MiR-214 levels decreased by 60% at 24 hrs and remained low for 72 hrs (Figure 2D), indicating that miR-214 was responding to the drug treatment. [score:1]
After 72 hrs of GEM treatment, we found that the viability of BxCP-3 cells transfected with miR-214 mimics was significantly higher (about 22%) than that of the NC and MOCK negative control groups (Figure 2E). [score:1]
A previous study showed that miR-214 can promote cell survival and cisplatin resistance in human ovarian cancer [21]. [score:1]
We then investigated whether overexpression of miR-214 could modulate the sensitivity of BxCP-3 cells to GEM -induced apoptosis. [score:1]
We found that miR-214 promoted survival of pancreatic cancer cells as well as GEM resistance, which might be related to the poor response to chemotherapy in pancreatic cancer patients. [score:1]
BxCP-3 cells were transfected with H [2]O (MOCK), mimics-NC (NC), and miR-214 mimics (miR-214). [score:1]
[1 to 20 of 50 sentences]
25
[+] score: 110
These miRs were found to act on different levels; miR-214-3p, which is upregulated, directly targets β-catenin [40], miR-24-3p, which is downregulated, targets two different “β-catenin destruction complex” genes, APC and GSK3β (TarBase v7.0) [41]. [score:12]
While the Venn diagram in Fig.   7d shows the cross-match of upregulated miRs shared by different EVs, only miR-214-3p was upregulated in all EVs. [score:7]
c-myc was found to be upregulated in naive EV -treated TECs, whereas it was downregulated in TECs stimulated with anti-IL-3R-EVs, antago-miR-24-3p-EVs and pre-miR-214-3p-EVs, which is consistent with what is known on the integrated miR-24-3p and miR-214-3p interaction-network. [score:7]
In order to gain further insight into the mechanisms behind the differences in antago-miR-24-3p-EV and pre-miR-214-3p-EV in vivo effects, miR cargo was analyzed and their fold change is reported in Supplementary Table  3 and 4. Figure  7a, b shows how up -upregulated and downregulated miRs are distributed. [score:7]
Two of these, miR-214-3p, which directly targets β-catenin [40], and miR-24-3p, which targets two members of the “β-catenin interacting complex” (APC and GSK3β) [41] were chosen for the study. [score:6]
miR-214-3p (red dot) was found as the most upregulated miR in anti-IL-3R-EVs (fold change: 93.63 ± 4.52). [score:4]
In particular, pathways correlating with downregulated miRs shared by anti-IL-3R-EVs, pre-miR-214-3p-EVs and antago-miR-24-3p-EVs, or by anti-IL-3R-EVs and pre-miR-214-3p-EVs, or anti-IL-3R-EVs and antago-miR-24-3p-EVs were analyzed. [score:4]
Since β-catenin content was reduced in the total lysates of anti-IL-3R-EV -treated TECs (Fig.   3d), it was decided to determine whether the enrichment of miR-214-3p in anti-IL-3R-EVs could exert a direct β-catenin expression effect. [score:4]
As shown in the Venn diagram (Fig. 7c), 4 miRs were downregulated in pre-miR214-3p-EVs, antago-miR-24-3p-EVs and in anti-IL-3R-EVs (Fig.   7c). [score:4]
miR-214-3p (red dot) was found to be significantly upregulated in antago-miR-24-3p EVs (foldchange: 3.80 ± 1.00). [score:4]
c Venn diagram of downregulated miRs, identified in anti-IL-3R-EVs, antago-miR-24-3p EVs and pre-miR-214-3p EVs, are reported. [score:4]
The diagram shows an overlap of common miRs across different EVs d Venn diagram of upregulated miRs identified in anti-IL-3R-EVs, antago-miR-24-3p EVs and pre-miR-214-3p EVs. [score:4]
The expression of miR-24-3p and miR-214-3p in EVs and anti-IL-3R-EVs was validated by real-time PCR (Fig.   3c). [score:3]
e, f Cell extracts from antago-miR-24-3p TECs (e) and from TECs, treated as above (f), were analyzed for pβ-catenin and β-catenin content, normalized to β-actin (n = 4) (* p < 0.05, for pβ-catenin and ** p < 0.01, for β-catenin, none vs antago-miR-24-3p in e, unpaired t-test, and ** p < 0.01, none and EVs vs anti-IL-3R-EVs and antago-miR-24-3p-EVs in f, one-way ANOVA) Fig. 5miR-24-3p and miR-214-3p integrated interaction-networks merge in c-myc a Network analysis between miR-24-3p/miR-214-3p and mRNA targets. [score:3]
As shown in Fig.   5b, anti-IL-3R-EVs, antago-miR-24-3p- and pre-miR-214-3p-EVs failed to induce c-myc expression, unlike EVs. [score:3]
Moreover, a further and deeper comparison among pre-miR-214-3p-EV, antago-miR-24-3p-EV and anti-IL-3R-EV miR content led us to hypothesize that their overlapping anti-angiogenic effects might also depend on the combined action of a pattern of shared miRs (miR-222-3p, miR-16-5p, miR-484 for all EV samples; miR-19b-3p miR-17-5p, miR-196b-5p, miR-365b-5p for pre-miR-214-3p-EVs and anti-IL-3R-EVs; miR-106a-5p, miR-197-3p, miR-193b-3p for antago-miR-24-3p-EVs and anti-IL-3R-EVs) which may be involved in the regulation of a network of genes related to cancer development/progression. [score:3]
c miR‐24-3p and miR-214-3p expression was validated by qRT–PCR on EVs and anti-IL-3R-EVs and data normalized to RNU6B (n = 4) (** p < 0.01, EVs vs anti-IL-3R-EVs for miR‐24-3p and miR-214-3p, unpaired t-test). [score:3]
Furthermore, the transfection of TECs with pre-miR-214-3p and the treatment of TECs with EVs that over-express miR-214-3p led to a reduction in β-catenin content. [score:3]
However, it was found that, unlike antago-miR-24-3p-EVs, pre-miR-214-3p-EVs were less effective in reducing vessel growth than anti-IL-3R-EVs, while the combo treatment completely recapitulated the anti-IL-3R-EV anti-angiogenic effect. [score:1]
miR-214-3p and miR-24-3p are both involved in anti-IL-3R-EV-antiagiogenic effects. [score:1]
Moreover, we found that miR-16-5p, commonly shared by pre-miR-214-3p-EVs, antago-miR-24-3p-EVs, and in anti-IL-3R-EVs significantly correlated with 4 out of the 5 pathways identified by DIANA miR path software. [score:1]
It is worth noting that antago-miR-24-3p-EVs were found to be enriched in miR-214-3p (Fig.   7a), while no changes in miR-24-3p content were detected in pre-miR-214-3p-EVs (Fig.   7b). [score:1]
Untransfected TECs were used as internal controls (none) (n = 5) (** p < 0.01, none vs pre-miR-214-3p, unpaired t-test). [score:1]
As expected, β-catenin content was reduced both in transfected cells and in TECs stimulated with pre-miR-214-3p-EVs. [score:1]
TECs were transfected with pre-miR-214-3p and EVs were recovered (pre-miR-214-3p-EVs). [score:1]
In order to collect EVs, depleted of miR-24-3p or enriched in miR-214-3p, loss-of-function and gain-of-function experiments were performed in TECs, as previously described [22, 64]. [score:1]
b Cell extracts from TECs, left untreated or treated with EVs, anti-IL-3R-EVs or EVs enriched in miR-214-3p, were analyzed for β-catenin content, normalized to β-actin (n = 5) (** p < 0.01, none and EVs vs anti-IL-3R-EVs and pre-miR-214-3p-EVs, one-way ANOVA). [score:1]
The effects of pre-miR-214-3p on β-catenin expression were initially evaluated in transfected cells (Fig.   4a) and then in TECs treated with pre-miR-214-3p-EVs (Fig.   4b). [score:1]
Of note, miR-16-5p, commonly shared by pre-miR-214-3p-EVs, antago-miR-24-3p-EVs, and anti-IL-3R-EVs significantly correlated with 4 of the above pathways. [score:1]
Finally, our results suggest that miR-24-3p may be involved in the reverse epigenetic silencing of miR-214-3p, which moves to EVs from cells. [score:1]
It was then decided to analyze the expression of phosphorylated and unphosphorylated β-catenin in total cell lysates in TECs treated with EVs and anti-IL-3R-EVs in order to investigate the possibility that miR-24-3p and miR-214-3p, carried by anti-IL-3R-EVs, may interfere with the β-catenin signaling pathway. [score:1]
As a matter of fact, antago-miR-24-3p-EVs, which were enriched in miR-214-3p, were also much more effective in their anti-angiogenic action than pre-miR-214-3p-EVs. [score:1]
As shown in Fig.   6a, b, both pre-miR-214-3p-EVs and antago-miR-24-3p-EVs strongly reduced TEC-derived vessels in vivo. [score:1]
The integrated miR-24-3p and miR-214-3p interaction-network identified c-myc as one of their downstream nodes (Fig.   5a). [score:1]
Although we cannot exclude the possibility that EV inducing effects may depend largely on the combination of all the miRs taken together, a comparison of the miR carried by antago-miR-24-3p-EVs, pre-miR-214-3p-EVs, anti-IL-3R-EVs and their functional activity would appear to point to the crucial role played by selective enrichment pathways. [score:1]
RNA, from cells and EVs, was then retro-transcribed using TaqMan microRNA RT kits, specific for miR-214-3p and miR-24-3p, and subjected to quantitative real-time PCR (qRT–PCR) [64]. [score:1]
DIANA miR path software was therefore interrogated to identify the most relevant pathways which, along with Wnt-β-catenin, may contribute to the overlapping of the anti-angiogenic effects detected in antago-miR-24-3p-, pre-miR214-3p-, and anti-IL-3R-EV -treated animals (Fig.   6b). [score:1]
Scale bars indicate 50 μm Fig. 7miR distribution in antago-miR-24-3p-EVs and pre-miR-214-3p-EVs. [score:1]
Such significant correlation was also found for miR-17-5p (in pre-miR-214-3p-EVs) and miR-193b-3p (in antago-miR-24-3p-EVs). [score:1]
miR-24-3p (red dot) was found to be almost unmodulated in pre-miR-214-3p-EVs (foldchange: 0.26 ± 0.14). [score:1]
a TECs that over-express miR-214-3p were subjected to SDS–PAGE to evaluate β-catenin content, normalized to β-actin. [score:1]
Data are reported in the histogram as number ± SD of vessels per sample (*** p < 0.001, none and EVs vs others experimental conditions; ** p < 0.01, anti-IL-3R-EVs vs pre-miR-214-3p-EVs and pre-miR-214-3p-EVs vs antago-miR-24-3p-EVs + pre-miR-214-3p-EVs, one-way ANOVA) (20× magnification). [score:1]
b TECs treated as indicated were lysed and analyzed for c-myc content, normalized to β-actin content (n = 5) (** p < 0.01, none and EVs vs anti-IL-3R-EVs, antago-miR-24-3p-EVs and pre-miR-214-3p-EVs, one-way ANOVA) Functional studies were performed in vivo to confirm the above data. [score:1]
[1 to 20 of 43 sentences]
26
[+] score: 107
From this analysis, three differentially expressed microRNAs were revealed, namely, miR-214 (permutation p value 3.7×10 [−3]), expressed specifically in human PBMCs exposed to either HMGB1 [+/+] or HMGB1 [−/−] lysates, and miR-34c (permutation p value 6×10 [−4]), expressed in PBMCs exposed to HMGB1 [+/+] lysates alone (Table 1). [score:9]
Together these data suggest that hsa-miR-214 expression is a general “DAMPmiR” expressed in human PBMCs exposed to damaged cells, while hsa-miR-34c is a miRNA that is sensitive to the presence of HMGB1 in damaged cells. [score:5]
These results support the observation that both hsa-miR-34c and hsa-miR-214 are upregulated when human PBMCs are exposed to damaged or necrotic cells, where hsa-miR34c appears to be responsive to the presence of HMGB1. [score:4]
Here, we report that when human PBMCs are exposed to damaged HMGB1 [+/+] cell lysates, or conditioned media from serum-starved and glucose-deprived cells, both hsa-miR-34c and hsa-miR-214 are upregulated. [score:4]
It will be interesting to test whether the expression of miR-214 in inflammatory tumors is functional in promoting tumor growth. [score:3]
High levels of miR-214 expression in human pancreatic tumors [20] have been observed, indicating that miR-214 may be a general marker of damage -associated inflammation, particularly in highly metastatic tumors etiologically associated with chronic inflammation, such as pancreatic cancer. [score:3]
Expression levels of miR-34c and miR-214 are changed when donor PBMCs are exposed to conditioned media from dying cells. [score:3]
Expression of Hsa-miR-34c and Hsa-miR-214 does not Increase in Human PBMCs Stimulated with Specific Pathogen-activated Molecular Pattern Molecules (PAMPs) or TLR Ligands. [score:3]
A: Changes in miR-34c, miR-214 and miR-155 expression in PMBCs (from one donor) exposed to conditioned media from HMGB1 [+/+] and HMGB1 [−/−] MEF cells. [score:3]
miR-34c and miR-214 are Differentially Expressed in Human PBMCs Following Exposure to Damaged/necrotic Cell Lysates. [score:3]
B: Changes in miR-34c, miR-214 and miR-155 expression in PBMCs from another donor exposed to conditioned media. [score:3]
Levels of miR-34c and miR-214 Expression (and Pro-inflammatory Cytokine Release) Increased After Exposure of Donor PBMCs to Conditioned Media from Serum-starved and Glucose-deprived Cells. [score:3]
High levels of miR-214 expression have been reported in a murine mo del of renal ischemia reperfusion injury [21]. [score:3]
hsa-miR-34c and hsa-miR-214 are expressed at negligible levels in human PBMCs stimulated with various PAMPS or TLR ligands. [score:3]
0038899.g005 Figure 5 A: Changes in miR-34c, miR-214 and miR-155 expression in PMBCs (from one donor) exposed to conditioned media from HMGB1 [+/+] and HMGB1 [−/−] MEF cells. [score:3]
Our findings clearly indicate that miR-34c and miR-214 are specifically expressed in human PBMCs following exposure to sterile cell lysates or conditioned media from stressed cells, but not when exposed to PAMPs as TLR ligands. [score:3]
Expression of miR-34c and miR-214 was negligible in all samples stimulated with the various TLR ligands. [score:3]
Exposure of PBMCs to conditioned media with heat shock at 42°C further increased levels of miR-214 expression. [score:3]
Interestingly, levels of miR-214 were differentially expressed in PBMCs exposed to HMGB1 [+/+] or HMGB1 [−/−] conditioned media, but was not significantly affected when exposed to the respective lysates. [score:3]
The fold expression changes for hsa-miR-214 varied from 2.8 to 5.7 in donor PBMCs exposed to HMGB1 [−/−] lysates, while in donor PBMCs exposed to HMGB1 [+/+] lysates, it varied from 2.9 to 7.3 fold. [score:3]
Expression of hsa-miR-34c and hsa-miR-214 is a hallmark of human PBMCs exposed to necrotic cell lysates. [score:3]
Fig. 3 shows the fold expression changes (as log2-transformed values) of miR-34a, miR-34c, miR-214, and miR-155 after stimulation of donor PBMCs with various concentrations of TLR ligands. [score:3]
Expression levels of miR-34c and miR-214 were assessed in conditioned media from stressed (hypoxia, serum starvation) cells. [score:3]
C: Fold changes in expression (as log-2-transformed RQ values) of hsa-miR-34c and hsa-miR-214 in donor PBMCs exposed to the indicated HCT116 necrotic lysates for 48 hrs. [score:3]
As observed previously with necrotic lysates, hsa-miR-214 expression increased in donor PBMCs exposed to both types of HCT116 lysate. [score:3]
Figure 1C shows the fold expression changes (as log 2-transformed values) for hsa-miR-34a, miR-34b, miR-34c, miR-214 and miR-155 under these conditions. [score:3]
To determine whether any PAMPs or TLR ligands are associated with miR-34c or miR-214 expression changes in donor PBMCs, we stimulated the cells with various PAMPS or known TLR ligands. [score:3]
One of the validated functional targets for miR214 is PTEN, a phosphatase and tensin homolog and a gene often deleted in many forms of cancer [19], [20]. [score:3]
Changes in miR-34c, miR-214 and miR-155 expression in PMBCs pre-incubated with 50 µM glybenclamide (Glyb) for 30 minutes before being exposed to conditioned media (MEF CM) for 48 hrs were used to assess the inflammasome pathway. [score:3]
Hsa-miR-214 expression clustered with other miRs (such as miR-10b and miR-125b) when donor PBMCs were exposed to both types of cell lysate (Figure 1A, middle panel). [score:3]
As shown in Fig. 5, both miR-34c and miR-214 were significantly expressed in cultures exposed to the conditioned media, compared to untreated cultures. [score:2]
From the microRNA profiling data, fold expression values (as log 2–transformed RQ values) for the statistically significant microRNAs (hsa-miR-34a, miR-34c, miR-214, and miR-155) were calculated for each donor after exposure to lysates or LPS (Figure 1B). [score:1]
This indicates that miR-214 may be a specific biomarker for internal tissue damage/injury. [score:1]
Using a Taqman microRNA profiling low-density PCR array we identified several microRNA genes, including miR-34c, miR-214, miR-210, miR-125b and miR-10b in human PBMCs, which are involved in the inflammatory response to damaged cells. [score:1]
Total mRNA was isolated from donor PBMCs and Taqman miR PCR was carried out for miR-34c, mir-214, miR-155 and the endogenous nucleolar control RNA, RNU48. [score:1]
Some of the other “DAMPmiRs” that clustered together with miR-214 include miR-125b and miR-10b, where the latter can be involved in metastasis [22], [23]. [score:1]
[1 to 20 of 36 sentences]
27
[+] score: 99
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-126
Although we demonstrated that the other established clinical parameters did not show strong correlation with the levels of circulating miR-214 and -126 in this study, it is still possible that the levels of these circulating miRNAs might increase or decrease in other non-neoplastic diseases: several studies examining human diseases reported that the level of circulating miR-214 is decreased in coronary artery disease [52], as well as that circulating miR-126 is increased in moyamoya disease [46], allergic rhinitis, and asthma [50] but decreased in atherosclerosis [47], atrial fibrillation, heart failure [51], and type-2 diabetes mellitus 48, 49. [score:9]
These results suggest that the levels of circulating miR-214 and -126 were independent of common concurrent diseases associated with neoplasia, such as anaemia, inflammation, and hepatic and renal disorders; thus, they might be able to accurately assess the state of the tumour without noise from concurrent disease. [score:5]
Prognostic potential of circulating miR-214 and -126 in canine neoplastic disease. [score:3]
Circulating miR-126, as well as miR-214, has been suggested to be a diagnostic biomarker for human neoplastic disease [24]. [score:3]
The purpose of this study was to assess the potential of circulating miRNA-214 and -126 for use as diagnostic and prognostic biomarkers in various canine neoplastic diseases, as well as for obtaining referential information for exploring novel biomarkers in human cancers. [score:3]
Levels of circulating miR-214 and -126 were increased in canine neoplastic disease. [score:3]
Diagnostic potential of circulating miR-214 and -126 in canine neoplastic disease. [score:3]
We assessed the potential of circulating miR-214 and -126 as prognostic biomarkers for canine neoplastic disease. [score:3]
MicroRNA-214 (miR-214) and microRNA-126 (miR-126) regulate angiogenesis, proliferation, migration, and cell death of cancer cells; and thus, dysregulation of these 2 miRNAs critically influences tumour progression 17, 18. [score:3]
However, our results provide and overall perspective of the circulating miR-214 and -126 profiles in canine neoplastic disease, and would help in an additional large-scale study of each tumour type to determine the true clinical usage of the miRNAs in veterinary clinical oncology. [score:3]
In conclusion, we have shown that circulating miR-214 and -126 have the potential to be diagnostic and prognostic biomarkers for canine neoplastic disease. [score:3]
It was reported that miR-214 regulates osteoblastic differentiation of mesenchymal stem cells [38], and the level of circulating miR-214 is increased in a genetically engineered mouse mo del of osteosarcoma and in human osteosarcoma patients [20]. [score:2]
This result is consistent with previous reports indicating that miR-214 contributes to tumorigenesis by regulating apoptosis 15, 36, proliferation [37], and migration [37], as well as having an impact on prognosis 19, 20 in diverse human cancers. [score:2]
We confirmed that miR-16, the internal control, was stably detected in these samples (Supplemental Fig.   4) and found that miR-214 levels in the tumour-bearing cases were significantly higher than those in the control cases (Fig.   2a,d). [score:1]
Next, we assessed the diagnostic potential of circulating miR-214 and -126. [score:1]
Circulating miR-214 and -126 levels did not show a strong correlation with the other clinical parameters. [score:1]
The levels of circulating miR-214 were increased in non-epithelial tumours, especially sarcomas. [score:1]
Furthermore, circulating miR-214 and -126 showed high diagnostic accuracies in sarcomas (specificities, 90.9–95.5%; sensitivities, 81.5–81.6%) and all types of canine tumours (specificity, 86.4%; sensitivity, 86.4%), respectively. [score:1]
Thus, we speculated that the high levels of circulating miR-214 in osteosarcoma cases might have obscured the survival difference in the case of other non-epithelial tumours. [score:1]
Figure 5Diagnostic accuracies of circulating miR-214 and -126. [score:1]
These results suggest the further application of circulating miR-214 and -126 to determination of the origin of primary tumours, although more detailed information on the profiles will be necessary for such clinical application. [score:1]
Circulating miR-214 and -126 discriminated tumour from control cases with high accuracies. [score:1]
miR-214 was significantly increased in both epithelial and non-epithelial tumours, and the non-epithelial tumours showed the highest median miR-214 levels (Fig.   2b,d). [score:1]
In addition, circulating miR-214 and -126 were prognostic predictors in 2 groups (adenocarcinoma and non-epithelial tumours except for osteosarcoma) and 3 groups (adenocarcinoma, other epithelial tumours, and melanoma), respectively. [score:1]
Given that exosomal miR-214 induces angiogenesis [39], abundant extracellular miR-214 may contribute to the local invasion and metastasis through accelerating tumour angiogenesis in canine adenocarcinomas. [score:1]
Circulating miR-214 levels (−∆CT, relative to circulating miR-16 levels) were mainly increased in non-epithelial tumours, especially the sarcomas. [score:1]
In veterinary medicine, although dogs develop a broad range of tumours, levels of circulating miR-214 and -126 have not been explored except for our previous report on canine hemangiosarcoma [25]. [score:1]
Our previous study in canine hemangiosarcoma suggested that circulating miR-214 and -126 are released from the tumour cells themselves: hemangiosarcoma cell lines released miR-214 and -126 into the surrounding environment, and surgical resection of the primary tumour decreased levels of these circulating miRNAs in the dogs with hemangiosarcoma [25]. [score:1]
Canine tumours have been advocated as an ideal mo del for human tumours in that they have biological and clinical behaviours, as well as a tumour microenvironment, similar to those for human tumours 4, 5. In the present study, the canine profiles of miR-214 and -126 were consistent with several previous reports on human cancers. [score:1]
Levels of circulating miR-214 and -126 did not show a strong correlation with other clinical parameters. [score:1]
For instance, circulating miR-214 was increased in canine mammary carcinomas and osteosarcomas; and these results agree with previous reports showing that miR-214 levels are increased in patients with breast cancer [21] and osteosarcoma [20]. [score:1]
Furthermore, there are also other reports indicating that circulating miR-214 is increased in human gastric cancers [22], ovarian cancers [23], and myeloma [19], and that circulating miR-126 also is increased in human non-small cell lung carcinoma [24]. [score:1]
The cases with high levels of circulating miR-214 showed significantly shorter survival time in the cases of adenocarcinoma and the non-epithelial tumours without osteosarcoma. [score:1]
The cases of epithelial tumours, such as mammary and thyroid carcinomas, also showed increased levels of circulating miR-214. [score:1]
As observed for circulating miR-214, circulating miR-126 levels were significantly high in tumour-bearing cases (Fig.   3a,d). [score:1]
Figure 2Circulating miR-214 profiles for canine tumours. [score:1]
To assess the profiles of circulating miR-214 and -126, we prospectively collected plasma samples from both tumour-bearing and healthy dogs. [score:1]
Figure 4 Heatmap and hierarchical cluster analysis of circulating miR-214 and -126 levels. [score:1]
ROC curve analysis showed that the AUC values of circulating miR-214 in discriminating tumour from control cases was high in the non-epithelial tumours (AUC = 0.83), especially in the sarcomas (hemangiosarcoma, osteosarcoma, chondrosarcoma, histiocytic sarcoma, and soft tissue sarcoma; AUC = 0.92) and aggressive sarcomas (hemangiosarcoma, osteosarcoma, and histiocytic sarcoma; AUC = 0.94), but relatively low in the epithelial tumours (AUC = 0.75) and the group including all types of tumours (AUC = 0.79, Fig.   5a,b). [score:1]
We next performed miRNA RT-qPCR to determine the profiles of circulating miR-214 and -126 in the tumour-bearing and control cases. [score:1]
P-value was calculated based on the null hypothesis that the slope of the regression curve is 0. Here, we revealed the profiles of circulating miR-214 and -126 in dogs with tumours of 17 histopathological subtypes and demonstrated that both miRNAs showed the potential of being biomarkers for canine neoplastic diseases. [score:1]
Accordingly, the high levels of circulating miR-214 in dogs with osteosarcoma may suggest a firm association between miR-214 and tumorigenesis in canine osteosarcomas. [score:1]
Taken together, these results showed that the cases with high miR-214 levels had a shorter survival duration in the group of non-epithelial tumours excluding osteosarcomas and in the adenocarcinomas of the epithelial group; furthermore, the adenocarcinoma and melanoma cases with high miR-126 levels had a shorter survival time than those with low levels. [score:1]
Circulating miR-214 showed high specificities (90.9–95.5%) and sensitivities (81.5–81.6%) in the sarcomas and aggressive sarcomas, but it showed relatively low specificities (63.6–90.9%) and sensitivities (56.8–80.8%) in the epithelial tumours and the group including all types of tumours (Fig.   5c). [score:1]
Adenocarcinoma cases with high miR-214 and -126 levels survived for a significantly shorter time (Fig.   6e). [score:1]
Circulating miR-214 and -126 showed different profiles between the epithelial and non-epithelial tumours in this study: the level of circulating miR-214 increased mainly in the sarcomas; in contrast, circulating miR-126 increased in most types of the tumours examined. [score:1]
Levels of circulating miR-214 and -126, showing different profiles between epithelial and non-epithelial groups. [score:1]
Difference in circulating miR-214 and -126 profiles between epithelial and non-epithelial tumours. [score:1]
We thus addressed this issue in our present study by evaluating the levels of circulating miR-214 and -126 in a wide variety of canine neoplastic diseases. [score:1]
In this study, we showed that levels of circulating miR-214 increased, and showed high diagnostic accuracies, in the dogs with non-epithelial tumours, especially sarcomas such as hemangiosarcoma, osteosarcoma, chondrosarcoma, and histiocytic sarcoma. [score:1]
Furthermore, circulating miR-214 or -126 levels are increased in 6 human tumours (multiple myeloma [19], osteosarcoma [20], breast [21], gastric [22], ovarian [23], and non-small cell lung carcinoma [24]) and a canine sarcoma (canine hemangiosarcoma [25]). [score:1]
Figure 7Correlation analysis between the circulating miR-214, -126 levels, and various clinical parameters. [score:1]
Taken together, the results suggest that circulating miR-214 and -126, which include both EV-carried and non-EV-carried forms, would be biomarkers suitable for evaluation of the tumour state with minimal effects from any concurrent disease. [score:1]
These results suggest that circulating miR-214 would be a potentially useful diagnostic biomarker for canine sarcomas, whilst it would not be suitable for use as a screening test or diagnostics for the other types of tumour. [score:1]
We next classified the cases into 4 clusters (A, B, C, and D) based on hierarchical cluster analysis using both circulating miR-214 and -126 levels. [score:1]
showed that the adenocarcinoma cases and cases of non-epithelial tumours (excluding osteosarcoma) with a high level of circulating miR-214 had a short survival time, suggesting that circulating miR-214 would have prognostic value for these canine tumours. [score:1]
However, other epithelial cancers showed relatively low levels of circulating miR-214. [score:1]
In the subcategories, 4 types of non-epithelial tumours (osteosarcoma, histiocytic sarcoma, chondrosarcoma, and hemangiosarcoma) and 2 kinds of epithelial tumours (thyroid carcinoma and mammary carcinoma) showed a high or moderate increase in miR-214 levels with statistical significance (Fig.   2c,e). [score:1]
As to melanoma cases, adenocarcinoma cases with high miR-126 levels had a significantly shorter survival duration, whilst those cases with high miR-214 levels did not (Fig.   6e). [score:1]
As a result, the non-epithelial tumour cases with a high level of circulating miR-214 showed a significantly shorter survival duration when the osteosarcoma cases were excluded (Fig.   6d). [score:1]
Blue lines and red dotted lines indicate the results of circulating miR-214 and miR-126, respectively. [score:1]
Adenocarcinoma cases with high levels of circulating miR-214 had a significantly shorter survival time, although only a few cases of them classified into the group with a high or moderate increase of circulating miR-214 in the cluster analysis. [score:1]
Circulating miR-214 has been suggested to be a diagnostic 21, 22 and prognostic 19, 20 biomarker for various human cancers. [score:1]
The representative values used were the medians of miR-214 levels. [score:1]
Considering the broad influence of miRNAs on cancer pathogenesis beyond histologic types and species, we hypothesized that circulating miR-214 and -126 could be potential low-invasive biomarkers common for diverse human and canine tumours. [score:1]
This result suggests that miR-214 estimates the prognosis but is not suitable for the diagnosis of canine adenocarcinoma. [score:1]
Finally, although miR-214 and -126 levels normalised by miR-16 showed a significant utility in canine cancer diagnosis and prognosis, there might be better internal controls other than miR-16 for these circulating miRNAs. [score:1]
[1 to 20 of 67 sentences]
28
[+] score: 90
Other miRNAs from this paper: hsa-mir-21, hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-210, hsa-mir-143
Inhibition of miR-199a or miR-214 using hairpin inhibitors led to the inhibition of TGFβ -induced hPSC activation, differentiation, and proliferation. [score:7]
Furthermore, inhibition of miR-199a or miR-214 using hairpin inhibitors dedifferentiated patient-derived CAFs, which was confirmed at gene expression levels. [score:7]
In conclusion, this study unravels miR-199a-3p and miR-214-3p as novel therapeutic targets in pancreatic CAFs and hPSCs, as their inhibition led to dedifferentiation of pancreatic CAFs and inhibition of differentiation of hPSCs to myofibroblasts. [score:7]
After 18 h, cells were transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors for 24 h. Then, cells were activated with TGF-β1 (5 ng/ml) and after 48 h cells were lysed with RIPA buffer (Thermo-Scientific) containing protease inhibitor cocktail. [score:5]
We found that both miR-199a and miR-214 were highly expressed (case I) and low expressed (case II) in the stroma of the human pancreatic tumors, which can be visualized as blue stained cells (see arrow heads). [score:5]
To investigate whether inhibition of miR-199a or miR-214 dedifferentiates patient-derived CAFs and also hinders the differentiation of hPSCs into myofibroblasts, we transfected CAFs and hPSCs with their hairpin inhibitors and studied their effect at gene expression levels. [score:5]
These data signify that inhibition of miR-199a and miR-214 in hPSCs leads to inhibition of PSC -induced pro-tumorigenic effects in vitro, representing them interesting miRNAs to develop for potential gene therapy. [score:5]
The key direct targets for miR-199a are mTOR, p53, Smad1, and miR-214 are PTEN, ING4, and Bax. [score:4]
Nevertheless, silencing of miR-199a or miR-214 in hPSCs/CAFs may represent a novel therapeutic option for the development of novel therapies for this devastating disease. [score:4]
Interestingly, network generated by IPA revealed the interactions of miR-199a with some of the potential target genes such as mTOR, TP53, and SMAD1 and for miR-214 such as PTEN, BAX and ING4 (Table 1). [score:3]
After 18 h, cells were transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors for 24 h. After that, cells were activated with TGF-β1 (5 ng/ml) for 48 h and cells were fixed and immunostained for αSMA, and Collagen1 as described elsewhere [56]. [score:3]
Interestingly, TGF-β−induced activation and differentiation as well as migration and cell growth of hPSCs was inhibited by anti-miR-199a or anti-miR-214, confirming the significance of these miRs in controlling PSCs’ phenotypic behavior. [score:3]
Treatment of hPSCs with anti-miR-199a or anti-miR-214 abrogated hPSC -induced Panc-1 tumor cell growth, spheroid formation and inhibited endothelial cells activation. [score:3]
We found that anti-miR-199a reduced the cell growth significantly whereas anti-miR-214 showed only moderate inhibitory effects (Figure 4C). [score:3]
The expression levels of miR-199a and miR-214 were also confirmed in CAFs, which were isolated from three different patients (Figure 1B). [score:3]
Figure 7 Ingenuity IPA pathway analysis predicted target genes for miR-199a and miR-214. [score:3]
hPSCs were seeded in a 24-well plate (4 × 10 [4] cells/well) for 18 h and transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors and allowed them to become confluent. [score:3]
These data demonstrate that both miR-199a and miR-214 are involved in regulation of hPSC migration while miR-199a is also involved in the proliferation of hPSCs. [score:2]
We selected miR-199a-3p and miR-214-3p as main miRNAs to investigate their therapeutic potential in PSCs, as they were shown to be upregulated in activated rat PSCs, lung fibrosis and cardiac remo deling [27, 33, 41]. [score:2]
To confirm that miR-199a and miR-214 are expressed in the stromal region of human pancreatic cancer, we first performed an in-situ hybridization (ISH) assay to detect the presence of miR-199a and miR-214 (Figure 1A). [score:2]
At last we compared the miRNA expression levels in non-activated and TGF-β activated hPSCs and found that both miR-199a and miR-214 were significantly induced in the activated hPSCs compared to that of non-activated hPSCs (Figure 1F). [score:1]
These results demonstrate that both miR-199a and miR-214 are involved in the differentiation of hPSCs into myofibroblasts. [score:1]
In the present study, we explored two miRNAs miR-199a-3p and miR-214-3p for their potential therapeutic role in the activation of pancreatic stellate cells (PSCs) and PSC -induced pro-tumorigenic effects in pancreatic cancer. [score:1]
We selected miR-199a-3p and miR-214-3p as the main target for the investigation based on our miR array on stromal part isolated from colorectal tumors using laser capture dissection microscopy (Supplementary Figure 1) and the reported miRNA array in activated rat PSCs [33]. [score:1]
Figure 6(A) Representative microscopic images (40× magnification) of human endothelial cell tube formation by HUVECs after incubation with conditioned media collected from control hPSCs or TGFβ-activated hPSCs with or without transfected with anti-miR-199a, anti-miR-214 or anti-miR negative control (NC). [score:1]
After 18 h, cells were incubated in serum-free media and transfected with anti-miR-199a and anti-miR-214 (50 nM). [score:1]
MicroRNA in situ hybridization (ISH) was performed using locked nucleic acid (LNA) probes for miR-199a-3p and miR-214-3p together with a MicroRNA ISH kit for FFPE tissues (Exiqon). [score:1]
Interestingly, induction of both miR-199a and miR-214 was also established in these cells, indicating a relationship of these miRNAs with PSC differentiation. [score:1]
We explored the predicted genes that might be responsible for the multiple functions of miR-199a and miR-214. [score:1]
Then, we investigated the effect of inhibition of either miR-199a or miR-214 on the differentiation, cell growth and migration of hPSCs and also on the hPSC -induced paracrine effects on human pancreatic tumor cells and endothelial cells in vitro. [score:1]
After 18 h, cells were transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors for 24 h. Thereafter, cells were activated with TGF-β1 (5 ng/ml) for 24 h, then total RNA was isolated using the GenElute [™] Mammalian Total RNA Miniprep Kit and the RNA amount was measured by a NanoDrop [®] ND-1000 Spectrophotometer (Wilmington, DE). [score:1]
[1 to 20 of 31 sentences]
29
[+] score: 84
Other miRNAs from this paper: hsa-mir-218-1, hsa-mir-218-2
Further, downregulaton of miRNA-214 induces the expression of enhancer of β-catenin (directly or indirectly through EZH2) and zeste homolog 2 (EZH2) (directly) [36]. [score:9]
Downregulaton of miRNA-214 induces hepatoma-derived growth factor expression and secreton, thereby stmulatng vascular endothelial cells for angiogenesis [35]. [score:6]
Evidence has been increasing that many target genes of miR-214 which regulate several biological processes, such as tumorigenesis, differentiation and angiogenesis [8, 26, 27]. [score:4]
Substantial data illustrates the dysregulation of miR-214 in different types of cancer [29], it indicates that different patterns of miR-214 expression may play a role in the carcinogenesis [30]. [score:4]
Despite innovative discoveries and intensive technological analysis in the development of the early stage biomarkers and translational research, miR-214 has not been validated in the clinical setting. [score:4]
These findings have raised a question about whether miR-214 paly dual function role as both a tumor promoter and suppressor, it is partly dependent on the specific signaling pathways in each of the different types of cancer [37]. [score:3]
Several studies have identfed reduced miRNA-214 expression in HCC [33], and unusual hypervascularity is a hallmark of HCC [34]. [score:3]
Data for analyses, including first author, publication year, origin country, histological classification, TNM stage, sample type and size, detection method, follow-up and cutoff value, HRs of miR-214 for overall survival (OS) and/or progressive free survival (PFS), disease free survival (DFS), recurrence free survival (RFS) and the corresponding 95% CIs. [score:3]
Therefore, miR-214 has reciprocal actions in various tumor tissues that provide insight into its complex function in multiple cancer tissues with regard to both tumor suppression and tumorigenesis. [score:3]
We performed subgroup analysis according to ethnicity, a significant relationship between miR-214 expression and DFS/PFS/RFS was observed in Caucasian patients (HR=2.74, 95%CI: 1.20-6.25, P=0.02). [score:3]
However, in our subgroup analysis, we found that high miR-214 expression significantly predicted favorable DFS/PFS/RFS (HR=2.57, 95%CI: 1.37-4.81, P=0.00) in HCC group, it may be a potential prognostic biomarker in HCC. [score:3]
Further, subgroup analysis stratified by cancer type suggested a significant positive relationship between miR-214 expression and OS was revealed in other cancers (excluding digestive tract cancer, DTC) (HR=2.90, 95%CI: 2.02-4.15, P=0.00). [score:3]
In addition, subgroup analysis was further carried out according to cancer type, the result showed that a higher expression level of miR-214 significantly predicted favorable DFS/PFS/RFS in hepatocellular carcinoma (HCC) (HR=0.50, 95%CI: 0.31-0.82, P=0.00) (Table 3). [score:3]
Therefore we strongly suggest conducting more prognostic studies for abnormal expression of miR-214 in HCC. [score:3]
The inclusion criteria for the studies were as follows: (i) the full-text article was available in English or Chinese; (ii) the subjects were patients with any type of cancer; (iii) miR-214 expression was measured in tumor tissue or serum and (iv) reporting the survival outcome or the correlation between miR-214 expression and the clinical variables. [score:3]
For the DFS/PFS/RFS, we failed to find associations between miR-214 expression and predicted survival (HR=1.73, 95%CI: 0.78-3.83, P=0.18) (Table 3, Figure 3). [score:3]
The results demonstrated that expression of miR-214 was significantly correlated with OS in cancers (HR=2.21, 95%CI: 1.33-3.68, P=0.00). [score:3]
Accumulation of evidence have demonstrated that abnormal regulation of miR-214 can be causative for a variety of human tumors, including hepatoblastoma, hepatocellular, gastric, esophageal squamous cell carcinoma (ESCC) lung, breast, osteosarcoma, pancreatic cervical, prostate, ovarian, bladder and melanoma cancer [8]. [score:2]
Identification of dysregulated miRNAs in different stages of cancers or in various tumors types could provide novel insight into the potency of miR-214 as a diagnostic and prognostic biomarker in different cancers [31]. [score:2]
Forest plots of the relationship between elevated miR-214 level and OS. [score:1]
In this study, we mainly focus on the potential clinical significance of miR-214 as prognostic biomarkers for different types of cancer. [score:1]
MiRNA214 (miR-214) lies within the DNM3, which is described in the human q24.3 arm, it is approximately 6 kb apart [11, 12]. [score:1]
Fourthly, most included studies use median or mean value as the cut-off value, but the actual value was different, the lack of a golden standard, a clear definition should be made about the cutoff value of miR-214 level for survival risk. [score:1]
The role of miR-214 in HCC prognosis remains unclear, although the included studies suggested that miR-214 could be a suitable prognostic biomarker for HCC. [score:1]
Irrespective of the mechanism or clinical verification of miR-214, the results suggest that miR-214 can be used as a predictive biomarker of cancer prognosis in Caucasians. [score:1]
Notably, the cutoff values of miR-214 were different in the studies, most with median or mean. [score:1]
In this sense, miR-214 is a promising biomarker for early detection and cancer prognosis in Caucasians. [score:1]
In response to the need for independently prognostic molecular markers for cancers, we conducted this pooled analysis of published literature to identify the miR-214 for which the data support validation as prognostic biomarkers of various cancer outcomes. [score:1]
For studies evaluating DFS/PFS/RFS, no correlation of miR-214 expression with DFS/PFS/RFS in cancers (HR=1.73, 95%CI: 0.78-3.83, P=0.18). [score:1]
However, we make this conclusion cautiously, and some details must be addressed for practical value of mir-214 prognosis. [score:1]
Literature searches of PubMed, Embase, Web of Science databases, Chinese National Knowledge Infrastructure (CNKI) and Wanfang database were carried out from January 1st, 1989 through Sep 26th, 2016 with the following terms: ‘microRNA-214’ or ‘miR-214’ and ‘neoplasms’ or ‘cancer’. [score:1]
Forest plots of the relationship between elevated miR-214 level DFS/PFS/RFS. [score:1]
In conclusion, our data demonstrated that high miR-214 could be a promising biomarker for prognosis prediction of cancer. [score:1]
To our knowledge, this report is the first to critically examine available literature and identify the prognostic role of miR-214 in different types of cancer. [score:1]
After the primary literature search in database, a total of 1,062 records for miR-214 were retrieved and a flow diagram is shown in Figure 1. After duplicated studies were excluded, 207 studies were remained. [score:1]
Our stratified analysis suggested a closer relationship between rising miR-214 levels and poor survival in Asians (HR=2.27, 95%CI: 1.09-4.73, P=0.00) and Caucasians (HR=2.04, 95%CI: 1.47-3.30, P=0.00). [score:1]
[1 to 20 of 36 sentences]
30
[+] score: 73
Because the absolute quantity of miR-200c was relatively lower than that of miR-214 in early passages of hUCB-MSCs and expression of miR-200c would be in an inhibited state in early passage cells compared to senescent cells, additional miR-200c inhibition may have no effect on BMI1 expression. [score:8]
According to the results shown in Figure 4, DNMT inhibition induced the expression of miR-200c and miR-214, which target PcGs. [score:7]
Inhibition or overexpression of miRNAs was achieved by commercial antisense miRNAs or mature miRNAs of hsa-miR-200c and hsa-miR-214 with an appropriate miRNA precursor -negative control (mature miRNA: Invitrogen, USA, anti-miRNA inhibitor: Ambion, USA, and miRNA precursor -negative control #1, Ambion, USA). [score:7]
MiR-200c and miR-214 were previously reported to target BMI1 and EZH2, respectively, in studies that showed that miR-214 targets Ezh2 in skeletal muscle and embryonic stem cells and that miR-200c targets BMI1 in breast cancer stem cells [33], [46]. [score:7]
To confirm whether the targets of miR-200c and miR-214 are BMI1 and EZH2, respectively, in hUCB-MSCs, we performed miRNA inhibition and overexpression experiments using transient transfection of anti- and mature-miRNA oligonucleotides. [score:7]
In addition, inhibition of miR-214 using antisense oligonucleotide transfection increased EZH2 expression (Fig. 6e). [score:5]
After overexpression of miR-200c and miR-214, MSCs underwent cellular senescence, as shown by SA β-gal staining, and BMI1 and EZH2, the respective targets of miR-200c and miR-214 were decreased, as shown by real-time qPCR (Fig. 6d and 6e). [score:5]
It is well known that miR-214 targets EZH2 and that miR-200c targets BMI1 [33], [46]. [score:5]
We confirmed that miR-200c and miR-214 were up-regulated in senescent hUCB-MSCs. [score:4]
Although EZH2 is a target of miR-214, EZH2 itself could be involved with the regulation of histone H3K27 methylation at miRNA genomic regions in a negative feedback manner. [score:4]
Next, to confirm whether miR-200c and miR-214 regulate BMI1 and EZH2 expression levels in hUCB-MSCs, we performed transient transfection of antisense or mature miRNA oligonucleotides. [score:4]
By real-time qPCR analysis, we confirmed that miR-200c and miR-214 were up-regulated in senescent hUCB-MSCs (Fig. 6a). [score:4]
The results showed that anti- and mature-miR-214 regulated EZH2 expression at the mRNA level. [score:4]
A significant increase in RNA polymerase II bound on the indicated locations shows that the transcriptional activities might be increased at both miR-200c and miR-214 genomic regions. [score:1]
This study shows that miR-200c and miR-214 are related not only to cancer cells but also to the cellular senescence of MSCs, linking DNA methylation and PcG-related histone modification. [score:1]
[1 to 20 of 15 sentences]
31
[+] score: 64
Rno-miR-19a, rno-miR-19b-2 and rno-miR-214 were downregulated at all four time-points, while rno-miR-137 was downregulated at T1 followed by upregulation from T2 to T4 (Fig.   6). [score:10]
Furthermore, we observed downregulated expression of miR-19a and miR-214, which are predicted to target ARC. [score:8]
The results of the present study indicate that propofol may have the ability to regulate the expression of rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214 and their target genes, ARC and EGR2. [score:6]
The expression of four miRNAs (rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214) and their target genes (EGR2 and ARC) were shown to be regulated by propofol in primary cultured embryonic NSCs. [score:6]
Rno-miR-19a (Rno, Rattus Norvegicus) and rno-miR-137, and their target gene EGR2, as well as rno-miR-19b-2 and rno-miR-214 and their target gene ARC were found to be closely related to neural developmental processes, including proliferation, differentiation, and maturation of NSCs. [score:6]
Recently, Huat et al. [49] found that the miR-214 was downregulated during the development of neural progenitor-like cell derived from rat bone marrow mesenchymal stem cell induced by IGF-1, bFGF and EGF. [score:5]
It can be speculated that the increased expression of ARC in NSCs following exposure to propofol will have a beneficial effect, which is in conflict with the neurotoxic effects of propofol in vivo reported by Krzisch et al. [10] Furthermore, when combined the patterns of miR-19a and miR-214 expression, the situation is much more complex and the results are somewhat contradictory. [score:5]
Relative expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214 at all four time-points (immediately (T1), Day 1 (T2), Day 3 (T3) and Day 7 (T4) after treatment with propofol or DMSO). [score:3]
MiR-214 is located in the miR-199a–214 cluster and targets PTEN to produce a protective effect in cardiac myocytes against H [2]O [2] -induced injury [47]. [score:3]
In this way, we confirmed two genes (EGR2 and ARC) and four miRNAs (rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214) that exhibited at least a 2-fold change in the mean expression level following propofol treatment at all four time-points. [score:3]
Fig. 6Quantitative RT-PCR analysis of relative expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214. [score:3]
The fold-change in the mean expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214 ranged from -2.56 to -12.15, -2.02 to 4.61, -2.33 to -6.68 and -2.16 to -4.63, respectively (Table  5). [score:3]
Lee et al. reported that miR-214 may act as a novel intermediator in controlling the NSC development [48]. [score:2]
The miRNAs predicted by all four databases (rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214, (Rno, Rattus Norvegicus)) were selected for validation (Table  4 and Fig.   5). [score:1]
[1 to 20 of 14 sentences]
32
[+] score: 64
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-126, hsa-mir-1228, hsa-mir-1246
miR-214 and miR-126 are not only miRNAs playing important roles in angiogenesis and tumorigenesis intracellularly but also are released into the surrounding biofluid such as blood and serve certain functions [6, 7]; therefore, these two miRNAs are candidates to be up-regulated in the plasma of malignant endothelial proliferative disease such as HSA and AS. [score:6]
Moreover, unlike the extracellular angiogenic function of miR-214, the intracellular miR-214 works as a negative regulator of angiogenesis [8], and miR-214 was reportedly an anti-oncomir inducing apoptosis by targeting COP1-p53 axis in HSA [17]. [score:4]
We previously reported that miR-214 was down-regulated in the clinical samples and cell lines of HSA [17]; however, in this study, we found that miR-214 was over-secreted in the plasma samples. [score:4]
In addition, extracellular miR-214 and miR-126 work for promoting angiogenesis and suppressing senescence in ECs [7] or promoting metastasis by modulating adhesive activities in ECs [6]. [score:3]
To clarify whether the levels of miR-214 and miR-126 were increased in the plasma of canines with HSA, we examined the levels of miR-214, miR-126, and miR-16 in the plasma of canines with HSA (HSA group, n = 10), benign splenomegaly (benign group, n = 9), and in that of control canines with no specific disease (control group, n = 10) by performing miRNA qRT-PCR. [score:3]
miR-214 and miR-126 plays important roles in regulating angiogenic pathways both intracellularly and extracellularly. [score:2]
In this study, we examined whether the miRNAs regulating angiogenesis such as miR-214 and miR-126 have potential to be biomarkers for AS and HSA. [score:2]
AS and HSA represent the uncontrolled proliferation of neoplastic endothelial cells (ECs), and both miR-214 and miR-126 play important roles in regulating angiogenesis both intracellularly [8, 9] and extracellularly [6, 7]; therefore, we hypothesized that the levels of these angiogenic miRNAs are altered in the bloodstream of AS and HSA. [score:2]
AS and HSA Cell Lines Over-Secreted miR-214 and miR-126 via MVs. [score:1]
The AUC value was 0.9684, suggesting that the combination of miR-214 and miR-126 showed better accuracy than the single use of each miRNA. [score:1]
Plasma miR-214 and miR-126 Levels Were Significantly Increased in the Plasma of Canines with HSA. [score:1]
Consistent with our hypothesis, the levels of miR-214 and miR-126 were significantly higher in the plasma of the canines with HSA than in that of the benign or control groups (Figure 3A,B). [score:1]
Surgical resection of primary tumor significantly decreased the levels of both miR-214 and miR-126 in two out of three cases shown. [score:1]
, PT, APTT, miR-214, and miR-126 between HSA and benign groups. [score:1]
Furthermore, plasma samples obtained from the canines with HSA showed high levels of miR-214 and miR-126, suggesting that these miRNAs have potential to be biomarkers for HSA and might be applicable for diagnosing AS. [score:1]
Consistent with our hypothesis, we found that both HSA and AS cell lines over-secreted miR-214 and miR-126; and their plasma levels were also higher in the canines with HSA than in those of the benign and control groups, although this finding may have reflected the amount of both MV- and soluble miRNA. [score:1]
Here, we demonstrated that AS and HSA cell lines over-secreted miR-214 and miR-126 via MVs. [score:1]
There was no significant difference between HSA and benign group in the clinical conditions but in the levels of miR-214 and miR-126 (Mann-Whitney U-test); (C) The result of Pearson product-moment correlation coefficient. [score:1]
Therefore, we concentrated to assess the levels of miR-214 and miR-126 in HSA, which is a spontaneous mo del for AS. [score:1]
Taken together, these results suggest that both miR-214 and miR-126 have potential to be biomarkers for discriminating HSA from benign or healthy cases. [score:1]
Next, we assessed whether the state of dogs presenting various clinical conditions affects the levels of miR-214 and/or miR-126. [score:1]
In this study, the levels of miR-214 and miR-126 didn’t correlate with their clinical conditions such as anemia and coagulopathy; moreover, the resection of primary tumors decreased the levels of miR-214 and miR-126 in the plasma, suggesting that these levels precisely reflected the biological change (resection) of the primary tumor site but not their clinical conditions such as anemia and coagulopathy. [score:1]
These results suggest that both AS and HSA cells over-secreted miR-214 and miR-126 into their surrounding environment via MVs. [score:1]
We examined the levels of miR-214 and miR-126 in paired (pre- and post-operation) plasma samples from three cases (HSA3, HSA6, and HSA8). [score:1]
These results suggest that both miR-214 and miR-126 have potential to be biomarkers for the diagnosis of HSA and possibly be applicable for diagnosing AS. [score:1]
In conclusion, we demonstrated that AS and HSA cell lines over-secreted miR-214 and miR-126 via MVs. [score:1]
Because the plasma miR-214 and miR-126 levels were increased in canines with HSA, we assessed whether the surgical resection of primary splenic HSA would affect these levels. [score:1]
The results showed that the surgical resection of the primary tumor significantly decreased the levels of both miR-214 and miR-126 in two out of three cases (Figure 5), supporting our hypothesis that HSA cells secreted the miR-214 and miR-126 into the bloodstream. [score:1]
As a result, we found that there was no significant difference between HSA and benign group in the clinical conditions but in the levels of miR-214 and miR-126 (Figure 4A,B); furthermore, the result of Pearson product-moment correlation coefficient showed that there was not any correlation between the levels of miRNAs and these clinical conditions (Table 1), suggesting that the levels of these miRNAs does not correlate with the state of anemia and coagulopathy. [score:1]
Figure 5Surgical resection of the primary tumor decreased the levels of plasma miR-214 and miR-126. [score:1]
The HSA group showed significantly increased levels of miR-214 and miR-126 (Steel-Dwass test; ** p < 0.01 for each comparison); (C) ROC curve analysis for the single use of miR-214 and miR-126. [score:1]
Next, by performing miRNA qRT-PCR, we assessed whether the levels of miR-214 and miR-126 in MVs were elevated in AS and HSA cell lines. [score:1]
The AUC values of miR-214 and miR-126 were 0.9 and 0.9421, indicating the sensitivities and specificities were significantly high; (D) miR-214 and miR-126 showed similar profile patterns in the HSA group, which showed increased levels of both miR-214 and miR-126; (E) ROC curve analysis for the combination of miR-214 and miR-126. [score:1]
In this study, we found that plasma miR-214 and miR-126 were able to discriminate the HSA from non-neoplastic lesions and healthy control groups with high accuracy, which AUC value were all over 0.9. [score:1]
We next addressed the levels of miR-214 and miR-126 in clinical plasma samples. [score:1]
In this study, we demonstrated that AS and HSA cell lines over-secreted miR-214 and miR-126 via MVs. [score:1]
Moreover, the levels of miR-214 and miR-126 were markedly high in the plasma of canines with splenic HSA. [score:1]
We identified miR-214 and miR-126 as over-secreted miRNAs in the plasma of canines with HSA, which is a spontaneous mo del of AS. [score:1]
Furthermore, since the miR-214 and miR-126 levels showed similar profile patterns (Figure 3D), the combination of miR-214 and miR126 was more effective than the single use of each miR-214 or miR-126: the AUC value was 0.9684 (Figure 3E). [score:1]
Figure 1AS and HSA cell lines over-secreted miR-214 and miR-126 via MVs. [score:1]
Sharma T. Hamilton R. Mandal C. C. miR-214: A potential biomarker and therapeutic for different cancers Future Oncol. [score:1]
Taken together, we demonstrated that AS and HSA cell lines over-secreted miR-214 and miR-126 via MVs. [score:1]
The result of clinical samples of HSA suggests that miR-214 and miR-126 are potential biomarkers for HSA; furthermore, given their extracellular functions, the over-secretion of miR-214 and miR-126 may function to accelerate the uncontrolled proliferation of neoplastic and tumor -associated ECs in a paracrine manner. [score:1]
Plasma miR-214 and miR-126 Levels Were Decreased after the Surgical Resection of Primary Splenic HSA. [score:1]
The levels of miR-214 and miR-126 in both AS and HSA should have been examined; however, because AS is extremely rare human sarcoma, we couldn’t collect sufficient number of AS samples. [score:1]
Several human cancers reportedly secrete miR-214 or miR-126 into the bloodstream via MVs and/or as a soluble miRNA [15, 16]. [score:1]
[1 to 20 of 46 sentences]
33
[+] score: 63
In fact, it has been demonstrated that CREB1 is able to regulate TFAP2A expression in melanoma [47], so we could hypothesize a double control of miR-214 on TFAP2C, direct, via targeting, and, indirect, via CREB1, thus leading to a strong promotion of melanoma progression. [score:8]
Among CREB1-controlled STPs we found SREBP2 (TF target) and miR-33a (Intragenic microRNA) that are known to be co-regulated [44] and we previously demonstrated to be downregulated by miR-214 [45]. [score:7]
We demonstrated the ability of miR-214 to promote melanoma progression by downregulation of miR-148b at least partially via TFAP2C regulation, thus leading to miR-148b targets derepression, such as ALCAM [34]. [score:7]
Very recently, Zhou and colleagues demonstrated miR-33a tumor suppressive role in melanoma, thus suggesting a potential additional effect of miR-214 in promoting melanoma malignancy via the downregulation of another miRNA, miR-33a [46]. [score:6]
an excel file containing the full list of 292 Double Indirect miRNA STPPs identified by TransFINDER using DNM3 as the Source Gene, the cognate human intragenic miR-214 as source intragenic miRNA (SmiRNA) and a previously described signature of 73 genes whose expression was driven by miR-214 [33] as destination genes (DG). [score:4]
The connection between miR-214 and TFAP2C was clearly demonstrated in our previous work [33], where we showed the direct targeting of miR-214 on TFAP2C 3 ′-UTR; while no data linking miR-214 and CREB1 were found. [score:4]
In previous studies we and others identified that miR-146a and miR-214 are involved in melanoma growth and metastasis formation by modulating several target genes. [score:3]
In particular, we identified a signature of 73 genes whose expression was driven by miR-214 [33]. [score:3]
Taken together, our analyses on the STPs generated by CyTRANSFINDER unravelled many relevant potential pathways regulated by miR-146a and miR-214 in human physiology and pathology; some of these are validated in literature, while others were validated by us. [score:2]
In melanoma, we demonstrated that miR-214 has essential roles in regulating invasiveness, extravasation and metastasis formation [33, 34]. [score:2]
In order to identify new molecular pathways underlying miR-214 -mediated regulation of these genes we took advantage of CyTRANSFINDER. [score:2]
Fig. 8 miR-214 Double Indirect miRNA STPs. [score:2]
miR-214 is deregulated in a variety of human tumors including melanoma, breast, ovarian, gastric, and hepatocellular carcinomas as reviewed in [41]. [score:2]
It describes a general template of regulators to be identified to connect a source node s n∈ S R L to a destination gene d n∈ D G L. The user can enter the desired inputs through panel (A) of Fig. 1. Both (SRL) and DGL are provided in a text file formatted as described in Fig. 2. Each gene can be defined by either the gene symbol or the NCBI gene ID, while miRNAs are defined using the miRBase identifier (e. g., hsa-mir-214). [score:2]
STPs involving human miR-214 analysis. [score:1]
Differently from the previous case, to show the use of the software on a STPP starting from a gene, we used DNM3, the host gene of miR-214, as SRL [see Additional file 2 – srl. [score:1]
Finally, another STP interestingly linked miR-214 to miR-15b-5p. [score:1]
To show the capability of the plugin, we have applied it to a study of two miRNAs that are particularly relevant in human melanoma progression, miR-146a and miR-214. [score:1]
In particular, we were interested in STPPs driven by CREB1 since potential miR-214 ↦ CREB1 connections could open up new lines of research in understanding miR-214 -driven metastatization. [score:1]
txt] and the miR-214 -dependent signature mentioned above as the DGL [see Additional file 2 – dgl. [score:1]
Human miR-214 gene is located in the chromosomal region 1q24.3, in intron 14 of the Dynamin-3 gene (DNM3) inside an almost 8 kb-long noncoding RNA, named DNM3os. [score:1]
To show the potential of the plugin we have applied it in a study of two miRNAs that are particularly relevant in human melanoma progression, miR-146a and miR-214. [score:1]
This transcript contains the sequences for miR-214 and miR-199a-2, two clustered miRs that are approximately 6 kb apart. [score:1]
[1 to 20 of 23 sentences]
34
[+] score: 61
Restoration of microRNA-214 expression reduces growth of myeloma cells through positive regulation of P53 and inhibition of DNA replication. [score:6]
Upregulated expression of microRNA-214 is linked to tumor progression and adverse prognosis in pediatric osteosarcoma. [score:6]
Downregulation of microRNA-214 and overexpression of FGFR-1 contribute to hepatocellular carcinoma metastasis. [score:6]
MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. [score:4]
MiR-214 targets β-catenin pathway to suppress invasion, stem-like traits and recurrence of human hepatocellular carcinoma. [score:4]
MicroRNA-214 suppresses growth and invasiveness of cervical cancer cells by targeting UDP-N-acetyl-α-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7. J. Biol. [score:4]
MicroRNA-214 downregulation contributes to tumor angiogenesis by inducing secretion of the hepatoma-derived growth factor in human hepatoma. [score:3]
Overexpression of in transgenic mice under control of the α-MHC promoter does not induce a deteriorating cardiac phenotype; however, adenovirus -mediated pri-miR-214 delivery and lentivirus -mediated delivery induce hypertrophic growth of primary neonatal rat cardiomyocytes in part through Ezh2 repression (van Rooij et al., 2006; Yang et al., 2013). [score:3]
Targets of miR-214. [score:3]
MiR-214 and N-ras regulatory loop suppresses rhabdomyosarcoma cell growth and xenograft tumorigenesis. [score:3]
Involvement of miR-214 in cardiovascular diseases. [score:3]
MiR-214 reduces cell survival and enhances cisplatin -induced cytotoxicity via down-regulation of Bcl2l2 in cervical cancer cells. [score:3]
microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. [score:3]
microRNA-214 -mediated UBC9 expression in glioma. [score:3]
Decreased microRNA-214 levels in breast cancer cells coincides with increased cell proliferation, invasion and accumulation of the Polycomb Ezh2 methyltransferase. [score:1]
is derived from the miR-199a-2/miR-214 locus at human chromosome 1q24.3 (Figure 2). [score:1]
Involvement of miR-214 in cancers. [score:1]
miR-214. [score:1]
Human chromosomal locus of miR-214 gene. [score:1]
Circulating miR-24, miR-125b, miR-195, and miR-214. [score:1]
Human chromosomal locus of gene is derived from the miR-199a-2/miR-214 locus at human chromosome 1q24.3 (Figure 2). [score:1]
[1 to 20 of 21 sentences]
35
[+] score: 58
Other miRNAs from this paper: hsa-mir-218-1, hsa-mir-218-2
A class of miRNAs has been proved as important regulators of gene expression, 28, 29 in this study with the help of bioinformatics analyses and miRNA expression profiles of BC cells, [20] we revealed that miR-214 directly suppresses SLC34A2 expression and decreased miR-214 contributes to SLC34A2 overexpression in BC. [score:13]
This finding is based on evidence as below: first, miR-214 has a conserved binding site in the 3'-UTR of SLC34A2; second, the luciferase activity of SLC34A2 3'-UTR reporter is specifically responsive to increased miR-214 but non-reactive to miR-214-mut; third, the overexpression of miR-214 reduced the expression of SLC34A2; and fourth, miR-214 is downregulated in BC cells. [score:8]
These data collectively provided evidence that miR-214 directly suppresses SLC34A2 expression and decreased miR-214 contributes to SLC34A2 overexpression in BC. [score:8]
To verify the hypothesis that downregulation of miR-214 was responsible for the upregulation of SLC34A2 in BC, we constructed miR-214 mutant(miR-214-mut), which mismatched the 3'-UTR of SLC34A2 (Figure 6c). [score:7]
of the luciferase reporter assay showed that miR-214 overexpression decreased the luciferase activity of the SLC34A2 3'-UTR, whereas the miR-214-mut failed to show an inhibitory effect on the luciferase expression (Figure 6d). [score:6]
Therefore, upregulation of miR-214, such as using miR-214 mimics, is an optional strategy to suppress BC, which has high level of SLC34A2. [score:6]
Next, our quantitative RT-PCR analyses showed that miR-214 was indeed downregulated in all four BC cell lines and five fresh BC tissues examined (Figure 6b). [score:4]
Furthermore, western blotting assays proved that miR-214 greatly downregulated the protein level of SLC34A2, whereas miR-214-mut exerted none of the above effects (Figure 6e). [score:3]
[20] The result showed that miR-214 was singled out as a potential regulator of SLC34A2 (Figure 6a). [score:2]
MiR-214 is a negative regulator of SLC34A2. [score:1]
[1 to 20 of 10 sentences]
36
[+] score: 57
The regulation of the Wnt signaling pathway by miR-142 and other miRNAs is described in more detail later in Section 4.3. miR-214, together with miR-199a-2, is located inside the sequence of the long non-coding Dynamin 3 opposite strand (Dnm3os) transcript on mouse and human chromosome 1. miR-214 is upregulated or downregulated in human tumors [101]. [score:8]
miR-214 is upregulated in luminal A, normal-like and triple -negative subtypes, but it is not upregulated in other subtypes [101, 103, 104]. [score:7]
In ovarian cancer, miR-214 increases CSCs by upregulating the Nanog expression [107]. [score:6]
In contrast, miR-214 suppresses stem-like traits in human hepatocellular carcinoma cells by directly targeting Ezh2 and β-catenin [110], suggesting that the roles of miR-214 will be different depending on the tumor types. [score:6]
miR-214 regulates cell differentiation, stemness, apoptosis, and invasion by targeting Ezh2, p53, transcription factor TFAP2, PTEN, BIM, and β-catenin [107, 108, 109, 110]. [score:4]
Xu C. X. Xu M. Tan L. Yang H. Permuth-Wey J. Kruk P. A. Wenham R. M. Nicosia S. V. Lancaster J. M. Sellers T. A. MicroRNA miR-214 regulates ovarian cancer cell stemness by targeting p53/Nanog J. Biol. [score:4]
miR-214 is one of the miRNAs highly upregulated in human breast CSCs. [score:4]
miR-214 induces cell survival by targeting PTEN and BIM [108]. [score:3]
miR-214 induces cell invasion by targeting p53 [109]. [score:3]
Further studies are required to clarify the roles of miR-214, miR-199a-2, and long non-coding Dnm3os in development. [score:2]
Wang F. Lv P. Liu X. Zhu M. Qiu X. MicroRNA-214 enhances the invasion ability of breast cancer cells by targeting p53 Int. [score:2]
Thus, miR-214 seems to have important roles in the regulation of proliferation, differentiation, stemness, apoptosis, invasion and metastasis [101]. [score:2]
Ubiquitous miR-214-specific knockout mice are viable and fertile, but following ischemia-reperfusion injury, show impaired cardiac function and progression to heart failure [105]. [score:2]
And the miR-214 locus is frequently amplified in breast cancers [102]. [score:1]
In contrast, mice lacking Dnm3os, which encodes miR-214 and miR-199a-2, display severe skeletal defects and die within the first month of birth [106]. [score:1]
3.5. miR-214. [score:1]
Penna E. Orso F. Taverna D. miR-214 as a key hub that controls cancer networks: Small player, multiple functions J. Invest. [score:1]
[1 to 20 of 17 sentences]
37
[+] score: 53
Upregulated expression of miR-214 in tumors is linked to tumor progression and poor prognosis in OS and a proposed mechanism of action is that miR-214 promotes OS proliferation and invasion through direct suppression of leucine zipper, putative tumor suppressor 1 (LZTS1) 19, 20. [score:11]
At 14 weeks from injection and in the presence of tumor, miR-205-5p was significantly downregulated and miR-214 and miR-574-3p were upregulated. [score:7]
The miRNA pattern of expression remained similar to previous experiments with increased levels of mir-214, miR-335-5p, and miR-574-3p in the diseased state. [score:5]
MicroRNA 205-5p was decreased 2.68-fold (95% CI 2.17–2.89) in diseased mice compared to controls, whereas miR-214 and miR-335-5p were increased 2.37- (95% CI 1.81–2.93) and 2.69-fold (95% CI 2.12–3.26), respectively, in diseased mice. [score:4]
These reports corroborate our data that plasma miR-214 is associated with metastatic disease and can be used as both a diagnostic biomarker and a prognostic biomarker for patient outcome. [score:3]
Our studies revealed plasma miR-205-5p was downregulated in GEMM mice with OS compared to wild-type littermate controls, whereas levels of miR-214 and miR-335-5p were significantly higher in GEMM mice. [score:3]
Next, we further stratified all patients that presented with metastatic disease and noted that low plasma miR-214 levels could distinguish a subpopulation of patients with significantly enhanced overall survival (P = 0.008), Figure 5B. [score:3]
Three of the four miRNAs (miR-205-5p-5p, miR-214, and miR-335-5p) were validated in an independent set of diseased and wild-type mice to be statistically significant (P < 0.05) using a two-sample, two-tailed Student’s t-test comparing the 2 [−ΔCq] values of the two groups MicroRNA-574-3p was not statistically significant in final statistical analysis, but was included in simultaneous studies based on preliminary results (P =  0.15) (Fig. 1). [score:3]
The levels of miR-205-5p, miR-574-3p, and miR-214 were significant from baseline at the time of tumor development (14 week time point). [score:2]
We found that miR-214 levels differ significantly between metastatic and nonmetastatic patients (P = 0.016), suggesting an association between metastatic status and miR-214 levels. [score:1]
Four miRNAs (miR-205-5p-5p, miR-214, miR-335-5p, and miR-574-3p) were chosen as candidate miRNAs based on reports in published literature, the presence of a conserved known human homologue, and the fold change in the global qPCR analysis. [score:1]
As shown in Figure 5A, the areas under the curves (AUCs) were 0.70 (95% CI 0.576–0.827), 0.8 0(95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
Finally, we provide evidence that plasma miR-214, a member of the signature, has prognostic significance in human OS patient plasma samples. [score:1]
Therefore, we monitored the levels of miR-205-5p, miR-214, miR-335-5p, and miR-574-3p prior to and serially after transplantation of OS cells. [score:1]
Analysis of our metastatic cohort suggests that plasma miR-214 levels can identify this subpopulation, as the 20% of metastatic patients with low miR-214 levels are all presently alive. [score:1]
Data are now emerging on the importance of miR-214 in OS. [score:1]
While our study is the first report of plasma miR-205-5p, miR-214, miR-335-5p, and miR-574-3p to be used as biomarkers, the literature supports that each of these miRNAs may have an important biologic function in OS. [score:1]
Lastly, we have identified that low plasma levels of miR-214 in metastatic patients at time of diagnosis is associated with an excellent prognosis. [score:1]
This result needs to be repeated in a larger sample size with longer follow-up times, but plasma miR-214 could be the first biomarker identified that can discriminate which metastatic patients will have a good outcome with current therapeutic regimens. [score:1]
Areas under the curve (AUCs) were 0.70 (95% CI 0.576–0.827), 0.80 (95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
The ΔCq cut-points were 8.34 for miR-205-5p, 10.31 for miR-214, 9.78 for miR-335-5p and 6.08 for miR-574-3p. [score:1]
[1 to 20 of 21 sentences]
38
[+] score: 48
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
MiR-17 family, miR-574-5p and miR-214 were upregulated at the onset of SARS infection: these miRNAs may help the virus to evade the host immune system and are responsible for effective transmission at the initial stage of viral infection [86]. [score:4]
[1 to 20 of 3 sentences]
39
[+] score: 44
In multiple human cancers, PTEN expressions are downregulated by miRNAs, which are shown in Table 1. Table 1 miRNA Locus Expression status Tumor type Reference MiR-21 17q23.1 Upregulated Colorectal, bladder, and hepatocellular cancer[112– 114] MiR-19a 13q31.3 Upregulated Lymphoma and CLL[87, 115] MiR-19b Xq26.2 Upregulated Lymphoma[87] MiR-22 17p13.3 Upregulated Prostate cancer and CLL[116, 117] MiR-32 9q31.3 Upregulated Hepatocellular carcinoma[118] MiR-93 7q22.1 Upregulated Hepatocellular carcinoma[119] MiR-494 14q32.31 Upregulated Cervical cancer[120] MiR-130b 22q11.21 Upregulated Esophageal carcinoma[121] MiR-135b 1q32.1 Upregulated Colorectal cancer[122] MiR-214 1q24.3 Upregulated Ovarian cancer[123] MiR-26a3p22.2 (MIR26A1)12q14.1(MIR26A2) Upregulated Prostate cancer[113] MiR-23b 9q22.32 Upregulated Prostate cancer[114] Abbreviations: CLL, chronic lymphocytic leukemia. [score:44]
[1 to 20 of 1 sentences]
40
[+] score: 43
Notably, rno-miR-214 was predicted to have maximum number of binding sites within the representative members of down-regulated pathways, whereas, rno-miR-34a was detected as miRNA hub having maximum number of interactions within the members of up-regulated pathways. [score:7]
Notably, miR-214 was predicted to anneal with the maximum number of significant genes (1,118 i. e. 583 down- and 535 up-regulated) and its seeds were more specific to down-regulated genes (Table 3 ). [score:7]
A few potential interactions are: rno-miR-214, -31, -199a-5p, -21, -34a and -132 were predicted to target several down-regulated TFs such as Hnf1α, Nfatc4 and Glis2. [score:6]
Similarly, 5 miRNAs (e. g., miR-214, -31 and -34a) were predicted to target down-regulated genes such as Glis2 and Hnf1α. [score:6]
Furthermore, Apc (down-regulated) was predicted as a putative target of miR-214 with a seed of 10nt long. [score:6]
These findings support our previous assumption in which we found that rno-miR-214 binding sites are abundantly present within down-regulated genes. [score:4]
Also, miR-214 and -503 were predicted to hybridise with Peroxisome proliferator-activated receptor α (Pparα) (down-regulated) with octamer seeds. [score:4]
Few examples include; rno-miR-214 can target Itgb4 (focal adhesion, ECM-receptor and actin cytoskeleton), Ccl19 (chemokine signaling), Mcm4 (cell cycle and DNA replication) and Tbl1x (Wnt signaling). [score:3]
[1 to 20 of 8 sentences]
41
[+] score: 41
Among D3 UM with liver metastasis (n = 6), higher expressions of miR-149* (83.3%), miR-1238 (83.3%), miR-199a (100%); moderate expressions in miR-134 (50%), miR-214 (50.0%), while lower expressions of miR-146b (33.33%) and let-7b (25%) and negative expression in miR-143 (100%) were observed. [score:9]
Among M3 UM with liver metastasis (n = 11), higher expressions of miR-149* (72.72%), miR-1238 (100%), miR-134 (100%), miR-214 (54.54%), miR-146b (54.54%), miR-199a (100%) while moderate expression of miR-143 (45.45%) and negative expression of let-7b (100%) was observed. [score:7]
Among D3 UM with no liver metastasis (n = 29), higher expressions of miR-149* (72.41%), miR-1238 (86.2%), miR-199a (82.75%), miR-134 (41.37%), miR-214 (41.37%) and miR-146b (58.62%), while lower expression of miR-143 (37.93%), let-7b (13.79%) were observed (S6 Table and Fig 3). [score:5]
Among M3 UM with no history of liver metastasis (n = 40), higher expressions of miR-149* (90.0%), miR-1238 (97.5%) and miR-134 (57.5%), miR-214 (62.5%), miR-146b (67.5%), miR-143 (65.0%), miR-199a (90.0%) and lower expression of let-7b (30.0%) were observed. [score:5]
Among the five miRNAs previously shown as class 2 tumor discriminators [13], four up-regulated miRNAs (miR-214, miR-143, miR-146b and miR-199a) showed a significant association with M3 tumors while the other miRNA, let-7b did not show any significant association with M3 UM (Fig 3). [score:4]
Differential expression of 8 miRNAs: miR-214, miR-149*, miR-143, miR-146b, miR-199a, let7b, miR-1238 and miR-134 were studied. [score:3]
Five miRNAs (miR-214, miR146b, miR-143, miR-199a and miR-134) were found to be differentially expressed in M3/ D3 UM tumors. [score:3]
miR-214 regulates cell cycle regulatory genes: phosphatase and tensin homolog (PTEN) [29], adipocyte protein 2 (AP2) and tumour protein 53 (TP53) genes [30]. [score:3]
The data derived from metastasis-free survival analysis is presented in S6 Table and Fig 5. These results indicate that the expression of miR-214, miR-149*, miR-146b, miR-199a, miR-1238 and miR-134 can be used to evaluate the metastasis-free survival in UM patients. [score:1]
Three miRNAs: miR-149*, miR-1238 and miR-134 (which were in common with supervised and unsupervised data analysis; Fig 1C) and 5 miRNAs: miR-214, miR-143, miR146b, miR-199a and let7b (earlier shown as class 1/ class 2 discriminators) [13] were selected for validation. [score:1]
[1 to 20 of 10 sentences]
42
[+] score: 40
Meanwhile, a target mRNA ACVR1C of miR-557 is also associated with a reduction in HCV-infected cells [28], while the target mRNA RAB43 of miR-214, a key RAB to maintain a functional Golgi complex in human cells [29], has been found to interact with HCV NS5A proteins [30] and can also mediate the replication of HCV [29]. [score:5]
The edges linking miR-214 and its mRNA targets are in solid lines, while the edges linking miR-557 and its mRNA targets are in dashed lines. [score:5]
As miR-214 and miR-557 expression patterns in hepatocellular carcinoma are tissue specific, they can both serve as novel biomarkers for chronic liver diseases. [score:5]
• In the module of miR-34a and miR-214, besides the confirmed miR-214 and its mRNA RAB43, miR-34a has been reported to upregulate in both liver fibrosis and hepatocellular carcinoma, and serum levels of miR-34a are significantly higher in chronic hepatitis C infection patients than in controls [31]. [score:4]
• In the module for miR-557 and miR-214 (Figure 4), miR-557 has been reported as a novel candidate biomarker for hepatocellular carcinoma [26], and miR-214-5p has been shown to up-regulate in human and mouse livers in a fibrosis progression -dependent manner. [score:4]
The expression of miR-214-5p increased during the culture -dependent activation of mouse primary stellate cells and was significantly higher in stellate cells than in hepatocytes [27]. [score:3]
For example, miR-557 and miR-214 have two common targets. [score:3]
• In the module of miR-493-3p and miR-214, the sole target mRNA WDR33 of miR-493-3p has been found to result in increased viral infection with two or more siRNAs [33]. [score:3]
GFRA2 QKI MAP2 FRMPD4 BNC2 CAMK2D miR-493-3p - -0.68 - 0.12 - - miR-184 - - - -0.05 - - miR-129 - -0.71 - - - 0.01 miR-214 - - -0.15 - -0.01 0.03 miR-557 0.18 - -0.01 - - - miR-765 0.21 -0.44 -0.02 -0.04 -0.10 - miR-17-3p 0.26 - - - -0.13 -0.13 miR-34a - - -0.05 - - - (Figure 8). [score:1]
CAMK2D has a random correlation with miR-129 and miR-214, but it is negatively correlated with miR-17-3p. [score:1]
Six miRNAs (miR-214, miR-34a, miR-129, miR-765 and miR-210) and 9 mRNAs (ACVR1C, RAB43, FNDC5, WDR33, ALDH4A1, ANKRD12, KCTD9, ARMC1 and DICER1) all in red are confirmed by literature work. [score:1]
miR-557 and miR-214, the miRNAs of the first HCV+ miRNA rule are placed at the up panel. [score:1]
An example of these miRNA rules is related to miR-557 and miR-214. [score:1]
• In the module of miR-184 and miR-214, a mRNA ALDH4A1 of miR-184 was believed to contribute to HBV- or HCV- induced liver [34]. [score:1]
As shown in Table 2 the rule consisting of miR-557 and miR-214 has the maximum distance and maximum AUC. [score:1]
For example, miR-129, miR-214 and miR-34a are found to associate with human hepatocellular carcinoma [26, 31, 35, 42]. [score:1]
[1 to 20 of 16 sentences]
43
[+] score: 39
Therefore, miR-214 regulates Ca [2+] homeostasis, and prevents cardiomyocyte death and protects against cardiac I/R injury by inhibiting the expression of the Ca [2+]-handling molecule NCX1, as well as CaMKIIδ, BIM, and cyclophilin D. MiR-494 is one of the miRNA transcripts that is downregulated in human infarcted and murine I/R-injured heart [11]. [score:9]
Therefore, miR-214 regulates Ca [2+] homeostasis, and prevents cardiomyocyte death and protects against cardiac I/R injury by inhibiting the expression of the Ca [2+]-handling molecule NCX1, as well as CaMKIIδ, BIM, and cyclophilin D. MiR-494 is one of the miRNA transcripts that is downregulated in human infarcted and murine I/R-injured heart [11]. [score:9]
The heart-specific miR-214 knockout mice demonstrates that heart structure, size, and function are not significantly affected by the mutation, but Ca [2+] regulator genes are upregulated compared to wild type mice. [score:6]
MiR-214 protects cardiomyocytes susceptible to cardiac I/R injury and heart failure and is upregulated in a variety of cardiac disease mo dels [70]. [score:5]
The primary Ca [2+] pump NCX1, a proapoptotic Bcl2 family protein known as BIM, CaMKIIδ, and cyclophilin D (a major regulator of mPTP) are direct targets of miR-214. [score:5]
Cardiomyocytes from miR-214 knockout mice show both high levels of intracellular Ca [2+] and Ca [2+] overload. [score:2]
Additionally, miR-214 knockout mice exhibit more severe cardiac injury, including a greater extent of cardiomyocyte loss, larger fibrotic regions, and impaired cardiac performance compared to wild type mice according to a left anterior descending coronary artery (LAD) mo del [71]. [score:1]
Aurora et al. discovered a potential role of miR-214 in I/R injury. [score:1]
3.2.4. miR-214. [score:1]
[1 to 20 of 9 sentences]
44
[+] score: 37
The quantitative PCR results confirmed the expression of two most upregulated (hsa-miR-361-5p and hsa-miR-214) and downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs in the same 35 GC pairs (Figure 1B). [score:9]
Upregulation of miR-214 is present in pancreatic, hepatoblastoma, gastric, osteosarcoma, esophageal, ovarian, bladder and melanoma cancer whereas its downregulation could be found in some other caner types including hepatocellular, cervical, breast, prostate cancer [40]. [score:7]
B. Validation of two most differentially upregulated (miR-214 and miR-361-5p) and downregulated (miR-148a and miR-1225-5p) miRNAs in tumor and corresponding nontumorous pairs used for microarray analysis. [score:7]
Two most upregulated (hsa-miR-361-5p and hsa-miR-214) and two most downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs were further validated using qRT-PCR in GC tissue pairs. [score:7]
The average mRNA expression levels in cancerous tissues were increased by 2.81- and 1.92-fold (p < 0.01 for both) for hsa-miR-361-5p and hsa-miR-214, but decreased by 4.76- and 6.25-fold (p < 0.01 for both) for hsa-miR-148a and hsa-miR-1225-5p relative to those in the adjacent normal tissues. [score:3]
These suggest that miR-214 may function as either a tumor suppressor or tumorigenic miRNA. [score:3]
The role of miR-214 in human cancers appears contradictory. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 36
miRNA target has-miR302a MECP2 hsa-miR29a TET1, TET2, TET3 has-miR29a/c DNMT3A, DNMT3B has-miR29b-1/2 DNMT1 (Indirect via SP1) hsa-miR148a DNMT3B hsa-miR148a DNMT1 hsa-miR152 DNMT1 has-miR302a DNMT1 (Indirect via AOF2) hsa-miR342 DNMT1 hsa-miR17-92 DNMT1 hsa-miR26a-1/2 EZH2 hsa-miR101-1/2 EZH2/EED hsa-miR214 EZH2 hsa-miR128-1/2 BMI-1 hsa-miR199a-1/2 BRM hsa-miR433 HDAC6 hsa-miR449a HDAC1 hsa-miR138 SIRT1In the first column we report a list of miRNAs which are known to target epigenetic regulators and in the second column the corresponding targets. [score:10]
Upon differentiation, stimulated by the MyoD and myogenin developmental regulators, mir-214 is released from the Polycomb control and downregulates the Ezh2 translation thus accelerating the differentiation of skeletal muscle cells. [score:8]
Among the targets of PRC2 there are several miRNAs and in particular one of its targets is mir-214. [score:5]
Before differentiation the Polycomb complex is upregulated and represses the transcription of a large set of genes among which also mir-214. [score:4]
In turn it was shown in Juan et al. (2009) that Ezh2 is targeted by mir-214 thus closing a DNFL. [score:3]
In turn Brm is able to silence the mir-199, mir-214 cluster by silencing Egr1 which is known to be a strong activator of the cluster (Sakurai et al., 2011), thus closing in an indirect way a double negative feedback loop between Brm and mir-199. [score:2]
The DNFL involving Ezh2 and mir-214 has been studied in detail in Juan et al. (2009) where it was shown its role in inducing the differentiation of embryonic stem cells into skeletal muscle cells. [score:1]
However, it is deeply linked with the previous ones, since mir-199 is located in the same cluster of mir214 and is known to form a common precursor with mir-214 (Loebel et al., 2005), and is thus controlled by the same PRC2 complex discussed in the previous examples. [score:1]
Mir-214 -dependent regulation of the polycomb protein Ezh2 in skeletal muscle and embryonic stem cells. [score:1]
The Ezh2 - mir214 loop. [score:1]
[1 to 20 of 10 sentences]
46
[+] score: 35
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2
Therefore, our CRISPRi system targeting the E-box element in the promoter of the miR-199a/214 cluster successfully inhibited miR-199a-5p, miR-199a-3p, and miR-214 expression in hiPS-NSCs under hypoxic condition. [score:7]
In the view that miR-199a-5p, miR-199a-3p, and miR-214 of the miR-199a/214 cluster are targeting the HIF-1 α and c-Met signaling pathways that play an essential role in hypoxia -induced cell migration (Figure 2(a)) [12– 15], we attempted to develop a CRISPRi system to inhibit the expression of this microRNA gene cluster. [score:7]
It has been described that miR-199a-5p, miR-199a-3p, and miR-214, which are coexpressed from the miR-199a/214 cluster on Chromosome 1, negatively regulate hypoxia -induced cell migration via downregulation of the HIF-1 α and c-Met signaling [12– 15]. [score:7]
Consistent with our previous studies [5, 8], the expression levels of miR-199a-5p, miR-199a-3p, and miR-214 in hiPS-NSCs were very high under normoxic condition but downregulated by 30%–50% under hypoxic condition. [score:6]
Our data showed that the CRISPRi system successfully suppressed the expression of miR-199a-5p, miR-199a-3p, and miR-214 in hiPS-NSCs and significantly enhanced their tumor tropism in vitro and in vivo. [score:5]
MicroRNA qPCR was performed to access the absolute expression levels of miR-199a-5p, miR-199a-3p, and miR-214 in hiPS-NSCs transduced with the CRISPRi system and under hypoxic condition (Figure 2(c)). [score:3]
[1 to 20 of 6 sentences]
47
[+] score: 34
Regulation of methylation also provides an explanation for the miR-410 -mediated decrease in FHL1 both at the level of mRNA and protein, whereas two other miRNAs (miR-214, and miR-495) down-regulate FHL1 expression only at the protein level. [score:7]
These results suggest that miR-495 and miR-214 inhibit FHL1 at the protein level, but that miR-410 functions to inhibit miR-410 via a mechanism that occurs prior to FHL1 translation. [score:7]
Western blot analysis showed that miR-410, miR-495, and miR-214 could inhibit FHL1 protein expression the most dramatically (Figure. [score:5]
These data suggest that miR-410, miR-495, and miR-214 specifically inhibit the FHL1 3′UTR, but that the effects of miR-146a and miR-146b-5p may be non-specific or at sites other than their predicted target sites. [score:5]
verify that each of the 5 miRNAs could inhibit the activity for the wt-FHL1 3'UTR luciferase plasmid; however, mutation of the seed recognition sequence prevented a decrease in luciferase activity only for miR-410, miR-495 and miR-214 (Figure. [score:4]
Preliminary screening results showed that miR-146a, miR-146b-5p, miR-214, miR-495, and miR-410 can significantly inhibit luciferase activity (Figure. [score:3]
Interestingly, FHL1 mRNA expression also was decreased by miR-410, but not miR-495 or miR-214 (Figure. [score:3]
[1 to 20 of 7 sentences]
48
[+] score: 34
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-199b
Whereas we know that suppression of the expression of a target protein by a certain miRNA is usually moderate and is not unconditionally retained in steady states, we selected the candidates of type 1-specific genes from various targets of miR-199a-5p (10 genes tested), miR-199a-3p (11 genes tested), and miR-214 (6 genes tested). [score:9]
On the other hands, the expression levels of GSK3β and Sirt1 (miR-199a-5p targets), and PTEN (a miR-214 target), which did not show type 1-specific expression patterns, were not affected by high levels of either Brm or NFκB in SW13 cells (Fig. 4a). [score:9]
The results of a series of quantitative reverse transcription-polymerase chain reaction (RT-PCR) experiments (Fig. 1a) confirmed our previous observations that epithelial tumor cell lines can be classified into two types according to the expression levels of Brm, EGR1, and miR-199a; type 1 cells specifically express Brm mRNA, whereas expressions of EGR1 mRNA and miR-199a-5p and-3p, as well as miR-214, which is also generated from the miR-199a (2) gene locus, are restricted to type 2 cells. [score:7]
PTEN protein, a well-known miR-214 target, was clearly expressed in all of the cell lines except C33A cells, because C33A have homozygous nonsense mutation of this gene. [score:6]
In our current study, we were able to efficiently identify the type 1-specific genes by setting the reported miR-199a and miR-214 target genes as the candidates. [score:3]
[1 to 20 of 5 sentences]
49
[+] score: 32
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Downregulation of microRNA-214 and overexpression of FGFR-1 contribute to hepatocellular carcinoma metastasis. [score:6]
In a review, Gramantieri et al. (2008) show miRNAs aberrantly expressed in HCC compared to non-tumorous liver tissue (up -expression of miR-33, miR-130, miR-135a, miR-210, miR-213, miR-222, miR-331, miR-373, miR-376a, and down -expression of miR-130a, miR-132, miR-136, miR-139, miR-143, miR-145, miR-150, miR-200a, miR-200b, miR-214). [score:6]
Therefore, Dong et al. (2013) postulated that miR-214 could be a key post-transcriptional regulator in oxidative stress -mediated human diseases. [score:4]
Dong et al. (2013) found that miR-214 directly bound to 3′-UTR of the GSR and POR genes, and repressed their endogenous expressions and activities. [score:4]
These findings suggested miR-214 mediating down-regulation of glutathione reductase and CYP oxidoreductase genes might play an important role in oxidative stress in live cells. [score:4]
Wang et al. (2008, 2013) reported that miR-214 is one of the most significantly downregulated miRNAs in HCC patients. [score:4]
MiR-214 promotes the alcohol -induced oxidative stress via down-regulation of glutathione reductase and cytochrome P450 oxidoreductase in liver cells. [score:3]
Potential microRNAs that could serve as possible markers of HCC by exposure to aflatoxins are miR-27a, miR-27b, miR-122, miR-148, miR-155, miR-192, miR-214, miR-221, miR-429, and miR-500. [score:1]
[1 to 20 of 8 sentences]
50
[+] score: 30
Other miRNAs from this paper: hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-101-2
As a matter of fact, EZH2 inhibits skeletal muscle differentiation by preventing the expression of miR-214 [5] while in turn, during myogenesis, miR-214 directly targets EZH2 3′UTR for degradation [6]. [score:8]
As shown in Fig.   2a, EZH2 knockdown in eRMS cells increases the expression of miR-29b, miR-214, and miR-101 as soon as 72 h after siRNA transfection. [score:4]
In line with this evidence, miR-214 is under-expressed in eRMS and its re-induction leads to myogenic differentiation [8]. [score:3]
a RT-qPCR analysis of mature forms of miR-214, miR-29b, and miR-101 in RD, JR1, and RD18 cells 72 h post EZH2 siRNA transfection (RD were transfected with SMART pool siRNA EZH2 (asterisks), JR1 and RD18 were transfected with siRNA targeting 5′-UTR of EZH2, see “Methods” section). [score:3]
Interestingly, while the up-regulation of miR-29b and miR-214 was comparable among the three cell lines, the de-repression of miR-101 appeared more modest in JR1 compared to RD and RD18 cells, suggesting a context -dependent response. [score:3]
Two independent measurements were done in duplicate To analyze whether miR-101 expression was affected by EZH2 modulation in eRMS, RD, JR1, and RD18 cell lines were silenced for EZH2 using either a pool of oligo siRNAs or oligo siRNA targeting the 5′UTR region of EZH2 mRNA, both previously validated (Additional file 1: Figures S1A and S1B) [11], and the expression of miR-101 together with that of other microRNAs known to be modulated by EZH2 in RMS, such as miR-214 and miR-29b [3, 8], was evaluated. [score:3]
Two independent measurements were done in duplicateTo analyze whether miR-101 expression was affected by EZH2 modulation in eRMS, RD, JR1, and RD18 cell lines were silenced for EZH2 using either a pool of oligo siRNAs or oligo siRNA targeting the 5′UTR region of EZH2 mRNA, both previously validated (Additional file 1: Figures S1A and S1B) [11], and the expression of miR-101 together with that of other microRNAs known to be modulated by EZH2 in RMS, such as miR-214 and miR-29b [3, 8], was evaluated. [score:3]
TaqMan microRNA assays (Applied Biosystems) were used for relative quantification of the mature miR-101 (hsa-miR-101; 002253), miR-29b (hsa-miR-29b; 0000413), and miR-214 (hsa-miR-214; 002293) expression levels, as described [9]. [score:2]
The concomitant induction in EZH2 -depleted eRMS cells of the myogenic microRNAs miR-214 and miR-29b, which have been previously involved in negative feedback loops with EZH2 in myoblasts and RMS cells [3, 6, 8], confirms the disruption of EZH2 -dependent tumorigenic pathways. [score:1]
[1 to 20 of 9 sentences]
51
[+] score: 29
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-342
As a result TWIST1 also determines the expression of miR-199a-2. Co -expression of miR-199a-2 and miR-214 has been observed in various systems, e. g., in zebrafish embryonic development [15], morphogenesis in skin (both highly expressed in hair follicle) [16], in response to stress and cardiac hypertrophy (both up-regulated) [17], in primary CNS lymphomas (both down-regulated) [18] and in antiviral responses [19]. [score:14]
Disruption of the expression of Dnm3os which induces miR-199a and miR-214 expression in mice resulted in skeletal defects. [score:5]
It was later shown in human cells that TWIST1 bound to an E-box region drives the expression of the DNM3OS transcript (Figure 1), which gives rise to miR-199a-2 and miR-214 [6]. [score:3]
Another transcription factor, EGR1 (Figure 1), was demonstrated to occupy the miR-199a-2/miR-214 gene promoter (one specific region in miPPR-199a-2) and induce its expression in certain cancer cells [13]. [score:3]
The high sequence homology between human and mouse suggests DNM3OS, in the form of miR-199a-2 and miR-214, may play important roles in human growth and development. [score:2]
Comparison of DNM3OS with its mouse homolog Dnm3os [7] indicated the human and mouse miR-199a-2 and miR-214 are highly homologous (99% and 100%, respectively). [score:1]
DNM3OS gives rise to miR-199a-2 and another microRNA, miR-214. [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 28
For instance, TUBG1 is inhibited by mir-152, STMN1 is inhibited by mir-210, LRRFIP2 and UNG are inhibited by mir-214, GCN1L1 is inhibited by mir-221, RPL37 is inhibited by mir-381, and PIGN is inhibited by mir-320a and mir-653. [score:13]
The specific core GEN of old men showed that STMN1 and LRRFIP2 are inhibited by mir-210 and mir-214, respectively, and DNA methylation of SMAD4 and LEF1, which may lead to dysregulation of the MAPK signaling and Wnt signaling pathways as well as deregulation of the cell cycle and apoptosis, thus resulting in cancer. [score:5]
Additionally, STMN1 is inhibited by mir-210 (c [il] = −0.25071) and LRRFIP2 is inhibited by the mir-214 (c [il] = −0.48908). [score:5]
Therefore, designing drugs to the DNA methylated genes, CTCF, CD27 and CCR7, or the genes inhibited by miRNAs, mir-210 and mir-214, STMN1 and LRRFIP2, may improve the male-specific aging process. [score:3]
We observed that there are two core miRNAs, mir-210 and mir-214, that regulate STMN1 and LRRFIP2, respectively which are involved in the MAPK and Wnt signaling pathways, respectively. [score:2]
[1 to 20 of 5 sentences]
53
[+] score: 27
It was found that miR-214 is highly expressed in ovarian tumors and functions as an oncogene that inhibits the tumor suppressor PTEN, leading to activation of the AKT pathway [79]; it is also overexpressed in CC tissue (Table 1) [43, 80]. [score:9]
Therefore, these data indicate that miR-214 could be a causal factor for the downregulation of PTEN in CC, leading to tumor progression and cell survival via the upregulation of AKT (Figure 1) (see also miR-21). [score:7]
Thus, miR-182 and miR-183 are overexpressed and miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in both cell lines containing integrated HPV16 or HPV18 DNA [30]. [score:5]
HPV18 positive HeLa cell line has overexpression of miR-182 and miR-183, while miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in this cell line as compared with normal cervical tissue. [score:4]
In contrast, miR-1, miR-126, miR-133b, miR-143, miR-145, miR-195, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in these cell lines as compared with normal cervical tissue. [score:2]
[1 to 20 of 5 sentences]
54
[+] score: 27
We found that miR-214 directly targeted ATF4 to inhibit osteoblast activity (Wang et al., 2013). [score:6]
Our previous study indicated that miR-214 directly targeted ATF4 to inhibit osteoblast activity and bone formation. [score:6]
miR-214 targets ATF4 to inhibit bone formation. [score:5]
Meantime, miR-214 promotes osteoclastogenesis by targeting Pten in vitro and in vivo (Zhao et al., 2015). [score:3]
miR-214 promotes osteoclastogenesis by targeting Pten/PI3k/Akt pathway. [score:3]
And we found simulated microgravity (hindlimb unloading mo del)—induced deleterious changes in trabecular bone mass and trabecular architecture were efficiently attenuated by the inhibition of miR-214 in mice (Wang et al., 2013). [score:3]
Unfortunately, the microRNA microarray results showed no significant change in miR-214 level in this study, however qPCR results demonstrated circulating miR-214 levels were significantly increased in plasma of individuals after bed rest (unpublished data). [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 27
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
Except for miR-214, all other miRNA led to decreases in Tip110 mRNA expression to various degrees (Figure 1C) and in parallel decreases in Tip110 protein expression (data not shown). [score:5]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
The first showed no expression changes from day 1 to day 7, and included only miR-214. [score:3]
miR-214 showed the lowest expression level with no changes between day 1 and 7 (Figure 3A). [score:3]
| | | | | | |3′ UGUUUCAAGACACUACGUGACUPosition 82–88 of Tip110 3′UTRHsa-miR-214-5p5′. [score:1]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG (A) Schematic of the Tip110 3′UTR region with predicted miRNA binding sites (Tip110 miRNA). [score:1]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 9 sentences]
56
[+] score: 27
Based on the case that miR-378 and miR-214 were up-regulated in the blood serum of cancer patients (Table 8) and down-regulated in the tumor tissues; therefore, it can be concluded that they can function as upregulated oncomiRs miRNAs on subunits of the TCR-CD3 complex. [score:10]
miR-138 (Table 6) from the second group (predicted for targeting the CD3EAP gene responsible for the CD3-epsilon subunit) was down-regulated, and miR-214 from the third group (predicted for targeting the CD247 gene responsible for the CD3-zeta subunit), was down-regulated in cancer tissues investigated in most of the studies. [score:9]
Since miR-378, miR-422a, miR-593, miR-494, miR-138 and miR-214 could target the CD3 subunits, some of which have been studied in different cancers and have been considered as biomarkers to detect cancer at the early stages, it is then highly likely that miRNAs damage the immune system so that it cannot distinguish cancer cells. [score:2]
With regard to the miR-214 copy number in blood serum studies, an increase in miRNA levels was observed in the blood sera of patients with prostate [69] and breast [70] cancers (Table 8). [score:1]
One miRNA (miR-138) was found to be conserved and similar to the CD3EAP gene and three conserved miRNAs (miR-761, miR-214 and miR-3619-5p) were shown to be similar to the CD247 gene. [score:1]
miR-214 levels had decreased in tumor tissues of patients suffering from esophageal squamous cell carcinoma (ESCC) [58], breast cancer [59], cervical cancer [60], hepatocellular carcinoma (HCC) [61] [62], squamous cell carcinoma (SCC) [63], cholangiocarcinoma metastasis [64] and primary central nervous ystem lymphoma (PCNSL) [65]. [score:1]
From the first group only 6 miRNAs (miR-378, miR-422a, miR-593 and miR-494, miR-515 and miR-136), from the second group one miRNA (miR-138) and from the third group only one miRNA (miR-214) were identified and studied, based on their levels in tissues or blood sera of different cancer patients. [score:1]
In contrast, gastric cancer [66], ovarian cancer [67] and pancreatic cancer [68] are examples of cancers in which miR-214 levels increased (Table 7). [score:1]
Except for hsa-miR-214, no reports have been cited so far regarding the levels of miR-761 and miR-3619-5p in tumor tissues. [score:1]
[1 to 20 of 9 sentences]
57
[+] score: 26
Interestingly, upregulation of several miRNAs (miR-214, miR-26, and miR-29) collaboratively represses PcG complex expression and function in myocytes and thereby promotes muscle-specific gene expression and differentiation (Figure 1). [score:8]
Therefore, by targeting and inhibiting Ezh2, miR-214 forms a negative feedback loop with the PcG complex [47]. [score:5]
Like miR-214, miR-29 forms a negative feedback loop with several other critical components of the PcG complex such as Yin Yang 1 (YY1), RING, and Rybp, an YY1 binding protein, by inhibiting their expression [50, 51]. [score:5]
Of these, miR-146b, miR-155, miR-214, miR-221, and miR-222 are of special interest, as their expression is altered in almost all of the muscle diseases studied [85]. [score:5]
In undifferentiated myoblasts, PcG occupies a MyoD enhancer site upstream of miR-214, which is released by MyoD upon differentiation, allowing the activation of miR-214 expression. [score:3]
[1 to 20 of 5 sentences]
58
[+] score: 24
Our PAS-Seq data also confirm upregulation of miR210 and downregulation of miR214 in PE [54]. [score:7]
Gonsalves CS Erythropoietin -mediated expression of placenta growth factor is regulated via activation of hypoxia-inducible factor-1α and post-transcriptionally by miR-214 in sickle cell diseaseBiochem. [score:6]
Among this set, only miR214 has been previously linked to PE, with microarray data indicating its downregulation [56]. [score:4]
miR214 is thought to regulate both PLGF [57] and components of the β-catenin pathway [58], with its own expression being modulated by HIF1 alpha [57]. [score:4]
Other differentially expressed noncoding transcripts with embedded miRNAs were DNM3OS (miR214; 1.7-fold down in both EO-PE and LO-PE) and RP6–99M1.2 (miR221/miR222; 1.6-fold down in EO-PE). [score:3]
[1 to 20 of 5 sentences]
59
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
In contrast, the miRNAs up-regulated in the liver (miR-199-3p, miR-199-5p, miR-21, miR-214 and miR-210) showed significantly higher levels in mouse serum at 12 weeks post infection (Fig. 2), however these failed to differentiate S. mansoni infected from uninfected humans (Fig. S4). [score:4]
As shown in Fig. 2, the levels of miR-192, miR-194 and miR-122 in serum do not change between 4–12 weeks post infection, whereas five of the miRNAs that are up-regulated in the liver are also significantly elevated in serum at 12 weeks post infection (p<0.05), ranging from 2.6 fold (miR-21) to 4.7 fold (miR-214) (Table S2). [score:4]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45]. [score:4]
The miRNAs that displayed the largest differential expression included miR-199a and miR-214, which are known to be altered in liver fibrosis caused by hepatitis C infection or induced by carbon tetrachloride [47], [48]. [score:3]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection. [score:3]
Thirty-three mouse miRNAs were differentially expressed in infected compared to naïve mice (>2 fold change, p<0.05) including miR-199a-3p, miR-199a-5p, miR-214 and miR-21, which have previously been associated with liver fibrosis in other settings. [score:2]
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
The 5 host miRNAs were detectable in serum (miR-21, miR-199-3p, miR-199-5p, miR-210, miR-214) but showed variable abundance and failed to differentiate ‘egg -positive’ and ‘egg -negative’ participants (Fig. S4). [score:1]
[1 to 20 of 8 sentences]
60
[+] score: 23
In ovarian cancer, 11 miRs were upregulated (miR-16, miR-20a, miR-21, miR-23a, miR-23b, miR-27a, miR-93, miR-141, miR-200a, miR-200b, and miR-200c) and 12 were downregulated (miR-10b, miR-26a, miR-29a, miR-99a, miR-100, miR-125a, miR-125b, miR-143, miR-145, miR-199a, miR-214, and let-7b). [score:7]
Mitra et al. found that, in ovarian CAFs, miR-31 and miR-214 are downregulated while miR-155 is upregulated compared to normal or tumor-adjacent fibroblasts [87]. [score:6]
The researchers compared the expression profiles of 8 miRs (miR-21, miR-141, miR-200a, miR-200b, miR-200c, miR-203, miR-205, and miR-214) between cancer tissues and exosomes collected from the peripheral sera of the corresponding patients, since these had been previously demonstrated to be overexpressed in ovarian cancer. [score:4]
Yang et al. showed that miR-214 induced cell survival and cisplatin resistance through direct targeting of PTEN and inactivation of the AKT pathway [66]. [score:4]
Yin et al. showed that TWIST1 regulated the IKK/NF- κB and PTEN/AKT pathways through the miR-199a-2/miR-214 cluster [63]. [score:2]
[1 to 20 of 5 sentences]
61
[+] score: 22
Four miRNAs (miR-144, miR-217, miR-424 and miR-214) were also reported to be down-regulated in HCC, and the supplement of their target gene E2F3a partially reversed the tumor suppressive effects of these miRNAs in HCC cells [50– 52]. [score:8]
The expression levels of miR-144, miR-141 and miR-214 were negatively correlated with E2F3 level, and overexpression of those miRNAs was found to inhibit proliferation of HCC cells [50, 68, 83]. [score:7]
Likewise, miR-214 was found to induce G1-S phase arrest by suppressing E2F3 -dependent cell cycle regulation [83]. [score:4]
Meanwhile, miR-217 was reported to function as a tumor suppressor in HCC progression and miR-217/E2F3 and miR-214/E2F3 axises may be potential candidates for developing rational therapeutic approaches [51, 83]. [score:3]
[1 to 20 of 4 sentences]
62
[+] score: 21
Other miRNAs from this paper: hsa-let-7e, hsa-let-7i, hsa-mir-200c, hsa-mir-497
Our results showed that downregulation of let-7i, let-7e and upregulation of miR-214 in A2780/CP compared with A2780. [score:6]
Consistent with other studies, we also found that let-7e and let-7i were among the top 10 downregulated miRNAs and miR-214 was upregulated in A2780/CP compared with A2780. [score:6]
In addition, miR-214 is involved in chemosensitivity by modulating PTEN expression, an important tumor suppressor gene [9]. [score:5]
B. - E. Relative expression levels of Let-7e, Let-7i, miR-214, and miR-497 in A2780 and A2780/CP cells were determined by Taqman qRT-PCR assay, and normalized to the U6 levels. [score:2]
The expression levels of miRNAs were analyzed using Taqman MicroRNA Assay Kits (Applied Biosystems, Foster City, CA) specific for hsa-Let-7e, hsa-Let-7i, hsa-miR-214, hsa-miR-497 precursors, p70S6K1 and mTOR mRNAs. [score:2]
[1 to 20 of 5 sentences]
63
[+] score: 21
During myogenesis it is up-regulated by SRFs and MEF2, and in a self-regulatory manner, it suppresses YY1 and HDAC4 translation by targeting their 3′-UTRs [48, 49]; miR-146a is another positive regulator of myogenesis, since it modulates the activity of NUMB protein, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling [55, 56]; miR-181 is involved in skeletal muscle differentiation and regeneration after injury and one of its targets is Hox-A11, which in turn represses transcription of MyoD [54]; miR-214 was identified in zebrafish as regulating the muscle development. [score:18]
Eisenberg et al. analyzing 10 primary muscular disorders (including DMD, BDM, LGMD and FSHD samples) have identified five miRNAs (miR-146b, miR-221, miR-155, miR-214, and miR-222) consistently deregulated in almost all samples taken into consideration, suggesting their involvement in common regulatory mechanisms. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 21
miR-214 upregulated in ovarian cancer can target PTEN tumor suppressor gene whereas down-regulated let-7 can target the RAS oncogene (8, 13), suggesting that miRNAs may have a role as novel class of oncogenes or tumor suppressor genes in ovarian cancer (14). [score:15]
miR-93, miR-141, miR-200 and miR-214 are frequently upregulated whereas miR-100, miR-143, miR-145 and let-7 are downregulated in ovarian carcinomas compared with normal counterparts (5– 9). [score:6]
[1 to 20 of 2 sentences]
65
[+] score: 20
Reference Number of samples/subtypes Method of analyses Main findingsIorio et al. (2007) 15 Normals/69 tumors 31 Serous/8 endometrioid/4 clear cells/9 poorly differentiated/1 mucinous miRNA microarray Ovarian cancer-specific miRNA signature Subtypes specific miRNA signature Epigenetic mechanism responsible for their aberrant expressionYang et al. (2008a) 10 Tumors and 10 “normal” HIOSE cell line miRNA microarray Ovarian cancer-specific miRNA signature miR-214 induces cell survival and cisplatin resistance through targeting PTENLaios et al. (2008) 3 Primary serous/3 recurrent serous tumors qRT-PCR miR-9 and miR-223 can be biomarkers in recurrent ovarian cancerNam et al. (2008) 22 Serous tumors/8 normals miRNA microarray Ovarian cancer-specific miRNA signatureZhang et al. (2008) 106 Tumors 109 Tumors 76 Tumors 504 Tumors miRNA microarray, aCGH, affymetrix cDNA microarray, tissue array, miRNAs are downregulated in malignant transformation and tumor progression Genomic copy number loss and epigenetic silencing account for miRNA dysregulation 96 Tumors qPCR validationDahiya et al. (2008) 34 Tumors and HOSE-B cell line miRNA microarray Ovarian cancer-specific miRNA signatureSorrentino et al. (2008) Drug-resistant vs. [score:9]
Yang et al. (2008a) identified 36 miRNAs differentially expressed between normal ovarian cells and tumors, including miR-199a*, miR-214, miR-200a which were found upregulated in 53, 56, and 43% tumor tissues respectively, and associated with high-grade and late-stage tumors. [score:6]
MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. [score:5]
[1 to 20 of 3 sentences]
66
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-199a-1, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-205, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-141, hsa-mir-144, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-146a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-29c, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-133b, hsa-mir-429, hsa-mir-487a, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-526b, hsa-mir-514a-1, hsa-mir-514a-2, hsa-mir-514a-3, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-542, hsa-mir-378d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-2114, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-514b, hsa-mir-378c, hsa-mir-4303, hsa-mir-4309, hsa-mir-4307, hsa-mir-4278, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The aberrantly expression miRNAs such as has-miR-214*, has-miR-105, has-miR-548n, and has-miR-514 which are upregulate in gastric cancerous tissues. [score:6]
However, only eight aberrantly expressed miRNAs (including has-miRplus-A1087, has-miR-542-3p, has-miR-141, has-miR-200c, has-miR-214, has-miR-29c, has-miR-378, and has-miR-128) were consistent with our findings. [score:3]
The inhibitor efforts of has-miR-214 had been reported in several types of tumors, including hepatocellular carcinoma, cholangiocarcinoma, and ovarian cancer [33– 35]. [score:3]
The expression level of miR-214* is increased 3.79-fold (Figure 4(a)), miR-105 is increased 16.32-fold (Figure 4(b)), has-miR-548 is 4.21-fold (Figure 4(c)), and miR-514 is increased 11.76-fold (Figure 4(d)) in comparing with normal tissues. [score:3]
has-miR-214 had multiple roles in regulating tumor cell characteristics, such as proliferation and migration by targeting p53 and β-catenin [36]. [score:2]
We selected hsa-miR-105, hsa-miR-214*, hsa-miR-514b, and has-miR-548n to test in 24 paired gastric normal and tumor tissues. [score:1]
Comparing with previous studies of miRNAs, we found that 21 among 31 genes have been reported in previous publications, for example, hsa-miR-105, hsa-miR-187, hsa-miR-214*, hsa-miR-656, and hsa-miR-487a. [score:1]
[1 to 20 of 7 sentences]
67
[+] score: 19
MiRNA families such as miR-200 (cfa-miR-200a, cfa-miR-200b and cfa-miR-200c), Mirlet-7 (cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7g and cfa-let-7f), miR-125 (cfa-miR-125a and cfa-miR-125b), miR-146 (cfa-miR-146a and cfa-miR-146b), miR-34 (cfa-miR-34a, cfa-miR-34b and cfa-miR-34c), miR-23 (cfa-miR-23a and cfa-miR-23b), cfa-miR-184, cfa-miR-214 and cfa-miR-141 were significantly up-regulated with testicular RA intervention via administration of CYP26B1 inhibitor and all-trans-RA (Figure 5). [score:6]
Up-regulated miRNAs (cfa-let-7, cfa-miR-200, cfa-miR-125, cfa-miR-34, cfa-miR-23, cfa-miR-146 clusters, cfa-miR-184 and cfa-miR-214) in adult canine testis treated with DMSO, RA or CYP26B1 inhibitor. [score:6]
In support of our findings, there is another study showed up-regulation of miR-214 in RA -induced differentiated ES cells [30]. [score:4]
Earlier studies [28], [29] reported that miR-214 in mice and mmu-miR-214 in pigs are significantly over-expressed in sexually immature testis compared to mature testis. [score:2]
However, our study has identified cfa-miR-214 as an RA pathway associated miRNA in canine spermatogenesis. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 18
We demonstrate that overexpression of these HMGA1 pseudogenes increases HMGA1 protein levels, and inhibits the suppression of HMGA1 protein synthesis by miRNAs that target the HMGA1 gene, namely, miR-15, miR-16, miR-214, and miR-761 [31- 34]. [score:9]
Figure 2 HMGA1P6 and HMGA1P7 are targeted by HMGA1 -targeting miRNAs (A) qRT-PCR analysis of HMGA1P6 (left), HMGA1P7 (middle) and HMGA1 (right) mRNA from the MCF7 cells transfected with scrambled-oligonucleotide, miR-15, miR-16, miR-214 and miR-761. [score:5]
Within the high homology regions, we found perfectly conserved seed matches for miRNAs that have been predicted (miR-103, miR-142-3p, miR-370, and miR-432) or already demonstrated (miR-15 [31], miR-16 [31], miR-26a [32], miR-214 [33], miR-548c-3p [34] and miR-761 [33]) to target the HMGA1 gene (Figure 1B and 1C). [score:3]
Relative luciferase activity in HEK293 cells transiently transfected with miR-15, miR-16, miR-214, miR-761 and a control scrambled oligonucleotide. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 17
Accordingly, miR-214 expression was recently shown to be directly linked to cell cycle rate. [score:4]
Decembrini and colleagues showed that miR-214 is one of four miRNAs that are highly expressed in fast cycling retinal progenitors in Xenopus governing cell fate decision and developmental timing [32]. [score:4]
The gene cluster composed of MDM288 and miR-214 belongs to the latter and was identified to be upregulated in both colonic loci. [score:4]
Cluster II consisted of miR-214 and MDM288 showing increased levels of expression in both colonic loci. [score:3]
In addition to miR-214 and MDM288, miR-19b, miR-23a, miR-24, miR-30b possessed increased expression in colon compared with other parts of the porcine intestine. [score:2]
[1 to 20 of 5 sentences]
70
[+] score: 16
Our results validate the down-regulation in EAC of mir-214 [11], which regulates expression of PTEN, a tumor suppressor gene that produces a protein with lipid and protein phosphatase function, antagonizing the PI3K/Akt pathway by dephosphorylation of phosphoinositides. [score:9]
Here we included the two miRNAs that were the most up-regulated in our previous study (mir-182 and mir-183) and one of the downregulated miRNAs (mir-214). [score:7]
[1 to 20 of 2 sentences]
71
[+] score: 16
In fact, growing evidence of indirect p53 deregulation in MM through MDM2 overexpression, TP53 promoter hypermethylation and alterations in certain miRNAs that directly or indirectly affect p53 expression, such as miR-25, miR-30d, miR-125a-5p and miR-214, have been reported. [score:9]
In this regard, we have also demonstrated that miR-214 activates p53 by targeting PSMD10 that encodes the oncoprotein gankyrin, which negatively regulates p53 by enhancing its proteasomal degradation [118]. [score:4]
Specifically, using gain-of-function experiments and luciferase reporter assays we observed that ectopic transfection of miR-214 decreased the level of gankyrin protein by directly targeting PSMD10 3′-UTR. [score:3]
[1 to 20 of 3 sentences]
72
[+] score: 16
miR-214 is induced by TGF-β and promotes fibrosis; it has been shown to down-regulate PTEN, up-regulate the AKT pathway and inhibit apoptosis of monocytes and macrophages. [score:9]
miR-214 is up-regulated in various mo dels of AKI and renal fibrosis [24, 45, 47] as well as in monocytes of animal with chronic kidney disease. [score:6]
Experimental antagonism of miR-214 has been shown to ameliorate renal fibrosis [24]. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 15
With the famous tumor suppressor, PTEN, as a bridge, hsa-miR-214 was involved in the regulatory balance between has-miR-21 and PTEN (26). [score:4]
As discussed in the differentially-expressed network, hsa-miR-21 and hsa-miR-214 are core biological factors in the cervical cancer network and therefore, the reoccurrence here strengthens the value of these particular miRNAs. [score:3]
miR-214 has been demonstrated to inhibit cell growth, migration and invasion (27). [score:3]
NFKB1 regulates hsa-miR-21, hsa-miR-214 and hsa-let-7b. [score:2]
The networks provide core effective systems in cervical cancer, particularly that of hsa-miR-214, PTEN and hsa-miR-21. [score:1]
TWIST1, hsa-miR-214, PTEN and hsa-miR-21 bind together as an ordered control chain. [score:1]
With the help of hsa-miR-21 and hsa-miR-214, NFKB1 takes part in the sub-system where PTEN and has-miR-21 act as cores. [score:1]
[1 to 20 of 7 sentences]
74
[+] score: 15