sort by

290 publications mentioning hsa-mir-182 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-182. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 511
Thus, we conclude the following: miR-182 is up-regulated in the EECs during the WOI, and it induces cell apoptosis by down -regulating the expression of PTN at both mRNA and protein levels; miR-182 plays a role in the development of endometrial receptivity by down -regulating PTN levels and up -regulating or maintaining the expression levels of OPN, COX-2 and PRLR in dairy goat EECs. [score:12]
In this study, the miR-182 mimics did not regulate the protein levels of PRLR in the EECs of dairy goats, but the miR-182 inhibitors down-regulated the levels, suggesting that miR-182 may be an essential factor to keep the expression of PRLR protein levels in the EECs of dairy goats. [score:9]
Bcl-2 protein expression levels were decreased significantly 48 h after treatment with miR-182 mimics (P < 0.01) and 72 h (P < 0.05), and the levels were significantly up-regulated after the EECs were treated with the miR-182 inhibitors at 72 h (P < 0.05). [score:8]
Confusingly, miR-182 inhibitors down-regulated the protein expression level of Bcl-2 at 48 h (P < 0.01) (Fig 12A). [score:8]
WB results further indicated that PTN was down-regulated by miR-182 in dairy goats at 48 h, however, inhibition of PTN protein expression by miR-182 disappeared at 72 h. And the reasoning behind that would be miR-182 mimics used in this study was an artificially synthesized mature miRNA with a shorter effective time; thus, its function may have reduced with time. [score:8]
We found that the COX2 protein levels were down-regulated by the miR-182 inhibitors, but the levels changed when the cells were treated with the miR-182 mimics, suggesting that miR-182 may be an essential factor to maintain the expression of COX2 protein levels in dairy goat EECs. [score:8]
Thus, we inferred that miR-182 may participate in regulating dynamic changes in goat uterine gene expression patterns via down-regulated PTN. [score:7]
Our previous sequencing data indicated that miR-182 expression was increased 15.55-fold in the receptive endometrium (RE, D15) compared with the pre-receptive endometrium (PE, D5) in dairy goats [30], and its predicted target gene, PTN, was down-regulated 20.97-fold [31]. [score:7]
After confirming the increase of miR-182 and the low abundance of PTN mRNA in the RE of healthy multiparous dairy goats, the psiCHECKTM-2 reporter plasmid, RT-qPCR, and Western blotting (WB) were used to confirm that miR-182 down-regulated the expression of PTN in EECs of dairy goats. [score:6]
In dairy goats, the VEGF protein levels were down-regulated by the miR-182 mimics, and the miR-182 inhibitors increased VEGF levels in the EECs. [score:6]
We verified for the first time that miR-182 induced EEC apoptosis by directly targeting the 3’ untranslated region of PTN. [score:6]
miR-182 down-regulated the expression level of PTN via the 3′ UTR. [score:6]
Therefore, we hypothesized that miR-182 down-regulates the expression of PTN in the endometrial cells of dairy goats. [score:6]
To explore the role of miR-182 in EECs, miR-182 mimics and inhibitors were used to perform miR-182 overexpression or knockdown, respectively. [score:6]
To determine whether miR-182 directly targets goat PTN through the predicted binding sites in the PTN 3′ UTR, the full-length 3′ UTR-containing miR-182 targeted sites were cloned and inserted downstream of the luciferase gene in the psiCHECKTM-2 reporter plasmid, and the mutated plasmids were constructed by inserting PTN-3′ UTR with the mutated miR-182 binding site (Fig 9A and 9B). [score:6]
Importantly, the predicted target site is also conserved, and miR-182 was found to directly target goat PTN through its 3′-UTR sequence. [score:6]
Overall, this study has shown that miR-182 is wi dely expressed in different tissues in dairy goats and that the expression levels are regulated by E2 and P4 in EECs. [score:6]
However, the miR-182 inhibitors had no effect on the mRNA expression levels at 24 h and 48 h (P > 0.05). [score:5]
Human PTN was predicted to be the target of miR-182 based on the information from Targetscan (www. [score:5]
The adherent cells were cotransfected with 0.5 μg of luciferase reporter and miR-182 mimics, miR-182 inhibitors, NC, or NC inhibitors (100 nM). [score:5]
In the present study, miR-182 decreased the expression of total AKT protein levels at both the 48 h and 72 h time points, and the miR-182 inhibitors increased the levels at 72 h (Fig 11A). [score:5]
0179783.g006 Fig 6 The cell cycle analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D). [score:5]
In this study, we found that the miR-182 mimics increased the Caspase-3 protein levels at 48 h, and miR-182 inhibitors decreased the levels of Caspase-3. Furthermore, Schulte reported a retroviral SP1 binding site in the PTN promoter is important for the expression in human choriocarcinoma cells [115]. [score:5]
In this study, EECs treated with the miR-182 mimics exhibited an obvious decrease in SP1 expression after 72 h. This result suggested that miR-182 may regulate SP1, but the specific molecular regulation mechanism needs further study. [score:5]
Furthermore, the expression levels of miR-182 in various tissues of dairy goats were studied, and miR-182 was found to be wi dely expressed in different tissues at both biophysical stages. [score:5]
We found that miR-182 decreased the expression of total AKT protein levels both at 48 h (P < 0.05) and 72 h (P < 0.05), and the miR-182 inhibitors increased AKT levels at 72 h (P < 0.05, Fig 11A). [score:5]
The miR-182 mimics decreased VEGF protein levels in EECs at 48 h (P < 0.05) but not at 72 h (P > 0.05), and the miR-182 inhibitors increased VEGF protein levels at 72 h but not 48 h (Fig 13B), suggesting that the miR-182 mimics and inhibitors exert their effects on different timelines. [score:5]
0179783.g007 Fig 7 The cell apoptosis analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D). [score:5]
And the result showed that overexpression of miR-182 dramatically decreased the mRNA levels of PTN at 48 h; in contrast, miR-182 inhibition increased PTN levels in EECs. [score:5]
The wild-type (psiCHECK-PTN-UTR-WT) or mutated (psiCHECK-PTN-UTR-Mut) plasmids were co -transfected with either the miR-182 mimics, miR-182 inhibitors, NC, or NC -inhibitors into HEK293T cells. [score:5]
The cell apoptosis analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D). [score:5]
EEC cells were plated at a density of 7.5×10 [5] in 6-well plates, seventy percent confluent cells were transfected with miR-182, miR-182 inhibitors, NC, and NC -inhibitors at final concentrations of 100 nM using the X-tremeGENE siRNA Transfection Reagent (Roche, Switzerland) according to the manufacturer′s protocols. [score:5]
In this study, we found that the miR-182 mimics increased the Caspase-3 protein levels at 48 h, and miR-182 inhibitors decreased the levels of Caspase-3. Furthermore, Schulte reported a retroviral SP1 binding site in the PTN promoter is important for the expression in human choriocarcinoma cells [115]. [score:5]
The expression levels of FAS were not affected in miR-182 inhibitors -treated EECs at 48 h (P < 0.01). [score:5]
Briefly, the cells were seeded in 96-well plates at a density of 2×10 [3] cells/well; the cells were transfected with miR-182, miR-182 inhibitors, NC, and NC inhibitors, and then were incubated at 37°C in a 5% CO [2] incubator for 24 h after the cells adhered to the plate; and then the MTT reagent (0.5 mg/mL) were added into 96-well plates and incubated for 4h. [score:5]
The cell cycle analysis of EEC were made after the cells were transfected with miR-182 mimic (A); NC (B); miR-182 inhibitor (C); NC inhibitor (D). [score:5]
We transfected EECs with a miR-182 mimics, miR-182 inhibitors, NC (negative control), or NC -inhibitors at a cell density of 80–90% using Lipofectamine 2000. [score:5]
miR-182 regulates the expression of PTN-related genes. [score:4]
We further investigated whether miR-182 down-regulated the expression levels of PTN in EECs of dairy goats. [score:4]
In addition, miR-182 may be an essential factor for the regulation of the expression of OPN, COX2 and PRLR protein levels in dairy goat EECs. [score:4]
After confirming the high abundance of miR-182 and low levels of PTN mRNA in the RE of goats, we further investigated if miR-182 down-regulates the expression levels of PTN in EECs. [score:4]
The miR-182 levels were down-regulated when the cells were treated with combination of E2 and P4 (Fig 3). [score:4]
Moreover, it is known that miR-182 up-regulated in various cancer type [16, 80, 81], striking similarities are present between the behavior of placental cells during the WOI and that of cancer cells [82]. [score:4]
Several studies have reported that miR-182 up-regulated in various cancer types, including prostate cancer [15, 16], glioblastoma [12], hepatocellular carcinoma [17]. [score:4]
What’s more, miR-182 could promote cellular differentiation by regulating the expression of snail family transcriptional repressor 2 (SNAI2) and induce the mesenchymal-to-epithelial transition [18]. [score:4]
Therefore, we inferred that miR-182 may participate in regulating dynamic changes in goat uterine gene expression patterns that occur during the transition from the pre-receptive to the receptive phase. [score:4]
miR-182 regulates PTN expression in EECs. [score:4]
The OPN protein levels were up-regulated at both 48 h and 72 h (P < 0.05) in miR-182 mimics -treated EECs. [score:4]
No statistical differences were found in COX-2 levels between the miR-182 mimics and NC in EECs at either 48 h or 72 h (P > 0.05), but COX-2 expression levels in the EECs were significantly decreased 48 h and 72 h after treatment with the miR-182 inhibitors compared with NC (P < 0.05). [score:4]
miR-182 down-regulated the PTN in endometrial epithelium cells (EECs). [score:4]
miR-182 regulates the expression of endometrial receptivity marker genes. [score:4]
In his study, an MTT assay showed that the miR-182 mimics inhibited and miR-182 inhibitors promoted the proliferation of EECs (Fig 5), although the differences were not significant (P > 0.05). [score:4]
Furthermore, the upstream proteins of Bcl-2, MAPK (p44/42) and p-MAPK (p44/42), were also monitored by WB, and these results showed that miR-182 decreased the total MAPK levels at 72 h. Because of their key role in cell signalling, a rigorous regulation of MAPKs is essential in eukaryotic physiology [105], p-MAPKs target different downstream effectors that lead to changes in transcriptional programs [106]. [score:4]
miR-182 regulates AKT expression in EECs. [score:4]
In this study, MTT assay (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide) showed that miR-182 mimics inhibited cell proliferation and miR-182 inhibitors promoted cell proliferation, but the differences were not statistically significant in EEC cells (Fig 5). [score:4]
Thus, we proposed that the expression of Bcl-2 family proteins may be altered under miR-182 conditions in EECs. [score:3]
miR-182 was first identified as a retina-specific miRNA, with its expression abundantly increasing postnatally and reaching the peak in adult retina [14]. [score:3]
Therefore, changes in OPN, VEGF, COX-2 and PRLR protein levels were investigated in EECs after they were treated with miR-182 mimics, miR-182 inhibitors, NC (negative control), or NC -inhibitors. [score:3]
The present study shows that miR-182 is wi dely expressed in different tissues in dairy goats, and the levels vary in association with the concentrations of E2 and P4 in EECs. [score:3]
The effect of E2/P4 on the expression levels of miR-182 in EEC. [score:3]
Expression levels of miR-182 in endometrium at D5 and D15. [score:3]
The expression of miR-182 in dairy goats. [score:3]
Thus, the induction of miR-182 may be a critical event for the development of endometrial receptivity, and this induction may be regulated by E2 and P4. [score:3]
The miR-182 mimics increased the protein expression levels of FAS in EECs at 48 h (P < 0.01) and 72 h (P < 0.05) (Fig 12D). [score:3]
The effect of E2/P4 on the expression levels of miR-182 in EECs. [score:3]
Based on the above information, the EEC surface morphology was observed by scanning electron microscopy after the cells were transfected with a miR-182 mimics or inhibitors in this study. [score:3]
Furthermore, the protein levels of Bcl-2, FAS, MAPK, Caspase-3, SP1, and other marker genes of endometrial receptivity (OPN, VEGF, COX-2, PRLR) were analyzed in EECs that were treated with a miR-182 mimics or inhibitors. [score:3]
We screened target genes for miR-182 using microRNA. [score:3]
The expression of total MAPK and p-MAPK proteins were detected, and these data showed that miR-182 decreased the MAPK protein levels in EECs at 72 h (Fig 12B). [score:3]
The apoptosis rate of EECs treated with a scrambled miR-182 mimics was 15.76%, and this rate decreased to 7.58% upon treatment with miR-182 inhibitors, suggesting that miR-182 induces EEC apoptosis in this study. [score:3]
In the present study, we found lower levels of BCL-2 protein in the miR-182 -treated EECs, suggesting that miR-182 might induce EEC apoptosis by decreasing Bcl-2 expression. [score:3]
Thus, cell proliferation, cell cycle and apoptosis events of EECs were also analyzed after treatment with a miR-182 mimics or inhibitors. [score:3]
Furthermore, EECs treated with a miR-182 inhibitors became round, the microvilli on the surface of the cell membrane disappeared, and the cell membrane sprouted and formed apoptotic bodies. [score:3]
Notably, the expression levels of FAS increased in miR-182 treated EECs at protein levels in dairy goats. [score:3]
Primer sequences(5′→3′) GADPH AF_030943.1 F: GCAAGTTCCACGGCACAG R: GGTTCACGCCCATCACAA PTN XM_005679509.1 F: TCTCCATTTCCCTTCCTTCC R: TCTCTCTCCACTTCGGCTTT PTN XM_005679509.1F: GC CTCGAGGACCGTGAAAAGGACATCR: GC GCGGCCGCCAGCATCACCTTGATTTA 18S / F: GTGGTGTTGAGGAAAGCAGACA R: TGATCACACGTTCCACCTCATC U6 / F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT miR-182-Loop / gtcgtatccagtgcagggtccgaggtattcgcactggatacgacAGTGTGAG miR-182-FW / ggTGAAAAGTTCGTTCGG Reverse Primer / GTGCAGGGTCCGAGGT Note: the underscore characters were restriction enzyme cutting site of xho І and not І. A mature miR-182 mimics (5’-TTTGGCAATGGTAGAACTCACACT-3’) and inhibitors (5’-AGUGUGAGUUCUACCAUUGCCAAA-3’), a nonspecific control (NC) and NC -inhibitors were synthesized by GenePharma (Shanghai, China). [score:3]
In the present study, the expression level of miR-182 in the PE was remarkably higher than that in the RE (Fig 2), which was inconsistent with the previous sequencing data [30]. [score:3]
Further study showed that miR-182 displayed a diurnal variation in the retina of mice, revealed its role in retina development and the regulation of mammalian circadian rhythm [69]. [score:3]
After being treated with miR-182 mimics or miR-182 inhibitors for 48 h, EEC cells were collected and incubated with Annexin V-FITC and PI at room temperature for 5 min in the dark. [score:3]
The effect of E2 and P4 on the expression levels of miR-182 in endometrial epithelium cells (EECs). [score:3]
What’s more, miR-182 is demonstrated to function either as a tumor suppressor or an oncomir in various human cancers [12, 17, 70]. [score:3]
Furthermore, miR-182 also decreased p-AKT protein levels at 48 h (P < 0.05), and the miR-182 inhibitors increased p-AKT levels at both 48 h (P < 0.05) and 72 h (P < 0.05, Fig 11B). [score:3]
The results showed that miR-182 expression level in the RE was higher (Fig 1) than that in the PE using either reference, which was inconsistent with previous sequencing data. [score:3]
Meanwhile, miR-182 decreased the p-AKT protein levels at 48 h, and the miR-182 inhibitors increased the levels at both 48 h and 72 h (Fig 11B). [score:3]
We confirmed the high abundance of miR-182 and the lower levels of PTN in the receptive endometrium of goats and miR-182 directly regulates PTN through its 3′UTR. [score:3]
However, cells treated with miR-182 inhibitors became significantly shrinked and gradually became round shape with poorly adhesion (Fig 4). [score:3]
In addition, an Annexin V-FITC/PI assay combined with flow cytometry 48 h after transfection with miR-182 mimics or inhibitors, NC or NC- inhibitors showed increased apoptosis of EECs (Fig 7A–7D) upon treatment with the miR-182 mimics compared with NC. [score:3]
This result suggested that the expression levels of miR-182 were affected by sex hormones in EECs. [score:3]
In addition, miR-182 inhibitors did not affect SP1 protein levels at either the 48 h or 72 h time points in EECs. [score:3]
However, cells treated with a miR-182 inhibitors became round, the microvilli on the surface of the cell membrane disappeared, and the cell membrane sprouted (buds) and formed apoptotic bodies (Fig 4). [score:3]
The contours of miR-182 mimic -transfected EEC cells are clear and microvilli regularly distributed on the surface; after the EEC cells were transfected with miR-182 inhibitor, cells became significantly shrinked and gradually became round shape with poorly adhesion. [score:3]
The miR-182 inhibitors decreased Caspase-3 levels at 48 h (P < 0.05) and 72 h (P < 0.05). [score:3]
miR-182 was expressed in various tissues of dairy goats. [score:3]
The expression levels of miR-182 were significantly enhanced with the constituents of E2, and the highest level was 10 nM in this study. [score:3]
Surprisingly, both the miR-182 mimics and inhibitors increased the p-MAPK levels at 48 h (P < 0.01) and decreased at 72 h (P < 0.05, Fig 12C). [score:3]
The expression levels of miR-182 were significantly enhanced in a concentration -dependent manner, with the highest level observed in the presence of P4 alone with 1 nM. [score:3]
In addition, an Annexin V-FITC/PI assay combined with flow cytometry 48 h after transfection with miR-182 mimics, miR-182 inhibitors, NC or NC -inhibitors showed that EEC apoptosis (Fig 7) increased upon the introduction of miR-182 mimics compared with NC. [score:3]
This study is the first to our knowledge that the expression levels of miR-182 are affected by sex hormones in the EECs of dairy goats. [score:3]
miR-182 directly regulates PTN through its 3′ UTR. [score:3]
miR-182 affects the expression of apoptosis-related genes. [score:3]
And the results showed that there was a target site for miR-182 in the 3′UTR PTN of mRNA. [score:3]
Furthermore, this study showed extensive expression of miR-182 in other tissues, especially in the kidney at D5 and oviduct at D15. [score:3]
Furthermore, the miR-182 inhibitors decreased PRLR protein levels at 72 h (P < 0.05) in EECs (Fig 13D), but no significant difference in PRLR protein level was found with the mimics (P > 0.05). [score:3]
Thus, we detected the protein levels of OPN in EECs and found that miR-182 significantly increased OPN protein levels in EECs, and the levels decreased after treatment with the miR-182 inhibitors. [score:3]
In addition, miR-182 inhibitors decreased OPN levels at 48 h and 72 h (P < 0.05, Fig 13A). [score:3]
The wild-type (psiCHECK-PTN-WT) or mutated (psiCHECK- PTN-UTR-Mut) plasmid was co -transfected with the miR-182 mimics or inhibitors into 293T cells. [score:3]
The apoptosis rate of EECs treated with the scrambled miR-182 mimics was 15.76%, and the apoptosis rate decreased to 7.59% when treated with the miR-182 inhibitors. [score:3]
These results confirm that miR-182 targets goat PTN. [score:3]
0179783.g004 Fig 4 The contours of miR-182 mimic -transfected EEC cells are clear and microvilli regularly distributed on the surface; after the EEC cells were transfected with miR-182 inhibitor, cells became significantly shrinked and gradually became round shape with poorly adhesion. [score:3]
Nevertheless, the transcriptional regulation of miR-182 as well as its role in EECs during WOI is not clear. [score:2]
miR-182 regulates proliferation, cell cycle, and apoptosis in EECs. [score:2]
Total RNAs were extracted and stem-loop qRT-PCR was used to validate the expression levels of miR-182 compared with the 18S rRNA and U6 reference controls in the dairy goat endometrium. [score:2]
The nucleotides in red represented “seed sequence” of miR-182, the mutation nucleotides were in yellow color. [score:2]
0179783.g010 Fig 10 (A) miR-182 down-regulated the PTN mRNA levels in EEC, PTN mRNA levels were measured by RT-qPCR and normalized to GAPDH. [score:2]
After co-transfection with the plasmids, the luciferase activity of the miR-182 group was significantly lower than that of the NC group (P < 0.01) after 48 h after transfection, and this reduction was rescued in the mutation groups (Fig 9C). [score:2]
Our previous study indicated that miR-182 was a differentially expressed miRNA and had a 15.55-fold increase in the receptive endometrium (RE) compared with the pre-receptive endometrium (PE) in dairy goats [30]. [score:2]
PTN protein levels were significantly decreased in miR-182 -transfected cells compared with NC at both 48 h and 72 h (P < 0.05), and miR-182 inhibitors significantly increased PTN levels in EECs at 48 h (P < 0.01) but not at 72 h (P > 0.05). [score:2]
2015; 5. 17 Du C, Weng X, Hu W, Lv Z, Xiao H, Ding C, et al Hypoxia-inducible MiR-182 promotes angiogenesis by targeting RASA1 in hepatocellular carcinoma. [score:2]
miR-182 regulated cell proliferation, cycle and apoptosis of EEC. [score:2]
Our previous sequencing data have indicated that miR-182 is a differentially expressed miRNA with a 15.55-fold increase in the RE compared with the PE of dairy goats [30]. [score:2]
miR-182 regulates the phosphorylation of AKT. [score:2]
0179783.g003 Fig 3 The effect of E2 and P4 on the expression levels of miR-182 in EEC were measured by Stem-loop RT-qPCR and normalized to 18S. [score:1]
The effect of miR-182 on the cell apoptosis of endometrial epithelium cells (EECs). [score:1]
Thus, the protein levels of Bcl-2, FAS, MAPK, Caspase-3, and SP1 were detected in the EECs treated with miR-182. [score:1]
The miR-182 mimics increased the Caspase-3 protein levels at both 48 h (P < 0.05) and 72 h (P > 0.05) in EECs (Fig 12E). [score:1]
This result suggested that miR-182 may be indispensable for the establishment of endometrial receptivity in dairy goats. [score:1]
miR-182 affected the surface microtopography of EEC. [score:1]
To determine whether the anti-proliferative effect of miR-182 was due to cell cycle disruption, flow cytometry was used to analyze changes in the cell cycle. [score:1]
The effect of miR-182 on some marker protein of endometrial receptivity in endometrial epithelium cells (EECs). [score:1]
The mRNA levels of PTN significantly decreased at both 24 h (P < 0.01) and 48 h (P < 0.05) after the EEC was transfected with the miR-182 mimics (Fig 10A). [score:1]
Together with its family members (miR-96 and miR-183), miR-182 was described in mouse neurosensory cells, specifically in the retina, inner ear, and dorsal root ganglia [12– 14]. [score:1]
The distribution of cells in the different phases of the cell cycle did not significantly change following miR-182 exposure in EECs (Fig 6), suggesting that miR-182 did not cause EEC cell cycle arrest under the conditions described. [score:1]
The effect of miR-182 on the surface microtopography of endometrial epithelium cells (EECs). [score:1]
miR-182 may participate in the formation of endometrial receptivity. [score:1]
The present report for the first time studies the effect of miR-182 on apoptosis-related proteins (Bcl-2, FAS, and Caspase-3) in the EECs of dairy goats. [score:1]
The effect of miR-182 on the surface morphology of EEC was detected by SEM (Scanning Electron Microscopy) [38]. [score:1]
The miR-182 levels in endometrium at D5 and D15 were detected by stem-loop qRT-PCR, 18S rRNA (A) and U6 (B) were used as the references. [score:1]
The above results suggest that, and we sought to analyze AKT protein levels after the cells were treated with miR-182. [score:1]
On the surface of cells treated with miR-182, we observed microridges with uniform and regularly-distributed microvilli. [score:1]
The effect of miR-182 on the cell cycle of endometrial epithelium cells (EECs). [score:1]
The effect of miR-182 on the surface morphology of EECs. [score:1]
The effect of miR-182 on AKT and p-AKT levels in endometrial epithelium cells (EECs). [score:1]
This study suggested that miR-182 induced EECs apoptosis. [score:1]
Furthermore, the miR-182 mimics decreased SP1 protein levels at 48 h (P < 0.05) in EECs (Fig 12F), but the difference was not significant at 72 h (P > 0.05). [score:1]
To investigate the response of miR-182 expression levels on sex hormones in EECs, β-estradiol (E2) and progesterone (P4) were diluted in cell medium to different concentrations. [score:1]
0179783.g001 Fig 1 The miR-182 levels in endometrium at D5 and D15 were detected by stem-loop qRT-PCR, 18S rRNA (A) and U6 (B) were used as the references. [score:1]
The effect of miR-182 on PTN-related protein levels in endometrial epithelium cells (EECs). [score:1]
Stem-loop qPCR was used to detect the transfection efficiency of miR-182 in this study [34]. [score:1]
On the surface cells treated with mimics of miR-182, microridges with uniform and regularly distributed microvilli were observed. [score:1]
The DNA contents of miR-182 -treated or control NC cells were quantitated for cell cycle analysis. [score:1]
To investigate the response of miR-182 expression levels to sex hormones in EECs, E2 and P4 were diluted in cell medium to different concentrations. [score:1]
The highest level of miR-182 was observed after treatment with 1 nM P4. [score:1]
The effect of E2 and P4 on the expression levels of miR-182 in EEC were measured by Stem-loop RT-qPCR and normalized to 18S. [score:1]
The effect of miR-182 on the proliferation of endometrial epithelium cells (EECs). [score:1]
To determine whether the anti-proliferative effect of miR-182 is due to cell cycle disruption, flow cytometry was used to analyze the changes in the cell cycle in EECs. [score:1]
The distribution of cells in the different phases of the cell cycle did not significantly change after miR-182 exposure in EECs (Fig 6), suggesting that miR-182 does not cause EEC cell cycle arrest under the conditions described. [score:1]
[1 to 20 of 155 sentences]
2
[+] score: 425
Other miRNAs from this paper: hsa-mir-21, hsa-mir-216a
Reciprocally, miR-182 inhibition in EpRas by the oligonucleotide inhibitor resulted in CDH1 up-regulation, as well as CDH2 and Vimentin suppression (Fig. 3a). [score:10]
Concordantly, miR-182 overexpression in SCP28 enhanced PTHLH expression and secretion of SCP28 following TGFβ treatment, as well as Rankl expression of the pre-osteoblast C2C12 cells when cultured in SCP28 conditioned medium, while SMAD7 or the TGFβ inhibitor SB431542 abrogated such effects of miR-182 (Fig. 5f, Supplementary Fig. 10A,B). [score:9]
Western blot and immunofluorescence analyses showed that miR-182 inhibition resulted in upregulation of SMAD7 protein, and suppressed the changes of EMT markers in response to TGFβ in the cancer cells (Fig. 4a,b). [score:8]
To determine whether SMAD7 was regulated by miR-182 endogenously, we analysed miR-182 expression levels in the breast and lung cancer cell lines (Supplementary Fig. 2A) and assessed the effects of miR-182 overexpression or inhibition in these cells. [score:8]
Taken together, these data indicate that miR-182 target SMAD7 for translational inhibition. [score:7]
To corroborate that SMAD7 suppression mediates the role of miR-182 in cancer cell TGFβ responses, we treated EpRas cells with a SMAD7 siRNA inhibitor (Supplementary Fig. 8A) in addition to TGFβ stimulation and miR-182 inhibition. [score:7]
The linkage of miR-182 expression with the SMAD7 protein, but not with the SMAD7 mRNA, was concordant to our observation that miR-182 targeted SMAD7 to suppress its protein level (Fig. 2b,c). [score:7]
Concordant to the difference in bone damages, there were significantly more osteoclasts along the tumour–bone interface when the tumour cells overexpressed miR-182, and this increment was suppressed by SMAD7 overexpression (Fig. 6d,e). [score:7]
Noticeably, our data showed that although miR-182 was required for TGFβ -induced EMT, its overexpression only led to modest changes in the expression of EMT markers (Fig. 3a), and the regulation in cancer cell morphology was not obvious (Supplementary Fig. 4A). [score:6]
Since miR-182 suppressed TGFβ -induced upregulation of SMAD7, we reasoned that this miRNA could be critical for cancer cell responses to TGFβ. [score:6]
Taken together, these data suggest that miR-182 upregulates cancer cell response to microenvironmental TGFβ and bone metastasis by suppressing SMAD7. [score:6]
Thus, miR-182 is both a downstream target of TGFβ and a direct suppressor of SMAD7 in these cancer cell lines. [score:6]
Meanwhile, miR-182 inhibition with the oligonucleotide or the sponge inhibitor significantly impaired the migration and invasion of MCF10AT, EpRas, SCP28 and NCI-H1299 cells (Fig. 3c,d). [score:5]
In addition, re-introducing miR-182 into the cells by overexpression rescued the impaired cell migration caused by miR-182 inhibition (Fig. 3c). [score:5]
Therefore, the positive feedback loop of TGFβ signalling and miR-182 expression seems to be disconnected in normal epithelial cells, although the mechanism of insensitivity of miR-182 expression to TGFβ treatment in these cells is unclear. [score:5]
Altogether with the fact that miR-182 suppresses SMAD7 specifically at the protein level, this could explain the apparent disassociation of SMAD7 mRNA and protein expression following TGFβ treatment. [score:5]
To further validate the role of miR-182 in bone metastasis of cancer cells, SCP28 cells with concurrent overexpression of miR-182 and its target genes were injected intratibially into the bone marrow of mice, followed by analyses of tumour growth and bone damage. [score:5]
The SMAD7 protein level was effectively suppressed, along with the manifest changes of EMT markers and cellular morphology after TGFβ stimulation, despite the inhibition of miR-182 (Fig. 5a,b). [score:5]
miR-182 is induced by TGFβ and suppresses SMAD7 translation. [score:5]
We further found that these cancer cells achieved this via TGFβ -induced expression of miR-182, which suppressed SMAD7 and thus endorsed the extended activation of TGFβ signalling leading to EMT and metastasis. [score:5]
Notably, miR-182 selectively inhibits the protein level of SMAD7, but not its transcript level, which was confirmed by our expression analysis of clinical samples. [score:5]
The median miR-182 expression level of the whole cohort was used as the cutoff to stratify all patients or the patients of luminal or triple negative subtypes into two groups with high or low expression of miR-182. [score:5]
Error bars are defined as s. d. (a) Protein expression of EMT markers and SMAD7 in EpRas and MCF10AT cells after TGFβ stimulation and miR-182 inhibition. [score:5]
We analysed the expression of miR-182 in clinical breast tumour samples of The Cancer Genome Atlas (TCGA) database and found that miR-182 expression was significantly higher in breast tumours than in normal tissues. [score:5]
A direct comparison of paired tumour and normal tissues of the same patients also revealed upregulation of miR-182 in most of the cases (Fig. 7b). [score:5]
Therefore, miR-182 suppresses SMAD7 expression at its protein level. [score:5]
First we confirmed that miR-182 was still overexpressed in the metastasis tumours caused by miR-182 -overexpressing cancer cells (Supplementary Fig. 11A). [score:5]
While miR-182 suppression led to SMAD7 induction on TGFβ treatment and abolished TGFβ -induced EMT phenotypes, simultaneous treatment with the SMAD7 inhibitor restored cancer cell responses to TGFβ. [score:5]
The inhibition efficacy of the sponge was validated with 3′UTR of a known miR-182 target gene MTSS1 (ref. [score:5]
In addition, our data demonstrated the aberrant up-regulation of miR-182 and its negative correlation with SMAD7 protein in tumours samples. [score:4]
miR-182 was upregulated and negatively correlated with SMAD7 protein in clinical breast tumours. [score:4]
miR-182 not only regulates TGFβ signalling by targeting SMAD7, but also is responsive to TGFβ signalling, thus constituting a self-enhancing circuit of the pathway. [score:4]
miR-182 directly targets SMAD7 and is induced by TGFβ. [score:4]
In addition, we found that miR-182 neither upregulated the E3 ligase of SMAD7, Arkadia 24, nor changed the ubiquitination status of SMAD7 protein (Supplementary Fig. 3). [score:4]
Although we did not observe obvious morphological changes in cancer cells after miR-182 overexpression (Supplementary Fig. 4A), the EMT marker proteins, namely CDH1, CDH2 and Vimentin, were modestly regulated by miR-182. [score:4]
Error bars are defined as s. d. (a) Luciferase reporter assays of SMAD7 wild-type and mutated 3′UTR with miR-182 overexpression and inhibition (n=4). [score:4]
Therefore, SMAD7 3′UTR is a direct target of miR-182. [score:4]
Log-ratios of miR-182 expression were shown. [score:3]
Therefore, miR-182 was a much less potent inducer of EMT than TGFβ itself, suggesting that SMAD7 suppression alone was not sufficient for fully activation of TGFβ signalling. [score:3]
Notably, miR-182 inhibition also quenched the morphological shift of cancer cells induced by TGFβ. [score:3]
qPCR analysis of miR-182 expression in these tumour samples were first validated by in situ hybridization analysis with a miR-182 probe (Fig. 7d). [score:3]
More importantly, with forced expression of SMAD7, miR-182 caused no obvious difference in the formation of bone metastases (Fig. 6a–c). [score:3]
HeLa cells were co -transfected with the miR-182 -expressing plasmid or control vector, the indicated firefly luciferase reporter plasmids and a renilla luciferase plasmid with a ratio of 2:2:1. Lysates were collected 72 h after transfection. [score:3]
miR-182 was stably overexpressed in SCP28, 4T1 and A549 (Supplementary Fig. 2B). [score:3]
Primary marrow was cultured in the conditioned medium from SCP28 cells with miR-182 and/or SMAD7 overexpression and osteoclast maturation was assessed by tartrate-resistant acid phosphatase (TRAP) staining. [score:3]
In addition to the observations of molecular and morphological changes, miR-182 silencing effectively suppressed cell migration and invasion caused by TGFβ in EpRas, MCF10AT, SCP28 and NCI-H1299. [score:3]
Notably, miR-182 overexpression was able to augment cancer cell response to TGFβ for osteoclast induction. [score:3]
miR-182 promotes EMT and invasion by suppressing SMAD7. [score:3]
The miR-182 -overexpressing or control SCP28 cells were intracardially injected into the circulation of nude mice followed by bioluminescent imaging of bone metastasis. [score:3]
The suppression of SMAD7 by miR-182 indicated that miR-182 might play a role in cancer cell EMT, migration and invasion. [score:3]
TGFβ treatment induced the SBE reporter activity, and miR-182 overexpression further enhanced the response. [score:3]
Although we did not observe obvious differences of SMAD7 mRNA levels in the tumours expressing high or low levels of miR-182 (Fig. 7e), the SMAD7 protein level was significantly lower in the samples with abundant miR-182. [score:3]
In addition, treatment of the cells with an oligonucleotide inhibitor of miR-182 effectively restored the luciferase activity of SMAD7 3′UTR (Fig. 2a). [score:3]
Reciprocally, we stably overexpressed both SMAD7 and miR-182 in SCP28 (Supplementary Fig. 8C), followed by TGFβ treatment. [score:3]
However, when the tumours were histologically examined, we observed markedly enhanced invasiveness of the miR-182 -expressing tumours. [score:3]
miR-182 overexpression significantly accelerated the outgrowth of cancer cells in bone, and caused more severe bone damages (Fig. 6a–c). [score:3]
With forced expression of SMAD7, miR-182 was no longer able to boost the cancer cell invasion after TGFβ stimulation (Fig. 5c). [score:3]
We then used a sponge construct 23 to inhibit miR-182 in the lung adenocarcinoma cell line NCI-H1299. [score:3]
Collectively, our data support the conclusion that miR-182 targets SMAD7 to enhance TGFβ signalling in cancer cell lines and human tumour samples. [score:3]
Previously it was reported that miR-182 expression could be induced by TGFβ in gallbladder cancer and glioma cells 19 25. [score:3]
SMAD7 overexpression completely blocked such effects of miR-182. [score:3]
10), were enhanced by miR-182 and suppressed by SMAD7 in SCP28 as well. [score:3]
The uncovering of this TGFβ-miR-182 circuit will extend our comprehension of TGFβ network complexity and argue for miR-182 as a new option to target TGFβ signalling for cancer intervention. [score:3]
Additionally, miR-182 and SMAD7 led to opposite changes in the level of SMAD3 phosphorylation and PTHLH expression in bone metastases (Fig. 6d; Supplementary Fig. 11B). [score:3]
Then, we analysed the consequences of miR-182 and SMAD7 overexpression in breast cancer bone metastasis in vivo. [score:3]
Error bars are defined as s. d. (a) Protein levels of EMT markers and SMAD7 in cancer cells after miR-182 overexpression or silencing. [score:3]
However, SMAD7 expression completely blocked the effect of miR-182 in osteoclast maturation after TGFβ treatment (Fig. 5e). [score:3]
In addition, it is also noticed that SMAD7 overexpression failed to completely block cancer cell TGFβ responses as revealed by SBE activity, osteoclast differentiation and PTHLH induction (Fig. 5d–f), implying a SMAD7-independent mechanism for the oncogenic role of miR-182 and the TGFβ response of cancer cells. [score:3]
Concordantly, miR-182 silencing with oligonucleotide or sponge inhibitors reactivated the self-limiting signal of the TGFβ pathway and impaired cancer cell responses in morphological transformation and microenvironment remo delling. [score:3]
In this study we, for the first time, report a role of miR-182 in targeting SMAD7 to enhance TGFβ signalling and metastasis. [score:3]
In the presence of miR-182 inhibitors, TGFβ failed to enhance the motility or invasiveness of cancer cells (Fig. 4d,e). [score:3]
In A549 cells, the overexpression of miR-182 led to a slight reduction of CDH1 and induction of CDH2 and Vimentin. [score:3]
Although SMAD7 mRNA was not obviously affected by miR-182 (Fig. 2b), a significant reduction of SMAD7 protein abundance was observed on miR-182 overexpression in these cancer cells (Fig. 2c). [score:3]
Previously we also showed that miR-182 expression was linked to elevated risk of metastasis in breast cancer patients 23. [score:3]
Forced expression of miR-182 markedly enhanced the transwell invasiveness of SCP28 to a similar extent of TGFβ treatment (Fig. 3b). [score:3]
Importantly, in the presence of SMAD7 overexpression, miR-182 failed to enhance the SBE response to TGFβ (Fig. 5d). [score:3]
In contrast, MTSS1, the other miR-182 target gene that also mediates the pro-invasive function of miR-182 (ref. [score:3]
Error bars are defined as s. d. (a) Protein levels of EMT markers and SMAD7 in EpRas with TGFβ stimulation, miR-182 inhibition and SMAD7 silencing. [score:3]
In addition, treating MCF10AT and EpRas with an anti-miR-182 oligonucleotide inhibitor 23 elevated the protein level of SMAD7 but did not affect its mRNA level (Fig. 2b,c). [score:3]
Anti-miR, miR-182 oligonucleotide inhibitor; VEC, empty vector control; SCR, scrambled siRNA control. [score:3]
Overexpression of miR-182 and MTSS1 was performed in the pMSCV retroviral plasmid 23. [score:3]
The analysis of TCGA miR-182 expression data in breast invasive carcinoma and normal tissues was based upon data generated by the TCGA Research Network: http://cancergenome. [score:3]
Similarly, treating the cells with the TGFβ receptor inhibitor SB431542 also abolished the effect of miR-182 on cell invasion (Supplementary Fig. 8D). [score:3]
Error bars are defined as s. d. (a) Comparison of miR-182 expression in TCGA breast invasive carcinoma and normal tissues. [score:3]
However, these TGFβ -induced molecular events were completely abolished when the cells were simultaneously treated by the miR-182 inhibitor (Fig. 4b). [score:3]
These data showed that miR-182 promotes cancer cell responses to TGFβ by suppressing SMAD7. [score:3]
4T1 cells with stable miR-182 overexpression and the control cells were implanted into the mammary fat pads of BALB/c mice. [score:3]
As expected, SMAD7 overexpression abolished the effects of miR-182 in cancer cell invasion. [score:3]
In this study, we showed that miR-182 also targets SMAD7 to elevate cancer cell responses to TGFβ during metastasis. [score:3]
For example, the promotion of cell invasiveness by miR-182 might result from the synergistic action of SMAD7 and other downstream targets, such as MTSS1 (ref. [score:3]
The same phenomenon was observed in 4T1 cells when miR-182 and SMAD7 were both overexpressed, following assessments of cell migration and invasion (Supplementary Fig. 8E). [score:3]
Without miR-182 inhibition, TGFβ treatment markedly reduced the epithelial marker CDH1 that was localized to the cell membrane, while the mesenchymal markers CDH2 and Vimentin were significantly elevated (Fig. 4b). [score:3]
Unlike in cancer cells, TGFβ treatment of these normal cells failed to induce the expression of miR-182, and thus an obvious increase of SMAD7 protein was observed following TGFβ stimulation (Supplementary Fig. 7A,B). [score:3]
9), could completely block the osteoclastogenesis effect of miR-182 (Fig. 5e), indicating that PTHLH is the main downstream mediator of miR-182 to regulate TGFβ -induced osteoclast maturation. [score:2]
Moreover, a 3-bp mutation in the seed sequence of the binding site abrogated the reduction of luciferase activity in response to miR-182 (Fig. 2a; Supplementary Fig. 1). [score:2]
Among these miRNAs, miR-182 was previously reported to be involved in cancer metastasis and TGFβ signalling by us and others 19 23, and thus represented a promising candidate to interfere TGFβ regulation of SMAD7. [score:2]
The assays were repeated in MCF10AT cells as well, and the same changes in EMT markers were observed (Supplementary Fig. 8B), suggesting that SMAD7 induction mediates the effects of miR-182 inhibition in cancer cell EMT. [score:2]
How to cite this article: Yu, J. et al. MicroRNA-182 targets SMAD7 to potentiate TGFβ -induced epithelial-mesenchymal transition and metastasis of cancer cells. [score:2]
Taken together, these data demonstrate that though miR-182 has a weaker effect on EMT regulation, it mimics TGFβ signalling to promote cancer cell migration and invasion. [score:2]
The miR-182 -mediated disruption of TGFβ negative feedback provides a good example of how central pathways can be disregulated in malignant cells. [score:2]
In contrast, CSF1, which was also involved in osteoclastogenesis 10 but was not responsive to TGFβ, was not regulated by miR-182 either (Supplementary Fig. 10C). [score:2]
As a comparison, we also analysed the role of miR-182 in TGFβ responses of non-malignant mammary epithelial cells MCF10A and HMLE. [score:1]
miR-182 promotes osteoclastogenesis and bone metastasis. [score:1]
miR-182 transcription was activated by the transfection of SMAD4 as well (Fig. 2d). [score:1]
Overall, our results demonstrate that miR-182 is a critical component of TGFβ signalling. [score:1]
miR-182 is required for TGFβ -induced EMT and invasion. [score:1]
The role of miR-182 in bone metastasis. [score:1]
The induction of miR-182 by TGFβ treatment was also confirmed in other breast and lung cancer cell lines (Fig. 2e). [score:1]
A nearly 5-fold increment of miR-182 transcript was observed 6 h after TGFβ treatment (Fig. 2d). [score:1]
The correlation of miR-182 expression with clinical metastasis was also analysed for the TCGA cohort, and it was found that miR-182 elevation was linked to accelerated metastasis in triple negative breast cancer, a subtype characterized with poor prognosis (Fig. 7c). [score:1]
Therefore, we further analysed the role of miR-182 in TGFβ signalling during bone metastasis. [score:1]
These findings demonstrated a functional role of miR-182 to promote tumour invasion and spreading in vivo. [score:1]
The luciferase activity of SMAD7 3′UTR was significantly reduced on miR-182 transfection in HeLa cells. [score:1]
In contrast, SMAD7 diminished the enhancing effect of miR-182 on SBE activity, although the reporter was still partially responsive to TGFβ stimulation. [score:1]
Thus, these data suggest that miR-182 is critical for TGFβ responses of cancer cells in EMT and invasion. [score:1]
The miR-182 seed sequence was further mutated to 5′-ATGGGTAAT-3′. [score:1]
The anti-miR-182 oligonucleotide (5′-AGUGUGAGUUCUACCAUUGCCAAA-3′) and scrambled control oligonucleotide (5′-CAGUACUUUUGUGUAGUACAA-3′) were previously reported 23 and purchased from GenePharma (Shanghai, China). [score:1]
These observations corroborated that miR-182 enhances TGFβ signalling of cancer cells. [score:1]
To further investigate the clinical relevance of SMAD7 suppression by miR-182, we examined a cohort (n=24) of breast cancer clinical samples collected from Qilu Hospital by q-PCR of miR-182 and IHC staining of SMAD7. [score:1]
miR-182 inversely correlates with SMAD7 in clinical samples. [score:1]
SMAD7 rescued the effect of miR-182 in TGFβ -induced EMT and osteoclastogenesis. [score:1]
Therefore, we treated MCF10AT and EpRas with the anti-miR-182 oligonucleotide together with TGFβ, and analysed the cellular responses in EMT. [score:1]
It remains to be further studied what happens in normal cells, although our preliminary results showed that in non-cancerous mammary epithelial cells MCF10A and HMLE TGFβ treatment did not result in miR-182 elevation and thus the SMAD7 protein was induced (Supplementary Fig. 7). [score:1]
Therefore, we assessed whether miR-182 could be induced by TGFβ in the above breast and lung cancer cell lines, and found that miR-182 was rapidly induced by TGFβ in SCP28. [score:1]
To further assess the function of miR-182 in tumour invasion and metastasis in vivo, we used the orthotopic transplantation mo del of 4T1 breast cancer cells. [score:1]
In silico analysis of the 2.5 kb promoter region of the miR-182 gene revealed several potential SBE sites. [score:1]
The effects of miR-182 on cancer cell invasiveness and tumour metastasis. [score:1]
For miR-182 in situ hybridization, OCT-embedded fresh-frozen specimens were cut at a thickness of 10 μm and fixed in 10% neutral-buffered formalin at room temperature overnight. [score:1]
The miR-182 sponge plasmid was constructed by inserting eight tandemly arrayed miR-182 -binding sites (50-AGTGTGAGTTCTAGGGTTTGCCAAA-30) into the 3′UTR of dsRed 23. [score:1]
Again, we found that miR-182 accelerated the growth of cancer cells in bone and osteolytic damage of the skeleton. [score:1]
Therefore, the positive feedback loop of TGFβ-miR-182 seems to be specific to cancer cells. [score:1]
The role of miR-182 in osteoclast induction was also observed only with the supplement of TGFβ in vitro, or in bone where TGFβ is largely available. [score:1]
The sections were treated with Proteinase K (15 μg ml [−1]) at 37 °C for 15 min, and incubated in the hybridization mix containing the miR-182 probe at 56 °C for 1 h. Following stringent washing in SSC, the slides were incubated with 3% FBS as blocking solution for 30 min at room temperature. [score:1]
miR-182 silencing impairs TGFβ -induced EMT and invasion. [score:1]
Concordantly, miR-182 did not obviously alter the TGFβ responsiveness of the SBE reporter, or TGFβ -induced cell apoptosis in MCF10A (Supplementary Fig. 7C,D). [score:1]
miR-182 promotes cancer cell migration and tumour invasion. [score:1]
11207733910) were used for in situ hybridization of miR182. [score:1]
Next, the effects of miR-182 in cancer cell migration and invasion were tested. [score:1]
[1 to 20 of 138 sentences]
3
[+] score: 412
Although the molecular pathway(s) through which miR-182 expression is upregulated by ATO have not been identified conclusively, our results suggest that the inhibition of geranylgeranyl synthesis is a key factor; these data are consistent with the findings that ATO inhibits cell proliferation and induces autophagy by inhibiting geranylgeranyl biosynthesis, which is also consistent with a previous report [9], and suggest that geranylgeranylation of Rho family GTPases or Rab family GTPases may inhibit miR-182 expression. [score:16]
miR-182 overexpression decreased Bcl2 mRNA expression, but had minimal effect on its protein expression; while miR-182 knock-down had no effect on Bcl2 mRNA expression, but increased its protein expression. [score:12]
The up-regulation of p21 expression by miR-182 may contribute to the effects of ATO on p21 expression; however, because less up-regulation of p21 was seen in miR-182 transfectants than in PC3 cells treated with ATO, other mechanisms must also be involved in ATO action in regulating p21. [score:12]
These data suggest that Bcl2 is a direct target of miR-182 in PC3 cells; since the basal protein level of Bcl2 was already low, there was little protein expression available to demonstrate further down-regulation through miR-182 overexpression. [score:11]
Because miR-182 was upregulated by ATO, the direct targets of miR-182 are most likely to be downregulated. [score:10]
Overexpression of miR-182 increased p21 mRNA expression by 57% (p<0.05), while knock-down of miR-182 by transfecting miR-182 inhibitor decreased p21 mRNA expression by 36% (p<0.05). [score:10]
Through this iterative process, 41 potential target genes of miR-182 were identified; 24 genes were upregulated and 17 genes were downregulated by ATO (Table S4). [score:9]
To confirm the miRNA array data in PC3 cells, qRT-PCR (Taqman technique) was used to confirm the differential expression of three miRNAs (miR-555, miR-654 and miR-182) identified as up-regulated by ATO and three miRNAs (miR-494, miR-1255a and miR-550a) that were down-regulated by ATO. [score:9]
Since miR-182 is upregulated by ATO, and ATO can cause cellular stress by inhibiting mevalonate biosynthesis [3], [9], we hypothesized that miR-182 upregulation by ATO might be due to ATO -induced cellular stress. [score:9]
As shown in Fig. 5C, transfection of miR-182 mimic increased miR-182 expression by 400–500 fold at both 24 h and 48 h after transfection; by contrast, transfection of miR-182 inhibitor suppressed miR-182 expression by >98%. [score:9]
In our studies, knock-down of miR-182 had no effect on the expression of Bcl2 expression at the mRNA level, but increased the expression of Bcl2 protein. [score:8]
These data clearly indicate that ATO -mediated inhibition of biosynthesis of geranylgeraniol, but not farnesol, results in upregulation of miR-182, suppression of proliferation and induction of autophagy. [score:8]
Using differential gene expression cutoff values of ≥2.0 with statistical significance set at p≤0.05, we identified five miR-182 target genes that were down-regulated by ATO in PC3 cells; genes identified through this process were Bcl2, BNC2, FRMD4A, ELL and AMOTL2. [score:8]
ATO up-regulation of miR-182 in PC3 cells was confirmed by qRT-PCR (Fig. 3A); other miRNAs were found to be expressed only at very low levels, and expression levels of these miRNAs demonstrated substantial variability between samples. [score:8]
Transfection of miR-182 inhibitor had no effect on Bcl2 mRNA expression, but did significantly increase Bcl2 protein expression (Fig. 5D). [score:7]
Whereas ATO induced LC3-II expression by ∼8.7 fold in PC3 cells transfected with negative control (NegCon), ATO induced LC3-II expression by only ∼6.3 fold in PC3 cells transfected with miR-182 inhibitor. [score:7]
Knock-down of miR-182 in PC3 cells was inversely associated with the expression of Bcl2 at protein levels; by contrast, upregulation of miR-182 was positively correlated to levels of p21 transcripts and protein. [score:7]
These data suggest that p21 is an indirect target of miR-182, and that miR-182 may contribute in some manner to p21 up-regulation by ATO in PC3 cells. [score:7]
Furthermore, the possible existence of isomiRs for miR-182 cannot be ruled out, since miRNA arrays demonstrated a 4-fold upregulation of miR-182 by ATO in PC3 cells, while Taqman qRT-PCR analysis detected an upregulation of only 1.5 to 2-fold. [score:7]
These results demonstrate that miR-182 directly inhibits the proliferation of PC3 cells, and may also mediate the suppression of cell proliferation induced by ATO. [score:6]
The link between up-regulation of miR-182, ATO inhibition of PC3 cell proliferation, and ATO induction of autophagy was clearly demonstrated by comparisons of ATO activity in PC3 versus LNCaP cells, and by comparisons of ATO activity in parental PC3 cells versus PC3 cell clones with different phenotypic responses. [score:6]
In consideration of the different activities of ATO and miR-182 transfectants, the effects of ATO on Bcl2 expression are presumably mediated through mechanisms other than upregulation of miR-182. [score:6]
Serum deprivation for 2 days increased miR-182 expression by 26% (p<0.001; Fig. 4C), suggesting that miR-182 up-regulation in PC3 cells is induced by different types of stressors. [score:6]
miR-182 overexpression did not alter PC3 cell responses to ATO; however, knock-down of miR-182 reduced the activity of ATO as an inhibitor of cell proliferation (Fig. 6A). [score:6]
As shown in Fig. 6A, overexpression of miR-182 in untreated cells inhibited proliferation by 36% (p<0.001); knock-down of miR-182 in otherwise untreated cells increased proliferation by 43% (p<0.001). [score:6]
By contrast, p21 was not identified as a direct target of miR-182 by either TargetScan or PicTar. [score:6]
Thus it is possible that inhibition of geranylgeranylation of Rho family GTPases may be critical for ATO to induce autophagy and enhance miR-182 expression. [score:5]
To evaluate this hypothesis, miR-182 expression was quantitated in PC3 cells treated with ATO ± several mevalonate metabolites whose synthesis is inhibited as a result of ATO suppression of mevalonate biosynthesis. [score:5]
Interestingly, p21 expression was positively correlated with miR-182 expression at both the mRNA and protein levels (Fig. 5D). [score:5]
Transfection with miR-182 inhibitor (miR-182-in) decreased the basal expression of LC3-II by ∼30% (n = 3, a representative western blot is shown in Fig. 6C). [score:5]
A series of transfection studies was performed to elucidate the relationship between ATO exposure, miR-182 expression, and Bcl2 and p21 mRNA and protein expression in PC3 cells. [score:5]
Overexpression of miR-182 decreased Bcl2 mRNA levels by 26% (p<0.05), but had no significant effect on Bcl2 protein expression at 48 hours. [score:5]
These data suggest that miR-182 regulation by ATO in prostate cancer cells is cell-specific, and that up-regulation of miR-182 may be involved in ATO action in PC3 cells. [score:5]
To examine the functional role of miR-182 as a mediator of ATO responses, miR-182 expression was manipulated by transfecting miR-182 mimic or miR-182 inhibitor into PC3 cells. [score:5]
PC3 cells were cultured overnight in normal growth medium, then transfected with miR-182 mimic (Sigma) or miR-182 inhibitor or negative control in OPTI-MEM (Invitrogen) containing 3% FBS for 18–28 h. The miRNA mimic, inhibitor for miR-182, and negative control (Invitrogen) were each used at a final concentration of 20 nM. [score:5]
miR-182 target genes were selected on the basis of microarray dataset and predicted based on Targetscan and Pictar program analyses. [score:5]
In a previous study, we reported that the expression of miR-182 was stress -associated, and was linked to the inhibition of proliferation in MCF12F breast epithelial cells [29]. [score:5]
By contrast, miR-182 suppresses cell proliferation in human gastric and lung adenocarcinoma cells [35], [36], [37] and in vitro invasion of prostate cancer cells [38], suggesting possible tumor suppressing activity in these tissues. [score:5]
Mir-182 Upregulation By Ato In Pc3 Cells Is Reversed By Geranylgeraniol Co-Treatment And Is Independent Of P53 Expression. [score:5]
A stress responsive miRNA, miR-182, was found to be up-regulated by ATO in PC3 cells; alterations in miR-182 levels were closely linked to the antiproliferative activities of ATO in these cells. [score:4]
Our data are in general agreement with a report demonstrating that miR-182 upregulation is associated with stress -induced premature senescence in primary cultures of diploid fibroblast and trabecular meshwork cells [39]. [score:4]
have been identified as direct target genes of miR-182. [score:4]
If this hypothesis is correct, removal of ATO stress would reverse miR-182 up-regulation. [score:4]
Because regulation of miR-182 has recently been reported to be p53 -dependent [20], we examined levels of p53 expression in PC3 cells with or without exposure to ATO. [score:4]
By contrast, ATO down-regulated miR-182 in LNCaP cells by 24% (p<0.01) at 48 hrs (Fig. 3B). [score:4]
These results also suggest that miR-182 may not contribute to Bcl2 down-regulation in response to ATO in PC3 cells. [score:4]
These data suggest that miR-182 regulates Bcl2 at posttranscriptional level by targeting the 3′UTR region, which has recently been demonstrated in melanoma cells [20]. [score:4]
p53 protein is not expressed in PC3 cells under either condition (Fig. 4D), demonstrating that miR-182 regulation by ATO in PC3 cells is p53-independent. [score:4]
The effects of ATO on potential target genes of miR-182 were studied in order to evaluate the hypothesis that ATO modulation of miR-182 expression induces changes in regulatory function. [score:4]
miR-182 (which was up-regulated by four-fold in PC3 cells exposed to ATO) was also selected due to its known relationship to cell stress [29]. [score:4]
Fig. 6B shows the images of CV staining at 4 days after transfection of miR-182 mimic and miR-182 inhibitor in PC3 cells. [score:3]
Table S4 List of potential target genes of miR-182 in PC3 cells. [score:3]
de/) were used to identify potential target genes of miR-182; genes identified using these computer simulation programs were then screened using microarray data. [score:3]
pone-0070442-g004 Figure 4 (A) PC3 cells were treated with 5 µM ATO for 48 h in the presence and absence of metabolites including geranylgeraniol (10 µM) and farnesol (10 µM), miR182 expression was then detected by qRT-PCR. [score:3]
We used a second stress mo del – serum deprivation – to determine the specificity of miR-182 responses to ATO and to determine whether miR-182 expression is also be enhanced by other types of stress in PC3 cells. [score:3]
In the presence of ATO, the absorbance generated by miR-182 inhibitor -transfected cells increased by 89% (p<0.001, n = 8) in comparison to negative control -transfected cells. [score:3]
Functional significance of miR-182 in ATO induced suppression of PC3 cell proliferation and induction of autophagy. [score:3]
Consistent with the results of the preliminary study, GGOH reversed the effect of ATO on miR-182 expression; FOH had no effect (Fig. 4A). [score:3]
Effect of ATO and alteration of miR-182 on expression of Bcl2 and p21. [score:3]
The 2.5 µM concentration of ATO was used in order to permit the study of differential responses resulting from manipulation of miR-182 expression. [score:3]
C confirms the successful transfection of miR182-mi and miR182-in by detection of increased or decreased expression of miR-182. [score:3]
Ato Regulates Bcl2 And P21, Which Are Potential Targets Of Mir-182 In Pc3 Cells. [score:3]
In the present studies, both exposure to ATO and serum deprivation enhanced miR-182 expression in PC3 cells; this enhancement was p53-independent. [score:3]
Confirmatory data were provided by studies conducted in PC3 cells transfected with an miR-182 mimic or an miR-182 inhibitor. [score:3]
Geranylgeraniol co-treatment reversed ATO effect on miR-182 expression. [score:3]
These data differ from the results of a recent study in melanoma cells, in which doxorubicin induced a p53 -dependent induction of miR-182 expression [20]. [score:3]
We initially identified Bcl2 as a target of miR-182 by microarray analysis, strategy for which there is scientific precedent [42]. [score:3]
miR-182 expression was increased by 56% (p<0.01) at 24 h and 66% (p<0.01) at 48 hours in PC3 cells exposed to ATO (Fig. 3A). [score:3]
p21 was positively correlated to miR-182 expression at both mRNA and protein levels. [score:3]
Effect of ATO on miR-182 expression in prostate cancer cells. [score:3]
A possible explanation for this finding is that the basal expression level of Bcl2 protein is low, and the effect of miR-182 is physiologic (instead of pharmacologic). [score:3]
Mir-182 Is Up-Regulated By Ato In Pc3 Cells. [score:3]
List of potential target genes of miR-182 in PC3 cells. [score:3]
Since ATO induces autophagy in PC3 cells, we used western blots and UN-SCAN-IT software to determine the effects of miR-182 on LC3-II expression. [score:3]
For example, the overexpression of miR-182 in prostate cancers [32], [33] and several other types of neoplasms [34] suggests a clear linkage to malignancy. [score:3]
In a preliminary study, only GGOH reversed the effects of ATO on miR-182 expression in PC3 cells. [score:3]
Effect Of Mir-182 Expression On Cell Proliferation In Response To Ato In Pc 3 Cells. [score:2]
The role of miR-182 in cancer development and progression remains incompletely defined, and may be tissue-specific; the literature contains what appear to be contradictory activities of miR-182 in different tissues. [score:2]
When compared to controls, PC3 cell transfectants overexpressing miR-182 demonstrated a 26% reduction in Bcl2 mRNA, but no changes in the levels of Bcl2 protein. [score:2]
The present studies have identified miR-182 as a possible mediator of the antiproliferative and pro-autophagic activities of ATO in PC3 human prostate cancer cells. [score:1]
When considered as a whole, these data suggest that miR-182 is involved in regulation of both PC3 cell proliferation and the induction of autophagy in PC3 cells. [score:1]
We previously reported that miR-182 is a stress-responsive miRNA in breast epithelial cells [29]. [score:1]
[1 to 20 of 82 sentences]
4
[+] score: 376
Anti-miR™ miRNA inhibitor [negative control (miR-NC inhibitor) or miR-182-5p inhibitor (miR-182-5p inhibitor), Ambion] were transiently transfected into cancer cells with siPORT NeoFX Transfection Agent (Ambion) according to the manufacturer’s instructions. [score:9]
Since target gene protein expression is low in PC-3 and DU145, we performed to observe any changes in protein expression with miR-182-5p inhibitor. [score:9]
We measured microRNA levels in xenograft tumors (miR-182-5p -inhibitor and inhibitor-NC), and found that miR-182-5p expression was significantly lower in miR-182 inhibitor xenografts compared to that of inhibitor-NC xenografts (Fig. 5-B ). [score:8]
These results indicate that knockdown of miR-182-5p increased expression of these tumor suppressor target genes in vitro and in vivo. [score:8]
Our next aim was to identify target genes of miR-182-5p since microRNAs exert their effects by regulating expression of other target genes. [score:8]
In our study, we observed that miR-182 inhibitor decreased active-MMP-2 expression in prostate cancer cell lines as well as up-regulation of RECK protein. [score:8]
Additionally knocking down of miR-182-5p with inhibitor may be of therapeutic benefit for enhancing expression of tumor suppressor genes FOXF2, RECK and MTSS1 in prostate cancer cells. [score:8]
A. Relative miR-182-5p expression (miR-NC inhibitor or miR-182-5p inhibitor transfected PC cells), B. Cell viability assay (miR-NC inhibitor or miR-182-5p inhibitor transfected PC cells), C. Invasion assay, D. Wound healing assay (24 hours). [score:8]
As shown in Figure 4-C, protein expression of target genes was significantly increased after miR-182-5p inhibitor transfection (Fig. 4-C ). [score:7]
We identified three tumor suppressor genes (FOXF2, RECK, MTSS1) as potential target genes for miR-182-5p based on three algorithms (miRDB, TargetScan, microRNA. [score:7]
C. Protein expression of FOXF2, RECK, MTSS1, MMP-2 and beta-tubulin in miR-NC inhibitor or miR-182-5p inhibitor transfected prostate cancer cells (PC-3, DU145). [score:7]
As shown in Figure 5-D, protein expression of the three target genes (FOXF2, RECK, MTSS1) was significantly higher in stable low miR-182-5p expressing xenograft tumor tissues. [score:7]
Establishment of stable low miR-182-5p expressing prostate cancer cells and effect on in vivo tumor growthIn order to observe the in vivo effect of miR-182-5p inhibitor on prostate cancer cells, we established stable low miR-182-5p expressing prostate cancer cell lines based on the lenti-viral system. [score:7]
miR-182-5p binds to the 3’ UTR of FOXF2, RECK and MTSS1 mRNAs and down-regulates expression. [score:6]
At 48 hours after transfection of inhibitor-NC or miR-182-5p inhibitor into PC-3 and DU145 cells, the miR-182-5p knock-down was verified by real time RT-PCR (0.003, 0.034, respectively) (Fig. 3-A ). [score:6]
Transfected cells (miR-NC inhibitor/miR-182-5p inhibitor transfectant-48 hours) were re-suspended in culture medium without FBS and placed in the upper chamber in triplicate. [score:5]
However our results show that miR-182-5p directly regulates RECK expression in prostate cancer cell lines. [score:5]
As shown in Figure 4-C, cleaved MMP-2 (active type) protein expression was significantly decreased in miR-182-5p inhibitor transfected cells. [score:5]
A. Relative miR-182-5p expression [each tumor tissue (T)/normal prostate tissue (N)] based on real time PCR results, B. Association between miR-182-5p expression and clinic-pathological parameters (age at diagnosis, pT, Gleason score, PSA failure and overall survival) in prostate cancer tissues based on q-PCR results. [score:5]
To generate a wound field, transfected cells (miR-NC inhibitor or miR-182-5p inhibitor transfectant-48 hours transfection) were cultured until they formed a monolayer around the insert. [score:5]
Finally we established stable low miR-182-5p expressing cell lines and performed in vivo studies in order to observe potential tumor suppression effects in a xenograft nude mouse mo del. [score:5]
In order to observe miR-182-5p inhibitor effects on tumor growth in nude mice, we used a lentiviral based system and established stable low miR-182-5p expressing PC-3 cells and controls (Fig. 5-A ). [score:5]
Since miR-182-5p expression was higher in all three prostate cancer cell lines (LNCaP, PC-3, DU145) compared to normal prostate epithelial cells, we used the two highest miR-182-5p expressing cell lines (PC-3 and DU145) for functional knockdown analyses. [score:5]
In order to observe the in vivo effect of miR-182-5p inhibitor on prostate cancer cells, we established stable low miR-182-5p expressing prostate cancer cell lines based on the lenti-viral system. [score:5]
Two prostate cancer cell lines (PC-3 and DU145) were transiently transfected with either miR-182-5p inhibitor or miR -negative control (miR-NC -inhibitor). [score:5]
0055502.g001 Figure 1 A. Relative miR-182-5p expression [each tumor tissue (T)/normal prostate tissue (N)] based on real time PCR results, B. Association between miR-182-5p expression and clinic-pathological parameters (age at diagnosis, pT, Gleason score, PSA failure and overall survival) in prostate cancer tissues based on q-PCR results. [score:5]
Expression of miR-182-5p in cell lines and effect of miR-182-5p overexpression on normal prostate cells (RWPE-1). [score:5]
We also used several algorithms to search for potential tumor suppressor genes as targeting for miR-182-5p. [score:5]
0055502.g003 Figure 3 Two prostate cancer cell lines (PC-3 and DU145) were transiently transfected with either miR-182-5p inhibitor or miR -negative control (miR-NC -inhibitor). [score:5]
As shown with 3’UTR luciferase assay and Western analyses, the three potential target genes (FOXF2, RECK, MTSS1) expression was regulated by miR-182-5p. [score:5]
We used two prostate cancer cell lines (PC-3 and DU145) with high miR-182-5p expression for further experiments since the miR-182-5p expression was significantly higher in these cell lines. [score:5]
MiR-182-5p expression was significantly lower in the miR-182-5p inhibitor group. [score:5]
Namely hsa-miR-182-5p inhibitor vector (catalog #; HmiR-AN0239-AM03, GeneCopoeia, Rockville, MD) or a miRNA inhibitor scrambled control clone pEZX-AM03 (catalog #; CmiR-AN0001-AM03, GeneCopoeia, Rockville, MD) with Lenti-Pac HIV mix were transfected into 293 Ta cells (GeneCopoeia) and incubated for 14 hours at 37°. [score:5]
We divided the 52 prostate cancer patients into two categories based on the average T/N ratio (2.27) as follows: 1) high miR-182-5p expressing group (miR-182-5p T/N ratio higher than 2.27), 2) low miR-182-5p expressing group (miR-182-5p T/N ratio lower than 2.27). [score:5]
This result suggests that the FOXF2, RECK and MTSS1 mRNAs are direct targets of miR-182-5p. [score:4]
For functional analysis studies, miR-182-5p was knocked down using a miR-182-5p inhibitor. [score:4]
MiR-182-5p expression is shown as the ratio of tumor (T)/and normal (N) expression (T/N ratio) in each paired sample (Figure 1 ). [score:4]
0055502.g005 Figure 5Inhibition of in vivo tumor growth by miR-182-5p knockdown in PC3 cells. [score:4]
Thus our results suggest that onco-miR-182-5p may be involved in the regulation of these invasion and metastatic suppressor genes. [score:4]
Inhibition of in vivo tumor growth by miR-182-5p knockdown in PC3 cells. [score:4]
In addition miR-182 has been reported to down-regulate MTSS1 and promote metastasis of hepatocellular carcinoma [32], a result very similar to ours. [score:4]
To accomplish this, we used an in vivo nude mouse xenograft mo del with stable low miR-182-5p expressing prostate cancer cells for this study. [score:3]
Kaplan Meier plots showed that overall survival was significantly shorter in the high miR-182-5p expressing group (p value = 0.0117, Log-rank test) (Figure 1-C ). [score:3]
C. Typical gross appearance of nude mouse tumors in control and miR-182-5p inhibitor groups. [score:3]
One report has shown that miR-182 is a tumor suppressor in a lung cancer cell line [17], while miR-182-5p has been reported to be an oncogene in several cancers [18]– [23]. [score:3]
Interestingly we found that high miR-182-5p expression was correlated with shorter overall survival after radical prostatectomy in prostate cancer patients. [score:3]
miR-182-5p directly regulates FOXF2, RECK and MTSS1. [score:3]
In conclusion this is the first report documenting that over -expression of miR-182-5p is associated with prostate cancer progression and potentially useful as a prognostic biomarker. [score:3]
miR-182-5p inhibitor effect on tumor growth in an in vivo nude mouse mo del. [score:3]
At 48 hours after transfection of miR-NC or miR-182-5p precursor into RWPE-1 cells, the miR-182-5p expression level was verified by real time PCR (fold change; 526, Fig. 2-B ). [score:3]
Since we could not detect tumor in one of the low miR-182-5p expression groups, it was excluded from the experiment. [score:3]
Stable low miR-182-5p expressing prostate cancer cells (1×10 [7]/each) or control cells (1×10 [7]/each) were injected subcutaneously into the right back side flanks of 5 week-old nu/nu mice, respectively. [score:3]
We also performed in vitro functional analyses using a miR-182-5p inhibitor in prostate cancer cells. [score:3]
As it has previously been reported that miR-182-5p overexpression promoted melanoma metastasis and was oncogenic in nature, our results also indicate that miR-182-5p may be an oncogene in prostate cancer cell lines. [score:3]
Stably transfected cells (miR-182-5p low expressing or control) were selected using Hygromycin (100 µg/ml, Invitrogen, Carlsbad, CA, USA) for three weeks. [score:3]
miRNA-182 expression is significantly increased in prostate cancer tissues and correlated with overall survival. [score:3]
Additionally the levels of FOXF2, RECK and MTSS1 were significantly higher in xenograft tissues from low miR-182-5p expressing prostate cancer cells. [score:3]
Segura et al reported that aberrant miR-182-5p expression promoted melanoma metastasis [18]. [score:3]
miR-182-5p expression in human prostate cancer tissues and normal prostate tissues and association with clinic-pathological parameters (q-PCR). [score:3]
So far miR-21 and miR-222 have been found to target RECK in prostate cancer and gastric cancer [28], [29] but there have been no reports about miR-182-5p and RECK. [score:3]
Chi-square or the Fisher’s exact test was used for the association of clinical parameters with miR-182-5p expression. [score:3]
Effect of microRNA-182-5p over -expression on cell viability and migration in a normal prostate cell line. [score:3]
miRNA-182-5p expression is significantly increased in prostate cancer cell lines. [score:3]
Liu et al found that miR-182-5p overexpression increased tumour transformation and tumor invasiveness in vitro and enhanced metastasis in vivo in ovarian cancer cells [21]. [score:3]
3’UTR luciferase assay and Western analyses were performed to confirm direct interaction between miR-182-5p and these target genes. [score:3]
B. Relative miR-182-5p expression at injection of cells and harvest of xenografts. [score:3]
Recently miR-182 has been reported to be over-expressed in prostate cancer [10]. [score:3]
A. Time record of tumor size in miR-NC and miR-182-5p inhibitor xenografts. [score:3]
A total of 8 nude mice (4-control, 4-miR-182-5p inhibitor) (strain BALB/c nu/nu; Charles River Laboratories, Inc. [score:3]
Establishment of stable low miR-182-5p expressing prostate cancer cells and effect on in vivo tumor growth. [score:3]
As expected, miR-182-5p knockdown decreased cell proliferation, migration and invasion in these cell lines. [score:2]
MiR-182-5p expression levels in clinical samples (52 samples) were confirmed by real-time PCR. [score:2]
Additionally the expression of miR-182-5p was significantly higher in prostate cancer cell lines (LNCaP, PC-3, DU145) compared with normal prostate epithelial cells (RWPE-1). [score:2]
In our study, we observed that miR-182-5p expression was significantly higher in prostate cancer tissues and prostate cancer cell lines compared to normal prostate tissues and cell lines. [score:2]
Then we confirmed miR-182-5p binding to the 3’UTR of target gene mRNA by luciferase assay with miR-182-5p precursor. [score:2]
Cell viability was measured 3 days after transfection (miR-NC inhibitor/miR-182-5p inhibitor transfectant) with MTS (CellTiter 96 Aqueous One Solution Cell Proliferation Assay, Promega). [score:2]
Effect of miR-182-5p knock down on prostate cancer cells (PC-3, DU145). [score:2]
We used 8 mice (4 mice; stable low miR-182-5p, 4 mice; control) and observed that stable low miR-182-5p expressing cell lines had significantly reduced tumor volume in nude mice compared to controls (Fig. 5-B ). [score:2]
0055502.g002 Figure 2 A. The expression of miR-182-5p was significantly higher in three prostate cancer cell lines compared to a normal prostate cell line (RWPE-1), B. Relative miR-182-5p expression (miR-NC or miR-182-5p precursor transfected RWPE-1 cells), B. cell viability assay (miR-NC or miR-182-5p precursor transfected RWPE-1 cells), C. Wound healing assay (miR-NC or miR-182-5p precursor transfected RWPE-1 cells). [score:2]
To test this hypothesis, we initially found that miR-182-5p expression was significantly higher in prostate cancer tissues compared with normal prostate tissues. [score:2]
Thus if the T/N ratio is over 1.0, miR-182-5p expression was judged to be higher in prostate cancer tissues compared to that in matched adjacent normal tissue. [score:2]
The tumor volume in nude mice was significantly decreased in low miR-182-5p expressing cells compared to control cells. [score:2]
Therefore miR-182-5p expression was significantly higher in prostate cancer tissues compared to matched normal prostate tissues. [score:2]
MiR-182-5p expression was confirmed by real-time PCR when stable cell lines were injected into mice and when xenograft tissues were harvested. [score:2]
Effect of microRNA-182-5p knock down on cell viability, invasion and migration in PC cell lines. [score:2]
Similar to our results, two other studies found miR-182-5p expression to be significantly higher in prostate cancer tissues compared to normal prostate tissues [10], [22], however they did not perform functional analysis. [score:2]
A. The expression of miR-182-5p was significantly higher in three prostate cancer cell lines compared to a normal prostate cell line (RWPE-1), B. Relative miR-182-5p expression (miR-NC or miR-182-5p precursor transfected RWPE-1 cells), B. cell viability assay (miR-NC or miR-182-5p precursor transfected RWPE-1 cells), C. Wound healing assay (miR-NC or miR-182-5p precursor transfected RWPE-1 cells). [score:2]
MiR-182-5p expression was significantly higher in prostate cancer cell lines (LNCaP, PC-3 and DU145) compared to the normal prostate cell line (RWPE-1) (Figure 2A ). [score:1]
Therefore only two reports have shown that miR-182-5p is an oncogene based on functional analysis in melanoma and ovarian cancer [18], [21]. [score:1]
A. FOXF2, RECK and MTSS1 3’UTR position and complementary miR-182-5p sequence. [score:1]
Cell viability (MTS assay), migration and invasion assays were performed (Fig. 3-B, 3-C, 3-D ) and we observed a significant decrease in cell proliferation (Fig. 3-B ), invasion (Fig. 3-C ) and migration (Fig. 3-D ) in miRNA-182-5p knockdown PC-3 and DU-145 cells compared to inhibitor-NC transfected cells. [score:1]
Therefore we hypothesize that miR-182-5p may function as an oncogene and be a new molecular biomarker in prostate cancer. [score:1]
RECK mRNA has one potential binding site (position 812) for miR-182-5p within its 3’ UTR (Fig. 4-A ). [score:1]
With mutated plasmids (shown as “M”), there was no significant difference in luciferase activity between controls and miR-182-5p precursor transfectants (Fig. 4-B ). [score:1]
FOXF2 mRNA has two potential binding sites for miR-182-5p within its 3’ UTR (Fig. 4-A ). [score:1]
To address this question, we initially transfected miR-182-5p into a normal prostate cell line (RWPE-1) and observed that miR-182 increased cell proliferation and wound healing ability. [score:1]
The relative luciferase activity was significantly decreased when the position 812 construct was used in miR-182-5p precursor transfected cells (Fig. 4-B ). [score:1]
MTSS1 mRNA has four potential binding sites for miR-182-5p within its 3’UTR and the relative luciferase activity was significantly decreased at position 1909 in miR-182-5p precursor transfected cells (Fig. 4-B ). [score:1]
Since we focused on three target genes (RECK, MTSS1 and FOXF2) and investigated only 52 clinical samples, additional studies will be needed to elucidate the role of miR-182-5p in prostate cancer and its use in clinical applications. [score:1]
Thus our next aim was to elucidate whether miR-182-5p functions as an oncogene in prostate cancer. [score:1]
Pre-miR™ miRNA precursors [negative control (miR-NC) or hsa-miR-182-5p (miR-182-5p), Ambion] were transfected into cells with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
We also investigated the possible use of miR-182-5p inhibitor as a potential PC treatment. [score:1]
0055502.g004 Figure 4 A. FOXF2, RECK and MTSS1 3’UTR position and complementary miR-182-5p sequence. [score:1]
Among the two sites, the relative luciferase activity was significantly decreased at position 670 in miR-182-5p precursor transfected cells (Fig. 4-B ). [score:1]
To confirm the function of miR-182-5p, we transfected miR-182-5p precursor into a normal prostate cell line (RWPE-1). [score:1]
However functional analysis of miR-182-5p has not been carried out in prostate cancer. [score:1]
[1 to 20 of 106 sentences]
5
[+] score: 363
Other miRNAs from this paper: hsa-mir-31, hsa-mir-96, hsa-mir-183
As expected, the expression levels of Snail and mesenchymal maker Vimentin were strikingly upregulated in miR-182-overexpression cells, whereas SATB2 and epithelial marker E-cadherin levels were downregulated. [score:11]
In this study, we have clearly illustrated that miR-182 might directly regulate SATB2 expression by inducing mRNA degradation and translational suppression. [score:9]
miR-182-specific inhibitor transfection was employed to inhibit miR-182 expression in M5 cells, which had high endogenous miR-182 expression. [score:9]
Further research showed that miR-182 could directly target the 3’untranslated region (3’UTR) of SATB2 mRNA and subsequently repress both the mRNA and protein expressions of SATB2, which we identified in previous studies as a CRC metastasis -associated protein. [score:8]
Moreover, miR-182 could suppress SATB2 via directly targeting its 3’-UTRs, and subsequently regulate EMT signaling. [score:7]
This up-regulated expression of miR-182 can be correlated with the poor prognosis of patients with CRC [10]. [score:6]
It has been identified that the expression of miR-182 is up-regulated in CRC [10, 16, 17]. [score:6]
In this study, we explored the role of miR-182 in CRC and found that the up-regulation of miR-182 promoted the proliferation, invasion, and metastasis of tumor cell by suppressing SATB2 in CRC. [score:6]
miR-182 expression had a negative correlation with SATB2 expression. [score:5]
Endogenous SATB2 expression in both mRNA and protein decreased in miR-182 over -expression CRC cells. [score:5]
We analyzed the changes of SATB2 expression after the ectopic over -expression of miR-182. [score:5]
The reintroduction of miR-182 into CRC cells induced EMT, indicating the down -expression of epithelial markers and up -expression of the mesenchymal markers. [score:5]
miR-182 can target tumor suppressor gene FOXO1 and functions as oncogene in endometrial cancer and breast cancer [13, 27]. [score:5]
In melanoma, an over -expression of miR-182 promoted cell migration, and sustained miR-182 suppression that prevented liver metastasis of melanoma cell in mice [14, 15]. [score:5]
Thereafter, SATB2 overexpression could significantly attenuate the expression changes of the above markers that are associated with miR-182 (Figure 7A). [score:5]
To explore the mechanism that facilitates the effects on proliferation and migration induced by miR-182, we analyzed the putative miR-182 targets by a bioinformatic screen that was developed using three algorithms: TargetScan, PicTar, and miRanda. [score:5]
We observed that the upregulation of miR-182 frequently occursred in CRC tissues, and that miR-182 high-expressed in CRC patients with metastases compared with those of patients without metastasis. [score:5]
The up-regulation of miR-182 in CRC was determined by miRNA microarray or quantitative RT-PCR analysis was consistent across three studies [16, 17, 25]. [score:4]
Our results illustrated that the up-regulation of miR-182 played a pivotal role in CRC tumorigenesis and metastasis, which suggesting a potential implication of miR-182 in the molecular therapy for CRC. [score:4]
Several studies have illustrated that miR-182 is abnormally expressed in various tumors [9, 10] and directly involves in human cancer processes, such tumorigenesis, migration and metastasis [11- 15]. [score:4]
These findings indicate that SATB2 might be an important target of miR-182, wherein it regulated invasion and metastasis in CRC. [score:4]
To further explore the mechanism through which miR-182 regulates CRC invasion and metastasis, we analyzed miR-182 targets. [score:4]
SATB2 was a direct target of miR-182 in CRC. [score:4]
We found that the up-regulation of miR-182 in tumor samples was associated with lymph-node metastasis to a significant extent (p = 0.021, Figure 1B). [score:4]
Western blot and immunohistochemical analysis were performed to examine the expression changes of molecular markers that are regulated by miR-182. [score:4]
A luciferase reporter assay was carried out to determine whether miR-182 can directly regulate the expression of SATB2 in CRC SW480 cells. [score:4]
miR-182 inhibitor can be considered as a novel therapeutic target for CRC patients, especially metastatic CRC. [score:4]
IHC staining showed that the Ki-67 index in tumors of miR-182-over -expression group was much higher than that in the control group (Figure 3C). [score:3]
Overexpression of miR-182 induces CRC cells metastasis though EMT pathway. [score:3]
SATB2 could inhibit cell growth, invasion and migration of SW480/miR-182. [score:3]
The expression level of miR-182 in the metastasizing cells was higher than with little metastatic powers. [score:3]
Furthermore, IHC staining illustrated that the tumors in caecum terminus of mice that originated from SW480/miR-182 cells had increased expression of Snail and Vimentin. [score:3]
Moreover, the matrigel invasion and wound-healing assays confirmed that the inhibition of miR-182 expression reduced the invasiveness and migration of M5 cells, compared with the control cells (p < 0.001 and p = 0.001, Figure 4B and Figure 4C). [score:3]
miR-182 also suppresses cylindromatosis (CYLD) to sustain NF-κB activation in glioma [28]. [score:3]
The ectopic expression of miR-182 enhanced cell proliferation, invasion, and migration in vitro. [score:3]
Cell proliferation (D), invasion (E) and migration (F) changes were detected between SW480/miR-182 cells and SW480/miR-182 cells with over -expression of STAB2. [score:3]
To reveal the unambiguous role of miR-182 in CRC cells, we established two stable miR-182-overexpression cell lines to test the effect of miR-182 on the behaviors of tumor cells. [score:3]
One of the limitations of our study was that it did not exhibit the direct evidence of EMT-related molecules that were regulated by miR-182/SATB2 in our studies. [score:3]
The results indicated that miR-182 was markedly up-regulated in CRC tissues compared with adjacent non-cancerous tissues (p < 0.001, Figure 1A). [score:3]
In this context, we also observed that the expression level of miR-182 in patients with lymph node metastases was higher than that in patients without metastases. [score:3]
As shown in Figure 4A, a significantly slower proliferation rate was observed in miR-182 inhibitor -transfected cells than in the control cells (p < 0.001). [score:3]
miR-182 accelerated CRC cells growth, invasion, and migration in vitroTo confirm the potential functional role of miR-182 in CRC, we generated two CRC cell lines with stable over -expression and two control cell lines by infecting the recombinant lentivirus. [score:3]
Our results indicate that miR-182 was remarkably up-regulated in CRC tissues compared with adjacent non-neoplastic tissues. [score:3]
The stable over -expression miR-182 cell lines and control cell lines were constructed by lentivirus infection. [score:3]
This indicated that the up-regulation of miR-182 can be considered as a predicted factor of metastasis for CRC patients. [score:3]
We found that the over -expression of miR-182 resulted in reproducible and statistically significant reduction of SATB2 mRNA and protein in both SW480 and DLD-1 cells (p < 0.05, Figure 5C and D). [score:3]
Restoring SATB2 expression could reverse the effects of miR-182 on CRC cell proliferation and migration. [score:3]
The expression levels of miR-182 in CRC tissues and CRC cell lines were examined by performing stem-loop quantitative RT-PCR. [score:3]
miR-182 mimics and antisense inhibitors containing 2’-OMe (O-methyl) modifications were synthesized by GenePharma (Shanghai, China). [score:3]
These controversial results indicate that the role of miR-182 is possibly tumor-specific and highly dependent on its targets in different cancer cells. [score:3]
These results indicate that miR-182 exerts its own functions depending on its specific target genes. [score:3]
In animal mo dels, the over -expression of miR-182 was sufficient to promote the metastasis of CRC cells to lung, liver, lymph node and organs in the peritoneal cavity. [score:3]
Researches have found that miR-182 plays an important role in regulating mammalian circadian rhythm, T-cell development and DNA repair [7, 8]. [score:3]
SW480/miR-182 denoted CRC SW480 cells with stable over -expression of miR-182. [score:3]
A recent study revealed that miR-182 represses the expression of MIM (missing in metastasis gene) and promotes breast cancer metastasis [12]. [score:3]
In bladder cancer, miR-182 promotes the cell proliferation, migration and invasion by suppressing Smad4 and RECK [26]. [score:3]
SATB2 was a tumor-suppressor in CRC and could attenuate miR-182 -mediated malignant phenotype in CRC. [score:3]
Inhibition of miR-182 reduced the growth, invasion, and migration of CRC cells in vitroTo confirm the effects of miR-182 on modulating the malignant phenotypes of CRC cells, we also investigated the change of aggressive phenotypes of CRC cells after reducing expression of miR-182. [score:3]
On the other hand, miR-182 suppresses tumorigenesis of lung adenocarcinoma [7]. [score:3]
To generate pLV-miR-182 expression vector, a 110-bp DNA fragment corresponding to pre-miR-182 was amplified and cloned into pLVTHM lentiviral vector. [score:3]
We first assessed the expression level of miR-182 by a stem-loop quantitative RT-PCR in 6 CRC cell lines, 31 CRC tissues and paired non-cancerous tissues. [score:3]
To determine whether SATB2 repression involves the effects of miR-182 -mediated cell behavior, we performed rescue experiments by transfecting pCAG-SATB2 vector into CRC cells which had an over -expression of miR-182. [score:3]
Furthermore, the most important effect exerted by miR-182 on cell proliferation, invasion, and migration is partially reversed after transfecting with a SATB2 expression vector. [score:3]
We found that miR-182 expression is increased in CRC cells that originated from metastatic foci and human primary CRC tissues with lymph node metastases. [score:3]
The putative miR-182 binding sites at SATB2 3’UTR were site-directed and mutated using GeneTailor Site-Directed Mutagenesis System (Invitrogen). [score:3]
CCK-8 analysis indicated that the over -expression of miR-182 significantly enhanced the proliferation of cancer cells in both cell lines (p < 0.001, Figure 2B). [score:3]
Among CRC cell lines or subclones, miR-182 was lower expression in the cells that originated from the primary tumors (SW480 and DLD-1) than those that originated from metastatic foci (SW620, Lovo, M5 and SCP51). [score:3]
These data indicated that the over -expression of miR-182 induced the EMT of SW480 cells both in vitro and in vivo. [score:3]
Elevation of miR-182 expression in CRC tissues and cell lines. [score:3]
Stable overexpression of miR-182 also facilitated tumor growth and metastasis in vivo too. [score:3]
These cells were infected with the recombinant lentivirus- transducing units and 8 mg/ml Polybrene (Sigma, St Louis, Missouri, USA) to generate four stable cell lines: two stable over -expression miR-182 cell line (SW480/miR-182 and DLD-1/miR-182) and two control cell line (SW480/miR-con and DLD-1/miR-con). [score:3]
Inhibition of miR-182 reduced the growth, invasion, and migration of CRC cells in vitro. [score:3]
The activities of SATB2 3’UTR luciferase reporter were responsive to miR-182 over -expression. [score:3]
A number of mRNAs involve in distinct pathways are targeted by miR-182. [score:3]
As shown in Figure 5E, a significant inverse correlation was observed between miR-182 and SATB2 mRNA expression (Spearman’s correlation, r = -0.7007, p = 0.001). [score:3]
In functional studies, overexpression of miR-182 dramatically promoted CRC cells proliferation, invasion and migration in vitro and in vivo. [score:3]
An increased expression of miR-182 upon infection in cell lines was confirmed by real-time PCR (Figure 2A). [score:3]
To confirm the potential functional role of miR-182 in CRC, we generated two CRC cell lines with stable over -expression and two control cell lines by infecting the recombinant lentivirus. [score:3]
The results indicated a significant decrease in luciferase activity that was induced by miR-182 over -expression when compared with the empty vector control (p < 0.001, Figure 5B). [score:2]
The results also illustrated that exogenetic expression of miR-182 in CRC cells caused a significant increase in cell migratory capacity using a wound-healing assay (p =0.002 in SW480, p =0.001 in DLD-1, Figure 2E). [score:2]
Moreover, these tumors that originated from SW480/miR-182 cells had decreased expression of SATB2 and E-cadherin, compared with that from SW480/miR-con (Figure 7B). [score:2]
Both miR-182 and SATB2 affect migration and invasion of CRC cells but in an opposite direction. [score:2]
Indeed, SATB2 restoration in SW480/miR-182 cells could inhibit both cell proliferation and migration ability compared with that of SW480/miR-182. [score:2]
Furthermore, we compared the correlation between miR-182 and SATB2 expression in clinical CRC tissues. [score:2]
We conducted luciferase activity assays to validate the targeting of SATB2 by miR-182. [score:2]
A recent systematic meta-analysis revealed that miR-182 is deregulated in colon or colorectal cancer [24]. [score:2]
In recent times, miR-182 has emerged as an important regulator of various physiological and pathological processes [8, 11, 23]. [score:2]
The deregulation of miR-182 has been identified in colorectal cancer (CRC). [score:2]
Moreover, compared with the control cells, the ability to form colonies in CRC cells increased owing to a stable over -expression of miR-182 (p=0.001 in SW480, p=0.003 in DLD-1, Figure 2C). [score:2]
Therefore, these results firmly illustrated that miR-182 acts as a pivotal mediator in the development and progression of CRC. [score:2]
For performing tumor growth assay, a total of 2 × 10 [6] cells of SW480 with stable over -expression of miR-182 were injected subcutaneously in upper and lower limbs of right flank of mice, while the control cells were injected into upper and lower limbs of left flank of mice (n = 6 per group). [score:2]
The results indicated that miR-182 promoted cell growth and colony formation and accelerated tumorigenesis in murine mo del of CRC xenograft. [score:1]
This is consistent with the previous findings of CRC studies [16, 17, 25], suggesting that a positive role for miR-182 in tumorigenesis. [score:1]
In the previous study, it was revealed that miR-182 plays an oncogenic role in breast cancer [13]. [score:1]
It was shown that miR-182 is associated with poor survival of breast cancer patients and promotes breast cancer metastasis [12]. [score:1]
In the presence of either miR-182 or miR-con, the firefly luciferase construct was cotransfected into SW480 cells with a control Renilla luciferase vector pRL-CMV (Promega). [score:1]
After 8 weeks, SW480/miR-182 cells developed dramatic metastatic nodules in liver, lung and peritoneal cavity, whereas SW480/miR-con cells only caused tumor increases without any metastasis (Figure 3D). [score:1]
Thus, the confirming results helped us in deducing that miR-182 is an oncogenic miRNA for CRC. [score:1]
In this study, we extend the study of miR-182 in tumor. [score:1]
miR-182 promoted tumor growth and metastasis in vivoThe effect of miR-182 on tumor growth was assessed in vivo by subcutaneously injecting of SW480/miR-182 and SW480/miR-con cells into the flank of mice. [score:1]
In this study, we demonstrated that miR-182 acts as a tumor growth- and metastasis-promoter in human CRC through repression of SATB2. [score:1]
H&E staining clearly illustrated the tumor invasion in intestinal wall, implantation metastasis of organs in peritoneal cavity, and the metastasis of liver, lymph node, and lung in SW480/miR-182 cells (Figure 3E and F). [score:1]
However, the activity of mt 3UTR vector was unaffected with a simultaneous transfection with miR-182 (p > 0.05, Figure 5B). [score:1]
3’UTR of SATB2 mRNA contains a complementary site for the binding region of miR-182. [score:1]
We focused on SATB2 from which orginated 3’UTR containing a binding site of miR-182. [score:1]
We conducted our search for determining the effects of miR-182 on CRC cells growth. [score:1]
However, Qu et al. illustrated the miR-182 induced mesenchymal to epithelial transition (MET) via repressing SNAIL2 in prostate cells [35]. [score:1]
When matrigel invasion assay was performed on CRC cells and control cells, it was found that the invasiveness was higher for CRC cells with stable over -expression of miR-182 compared with control cells (p =0.023 in SW480, p <0.001 in DLD-1, Figure 2D). [score:1]
However, the role and mechanism of miR-182 in CRC have not been completely understood till date. [score:1]
It could also attenuate the effects of miR-182 in CRC cells (p < 0.05, Figure 6D-F). [score:1]
miR-182 promoted tumor growth and metastasis in vivo. [score:1]
To confirm the effects of miR-182 on modulating the malignant phenotypes of CRC cells, we also investigated the change of aggressive phenotypes of CRC cells after reducing expression of miR-182. [score:1]
Investigations of possible mechanisms underlying these behaviors induced by miR-182 revealed that miR-182 induced epithelial-mesenchymal transition (EMT) by modulating the expression of key cellular molecules in EMT. [score:1]
A stem-loop quantitative RT-PCR was carried out to detect the expression of mature miR-182 using ABI TaqMan® MicroRNA Assay kit (Applied Biosystems, Foster City, USA) and gene-specific primers (ABI) using an ABI 7500 Real-Time PCR system. [score:1]
As shown in Figure 3A and B, the average tumor volume increased in SW480/miR-182 cells than in SW480/miR-con group (p < 0.05). [score:1]
Virus particles were harvested 48 hours after transfecting pLV-miR-182 with the envelope plasmid pMD2. [score:1]
However, the functional analyses of miR-182 in tumorigenesis have yielded inconsistent results in different cancer mo dels [7, 9, 12]. [score:1]
In addition, we explored the underlying mechanism of miR-182 functions in CRC. [score:1]
In all six CRC cell lines, miR-182 was significantly higher than in all of the non-cancerous tissue samples (p < 0.001, Figure 1C). [score:1]
This association indicated that miR-182 might well have a key role in CRC metastasis. [score:1]
Therefore, our data demonstrated that miR-182 was indeed a metastasis promoter in CRC, and the study also shed light on the molecular mechanisms of its anti-metastasis function in CRC patients. [score:1]
However, the role and mechanism of miR-182 in CRC have not been completely understood yet. [score:1]
In addition, our study revealed the functional mechanism of miR-182 in CRC metastasis. [score:1]
This correlation indicates that miR-182 might be playing a pivotal role in CRC metastasis. [score:1]
miR-182 accelerated CRC cells growth, invasion, and migration in vitro. [score:1]
The effect of miR-182 on tumor growth was assessed in vivo by subcutaneously injecting of SW480/miR-182 and SW480/miR-con cells into the flank of mice. [score:1]
At 30 days after subcutaneous injection, SW480/miR-182 and SW480/miR-con cells produced primary tumors. [score:1]
miR-182 belongs to the miR-183 family which is comprised of miR-96, miR-182 and miR-183. [score:1]
[1 to 20 of 128 sentences]
6
[+] score: 337
Other miRNAs from this paper: hsa-mir-96, hsa-mir-183, hsa-mir-200c, hsa-mir-200a
To assess whether miR-182 mediated P21 upregulation requires P53, p53 expression was inhibited by lentiviral sh-p53 in leiomyoma cell line DD-HLM (Figure 2E) and FTE194 (Figure 2F) and then overexpressed miR-182. [score:10]
When introducing miR-182 overexpression in FTE194, we noted not only the triggering of significant cellular senescence (Suppl Figure 2A) but also upregulated P21 expression with or without ROS exposure (Figure 2C, Suppl Figure 2C). [score:8]
E and F. P21 and P53 expression in uterine smooth muscle cell line, DD-HLM (E) and FTE194 (F) cells by controlling miR-182 expression, blocking p53 expression by sh-p53 and treating with H [2]O [2]. [score:7]
However, when p53 is lost, ROS upregulates miR-182 through the β-catenin pathway, but miR-182 mediated p21 upregulation is aborted (Figure 2E, 2F). [score:7]
We have observed that administering ROS or simply overexpressing miR-182 induces p21 upregulation and triggers SIPS in FTSE cells (Figure 2). [score:6]
We demonstrated that in the presence of normal P53, stress -induced miR-182 overexpression mediated by β-catenin upregulates P21 and this will likely drive cells into SIPS. [score:6]
MiR-182 expression was further examined when β-catenin expression was inhibited by si -RNA (F). [score:6]
Figure 3ROS or stress -induced miR-182 expression is regulated by β-catenin A. β-catenin mRNA expression in primary FTE cells (n = 3) treated by DMSO (ctrl) and H [2]O [2] detected by real time RT-PCR. [score:6]
In FTSE cells with p53 mutations, miR-182 overexpression no longer enhances p21, but may function as an “Onco-miR” through the repression of several tumor suppressor genes, including BRCA1 [30] and FOXO3a [31], FOXO1 [32, 33], MITF1 [34], MTSS1 [23], and RECK [35]. [score:6]
To explore what molecular mechanisms are involved with ROS -induced miR-182 expression in FTE cells, we examined several candidate genes that respond to ROS and potentially regulate miR-182 expression. [score:6]
E and F. To determine whether β-catenin specifically regulated miR-182 expression, β-catenin expression was controlled by different doses of β-catenin in the quantitative adenovirus infection by β-catenin construct Ad-S37A-β-cat-HA (×10 [6] PFU/ml) in FTE194 cells. [score:6]
We noted that only blocking p53 expression resulted in abolishing miR-182 mediated P21 upregulation in leiomyoma cells (Figure 2E) and FTSE cells (Figure 2F). [score:6]
To evaluate how β-catenin regulates miR-182 expression in FTE cells, β-catenin was overexpressed by introducing the adenovirus β-catenin construct Ad-S37A-β-cat-HA in FTSE cell lines, and miR-182 expression was examined. [score:6]
Future studies will be focused on developing the screening tests for miR-182 and mutant p53 expression in FTE cells for risk and non-risk populations and establishing a mouse mo del with overexpression of miR-182 and mutant p53 in FTE cells for ovarian cancer development. [score:6]
We found β-catenin upregulated miR-182 expression, and it was dose dependent (Figure 3E, Suppl Figure 3). [score:6]
Given that most of the ROSmiRs are directly or indirectly regulated by p53 [8] (Figure 1E), and p53 is frequently mutated during the early and later stages of high-grade serous carcinoma, the role of p53 independent ROSmiR, such as miR-182 expression and its function in FTE cells, seems to be pivotal when p53 is partly or completely inactivated. [score:6]
In FTSE cells with normal p53, miR-182 overexpression triggers SIPS by upregulation of p21 (Figure 3). [score:6]
Interestingly, miR-182 mediated P21 upregulation was not observed in cell line FTE237, which was immortalized by sh-p53, and no detectable p53 expression was noted (Suppl Figure 2D) [18]. [score:6]
Findings suggest that ROS -induced miR-182 expression is mostly through ROS -induced β-catenin expression and its nuclear translocation. [score:5]
C. P21 expression were examined by western blot in FTE194 cells by controlling miR-182 expression and treated with H [2]O [2] (100 μM). [score:5]
Furthermore, the level of P21 expression by miR-182 was much higher than simply ROS exposure and anti- miR-182 treatment was able to block P21 expression (Figure 2C, Suppl Figure 2C). [score:5]
When p53 is intact, these ROSmiRs including miR-182 function as tumor suppressors or cell cycle inhibitors by triggering SIPS (Figure 2). [score:5]
In this study, we overexpressed miR-182 in FTSE cell lines and found miR-182 overexpression can trigger significant cellular senescence in primary FTE and immortalized FTSE cells (Figure 2B, Suppl Figure 2A and 2B). [score:5]
When blocking β-catenin expression by si -RNA, ROS -induced miR-182 expression was significantly reduced (Figure 3F). [score:5]
MiR-182 overexpression further triggers SIPS through upregulation of p21 in the presence of p53 (Figure 2). [score:5]
MiR-182 overexpression significantly inhibits DNA damage response through its negative regulation of DNA repair genes, BRCA1 and FOXO3a [23, 24]. [score:5]
MiR-182 is overexpressed in most HGSC [23, 36] and its overexpression is associated with aggressive tumor growth and the worst clinical outcome [23]. [score:4]
Moreover, upregulation of three different forms of miR-182 (pre-, pri- and mature) and miR-182 family members (miR-96 and miR-183) suggests ROS -induced miR-182 is at transcriptional level and dose dependent in primary FTE (Figure 1B) and immortalized FTSE cell lines (Suppl Figure 1B). [score:4]
Taken together, our current study suggests that the response to elevated ROS or DNA stress in FTSE cells may trigger a series of events, beginning with stress -induced miR-182 expression and p53 mutations, leading to impairments of the DNA damage response, DNA instability, bypassing senescence, thus increasing the risk of HGSC transformation (Figure 7) [4, 23]. [score:4]
Moreover, miR-182 mediated P21 upregulation was dose dependent (Figure 2D). [score:4]
When both cells were treated by 100 μM H [2]O [2] for 24 hours, miR-182 upregulation was noted (data not shown). [score:4]
ROS or stress -induced miR-182 expression is regulated by β-catenin. [score:4]
We overexpressed miR-182 in FTSE cell lines and examined cellular senescence and several cell cycle negative regulators in primary and immortalized FTE cells. [score:4]
ROS or DNA stresses can robotically upregulate miR-182 [16, 27]. [score:4]
Disrupting the balance between stress and miRNA expression, especially miR-182, results in the impaired DNA damage response, senescence bypass, risk for tumor transformation and eventual development of DNA instable HGSC. [score:4]
Upregulation of miR-182 enhances senescence bypass in FTSE cells when exposed to ROS or DNA stress. [score:4]
However, in cells with impaired or null p53, ROS induced miR-182 can increase the chance of senescence bypass (no-longer upregulating P21) and promote cell transformation or colony formation. [score:4]
Findings strongly suggest that miR-182 triggers SIPS by upregulation of p21 and this process requires functional p53. [score:4]
These chronically stressed cells with miR-182 overexpression can occasionally transformed in vitro, detected by soft agar (Figure 4D). [score:3]
Results shown that h-FF or b-FF in ex vivo culture FTE cells increased miR-182 and p53 expression (Suppl Figure 6C). [score:3]
We found among most ROSmiRs, miR-182 was highly induced by ROS in cells with and without p53 expression. [score:3]
To further evaluate the cellular nature of the senescence bypassed FTSE cells with and without miR-182 overexpression, FTE194 cells were stably overexpressed with luciferase and grafted into the intrabursa [22]. [score:3]
At the end of 180 days, cell growth was detectable in 45% (9/20) of FTSE cells with miR-182 overexpression and only in 10% (1/10) of implants in the control group (Figure 4C). [score:3]
Although no tumor formation was noted in all of the mice, long-lasting cell growth of FTSE with miR-182 overexpression suggesting the role of promoting cell proliferation and independent growth by miR-182 when p53 is partly inactivated (Figure 4C). [score:3]
Current study also shows that FTSE and FTCE cells react differently to ROS -induced β-catenin and miR-182 expression (Figure 5). [score:3]
Findings suggest that higher levels of β-catenin and miR-182 expression in FTSE cells slow down DNA damage repair and this may result in increasing the risk of DNA alteration. [score:3]
Apparently, miR-182 overexpression significantly slowed DNA repair after 48 hours of ROS exposure. [score:3]
To further evaluate the cellular nature of the senescence bypassed FTSE cells with and without miR-182 overexpression, FTE194 cells were stably overexpressed with luciferase and grafted into the intrabursa in nude mice (for detailed techniques, please refer to our recent publication [22]). [score:3]
However, in addition to higher senescent rate in cells with miR-182 overexpression, these cells also obtained a significantly high-rate of senescence bypass when treated with ROS or DOX (Figure 4). [score:3]
β-catenin (hollow dot), miR-182 (dark square), and miR-200a (triangle dot) expression was detected by real time RT-PCR (E). [score:3]
The same cell lines without miR-182 overexpression were used as controls. [score:3]
As illustrated above, ROS significantly induces miR-182 overexpression (Figure 1). [score:3]
The chronically stressed cells with miR-182 overexpression can occasionally transformed in vitro, detected by soft agar. [score:3]
In this study, we found h-FF can significantly induce a high level of ROS production and increase miR-182 and p53 expression in FTSE cells (Figure 6). [score:3]
C and D. β-Catenin and miR-182 expression was detected in the sorted FTSE and FTCE cells with and without ROS treatment. [score:3]
However, in addition to higher senescent rate in cells with miR-182 overexpression (Suppl Figure 4A), these cells also obtained a significantly high-rate of senescence bypass when treated with ROS or DOX (Figure 4A). [score:3]
Pre- miR-182 lentivirus was prepared as previously described and its stable overexpression was made in FTE190, FTE194, FTE237, and FTE246 cell lines by the method described previously [23]. [score:3]
Therefore, ROS or DNA stress -induced miR-182 and other ROSmiR overexpression requires p53 for cell protection. [score:3]
Karyotypes were prepared and analyzed in FTE194 (n = 50) and FTE194 with miR-182 overexpression (n = 100) and the aneuploidy was counted and summarized in dotplots (bottom). [score:3]
D. P21 expression in FTE194 cells by administrations of different doses of miR-182 mimic (0–60 nM). [score:3]
Taken together, ROS induces a subset of miRNAs in FTE cells and most of them are mediated by p53 expression, but miR-182 is an exception. [score:3]
Senescence bypass cells for FTSE cells with and without miR-182 overexpression were engrafted in intraovarian bursa of female nude mice (NCI-Frederick) as previously described [22]. [score:3]
To address this question, we established stable overexpression of miR-182 in the immortalized FTSE cell lines. [score:3]
In brief, FTSE cells including FTE190, FTE194, FTE237 and FT246, with and without stable miR-182 overexpression were cultured in 100 mm dishes and pulse treated with 10 μM H [2]O [2] for three times per week. [score:3]
B. ROSmiR expression including pri-, pre- and mature miR-182 and its family member miR-96 when primary FTE cells were treated with different concentrations of H [2]O [2] (0: open box, 25 μM: gray box; 50 μM: dark box). [score:3]
B. The percentage of senescent cells was counted in FTE194 cells with (dark box) and without (open box) miR-182 overexpression. [score:3]
E. FTE194 cells with and without miR-182 overexpression were chronically treated with low dose of H [2]O [2] exposure (10 μM) in each passage and up to 15 passages. [score:3]
B and C. Senescence bypassed FTE194 cells with (test) and without (control) miR-182 overexpression were stably transfected with luciferase and grafted into the intrabursa in nude mice (B). [score:3]
We also examined whether h-FF or b-FF has any effect on miR-182 and p53 expression in cultured FTE cells. [score:3]
G. DNA damage response in ex vivo culture of the sorted FTSE (dark box) and FTCE (open box) cells with or without miR-182 overexpression (by transient transfection 60 nM miR-182 mimic) and anti- miR-182 treatment. [score:3]
Thus, h-FF can not only induce ROS production, but also increase the miR-182 and p53 expression in cultured FTE cells. [score:3]
We recently reported that overexpression of miR-182 [16] and miR-200a [17] can trigger significant cellular senescence in uterine leiomyoma. [score:3]
The cells with and without miR-182 overexpression treated with ROS and anti-miR-182, DNA damage repair were examined by immunofluorescent stain, H2AX at time points of 0, 8 and 48 hours. [score:3]
Our findings suggest that miR-182 plays a central role in coordinating with p53 to regulate p21 for cellular senescence and to maintain DNA integrity in ROS-exposed cells. [score:2]
We found a subset of miRNAs that were significantly dysregulated in FTE cells after H [2]O [2] exposure including let-7s, miR-34s, and miR-200s and miR-182 family members (Figure 1A, Suppl Table 1, Suppl Figure 1A). [score:2]
We suggest that p53 dysfunction is a prerequisite for miR-182 -mediated tumorigenesis through negative regulation of DNA repair and cell cycle pathway [22, 23]. [score:2]
D. Soft agar assays showed that chronic stress treatment in FTE194 and FTE237 cells with (test) and without (control) miR-182 overexpression increased anchorage independent growth. [score:2]
DNA alterations were characterized by a significant increase of aneuploidy in FTSE cells with miR-182 overexpression (Figure 4E, Suppl Figure 4B). [score:1]
E and F. DNA damage response in ex vivo culture of total FTE cells with or without miR-182 transient transfection. [score:1]
Both miR-182 and miR-200c were inducible when p53 was present, but only miR-182 was significantly induced by H [2]O [2] when p53 was blocked by sh-p53. [score:1]
Unlike other ROSmiRs, ROS -induced miR-182 does not require p53 in some cell types [8, 28] as well as in normal FTSE cells observed in this study (Figure 1). [score:1]
DNA alterations were characterized by a significant increase of aneuploidy in FTSE cells with miR-182 overexpression (Figure 4). [score:1]
miR-182 enhances senescence bypass in FTSE cells under DNA stress and impaired p53. [score:1]
Goat anti-Mouse IgM HRP Conjugate was used and results were taken by chemiluminescent readings using a Cytation 3 Cell Imaging Multi-Mode Reader in three time points for control (open dot), anti- miR-182 (dark square) and miR-182 mimic (triangle). [score:1]
p21 was one of the major genes influenced by miR-182. [score:1]
We found that the baseline β-catenin and miR-182 family members were higher in FTSE than in FTCE cells (Figure 5C). [score:1]
To investigate the role of miR-182 in DNA integrity and the chances of tumor transformation, we isolated the senescence bypass FTSE cells with and without miR-182 overexpression and treated with lower doses (25–50 μM) of H [2]O [2] in each passage and propagated up to 15 passages (to mimic chronic stress in vitro). [score:1]
One of the major functions for miR-182 involves the DNA damage response [23]. [score:1]
Our study for the first time, illustrates the dual effects of miR-182 in FTSE cells and how these are closely related to the intactness of p53 function. [score:1]
To evaluate how the FTSE cells react to stress when p53 is partly or completely lost or mutated, we established stable overexpression of miR-182 in the immortalized FTSE cell lines. [score:1]
In the same experiment setting, transient transfection of anti-miR-182 along with ROS exposure would significantly improve DDR to 55% of FTSE cells and 70% of FTCE cells at 48 hours, respectively (Figure 5G). [score:1]
ROS or stress -induced miR-182 is through β-catenin when P53 is inactivated. [score:1]
This difference provides a strong clue for the potential functional role of miR-182 in the early tumorigenesis of HGSC when p53 is mutant. [score:1]
Although no tumor formation was noted in all of the mice by histologic evaluation, IVIS data showing long-lasting cell growth of FTSE with miR-182 overexpression suggests the role of promoting cell proliferation and independent growth by miR-182 when p53 is partial inactivated (Figure 4). [score:1]
Anti- miR-182 and scramble control were from Regulus Therapeutics. [score:1]
Consistent with β-catenin reaction, miR-182 and its family members were also significantly higher in FTSE cells than in FTCE cells when exposed to ROS (Figure 5D). [score:1]
The transient transfections for miRNA mimic and anti- miR-182 were previously described [22]. [score:1]
[1 to 20 of 97 sentences]
7
[+] score: 308
In this study, we showed that NDRG1 could be directly targeted by miR-182 and uncovered a new epigenetic regulation of NDRG1, suggesting that upregulation of miR-182 may provide an alternative mechanism for the reduced expression of the NDRG1 tumor suppressor protein in PCa cells. [score:12]
Luciferase activity of the pmirGLO/NDRG1-UTR was dramatically inhibited by overexpression of miR-182 with cotransfection with miR-182 mimics and significantly increased by downregulation of miR-182 with cotransfection with miR-182 inhibitors in PC-3 cells, compared to the control plasmids (Figure 11), suggesting that miR-182 specifically targets the NDRG1 3′-UTR. [score:11]
Overexpression of miR-182 significantly decreased the protein expression levels of NDRG1 and downregulation of miR-182 dramatically increased the protein expression levels of NDRG1 (* P<0.05, ** P<0.01). [score:10]
On the contrary, after downregulation of miR-182 by an inhiobitor, the protein expression levels of NDRG1was dramatically increased compared to miR-182 inhibitor-NC -transfected cells (Figure 10), indicating that NDRG1 is a potential miR-182 target gene. [score:9]
We observed that miR-182 was significantly overexpressed in PCa cell lines, compared to RWPE-1. Furthermore, ectopic overexpression of miR-182 significantly promotes the proliferation, increases the invasion, promotes the G1/S cell cycle transition and reduces early apotosis of PC-3 cells, while suppression of miR-182 decreased the proliferation and invasion, inhibits the G1/S cell cycle transition and increase early apotosis of PC-3 cells. [score:8]
, Ltd, Shanghai, China), synthetic negative control miRNAs (miR-182 mimics-NC), synthetic miR-182 -inhibitor sequence or synthetic miR-182 -inhibitor negative control (miR-182 inhibitor-NC). [score:7]
Real-time RT-PCR analysis revealed that miR-182 expression was markedly increased in four common PCa cell lines tested (PC-3, DU145, 22Rv1 and LNCaP), compared to normal prostate epithelial RWPE-1 cell, indicating that miR-182 is upregulated in PCa cell lines and PC-3 has the highest expression level (Figure 2). [score:7]
These results showed that miR-182 increases the proliferation and invasion of PCa PC-3 cells by directly targeting the NDRG1 3′-UTR to downregulate NDRG1. [score:7]
Sequences of miR-182 mimics, miR-182 mimics-NC, miR-182 -inhibitor and miR-182 inhibitor-NC were shown in table 1. All mimics and inhibitors were labelled with FAM (carboxyfluorescein). [score:7]
Then we revealed that miR-182 expression was markedly increased in four common PCa cell lines tested (PC-3, DU145, 22Rv1 and LNCaP), compared to normal prostate epithelial RWPE-1 cell, indicating that miR-182 is upregulated in PCa cell lines and PC-3 has the highest expression level. [score:7]
showed that mimics or inhibitors were efficiently transfected (Figure 3) and the expression level is highest in miR-182 mimics group and lowest in miR-182 inhibitor group (Figure 4). [score:7]
However, miR-182 could suppresse lung tumorigenesis through down regulation of RGS17 expression in vitro [18]. [score:6]
0068982.g010 Figure 10 results of NDRG1 protein expression in PC-3 cells after transfection with miR-182 mimics or inhibitors. [score:5]
On the contrary, after downregulation of miR-182 by an inhiobitor, the growth rate of PC-3 cells was dramatically decreased compared to miR-182 inhibitor -NC -transfected cells (P<0.05) (Figure 5). [score:5]
PC-3 cells transfected with either miR-182 mimics or miR-182 mimics-NC, or miR-182 -inhibitor and miR-182 inhibitor-NC were collected. [score:5]
PC-3 cells transfected with either miR-182 mimics or miR-182 mimics-NC, or miR-182 -inhibitor and miR-182 inhibitor-NC were collected and fixed with 70% ethanol for the detection of early apoptosis. [score:5]
In this study, we demonstrated that miR-182 promoted PCa PC-3 cells proliferation and invasion by directly targeting the 3′-UTR of N-myc downstream regulated gene 1 (NDRG1, NM_006096.3) mRNA. [score:5]
PC-3 cells transfected with either miR-182 mimics or miR-182 mimics-NC, or miR-182 -inhibitor and miR-182 inhibitor-NC were harvested 72 h after transfection, washed with cold phosphate buffered saline (PBS), and fixed in 1 ml of 70% ethanol. [score:5]
The results show that the expression level is highest in miR-182 mimics group and lowest in miR-182 inhibitor group. [score:5]
On the contrary, after downregulation of miR-182 by an inhiobitor, the early apoptosis rate of PC-3 cells was dramatically increased compared to miR-182 inhibitor-NC -transfected cells (Figure 7). [score:5]
Further research is still required to examine whether other miRNAs or signaling pathways can regulate NDRG1 in PCa, because we could not exclude that there might be other microRNAs, not found yet, to play an important role in regulating NDRG1 in PCa, and whether miR-182 can target other members of the NDRG1 family. [score:5]
Western Blotting results of NDRG1 protein expression in PC-3 cells after transfection with miR-182 mimics or inhibitors. [score:5]
These results indicated that these mimics or inhibitors can mimic or inhibit miR-182 effectively. [score:5]
PC-3 cells were divided into five groups according to different transfection contents: a: (blank) pmirGLO/NDRG1-UTR; b: pmirGLO/NDRG1-UTR+miR-182 inhibitor-NC; c: pmirGLO/NDRG1-UTR+miR-182 -inhibitor; d: pmirGLO/NDRG1-UTR+miR-182 mimics-NC; e: pmirGLO/NDRG1-UTR+miR-182 mimics. [score:5]
In order to explore the mechanism of miR-182, we identified NDRG1 as a putative miR-182 target gene using bioinformatic analysis, and confirmed that NDRG1 is a direct target of miR-182 by dual luciferase reporter gene assay. [score:5]
On the contrary, after downregulation of miR-182 by an inhiobitor, PC-3 cells had a significantly higher percentage of cells in the G0/G1 phase and decreased percentage of cells in the S phase, compared to miR-182 inhibitor-NC -transfected cells (Figure 6). [score:5]
MiR-182 Expression Level is Significantly Changed after Transfection with Mimics or Inhibitors. [score:4]
The upregulation result of miR-182 was consistent with the study by Schaefer A et al [14]. [score:4]
Western Blotting results showed that overexpression of miR-182 in PC-3 cells significantly decreased the protein expression levels of NDRG1 after transfection with miR-182 mimics, compared to miR-182 mimics -NC -transfected cells. [score:4]
Studies showed that miR-182 could promote melanoma metastasis by repressing FOXO3 and microphthalmia -associated transcription factor [16], meanwhile, miR-183-96-182 cluster was overexpressed in prostate tissue and could regulate Zinc homeostasis in prostate cells [17]. [score:4]
MiR-182 expression level was detected by real-time RT-PCR after transfection with mimics or inhibitors in PC-3 cells. [score:4]
Luciferase activity of the pmirGLO/NDRG1-UTR was dramatically inhibited in miR-182 mimics group and significantly increased in miR-182 inhibitors group, compared to the control groups (* P<0.05, ** P<0.01). [score:4]
miRNA-182 was up-regulated with fold change of 3.07 and further confirmed by real-time RT-PCR with fold change of 2.85. [score:4]
results showed that overexpression of miR-182 in PC-3 cells significantly decreased the protein expression levels of NDRG1 after transfection with miR-182 mimics, compared to miR-182 mimics -NC -transfected cells. [score:4]
These results demonstrated that upregulation of miR-182 reduces the early apoptosis of PC-3 cells. [score:4]
These results demonstrated that upregulation of miR-182 promotes the proliferation of PC-3 cells. [score:4]
0068982.g011 Figure 11Luciferase activity of the pmirGLO/NDRG1-UTR was dramatically inhibited in miR-182 mimics group and significantly increased in miR-182 inhibitors group, compared to the control groups (* P<0.05, ** P<0.01). [score:4]
MiR-182 expression in PC-3 cells measured by real-time RT-PCR after transfection with miR-182 mimics or inhibitors. [score:3]
In summary, the key finding of the current study is that miR-182 can increase the proliferation of PCa cell lines by targeting NDRG1. [score:3]
Analysis of cell cycle in PC3 cells after transfected with miR-182 mimics or inhibitors. [score:3]
Early apoptosis detection of PC-3 cells transfected with miR-182 mimics or inhibitors. [score:3]
Furthermore, a new study showed that miR-182 and microRNA-200a could control G-protein subunit alpha-13 (GNA13) expression and cell invasion synergistically in PCa cells [19]. [score:3]
In the current study, we first screened the miRNAs related to PCa by miRNA microarrays, and according to the preliminary results, we found that microRNA-182 (miR-182) was overexpressed in PCa tissues. [score:3]
MiR-182 was Upregulated in PCa Cell Lines. [score:3]
MiR-182 Directly Targets the Metastasis Supressor Gene NDRG1 in PC-3 Cells. [score:3]
MiR-182 was up-regulated with fold change of 6.14 and further confirmed by real-time RT-PCR with fold change of 5.70. [score:3]
Overexpression of miR-182 Promotes Proliferation in PC-3 Cells. [score:3]
PC-3 cells were observed using fluorescence microscope after transfection with miR-182 mimics or inhibitors. [score:3]
Overexpression of miR-182 Promotes the G1/S Cell Cycle Transition in PC-3 Cells. [score:3]
After miRNA microarray analysis and real-time RT-PCR confirmation, we demonstrated that miR-182 is upregulated in Chinese PCa tissues, compared to BPH tissues. [score:3]
The results show that the early apoptosis rate is lowest in miR-182 mimics group and highest in miR-182 inhibitor group (* P<0.05, ** P<0.01). [score:3]
Overexpression of miR-182 Reduces Early Apotosis of PC-3 Cells. [score:3]
Overexpression of miR-182 significantly increased the invasive potential of PC-3 cells when transfected with miR-182 mimics compared with control cells in Transwell assay with Matrigel, and cells transfected with miR-182 inhibitor resulted in a significantly decresed invasive potential (Figure 8). [score:3]
MiR-182 was Upregulated in PCa Tissues. [score:3]
Schematic digram of NDRG1 3′-UTR region targeted by miR-182. [score:3]
As the most significant differentially expressed miRNA between PCa and BPH tissues, miR-182 was chosen for further study. [score:3]
This data suggested that overexpression of miR-182 could promote the G1/S cell cycle transition, and may therefore, enhance the proliferation of PC-3 cells. [score:3]
Next we prove that miR-182 specifically targets the NDRG1 3′-UTR in PC-3 cells. [score:3]
Overexpression of miR-182 Increases Invasion in PC-3 Cells. [score:3]
Sequences of miR-182 mimics and inhibitors. [score:3]
showed that the early apoptosis rate of miR-182 overexpressing cells was dramatically decreased, compared to miR-182 mimics-NC -transfected cells. [score:2]
Invasion assays were performed with PC-3 cells transfected with miR-182 mimics or inhibitors. [score:2]
This data indicates that miR-182 plays an essential role in the regulation of PCa cell proliferation and may function as an onco-miRNA. [score:2]
Our results suggest that miR-182 may play an important role in the development and progression of PCa. [score:2]
0068982.g008 Figure 8Invasion assays were performed with PC-3 cells transfected with miR-182 mimics or inhibitors. [score:2]
MiR-182 -overexpressing PC-3 cells had a significantly lower percentage of cells in the G0/G1 phase and increased percentage of cells in the S phase, compared to miR-182 mimics-NC- transfected cells. [score:2]
MiR-182 may sever as a novel therapeutic target for the treatment of PCa. [score:2]
According to the potential miR-182 binding sequence of NDRG1 3′-UTR, a double - stranded sequence was obtained by annealing using two single-strands NDRG1-Top, (NheI) 5′- CTAGCTAGCGGCCGCTAGT CCTC AGAGAC ACCAAACTGCCAAAAG- 3′; NDRG1-Bot (SalI) 5′- TCGACTTTTGGCA GTTTGGTGTC TCTGAGG ACTAGCGGCCGCTAG- 3′, and then cloned into the NheI/SalI sites of pmirGLO-Dual-luciferase reporter vector. [score:1]
Each well received 10 µl of lipofectamine reagent and 50 pmol of synthetic miR-182 mimics (GenePharma Co. [score:1]
Identification of miR-182 Binding Sites in NDRG1 3′-UTR Region. [score:1]
NDRG1 3′-UTR region has only one highly conserved miR-182 binding sites after bioinformatic analysis. [score:1]
miR-182 expression in different prostate cells measured by real-time RT-PCR. [score:1]
Next, we found that NDRG1 3′-UTR region has only one highly conserved miR-182 binding sites (Figure 9). [score:1]
MiR-182 was thought to be an important oncomiR. [score:1]
Using MTT assays, we observed that the growth rate of miR-182 overexpressing cells was dramatically increased, compared to miR-182 mimics -NC -transfected cells (P<0.05). [score:1]
These inconsistent results indicate that the function of miR-182 is complex and further study is needed. [score:1]
0068982.g009 Figure 9 NDRG1 3′-UTR region has only one highly conserved miR-182 binding sites after bioinformatic analysis. [score:1]
To confirm the function of the putative miR-182 binding site in the NDRG1 3′-UTR, we synthesized the double - stranded sequence which included the miR-182 binding site and cloned into the luciferase reporter plasmid. [score:1]
These data suggest that miR-182 increases invasion in PC-3 cells in vitro. [score:1]
PmirGLO-Dual-luciferase reporter vector (7350 bp, Promega, Madison, WI, USA) was used to confirm the function of the putative miR-182 binding site in the NDRG1 3′-UTR. [score:1]
[1 to 20 of 80 sentences]
8
[+] score: 302
miR-182-5p downregulates FLOT1 expression by directly targeting its 3′UTR. [score:9]
Silencing FLOT1 by small interfering RNAs phenocopied the effects of miR-182-5p overexpression, whereas restoration of FLOT1 in miR-182-5p -overexpressed RCC cells partly reversed the suppressive effects of miR-182-5p. [score:7]
However, three studies illustrated that the ectopic expression of miR-182-5p inhibits the cell growth of posterior uveal melanoma, lung cancer and stomach cancer by targeting MITF, BCL2, cyclin D2, RGS17 and CREB1 [26- 28]. [score:7]
To determine whether the downregulation of FLOT1 was involved in miR-182-5p -mediated suppression of proliferation, we first analyzed the functions of FLOT1 in RCC cells, which had not been previously reported. [score:6]
Taken together, these results suggest that miR-182-5p inhibits the proliferation of RCC cells via, at least in part, directly targeting the 3′-UTRs of FLOT1. [score:6]
Thus, we hypothesized that the upregulation of miR-182-5p might inhibit AKT/FOXO3a signaling. [score:6]
Although down expression of miR-182-5p has been reported in several types of human cancers [26- 28], little is known about the mechanisms of its downregulation. [score:6]
miR-182-5p, by targeting FLOT1, could suppress proliferation and tumorigenesis of RCC cells. [score:5]
Additionally, overexpression of miR-182-5p induced G1-phase arrest via inhibition of AKT/FOXO3a signaling. [score:5]
To further validate the expression pattern of miR-182-5p in RCC, we quantified the expression levels of miR-182-5p in 25 pairs of human RCC tissues and adjacent non-tumor tissues by qRT-PCR (Figure  1A). [score:5]
Upregulation of miR-182-5p in RCC cells triggers G1-phase arrest and regulates cell cycle factors through AKT/FOXO3a signaling. [score:5]
Overexpression of miR-182-5p inhibits the proliferation and tumorigenicity of RCC cells in vitro and in vivoWe transfected the RCC cell lines 786-O and Caki-1 with miR-182-5p mimics and examined the effects on cellular proliferation. [score:5]
In this study, we observed that the expression of miR-182-5p was decreased in most of our RCC tissues and that miR-182-5p may serve as a tumor-suppressor gene. [score:5]
FLOT1, a putative target of miR-182-5p identified by TargetScan, was of particular interest because it had three high scoring predicted binding sites and was previously considered as a positive cell cycle regulator in breast cancer [36]. [score:5]
Furthermore, gain-of-function analyses of miR-182-5p in vitro and in vivo suggest that miR-182-5p was able to suppress the proliferation and tumorigenicity of RCC cells, and may serve as a tumor-suppressor gene. [score:5]
Figure 3 Overexpression of miR-182-5p inhibits the G1/S transition and cell cycle progression in RCC cells. [score:5]
In parallel, co-transfection of pFLOT1 was applied to abrogate the FLOT1 expression inhibition by miR-182-5p (Figure  6A). [score:5]
In the current study, we found that the upregulation of miR-182-5p decreased AKT phosphorylation and significantly increased the transactivation activity of FOXO3a, suggesting that this pathway might represent a new mechanism underlying the development of RCC. [score:5]
We have also demonstrated that the molecular mechanism by which miR-182-5p inhibited RCC cell proliferation and tumorigenicity could be attributed to, at least in part, triggering G1-phase arrest via suppression of the AKT/FOXO3a signaling pathway. [score:5]
As indicated by the previous published datasets, miR-182-5p was in a down-regulated expression pattern in RCC compared with normal renal tissue [29, 30]. [score:5]
Overexpression of miR-182-5p inhibits the proliferation and tumorigenicity of RCC cells in vitro and in vivo. [score:5]
In addition, for the first time, we found that miR-182-5p could suppress the proliferation and tumorigenicity of RCC cells by targeting FLOT1. [score:5]
The results showed that the expression level of miR-182-5p was generally lower in tumor tissues compared to matched non-tumor tissues (19 out of 25 exhibited a down-regulated pattern). [score:5]
Enforced expression of miR-182-5p in RCC cells significantly inhibited the proliferation and tumorigenicity in vitro and in vivo. [score:5]
Figure 4 FLOT1 is a direct target of miR-182-5p. [score:4]
In addition, FOXO3a activity was strongly activated by the upregulation of miR-182-5p, as demonstrated by a FOXO3a luciferase reporter vector (Figure  3C). [score:4]
miR-182-5p is frequently down-regulated in human RCC tissues. [score:4]
In this study we observed the frequent downregulation of miR-182-5p in human RCC tissues. [score:4]
We found that the treatment of cells with 5-Aza significantly elevated the expression of miR-182-5p in both cell lines (Figure  1C), indicating the existence of epigenetic regulation. [score:4]
Consistent with the cell cycle arrest phenomenon, the G1/S transition regulators CCND1 and CDK4 were significantly decreased at the protein and mRNA levels in miR-182-5p -overexpressing cells (Figure  3B, 3D and Additional file 3: Figure S3). [score:4]
Figure 5 Downregulation of FLOT1 phencopied the effect of miR-182-5p. [score:4]
Thus, our current study reveals what we believe to be a novel upstream regulatory mechanism of FLOT1 in cancer cells Our study suggests that miR-182-5p is a potential tumor suppressor in RCC. [score:4]
Thus, the first important finding of our present study is that epigenetic modulation may be involved in the regulation of miR-182 expression. [score:4]
miR-182-5p is down-regulated in RCC. [score:4]
Epigenetic modulation may be involved in the regulation of miR-182-5p expression. [score:4]
Moreover, the treatment of cells with 5-Aza apparently reduced the methylation level of this CpG island (Additional file 1: Figure S1), which further indicated that this epigenetic modulation could be involved in the regulation of miR-182-5p expression. [score:4]
Liu et al. previously reported that this CpG island was exclusively methylated in melanoma cells and may be involved in the regulation of miR-182 expression [32]. [score:4]
Forced FLOT1 expression partially, but significantly, attenuated the G1-phase arrest induced by miR-182-5p (Figure  6B and C) and promoted cell viability (Additional file 8: Figure S8). [score:3]
Figure 6 Forced expression of FLOT1 partly rescued miR-182-5p -dependent G1 phase arrest. [score:3]
Additionally, FLOT1 was directly regulated by miR-182-5p. [score:3]
The ectopic expression of miR-182-5p was confirmed by qRT-PCR (Additional file 2: Figure S2). [score:3]
As a result, FLOT1, a marker of lipid rafts, was identified as a novel target of miR-182-5p. [score:3]
Moreover, silencing FLOT1 significantly suppressed the proliferation and tumorigenicity of RCC cells in vitro and induced G1 arrest (Figure  5B, C and D), which phenocopied the effects of miR-182-5p on RCC cells. [score:3]
On one hand, miR-182-5p was reported to function as an oncogene in most common types of human cancers, but on the other hand, miR-182-5p exhibited tumor-suppressive activity in human gastric adenocarcinoma, lung adenocarcinomas, and posterior uveal melanoma [26- 28]. [score:3]
The ectopic expression of miR-182-5p was confirmed by qRT-PCR. [score:3]
Thus, we further explored the possible mechanism by which miR-182-5p could inhibit the AKT/FOXO3a signaling pathway. [score:3]
To clarify the possible roles of the epigenetic mechanism of miR-182-5p silencing in RCC cell lines, we treated 786-O and Caki-1 with 5-Aza, a methyltransferase inhibitor. [score:3]
Emerging evidence has suggested that dysregulation of miR-182-5p may contribute to tumor development and progression in several types of human cancers. [score:3]
Decreased Ki-67 expression was also detected in miR-182-5p treated tumors. [score:3]
Moreover, FLOT1 was confirmed as a target of miR-182-5p. [score:3]
Therefore, defining the function of miR-182-5p is complicated because it can be an oncogene or a tumor suppressor in the context of different cancers. [score:3]
Over -expression of miR-182-5p induced a significant accumulation of cells in G1-phase and blocks G1-S entry. [score:3]
The underlying mechanism for miR-182-5p -suppressed tumor growth was further explored with FACS. [score:3]
We observed a significant increase in the percentage of cells in the G1/G0 phase and a decrease in the percentage of cells in the S phase in miR-182-5p -overexpressing cells (Figure  3A). [score:3]
As shown in Figure  3B and Additional file 3: Figure S3, the phosphorylation levels of both FOXO3a and AKT decreased in miR-182-5p -overexpressing RCC cells. [score:3]
Thus, the cell context -dependent balance among the network of directly regulated genes of miR-182-5p may determine the biological function in a specific cancer. [score:3]
Thus, we speculated that miR-182-5p might be a putative tumor suppressor in RCC. [score:3]
Click here for file The ectopic expression of miR-182-5p was confirmed by qRT-PCR. [score:3]
To further confirm the above findings, the growth rates of Caki-1 cells with or without miR-182-5p over -expression were examined after s. c. implantation into BALB/c mice. [score:3]
IHC staining confirmed that the tumors derived from the miR-182 -overexpressing cells displayed much lower Ki-67 indices than the tumors from the control group (Figure  2E). [score:3]
The over -expression of miR-182-5p resulted in a dramatic retardation of tumor growth in vivo (Figure  2C and D). [score:3]
RNA was extracted and analyzed for the expression of miR-182-5p. [score:3]
Ectopic overexpression of FLOT1 (without the 3′-UTR) significantly abrogated the miR-182 -induced G1 arrest of RCC cells and promoted cell viability in vitro. [score:3]
With qRT-PCR and western blot, we verified that FLOT1 was significantly decreased in both mRNA and protein level after the over -expression of miR-182-5p (Figure  4D and E). [score:3]
The relative expression of miR-182-5p was normalized to an endogenous control (U6 RNA). [score:3]
Quantitative RT-PCR was used to quantify miR-182-5p expression in RCC clinical tissues. [score:3]
A miR-182-5p target was determined by luciferase reporter assays, quantitative RT-PCR, and Western blotting. [score:2]
Figure 2 Effect of miR-182-5p in regulating RCC cells proliferation. [score:2]
In the present study, the miR-182-5p expression level was significantly lower in RCC tissues compared with the corresponding non-tumor tissues. [score:2]
Most previous studies suggested an oncogenic role for miR-182-5p in various types of human cancers, including prostate cancer, breast cancer, bladder cancer, liver cancer, colon cancer, cervical cancer, ovarian cancer, and glioma [18- 25]. [score:1]
Cancer-specific methylation pattern of CpG islands associated with miR-182-5p in RCC cells. [score:1]
We first predicted the presence of CpG islands in the upstream sequence of pri-miR-182. [score:1]
Taken together, these results showed that miR-182-5p negatively modulate RCC cells growth. [score:1]
CCK-8 and colony formation assays revealed that the overexpression of miR-182-5p significantly decreased the growth rate of both RCC cell lines, compared to NC -transfected cells (Figure  2A and B). [score:1]
HEK 293 T cells were plated in 24-well plates and transfected with 50 nM miR-182-5p or NC and 100 ng of the luciferase vector (pmirGLO). [score:1]
When palpable tumors arose, the mice were injected intratumorally with 30 μg of Lipofectamine 2000-encapsulated miR-182-5p or NC every 3 days for 3 weeks. [score:1]
After an overnight incubation, the cells were transfected with the RNAs (miR-182-5p, siFLOT1 or NC) for 2 days. [score:1]
MicroRNA-182-5p is a member of the miR-183 family which includes miR-96, miR-182 and miR-183. [score:1]
However, the luciferase activity of the control vector was unaffected by the simultaneous transfection of miR-182-5p (Figure  4C). [score:1]
miR-182-5p or NC was cotransfected with pFLOT1 or the empty vector (pNull). [score:1]
To detect the level of miR-182-5p, the complementary DNA was synthesized using One Step PrimeScript miRNA cDNA Synthesis Kit (TaKaRa, Japan), and real-time PCR analysis was performed with the ABI 7500 FAST real-time PCR System. [score:1]
The miR-182-5p mimic, small interfering RNAs (siRNAs) of FLOT1 and the negative control were purchased from GenePharma (Shanghai, China). [score:1]
We transfected the RCC cell lines 786-O and Caki-1 with miR-182-5p mimics and examined the effects on cellular proliferation. [score:1]
The 3′-UTR of FLOT1 mRNA has 3 putative miR-182-5p binding sites (Figure  4B). [score:1]
Repression of FLOT1 plays essential roles in miR-182-5p-supressed proliferation of RCC cells. [score:1]
For convenience, these are termed miR-182-5p, siFLOT1 and NC, respectively. [score:1]
We then carried out luciferase reporter assays to verify a direct interaction between miR-182-5p and the 3′UTR of FLOT1. [score:1]
The restoration of miR-182-5p could be a vigorous therapeutic strategy for RCC treatment. [score:1]
php) predicted that the transcription start site (TSS) of miR-182-5p may be located 9729 upstream of the precursor. [score:1]
The human miR-182-5p, located at chromosome 7q32 region, is transcribed from the cluster of the miR-183 family and has been extensively researched in human cancers. [score:1]
To the best of our knowledge, the biological function of miR-182-5p in RCC is not yet well understood. [score:1]
The tumor volumes and the growth curves indicated that tumor in miR-182-5p group was in a significant slower growth pattern. [score:1]
Thus our next aim was to investigate the targets of miR-182-5p that contributed to its anti- proliferation function. [score:1]
Cotransfected of either miR-182-5p or NC and luciferase reporter constructs comprising 3′-UTR was conducted. [score:1]
[1 to 20 of 94 sentences]
9
[+] score: 296
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-96, hsa-mir-183, hsa-mir-125b-1, hsa-mir-125b-2
ATO induced down-regulation of miR-182-5p accompanied by up-regulation of SESN2 in these cell lines suggests that ATO -mediated regulation of miR-182-5p expression may be an important therapeutic property. [score:10]
MiR-182-5p expression is up-regulated in hepatocellular carcinoma, and the miRNA has been shown to function as an oncogene by targeting various genes, including SESN2 and TP53INP1, related to cancer [66]. [score:8]
Here, we showed that moderate doses of ATO significantly suppress miR-182 expression, leading to up-regulation of the anti-oxidant molecule SESN2 in GBM cells. [score:8]
To examine if over -expression of miR-182-5p could also regulate SESN2 and TP53INP1 in different cell type, we introduced a tetracycline-inducible (tet-on) miR-182-5p expression system to H1299 lung cancer cells to express miR-182-5p. [score:8]
Figure 4Association of miR-182-5p and SESN2 expression with overall survival using publicly available datasets (A) Comparison of high and low miR-182-5p expressive levels on overall survivals of glioma (TCGA Brain Lower Grade Glioma data) and lung cancer patient (TCGA Lung Squamous Cell Carcinoma data); (B) Comparison of high and low SESN2 mRNA expressive levels on overall survivals of glioma (accession No. [score:7]
Here, we showed that the binding of AGO2 to SESN2 mRNA was attenuated by ATO as well as by transfection with anti-miR-182-5p (ASO), suggesting that ATO directly suppresses miR-182-5p to control the up-regulation of SESN2. [score:7]
gmt, see Materials and Methods) revealed that miR-182-5p -associated genes were significantly enriched (maximum ES values of 0.01 and 0.042 for up-regulated genes and down-regulated genes, respectively. [score:7]
Overexpression of miR-182-5p also markedly suppressed SESN2 expression over the same period (Figure 2H). [score:7]
In contrast to SESN2, HO-1, which is not a target of miR-182-5p, was significantly induced by ATO but not suppressed by overexpression of miR-182-5p (Figure 2I). [score:7]
These findings suggested that ATO -mediated induction of oxidative stress suppressed miR-182-5p, leading to the up-regulation of SESN2. [score:6]
Additionally, ATO down-regulated the expression of miR-96 and miR-183 in addition to miR-182, and all three miRNAs are located on the same gene cluster. [score:6]
ATO -mediated suppression of miR-182-5p led to up-regulation of SESN2 mRNA, whereas NAC reversed this phenomenon (Figure 1E). [score:6]
These preliminary analyses using public available datasets implies that high expression of miR-182-5p and low expression of SESN2 may lead to higher survival rates. [score:5]
These data suggest that ATO -mediated suppression of miR-182 protects cells from oxidative stress by inducing the expression of the anti-oxidative molecule SESN2. [score:5]
Although the ranks of SESN2 targeted by miR-182-5p was moderate (Table 1), we still decided to investigate if ATO suppressed miR-182-5p would correlate to SESN2 expression and associated oxidative stress response. [score:5]
Figure 1 (A) Dose -dependent suppression of miR-182-5p expression by ATO (n=4). [score:5]
ATO induces oxidative stress and SESN2 expression via suppression of miR-182-5p. [score:5]
Because ATO suppressed miR-182-5p, we next examined whether manipulating miR-182-5p expression affected the binding of AGO2 to SESN2 and TP53INP1 mRNA. [score:5]
It appeared that the analytic results using PROGmiR and PRECOG partially agreed our findings because high expression of miR-182-5p and low expression of SESN2 contributed to longer survivals in glioma and lung cancers. [score:5]
Figure 2MiR-182-5p suppressed the expression of SESN2 and TP53INP1 (A) Sequence complementary between miR-182-5p and 3’-UTR of SESN2 and TP53INP1. [score:5]
Additionally, ATO suppressed the expression of not only miR-182-5p but also miR-96-5p and miR-183-5p, which are derived from the same transcript as miR-182-5p (Figure 3C). [score:5]
However, miR-182-5p ASO showed no significant inhibition of AGO2 binding to TP53INP1 mRNA, suggesting that TP53INP1 mRNA may be targeted by miR-182 through the aid of a mRNA -binding protein other than AGO2. [score:5]
Our data also showed that overexpression of a miR-182-5p mimic enhanced ATO -induced cytotoxicity in GBM, suggesting that miR-182-5p plays a tumor-suppressive role that is consistent with previous reports [67– 69]. [score:5]
Using the ROS scavenger NAC in ATO -treated cells demonstrated that the effect of ATO on SESN2 and miR-182 expression is directly related to oxidative stress. [score:4]
Because ATO could suppress miR-182-5p and lead to up-regulation of SESN2, it is interesting to investigate whether these genes would be associated with overall survival of patients. [score:4]
Here we found that miR-182-5p plays an important role in regulating the expression of anti-oxidant related genes to protect against ATO. [score:4]
miR-182-5p targeting of SESN2 and/or TP53INP1 may be directly responsible for this phenomenon. [score:4]
We next examined whether miR-182-5p would directly inhibit SESN2. [score:4]
These results support that miR-182-5p would play an important role in regulating SESN2 expression. [score:4]
MiR-182-5p suppressed the expression of SESN2 and TP53INP1. [score:4]
A mo del showing the pathway for ATO -mediated suppression of the miR-182-5p gene cluster and regulation of AGO2 for stabilizing SESN2 mRNA was illustrated (Figure 3E). [score:4]
In summary, down-regulation of miR-182-5p plays an important role in the anti-oxidant effects resulting from ATO treatment. [score:4]
These results suggest that ATO suppresses the transcription of the miR-182/183/96 gene cluster as a whole. [score:3]
Suppression of miR-182-5p mediated binding of AGO2 to SESN2 mRNA following treatment with ATO. [score:3]
To normalize miR-182-5p expression, U6 ncRNA was used as an internal control. [score:3]
TP53INP1, another anti-oxidant gene known to be directly regulated by miR-182-5p [44], was co-examined with SESN2 after cells were transfected with miR-182-5p mimics. [score:3]
However, a recent report showed that ROS generated by hydrogen peroxide -induced miR-182-5p expression via the Wnt/β-catenin signaling pathway in high-grade serous ovarian carcinoma [30]. [score:3]
The miR182-5p mirVana inhibitor (Cat. [score:3]
The qRT-PCR data showed that doxycycline -induced miR-182-5p expression was sustained for up to 144 hours in H1299 cells (Figure 2G). [score:3]
Effect of ATO on miR-182-5p expression in S1 GBM cells. [score:3]
First, we showed that the 3’-UTR of SESN2 and TP53INP1 shared identical targeting sequences recognized by miR-182-5p (Figure 2A). [score:3]
Interestingly, the TGF-β signaling pathway, which transactivates the miR-96/miR-182/miR-183 gene cluster [72], compromised the effects of ATO -mediated suppression of miR-182-5p. [score:3]
Our results suggest that miR-182-5p is important for modulating ATO -mediated SESN2 expression and cell death. [score:3]
A recent study showed that high intracellular levels of reactive oxygen species (ROS) induced the expression of miR-182-5p, which results in different cell fates in fallopian tube secretory epithelial cells containing wild-type p53 versus mutant one [30]. [score:3]
Furthermore, the miR-182-5p mimic suppressed the luciferase activity of fLuc reporter genes fused to the wild-type 3 ’UTRs, but not mutant forms of the 3 ’UTRs, of SESN2 and TP53INP1 mRNA (Figure 2E and 2F). [score:3]
Restoration of miR-182 expression significantly enhanced the cytotoxicity of ATO, suggesting that ATO controls the miR-182 pathway to modulate anti-oxidant responses. [score:3]
Although ATO is known to induce oxidative stress, little is known regarding whether this is the primary factor suppressing miR-182-5p and inducing SESN2. [score:3]
However, miR-182-5p ASO did not significantly inhibit the binding of AGO2 to TP53INP1 mRNA (Figure 3B). [score:3]
Several lines of evidence have shown that hsa-miR-182-5p (abbreviated as miR-182-5p) expression is associated with human malignancies, including hepatoma, glioma, ovarian carcinoma, and bladder cancer [24– 27]. [score:3]
Whether the expression of miR-182-5p is involved in ATO induced oxidative responses remains unclear. [score:3]
Among them, we noticed that SESN2 gene was one of the miR-182-5p targets because the predicted binding sequence of miR-182-5p was found to be matched with the 3’-UTR of SESN2 mRNA from +1020 to +1027 bps. [score:3]
We found that high expression of miR-182-5p represented longer survival in lung cancer (Figure 4A). [score:3]
ATO -mediated suppression of miR-182-5p was demonstrated in both GBM cells and lung cancer cells, complementing the original findings based on HepG2 cells. [score:3]
To investigate whether ATO could also influence the expression of miR-182-5p, The qRT-PCR analysis was used to determine the expression of miR-182-5p in cells exposed to ATO. [score:3]
Association of miR-182-5p and SESN2 expression with overall survival using publicly available datasets. [score:3]
ATO -mediated suppression of miR-182-5p recruited AGO2 to the mRNA, leading to Degradation. [score:3]
However, miR-182-5p was also found to suppress the growth or proliferation of lung cancer and gastric cancer in vitro [28, 29]. [score:3]
Three hundred and twenty-seven overlapped mRNA targeted by miR-182-5p were displayed in a Venn diagram, which is used for exhibiting logical relations among a collection of different databases (Figure 1C). [score:3]
The estimated rankings of TP53INP1 targeted by miR-182-5p were also performed in four different databases as described above (Table 1). [score:3]
Interestingly, miR-182-5p could be significantly inhibited by 5μM ATO (Figure 1A). [score:3]
ATO suppressed miR-182-5p was also detected in U87MG cells, A549 cells and H1299 cells using the same concentration (Supplementary Figure 2). [score:3]
However, miR-182-5p is regarded to have tumor-suppressor functions in glioblastoma and osteosarcoma [67, 68]. [score:3]
Effects of miR-182-5p on SESN2 expression. [score:3]
Since robust online databases have developed microRNA binding prediction based on diversified algorithms, we individually acquired the list of predicted mRNA targets of miR-182-5p from four databases including microRNA. [score:3]
Thus, suppression of miR-182-5p by ATO may account for the therapeutic efficacy of this compound in this cancer. [score:3]
The genes predicted to be targeted by miR-182-5p in all four microRNA prediction databases (DIANA, microRNA. [score:3]
Interestingly, ATO -mediated suppression of the miR-182/183/96 gene cluster tended to be restored by pretreating cells with TGF-β (Figure 3D). [score:3]
Ranking of SESN2 and TP53INP1 regulated by miRNA-182 in four different databases. [score:2]
ATO induced SESN2 was also detected in U87MG cells, A549 cells and H1299 cells that have exhibited reduced miR-182-5p mentioned above (Supplementary Figure 3). [score:1]
The potent clinical outcomes of miR-182-5p and SESN2 gene expression were also evaluated using online tools. [score:1]
In this study, we explored whether miR-182-5p and SESN2 are involved in ATO -induced oxidative responses. [score:1]
Bioinformatics analysis implicates the involvement of miR-182-5p in ATO -associated responses. [score:1]
The survival implication for miR-182-5p and SESN2. [score:1]
A miR-182-5p mimic was subsequently transfected into S1 GBM cells and confirmed using qRT-PCR (Figure 2B). [score:1]
Ablation of miR-182 during ATO treatment may enhance the therapeutic efficacy of this compound. [score:1]
Figure 3Suppression of miR-182-5p mediated binding of AGO2 to SESN2 mRNA following treatment with ATO (A) RNP-IP was used to evaluate the binding ability of AGO2 to SENS2 mRNA and TP53INP1 mRNA before and after ATO treatment (see text) (n=3). [score:1]
Three separate transformation growth factor β (TGF-β) -mediated Smad2/3-responding elements (SREs) were found located approximately −2000 to −3500 bp upstream of the transcription start site of the miR-182/183/96 gene cluster. [score:1]
The melting curves performed in amplification of miR-182-5p and U6 snRNA control demonstrated no nonspecific products were visualized in qRT-PCR (Figure 1B). [score:1]
Thus, the biological function of oxidative stress -induced miR-182 expression should be further investigated. [score:1]
[1 to 20 of 79 sentences]
10
[+] score: 277
Other miRNAs from this paper: hsa-mir-96, hsa-mir-192, hsa-mir-183
WIF-1 expression was elevated in the shRNA-HOXA9 group, indicating that miR-182 might regulate WIF-1 expression by directly suppressing HOXA9 expression (Figures 6 and 7). [score:11]
We found that miR-182 downregulated Wnt/β-catenin signaling, inhibited cell proliferation, and promoted apoptosis in OS cells by suppressing HOXA9 expression. [score:10]
Upregulation of miR-182 and downregulation of HOXA9 inhibited U-2OS and hFOB cell proliferation. [score:9]
Downregulation of miR-182 in OS cells enhanced tumor growth, migration, and invasion by targeting TIAM1, indicating that miR-182 may act as a tumor suppressor in OS [7]. [score:8]
MiR-182, a p53 -dependent miRNA, was shown to inhibit MITF, Bcl2, and Cyclin D2 expression in uveal melanoma cells, suggesting it functions as a tumor suppressor [42]. [score:7]
Reduced miR-182, WIF-1, BIM, and Bax expression, but elevated HOXA9, Wnt, β-catenin, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail mRNA expression was observed in the miR-182 inhibitor group (all P < 0.05). [score:7]
Low miR-182 expression was associated with elevated HOXA9 expression and reduced WIF-1 expression. [score:7]
In conclusion, this study brings novel insight for the OS treatment in a molecular level, indicating that the miR-182 inhibiting Wnt/β-catenin signaling pathway can promote apoptosis but inhibit proliferation of human OS cells by suppressing HOXA9, meanwhile, provides a new biomarker for further study. [score:7]
Figure 6(A) Histograms showing the relative expression of miR-182, HOXA9, β-catenin, and WIF-1 in the six groups; (B) Histograms showing the relative expression of Survivin, c-Myc, Cyclin D1, and Snail in the six groups; (C) Histograms showing the relative expression of BIM, Mcl-1, Bcl-xL, and Bax in the six groups. [score:7]
MiR-182 overexpression suppressed colony formation and proliferation in gastric cancer cells, suggesting that it inhibits tumor progression in gastric cancer [29]. [score:6]
Upregulation of miR-182 and HOXA9 silencing inhibited OS progression. [score:6]
Following transfection, increased WIF-1, BIM, and Bax expression, and decreased Wnt, β-catenin, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail expression were observed in the miR-182 mimic and siRNA-HOXA9 groups compared to the blank, NC, and miR-182 inhibitor + siRNA-HOXA9 groups. [score:6]
Opposite trends in protein expression were observed in the miR-182 inhibitor + siRNA-HOXA9 group compared to the miR-182 mimic and miR-182 inhibitor groups. [score:6]
We divided the cells into blank, negative control (NC), miR-182 mimics, miR-182 inhibitor, siRNA-HOXA9, and miR-182 inhibitor + siRNA-HOXA9 groups. [score:5]
No differences were observed in HOXA9, Wnt, β-catenin, WIF-1, Survivin, Cyclin D1, c-Myc, BIM, Bax, Mcl-1, Bcl-xL, and Snail mRNA expression between the miR-182 inhibitor + siRNA-HOXA9, blank, and NC groups (P > 0.05). [score:5]
We also found the responses of proliferation-related genes (Survivin, c-Myc, and Cyclin D1), apoptosis-related genes (BIM, Bax, Mcl-1, and Bcl-xL), and the migration-related gene Snail to changes in β-catenin, WIF-1, and HOXA9 expression were indirectly regulated by miR-182. [score:5]
Plasmids (NC, miR-182 mimics, miR-182 inhibitor, siRNA-HOXA9, and miR-182 inhibitor + siRNA-HOXA9, 100 pmol) were diluted in serum-free Opti-MEM (250 μl, 31985-070, Gibco, Grand Island, NY, USA) to a final concentration of 50 nM, mixed, and incubated at room temperature for 5 min. [score:5]
Expression of miR-182, HOXA9, Wnt/β-catenin signaling pathway-, proliferation-, and apoptosis-related genes in OS compared to normal tissueReverse transcription quantitative PCR (RT-qPCR) analysis demonstrated that miR-182 expression as well as WIF-1, BIM, and Bax mRNA expression were reduced in OS compared to normal tissue. [score:5]
Our data indicate that miR-182 indirectly regulates Wnt/β-catenin signaling by decreasing HOXA9 expression in OS. [score:5]
Eighteen nude mice were divided into blank, NC, miR-182 mimic, miR-182 inhibitor, siRNA-HOXA9, and miR-182 inhibitor + siRNA-HOXA9 group (three mice per group). [score:5]
Expression of miR-182, HOXA9, Wnt/β-catenin pathway-, proliferation-, and apoptosis-related genes in OS cells following transfectionWe analyzed miR-182, WIF-1, β-catenin, BIM, Bax, HOXA9, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail mRNA expression using (Figure 6). [score:5]
The findings in this study provided underlying molecular mechanism for further investigation that upregulation of miR-182 and silencing of HOXA9 can inhibit cell proliferation and enhance apoptosis in OS, suggesting that miRNAs have therapeutic potential and could also be novel prognostic markers. [score:4]
BIM and Bax are apoptosis-related proteins that are targets of FOXO1, which is negatively regulated by miR-182 in response to oxidative stress [37]. [score:4]
An opposite trend was observed in the miR-182 inhibitor + siRNA-HOXA9 group compared to the miR-182 mimic and miR-182 inhibitor groups (Figure 8). [score:4]
Additionally, opposite results were observed in the miR-182 inhibitor + siRNA-HOXA9 group compared to the miR-182 mimic and miR-182 inhibitor groups. [score:4]
MiR-182 was shown to induce cell cycle arrest by suppressing Survivin expression in tongue squamous cell carcinoma [48]. [score:4]
These data indicated that miR-182 upregulation and HOXA9 silencing reduced the proliferation of U-2OS and hFOB cell lines in vitro. [score:4]
MiR-182 mRNA expression was reduced in the miR-182 inhibitor + siRNA-HOXA9 compared to the blank and NC groups (P < 0.05). [score:4]
Increased WIF-1, BIM, and Bax mRNA expression, and decreased HOXA9, Wnt, β-catenin, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail mRNA expression (all P < 0.05) were observed in the miR-182 mimic and siRNA-HOXA9 groups compared to blank and NC groups. [score:4]
Opposite results were observed in the miR-182 inhibitor + siRNA-HOXA9 group compared to the miR-182 mimic and the miR-182 inhibitor groups. [score:4]
In contrast, a decrease in WIF-1, BIM, and Bax, and in increase in HOXA9, β-catenin, Survivin, Cyclin D1, c-Myc, Bax, Mcl-1, Bcl-xL, and Snail protein expression were observed in the miR-182 inhibitor group compared to the blank and NC groups (all P < 0.05). [score:4]
Reverse transcription quantitative PCR (RT-qPCR) analysis demonstrated that miR-182 expression as well as WIF-1, BIM, and Bax mRNA expression were reduced in OS compared to normal tissue. [score:4]
We observed increased HOXA9 expression and decreased miR-182 expression in OS compared to normal tissue. [score:4]
These results demonstrated that HOXA9 expression was negatively regulated by miR-182. [score:4]
An increase in WIF-1, BIM, and Bax protein expression, and a decrease in HOXA9, Wnt, β-catenin, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail expression was observed in the miR-182 mimic and siRNA-HOXA9 groups compared to blank and NC groups. [score:4]
Opposite results were observed in the miR-182 inhibitor + siRNA-HOXA9 group compared to the miR-182 mimic and miR-182 inhibitor groups. [score:4]
Opposite effects were observed in the miR-182 inhibitor + siRNA-HOXA9 group compared to the miR-182 mimic and miR-182 inhibitor groups. [score:4]
We analyzed miR-182 expression in three OS cell lines (SOSP-9607, U-2OS, and MG63) by (Figure 4). [score:3]
HOXA9 is a target of miR-182. [score:3]
Opposite results were observed in the miR-182 inhibitor group (P < 0.05). [score:3]
Cell lines with relatively high miR-182 expression were identified using. [score:3]
Opposite results were observed in the miR-182 inhibitor group. [score:3]
MiR-182 mRNA expression was elevated in the miR-182 mimic group (P < 0.05). [score:3]
We analyzed miR-182, WIF-1, β-catenin, BIM, Bax, HOXA9, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail mRNA expression using (Figure 6). [score:3]
analysis of miR-182, WIF-1, β-catenin, BIM, Bax, HOXA9, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail expression following transfection. [score:3]
Overexpression of the miR-182/miR-183/miR-96 cluster was associated with activation of Wnt/β-catenin signaling in medulloblastoma [44]. [score:3]
Decreased HOXA9 mRNA and protein expression were observed in the miR-182 mimic and siRNA-HOXA9 groups following transfection, indicating the miR-182 mimic and siRNA-HOXA9 had similar effects and could prevent OS progression. [score:3]
No differences in miR-182 mRNA expression were observed between the siRNA-HOXA9 and NC groups (P > 0.05). [score:3]
were used to verify the targeting of the HOXA9 3′UTR by miR-182. [score:3]
Expression of miR-182, HOXA9, Wnt/β-catenin pathway-, proliferation-, and apoptosis-related genes in OS cells following transfection. [score:3]
Increased proliferation was observed in the miR-182 inhibitor group compared to the blank and NC groups (P < 0.05). [score:2]
MiR-182 expression in SOSP-9607, U-2OS, and MG63 cells. [score:2]
MiR-182 has a predicted HOXA9 binding site located in the 3′ untranslated region (3′UTR) (Figure 5A). [score:2]
An increase in apoptosis was observed in the miR-182 inhibitor compared to the blank and NC groups (P < 0.05). [score:2]
Opposite results were observed in the miR-182 mimic compared to miR-182 inhibitor group. [score:2]
analysis of miR-182, WIF-1, BIM, Bax, HOXA9, Wnt, β-catenin, Survivin, Cyclin D1, c-Myc, Mcl-1, Bcl-xL, and Snail expression in OS compared to normal tissue. [score:2]
MiR-182 and HOXA9 expression were elevated in OS compared to normal tissue, indicating there could be a functional connection between miR-182 and HOXA9 in OS (Figures 2 and 3). [score:2]
An increase in the number of cells in G0/G1 and a decrease in the number of cells in S phase were observed in the miR-182 mimic and siRNA-HOXA9 groups compared to blank and NC groups, which was indicative of inhibition of OS cell proliferation (P < 0.05). [score:2]
Expression of miR-182, HOXA9, Wnt/β-catenin signaling pathway-, proliferation-, and apoptosis-related genes in OS compared to normal tissue. [score:2]
Tumor volume and growth were increased in the miR-182 inhibitor group compared to blank and NC groups (P < 0.05). [score:2]
An increase in WIF-1, BIM, and Bax, and a decrease in HOXA9, β-catenin, Survivin, Cyclin D1, c-Myc, Bax, Mcl-1, Bcl-xL, and Snail protein expression was observed in the miR-182 mimic and siRNA-HOXA9 groups compared to the blank and NC groups (all P < 0.05). [score:2]
A decrease in the number of cells in GO/G1, and an increase in the number of cells in S phase was observed in; the miR-182 inhibitor group compared to the blank and NC control groups (P < 0.05). [score:2]
Reduced cell proliferation, percentage of cells in S phase, and tumor growth/volume, but an enhanced percentage of cells in G0/G1 and an increase in apoptosis was observed in the miR-182 mimic and siRNA-HOXA9 groups compared to the blank, NC, and miR-182 inhibitor + siRNA-HOXA9 groups. [score:2]
In this study, we investigated the mechanisms by which miR-182 inhibits cell proliferation and promotes apoptosis in OS. [score:1]
The reaction condition were as follows: pre-denaturation at 95°C for 30 s, 40 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 60°C for 30 s. U6 was used as an internal reference for miR-182 and GAPDH for HOXA9, Wnt, β-catenin, WIF-1, Survivin, Cyclin D1, c-Myc, BIM, Bax, Mcl-1, Bcl-xL, and Snail. [score:1]
MiR-182 has an important role in regulating cancer progression [27]. [score:1]
There was no difference in relative luciferase activity in OS cells transfected with a mutant HOXA9 (HOXA9-mut) between the miR-182 mimic and NC groups (P > 0.05) (Figure 5B). [score:1]
Cell cycle arrest in G1 and an increase in apoptosis were observed in cells transfected with miR-182 [42]. [score:1]
MiR-182, a member of the miR-183 cluster, is located on human chromosome 7q32. [score:1]
Inhibition of miR-182 in hFOB and U-2OS cells enhanced migration in wound healing assays compared to the blank and NC groups (P < 0.05). [score:1]
The HOXA9-wt and HOXA9-mut constructs were then cotransfected with miR-182 into human embryonic kidney (HEK)-293T cells (Shanghai Beinuo Biotech Ltd. [score:1]
MiR-182 expression is higher in U-2OS cells compared to other OS cell lines. [score:1]
Repression of the atypical Bcl-2 family member, Bcl2-like12 (Bcl2L12), was critical for miR-182 anti-tumor activity and enhanced therapeutic susceptibility [39]. [score:1]
Here, we investigated the mechanisms by which miR-182 inhibits proliferation and promotes apoptosis in human OS cells. [score:1]
[1 to 20 of 74 sentences]
11
[+] score: 259
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-96, hsa-mir-34a, hsa-mir-218-1, hsa-mir-218-2
MiRNA mimics or inhibitor were transfected for up-regulation or down-regulation of miR-182 expression. [score:11]
In conclusion, this study demonstrates that miR-182 functions as a tumor suppressor miRNA in osteosarcoma by suppressing TIAM1 expression. [score:7]
We found that overexpression of miR-182 inhibited MG-63 cells proliferation (Fig 2C) and inhibition of miR-182 promoted MG-63 cells proliferation (Fig 2D). [score:7]
After 48h transfection, MG-63 that transfected with miR-182 mimic showed higher expression of miR-182 (Fig 2A), while MG-63 that transfected with miR-182 inhibitor showed lower miR-182 expression (Fig 2B). [score:7]
MiR-182 might act as a tumor suppressor gene whose down-regulation contributes to the progression and metastasis of osteosarcoma, providing a potential therapy target for osteosarcoma patients. [score:7]
The tumor suppressor function of miR-182 was shown in lung adenocarcinoma cells, where it inhibits the proliferation and invasion by targeting CTTN[40]. [score:7]
In this study, target validation experiments showed that miR-182 efficiently bound to TIAM1 mRNA and inhibited TIAM1 expression. [score:7]
Overexpression of miR-182 inhibited TIAM1 mRNA and protein expression. [score:7]
In addition, the expression of miR-182 is up-regulated and functions as an oncogene in several human cancers such as melanoma, it promotes anchorage independent growth, invasion and metastasis[29]. [score:6]
These results suggest that miR-182 might act as a tumor suppressor gene whose down-regulation contributes to the progression and metastasis of osteosarcoma. [score:6]
The expression of miR-182 was down-regulated in osteosarcoma cell lines. [score:6]
In this study, we showed that miR-182 expression was downregulated in osteosarcoma tissues and cell lines. [score:6]
Forced overexpression of miR-182 inhibited cell proliferation, migration, and invasion in MG-63 cells. [score:5]
Overexpression of miR-182 impaired TIAM1 -induced inhibition of proliferation and invasion in osteosarcoma cells. [score:5]
miR-182 expressing or control cells were cultured in 24-well plates, and transfected with 100 ng luciferase reporter plasmid and 5 ng pRL-TK vector expressing the Renilla luciferase (Promega, Madison, WI, USA) using Lipofectamine 2000 reagent (Invitrogen). [score:5]
Overexpression of miR-182 inhibited tumor growth. [score:5]
Down -expression of miR-182 in osteosarcoma promoted tumor growth, migration and invasion by targeting TIAM1. [score:5]
We further revealed that TIAM1 was a target of miR-182 in osteosarcoma cells, and overexpression of miR-182 impaired TIAM1 -induced promotion of proliferation and invasion in osteosarcoma cells. [score:5]
Thus our data indicated that overexpression of miR-182 inhibited osteosarcoma cells growth. [score:5]
The target genes of miR-182 were predicated by bioinformatics algorithm (TargetScan Human). [score:5]
Overexpression of miR-182 inhibited tumor invasion. [score:5]
Moreover, miR-182 inhibitor increased both the protein and mRNA levels of TIAM1 (Fig 4C and 4F), further indicating that TIAM1 was a target of miR-182 in osteosarcoma cells. [score:5]
Overexpression of miR-182 inhibited tumor migration and invasion. [score:5]
Therefore, our study identifies that miR-182 might be a tumor suppressor in the progression of osteosarcoma via targeting TIAM1. [score:5]
In this study, we identified TIAM1 as a direct and functional target of miR-182. [score:4]
miR-182 was down-regulated in osteosarcoma cell lines and tissues. [score:4]
Our results demonstrated that miR-182 was significantly down-regulated in osteosarcoma tissues (Fig 1B). [score:4]
Thus, our results suggest that reduced miR-182 expression may be a pivotal component in regulation of TIAM1 and osteosarcoma cell proliferation. [score:4]
MiR-182 suppressed lung tumorigenesis by targeting RGS17 [39, 41]. [score:4]
The overexpression of miR-182 is also up-regulated in colorectal cancer and is associated with adverse clinical characteristics and poor prognosis[44], and in hepatocellular carcinoma, it is correlated with metastatic behavior[36]. [score:4]
In the present study, we demonstrated that miR-182 was down-regulated in three four osteosarcoma cell lines and tissues. [score:4]
miR-182 directly targets the TIAM1 in osteosarcoma cells. [score:4]
Previous studies have indicated that miR-182 is frequently aberrantly expressed in various human malignancies, including gastric cancer, malignant pleural mesothelioma, ovarian carcinoma, prostate, bladder, lung, endometrial, colon and breast cancers, polycythemia vera, pediatric acute leukemia and melanoma[29– 39]. [score:3]
The ability of miR-182 to target TIAM1 may be one mechanism underlying the post-transcriptional control of TIAM1. [score:3]
In addition, loss of miR-182 levels in patients with osteosarcoma was associated with considerably shortened disease-free survival (hazards ratio = 3.22, Fig 1D). [score:3]
Restoration of miR-182 inhibits TIAM1-inducing osteosarcoma cell proliferation and invasion. [score:3]
MiR-182 directly targets the TIAM1 in osteosarcoma cells. [score:3]
Moreover, miR-182 -mediated suppression of TIAM1 depended on the 3’-UTR. [score:3]
The relative expression ratio of miR-182 in tissues and cells was quantified by the 2-ΔΔCT method. [score:3]
0121175.g004 Fig 4 (A) The potential miR-182 binding site at the 3'-UTR of TIAM1 mRNA was computationally predicted by Targetscan. [score:3]
Our aim is to identify the role of miR-182 in osteosarcoma cells growth, migration and invasion, and the target gene of miR-182. [score:3]
In ovarian carcinoma, miR-182 promotes cell proliferation, invasion and chemoresistance by targeting programmed cell death 4 [43]. [score:3]
When miR-182 mimics and pcDNA-TIAM1 were cotransfected into MG-63 cells, miR-182 expression significantly enhanced the TIAM1 -induced osteosarcoma cell proliferation and invasion (Fig 5D and 5E). [score:3]
A lower expression of miR-182 was observed in osteosarcoma cell lines (U2OS, MG-63, SOSP-9607, and SAOS-2), as comparing with human osteoblast cell lines (hFOB) (Fig 1A). [score:3]
The miR-182 mimics, inhibitor and their controls were purchased from GenePharma (Shanghai, China). [score:3]
Restoration of miR-182 inhibited TIAM1-induce osteosarcoma cell proliferation and invasion. [score:3]
MiR-182 was down-regulated in osteosarcoma cell lines and tissues. [score:3]
MiR-182 was down-regulated in osteosarcoma tissues and cell lines. [score:3]
Conversely, miR-182 inhibitor significantly promoted the cell migration and invasion of the MG-63 cells (Fig 3A and 3B). [score:3]
Taken together, these results establish a functional connection between miR-182 and TIAM1, and confirm that miR-182 can function as an anti-metastatic miRNA in osteosarcomas cells by targeting TIAM1. [score:3]
The expression of miR-182 was normalized to U6 snRNA. [score:3]
Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. [score:2]
Our findings reveal a previous unknown mechanism for miR-182 -mediated regulation of cancer cell proliferation. [score:2]
MiR-182 functions as tumor-suppressor or oncogene in different human malignancies. [score:2]
Luciferase reporter assays using 3’-untranslated region (3’-UTR) of TIAM1 gene further demonstrated that miR-182 mimics significantly reduced the activity of TIAM1 3’-UTR, but not the binding motif mutant one (Fig 3B). [score:2]
However, the comprehensive understanding of the roles of miR-182 in regulating TIAM1 in various cancers needs further exploration. [score:2]
MicroRNA-182 promotes cell growth, invasion, and chemoresistance by targeting programmed cell death 4 (PDCD4) in human ovarian carcinomas. [score:2]
Subsequent investigation revealed that TIAM1 was a direct and functional target of miR-182 in osteosarcoma cells. [score:2]
In agreement, miR-182 mimics significantly reduced the protein and mRNA abundance of TIAM1 in MG-63 cells (Fig 4C and 4D). [score:1]
We found that the TIAM1 harbored a potential miR-182 binding site (Fig 4A). [score:1]
0121175.g001 Fig 1 (A) The expression levels of miR-182 were measured by qRT-PCR in osteosarcoma cell lines (U2OS, MG-63, SOSP-9607, and SAOS-2) and human normal osteoblastic cell line (hFOB). [score:1]
Moreover, restoration of miR-182 can reduce osteosarcoma cell proliferation and invasion. [score:1]
Here, we wondered whether miR-182 was involved in the pathogenesis of osteosarcoma. [score:1]
The level of miR-182 was lower in osteosarcoma tissue than in normal tissues in the 40 pairs (Fig 1C). [score:1]
Finally, TIAM1 -induced cell proliferation and invasion were reversed by miR-182. [score:1]
MiR-182 expression level in osteosarcoma cell lines and tissues were assayed by qRT-PCR. [score:1]
MiR-182 expression in osteosarcoma cell lines was assayed by qRT-PCR. [score:1]
0121175.g002 Fig 2. (A) The miR-182 expression level of the indicated cells was measured by qRT-PCR. [score:1]
Moreover, TIAM1 was inversely correlated with miR-182 in osteosarcoma tissues. [score:1]
Mutant (Mut) constructs were generated by mutating the seed region of the miR-182 binding site. [score:1]
[1 to 20 of 70 sentences]
12
[+] score: 200
Other miRNAs from this paper: hsa-mir-96, hsa-mir-10b, hsa-mir-183
In summary, our findings reveal KLF4 as a key regulator of miR-182 cluster expression in hESCs and a main contributor to its aberrant expression in melanoma and potentially in other tumors, thereby providing potential new avenues for therapeutic intervention. [score:6]
In the present study, we focus on the regulation of the miR-182 cluster expression, shown to be deregulated in multiples pathologies [8] and functionally contributing to development of sensory organs and progression of different tumor types such as melanoma (reviewed in [16]). [score:6]
However, treatment of immortal melanocytes with the HDAC inhibitor Trichostatin A (TSA) resulted in miR-182 upregulation in a time (Figure 4B) and dose -dependent manner (Figure 4C). [score:6]
miR-182 is induced by HDAC inhibitor but not by DNA methyl-transferase inhibitor treatment. [score:5]
In around 50% of melanoma cell lines tested (7 out of 14 cell lines), miR-182 cluster overexpression was linked to amplification of the 7q31-34 locus, a region commonly amplified in melanoma, but the mechanism(s) underlying overexpression in the remaining cases remained unclear. [score:5]
Aberrant expression of the miR-182 cluster in melanoma cells may be due to enhanced histone acetylation of the promoter region together with altered expression of necessary TFs (see Figure 6D). [score:5]
Treatment with the DNA methyltransferase inhibitor 5′-azacytidine was unable to induce miR-182 levels on immortal melanocytes or melanoma cells lacking miR-182 expression (Figure 4A), suggesting that promoter DNA methylation does not account for this cluster silencing during differentiation or in those cells. [score:5]
miR-182 is re-expressed upon histone deacetylase inhibition. [score:5]
KLF4 and PAX9 transient ectopic expression significantly enhanced the basal luciferase activity of the Δ1.1 reporter construct, indicating that those TFs may modulate -directly or indirectly- the activity of the miR-182 cluster promoter (Figure 1D, green bars). [score:5]
The mechanisms underlying the silencing of the miR-182 cluster in the melanocytic lineage involve histone deacetylation since the treatment of cells with histone deacetylase inhibitors restores miR-182 cluster expression. [score:5]
The first suggestion of a physiological role of this cluster was reported by Xu and colleagues who found miR-182 cluster levels upregulated during the retina development [17]. [score:5]
In addition to its physiological role, aberrant expression of the miR-182 cluster or its components has been reported in several diseases including auto-immune disorders, neuronal and psychiatric disorders and in multiple tumor types (reviewed in [8]). [score:5]
However, the overexpression of miR-182 was not able to rescue the effects of KLF4 silencing (data not shown), thereby suggesting that other KLF4 targets may also be relevant to KLF4 pro-survival effects in melanoma. [score:5]
To narrow down the main potential regulator(s) of miR-182 cluster expression, we integrated mRNA microarray expression data for the 46 TFs with miR-182 levels measured by qPCR in a panel of melanoma cell lines without amplification of the 7q32 locus. [score:4]
KLF4 regulates the miR-182 cluster expression in hES cells. [score:4]
Treatment of melanocytes with TSA resulted in KLF4 upregulation paralleling miR-182 cluster induction (Figure 4G). [score:4]
Additionally, the miR-182 cluster is one of the most expressed in human embryonic stem cells (hESCs) [9, 10], suggesting a potential role in stem cell maintenance and regulation of differentiation. [score:4]
However, in the same experimental samples, miR-182,-96, and -183 endogenous levels were only found upregulated in KLF4-transduced cells (Figure 1D, orange bars). [score:4]
Another set of reports propose that the growth factor TGF-β regulates the expression of the miR-182 cluster in glioma [26], gallbladder cancer metastasis [27], prostate cancer bone metastasis [28] and breast cancer [29] but the specific mediators of TGFβ effects were not identified. [score:4]
In sum, our study provides new insights into the regulation of this cluster in development and cancer and opens up new opportunities for therapeutic intervention in tumors in which the KLF4-miR-182 cluster is deregulated. [score:4]
Concurring with their results, the WNT/β-catenin pathway was also shown to be relevant for miR-182 cluster expression in gastric [23] and hepatocellular carcinomas [24]. [score:3]
To determine whether KLF4 alone was necessary to drive the expression of the miR-182 cluster in melanoma, two different shRNAs against KLF4 were transduced into melanoma cells resulting in a clear reduction of endogenous miR-182 cluster levels (Figure 2A–2B). [score:3]
Chiang et al. found β-catenin/TCF4 binding sites in the promoter of miR-182 cluster and showed that the genetic or pharmacological inhibition of β-catenin impacted negatively on miR-182 levels in breast cancer cell lines [22]. [score:3]
ChIP-qPCR experiments demonstrated that the RNA polymerase II binds the miR-182 cluster promoter in melanoma cells that do express the cluster, preferentially around the TSS, but not in differentiated cells like the immortal melanocytes Hermes 2B (Figure 2D). [score:3]
In summary, these results demonstrate that KLF4 binds to the miR-182 cluster promoter and is necessary to drive miR-182 cluster expression in melanoma cells. [score:3]
Recently, the Kruppel like factor-3 (KLF3) has been shown to repress the expression of miR-182 in soft tissue sarcomas (STS) [31] where miR-182 has a pro-metastatic role [32]. [score:3]
KLF4 is sufficient to activate the expression of the miR-182 cluster. [score:3]
We found that miR-182 cluster is highly expressed in hESCs and progressively repressed during differentiation towards melanocytes, paralleling the increase in melanocyte differentiation markers, such as MITF-M (Figure 3A). [score:3]
We cannot rule out the possibility that the WNT pathway may also contribute to miR-182 cluster expression in melanomas with different genetic background or molecular contexts. [score:3]
ChIP confirmed KLF4 binding to the miR-182 cluster promoter in melanoma cells expressing this cluster (i. e. A375 and SK-MEL-147). [score:3]
We describe the minimal promoter region that is sufficient to drive the expression of the miR-182 cluster. [score:3]
KLF4 binds to the miR-182 cluster promoter and is necessary for miR-182 expression. [score:3]
KLF4 controls miR-182 expression in melanoma cells. [score:3]
Sixteen out of forty-six TFs revealed a positive correlation with miR-182 expression levels (Pearson's value > 0.5, Supplementary Table 2, Figure 1C). [score:3]
In this study, we sought to analyze the transcriptional and epigenetic mechanisms that lead to miR-182 cluster expression in physiological (i. e. hESCs) and pathological (i. e. malignant melanoma) conditions. [score:3]
Chromatin Immunoprecipitation (ChIP) analysis confirmed the physical binding of KLF4 to the miR-182 cluster promoter in melanoma cell lines but not in melanocytes, in which miR-182 is not expressed. [score:3]
In prostate cancer, where the miR-182 cluster also is highly expressed [37], indicative of poor prognosis [38] and drives proliferation and invasion [39], KLF4 has been reported to contribute to the progression and have a key role on migration and proliferation of prostate cancer cells in vitro and in vivo [40]. [score:3]
Since the miR-182 cluster has been shown to be abundantly expressed in mouse and hESCs [10], we investigated whether KLF4 could also be responsible for this miRNA cluster expression in that physiological context. [score:3]
To expand our characterization of the miR-182 cluster's regulation in the melanocytic lineage, we examined whether epigenetic mechanisms could be responsible for the regulation of the miR-182 cluster in differentiated hESCs and melanoma cells in which this cluster is very lowly expressed or undetectable. [score:3]
The primary transcript encodes three different miRNAs (i. e. miR-183, miR-96 and miR-182) which are highly homologous in their seed sequence, especially in the case of miR-96 and miR-182, thereby suggesting a significant number of potentially shared targets. [score:3]
We confirmed that miR-182 suppression was not just a general consequence of a defect in the miRNA processing machinery, as levels of DICER1, DROSHA and DGCR8 showed no correlation with the miR-182 cluster levels during the hESCs to melanocyte differentiation time-course (Supplementary Figure 1). [score:3]
Among the several transcription factors predicted to bind this region, Krüppel-like factor 4 (KLF4) showed the highest trans-activation capacity, and expression correlation with miR-182 in melanoma cell lines without 7q amplification. [score:3]
Eight candidate genes (KLF4, KLF10, ZEB1, ZNF83, ZNF148, CEBP, BACH1 and PAX9) were selected for further analysis based on their higher expression levels in melanoma compared to normal melanocytes, and individually tested as potential trans-activators of the minimal miR-182 cluster promoter in HEK293T cells. [score:2]
KLF4 regulates the miR-182 cluster promoter. [score:2]
Moreover, loss of function experiments in zebrafish demonstrated that the miR-182 cluster is necessary for the proper development of sensory epithelia in the inner ear [18]. [score:2]
KLF4 is a physiological regulator of the miR-182 cluster. [score:2]
However, siRNA -mediated knockdown of SMAD3 did not produce alterations in miR-182 levels in melanoma cell lines (Supplementary Figure 2). [score:2]
Overall, our results support a two-step mo del of miR-182 cluster regulation consisting of histone acetylation relaxing the chromatin structure and thus permitting physical access of TFs, such as KLF4, to the promoter region. [score:2]
Figure 4(A) MiR-182 expression levels measured by qPCR in immortal melanocytes (grey bars) and melanoma cells (black bars) treated with the DNA methyltransferase inhibitor 5′-azacytidine for the indicated times. [score:2]
In an attempt to ascertain whether KLF4 directly binds to the miR-182 cluster promoter, chromatin immuno-precipitation (ChIP) experiments were performed. [score:2]
However, a direct association between miR-182 and KLF4 levels was observed during the differentiation time course. [score:2]
Moreover, KLF4 also occupies the miR-182 cluster promoter in hESCs from which is gone during melanocyte differentiation. [score:1]
Figure 1(A) Representative scheme of the miR-182∼96∼183 cluster locus. [score:1]
All members of the miR-182 cluster have been found in exosomes fractions (Exocarta, [41]) and thus may be transferred from stromal tissue to tumor cells as it have been described for other pro-oncogenic miRNAs [42]. [score:1]
Our group showed that the melanoma metastasis promoter miR-182 is transcribed from the miR-183∼96∼182 cluster (hereafter referred as miR-182 cluster) in the 7q32 chromosomal region. [score:1]
The miR-182 cluster gene is a large intergenic miRNA gene located in the reverse strand of the long arm of the human chromosome 7 (7q32.2). [score:1]
Among them, KLF4 and KLF10 where those TFs that best correlate with miR-182 in melanoma cell lines. [score:1]
For miR-182 cluster promoter analysis, the different indicated constructs were generated by PCR amplification from genomic DNA and cloned into the pGL4-luciferase reporter vector (Promega). [score:1]
Bioinformatic algorithms predict up to ten KLF4 binding sites in the promoter of the miR-182 cluster. [score:1]
Concurring with our results, data mining of ChIPseq analysis of mouse ES cells revealed KLF4 occupancy of the miR-182 cluster promoter (Supplementary Table 3) [14]. [score:1]
The same effect was also observed in melanoma cell lines harboring low miR-182 levels (Figure 4D). [score:1]
In an attempt to delineate the functional promoter region of the miR-182 cluster, several luciferase reporter constructs flanking the predicted transcription start site [10] (TSS) (Figure 1A) were generated. [score:1]
In addition to changing tumor cell intrinsic properties, the KLF4-miR-182 cluster axis could contribute to tumor progression by altering the metastatic niche. [score:1]
Interestingly, high KLF4 levels in normal tissues surrounding colorectal tumors were found indicative of poor prognosis [43] suggesting that some KLF4 downstream effectors, such as the miR-182 cluster, maybe transferred from normal to tumor cells, thereby contributing to tumor genesis or progression. [score:1]
Several reports support a pro-metastatic role of the miR-182 cluster by promoting migration, invasion and survival of tumor cells in a number of malignancies including melanoma [7]. [score:1]
However, our experimental validation determined that only KLF4 is bound to the promoter region of the miR-182 cluster in physiologic conditions (hESCs) and in a subset of melanoma cell lines. [score:1]
With all these evidence, it is tempting to speculate that some of the pro-metastatic roles of KLF4 might be attributed to the miR-182 cluster. [score:1]
Concurring with their results, we also did find several KLF binding sites in the miR-182 cluster promoter. [score:1]
For microRNA expression analysis, quantitative real-time PCR (qRT-PCR) analysis of mir-182, -96, -183, was performed by using miRNA-specific TaqMan MicroRNA Assay Kit (Applied Biosystems); Briefly, 12.5 ng of total RNA were reversed transcribed using the corresponding RT Primer and the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). [score:1]
However, there is growing evidence that KLF4 may also behave as an oncogene or a pro-metastatic factor, properties frequently attributed to the miR-182 cluster. [score:1]
Indeed, we found P300 co-localizing with KLF4 in the miR-182 cluster promoter region (Figure 2F). [score:1]
[1 to 20 of 71 sentences]
13
[+] score: 163
As the miR-182 has downregulated expression that the PTEN can express higher level than usual, the upgoing expressed PTEN will attenuate the signal of insulin that come to the potential insulin resistance. [score:10]
Currently, report has shown that miR-182 is in the positive regulation toward insulin secretion by inhibiting the expression of BHLHE22 which is a molecule that can downregulate insulin mRNA transcription in islet [50]. [score:9]
Therefore, the tissues and organs which detected the differentially expressed miR-182 in the previous studies and the valid target genes of miR-182 were summarized and shown in Table 2. The references which provided the valid target genes of miR-182 were listed in Table S4. [score:7]
In addition, we divided the animal samples into the normal diet and high diet group which can provide general view of the idea that miR-182 is conserved, downregulated, and expressed in any diet conditions. [score:6]
Moreover, the symbol of downregulated expression of miR-182 is consistent whether in the blood sample or the peripheral organ samples. [score:6]
Moreover, the downregulated expression of miR-182 was represented consistently in these tissues as well. [score:6]
In our results, miR-182 is in conserved downregulated expression across the species such as human, rat, and cynomolgus macaque. [score:6]
In this case, the downregulated miR-182 is may possibly become a biomarker in detecting the potential T2D which makes benefits to the medical development. [score:5]
By observing the target genes of miR-182, the gene PTEN is under its suppression [48, 49]. [score:5]
Therefore, it is in high possibility that serious downexpression of miR-182 increases expression of FOXO1 which contributes to hyperglycemia in diabetes [43, 44]. [score:5]
The references and specific expressed tissues of the valid target genes of miR-182. [score:5]
Moreover, the downregulated expression of miR-182 is consistent with the previous study in the blood plasma samples of human and rat [6] and the microarray experiment in peripheral blood with lean and obese human (Accession number: GSE27645; significance was calculated by t-test). [score:4]
Such phenomenon may be explained as the miR-182 was downregulated during T2D and hence causing the insulin mRNA transcripts to decrease. [score:4]
Moreover, as the miR-182 showed close relationship to the T2D syndrome, regulating the expression level of miR-182 might be a possible strategy of treating T2D. [score:4]
The general putative regulation network is summarized in Figure 3. In our study, miR-182 was in the highest copy number among the whole differentially expressed miRNAs. [score:4]
Two genes, BCL2 and BAX, that led to the processes of antiapoptosis and apoptosis are under suppression of miR-182, respectively [52, 53]. [score:3]
By analyzing the target genes of miR-182, the underlying mechanism can be deduced which give us hints to understand about miR-182's functions and relationship to T2D. [score:3]
Therefore, as in the HFD group, in miR-182 expressed lower than that in intact group, the individuals may be in more serious insulin resistance. [score:3]
From the previous studies, it is known that the expression of the gene Foxo1 is under the modulation of the miR-182 [40, 41]. [score:3]
In this study, we used the cynomolgus macaque as T2D animal mo del for doing the miRNA profile analysis for the first time and finally got the same result of differential expressed miR-182 toward the previous experiments done by human and rat. [score:3]
In our study, miR-182 was in the highest copy number among the whole differentially expressed miRNAs. [score:3]
While the individual gets sick in T2D, the balance of the internal environment can get into dysfunction and the miR-182 therefore becomes downexpressed which influences the process of T2D. [score:3]
It can obviously be observed that the miR-182 was in the significant differential expression in the All, intact, and HFD groups, especially in the All compare that reached the entire criteria (P < 0.05 in t-test and ANOVA test, fold change >2). [score:3]
The ANOVA test also proved that, in the expression of miR-182, the interaction between HFD and T2D was not significant (P value = 0.24). [score:3]
In the intact and HFD comparison groups, it is noteworthy that miR-182 represented down -expression consistently (both were almost in 2-fold change). [score:3]
In this case, the serious downexpression of miR-182 (~2-fold in intact group and ~4-fold in HFD group) might finally result in increasing ofmRNA level of FOXO1. [score:3]
According to Table 2, the differentially expressed miR-182 detected in the circulating blood can also be detected in the peripheral organs such as adipose, liver, muscle, and pancreas. [score:3]
While the cholesterol gets higher, the miR-182 and SREBP-2 expression level will tend to be lower. [score:3]
It may be linked to the differential expression of miR-182 which enforces the process of apoptosis, because it can be noticed that the miR-182 may be linked to the two opposite processes of cell proliferation and apoptosis. [score:3]
Moreover, in the T2D individuals, the miR-182 in the HFD group was expressed in much lower level than that in the intact group (Table S3). [score:3]
By the further valid target genes analysis, it is represented that the miR-182 has potentially an important role in the pathogenic process of T2D including the insulin resistance, insulin secretion, and the cell apoptosis which potentially cause tissue impairment. [score:3]
In another word, the expression of miR-182 was generally stable in both groups. [score:3]
Interestingly, by comparing the intact-normal and HFD-normal individuals, we found that miR-182 was not in significant expression (Figure 2). [score:3]
In addition, some of the genes such as MYC which is important in the cell cycle regulation [48, 49] and RELA which is in the functions of inflammatory reaction and antiapoptosis are also regulated by miR-182 [54]. [score:3]
Thus, the fate of the cell can be determined by the miR-182 but the underlying mechanism about how to regulate which functions it would perform is still unknown. [score:2]
The relationship of the miR-182 and the mechanism linked to T2D was summarized in Figure 3. From the previous studies, we supposed that the miR-182 can influence the process of T2D to modulate the insulin secretion, attenuate the effect of insulin signaling pathway, and do the possible regulation of the cell's fate. [score:2]
Therefore, further studies to clarify the functions of the miR-182 might be needed for the medical purpose in diagnosis of T2D and therapy development toward T2D. [score:2]
Thus, some important miRNAs including miR-182 can be kept stable so that they cannot get into the endocrinal dysfunction and therefore protect the internal environmental balance. [score:1]
The Syndrome Which Occurs during the T2D Can Be Potentially Linked to the miR-182. [score:1]
In the general view, miR-182 represents a crucial component in the modulation of the molecules during T2D. [score:1]
The miR-182 Can Be a Reliable Biomarker for Diagnosis of T2D. [score:1]
However, in the recent years, little attention was paid to the relationship between miR-182 and T2D. [score:1]
However, currently few reports were focus on the relationship between miR-182 and T2D. [score:1]
Among the 24 specific miRNAs, 13 of them, such as miR-182/196a/381/499a/99a [6], miR-183 [6, 23], miR-409 [23], miR-146b [6, 24], miR-143 [6, 24], miR-148a [24, 25], miR-204 [5], and miR-9 [6], have been reported to involve in T2D process in mouse or rat. [score:1]
Therefore, it cannot simply be said that the level of miR-182 is only related to the cholesterol level. [score:1]
3.4. miR-182 as a Crucial miRNA in the T2D Individuals. [score:1]
Therefore, it can be obviously noticed that miR-182 is closely related to T2D and might influence or lead to some of the syndromes during T2D. [score:1]
Four microRNAs, including miR-9, miR-1285-3p, miR-424-3p, and miR-182-5p, were filtered in all three comparisons. [score:1]
Therefore, because of the characteristics of miR-182 that keeps stable in the healthy individuals but downexpressed in the T2D period no matter in the lean or obese individuals, it comes to be a reliable biomarker for diagnosis of T2D. [score:1]
Thus, such case may contribute to the greater fold change of miR-182 in HFD group than intact group (Figure 1). [score:1]
Thus, miR-182 might be in close relationship to T2D. [score:1]
[1 to 20 of 51 sentences]
14
[+] score: 160
We examined the protein levels of PDCD4 following the transfection of miR-182 inhibitor in A549 cells by Western blot analysis and found that cells transfected with miR-182 inhibitor showed an increase PDCD4 protein expression (shown in Figure  4b). [score:7]
In addition, the enhanced growth -inhibitory effect by the miR-182 inhibitor transfection was weakened after the addition of PDCD4 siRNA, suggesting that PDCD4 was responsible for the miR-182 -induced resistance to cisplatin. [score:5]
We transfected A549 cells with miR-182 inhibitor or a scrambled miR-182 inhibitor control. [score:5]
In the present study, We transfected A549 cells with miR-182 inhibitor or a scrambled miR-182 inhibitor control. [score:5]
Then showed that the miR-182 -suppressed cells were significantly more sensitive to the therapy of cisplatin than control cells, indicating that overexpression of miR-182 may involve in chemoresistance of NSCLC cells to cisplatin. [score:5]
In addition, the enhanced growth -inhibitory effect by the miR-182 inhibitor transfection was weakened after the addition of PDCD4 siRNA (shown in Figure  5). [score:5]
In addition, the enhanced growth -inhibitory effect by miR-182 inhibitor was weakened after the addition of PDCD4 siRNA. [score:5]
The PDCD4 mRNA and protein were overexpression in miR-182 -suppressed cells compared with controls, indicating that miR-182 was a negative regulator of PDCD4. [score:5]
Figure 3 revealed that the anti-tumour effects cisplatin in the miR-182 downregulated cells were significantly profound than in control cells (*P <0.05). [score:4]
Several studies have reported miR-182 to be upregulated in NSCLC [7]. [score:4]
In the present study, to explore whether the unregulated oncogene miR-182 was involved in the NSCLC cells resistant to cisplatin, we transfected miR-182 inhibitor and its negative control oligonucleotides into A549 cells. [score:4]
The PDCD4 mRNA level was overexpression in miR-182 -suppressed cells compared with controls (shown in Figure  4a). [score:4]
In conclusion, the results of the present study demonstrates that overexpression of miR-182 may involve in chemoresistance of NSCLC cells to cisplatin by down -regulating PDCD4. [score:4]
Previously, Wang M et al. found that miR-182 was markedly upregulated in human lung cancer cells. [score:4]
miR-182 is one of the miRNAs often seen upregulated in cancers. [score:4]
The results of the present study demonstrated that overexpression of miR-182 may involve in chemoresistance of NSCLC cells to cisplatin by down -regulating PDCD4. [score:4]
Husted et al. found that miR-182 was consistently upregulated in the multidrug resistant Ehrlich ascites tumor cells [10]. [score:4]
Transfection of cells with miR-182 inhibitor suppressed miR-182 level compared with the control cells (shown in Figure  2). [score:4]
Therefore, we hypothesized that the up-regulation of miR-182 may be related to chemotherapy resistance in NSCLC, but the molecular mechanism remains unclear. [score:4]
Transfection of miR-182 inhibitor induced sensitivity of A549 cells to cisplatin. [score:3]
Overexpression of microRNA-182 (miR-182) is found in various human cancers, including non-small cell lung cancer (NSCLC). [score:3]
The expression level of miR-182 in A549 was significantly higher than that in NHBE cell line (p < 0.01, Figure  1). [score:3]
miR-182 and (or) PDCD4 depleted cell lines were generated using miR-182 inhibitor and (or) siRNA. [score:3]
Cells transfected with miR-182 inhibitor or siRNA-PDCD4 were seeded into 96-well plates at 6*10 [3] cells/well and allowed to grow overnight, and then were treated with different concentrations of cisplatin. [score:3]
Figure 2 Transfection of miR-182 inhibitor and its negative control oligonucleotides (NC) into A549 cells. [score:3]
We found an increase PDCD4 protein level following the transfection of miR-182 inhibitor using Western blot analysis. [score:3]
The showed that the miR-182 -suppressed cells were significantly more sensitive to the therapy of cisplatin than control cells (shown in Figure  3). [score:3]
In a cohort of 253 glioma patients, high miR-182 expression was found to be a negative prognostic factor [19]. [score:3]
To further assess the effect of miR-182, we transfected miR-182 inhibitor and its negative control oligonucleotides into A549 cells. [score:3]
MiR-182 was upregulated in human lung adenocarcinoma cell line A549. [score:3]
TaqMan RT-PCR or was performed to detect the expression of mature miR-182 and programmed cell death 4 (PDCD4) protein. [score:3]
The indicated a weaker anti-tumour effect of cisplatin following transfection of PDCD4 siRNA, and the enhanced growth -inhibitory effect by anti-miR-182 transfection was also weakened after the addition of PDCD4 siRNA (*P <0.05). [score:3]
These results established that miR-182 transfer in combination with cisplatin therapy may be a target to reverse chemotherapeutic resistance. [score:3]
PDCD4 was a target of miR-182 and responsible for the miR-182 -induced resistance in A549 cells. [score:3]
This finding suggests that inhibition of miR-182 may be a useful therapeutic strategy for NSCLC treatment. [score:3]
In melanoma cell lines, Segura and coworkers showed that high miR-182 expression stimulated migration and survival. [score:3]
The expression level of miR-182 in A549 cell line was significantly higher than that in NHBE cell line (p < 0.01). [score:3]
qRT-PCR showed significant under -expression of miR-182 in the transfected cells compared with control cells. [score:2]
MiR-182 inhibitor, PDCD4 siRNA, and their negative control oligonucleotides were obtained from Shanghai GeneChem Co. [score:2]
Figure 1 MiR-182 was up-regulated in A549 cell line compared to that in NHBE cell line (p < 0.01). [score:2]
We speculate that miR-182 may play an important role in chemoresistance of A549 cells by down -regulating the PDCD4. [score:2]
To define the role of miR-182 in human lung cancer tumorigenesis, we compared the expression levels of miR-182 in human lung cancer cell line A549 and NHBE cell line (normal human bronchial epithelial cells) by qRT-PCR. [score:2]
Their results demonstrate that miR-182 acts as an oncogene in lung cancer [9]. [score:1]
Recent studies indicated that miR-182 plays an important role in drug resistance. [score:1]
Our aim is to investigate the association of miR-182 expression with the sensitivity of NSCLC to cisplatin. [score:1]
Furthermore, miR-182 functions as an oncomiR to enhance cancer cell proliferation [8, 9]. [score:1]
miR-182 has been regarded as an oncogene in most contexts. [score:1]
In addition, further research is needed to investigate whether the expression level of miR-182 in tumor tissue and plasma might be used as a biomarker to predict platinum based chemotherapy response in patients with NSCLC. [score:1]
Figure 5 Changes in anti-tumour effects of the cisplatin after transfection of anti-miR-182 and/or siRNA against PDCD4 in A549 cells. [score:1]
The same group treated liver metastases in mice with anti -miR-182 and obtained a lower tumor burden and a lower mir-182-level than in untreated mice [20]. [score:1]
Also in breast tumors and cervical cancers miR-182 seems to have an oncogenic impact [21, 22]. [score:1]
Figure 4 Evaluation of PDCD4 in A549cells transfected with miR-182 inhibitor and its negative control oligonucleotides (NC). [score:1]
[1 to 20 of 52 sentences]
15
[+] score: 158
We used several algorithms to search for potential miR-182-5p target genes since microRNAs exert their effects by regulating target gene expression. [score:8]
Anti-miR™ miRNA inhibitor [negative control (inh-NC) or miR-182-5p inhibitor (miR-182 inhibitor), Ambion] were transiently transfected into bladder cancer cells by siPORT NeoFX Transfection Agent (Ambion) according to the manufacturer’s instructions. [score:7]
This is the first report to also document that miR-182-5p expression is significantly increased in bladder cancer tissues where it functions as an oncogene by inhibiting RECK and Smad4 expression and may be potentially useful as a prognostic biomarker. [score:7]
B. 3′UTR Luciferase assay (miR-NC and miR-182-5p precursor), C. RECK, Smad4 and beta-tubulin protein expression in miR-NC inhibitor or miR-182-5p inhibitor transfected bladder cancer cells (T24, UM-UC-3). [score:6]
miR-182-5p binds to the 3′ UTR of RECK and Smad4 mRNAs and down-regulates expression. [score:6]
Recently miR-21 was identified as a regulator of RECK gene expression in several cancers [42], but to date there has been no report showing direct regulation of RECK by miR-182-5p. [score:6]
Of three bladder cancer cell lines (T24, UM-UC-3, J82), the expression of miR-182-5p in two cell lines (T24 and UM-UC-3) was in the range of expression observed in bladder cancer tissues. [score:5]
Western analysis confirmed that RECK and Smad4 protein expression was significantly increased in miR-182-5p inhibitor transfected cells (Fig. 3 -C). [score:5]
Thus we focused on miR-182-5p, performed functional analyses, identified several target genes of miR-182-5p using several algorithms and identified Smad4 and RECK as target genes. [score:5]
As we observed, miR-182-5p increased nuclear beta-catenin expression while Smad4 decreased nuclear beta-catenin expression. [score:5]
Finally, we over-expressed these target genes (Smad4 and RECK) in bladder cancer cells to examine the mechanism of miR-182-5p function. [score:5]
For miR-182-5p precursor transfection, bladder cancer cells were co -transfected with miR-NC and pmirGLO or miR-182-5p and pmirGLO Dual-Luciferase miRNA Target Expression Vectors using Lipofectamine 2000 (Invitrogen). [score:5]
We found that over -expression of miR-182-5p significantly promoted bladder cancer cell viability, migration and invasion and inhibited apoptosis. [score:5]
Since we focused only on Smad4 in the Wnt-signaling cascade, it is possible that other genes may be directly or indirectly regulated by miR-182-5p. [score:4]
We compared miR-182-5p expression in several bladder cancer cell lines and its expression in T24 and UM-UC-3 cells was in the range of that in bladder cancer tissues. [score:4]
3′-UTR-Luciferase Assay and Target Protein Expression in miR-182-5p Transfectants. [score:4]
0051056.g001 Figure 1 A. miR-182-5p expression in clinical samples and bladder cancer cell lines, B. Association of miR-182-5p with clinic-pathological parameters, C. Kaplan Meier plots of overall survival. [score:3]
At 24 hours after transfection of miR-NC or miR-182-5p precursor into bladder cancer cells, the miR-182-5p expression level was verified by real time PCR (fold change; 4545, 5920, respectively Fig. 2 -A). [score:3]
miRNA-182-5p Expression is Significantly Increased in Bladder Cancer Cell Lines. [score:3]
We divided the 18 bladder cancer patients into two categories based on the median value and Kaplan Meier plots showed that overall survival was shorter in the high miR-182-5p expressing group (p value = 0.0349, Log-rank test) (Figure 1 -C). [score:3]
miRNA-182-5p Expression is Significantly Higher in Bladder Cancer Tissues and Associated with Shorter Overall Survival. [score:3]
Effect of miR-182-5p over -expression on bladder cancer cell function (T24, UM-UC-3). [score:3]
A. miR-182-5p expression in clinical samples and bladder cancer cell lines, B. Association of miR-182-5p with clinic-pathological parameters, C. Kaplan Meier plots of overall survival. [score:3]
Thus we looked to see whether beta-catenin expression was altered by either miRNA-182 or Smad4 transfection. [score:3]
miR-182-5p expression and association with clinical parameters in bladder cancer tissues. [score:3]
These results suggest that RECK and Smad4 mRNAs are potential target genes of miR-182-5p. [score:3]
The miR-182-5p expression was significantly higher in bladder cancer tissues (Fig 1A ). [score:3]
Effect of microRNA-182-5p Over -expression on Cell Viability and Migration in Bladder Cancer Cell Lines. [score:3]
Thus we investigated the relationship between miR-182-5p expression and clinical parameters including pathological stages and patient outcomes and found that miR-182-5p expression was correlated to shorter overall survival after operation in bladder cancer patients. [score:3]
As shown in Figure 4 -G, beta-catenin expression in the nuclear fraction was significantly increased in miR-182-5p transfected T24 cells. [score:3]
Effect of miR-182-5p and Smad4 on Beta-catenin Expression in the Nuclear Fraction. [score:3]
As far as we know, there have been no reports about miR-182 and Wnt-beta-catenin signaling and our results suggest that onco-miR-182-5p may be involved in the regulation of Wnt-beta-catenin related genes. [score:2]
Then we confirmed miR-182-5p binding to the target genes mRNA 3′UTR by luciferase assay with miR-182-5p precursor. [score:2]
We compared miRNA-182-5p expression levels in bladder cancer tissues (n = 18) and normal urothelial tissues (n = 6) by real-time PCR. [score:2]
In this study, we found that miR-182-5p was significantly higher in bladder cancer tissues compared to normal urothelial tissues and high miR-182-5p expression was significantly associated with shorter overall survival. [score:2]
Similar to our results, one report found that miR-182-5p expression was significantly higher in bladder cancer tissues compared to normal urothelium, however functional analysis was not performed in this study [38]. [score:2]
Taken together, this study shows that miR-182-5p exerts its oncogenic effects in bladder cancer cells by down -regulating RECK and Smad4. [score:2]
So far there have been no reports about the function of miR-182-5p in bladder cancer. [score:1]
Our next aim was to determine whether miR-182-5p functions as a bladder cancer oncogene. [score:1]
In addition, miR-182-5p significantly decreased cell apoptosis (Fig. 2 -E). [score:1]
Pre-miR™ miRNA precursors [negative control (miR-NC) or hsa-miR-182-5p, Ambion] were transiently transfected into bladder cancer cells by Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
A. RECK and Smad4 3′UTR position and complementary miR-182-5p sequences. [score:1]
RECK mRNA has one while Smad4 has two potential complimentary binding site with miR-182-5p within its 3′ UTR (Fig. 3 -A). [score:1]
Additional experiments will be needed to elucidate the exact role of miR-182-5p in Wnt-beta catenin signaling. [score:1]
To confirm the function of miR-182-5p, we transfected miR-182-5p precursor into bladder cancer cell lines (T24 and UM-UC-3). [score:1]
0051056.g003 Figure 3 A. RECK and Smad4 3′UTR position and complementary miR-182-5p sequences. [score:1]
0051056.g002 Figure 2 Two bladder cancer cell lines (T24 and UM-UC-3) were transiently transfected with either miR-182-5p precursor or control (miR-NC). [score:1]
These results also suggest that miR-182-5p may have therapeutic potential for the treatment of bladder cancer. [score:1]
Two bladder cancer cell lines (T24 and UM-UC-3) were transiently transfected with either miR-182-5p precursor or control (miR-NC). [score:1]
These results suggest that miR-182-5p may be a new and useful diagnostic biomarker in bladder cancer. [score:1]
We investigated the association of miR-182-5p and several clinical parameters as shown in Figure 1 -B and observed that high miR-182-5p expression was significantly associated with shorter overall survival. [score:1]
[1 to 20 of 51 sentences]
16
[+] score: 149
Overactivation of the NF- κB pathway in inflammation is the main cause of dysregulation of the lncRNA-POIR and miR-182 regulatory networkIn this part, we found that the strong upregulation of miR-182 had an important role in suppressing the expression of lncRNA-POIR in pPDLSCs. [score:10]
In this part, we found that the strong upregulation of miR-182 had an important role in suppressing the expression of lncRNA-POIR in pPDLSCs. [score:8]
revealed that the inhibition of miR-182 reversed the downregulation of lncRNA-POIR expression in the inflammatory environment (Figure 8a). [score:8]
To verify this finding, we inhibited the NF- κB pathway using siIKK α (the efficiency of siIKK α was determined by) (Figure 8e) and found that the increase in miR-182 expression was blocked and that lncRNA-POIR expression was increased in the inflammatory microenvironment (Figures 8f and g). [score:7]
However, the effects of the inflammatory environment on miR-182 upregulation were consistent regardless of whether lncRNA-POIR was inhibited or not (Figure 8b). [score:6]
The results revealed that anti-miR-182 significantly inhibited miR-182 expression compared with a blank control and miR-182 inhibitor NC (anti-miR-NC) (Figure 4a). [score:6]
To identify the mechanism that impairs the expression of lncRNA-POIR in pPDLSCs, we found that the strong upregulation of miR-182 had an important role. [score:6]
In the absence of miR-182, the effects of the inflammatory environment on downregulation of lncRNA-POIR expression disappeared (Figure 8a). [score:6]
Inhibition of the NF- κB pathway using siIKK α resulted in a decrease in the miR-182 level and an increase in the lncRNA-POIR expression in the inflammatory microenvironment (Figures 8f and g). [score:5]
We also found that the lncRNA-POIR level was increased following miR-182 inhibition (Figure 4d), Moreover, lncRNA-POIR and miR-182 expression in pPDLSCs was highly negatively correlated at 0, 1, 7 and 14 days after osteogenic induction (Figure 4e). [score:5]
To determine whether miR-182 directly targets lncRNA-POIR and the FoxO1 3′-UTR, we constructed a wild-type FoxO1 3′-UTR (FoxO1 3′-UTR wt) reporter plasmid and mutated (FoxO1 3′-UTR mut, with mutation of individual bases in the binding site) FoxO1 3′-UTR reporter plasmid with pmirGLO luciferase vectors. [score:5]
The putative miR-182 target binding sequence in wild-type lncRNA-POIR (lncRNA-POIR wt) and a mutant (lncRNA-POIR mut, with mutation of individual bases in the binding site) were synthesized and cloned downstream of the luciferase gene in pmirGLO luciferase vectors (Promega, Madison, WI, USA). [score:4]
Considering lncRNA-POIR and miR-182 often negatively regulate each other, as described above, an abnormally low lncRNA-POIR level may lead to a further increase in miR-182 expression in a vicious circle. [score:4]
Reports have shown that miR-182 decreases bone formation of MSCs by directly targeting FoxO1. [score:4]
In addition, we observed that miR-182 expression was regulated by the NF- κB pathway. [score:4]
42, 43 Kim et al. [24] have reported that miR-182 negatively regulates osteogenesis by targeting FoxO1. [score:4]
To determine whether lncRNA-POIR directly regulates miR-182, we generated luciferase reporter constructs. [score:3]
Overactivation of the NF- κB pathway in inflammation is the main cause of dysregulation of the lncRNA-POIR and miR-182 regulatory network. [score:3]
The results showed that the lncRNA-POIR-wild-type reporter was strongly suppressed by miR-182 (Figure 4f). [score:3]
These results indicate that lncRNA-POIR and miR-182 directly regulate each other. [score:3]
The results of, western blot analyses, and Alizarin red staining showed that the miR-182 inhibitor promoted the osteogenesis of pPDLSCs (Supplementary Figures S4A–D). [score:3]
Furthermore, we synthesized a miR-182 inhibitor to identify the osteogenic effects of miR-182. [score:3]
Interestingly, lncRNA-POIR and miR-182 form an autoregulatory loop by negatively regulating each other. [score:3]
To determine whether lncRNA-POIR acts as a miRNA sponge that competes with mRNA for binding to miRNAs, we synthesized a miR-182 inhibitor (anti-miR-182) and assessed its efficiency by. [score:3]
Further, we found that aberrant activation of this pathway was the key factor leading to miR-182 overexpression during inflammation. [score:3]
In inflammation, increased miR-182 caused the low level of lncRNA-POIR expression. [score:3]
[24] Consistent with these findings, the miR-182 inhibitor significantly reduced the FoxO1 mRNA and protein levels in pPDLSCs (Figures 5a and b). [score:3]
We found that lncRNA-POIR contains a single element complementary to miR-182 (Figure 4b) and that miR-182 expression was promoted by shlncRNA-POIR (Figure 4c). [score:3]
Besides, lncRNA-POIR and miR-182 could negatively regulate each other. [score:2]
LncRNA-POIR modulates FoxO1 through regulation of miR-182. [score:2]
All of these results suggested that the activated NF- κB pathway during inflammation disrupted the balance of the lncRNA-POIR and miR-182 regulatory network. [score:2]
In this study, we found that lncRNA-POIR, miR-182 and FoxO1 were strongly correlated because both lncRNA-POIR and FoxO1 3′-UTR region were found to be targets of miR-182, as determined by bioinformatics analysis and luciferase assay. [score:2]
Further, luciferase reporter assay demonstrated that miR-182 inhibited the luciferase activity of the 3′-UTR of the FoxO1 luciferase reporter (Figures 5c and d). [score:2]
These findings indicate that overactivation of the NF- κB pathway is the main cause of dysregulation of the lncRNA-POIR and miR-182 network. [score:2]
This is mainly because P65 and P50, important transcription factors of the NF- κB pathway, directly bind to the promoter regions of pri-miR-182 (Figure 8d). [score:2]
ting revealed that the NF- κB pathway was activated in pPDLSCs (Figure 8c), and chromatin immunoprecipitation (ChIP) assay showed that RelA (P65) and c-Rel directly bound to the promoter region of pri-miR-182 (Figure 8d). [score:1]
39, 40, 41 In our study, both lncRNA-POIR and miR-182 were found to associate with the RISC by binding to Ago2, a core component of the RISC (Figures 4g and h). [score:1]
The plasmids, miRNA mimics (miR-NC and miR-182) and Renilla luciferase plasmid (Promega, Madison, WI, USA), used as a normalization control, were co -transfected into cells. [score:1]
The miR-182 and FoxO1 have opposite effects on osteogenic differentiation of pPDLSCs. [score:1]
30, 40, 41 In our study, we indicated an innovative mo del to depict the core effects of lncRNA-POIR-miR-182 network in osteogenesis of pPDLSCs. [score:1]
LncRNA-POIR acts as a sponge of miR-182. [score:1]
The binding sites on the promoter region of pri-miR-182 were predicted by JASPAR (http://jaspar. [score:1]
[1 to 20 of 42 sentences]
17
[+] score: 140
Other miRNAs from this paper: mmu-mir-182, mmu-mir-185, hsa-mir-185
Furthermore, the significant suppression of both endogenous mRNA and protein expression of SLC30A1, SERPINB2 or AKR1C1 in A549 and H446 cells was verified by transfection of cells with miR-182 or miR-185 mimic (all P < 0.01), and this microRNA -induced suppression of gene expression could be rescued when the specific miRNA inhibitor was co -transfected (Figure 3a– 3c). [score:11]
Figure 6Aberrant expression of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in human lung cancer and paired normal tissues (up panel, squamous cell carcinoma and lower panel, adenocarcinoma) Data were retrieved from the TCGA database Data were retrieved from the TCGA database In the present study, we showed that down-regulation of miR-182 and miR-185 in HBE cells exposed to DMSO extracts of PM [2.5] resulted in increased SLC30A1, SERPINB2 and AKR1C1 gene expression and ectopic expression of these genes can respectively lead to neoplastic transformation in NIH3T3 cells. [score:10]
We then examined the correlation between the expression of microRNAs and mRNAs to predict the potential targets of microRNAs and found 3 genes, SLC30A1, SERPINB2 and AKR1C1, whose expression was inversely correlated with miR-182 and (or) miR-185 expression (Figure 1c). [score:9]
Mutations in the core microRNA binding sites are shown e Figure 3Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
The upregulation of SLC30A1, SERPINB2 and AKR1C1 and downregulation of miR-182 and miR-185 in HBE cells exposed to PM [2.5] extract detected by microarray were further confirmed by using quantitative real-time PCR (qRT-PCR) and Western blot assays (Supplementary Figure S1a and S1b). [score:6]
Mutations in the core microRNA binding sites are shown e Figure 3Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
We also detected depressed expression of miR-182 and perhaps miR-185 in human subjects exposed to high level of PM [2.5] and overexpression of SLC30A1, SERPINB2 and AKR1C1, which we have first demonstrated to be target genes of miR-182 and/or miR-185, in human lung cancer compared with the corresponding normal lung tissues. [score:6]
The most significant finding in the present study is that we identified at the first time that miR-182 and miR-185 are target regulators of SLC30A1, SERPINB2 or AKR1C1 that function as potential oncogenes because they were able to induce neoplastic transformation in NIH3T3 cells and were overexpressed in human lung cancer. [score:6]
Mutations in the core microRNA binding sites are shown e. Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
Among them, overexpression of SLC30A1, SERPINB2 as well as AKR1C1, mediated by downregulation of miR-182 and (or) miR-185, can induce neoplastic transformation in NIH3T3 cells. [score:6]
Figure 1Altered global microRNA a. and mRNA b. expression in human bronchial epithelial cells exposed to DMSO extracts of airborne PM [2.5], and potential interactions between microRNAs and mRNAs suggested by integrate and in silico analysis c. The experimental conditions are described in Materials and Methods SLC30A1, SERPINB2 and AKR1C1 are bona fide target genes of miR-182 or miR-185To test whether SLC30A1, SERPINB2 and AKR1C1 are bona fide targets of miR-182 or miR-185, a series of assays were conducted. [score:6]
For example, miR-182 was reported to suppress lung tumorigenesis and lung cancer cell proliferation through downregulation of RGS17 or RASA1 [21, 22]. [score:6]
In another study, downregulation of miR-182 was shown to contribute to renal cell carcinoma proliferation via activation of AKT/FOXO3a signaling pathway [23]. [score:4]
These results suggested that SLC30A1, SERPINB2 and AKR1C1 may be regulatory targets for miR-182 and miR-185. [score:4]
*, P < 0.05 compared with vector control Figure 5Xenograft tumor formation in nude mice of NIH3T3 cells ectopically and stably expressing SLC30A1, SERPINB2, AKR1C1, or vector control a. Histological analysis showed that all tumor cells had similar morphology and were diagnosed as fibrosarcoma b. Immunohistochemical staining c. demonstrated a high expression of SLC30A1 (up panel) or SERPINB2 (lower panel), respectively, in tumors induced by each of these two genes Reduced expression of miR-182 and miR-185 in human subjects exposed to PM [2.5]Plasma miR-182 and miR-185 were measured in 109 subjects living at the same region (Wuhan, China) but exposed to different levels of PM [2.5] and PM [10] monitored by personal sampler for 24 h. The median levels of individuals' exposure to PM [2.5] and PM [10] were 124.8 μg/m [3] and 179.3 μg/m [3], respectively, with the ranges of 18.7 to 274.2 μg/m [3] for PM [2.5] and 39.8 to 383.3 μg/m [3] for PM [10] (Supplementary Table S1). [score:4]
It has been shown that miR-182 is overexpressed in many types of cancer including lung cancer and is thought to be associated with cancer development and prognosis [19, 20]. [score:4]
Figure 1Altered global microRNA a. and mRNA b. expression in human bronchial epithelial cells exposed to DMSO extracts of airborne PM [2.5], and potential interactions between microRNAs and mRNAs suggested by integrate and in silico analysis c. The experimental conditions are described in Materials and Methods To test whether SLC30A1, SERPINB2 and AKR1C1 are bona fide targets of miR-182 or miR-185, a series of assays were conducted. [score:4]
SLC30A1, SERPINB2 and AKR1C1 are bona fide target genes of miR-182 or miR-185. [score:3]
These results provided further evidence that SLC30A1, SERPINB2 and AKR1C1 are respective bona fide target genes of miR-182 or miR-185 in human cells. [score:3]
In the present study, we identified SLC30A1, SERPINB2 and AKR1C1 as potential oncogenes targeted by miR-182 and (or) miR-185, respectively. [score:3]
Depression of plasma miR-182 and miR-185 in subjects exposed to high levels of PM [2.5] and overexpression of SLC30A1, SERPINB2 and AKR1C1 in human lung cancer tissues were detected. [score:3]
Reduced expression of miR-182 and miR-185 in human subjects exposed to PM [2.5]. [score:3]
We also observed reduced levels of plasma miR-182 and perhaps miR-185 in human subjects exposed to high levels of PM [2.5] compared with those exposed to low levels of PM [2.5] residing at the same region, directly connecting PM [2.5] exposure to microRNA expression in vivo. [score:3]
Figure 2Relative activity of reporter gene constructed with wild type of 3′UTR of SLC30A1 a. SERPINB2 b. or AKR1C1 c. gene or their mutant types d. cotransfected with miR-182 or mir-185 or their inhibitors in A549 and H446 cells. [score:3]
Relative activity of reporter gene constructed with wild type of 3′UTR of SLC30A1 a. SERPINB2 b. or AKR1C1 c. gene or their mutant types d. cotransfected with miR-182 or mir-185 or their inhibitors in A549 and H446 cells. [score:3]
Indeed, miR-182 has also been shown to act as a tumor suppressor. [score:3]
*, P < 0.05 compared with vector control Figure 5Xenograft tumor formation in nude mice of NIH3T3 cells ectopically and stably expressing SLC30A1, SERPINB2, AKR1C1, or vector control a. Histological analysis showed that all tumor cells had similar morphology and were diagnosed as fibrosarcoma b. Immunohistochemical staining c. demonstrated a high expression of SLC30A1 (up panel) or SERPINB2 (lower panel), respectively, in tumors induced by each of these two genes Plasma miR-182 and miR-185 were measured in 109 subjects living at the same region (Wuhan, China) but exposed to different levels of PM [2.5] and PM [10] monitored by personal sampler for 24 h. The median levels of individuals' exposure to PM [2.5] and PM [10] were 124.8 μg/m [3] and 179.3 μg/m [3], respectively, with the ranges of 18.7 to 274.2 μg/m [3] for PM [2.5] and 39.8 to 383.3 μg/m [3] for PM [10] (Supplementary Table S1). [score:2]
Transfection of these plasmids with miR-182 or miR-185 mimic showed no significant change in luciferase activity compared with transfection of these plasmids with microRNA control (Figure 2d), suggesting that the interactions between the two microRNAs and 3′UTR of three target genes are sequence-specific. [score:2]
The expression of miR-182 and miR-185 was calculated relative to U6 small nuclear RNA. [score:1]
Plasma miR-182 and miR-185 in subjects exposed to different levels of PM [2.5] and PM [10]. [score:1]
However, little has been known about the effect of miR-182 on lung cancer initiation. [score:1]
For analysis of plasma miR-182 and miR-185, the input RNA was reverse transcribed using TaqMan miRNA Reverse Transcription Kit (Applied BioSystems, Foster City, CA). [score:1]
Transient transfection of these reporter plasmids to human lung cancer cell lines A549 and H446 with miR-182 or miR-185 mimic or microRNA control showed that transfection with miR-182 significantly reduced the luciferase activity caused by 3′UTR of SLC30A1 or SERPINB2 while transfection with miR-185 significantly reduced luciferase activity caused by 3′UTR of AKR1C1 (all P < 0.05). [score:1]
[1 to 20 of 33 sentences]
18
[+] score: 106
Consequently, MCF-7 cells were transfected with pCMV-MIR182, pCMV-MIR223, and pCMV-MIR (=empty or scrumble vectors) to induce their overexpression and to analyze the protein expression of their targets, that is, IGF-1R, FOXO3A, and FOXO1A. [score:7]
In addition, pair-wise analyses revealed 42 common targets for miR-182 and miR-142-3p, 34 common targets for miR-182 and miR-223, and 7 common targets for miR-142-3p and miR-223 (Table S1, Fig. 2A). [score:7]
The most noteworthy novel finding was that in skeletal muscle, HRT use associates with down-regulation of miR-182, miR-223, and miR-142-3p, which modulate the expression of central players in the insulin/IGF-1 pathway, namely IGF-1R and FOXO3A. [score:6]
Estradiol regulates miR-182 and miR-223 expression and their identified targets leading to activation of insulin/IGF-1 signaling pathway in MCF-7 cells. [score:6]
Figure 4The effects of miR-182 and miR-223 over -expression on protein expression of IGF-1R, FOXO3A, and FOXO1A in MCF-7 cells. [score:5]
We found that miR-182 over -expression represses IGF-1R and FOXO3A in MCF-7 cells (P < 0.05), while the effects on FOXO1A protein expression were milder (Fig. 4A and B). [score:5]
Figure 6The effects of estrogen stimulation on the expression of miR-182, miR-223, and miR-142-3p and their targets in infant female quadriceps femoris-derived myoblasts. [score:5]
First, the down-regulation of miR-182 and miR-223 in the HRT users accorded with the higher mRNA and protein expression of IGF-1R, which in all likelihood leads to higher activity of the following PI3K/Akt-pathway in HRT users compared to nonusers. [score:5]
HEK-293 cells were transfected with 100 ng of pLUC, pLUC-182/223-target or pLUC-182/223-target- del, 0.9 μg of pCMV-MIR182/223 and pCMV-MIR, and 50 ng of pRL -null renilla luciferase. [score:5]
Identification of common pathways targeted by miR-182, miR-223, and miR-142-3p was obtained using the DIANA-microT 3.0 target prediction program (http://diana. [score:5]
FOXO3A and FOXO1A have been identified as direct targets for miR-182 (Guttilla & White, 2009; Segura et al., 2009). [score:4]
We found out that diaphragm muscle cells of young male mouse showed down-regulation of both miR-182 and miR-223 under exposure to 100 n m estradiol for 24 h (Fig. 7A) concomitantly with increased AKT phosphorylation (P < 0.05) (Fig. 7B). [score:4]
This is in line with our previous studies showing that postmenopausal HRT induces an up-regulation of genes belonging to the IGF-1 signaling cascade (Pöllänen et al., 2010; Ahtiainen et al., 2012a) and with other studies showing that miR-182 represses FOXO3A (Guttilla & White, 2009; Segura et al., 2009). [score:4]
The next day, the cells were transfected with pCMV-MIR182/223 and pCMV-MIR (OriGene) or mirVana™ miRNA inhibitors (Ambion, USA) hsa-miR-223 ID:MH12301 (miR-223 antagomir), anti-miR negative control #1 (Mock) (Fig 3). [score:3]
Western blot analysis of target proteins in MCF-7 cells transfected with p-CMV-MIR (empty vector) and p-CMV-MIR182. [score:3]
Previously, it has been shown that miR-182 over -expression represses FOXO1A and FOXO3A in breast cancer and melanoma cells, respectively (Guttilla & White, 2009; Segura et al., 2009). [score:3]
Putative pathways affected by miR-182, miR-223, and miR-142-3p are reported in Table 2. Among the putative target pathways, we found the insulin/IGF1 pathway (Fig. 2B). [score:3]
Table S1 Common targets for hsa-miR-142-3p (250 elements), hsa-miR-182 (841 elements) and hsa-miR-223 (202 elements). [score:3]
Validation by quantitative PCR (qPCR) confirmed that the expression levels of miR-182, miR-223, and miR-142-3p in the HRT users were approximately one-third of that of nonusers (P = 0.05, 0.001 and 0.003, respectively; Fig. 1C), while miR-142-5p and miR-451 were not significantly different between HRT users and their nonuser co-twins. [score:3]
In the present study, we demonstrated, using luciferase assay in HEK-293 cells, that IGF-1R also is a target for miR-182 (Fig. 3A). [score:2]
The plasmids used in the luciferase assays were generated by cloning oligonucleotides bearing wild-type (wt) or deleted (del) miR-182/223 target pairing site of IGF-1R, FOXO1A, and FOXO3A genes downstream of the stop codon in pMIR-REPORT-Luciferase (pLUC, Ambion Inc. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
MiR array data showed miR-142-3p, miR-142-5p, miR-223, miR-182, and miR-451 to be hypo-expressed in the HRT users compared to nonusers (Fig. 1B). [score:2]
In the present study, we confirmed that estrogen-regulated miRNAs, that is, miR-182, miR-223 and miR-142-3p, exist in skeletal muscle of postmenopausal women. [score:2]
Specifically, miR-182 and miR-223 participate in the modulation of the insulin/IGF-1 pathway signaling. [score:1]
Instead, we found two miRNAs, miR-182 and -223, participating in the main pathway of the body’s glucose homeostasis. [score:1]
MiR-223 and miR-182 modulate IGF-1R, FOXO1A, and FOXO3A protein levels. [score:1]
P-CMV-MIR182, p-CMV-MIR223, and p-CMV-MIR (empty vector) plasmids were shipped from OriGene (OriGene Technologies Inc. [score:1]
Each pLUC vector was co -transfected into the HEK293T cells with a plasmid-encoding Renilla luciferase along with a plasmid-encoding miR-182 or miR-223 or the empty vector. [score:1]
In addition to repressing FOXO3A, we showed, for the first time, that miR-182 also represses IGF-1R. [score:1]
To determine the effects of gain-of-function of miR-182/223, we used MCF-7 cells known to be highly responsive to E [2]. [score:1]
Note: The expression of miR-182 in these myoblasts was too low to be accurately measured. [score:1]
[1 to 20 of 33 sentences]
19
[+] score: 100
In the case of miR-182, which has been described to be upregulated in breast carcinoma, to target specifically BRCA1 gene and to be involved in the resistance to PARP-1 inhibitors [41], [42], we identified a relationship between miR-182 expression and clinical outcome. [score:10]
It has been found to bedownregulated in several tumortypes and has been suggested tobe a tumor suppressor gene [28] miR-182 Breast and ovariancancerTargets the 3′UTR of BRCA1. [score:8]
42 McMillen BD, Aponte MM, Liu Z, Helenowski IB, Scholtens DM, et al (2012) Expression analysis of MIR182 and its associated target genes in advanced ovarian carcinoma. [score:5]
In the triple negative breast cancer group including young patients <38 years old at diagnosis, miR-21 and miR-182 were significantly over-expressed; P value = 0.04, while there was no effect of age on expression of any analyzed miR in NTNBC group (Table7). [score:5]
Second, comparing the fold expression between the two groups of TNBC and NTNBC, we also showed that the deregulation is significantly different between the two analyzed groups for miR-21, miR-146a and miR-182. [score:4]
In the present study, miR-10b seemed not to be over-expressed in mammary tumors; in NTNBC group it was associated with the occurrence of a high grade (III) and correlates with both miR-34 and miR-182. [score:3]
In the present study, we explored the expression levels of seven microRNAs: miR-10b, miR-17, miR-21, miR-34a, miR-146a, miR-148a and miR-182 in both triple negative (TNBC) and non triple negative breast carcinoma (NTNBC). [score:3]
The age of the first menstruation >13 years in TNBC was associated to the over -expression of miR-10b; miR-17; miR-21; miR-148a and miR-182 (P value, 0.03; 0.006; 0.01; 0.01 and 0.02 respectively) and it was associated only to miR-17 (P value, 0.003) in NTNBC group. [score:3]
Indeed, miR-10b, miR-21 and miR-182 in TNBC are significantly over-expressed in patients with lymph node metastases (P value, 0.02, 0.006 and 0.03 respectively). [score:3]
Interestingly, an association between miR-21 and miR-182 expression to young patients with triple negative breast cancer, was proved in this work. [score:3]
miR-21, miR-146a and miR-182 were more expressed in TNBC than in NTNBC. [score:3]
In addition, women with no completed pregnancy and who have never breastfed had significant association with the expression of miR146a and miR-182 in TNBC. [score:3]
The age at the first pregnancy >25 years across TNBC was strongly associated to the expression of miR-182 (P value, 0.004); however, in relation to NTNBC, it is associated to miR-17 (P value 0.03). [score:3]
We observed that miR-21, miR-146a and miR-182 were significantly over expressed in triple negative breast cancer. [score:3]
We analyzed the expression of seven microRNAs (miR-10b; miR-21; miR-34a; miR-146a; miR-148a and miR-182) among the two groups of breast cancer types in both tumor and normal adjacent tissues. [score:3]
miR146a and miR-182 combined together along with miR-148a, were found to play a role in cell growth, angiogenesis, proliferation and invasion, through the silencing of the tumor suppressors tropomyosin-1 (TPM1) and programmed cell death gene-4 (PDCD4) [45]. [score:3]
Figure S2 Roc curve of the lymph node metastases occurrence prediction according to miR-10b, miR-21, miR-148a and miR-182 fold expression among triple negative breast cancer cases. [score:3]
In TNBC, lymph node metastases occurrence was significantly associated with the expression of miR-10b, miR-21 and miR-182 (P value, 0.02; 0.006 and 0.03 respectively); however, it was not associated to any of the analyzed miRs in the other group. [score:3]
In addition, miR-10b and miR-182 were significantly over-expressed in mammary tumors with TNBC to predict the occurrence of lymph node metastases from a cut-off value of 0.8732 and 3.2992, respectively, with a sensitivity of 70% and 80% respectively, and a specificity of 80% for both miRs (Figure S2). [score:3]
For women with triple negative breast carcinoma who did not have any completed pregnancy, miR-146a and miR-182 were significantly over-expressed (P value, 0.02 and 0.04 respectively). [score:3]
We observed that miR-21 correlated with both miR-148a and miR-182 (Spearman’s rho, 0.72 and 0.65 respectively; P<0.01) along with miR-10a and miR-17. [score:1]
We also observed that the age of first pregnancy upper than 25 years old is significantly associated to miR-182 and miR-17 respectively in TNBC and NTNBC. [score:1]
The objective of the present study is to evaluate the expression profile of the following micro -RNAs: miR-10b, miR-17, miR-21, miR-34a, miR-146a, miR-148a and miR-182, and to determine their possible interaction in triple -negative and non triple -negative primary breast cancers based on clinical outcome. [score:1]
According to our results, we consider miR-10b, miR-21 and miR-182 as potential biomarkers that could play a predictive role in the lymph node metastases occurrence across triple negative breast cancer and miR-10b as biomarker that could predict the occurrence of high grade III in the non triple negative breast cancer group. [score:1]
Considering the triple negative breast cancer, we observed a group of correlating miRs constituted by miR-10b, miR-21, miR-17, miR-148a and miR-182; while miR-34 and miR-146a appeared to be less correlated with the other studied miRs. [score:1]
0585±1.641 2.5899±2.498 0.002 2.03 miR-182 1.9118±1.329 4.2027±2.705 0.004 3.73 P value in blot <0.05, SD: standard deviation. [score:1]
In our case, miR-10b, miR-21 and miR-182 could be defined as biomarkers to predict both lymph node metastases in triple negative breast cancer and miR-10b to predict grade III occurrence in non triple negative breast cancer. [score:1]
In addition, miR-21′s association with miR-148a and miR-182 in both TNBC and NTNBC according to Spearman’s rank correlation coefficient has been found to be involved in different tumors, including glioblastoma, lung, stomach, pancreatic, colon, prostate and breast, [31] as well as in invasive cancer cells and tumor metastases [31]. [score:1]
These correlations could explain in part the involvement of the three miRs (miR-10b, miR-21 and miR-182) in the occurrence of the lymph node metastases within triple negative breast cancer group. [score:1]
The use of the contraceptive pills according to TNBC was strongly associated to all microRNAs except for miR-34 and miR-146a and miR-182 with P value <0.05 and in relation to NTNBC, it was significantly associated with the all analyzed microRNAs; P value <0.01. [score:1]
The correlation between miR-182 and miR-148a has already been described to be involved in medulloblastoma and metastases mechanisms [46]. [score:1]
Indeed, miR-182 exhibited the highest fold change difference with R ratio = 4.32 and P value = 0.0001. [score:1]
Moreover, miR-10b, miR-21 and miR-182 could be defined as biomarkers in breast cancer to predict both lymph node metastases and grade III occurrence. [score:1]
We also observed that miR-17 correlates strongly with miR-21 and normally with miR-148a (Spearman’s rho, 0.39 and 0.4 respectively; P<0.05) and that miR-21 correlates with miR-146a, miR-148a and miR-182 (Spearman’s rho, 0.39, 0.38 and 0.62 respectively; P<0.05). [score:1]
Figure S1 Distribution of miR-10b, miR-21 and miR-182 according to lymph node metastases status in triple negative and non triple negative breast cancer. [score:1]
Then, we scored the expression of miR-10b, miR-12, and miR-182 by curve ROC to confirm their association to lymph node metastases across TNBC and to Grade III according to non triple negative breast cancer by measuring their degree of sensibility and specificity with respect to this type of cancer (Figure S2) and (Figure S3). [score:1]
miR-34a correlates with both miR-146a and miR-182 (Spearman’s rho, 0.81 and 0.45 respectively; P<0.05). [score:1]
We also recorded that miR-17 correlates strongly with miR-21; miR-148a and miR-182 (Spearman’s rho, 0.71, 0.74 and 0.6 respectively; P<0.01). [score:1]
We finally observed a correlation between miR-146a and miR-182 (Spearman’s rho, 0.5; P<0.05) (Table 6). [score:1]
We also noticed a strong correlation between miR-148a and miR-182 (Spearman’s rho, 0.64; p<0.05). [score:1]
Finally we observed that miR-34a correlated weakly with only miR-148a and miR-182 (Spearman’s rho, 0.39 and 0.4 respectively; P<0.05) (Table 6). [score:1]
The non breastfeeding in women with TNBC was significantly associated with only miR-182 (P value, 0.02), while in the NTNBC group we did not observe any significant association with any of the studied miRs. [score:1]
Moreover, miR-10b, miR-21 and miR-182 were significantly associated to lymph node metastases occurrence in triple negative breast carcinoma while only miR-10b was associated with grade III in non triple negative breast cancer cases. [score:1]
[1 to 20 of 43 sentences]
20
[+] score: 82
Other miRNAs from this paper: hsa-mir-96, mmu-mir-182, mmu-mir-183, hsa-mir-183, mmu-mir-96
In miR-183C [GT/GT] 5wk-retina, our hypergeometric analysis demonstrates that combined loss of all miR-183 cluster miRNAs results not only in enrichment (Odds Ratio 1.65–1.70, FDR-adjusted P < 0.05, Table  5) of miR-183 cluster targets in miR-183C [GT/GT] upregulated genes (uncorrected P < 0.05, fold change >+ 1.05), but also the reciprocal depletion of miR-96 and miR-182 targets (Odds Ratio 0.52, 0.58, respectively, FDR-adjusted P < 0.05, Table  5) in miR-183C [GT/GT] downregulated genes (uncorrected P < 0.05, fold change <−1.05). [score:11]
The effects mediated by miRNAs on inner ear morphogenesis, neurosensory cell identity, function and homeostasis indicate that gene regulation through miRNAs are critical to the biology of the inner ear 1– 6. The polycistronic cluster of Mir96, Mir182 and Mir183 genes are abundantly expressed in afferent cochlear and vestibular neurons and their peripheral innervating targets: auditory and vestibular hair cells (HCs) 7– 9. From an evolutionary viewpoint, the miR-183 cluster of miRNA genes are syntenic, highly conserved and co-expressed in neurosensory organs of animals representing several taxonomic phyla, suggesting that the control of gene expression through by this miRNA cluster is highly coordinated and under extraordinary selective pressure [10]. [score:10]
Similarly, Hes1 validates as a target of miR-96 and miR-182, with miR-96 downregulation of luciferase activity exceeding 20%. [score:6]
Taken together, the hypergeometric analysis of Tg [1MDW/1MDW] demonstrates that at P5 in the OC, miR-183 cluster target genes, defined by both miRNA and 3′UTR seed site evolutionary conservation, are reduced concomitantly with transgenic overexpression of miR-183, mir-96 and miR-182. [score:5]
We confirmed transgenic SC miR-183 cluster expression directly by dual whole mount ISH/IHC using LNA-DIG labeled probes against miR-182 and an antibody against MYO6 (Fig.   1A–D). [score:4]
To direct misexpression of miR-96, miR-182 and miR-183 in the SCs of the inner ear, we modified an established GFAP promoter -driven reporter construct (pGFA-nlac, Michael Brenner, UAB) by substituting the nLacZ gene with the miR-183 cluster coding sequences [23]. [score:4]
As expected, relative luciferase activity in cells co -transfected with miR-182 and reporter vector containing the Sox2 3′ UTR is reduced by nearly 20%, confirming previous findings that Sox2 is a miR-183 cluster target [9]. [score:3]
To test this hypothesis, we engineered Tg(GFAP- Mir183,Mir96,Mir182) (Tg [1MDW]) mice to drive ectopic miR-183 cluster expression using the core human promoter of the glial fibrillary acidic protein (GFAP). [score:3]
Also, in-situ hybridization (ISH) with an LNA-DIG labeled probe against miR-182 was consistent with RT-PCR, showing Bergmann glial cell localization in Tg [1MDW] cerebellum only, a common cell type expressing GFAP-core promoter transgenes [23] (Supplementary Figure  1B–D). [score:3]
However, further evidence of transgenic SC miR-183 cluster expression was obtained through quantitative RT-PCR, which showed 2.9-, 2.7- and 2.2-fold higher levels of miR-182, miR-96 and miR-183, respectively, in Tg [1MDW/1MDW] versus WT P18-cochlear total RNA (Fig.   1E). [score:3]
Figure 1Supporting cell (SC) expression of miR-182 in Tg [1MDW/1MDW] mice at P18. [score:3]
The spatiotemporal expression pattern of Mir96, Mir182 and Mir183 in the developing vertebrate inner ear and the effects induced by modulating levels of these miRNAs on HC fate determination in zebrafish and chicken argue that these miRNAs collectively function, to some degree, in the transition from inner ear prosensory cells towards a HC fate 8, 9, 11, 12. [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (Fig.   5A,B, boxed probesets), with fold changes + 5.67 (P18- Prm1) to + 16.97 (P18- Mir182). [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (boxed probesets). [score:3]
The miR-183/miR-96 PCR product was directionally cloned into the XmaI-EcoRV sites within the polycloning region of pIRES-hrGFPII (Stratagene) to create p183-X-E. The miR-182 PCR product was subsequently cloned into the EcoRV-NotI sites of p183-X-E to create p182-10. [score:2]
Line name FISH localization Intercross genotypes scoredMen delian ratio χ [2] P-valueTg genotype (log2 [−∆∆CT]) MGI submission # WT = 154 N/ATg [1MDW] Chr 9E3 Het = 240 0.017 5.9 ± 1.3 MGI:5436579 Homo = 113 10.6 ± 2.4 WT = 23 N/ATg [2MDW] Chr 16C1~3.1 Het = 36 0.40 7.5 ± 2.8 MGI:5436582 Homo = 25 15.6 ± 6.7 WT = 25 N/ATg [3MDW] Chr 16 A~B2 Het = 49 0.98 2.2 ± 0.3 MGI:5436584 Homo = 22 3.9 ± 0.7 FVB/NClr-Tg(GFAP- Mir183,Mir96,Mir182)1MDW miceSCs in the postnatal inner ear organ of Corti (OC) express endogenous GFAP and human GFAP-promoter driven GFP and LacZ reporters 21, 22. [score:2]
To determine whether miR-183, miR-182, or miR-96 directly regulate select SC genes important to HC/SC differentiation (i. e. Jag1, Sox2, Hes1, Notch1) dual luciferase assays were performed. [score:2]
In support of this idea, we detected a discrete number of apparent Deiters’ cells positive for both MYO6 and miR-182 at P18 (Fig.   3A,B, arrows). [score:1]
Cy5 fluorescence of tyramide enhanced miR-182 ISH labeling shows nuclear/cytoplasmic staining in hair cells (HCs A, B) and definitive Tg [1MDW/1MDW] OC SC nuclear staining, including Deiters’, inner pillar, outer pillar, inner phalangeal and inner border cells (B, arrowheads). [score:1]
HEK293 cells (~2 × 10 [5] cell/well; 24-well plate) were co -transfected using Lipofectamine 2000 (Invitrogen) with 200 ng reporter vector and 20 pmol synthetic RNA duplex representing scrambled control siRNA (Integrated DNA Technologies), miR-96, miR-182, or miR-183, or with 30 pmol combined miRNAs (10 pmol each). [score:1]
Arrows point to additional miR-182 positive, medially placed IHCs. [score:1]
Each were co -transfected in HEK293 cultures with synthetic RNA duplexes representing miR-96, miR-182, or miR-183 alone or in combination. [score:1]
Cy5 fluorescence of miR-182 used sheep anti-DIG-POD Fab antibodies (Roche) with a tyramine signal amplification kit (TSA Plus, Perkin Elmer). [score:1]
The miR-183, miR-96 and miR-182 levels were normalized to Sno135. [score:1]
SC labeling with miR-182 was found in spiral limbus cells and myelinated Schwann cells of spiral ganglion neurons (B, arrows). [score:1]
Whole-mount in situ hybridization (ISH) using LNA-DIG labeled probes against miR-182 was performed as previously described [7]. [score:1]
Spiral limbus and Schwann cell nuclei also were stained with LNA-miR-182, similar to other GFAP promoter driven transgenes (Fig.   1B, arrows, Smeti et al., 2011). [score:1]
Histograms of mean relative luciferase activity in HEK293 cells co -transfected with a dual reporter vector (pmirGLO) containing cloned DNA sequences corresponding to the 3′ UTR of the indicated genes plus synthetic miRNA duplexes representing miR-96, miR-182, miR-183, or all three (ALL) normalized to scrambled siRNA control (CTRL). [score:1]
The results quantitate statistically significant (ΔCT values, 2 sample t-test, P < 0.001) increases in miR-182 (2.9 fold), miR-96 (2.7 fold) and miR-183 (2.2 fold) in Tg [1MDW/1MDW] cochlea at P18. [score:1]
[1 to 20 of 29 sentences]
21
[+] score: 80
We reasoned that upregulation of miR-182 could result in reduced expression of target mRNAs. [score:8]
Targeted suppression of miR-182 expression has been reported to reduce hepatic metastases in an experimental mo del of melanoma (41), suggesting that miR-182 is involved in promoting the development of liver metastases. [score:8]
While subsequent confirmed upregulation of miR-182 and downregulation of miR-204 in tumor vs. [score:7]
This included the upregulation of a number of miRNAs (e. g., miR-21, miR-31, miR-96 and miR-135b, miR-182, miR-183) (14– 19, 29– 34) and downregulation of miRNAs (e. g., 133a and mir-1) (31) which were previously noted. [score:7]
These immunohistochemical results support a recent report of decreased FOXO3a (39) expression in CRC, and suggest that miR-182 levels may contribute to the regulation of FOXO1 and FOXO3a expression. [score:6]
In accordance with the expression levels of miR-182, there were reduced expressions of FOXO3 and FOXO1 in tumor vs. [score:5]
In agreement, analysis of miR-182 expression in the 6 AA designated colon cancers and the 37 CA designated colon cancers in The Cancer Genome Atlas database also showed increased expression in the AA cancers, but this increase did not reach statistical significance (37). [score:5]
While the observation that miR-182 expression is increased in AA tumors, needs to be confirmed in larger samples sets and/or better annotation of racial metadata in existing collections, the results of this study suggests that variations in sample processing at different institutions will not obscure racial differences in miRNA expression. [score:5]
Our main potential biomarker for indicating a role in racial disparity, miR-182, has been previously reported to be upregulated in tumor vs. [score:4]
miR-182 was upregulated 11.1-fold in paired tumor vs. [score:4]
For further downstream analysis, we focused our attention on the potential targets of miR-182 (35, 36). [score:3]
To test this hypothesis, immunohistochemical staining for two potential miR-182 targets, FOXO1 and FOXO3a, were performed on 10 of the 15 matching tissue sets from SBU CA and AA colon cancer patients (Fig. 3). [score:3]
were used to detect these targets of miR-182 and miR-183. [score:3]
miR-182 demonstrates a significant race:tumor interactions based on resultsqRT-PCR using primers for 25 of the miRNAs which were most differentially expressed was conducted to confirm results of the miRNA microarray analysis. [score:2]
RANOVA analysis of only miR-182 and its cluster partner, miR-183 demonstrated a significant race:tumor interaction term (p<0.05, Table III). [score:1]
The miRNAs which exhibited statistical significance as determined by RANOVA analysis were mir-182 and miR-183 (Fig. 1). [score:1]
miR-182 demonstrates a significant race:tumor interactions based on qRT-PCR results. [score:1]
We propose that this may be related to an increase of miR-182 in AA colon cancers. [score:1]
Of the 5 miRNA with both race and tumor main effects, we noted the prominence of miR-182 and miR-204, which were identified based on RANOVA analysis of the SBU miRNA profiles alone (data not shown) and confirmed by the combined data sets. [score:1]
A recent RT-PCR analysis of selected miRNAs in AA and CA paired tumor and adjacent normal colon tissues detected an effect of race and colon cancer stage on expression; however, miR-182 was not measured in this study (38). [score:1]
Another may be epigenetic modulation of the miR-182 locus (43). [score:1]
The relative level of miR-182 is much higher in the tumor than in the paired adjacent normal colonic tissue. [score:1]
normal tissues, only miR-182 was confirmed as being increased in AA vs. [score:1]
As demonstrated in Fig. 2, the lines connecting the paired tumor and normal tissues cross, thus graphically demonstrating the interaction between race and tumor in miR-182 data. [score:1]
[1 to 20 of 24 sentences]
22
[+] score: 79
Since ENTPD5 resulted significantly down-regulated in our analysis, and another study provided support for downregulation during cancer progression [21], we decided to study the relationship between miR-182 and its predicted target gene ENTPD5. [score:9]
Some genes are shared predicted targets of different miRNAs: the PDCD4 gene, a tumor suppressor gene, appears to be the target of miR-21, miR-182 and miR-183, all up- regulated in the T vs N comparison. [score:8]
Among the predicted miR-182 targets, ENTPD5 was differentially down-regulated in our analysis. [score:6]
Average relative light units (RLU) of biological replicates compared with control (HEK293T pMIR-ENTPD5), non-target RNA (HEK293T pMIR-ENTPD5 non-target RNA) and miR-182 over -expression (HEK293T pMIR-ENTPD5 miR-182). [score:6]
The component regarding the 6 up-regulated miRNAs was smaller, and a large fraction of genes appeared to be regulated by miR-182. [score:5]
As shown in Figure  2B, all tumor cell lines showed an inverse correlation (−0.85, p-value < 0.05) between high expression of miR-182 and low expression of ENTPD5. [score:5]
We next wanted to provide support to the direct targeting of ENTPD5 by miR-182. [score:4]
For instance, focusing on T vs N up-regulated DEMs, miR-182 is involved together with miR-21, miR-18a, miR-1246 and miR-183 in the modulation of cancer-related pathways, and with miR-150 and miR-183 in the reprogramming of energy metabolism (purine and selenoaminoacid metabolism), in which various down-modulated DEGs were found, including ENTPD5 (Figure  2 and Additional file 1: Table S4). [score:4]
At the same time, miR-182 was grouped in the cell cycle pathway together with down-regulated miRNAs. [score:4]
miR-182 was one of the most upregulated DEMs in the T vs N contrast. [score:4]
This finding is in line with our results, which also indicate miR-182 as a possible regulator of ENTPD5 expression. [score:4]
RNU44 and GAPDH were used as internal controls, respectively for miR-182 and ENTPD5 gene expression quantification. [score:3]
The suppressor activity of miR-182 on ENTPD5 gene was identified for the first time and confirmed in an independent set of samples. [score:3]
For miR-182 analysis, cells were cotransfected with non-target RNA (Tema ricerca, Bologna, Italy) as negative control or miCENTURY OX miNatural for hsa miR-182 (Tema ricerca), in triplicate. [score:3]
The suppressor activity of miR-182 on the ENTPD5 gene was identified for the first time and confirmed in an independent set of samples. [score:3]
When cells were co -transfected with miR-182, a 50% reduction in luciferase expression was observed, compared with cells transfected with negative control RNA or pMIR-ENTPD5 only (Figure  2C). [score:2]
To confirm array data for miR-150, miR-146a, miR-10b, miR-122 and miR-210 and to validate miR-145/c-Myc and miR-182/ENTPD5 relationships, we conducted qRT- PCR experiments, as previously described [52]. [score:1]
To investigate the opposite behavior of the miRNA and its target gene, we performed qRT-PCR to measure miR-182 and ENTPD5 expression in a panel of five cell lines (CG-705, HT29, from a primary colorectal tumor, and MICOL-S, MICOL-14, and LoVo, from colorectal carcinoma metastases [22]). [score:1]
The connection between miR-21 and miR-182 is particularly intriguing, in the light of the role of miR-182 in cytoskeleton reorganization, a process which favors the epithelial to mesenchymal transition and fosters cell proliferation and invasion. [score:1]
The interplay between the sub-networks suggested to be modulated by miR-21 and miR-182 deserves comment. [score:1]
miR-182 controls ENTPD5. [score:1]
The pink solid line outlines the experimentally validated miR-182/ENTPD5 relation. [score:1]
[1 to 20 of 22 sentences]
23
[+] score: 78
MRL-Fas [lpr]/J mice, and the expression levels of miR-96-5p and miR-182-5p showed strong positive correlations with some SLE parametersTo examine whether ASC or cyclophosphamide treatment can modify disease -associated miRNAs, we compared the expression levels of the common lupus disease -associated miRNAs between the different treatment groups. [score:8]
The upregulation of miR-96 and miR-182 may downregulate Foxo1/3a 30 31, leading to the breakdown of T cell tolerance 34 35. [score:7]
Relationships between miR-96-5p expression level and other SLE parameters and between miR-182-5p expression level and other SLE parameters. [score:5]
Cyclophosphamide treatment led to significantly lower miR-96-5p, miR-182-5p, and miR-379-5p expression and significantly higher miR-150-5p expression relative to the saline -treated C3. [score:5]
In the results of the splenocytes from the MRL/lpr mice, ASC treatment did not change the miR expression significantly, but cyclophosphamide treatment decreased the expression of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p significantly compared with the saline-treatment. [score:4]
The expression level of miR-182-5p also showed a strong negative correlation with percentage of CD4+ CD25+ Foxp3+ cells (Pearson’s correlation, Table 1). [score:3]
In splenocytes from the MRL-lpr mice (the samples in our previous study), the expression levels of miR-18a-5p, miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR-101a-3p and miR150-5p were significantly lower in the C group than in the N group. [score:3]
MRL-Fas [lpr]/J mice, and the expression levels of miR-96-5p and miR-182-5p showed strong positive correlations with some SLE parameters. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p 5p in the Y group were significantly lower than in the C group (Supplementary Fig. 3). [score:3]
A decrease in miR-96-5p and miR-182-5p expression as well as a decrease in the CD138 proportion and Th1/Th2 ratio might be involved in the mechanisms of therapeutic effects of ASCs in C3. [score:3]
The expression levels of miR-96-5p, miR-182-5p in the H group were significantly lower than in the C group (Fig. 4). [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in C3. [score:3]
The expression levels of miR-96-5p, miR-182-5p, and miR-379-5p were significantly lower, while those of miR150-5p were significantly higher in the Y group than in the C group. [score:3]
Thus, a decrease in miR-96-5p and miR-182-5p expression by ASC or cyclophosphamide treatment might result in reducing the breakdown of T cell tolerance and decreasing the production of autoantibodies, which are thought to be involved in the therapeutic mechanism. [score:3]
Relationships between miR-182-5p expression level and the other SLE parameters analyzed in this study were also examined. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression level of miR-96-5p showed strong positive correlations (r > 0.7) with SLE parameters of miR-182-5p, spleen weight, lymph node weight, spleen weight/body weight, lymph node weight/body weight, glomerular C3 deposition, anti-dsDNA antibody levels (at 40 weeks of age), percentage of CD138 + cells, percentage of T-bet+ of CD4+ CD25+ cells, and Th1/Th2. [score:3]
The expression level of miR-182-5p showed strong positive correlations with SLE parameters of miR-96-5p, spleen weight, lymph node weight, spleen weight/body weight, glomerular C3 deposition, percentage of CD138+ cells, percentage of T-bet+ of CD4+ CD25+ cells, and Th1/Th2. [score:3]
ASC or cyclophosphamide treatment restored the expression levels of miR-96-5p and miR-182-5p in C3. [score:3]
A representative gating scheme and representative dot plots are presented in Supplementary Fig. 2. ASC or cyclophosphamide treatment restored the expression levels of miR-96-5p and miR-182-5p in C3. [score:3]
ASC treatment also led to significantly lower miR-96-5p and miR-182-5p expression compared with the saline -treated C3. [score:2]
There was strong correlation between miR-96-p5 and the SLE parameters of miR-182-5p, spleen weight, lymph node weight, spleen weight/body weight, lymph node weight/body weight, glomerular C3 deposition, anti-dsDNA antibody levels (at 40 weeks of age), percentage of CD138+ cells, percentage of T-bet+ of CD4+ CD25+ cells, Th1/Th2, and percentage of CD4+ CD25+ Foxp3+ cells. [score:1]
There was also strong correlation between miR-182-p5 and some SLE parameters. [score:1]
[1 to 20 of 23 sentences]
24
[+] score: 68
Their respective sequences are: miRCURY LNA™ miRNA Inhibitor Negative Control A: GTGTAACACGTCTATACGCCCA; miRCURY LNA™ miR-183 inhibitor: AGTGAATTCTACCAGTGCCAT; miRCURY LNA™ miR-96 inhibitor: GCAAAAATGTGCTAGTGCCAA; miRCURY LNA™ miR-182 inhibitor: TGTGAGTTCTACCATTGCCAA. [score:9]
Compared with EV, overexpression of GSK3β inhibited the expression of miR-96, miR-182 and miR-183 by 2-fold (P < 0.05) (Figure 2D). [score:6]
miR-182 increases tumorigenicity and invasiveness in breast cancer by targeting the matrix metalloproteinase inhibitor RECK (29). [score:5]
Our results showed that both the primary and mature miR-96, miR-182, miR-183 expression levels were significantly upregulated in gastric cancer tissues compared with the adjacent normal control gastric tissues. [score:5]
To investigate the effects of suppression of miR-183-96-182 cluster on gastric cancer cell phenotype, we transfected a miRCURY LNA™ miRNA Inhibitor Negative Control or a mix of miRCURY LNA™ inhibitors for miR-183, miR-96 and miR-182 into AGS cells. [score:5]
Kong et al. (31) found that miR-182 was significantly downregulated in human gastric adenocarcinoma tissue samples. [score:4]
Li et al. (32) reported that miR-96, miR-182 and miR-183 were all upregulated in intestinal-type gastric cancers. [score:4]
Since GSK3β inhibits the expression of miR-96, miR-182 and miR-183 in human gastric epithelial AGS cells, we measured the protein levels of GSK3β and β-Catenin by western blot and miR levels of miR-96, miR-182 and miR-183 by quantitative RT-PCR (qRT-PCR) in eight gastric cancer and matched normal gastric tissue samples. [score:3]
Figure 6. β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster in human gastric cancer. [score:3]
Overexpression of β-Catenin increased the levels of primary and mature miR-96, miR-182 and miR-183 by 5-fold (Figure 6A and B). [score:3]
Figure 3. Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and pri-miR-183 in human gastric cancer. [score:3]
The miR array data revealed that they were increased 6-, 5- or 3-fold, respectively (Table 1 and Figure 2C), suggesting that GSK3β may suppress the generation of miR-96, miR-182 and miR-183. [score:3]
Surprisingly, the primary miR-183-96-182 cluster (pri-miR-183) levels were higher in gastric cancer tissues than that in the matched normal tissues, indicating that GSK3β regulates the production of miR-96, miR-182 and miR-183 through β-Catenin at the transcription level. [score:2]
On the other hand, knockdown of β-Catenin by specific siRNA decreased the primary and mature miR-96, miR-182 and miR-183 levels by 3-fold (Figure 6C and D). [score:2]
We measured pri-miR-183 and mature miR-96, miR-182, miR-183 expression levels in gastric cancer and matched normal gastric tissue by qRT-PCR. [score:1]
The levels of miR-96, miR-182 and miR-183 in gastric cancer were increased by 2-fold (Figure 3C). [score:1]
Of the miRs that were increased the most by GSK3β KO, miR-96, miR-182 and miR-183 are all from the same miR gene cluster. [score:1]
The products of miR-183-96-182 cluster gene, miR-183, miR-96 and miR-182, play important roles in a variety of cancers. [score:1]
The gene encoding miR-96, miR-182 and miR-183 locates to human chromosome 7q32.2. [score:1]
[1 to 20 of 21 sentences]
25
[+] score: 61
Over -expression of miR-182 expression can regulate cell cycle and suppress proliferation of lung cancer cells in vitro [46]. [score:8]
We found that the BDNF mRNA 3′-untranslated regions (UTR) was targeted by miR-182 through this computational analysis (Fig. 1B). [score:5]
We identified miR-132 and miR-182 as BDNF regulatory miRNAs by bioinformatics, and functionally validated their role in the negative regulation of the BDNF expression using a human neuronal cell mo del. [score:5]
miR-182 has been shown to regulate cell growth and suggested as a tumor-suppressive gene. [score:4]
Thus, our results supported the roles of both miR-182 and miR-132 in regulating the BDNF expression. [score:4]
We also found that miR-182 was a novel putative miRNA that regulated the BDNF expression through bioinformatic and cell -based functional studies. [score:4]
Dysregulation of miR-182 can result in tumorigenesis, and lead to gastric adenocarcinoma through a mechanism targeted by CREB1 [45]. [score:4]
However, Bai et al. reported different roles of miR-182 in non-sonic hedgehog medulloblastoma, and showed that over -expression of miR-182 contributed to leptomeningeal metastatic dissemination in non-sonic hedgehog medulloblastoma and the knockdown of miR-182 decreased cell migration in vitro [47]. [score:4]
After chemical synthesis of miRNAs, the human neuroblastoma SH-SY5Y cells were transfected with miR-132 or miR-182, and the BDNF expression was detected by western blotting analysis. [score:3]
SH-SY5Y cells were treated with miR-182 or miR-132, the results showed that BDNF expression in the miR-182- or miR-132 -treated cultures was much lower than that of negative control miRNA cultures. [score:3]
The serum levels of miRNAs (miR-132 and miR-182) were found to be increased and BDNF levels were reduced in depressed patients compared with healthy controls, which supported that miR-132 and miR-182 could negatively regulate BDNF expression. [score:3]
Our results demonstrated that miR-182 was a novel putative BNDF -regulating miRNA, which may be involved in the pathogenesis of depression. [score:2]
Serum miR-132 and miR-182 levels detected by real-time PCR. [score:1]
miR-182 has also been reported to involve in circadian rhythms in major depression patients with insomnia [22]. [score:1]
In addition, the serum miR-182 levels in patients with depression were 0.02×10 [3] copies/ml (n = 40), which were also significantly higher than those in the serum levels of healthy controls (P<0.01, Table 1, n = 40, Fig. 3B). [score:1]
Therefore, we found that a negative correlation between the serum BDNF levels and the miR-132 levels in depressed patients and healthy controls, but we did not found a significant negative correlation between the serum BDNF levels and the miR-182 levels in patients and controls. [score:1]
Since miR-132, miR-182 did not showed normal distribution, nonparametric tests were applied. [score:1]
showed that serum miR-132 (or miR-182) levels in depressed patients (n = 40) were much higher than those in healthy controls (n = 40, P<0.01). [score:1]
0063648.g003 Figure 3(A, B) Serum miR-132 or miR-182 levels in patients with depression and their controls, respectively. [score:1]
MiR-132 and miR-182 were chemically synthesized in the form of small interfering RNA (siRNA) duplexes according to Park’s study [51] (Table 2). [score:1]
Moreover, significant positive correlations were found not only between the serum miR-132 level and SDS score, but also between the serum miR-182 levels and the SDS scores in depressed patients and healthy controls. [score:1]
A significant positive correlation (Spearman r [s = ]0.242, P = 0.030) was also found between the serum miR-182 levels and the SDS scores in all subjects (n = 80, Fig. 5C). [score:1]
However, there was no significant correlation (Spearman r [s] = 0.098, P = 0.385) between the serum BDNF levels and the miR-182 levels in all patients (n = 40) and controls (n = 40, Fig. 4B). [score:1]
For example, two polymorphisms, located in pre-miR-182 and pre-miR-30e, were associated with the increased risk of the major depressive disorder [22], [23]. [score:1]
[1 to 20 of 24 sentences]
26
[+] score: 54
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The reduction of Cxcr3, Fut1, and Rhobtb1 expression was associated with an increased expression of miR-148b, miR-125a, and miR-182, which target Cxcr3, Fut1, and Rhobtb1 mRNAs, respectively, suggesting that, in addition to Aicda and Prdm1, which are already downregulated by HDI, other genes can also be downregulated by HDI through upregulation of their targeting miRNAs. [score:18]
Like miR-182, miR-96, which, based on its sequence, could target all putative miR-182 targeting sites, is also highly expressed by B cells induced to undergo CSR and plasma cell differentiation (Figure 8), would compensate the function of miR-182. [score:7]
Figure 8The Prdm1 targeting miRNAs miR-23b, miR-125a, miR-351, miR-30a/c/d, miR-182, miR-96, miR-98, miR-200b/c, and miR-365 are upregulated by HDI. [score:6]
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
Because the precursors of miR-96, miR-182, and miR-183 are transcribed as a single transcript, these findings further support the contention that HDI modulate miRNA expression through regulation of their primary transcript (16). [score:4]
org, in both mouse and human, miR-182 and miR-96 can potentially target Prdm1/PRDM1 3′ UTR at the same site (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
In B cells stimulated with LPS plus IL-4, miR-182, miR-96, and miR-183 were all highly expressed. [score:3]
miR-182, miR-96, and miR-183 belong to a polycistronic miRNA cluster that is located within a 4-kb area on mouse chromosome 6q. [score:1]
miR-182 has been identified as the miRNA induced at a high level in B cells stimulated to undergo CSR (60); however, deficiency of this miRNA did not significantly alter the titers of total serum IgM, IgG1, IgG2a, IgG2b, IgG3, IgA, and IgE, and NP -binding IgG1 in mice immunized with NP-CGG (60). [score:1]
miR-182 is a member of the miR-183~182 cluster which includes miR-96, miR-182, and miR-183. [score:1]
These miRNA siblings share similar seed sequences; in fact, the seed sequences of miR-96 and miR-182 are identical. [score:1]
[1 to 20 of 12 sentences]
27
[+] score: 45
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
Wang et al. (2012) miR-96, miR-182 Chloride intracellular channel 5 (Clic5) Co -expression in mouse auditory HEI-OC1 cells; luciferase assay in A549 cells; down-regulation of target. [score:7]
In the presence of miR-182, the mRNA levels of Tbx1 were restored as compared to infected cells, suggesting target inhibition. [score:4]
Therefore the tightly regulated transcriptional regulation of Tbx1 in the mammalian ear may be influenced in part by miR-182, providing a function in crucial inner ear developmental pathways. [score:4]
Expression patterns of miR-96, miR-182 and miR-183 in the development inner ear. [score:4]
After confirming direct binding between miR-182 and the Tbx1 3′UTR by luciferase assay, degradation of the target on an mRNA level was tested (Wang et al., 2012). [score:3]
To demonstrate that miR-182 is a direct target of Sox2, a luciferase assay was performed both with a luciferase reporter vector with the 3′UTR of Sox2 and a mutated version of the 3′UTR at the seed region of miR-182 (Weston et al., 2011). [score:3]
Clic5, a chloride intracellular channel that is associated with stereocilia in the inner ear, was identified as a target of both miR-96 and miR-182 (Gu et al., 2013). [score:3]
Isolated IHC infected with rA-miR-182 and transfected miR-182 inhibitor were collected and harvested to explore Tbx1 transcription. [score:3]
Moreover, the transcription factor Tbx1 was found to be a target of miR-182. [score:3]
MicroRNA-182 regulates otocyst-derived cell differentiation and targets T-box1 gene. [score:3]
Targeted deletion of miR-182, an abundant retinal microRNA. [score:3]
In a study on cells derived from mouse otocysts, miR-182 promoted differentiation of these cells to a hair cell-like fate (Wang et al., 2012). [score:1]
” For specific miRNAs, the approach taken to examine loss of miR-182 in the retina is a relevant approach (Jin et al., 2009), though not yet exploited in the inner ear. [score:1]
This conserved miRNA triad, composed of miR-183, miR-182, and miR-96, is transcribed in one polycistronic transcript. [score:1]
The mutated 3′UTR could not bind miR-182 and the decrease in luciferase activity that was observed in the wild-type construct was lost. [score:1]
Patel et al. (2013) Early growth response 1 (Egr1) Insulin receptor substrate 1 (Irs1) miR-182 SRY-box containing transcription factor (Sox2) In situ hybridization; luciferase assay in HEK293 cells Weston et al. (2011) miR-182 T-box 1 (Tbx1) Luciferase assay in COS1 cells; overexpression of miR in cultured otic progenitor/stem cells. [score:1]
[1 to 20 of 16 sentences]
28
[+] score: 44
Other miRNAs from this paper: mmu-mir-182
Indeed, FMO3 knockdown increased expression of miR-182 (Fig. 4r) and suppressed FoxO1 (Fig. 4q) and its targets (Supplementary Fig. 4b) in females, just as it did in males. [score:8]
This construct reduced expression of Srebp-2 and its targets, Hmgcr, Ldlr and miR-182 (Supplementary Fig. 2k). [score:5]
Overexpression of miR-182 also reduced FoxO1 protein, but the effects were more modest, suggesting that SREBP-2 may suppress FoxO1 via other mechanisms as well (Fig. 2o). [score:5]
To directly test the roles of SREBP-2 and miR-182 in the regulation of FoxO1, we overexpressed SREBP-2 via an adenovirus in primary mouse hepatocytes (Fig. 2l). [score:5]
Thus, in ob/ob mice, as in LIR KO mice, the knockdown of FMO3 can activate SREBP-2/miR-182 and suppress FoxO1 and hyperglycaemia. [score:4]
It also induced miR-182 (Fig. 2r) and suppressed FoxO1 mRNA, FoxO1 protein and G6pc mRNA (Fig. 2s,t). [score:3]
Overexpression of SREBP-2 was sufficient to induce Ldlr, Hmgcr and miR-182 (Fig. 2m,n). [score:3]
expressing the precursor form of mmu-miR-182 was generated using the AdEasy XL Adenoviral Vector System. [score:3]
Importantly, miR-182 is encoded by a miRNA locus that is activated directly by SREBP-2 (ref. [score:2]
Primer sequences are listed in Supplementary Table 1. The value of the control group was set to 1, but actual Ct values for QPCR are given in Supplementary Table 2. Alternatively, for quantification miR-182 (mmu-miR-182), Taqman assays (Applied Biosystems) were performed on RNA samples prepared using Trizol and the expression was normalized to housekeeper U6 snRNA. [score:1]
Consistent with the induction of SREBP-2 in these livers (Fig. 2i), miR-182 was increased four-fold (Fig. 2k). [score:1]
Primer sequences are listed in Supplementary Table 1. The value of the control group was set to 1, but actual Ct values for QPCR are given in Supplementary Table 2. Alternatively, for quantification miR-182 (mmu-miR-182), Taqman assays (Applied Biosystems) were performed on RNA samples prepared using Trizol and the expression was normalized to housekeeper U6 snRNA. [score:1]
In parallel, it increased Srebp-2, the cholesterologenic enzymes, and miR-182 (Fig. 4k-l). [score:1]
One potential link between FoxO1 and SREBP-2 is miR-182. [score:1]
We therefore measured miR-182 expression in the livers of LIR KO mice treated with FMO3 ASO. [score:1]
[1 to 20 of 15 sentences]
29
[+] score: 41
One hundred seven human placenta samples were analyzed for the expression of candidate miRNA previously shown to be expressed in the placenta and involved in regulating cell growth and developmental processes by targeting genes in a variety of cell growth and cell functioning pathways, specifically, miR-16, miR-21, miR-93, miR-135b, miR-146a, and miR-182. [score:9]
The range of expression values differed for the miRNAs, with miR-146a and miR-182 exhibiting expression in the 0.001–3.95 amol range, while miR-16 and miR- 21 expression was 2 orders of magnitude greater with expression ranging from 3.53–434.74 amol range. [score:9]
We analyzed 107 primary, term, human placentas for expression of 6 miRNA reported to be expressed in the placenta and to regulate cell growth and development pathways: miR-16, miR-21, miR-93, miR-135b, miR-146a, and miR-182. [score:7]
Since miRNA have been described as playing important roles in development and are susceptible to the environment, we sought to further characterize the expression of six candidate miRNA previously shown to be expressed in the placenta and previously reported to target genes in pathways crucial for regulating key cell processes – miR-16 [9], [14], miR-2 1 [9], [15], miR-93 [12], [13], miR-135b [11], miR-146a [9], [16], and miR-182 [10] – in a large series of human placentas for associations with fetal growth. [score:7]
Median (amol) Range (amol) miR-16 18.64 3.53–399.50 miR-21 54.86 5.25–434.74 miR-93 4.26 0.14–118.39 miR-135b 4.72 0.13–216.92 miR-146a 0.1 0.002–3.95 miR-182 0.23 0.001–3.63 Observing that expression in the lowest quartiles of miR-16 and miR-21 was associated with reduced birthweight percentile, we more specifically examined the association between low expression (≤median vs. [score:5]
Expression of miR-16, miR-21, miR-93, miR-135b, miR-146a, and miR-182 determined through qRT-PCR in 107 primary human term placenta samples. [score:3]
0021210.g001 Figure 1(A) miR-16 (p = 0.04), (B) miR-21 (p = 0.02), (C) miR-93 (p = 0.88), (D) miR-135b (p = 0.84), (E) miR-146a (p = 0.46), and (F) miR-182 (p = 0.55). [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 40
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 3. Conserved microRNA target sequences of stratum 1. (a– c) let-7 target sequences; (d) tandem target sequences for miR-182. [score:7]
The megaloop contains, among other features, a conserved pair of target sites for miR-320a and miR-182 (Fig.  4b) and a conserved triplet of target sites for miR-378, miR-99a and miR-30a (Fig.  4c). [score:5]
Another short region of conservation contains tandem target sequences for miR-182 that are present in Callorhinchus, Pelodiscus, Mono delphis and Callithrix (marmoset) IGF1R genes. [score:3]
Postranscriptional regulation of IGF1R by let-7, miR-7 and miR-182 are plausible candidates for such ancient functions because these microRNA families are themselves ancient, conserved between protostomes and deuterostomes [32–34]. [score:2]
We found that some ancient microRNAs, such as let-7 and mir-182, have predicted binding sites that are conserved between cartilaginous fish and mammals. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 39
Therefore, some common deregulated miRNA loci were selected to perform isomiR expression analysis based on gender-specific diseases and the common diseases, including down-regulated miR-143 and up-regulated miR-182 (S2 Table). [score:14]
Although some miRNAs are identified as common deregulated species in gender-specific diseases, such as deregulated miR-182 and miR-183, these miRNAs always exhibit different levels of up- or down-regulated expression (S2 Table). [score:10]
As expected, isomiR expression may show a significant difference between tumor and control samples, particularly for miR-143 in male-specific PRAD disease and miR-182 in LUSC disease (S3 Table). [score:7]
IsomiR expressions in selected common deregulated miRNA loci, including miR-143 and miR-182, differ across the four groups with different diseases (P < 0.01, Fig 3). [score:6]
For example, miR-182 and miR-183 are identified as oncogenic miRNAs and contribute to early breast cancer development [46]. [score:2]
[1 to 20 of 5 sentences]
32
[+] score: 38
To test if the expression of miR-200c, miR-125b and miR-182 could contribute to the low expression of cMaf in beta cells, Min6 cells were transfected with a combination of 200 nM each miR-200c, miR-125b, and miR-182 exogenous hairpin inhibitors (Dharmacon-Thermo Scientific). [score:7]
E. miR-182 inhibits cMaf and Gcg expression in α-TC6 cells. [score:5]
Over expression of miR-182 (50 nM) for 72 hs inhibits endogenous cMaf and Gcg mRNA, (n = 6), * p = 0.036 for cMaf and Gcg, Wilcoxon signed rank test-2 tails. [score:5]
Among the β-miRNAs potentially targeting cMaf are miR-125b, miR-182 and miR-200c, which are 27.3-, 9.7- and 3.3 fold more expressed in β-cells (Table 1 ). [score:5]
B. Differential expression of β-miRNAs: miR-200c, miR-125b and miR-182 assessed by qRT-PCR. [score:3]
Conversely, inhibition of miR-200c, miR-125b and miR-182 in Min6 cells increased the amount of cMaf transcripts. [score:3]
Moreover, in Min6 the expression of miR-125b, miR-182 and miR-200c is much higher than in alpha TC6. [score:3]
This result strongly suggests that miR-125b and miR-182 regulate cMaf as well. [score:2]
The same experiments were performed with miR-125b (Fig. 4D ) and miR-182 (Fig. 4E ) resulting in down regulation of endogenous cMaf and Gcg mRNAs as well cMaf protein levels. [score:2]
In n = 4 independent experiments we found a 222 fold (Min6 vs alphaTC6) for miR-125b, 27 fold for miR-182 and 166×103 for miR-200c (Fig. 3B ). [score:1]
α-TC6, transfected either with 50 nM mimic miR-200c, mimic miR-182,, mimic miR-125b or irrelevant control were lysed in SDS, Tris-HCL buffer (pH 6.8), and aliquots corresponding to 1.8 to 2.6 µg of protein (for cMaf nuclear proteins) were subjected to. [score:1]
U6 small nuclear RNA was used as endogenous control, mean ± SD (n = 4), * p = 0.005, 0.005 and 0.0022 (t-test, 2 tails) for miR-200c, miR-125b and miR-182. [score:1]
[1 to 20 of 12 sentences]
33
[+] score: 35
Sacheli et al. noted the earliest expression of miR-183 and miR-182 in the mouse otic vesicle at embryonic day 9. (E9.5), expression of all three miRNAs in OV, CVG, and neural tube at E11.5, and limited expression was observed at E14.5 [51]. [score:7]
We found that in human CVG, the miRNA-183 family was differentially expressed at stage 13 (E11), but only miR-182-5p was expressed at stage 14 (E11.5), and the miRNA family was not differentially expressed at stage 15 (E12). [score:7]
To investigate how the miR-183 family targets gene expression in human inner ear development, we performed computational target prediction for the miR-183 family (miRNA-96-5p, miR-182-5p, and miR-183-5p). [score:6]
The trend was not seen at Stage 14, where the only member of the miR-183 family that was upregulated was miR-182 (p = 0.004; with FDR correction p = 0.27) (indicated with a green circle in Fig 2). [score:4]
The differential expression of miR-183 family members (miR-96-5p, miR-182-5p, and miR-183-5p) in human CVG cell types at stage 13 correlates well with prior studies in mice. [score:3]
Weston et al. found that expression of the triad of miR-96, miR182, and miR-183 during development is relatively restricted to mouse inner ear compared to brain, heart, and whole embryo [3]. [score:3]
Note that at the Carnegie developmental stage 13, members of the miR-183 family (miR-96, miR-182, and miR-183) were highly expressed in CVG and OV as compared with NC (for CVG vs NC comparison, p = 0.0009, 0.003, and 0.0045; with FDR correction, p = 0.27, 0.40, and 0.41, respectively). [score:3]
In addition, the miR-183 family (miR-96, miR-182, and miR-183) is differentially expressed in the mouse inner ear as compared to other organs [3, 11]. [score:2]
[1 to 20 of 8 sentences]
34
[+] score: 35
The final stable reporter cell line was designed to identify small compounds (e. g. HDAC inhibitor Panobinostat) that inhibit miR-182 (and/or miR-183) generation or function, thereby resulting in the activation of the luciferases (both firefly and Renilla). [score:5]
We used a miR-182 (or miR-183) inhibitor (miRIDIAN microRNA hairpin inhibitor, Thermo Fisher Scientific) as a positive control and non-specific miRNA (miRIDIAN microRNA Negative Control, Thermo Fisher Scientific) as a negative control. [score:5]
[12] We showed that the inhibition of the miR-200 family and/or miR-182 family in SHSY5Y cells increased global protein conjugation by the abovementioned ULMs, and in so doing made these cells more resistant to OGD -induced cell death. [score:3]
As shown in Supplementary Figure 2(c), the basal level of luciferase activities (both firefly and Renilla) are very low in comparison to negative controls in Supplementary Figure 2(a) and (b) and the activation by the miR-182 (or miR-183) inhibitors were substantial. [score:3]
In order to maintain minimal basal levels of luciferase activities, we transduced these stable cell lines with lentiviral particles containing miR-182 (or miR-183) shMIMIC microRNAs (Thermo Fisher Scientific), and in so doing established cell lines that constitutively expressed these miRNAs via the selective pressure of puromycin. [score:3]
Herein we describe the development of a novel qHTS assay designed to uncover small molecules that increase global SUMOylation via inhibition of the miR-182 family. [score:3]
We then examined whether these stable transfectants (miR-182 or miR-183 target sequence in pmirGLO/psiCHECK1 plus lentiviral particles containing miR-182 or miR-183 shMIMIC) were usable for high-throughput screens. [score:3]
The final stable reporter cell line was designed to identify small compounds that inhibit miR-182 (and/or miR-183) generation or function, thereby resulting in the activation of the luciferases (both firefly and Renilla). [score:3]
Starting from these two vectors, we built a dual reporter construct with the miR-182 (or miR-183) target sequence (Figure 1 and Supplementary Figure 1), so that the presence of mature miR-182 or miR-183 would lead to a decrease in luciferase (both firefly and Renilla) signal, enabling the detection of putative miR-182 (or miR-183) levels. [score:3]
Of note, the endogenous levels of both miR-182 and miR-183 are quite low in SHSY5Y cells and thus the basal levels of luciferase activities are quite high (Supplementary Figure 2a and b). [score:1]
As shown in Supplementary Figure 2a, increased miR-182 (or -183) levels induced via the transfection of mimics significantly depressed both firefly and Renilla luciferase activity. [score:1]
The established stable transfectants responded well to both miR-182 or miR-183 mimics (i. e. the transfection of these mimics caused the depression of both firefly and Renilla luciferase acitivities in each cell line (Supplementary Figure 2b)). [score:1]
We confirmed that the presence of mature miR-182 or miR-183 would lead to a decrease in luciferase (both firefly and Renilla) signal, enabling the detection of putative miR-182 (or miR-183) levels (Supplementary Figure 2). [score:1]
[1 to 20 of 13 sentences]
35
[+] score: 35
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
In order to address the essential question of the effect of miRNAs throughout development, a study was conducted examining the expression pattern of the mir-183, mir-182 and mir-96 cluster (Sacheli et al, 2009). [score:4]
Over -expression of miR-182 in a miR-96 knockdown embryo demonstrated a partial rescue effect, and the number of hair cells was increased, as compared to the knockdown. [score:4]
These analyses revealed that the conserved cluster of mir-183, mir-182 and mir-96 have a restricted expression to the mouse inner ear, as compared to brain, heart and whole embryo expression. [score:4]
A conserved miRNA cluster, which includes miR-183, miR-182 and miR-96, was shown to be expressed in the zebrafish in the hair cells, otic neurons and other primary sensory cells. [score:3]
Embryos with miR-182 and miR-96 over -expression exhibited body malformations and produced ectopic hair cells. [score:3]
However, the expression of miR-183 and miR-182 continued in the hair cells, but ceased to be present in hair cells from P11-15, and was only found in the spiral limbus and the inner sulcus. [score:3]
provides another example of the involvement of miRNAs in regeneration, as over -expression of miR-182 and miR-96 resulted in production of ectopic hair cells (Li et al, 2010). [score:3]
In situ hybridization revealed the unique expression pattern of mir-182, mir-183 and mir-96 in inner and outer hair cells of the cochlea, hair cells of the vestibular organs and spiral and vestibular ganglia. [score:3]
By P0, miR-183, miR-182 and miR-96 were strongly expressed in hair cells of the cochlea and the vestibular system, and in the spiral ganglia. [score:3]
Since this report, several studies have focused on the mir-96, mir-182 and mir-183 genes as a source for more deafness mutations. [score:2]
In a different mo del system, zebrafish were used to understand the role of the miR-96, miR-182 and miR-183 cluster in inner ear development (Li et al, 2010). [score:2]
miR-183 and miR-182, but not miR-96, were detected in the otic vesicle in the embryonic early inner ear. [score:1]
[1 to 20 of 12 sentences]
36
[+] score: 33
In the same study we reported that GNA13 was upregulated in aggressive prostate cancer cells and this upregulation was mediated by loss of microRNAs, specifically by miR-182 and miR-200a, in a synergistic fashion [28]. [score:7]
Surprisingly, both miR-182 and miR-200a/141, which showed an inverse correlation to GNA13 protein expression in prostate cancer cells as reported earlier [28], were highly suppressed in breast cancer cells and hence had no correlation to GNA13 protein expression (Figure  3A, B). [score:7]
To our surprise, both miR-182 and miR-200a are highly suppressed in all the breast cancer cells tested, irrespective of the endogenous GNA13 protein expression in the cell type. [score:5]
Additionally, deregulation of miRNAs has been closely associated with oncogenesis and tumor progression in several cancer types [30, 45], In the context of GNA13 regulation, we have reported that miR-182 and miR-200a are involved in control of GNA13 expression in prostate cancer cells [28]. [score:5]
Surprisingly, unlike prostate cancer cells, GNA13 expression in breast cancer cells is mainly regulated through miR-31 and not through miR-182 and miR-200a. [score:4]
These studies led to the above-noted findings that miR-182 and miR-200a control GNA13 expression in prostate cancer cells [28]. [score:3]
The miRNAs that were predicted to bind the GNA13-3′ -UTR are miR-30 family, miR-27a/b, miR-128, miR-31, miR-182, miR-29a/b/c and miR-141/200a. [score:1]
It is important to note that miR-31 and miR-182 had overlapping binding sites, suggesting that either of these miRNAs could bind to the site based on the availability of the miRNA. [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 33
Whereas miR-182 and miR-375 were significantly overexpressed in PCa (P < 0.001 for both), confirming the results of the array, no significant differences were found for miR-32 expression between PCa and MNPT (Figure  1A and Additional file 2: Figure S1). [score:5]
Correlation analysis for miRNAs expression showed that miR-375 was significantly co-expressed with miR-32 and miR-182 (r = 0.36 and r = 0.60, respectively; Table  3 and Figure  3). [score:5]
Because a report on miR-182 overexpression in PCa was published during the execution of this study [18], we then proceeded with miR-375 for further analysis. [score:3]
Because several miRNAs were below detection level in quantitative reverse transcription-polymerase chain reaction (RT-qPCR) analyses (probably due to low expression levels), only three miRNAs (miR-32, miR-182, and miR-375) were assessed in the larger dataset. [score:3]
Expression of three miRNAs, not previously associated with PCa, was subsequently assessed in large independent sets of primary tumors, in which miR-182 and miR-375 were validated, but not miR-32. [score:3]
Validation of expression levels of (A) miR-32, (B) miR-182 (*** P < 0.001; ns, non-significant). [score:3]
Expression of miR-32 and miR-182 is increased in prostate cancer in patients from TCGA. [score:3]
Importantly, miR-182 and miR-375 overexpression was confirmed in the validation datasets. [score:3]
Moreover, both miR-32 and miR-182 were overexpressed in PCa compared to matched normal prostate tissues (P < 0.0001; Additional file 3: Figure S4). [score:2]
MNPT) miR-449a# 3.92 miR-32 3.49 miR-548c-5p 2.71 miR-562 2.56 miR-103-as 2.53 miR-512-3p 2.41 miR-200c* 2.33 miR-147b 2.24 miR-770-5p 2.09 miR-518c* 2.00 miR-517b 1.88 miR-182 1.79 miR-615-3p 1.70 miR-496 1.59 miR-1200 1.58 miR-375 1.54 miR-551a 1.53 *Passanger strand. [score:1]
Clinical and pathological data of patients included in this study for miR-32 and miR-182. [score:1]
Figure 3miR-375 is significantly co-expressed with (A) miR-32 and (B) miR-182 in prostate cancer patients from TCGA (r calculated by Spearman’s correlations). [score:1]
[1 to 20 of 12 sentences]
38
[+] score: 30
hsa-miR-182, hsa-miR-183 and hsa-miR-224 are upregulated and hsa-miR-1, hsa-miR-101, hsa-miR-143, hsa-miR-145, hsa-miR-127 and hsa-miR-29c are downregulated in bladder urothelial carcinoma compared to matched histologically normal urothelium [27]. [score:6]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium. [score:4]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium (p<0.001 for each miRNA) (Table S3). [score:4]
The upregulation of hsa-miR-182 and hsa-miR-183 and the downregulation of hsa-miR-143 were found in bladder urothelial carcinoma compared to matched histologically normal urothelium in our Real-Time qPCR evaluation. [score:4]
This cluster consists of hsa-miR-96, hsa-miR-182 and hsa-miR-183 and is located on chromosome 7. These three miRNAs are upregulated in prostate carcinoma [18]. [score:4]
Three overexpressed (hsa-miR-182, hsa-miR-183 and hsa-miR-200a) and two underexpressed miRNAs (hsa-miR-143 and hsa-miR-195) were evaluated in all of the patients included in this study. [score:3]
For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
0018286.g001 Figure 1For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
In this study, Real-Time qPCR was performed to evaluate the expression patterns of hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 in a total of fifty-one bladder urothelial carcinoma patients. [score:1]
[1 to 20 of 9 sentences]
39
[+] score: 30
We also found an age -associated increase of the median expression of miR-96 (p = 0.002), miR-145 (p = 0.024) and miR-9 (p = 0.026), decrease of the expression of miR-99a (p = 0.037), and no changes regarding miR-132 and miR-182. [score:5]
The expression of IGF-1R, FOXO1, FOXO3a, as well as of miR-9, miR-96, miR-99a, miR-132, miR-145, and miR-182 was examined in PBMC of young (27.8 ± 3.7 years), elderly (65.6 ± 3.4 years), and long-lived (94.0 ± 3.7 years) Polish Caucasians using real-time PCR. [score:3]
pmirGLO: “empty” reporter vector; pmirGLO_IGF-1R_5’: reporter vector containing DNA corresponding to the 5’ end of 3’UTR of IGF-1R mRNA; pmirGLO_IGF-1R_3’: reporter vector containing DNA corresponding to the 3’ end of 3’UTR of IGF-1R mRNA; pre-miR-neg, pre-miR-96, pre-miR-182: miRNA precursors Similarly, the mean luminescence induced by firefly luciferase expressed from the reporter vectors pmirGLO_FOXO1_5’ or pmirGLO_FOXO1_3’ in the presence of negative control miRNA was normalized to 100%. [score:3]
The expression of miR-132 and miR-182 remained stable (Table  2). [score:3]
Co-transfection with pre-miR-182 showed that only the binding site located within the 5’ fragment of 3’UTR of IGF-1R mRNA (Fig.   1c) was functional since the luminescence induced by firefly luciferase expressed from the pmirGLO_IGF-1R_5’ vector decreased by 29.5% (p = 0.0005). [score:3]
pmirGLO: “empty” reporter vector; pmirGLO_IGF-1R_5’: reporter vector containing DNA corresponding to the 5’ end of 3’UTR of IGF-1R mRNA; pmirGLO_IGF-1R_3’: reporter vector containing DNA corresponding to the 3’ end of 3’UTR of IGF-1R mRNA; pre-miR-neg, pre-miR-96, pre-miR-182: miRNA precursors Similarly, the mean luminescence induced by firefly luciferase expressed from the reporter vectors pmirGLO_FOXO1_5’ or pmirGLO_FOXO1_3’ in the presence of negative control miRNA was normalized to 100%. [score:3]
3’UTR of IGF-1R mRNA contains two putative miR-96 and two putative miR-182 binding sites; therefore, each site was analyzed separately. [score:1]
miR-96 interacts with two (a, b), and miR-182 with one out of two in silico indicated binding sites (c, d). [score:1]
Using this approach, we selected miR-96, miR-99a, miR-145, and miR-182 for IGF-1R mRNA, and miR-9, miR-96, miR-132, miR-145, and miR-182 for FOXO1 mRNA. [score:1]
miR-96 and miR-182, and for the FOXO1 mRNA vs. [score:1]
In contrast, there was no interaction between miR-182 and its second putative binding site (Fig.   1d). [score:1]
miR-145 and miR-132.3’UTR of IGF-1R mRNA contains two putative miR-96 and two putative miR-182 binding sites; therefore, each site was analyzed separately. [score:1]
Eighty ng of pmirGLO with or without cloned 3’UTR-encoding DNA and 5 pmol of pre-miRNA (pre-miR-96, pre-miR-182 or pre-miR miRNA Precursor Negative Control #2 for IGF-1R, and pre-miR-145, pre-miR-132 or pre-miR miRNA Precursor Negative Control #2 for FOXO1, Ambion, Life Technologies, Carlsbad, CA USA) were used. [score:1]
miR-9, miR-96, or miR-182 has been previously shown by other authors [45– 48], we conducted functional studies only for the IGF-1R mRNA vs. [score:1]
Functional studies revealed that miR-96 and miR-182 interacted with human IGF-1R mRNA, and that miR-145 and miR-132 interacted with human FOXO1 mRNA. [score:1]
Fig. 1miR-96 and miR-182 interact with the 3’UTR of IGF-1R mRNA. [score:1]
[1 to 20 of 16 sentences]
40
[+] score: 30
The qPCR confirmed significant a up-regulation of eight miRNAs, b down-regulation of miR-1303 in both the DOX-Day2 and DOX-Day6 groups, and c prolonged up-regulation of miR-182-5p, miR-4423-3p and miR-34c-5p in the drug washout groups at day 14. [score:10]
Similarly, in our study, DOX induced the up-regulation of miR-182-5p in hiPSC-CMs, while verified gene targets enriched KEGG pathways such as cardiac muscle contraction. [score:6]
qPCR also confirmed the prolonged up-regulation of miR-182-5p, miR-4423-3p and miR-34c-5p in DOX-Day2WO and DOX-Day6WO groups. [score:4]
An elevated level of miR-182 was found in patients with coronary disease (Taurino et al. 2010), dilated cardiomyopathy and chronic congestive heart failure (Zhu et al. 2013). [score:3]
Additionally, increased expression of miR-182 in melanoma cells after DOX treatment has been reported (Yan et al. 2012). [score:3]
Validation of miRNA microarray data using qPCR confirmed deregulation of miR-187-3p, miR-182-5p, miR-486-3p, miR-486-5p, miR-34a-3p, miR-4423-3p, miR-34c-3p, miR-34c-5p and miR-1303 in both DOX-Day2 and DOX-Day6 groups. [score:2]
These observations suggest that miR-182-5p may be an initial indicator of cardiac injury and possibly DNA damage. [score:1]
Moreover, increased levels of miR-182 impede the DNA repair process and increase genomic instability in cancer cell lines (Krishnan et al. 2013; Moskwa et al. 2011; Yao and Ventura 2011). [score:1]
[1 to 20 of 8 sentences]
41
[+] score: 30
Other miRNAs from this paper: hsa-mir-96, hsa-mir-183
The results demonstrated that patients with higher miR-183, miR-182 and miR-96 expression levels had shorter mean OS and DFS than patients with lower expression levels (P = 0.000, 0.000 and 0.022 for OS, respectively and P = 0.000, 0.004 and 0.011 for DFS, respectively, Fig. 3A,B). [score:5]
These clinical samples were divided into low or high expression groups with a miR-183/182/96 expression cutoff score of 2. Chi-square tests were used to analyze the relationship between clinical pathological parameters and altered miR-183, miR-182, and miR-96 levels (Table 1). [score:5]
These results are consistent with a previous report that the miR-183/96/182 cluster is overexpressed in prostate tissue 26. miR-183, miR-182 and miR-96 have been proposed as oncogenes in glioma 22 and medulloblastoma 27. [score:3]
The correlation coefficient between miR-183 and miR-182 was 0.728 (linear R [2] = 0.530), that between miR-183 and miR-96 was 0.524 (linear R [2] = 0.274), and that between miR-182 and miR-96 was 0.465 (linear R [2] = 0.217), respectively; indicating that the expression levels of miR-182 and miR-96 or miR-183 and miR-182 were more significantly related than those of miR-183 and miR-96 (2-tailed, Fig. 2A,B). [score:3]
Then, we explored the correlation between miR-183, miR-182 and miR-96 expression using Pearson correction analysis. [score:3]
We also found that the expression levels of miR-183 and miR-182 were more significantly related than those of miR-182 and miR-96 or miR-183 and miR-96. [score:3]
Pearson correction analysis was used to analyze the correlations between miR-183, miR-182 and miR-96 expression levels. [score:3]
miR-183 and miR-182 were positively correlated with local relapse (P = 0.025 and 0.028, respectively). [score:1]
Among 131 breast cancer patients, we found that miR-183, miR-182 and miR-96 levels were positively correlated with both TNM stage (P = 0.012, 0.018 and 0.020, respectively) and distant metastasis (P = 0.000, 0.001 and 0.033, respectively) (Table 1) but not with tumor size; LNMET (lymph node metastasis); age; menopause; or ER, PR or HER2 status. [score:1]
This finding coincided with the results that local relapse was positively correlated with miR-183 and miR-182, but not with miR-96. [score:1]
The correlation coefficient between miR-183 and miR-182 was the highest. [score:1]
Among 41 breast cancer patients, approximately 82.9% (p < 0.01, 34 of 41 patients), 82.9% (p < 0.01, 34 of 41 patients) and 87.8% (p < 0.01, 36 of 41 patients) of tumor samples showed significant increases in miR-183, miR-182 and miR-96 levels, respectively (Fig. 1B). [score:1]
[1 to 20 of 12 sentences]
42
[+] score: 30
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
Next, dose-response studies comparing the activity of highly inhibitory AMOs (miR-182-5p 2′OMe and miR-331-3p LNA/DNA) and that of poorly inhibitory AMOs (miR-224-5p 2′OMe and miR-195-5p LNA/DNA) on both TLR7 and TLR8 sensing were conducted in human PBMCs (Figure 3C and D). [score:5]
The miR-182-5p 2′OMe AMO had a strong inhibitory effect on both TNF-α and IFN-α, and was significantly more inhibitory than the miR-224-5p 2′OMe AMO in a dose -dependent manner (Figure 3C). [score:5]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
Critically, we found this motif in miR-182-5p and miR-122-5p AMOs, when read in 3′-5′ orientation. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 30
Another group identified the expression of antisense miR-182 in the mouse cochlea and vestibule at P0, suggesting potential downregulation of miR-182 in the inner ear [73]. [score:6]
Notably, miR-183 and miR-96 were upregulated during adult stages, while miR-182 was not [78]. [score:4]
Overexpression of either miR-182 or miR-96 in zebrafish embryos showed duplicated otic vesicles and an increase in the number of ectopic hair cells, suggesting that these miRNAs can control hair cell fate during development. [score:4]
miR-183, miR-182 and miR-96 are expressed from the cluster as a polycistronic unit in the mouse inner ear [78]. [score:3]
Morpholinos targeted towards either miR-182/miR-183, miR-96 or miR-183/182/96 all decreased hair cell numbers in the zebrafish inner ear [77]. [score:3]
Interestingly, the expression pattern of miR-182 was broad in many embryonic tissues, but confined specifically to the inner ear during post-natal periods [79]. [score:3]
This cluster showed strong expression of mature miR-183, miR-182 and miR-96 in the hair cells of both mouse cochlea and vestibule at P0, but the levels of pri-miR-183/96 [78] and miR-183 [88] varied between the hair cells in the apex and base of the cochlea. [score:3]
In mouse, the levels of miR-183, miR-182 and miR-96 changed over developmental time between P0 and P100. [score:2]
For example, the targets for miR-96 were identified to be Aqp5, Celsr2, Odf2, Myrip and Ryk [71] and for miR-182, Sox2 [88], Egr1, Irs1 and Taok1 [83], using luciferase assays. [score:2]
[1 to 20 of 9 sentences]
44
[+] score: 29
We observed a significant overexpression of miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429, miR-520b (all p<0.001) in UUTUC; the microRNAs miR-10a (p = 0.012) and miR-200b (p = 0.006) showed a distinct trend towards upregulation, whereas miR-1244 (p = 0.600) was similar in normal and malignant tissue. [score:6]
The expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) formerly shown to be upregulated in urothelial bladder cancer were studied in corresponding normal and cancerous tissue samples of patients undergoing nephroureterectomy for UUTUC. [score:6]
MicroRNA expression allowed differentiation of normal and cancerous tissue: miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429 and miR-520b were significantly overexpressed. [score:5]
In order to investigate the role of microRNAs as non-invasive biomarkers in patients with UUTUC, the expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) earlier shown to be upregulated in urothelial cancer of the bladder [13– 20], was analyzed [11] in corresponding normal ureter and UUTUC tissue. [score:4]
Interestingly, this partly overlaps with the microRNA expression profile earlier established in a prostate cancer study, in which miR-205, miR-96 and miR-182 were found particularly regulated [23]. [score:4]
Especially miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429 and miR-520b were distinctly overexpressed in UUTUC. [score:3]
miR-182 (p = 0.083), miR-21 (p = 0.532) and miR-135 (p = 0.261) were similar in UUTUC patients and controls. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 29
Conversely, we found that up-regulation of miR-30a-5p, miR-96 and miR-182 at E17.5, and miR-429 at E14.5 were reciprocally correlated with down-regulation of Cpeb3, Sox6, Hdac9, and Ddx3y respectively in Pkd1 [-/- ]mutants (Additional file 21). [score:7]
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
In contrast, at E17.5 miR-96, miR-182 and miR-30a were up-regulated in Pkd1 [-/- ]kidneys compared to WT. [score:3]
We observed that miRNAs: miRs-10a, -30a-5p, -96, -126-5p, -182, -200a, -204, -429, and -488; and the such as miR-126-5p-Fgf10, miR-488-Fgfr3, miR-182-Hdac9, miR-204-P2rx7 and miR-96-Sox6 (as shown in Table 6) have not been previously reported in ADPKD. [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 27
Total RNA extracted from Dex/OSM treated AR42J-B13 cells (7 Days) and mock controls were used for Northern blot analysis using antisense probes against down-regulated miRNAs (miR-93, miR-106b and miR-130b) and up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Mature miRNA of miR-93, miR-106b, miR-130b, miR-21, miR-22 and miR-182 were differentially expressed after transdifferentiation. [score:3]
As shown in Table 2, we found increased expression of liver specific miRNAs in transdifferentiated hepatocytes, including miR-122a, miR-21, miR-22, miR-182, miR-29 and miR-30. [score:3]
[1 to 20 of 5 sentences]
47
[+] score: 27
Calin et al. described the location of miR-182 in a minimal deleted region that is associated with an aggressive prostate cancer histotype [5] and others have also observed upregulation of miR-182 in prostate tumors [40, 41]. [score:4]
According to our data, the miRNAs miR-221, miR-222, miR-182, and miR-21 were expressed at relatively high levels in prostate cancer xenograft specimens. [score:3]
Four of these miRNAs, miR-221, miR-222, miR-21 and miR-182, were selected for further study based on the known biological functions of their predicted mRNA targets [25- 32]. [score:3]
Our results also showed miR-182 was highly upregulated in the majority of tumor tissues compared to normal samples (see Additional file 4). [score:3]
Identification of miR-21, miR-182, miR-221 and miR-222 targets for assay development. [score:3]
Capture of mature miRNAs was performed using the following chimeric hairpin target capture oligonucleotides (TCO) [20]: for miR-21 (TTTTTTTTTTTTUCAACAUCAGUCUGAUAAGCUAAAAAAAAAAAAA), for miR-182 (TTTTTTTTTTTTAGUGUGAGUUCUACCAUUGCCAAAAAAAAAAAAAAA), for miR-221 (TTTTTTTTTTTTGAAACCCAGCAGACAAUGUAGCUAAAAAAAAAAAA), for miR-222 (TTTTTTTTTTTTACCCAGUAGCCAGAUGUAGCUAAAAAAAAAAAA), and for miR-802 (TTTTTTTTTTTTACAAGGAUGAAUCUUUGUUACUGAAAAAAAAAAAA). [score:3]
Click here for file Validation of miR-21, miR-182, miR-221 and miR-222 expression levels in human adjacent-normal and prostate tumor xenograft tissues using a commercial quantitative RT-PCR assay. [score:2]
Validation of miR-21, miR-182, miR-221 and miR-222 expression levels in human adjacent-normal and prostate tumor xenograft tissues using a commercial quantitative RT-PCR assay. [score:2]
Research prototype assays for miR-21, miR-182, miR-221 and miR-222 provided analytical sensitivities ranging from 50 to 500 copies of target per reaction in sample transport medium. [score:2]
Here we describe research prototype assays that detect a number of miRNA sequences with high analytical sensitivity and specificity, including miR-21, miR-182, miR-221 and miR-222, which were identified through expression profiling experiments with prostate cancer specimens. [score:2]
[1 to 20 of 10 sentences]
48
[+] score: 26
Suppressor of cytokine signaling (SOCS) protein family is also responsible for termination of GH-activated STAT signaling [68], where the expression of SOCS1-7 proteins is regulated by HM cell miR-182-5p, let-7f-5p, miR-148a-3p, miR-22-3p, miR-16-5p, miR-181a-5p, miR-141-3p (Figure S6). [score:6]
GLUT1 expression is regulated by miR-148a-3p, miR-181a-5p, and miR-182-5p, which were highly expressed in HM cells. [score:6]
Specifically, AGPAT6 (1-acylglycerol-3-phosphate O-acyltransferase 6) is known to be regulated by the some of the top most highly expressed HM cell miRNAs (let-7f-5p, miR-182-5p, miR-148a-3p, and miR-22-3p), and has a direct effect on the synthesis of triacylglycerol and long chain acyl-CoA (fatty acids) [61]. [score:5]
Importantly, most of the highly expressed HM cell miRNA (let-7f-5p, miR-16-5p, miR141-3p, miR30a/d-5p, miR182-5p, andmiR375-3p) regulate the insulin-like growth factor-I receptor (IGF-IR) (Figure S6). [score:4]
In addition, INSR itself is regulated by the most highly expressed miRNA in HM, let-7f-5p, and also by miR-182-5p (Figure S7). [score:4]
The known miRNAs examined were: hsa-let-7f-5p, hsa-miR-181a-5p, hsa-miR-148a-3p, hsa-miR-22-3p, and hsa-miR-182-5p. [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 25
Coherently with this finding, it has been found that in ATC tissues and cell lines, TRIM8 downregulation is significantly correlated with the upregulation of miR-182, which targets TRIM8 mRNA. [score:9]
Moreover, in ATC tissues and cell lines, it has been reported that TRIM8 mRNA and protein levels are kept low via the up-regulation of another miRNA, miR-182, which directly targets TRIM8 mRNA (Figure 3) [26]. [score:7]
Liu Y. Zhang B. Shi T. Qin H. miR-182 promotes tumor growth and increases chemoresistance of human anaplastic thyroid cancer by targeting tripartite motif 8Onco Targets Ther. [score:5]
MiR-182 overexpression induces cellular growth by repressing TRIM8 expression, greatly contributing to the chemoresistance of ATC cells [26]. [score:4]
[1 to 20 of 4 sentences]
50
[+] score: 25
To investigate the cellular mechanism for the hypothesis that high miRNA expression is associated with tumor cell progression, we transfected the three miR inhibitors (miR-141*, miR-205, miR-182) into the endometrial cancer cells (Hec1A) to down-regulate miRNA activity. [score:6]
Up-regulated miR-182 in endometrial cancer is reported to be associated with the repressing FOXO1 gene, which is known to be down-regulated in endometrial cancer compared to normal endometrial [21], [22]. [score:6]
The up-regulated miRNA was miR-200a* miR-205, miR-141*, miR-200b*, miR-141, miR-200b, miR-200a, miR182. [score:4]
Among these miRNAs, five were up-regulated in tumor samples where the fold change was more than 5-fold (miR-200a*, miR-205, miR-141*, miR-200b*, miR182). [score:4]
Five miRNA genes (miR-200a*, miR-205, miR-141*, miR-200b*, miR182) were selected because of their notably high differential expression in tumor tissues in the microarray data. [score:3]
The ability of miR-182 to promote FOXO1 repression may adopt a key role in endometrial tumorigenesis by bypassing the cell cycle and cell death control. [score:1]
We transfected with the five anti-miRNAs (anti-miR-141*, anti-miR-205, anti-miR-182, anti-miR-200a*, anti-miR-200b*) into the Hec1A cells and treated them with IC50 of cisplatin or paclitaxel for 48 hours. [score:1]
[1 to 20 of 7 sentences]
51
[+] score: 24
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-141
In addition, protein levels of ACLY (miR-27a target – Figure 7C), ZEB1 (miR-141 target – Figure 7D), PTEN (miR-141 target – Figure 7E) and FOXO1 (miR-182 and −27a target, Figure 7F) were significantly increased following addition of 99021, indicating derepression by their targeting miRs due to loss of GSK3β-enhanced miR biogenesis. [score:11]
We next examined whether 99021 treatment affected levels of the 3΄UTR of ACLY, ZEB1, PTEN and FOXO1 (miR-27a, miR-141, miR-141 and miR-182/27a targets, respectively). [score:3]
Constitutively active GSK3β S [9]A mutant increases Drosha cleavage activity and enhances MiR biogenesisTo provide further evidence for the importance of GSK3β activity for miR maturation, converse experiments were performed using a vector expressing constitutively active GSK3β: GSK3β-S [9]A. Transfection of GSK3-S [9]A into HEK293T significantly increased levels of mature miR-27a, miR-23a, miR-24, miR-141 and miR-182 by up to 7.5-fold (Figure 2A), with similar effects also observed in HeLa cells (Supplementary Figure S2A). [score:3]
To provide further evidence for the importance of GSK3β activity for miR maturation, converse experiments were performed using a vector expressing constitutively active GSK3β: GSK3β-S [9]A. Transfection of GSK3-S [9]A into HEK293T significantly increased levels of mature miR-27a, miR-23a, miR-24, miR-141 and miR-182 by up to 7.5-fold (Figure 2A), with similar effects also observed in HeLa cells (Supplementary Figure S2A). [score:3]
It was demonstrated that transfection of Flag-Drosha significantly increased pri-miR-23a27a24-2 and pri-miR-182 pull-down by up to 4-fold over background binding (Figure 3Ai and iii), with a similar trend observed for pri-miR-141/200c (Figure 3Aii). [score:1]
Similar effects were observed for pull down of pri-miR-141/200c and pri-miR-182 (Supplementary Figure S5). [score:1]
Figure 2. GSK3β activation enhances MiR biogenesis and GSK3β modulation alters pre-miR synthesis (A) qRT-PCR analysis of miR-27a, miR-23a, miR-24, miR-141 and miR-182 levels in HEK293T cells transfected with pMT23-HA-GSK3β(S [9]A) for 48 h. U18 was used as a normalisation gene. [score:1]
Conversely, addition of constitutively active GSK3β-S [9]A significantly enhanced association of pri-miR-141/200c with Drosha by 5-fold (Figure 3Bii) and the same trend was observed for both pri-miR-23a27a24-2 and pri-miR-182 (Figure 3Bi and iii). [score:1]
[1 to 20 of 8 sentences]
52
[+] score: 24
a High level of six hsa-miRNAs randomly selected for the validation of expression level by qRT-PCR is consistent with the result from miRNA microarray; b Low level of six hsa-miRNAs randomly selected for the validation of expression level by real-time RT-PCR is consistent with the result from miRNA microarray Fig.  3Validation of 12 hsa-miRNAs using qRT PCR shows hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples from narcolepsy patients. [score:11]
Consistent with the results from the microRNA microarray (Fig.   2a, b), hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples (Fig.   3). [score:7]
Among these miRNAs with significant change, 12 hsa-miRNAs were validated by qRT PCR which showed that hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p had significantly high expression and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p had significantly low expression in each of the peripheral blood samples. [score:5]
In conclusion, we have identified 12 aberrant miRNAs (hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p, hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p) in plasma from patients with sleep disorder. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 24
The study revealed that 10 dysregulated miRNA signature among which hsa-miR-1271-5p and hsa-miR-574-3p were down-regulated; and hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-182-3p, hsa-miR-141-5p, hsa-miR-15b-5p, hsa-miR-130b-5p, and hsa-miR-135b-3p were overexpressed in ovarian cancer tissues. [score:7]
For miR183-96-182 cluster, Xu reported that overexpressed miR-182 and miR-96 targeting fork head box O3 plays a significant role in the pro-proliferation effect of leptin on ovarian cancer cells [22]. [score:5]
miR-182 was reported to directly and negatively regulates an important tumor suppressor, programmed cell death 4 (PDCD4) in OC [23]. [score:5]
In contrast, other miRNAs such as miR-182-5p, miR-183-5p, miR-96-5p, miR-15b-5p, miR-182-3p, miR-141-5p, miR-130b-5p, and miR-135b-3p had a significantly higher expression level in ovarian cancer tissue sample group (C group) than in the normal group (P values are presented in Table 2). [score:3]
The seven dysregulated miRNAs including hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-1271-5p, hsa-miR-182-3p, hsa-miR-1468-5p, and hsa-miR-135b-3p (Table S1 in file S1) were confirmed by the AUC of ROC curve (AUC = 0.965) with 97% sensitivity and 85% specificity (Figure S5 in file S1). [score:2]
6 out of these 7 miRNAs (hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-1271-5p, hsa-miR-182-3p, and hsa-miR-135b-3p) are in the 10-miRNAs signature. [score:1]
Among these miRNAs, miR-96, miR-182 and miR-183 are clustered at one locus of the chromosome 7 [17] and miR-141-5p belongs to the miR-200 family, which is clustered on the chromosomes 12. [score:1]
[1 to 20 of 7 sentences]
54
[+] score: 23
Analysis of expression of these miRs at different stages of lung development showed that miR-140-5p and miR-328-3p were expressed at relatively low levels during the pseudoglandular stage of lung development and at relatively higher levels during the saccular stage, while miR-182-5p showed the opposite profile (Fig 3B– 3D). [score:7]
Importantly, several of these miRNAs (miR-24, miR-140, miR-182, miR-183, miR-328) are expressed in fetal or neonatal lung and their relative expression levels are modulated during lung development [26, 27] or in lung cancer [28– 30]. [score:6]
We also show that the Fgf9 3’ UTR is responsive to conserved miRNA-140, miRNA-328, and miR-182, and that miRNA-140 (and miR-328) is an important regulator of lung development. [score:3]
Of these, miR-140, miR-183, and miR-328 suppressed luciferase activity, while miR24 and miR-182 increased luciferase activity (Fig 3F, mouse, and S4A Fig and S4B Fig, human). [score:3]
The human and mouse FGF9 3’ UTR are highly conserved and are similarly regulated by miR-140, miR-182, miR-183, miR-328. [score:2]
Mature microRNA mimics for miR-24, miR-140, miR-182, miR-183, and miR-328 were then screened for their ability to regulate luciferase activity of the human or mouse FGF9 3’ UTR. [score:2]
[1 to 20 of 6 sentences]
55
[+] score: 23
These miRNAs have all been previously shown to contribute to CRC disease progression; for example, miR-182 and miR-503 were found to cooperatively target FBXW7 and contribute to CRC malignant transformation and progression and were also predictive of patient survival (28). [score:5]
Li L, Sarver AL, Khatri R, Hajeri PB, Kamenev I, French AJ, Thibodeau SN, Steer CJ, Subramanian S 2014 Sequential expression of miR-182 and miR-503 cooperatively targets FBXW7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. [score:5]
In CRC, several miRNAs, such as miR-182, miR-503, and mir-17~92 cluster, can regulate multiple genes and pathways and have been found to promote malignant transformation and disease progression (28 – 30). [score:4]
Interestingly, Blautia, a genus previously found to have lower abundance in tumor samples, is negatively correlated with miR-20a, miR-21, miR-96, miR-182, miR-183, and miR-7974, which are all miRNAs with high expression levels in tumor tissues. [score:3]
We identified 76 miRNAs as differentially expressed (DE) in tissue from CRC tumors and normal tissue, including the known oncogenic miRNAs miR-182, miR-503, and mir-17~92 cluster. [score:3]
DE miRNAs with higher expression levels in tumor tissues include miR-182, miR-183, miR-503, and the miR-17~92 cluster miRNAs (Fig.  2; Table S1), all consistent with our previous reports (28, 33). [score:3]
[1 to 20 of 6 sentences]
56
[+] score: 22
miR-182 plays a critical role in the regulation of activated Th cell proliferation and clonal expansion, but its contribution to autoimmune disease pathogenesis is still not clear. [score:4]
Unlike lupus -associated miRNAs such as the miR-182 cluster that was highly increased in diseased, 36–40-wk-old NZB/W [F1] mice [34], miR-223 and miR-451 were not significantly increased in 36–40-wk-old female NZB/W [F1] mice when compared to pre-diseased NZB/W [F1] or NZW control (Additional file 1: Figure S1). [score:4]
However, its role in autoimmunity is suggested by the finding that the inhibition of miR-182 in T cells reduced ovalbumin (OVA) -induced arthritis in mice [46]. [score:3]
Our finding of increased miR-182 cluster, miR-155, miR-31, and miR-148a expression in female NZB/W [F1] mice at an age after the onset of lupus validates our previous report of the association of these miRNAs with lupus manifestation in this mo del. [score:3]
However, our data tends to support that estrogen treatment promoted the expression of selected lupus -associated miRNAs such as the miR-182 cluster, miR-379, and miR-148a in orchidectomized male NZB/W [F1] mice. [score:3]
At 23 wks of age, the expression levels of miR-182, miR-183, miR-127, and miR-31 were significantly increased in female NZB/W [F1] mice when compared to age-matched male NZB/W [F1] mice (Figure  2A). [score:2]
The direct link between miR-182 and autoimmune inflammation is not definitive thus far. [score:2]
miR-182 is substantially increased in activated T cells, which is critical for the proliferation and expansion of activated T helper (Th) cells [46]. [score:1]
[1 to 20 of 8 sentences]
57
[+] score: 22
Seven miRNAs (downregulated: miR-29c, miR-93, miR-101 and miR-130a; upregulated: miR-9, miR-182 and miR-221) were identified as differentially expressed (≥2-fold) in both A172-TR and U251-TR cell lines (Figure 1A). [score:9]
Upregulated miRNAs (miR-9, miR-182 and miR-221) were shown in red, downregulated miRNAs (miR-29c, miR-93, miR-101 and miR-130a) were shown in green. [score:7]
Among them, three miRNAs (miR-29c, miR-93 and miR-101) were downregulated and two (miR-9 and miR-182) were upregulated in the TMZ-refractory samples as compared with that in the primary tumor samples (p<0.05, Figure 1D). [score:6]
[1 to 20 of 3 sentences]
58
[+] score: 22
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-96, hsa-mir-183, hsa-mir-210
The inhibitions (%) of miRNA expressions were shown in Table 2. The expression levels of miR-96, miR-182, and miR-183 could not be suppressed by miRM-210. [score:9]
Either individually or as a cluster, the expression levels of miR-96, miR-182, and miR-183 have been shown to be up-regulated in several cancers, including prostate cancer, breast cancer, lung cancer, medulloblastoma, bladder cancer and etc. [score:6]
Inhibitions (%) [a] Cell lines miRNA- mowers miR-96 miR-182 miR-183 miR-210 T24 miRM- 183/96/182 49.33±2.46 47.34±4.23 52.67±5.11 −3.42±4.23 T24 miRM-210 2.42±3.85 −2.13±3.51 3.19±4.25 69.67±3.58 UM- UC-3 miRM- 183/96/182 46.33±3.57 46.13±3.41 51.37±3.89 2.55±3.52 UM- UC-3 miRM-210 1.78±3.31 2.33±3.03 −2.39±2.63 70.65±4. [score:3]
Segura et al. found that miR-182 over -expression promoted the migration of human melanoma cells in vitro and their metastases in vivo [29]. [score:3]
Bulged miRNA binding sites for the miR-96, miR-182, miR-183, and miR-210 and the linkers between them were designed and chemically synthesized. [score:1]
[1 to 20 of 5 sentences]
59
[+] score: 21
[28] But another study showed that regulated miR-182 by targeting Fbxw7, resulting in a feedback pathway to regulate SREBP transcriptional activity. [score:5]
Li L Sarver AL Khatri R Sequential expression of miR-182 and miR-503 cooperatively targets FBXW7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. [score:5]
What is more, several proteins such as, RITA, EBP2, Numb4, SGK1,,, Pin1, FAM83D, C/EBPδ, Hes-5, presenilin, miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a are found to regulate the expression of Fbxw7. [score:4]
In a study from Li et al, [64] they showed that a sequential expression of miR-503 and miR-182 in benign adenoma cooperatively regulated Fbxw7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. [score:4]
Besides those, recently, accumulating evidence has shown that several molecules such as, miRNAs including miR-223, miR-25, miR-27a, miR-182, miR-503, and miR-129-5p, RITA, and FAM83D, as well as Pin1, CCAAT/enhancer -binding protein-δ, presenilin,,, EBP2, Numb4 and serum-and glucocorticoid-inducible protein kinase1 could regulate Fbxw7 (Figure 3). [score:2]
MicroRNAs (miRNAs) Including miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a. [score:1]
[1 to 20 of 6 sentences]
60
[+] score: 21
Several miRNAs such as miR-96, miR-182, and miR-143 demonstrated high influence on their target protein complexes and could explain most of the gene expression changes in our analyzed prostate cancer data set. [score:5]
Modules identified by our approach includes miRNAs like miR-96 and miR-182 targeting highly interacting proteins, and miRNAs like miR-1, and miR-205 that target non-interacting complexes. [score:5]
On the other hand, some miRNAs (miRNA-96, miRNA-182, miRNA-1) are highly influential on target partners as they regulate several connected proteins. [score:4]
revealed that miR-221, miR-222, miR-210, miR-542-5p, miR-96, miR-182, and miR-143 are the miRNAs that can positively explain the gene activity profile; this means that increasing expression level of miRNAs will lead to increasing the transcription of activity centers. [score:3]
They all indicate the significant role of specific miRNAs (miR-221, miR-222, miR-210, miR-542-5p, miR-96, miR-182, and miR-143) in prostate cancer. [score:1]
This is in agreement with our results that demonstrate that miR-96 and miR-182 explain most of the genes ActivityScore that is significantly enriched in zinc homeostasis. [score:1]
For instance, miR-96 and miR-182 are members of the same gene cluster and thus this supportes the effectiveness of integrating protein networks to identify miRNAs with similar mode of action. [score:1]
miRNAs identified using the miRTI and Corrmir networks overlap; both networks identified miR-182 and miR-96 as important miRNAs. [score:1]
[1 to 20 of 8 sentences]
61
[+] score: 21
Down -expression of DDX5 was observed in 7 types of HCs, while, mir-20b, mir-21, mir-141 and mir-182 over-expressed in 3, 5, 3 and 4 HCs, respectively (Table 3 and Table 4). [score:5]
DDX5 is negatively regulated by mir-20b and mir-141, while DDX5 itself regulates mir-21 and mir-182. [score:3]
For example, the potential clinical utility of DDX5 and its associated miRNAs (mir-21 and mir-182) are suggested as therapeutic target in breast cancer [29], [31]. [score:3]
RNA helicase DDX5 (also known as p68) is involved in RNA metabolism and serves as a transcriptional co-regulator and has been reported as regulator of mir-182 in breast cancer [29]. [score:3]
Several types of miRNAs (such as miR-93, mir-182, mir-196b and mir-1274b) exhibited over -expression in majority of cancers (Table 3). [score:3]
This subnetwork comprises 5 entities including DDX5, mir-20b, mir-21, mir-141 and mir-182. [score:1]
Network analysis indicates that DDX5, LIFR, ZEB2, mir-21, mir-27b, mir-30a, mir-141, mir-182 and mir-200c were shared across different constructed networks, indicting their crucial role in cancer biology and progression, which has been reported previously [28], [29], [30]. [score:1]
Network is including mir-21, mir-182, -mir20b and mir-141. [score:1]
0096320.g002 Figure 2Network is including mir-21, mir-182, -mir20b and mir-141. [score:1]
[1 to 20 of 9 sentences]
62
[+] score: 21
miR-96, miR-182, and miR-183 are downregulated and miR-1, miR-133, and miR-142 are upregulated consistently in multiple mouse mo dels of retinitis pigmentosa, suggesting that this may be a miRNA signature of retinal degeneration [39, 40]. [score:7]
In the murine experimental autoimmune uveoretinitis mo del, miR-142-5p and miR-21 were found to be upregulated, and miR-182 was found to be downregulated [46]. [score:7]
In the case of miR-182, for example, which is highly expressed in the mouse eye, knockout did not lead to any detectable deficit [36]. [score:4]
A sensory organ-specific miRNA cluster comprised of miR-96, miR-182, and miR-183, expressed in photoreceptors and bipolar cells, was also identified [38]. [score:3]
[1 to 20 of 4 sentences]
63
[+] score: 20
The interplay between the reported opposing alterations involving miR-137 and miR-182 might represent a molecular mechanism able to orchestrate the complex modulation of MITF expression that appears to be required during CM "lifespan", including its up-regulation in the initial phases of CM tumorigenesis and its down-regulation necessary for CM cells to acquire invasive and metastatic potential. [score:9]
Of note, miR-182 appeared to be particularly involved in CM progression, being increasingly over-expressed with evolution from primary to metastatic disease [65]. [score:5]
On the other hand, miR-182 has been identified as being frequently over-expressed through gene amplification in different CM cell lines and tissues, where it contributed to an increased survival and metastatic potential of neoplastic cells by repressing MITF and FOXO3. [score:3]
Along this line, the transcription factor MITF, a master regulator of melanocytes biology, was found to be regulated by at least 2 different miRNAs, miR-137 and miR-182, which showed opposite alterations. [score:3]
[1 to 20 of 4 sentences]
64
[+] score: 20
At the same time, up-regulation of hsa-miR-181c and hsa-miR-182 targets HRB and IGF1R expression, suggesting the biological functions of the two key genes may be suppressed. [score:10]
To generate a miR-340 expression vector, a ≍260-bp genomic fragment up and downstream of the pre-mir-182 form was amplified by PCR and the fragment containing strictly the pre-miR-340 form was cloned into pGIPZ (Open Biosystems, Pittsburgh, PA, USA) that allows regulated expression of miR-340 upon zeocin treatment. [score:6]
In contrast, the miRNAs hsa-miR-340 (14 degrees), hsa-miR-181c (11 degrees) and hsa-miR-182 (10 degrees) were significantly up-regulated in the DCM samples. [score:4]
[1 to 20 of 3 sentences]
65
[+] score: 19
miR-96, miR-182, miR-182* and miR-183 were all up-regulated; expression was highly correlated and mapped to the same region of chromosome 7. Additionally, 22 miRNAs showed decreased expression in colon tumors. [score:8]
Of interest was the expression profile of the miR-96, miR-182 and miR-183 clusters as well as miR-135b, which were up-regulated in embryonic stem cells and whose expression decreased following differentiation. [score:8]
Tumor specimens showed highly significant and large fold change differential expression of the levels of 39 miRNAs including miR-135b, miR-96, miR-182, miR-183, miR-1, and miR-133a, relative to normal colon tissue. [score:3]
[1 to 20 of 3 sentences]
66
[+] score: 19
A recent study revealed that suppressing miR-182 and miR-183 in vitro led to upregulation of their four target genes, which in turn resulted in upregulation of E-cadherin expression. [score:13]
Another pair of oncogenic gene regulators, miR-182 and miR-183, are overexpressed in ductal carcinoma in situ (DCIS) and lead to increased expression of chromobox homolog 7 (CBX7), DOK4, NMT2, and EGR1 [124]. [score:6]
[1 to 20 of 2 sentences]
67
[+] score: 18
In summary, the cell-cycle-regulatory genes CDK2, CDK4, CyclinD1 and CyclinE1 were targeted by mir124, CDK2 and CyclinD1 were targeted by mir182 and mir27b, CyclinD1 was targeted by mirlet7b, P27 was targeted by mir221 and mir181a. [score:10]
Among these fourteen candidates, six miRNAs (hsa-mir-124-3p, hsa-mir-182-5p, hsa-mir-27b-3p, hsa-mir-let7b-5p, hsa-mir-221-3p and hsa-mir-181a-3p), which might target cell-cycle-regulatory genes according to bioinformatic algorithms, were selected for further study. [score:4]
The expression change of mir182, 27b and let7b was closely associated with tumor volume of G2 patients (Fig. 6A, R<-0.4). [score:3]
Fig. 6H showed that there were significant differences in tumor volume between Low and High mir patients of mir182, 27b, let7b and 221. [score:1]
[1 to 20 of 4 sentences]
68
[+] score: 17
Therefore, just as we recently demonstrated that miR-182 regulates metastasis by targeting multiple genes (Sachdeva et al., 2014), miR-16 may also regulate metastasis through a number of targets, which are differentially regulated in immunocompromised versus immunocompetent mice. [score:8]
Using novel genetically engineered mice to either delete or overexpress miR-182 in primary sarcomas in vivo, we showed that deletion of miR-182 in primary sarcomas significantly decreased the rate of lung metastasis after amputation of the tumor-bearing limb, whereas overexpression of miR-182 significantly increased the rate of lung metastasis (Sachdeva et al., 2014). [score:5]
MicroRNA-182 drives metastasis of primary sarcomas by targeting multiple genes. [score:2]
For example, we recently showed that miR-182 drives metastasis of primary sarcomas in vivo (Sachdeva et al., 2014). [score:1]
For example, we recently showed that a single miRNA (miR-182) modulated sarcoma metastasis in vivo (Sachdeva et al., 2014). [score:1]
[1 to 20 of 5 sentences]
69
[+] score: 17
miR-182 expression can impact DNA repair and cellular sensitivity to PARP inhibitors by targeting BRCA1 mRNA and inhibiting its protein expression [30]. [score:11]
Moskwa P. Buffa F. M. Pan Y. Panchakshari R. Gottipati P. Muschel R. J. Beech J. Kulshrestha R. Ab delmohsen K. Weinstock D. M. miR-182 -mediated downregulation of BRCA1 impacts DNA repair and sensitivity to PARP inhibitors Mol. [score:6]
[1 to 20 of 2 sentences]
70
[+] score: 17
Other miRNAs from this paper: hsa-mir-139, hsa-mir-34c, hsa-mir-486-1, hsa-mir-4423, hsa-mir-486-2
The hsa-miR-486-3p, hsa-miR-182-5p, and hsa-miR-139-5p showed dose -dependent upregulation in fold expression value, whereas hsa-miR-34c-5p and hsa-miR-4423-3p remained twofold upregulated with no significant deviation in fold expression at all three test concentration. [score:11]
Moreover we also found upregulation in 5 miRNAs (has-miR-486-3p, has-miR-34c-5p, has-miR-4423-3p, has-miR-182-5p, and has-miR-139-5p) which play role in muscle contraction, Arginine and proline metabolism and Hypertrophic cardiomyopathy (HCM). [score:4]
In addition, we also identified 5 out of 14 miRNAs; hsa-miR-486-3p, hsa-miR-34c-5p, hsa-miR-4423-3p, hsa-miR-182-5p, and hsa-miR-139-5p deregulated after ETP treatment (Fig.   2e). [score:2]
[1 to 20 of 3 sentences]
71
[+] score: 17
For miRNA overexpression, the cells were grown to 90% confluence, transfected with plasmid constructs (1 µg/ml) expressing miRNA precursors (pri-miR-182 (Open Biosystems), pri-miR-191, pri-miR-137 or pri-miR-206 (System Biosciences)), and harvested 24 hours after transfection. [score:5]
Moreover, 48 h after the second transfection, the HeLa cells were transfected with plasmid constructs encoding miRNA precursors, pre-miR-191 (System Biosciences) and pre-miR-182 (Open Biosystems), as described above for miRNA overexpression. [score:3]
To rule out the possibility that the effect of Dicer protein partner depletion on miRNA levels is somehow affected by the high stability of endogenous miRNAs, we used the system for miRNA overexpression and analyzed exogenous miR-182 and miR-191. [score:3]
The only exception was the pre-miR-182 expressed in the cells transfected with siRNA AGO2, the level of which did not decrease (Figure 3C). [score:3]
Only a minor effect of Dicer protein partner depletion on pre-miRNA cleavage specificity was observed in the case of AGO2 and TRBP knockdown (Figure 3D and Figure 3H), and a substantial change in the miR-182 heterogeneity profile was detected in cells deprived of PACT (Figure 3D). [score:2]
Two independent experiments, for miR-182 and miR-191, showed that the levels of these miRNAs were substantially decreased upon the depletion of Dicer protein partners, and the levels of pre-miRNAs also declined (Figure 3B, Figure 3F). [score:1]
[1 to 20 of 6 sentences]
72
[+] score: 16
Biotin miR-182-5p RISC was generated by transfecting MDA-MD-231 cells with biotin-labeled miR-182-5p duplexes, whilst native miR-182-5p RISC was generated by inducing expression of miR-182-5p by adding doxycycline to a previously generated and validated inducible cell line [36]. [score:3]
Data used in this manuscript are available from the Gene Expression Omnibus (GEO) under accession numbers GSE29101 (miR-10 family and mock transfection microarray data), GSE38593 (miR-182 microarray data), GSE40406 (miR-424 and miR-199a microarray data), and GSE55059 (all remaining microarray and sequencing data). [score:3]
Cells were either transfected with biotinylated miR-182-5p or induced to over-express miR-182-5p, and RISC complexes containing these miRNAs were affinity purified. [score:3]
At a 5% false discovery rate (FDR; see), between 963 (miR-10b-iso) and 2,261 (miR-182) microarray probes detected significantly higher expression in the biotin pull-down samples than in the mock -transfected controls (Table  1). [score:3]
The miR-182-5p capture oligo and all binding site oligo sequences are shown in Table S8 in Additional file 1. Association and disassociation profiles were generated using the Octet Red (Forte Bio, Menlo Park, CA, USA) and streptavidin biosensors (Forte Bio) using the following parameters: lysis buffer for 60 seconds; RNA oligo for 10 minutes; saturated biotin (Sigma Aldrich) solution for 10 minutes; lysis buffer for 60 seconds; RISC solution for 10 minutes (association); lysis buffer for 10 minutes (disassociation). [score:1]
The generation and validation of the MDA-MB-231 miR-182-5p inducible cell line has been previously described [36]. [score:1]
Although this approach lost some statistical power through the large reduction of transcripts, we still found statistical support (P ≤ 0.05) for each of the five comparisons (miR-10a versus miR-10b; miR-10a versus miR-10a-iso; miR-10b versus miR-10b-iso; miR-182 versus miR-182-iso; miR-17-5p versus miR-17-5p-iso), and a total of 14/20 of the observed enrichments confirmed our hypothesis (Table S4 in Additional file 1). [score:1]
Lane 1, no lysate; lane 2, no oligo; lane 3, miR-182-5p 3 prime binding site; lane 4, miR-182-5p imperfect centered site with GU wobble; lane 5, miR-182-5p imperfect centered site; lane 6, miR-182-5p perfect centered site; lane 7, miR-182-5p seed site. [score:1]
[1 to 20 of 8 sentences]
73
[+] score: 16
[A] The expression of candidate biomarkers, miR-200a, miR-200b, miR-200c and miR-182 and [B] the expression of candidate normalizers, miR-103, miR-638, miR-92a and RNU48 in SEOC and OSE(tsT) cell lines by qRT-PCR normalized to Z30 and plotted as log [10] ratios. [score:5]
Candidate biomarkers miR-182, miR-200a, b and c were selected based on > 2-fold (log [2]) over -expression in at least 3 of the 4 SEOC cell lines relative to OSE(tsT) cells (Figure 1B) and confirmed by qRT-PCR (P < 0.05, 1-way ANOVA; Figure 2A). [score:3]
[B] Heatmap showing expression relative to OSE(tsT) cells (ie OSE(tsT) set to log [2]0) for candidate biomarkers in SEOC cell lines (miR-200a, b, c, and miR-182) and candidate endogenous controls for normalization (miR-638, miR-92a and miR-103). [score:3]
[A] Mean expression of miR-182, miR-200a, miR-200b and miR-200c in cancer and normal serum; volume adjusted values normalized to miR-103 (ΔΔC [T]/L [-1] of serum assayed) +/- SEM (N = 56). [score:2]
We found no association between subject age and serum miRNA levels for miR-200a, b, c, (or miR-103, miR-92a, miR-182, miR-638 or RNU48). [score:1]
For miR-182 the levels between the 2 cohorts did not reach significance (data not shown). [score:1]
We next assessed the miRNA selected as candidate biomarkers (miR-200a, b, c and miR-182) in serum RNA from the SEOC and healthy cohorts. [score:1]
[1 to 20 of 7 sentences]
74
[+] score: 16
Among the top differentially expressed miRNAs, miR-183 and miR-182 are most up-regulated in cancer samples (highest fold change) while miR-1247 and miR-199b-5p were most down-regulated in cancer samples compared to normal samples (Table  1). [score:8]
77 × 10 [−05] miR-542-5p −3.591.58 × 10 [−05] miR-758 −2.578.54 × 10 [−06] miR-377 −2.531.07 × 10 [−05] miR-337-5p −2.196.91 × 10 [−05] In the former studies, four miRNAs (miR-182, miR-183, miR-200a and miR-200c) were found to be up-regulated in four of the six surveys. [score:4]
77 × 10 [−05] miR-542-5p −3.591.58 × 10 [−05] miR-758 −2.578.54 × 10 [−06] miR-377 −2.531.07 × 10 [−05] miR-337-5p −2.196.91 × 10 [−05] In the former studies, four miRNAs (miR-182, miR-183, miR-200a and miR-200c) were found to be up-regulated in four of the six surveys. [score:4]
[1 to 20 of 3 sentences]
75
[+] score: 15
As each miRNA can have multiple targets, we performed an analysis to discover additional mRNA genes that are computationally predicted to be targets of the three most highly expressed miRNAs, miR-182, miR-181a and miR-26a. [score:7]
RNA-seq analysis led to the identification of over 500 miRNAs, with miR-182 as the most highly expressed miRNA in both sensory epithelia (Table  1) and accounting for more than 50% of the 20 most highly expressed miRNAs. [score:5]
A few targets have been confirmed for miR-182, including Sox2, Clic5 and Tbx1 [28– 30]. [score:3]
[1 to 20 of 3 sentences]
76
[+] score: 15
By analyzing miRNA expression profiles in DCs using qRT-PCR, we identified 4 miRNAs (miR-7, miR-9, miR-155, and miR-182) uniquely overexpressed in aDCs treated for 6 h or 24 h with LPS and IFN- γ compared to untreated immature iDCs and to tDCs cultured with IL-10 and TGF- β. Recent investigations in different immune cell types have shown that TIRs and TNF- α receptor activation results in the rapid expression of miRNAs including miR-9, miR-99b, miR-146a, miR-146b, and miR-155 [29]. [score:4]
Upregulation of miR-182, connected with the immune system, was referred to in sepsis patient leukocytes and activated helper T cells clonal expansion [31, 32]. [score:4]
Upon maturation, we identified 4 miRNAs (miR-7, miR-9, miR-155, and miR-182) consistently upregulated in aDCs and 4 other miRNAs (miR-17, miR-133b, miR-203, and miR-23b) in tDCs. [score:4]
Four upregulated miRNAs are important for activation (miR-7, miR-9, miR-155, and miR-182) in aDCs compared to tDCs and iDCs after 6 h and 24 h of maturation. [score:3]
[1 to 20 of 4 sentences]
77
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway [51]. [score:5]
Ssc-miR-182, ssc-miR-187, ssc-miR-136, ssc-miR-210, ssc-miR-217 and ssc-miR-10b participate in regulation Neurotrophin signaling pathway by targeting corresponding genes, including BNDF, SHC4, KRAS and FOXO3. [score:4]
We also assessed another three selected miRNAs, ssc-miR-136, ssc-miR-217 and ssc-miR-182, which were found to be more highly expressed in mpiPSCs (Fig 3C). [score:3]
Additionally, ssc-miR-216, ssc-miR-217, ssc-miR-142-5p, ssc-miR-96-5p, ssc-miR-182 and ssc-miR-183 have higher expression levels in mpiPSCs than that in hpiPSCs (Fig 3A). [score:3]
[1 to 20 of 4 sentences]
78
[+] score: 14
Furthermore, seven miRNAs were expressed more highly in C57BL/6J mice and were mainly downregulated across the time course (miR-92b-3p, miR-34b-5p, miR-672-5p, miR-31-5p, miR-34c-5p, miR-34b-3p, and miR-182-5p; listed in descending order according to the heat map in Figure 5). [score:6]
Five of these [miR-34b-3p, miR-34c-5p, miR-34b-5p, miR-92b-3p, and miR-182-5p; as well as miR-31-5p, which was identified through literature search (41)] belonged to the aforementioned seven miRNAs which were expressed more highly in the C57BL/6J mice and downregulated throughout the time course. [score:6]
Two of the 20 miRNAs (miR-31-5p and miR-182-5p) can be linked to adaptive immunity, i. e., T cell activation and regulation of Treg differentiation, respectively (72, 73). [score:2]
[1 to 20 of 3 sentences]
79
[+] score: 14
- In, up-regulation is shown for miR-19a (position 5), miR-183 (position 9), and miR-141 (position 10); we also observe that miR-182 (position 3) is likely to be a true positive. [score:4]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
[1 to 20 of 5 sentences]
80
[+] score: 14
Among these, 10 pairwise miRNAs (mfi-miR-142, mfi-miR-17, mfi-miR-18a, mfi-miR-20a, mfi-miR-181a, mfi-miR-182, mfi-miR-199a, mfi-miR-30a, mfi-miR-9a, and mfi-miR-9b) were found to have relatively lower expression levels of miR-#-3p than their miR-#-5p counterparts, while the other 5 pairwise miRNAs (miR-29c, miR-22, miR-363, miR-24a, and miR-126) showed relatively higher expression levels of miR-#-3p. [score:5]
MiR-182 was significantly upregulated in anaplastic thyroid cancer (ATC) tissues and cells [44]; its high abundance in this study may suggest its role in thyroid cell activation during metamorphosis. [score:3]
Among the miRNAs with high abundance (more than 100,000 counts), 12 miRNAs (mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f) were most highly expressed in M. fissipes metamorphosis. [score:3]
The expression levels of mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f were highest in this study, implying their potential significant functions in M. fissipes metamorphosis. [score:3]
[1 to 20 of 4 sentences]
81
[+] score: 14
Gilam et al. [55] have reported that miR-96 and miR-182 reduce breast cancer cell migration and invasion by downregulating Palladin protein levels and that this process is disrupted by a SNP, rs1071738 (G < C), located in the 3′-UTR of the PALLD gene. [score:4]
A significant decrease in Palladin levels is diminished by miR-96 and miR-182 expression (approx. [score:3]
If the C allele occurs in the binding site, the mRNA target sequence at the 3′-UTR of PALLD is fully complementary to the miR-96 and miR-182 seed regions, whereas the presence of the alternate G allele results in one mismatch. [score:3]
none —[54] breast cancer miR-96, miR-182 PALLD rs1071738 C>G (G impairs binding site) in vitro: reporter gene assay in HeLa and HEK-293T cells (with miR mimic, miR inhibitor or control). [score:2]
PALLD | miR-96 and miR-182. [score:1]
These findings suggest that although miR-96 and miR-182 may prevent breast cancer metastasis, the functional rs1071738 G variant abolishes this effect [55]. [score:1]
[1 to 20 of 6 sentences]
82
[+] score: 14
Several miRs are evident in the pathologies of both MetS and sepsis; MiR-122 regulates lipid synthesis and oxidation, and also serves as a biomarker in hepatic ischemia, viral hepatitis and sepsis; MiR-150 is downregulated in sepsis and correlates with its severity as assessed by clinical scoring, but is upregulated in dysglycemia and diabetes mellitus; MiR-182 regulates glucose levels and its metabolism, and is also upregulated in sepsis; and miR-197, −375, −155 and −132 show dual roles in both infection control and MetS (Supplementary Material). [score:12]
miR-182 regulates metabolic homeostasis by modulating glucose utilization in muscle. [score:2]
[1 to 20 of 2 sentences]
83
[+] score: 13
In differentiated hNSCs, downregulated hsa-miR-96 correlated with SOX5 upregulation of gene and protein expression; similar results were obtained for hsa-miR-302a, hsa-miR-182, hsa-miR-7, hsa-miR-20a/b, and hsa-miR-17 and their target NR4A3. [score:11]
Top-ranked downregulated miRNAs: hsa-miR-96, hsa-miR-182, hsa-miR-183, hsa-miR-7 and hsa-miR-302a were analyzed by using the DIANA-microT 4.0 algorithm to investigate the KEGG pathway. [score:2]
[1 to 20 of 2 sentences]
84
[+] score: 13
The miR-182 forms a part of miR-183/96/182 cluster, whose expression is considerably enriched in the pineal gland and up-regulated by light [23], [24]. [score:6]
MiR-181a and miR-182 were the highly expressed miRNAs in the brain and pineal gland of zebrafish. [score:3]
It is also reported that over -expression of miR-182 results in production of ectopic hair cells [21]. [score:3]
The maximum read count was observed for miR-181a and miR-182 in the brain and pineal gland, respectively. [score:1]
[1 to 20 of 4 sentences]
85
[+] score: 13
The authors also showed that the region containing the up-regulated miR-182 was amplified in 28.9% of ovarian carcinomas, whereas, miR-15a was deleted in 23.9% of ovarian carcinomas, as previously also shown for CLL (Calin et al., 2002). [score:4]
Two other studies reported that miR-182 and miR-125b conferred resistance to cisplatin, possibly by their anti-apoptotic activity due to the repression of two important tumor suppressors, PDCD4 and Bcl-2 antagonist killer 1 (Bak1), respectively (Kong et al., 2011; Wang et al., 2013). [score:3]
In another study, the levels of four miRNAs (miR-200a, b, c, and miR-182) were identified as differentially expressed between the serum of 28 patients with serous ovarian cancer and healthy age-matched volunteers (Kan et al., 2012). [score:3]
MicroRNA-182 promotes cell growth, invasion and chemoresistance by targeting programmed cell death 4 (PDCD4) in human ovarian carcinomas. [score:2]
As previously described, Coukos’s laboratory identified a consistent amplification of miR-182 region and deletion of miR-15 in ovarian carcinomas (Zhang et al., 2008). [score:1]
[1 to 20 of 5 sentences]
86
[+] score: 13
Researchers also demonstrated that miR-182 contributes to the regulation of FOXO3 by targeting FOXO3 in skeletal muscle during chronic diseases (e. g., diabetes, chronic kidney disease) which are associated with elevated glucocorticoid production [82]. [score:8]
miR-182 -induced downregulation of FOXF2 partially accounts for the increased activity of β-catenin signaling suggesting a potential mechanism underlying an miR-182/FoxF2 link contributing to CRC development [157]. [score:5]
[1 to 20 of 2 sentences]
87
[+] score: 13
For example, miR-27a, miR-96 and miR-182 can coordinately regulate the expression of FOXO1 by directly targeting the FOXO1 3′-UTR in breast cancer [34]. [score:7]
It has been demonstrated that FOXO1 expression is regulated by several microRNAs, such as miR-223, miR-182, miR-27a, miR-139 and miR-96 [39]– [43]. [score:4]
Of these, some microRNAs may be dysregulated in prostate cancer, such as miR-27a, miR-182 [41], [44]. [score:2]
[1 to 20 of 3 sentences]
88
[+] score: 13
miR-182 and 181c were upregulated (⇑) and miR-19a was downregulated (⇓). [score:7]
Three miRNAs (miR-181c, miR-182, miR-19a) were selected from among the miRNA-mRNA high correlation pairs to test whether the correlations predicted changes that could be reproduced experimentally. [score:1]
The above figure represents Ct [scrambled]-Ctpre-mir/2′ -O-Me from three individual transfection experiments of pre- miR-181c, pre- miR-182, 2′ -O-Me- miR-19a, 2′ -O-Me-scrambled and pre-mir-scrambled. [score:1]
miR-181c and miR-182 were individually transfected as pre-miRNAs into U251 glioblastoma cells to increase their levels 2–4 fold (data not shown). [score:1]
Three independent transfections were performed for each pre-mir and 2′ -O-Me oligoncleotide of miR-181c, miR-182, miR-19a and a scrambled pre-miR or 2′ -O-Me as a negative control (Ambion, TX). [score:1]
0000804.g005 Figure 5The above figure represents Ct [scrambled]-Ctpre-mir/2′ -O-Me from three individual transfection experiments of pre- miR-181c, pre- miR-182, 2′ -O-Me- miR-19a, 2′ -O-Me-scrambled and pre-mir-scrambled. [score:1]
Twenty-four hours after the transfections of pre- miR-182, pre- miR-181c, 2′ -O-Me- miR-19a, as well as a pre-miR scramble or a 2′ -O-Me scramble, we collected total RNA for real-time RT-PCR to determine the relative changes in the levels of the correlated mRNAs (Figure5). [score:1]
[1 to 20 of 7 sentences]
89
[+] score: 13
Notably, SNAI2/Slug, an important EMT gene, is upregulated in 2102Ep cells, while its previously validated miRNAs, miR-182 and miR-183, are downregulated. [score:7]
In 2102Ep cells, inhibitors of EMT, miR-9 and miR-424, and an activator of MET, miR-182, are all upregulated. [score:6]
[1 to 20 of 2 sentences]
90
[+] score: 13
miR-182 was not detected as preferentially over-expressed with the most restricted analysis, but their up-regulation was clearly observed in CRC cell lines analysis (table 1). [score:6]
Other members of this family, including FOXF2, FOXK2, FOXO1A, FOXO3A and FOXQ1, were also found as putative targets of miR-182, miR-183 and miR-96. [score:3]
CHES1 protein was identified as a potential target of both miR-96 and miR-182. [score:3]
miR-96, miR-182 and miR-183 are located in the same chromosomal region, 7q32.2. [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 13
Interestingly, the expression of miR-182 which is co-ordinately expressed from the same genetic locus as miR-183 has been shown to be downregulated in ER positive tumors[13], this supports our finding of miR-183 dysregulation in association with ER status. [score:9]
MiR-183 is located on chromosome 7q32.3 and is part of a miRNA family comprised of three homologous miRNAs (miR-183, miR-182 and miR-96) that are co-ordinately expressed from this locus. [score:3]
MiR-183 is a member of a miRNA family comprised of three homologous miRNAs (miR-183, miR-182 and miR-96) that are clustered within 2-4 kb at chromosome 7q32. [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 13
Because miR-199a is highly upregulated and miR-182 is downregulated in human breast CSCs and mammary stem/progenitor cells, it is possible that miRNAs function as epigenetic regulators of the EMT transcription factors Snail and Slug to regulate the stem cell abilities of breast CSCs and normal mammary stem/progenitor cells. [score:9]
And miR-182 targets Slug and induces mesenchymal-to-epithelial transition (MET) features in prostate cells [165]. [score:3]
Qu Y. Li W. C. Hellem M. R. Rostad K. Popa M. McCormack E. Oyan A. M. Kalland K. H. Ke X. S. miR-182 and miR-203 induce mesenchymal to epithelial transition and self-sufficiency of growth signals via repressing SNAI2 in prostate cells Int. [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 12
Furthermore, three microRNAs, miR-27a, miR-96, and miR-182, have all been found to directly target FOXO1 and regulate endogenous FOXO1 protein expression in breast cancer cells, while suppression of these microRNAs resulted in an increase in FOXO1 protein and a decrease in cell growth [22]. [score:9]
For example, Anna et al. found that FOXO1 is a bona fide target of miR-182 and mediated the function of miR-182 in promoting clonal expansion of activated helper T lymphocytes [21]. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 12
Stress also downregulated miRNAs that possess potential roles in the pathogenesis of psychiatric diseases, such as miR-96 [51], miR-182 and miR-183 [52]. [score:6]
The qRT-PCR confirmed changes of the selected miRNAs (Figure  4B), decreased expression of miR-96, miR-141, miR-182, miR-183, miR-200a, miR-200b, miR-429 and miR-451 in F2-SSS compared to F0-S animals, whereas miR-23b and miR-200c showed increased expression levels. [score:4]
In order to validate miRNAs, we performed quantitative real time PCR (qRT-PCR) analysis of these differentially regulated miRNAs (n = 3 per group for F0, F1 and F2 generations, three replicates per sample): miR-23b, miR-96, miR-141, miR-181a, miR-182, miR-183, miR-200a, miR-200b, miR-200c, miR429 and miR-451. [score:2]
[1 to 20 of 3 sentences]
95
[+] score: 12
They assessed the relationship of two miRNAs (miR-182 and miR-187) most differentially expressed in prostate cancer with the clinicopathological characteristics and outcome of patients, and it was observed that miR-187 expression was decreased in advanced prostate cancer cases, which was consistent with microarray data. [score:3]
Likewise, high expression of the miR-183 family (miR-183, miR-182, and miR-96) was associated with overall poor survival in patients with lung cancer [42]. [score:3]
Moreover, in lung cancer, a signature of five miRNAs has been used in the prediction of treatment outcome for non-small-cell lung carcinoma (NSCLC), among which high expression of miR-221 and let-7a is associated with good prognosis, as opposed to elevated miR-137, miR-372, and miR-182 with poor prognosis [41]. [score:3]
Moreover, the higher expression of miR-182 independently conferred a worse prognosis for BPFS and PFS using Cox proportional hazard multivariable analysis. [score:3]
[1 to 20 of 4 sentences]
96
[+] score: 12
In addition, it has been shown that miR-182 targets Mitf 3′UTR sequence in the retina [32], and recently Segura et al. (2009) showed that miR-182 promotes migration and survival of melanoma cells by downregulating Mitf expression [33]. [score:8]
miR-182 has been shown previously to target the 3′UTR of Mitf and was used as a positive control [32]. [score:3]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
[1 to 20 of 3 sentences]
97
[+] score: 12
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-145, hsa-mir-138-1, hsa-mir-150
Especially in EOC, Yeh et al. [7] indicated the downregulation of miRNA-138 in the highly invasive cells, and its functioning as an inhibitor of cell migration and invasion; Wang et al. [8] found that miR-182 may act as an oncogenic miRNA and promote cancer cell growth, invasion, and chemoresistance by targeting PDCD4 in EOC cells; Wu et al. [9] suggested that miR-145 may modulate EOC growth and invasion by suppressing p70S6K1 and MUC1, functioning as a tumor suppressor. [score:12]
[1 to 20 of 1 sentences]
98
[+] score: 12
Wang L Wu F Song Y Li X Wu Q Duan Y Jin Z Long noncoding RNA related to periodontitis interacts with miR-182 to upregulate osteogenic differentiation in periodontal mesenchymal stem cells of periodontitis patientsCell Death Dis. [score:4]
Further study revealed that lncRNA- POIR acted as a ceRNA for miR-182, thus positively regulating expression of FoxO1. [score:4]
The inflammatory environment, which usually occurred in periodontitis, increased miR-182 expression through NF-κB pathway, finally resulted in an imbalance in the lncRNA- POIR-miR-182 regulatory network [76]. [score:4]
[1 to 20 of 3 sentences]
99
[+] score: 12
Thus, miR-182 and miR-183 are overexpressed and miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in both cell lines containing integrated HPV16 or HPV18 DNA [30]. [score:5]
HPV18 positive HeLa cell line has overexpression of miR-182 and miR-183, while miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in this cell line as compared with normal cervical tissue. [score:4]
HPV16 positive SiHa and CaSki cell lines have shown an overexpression of miR-182, miR-183, and miR-210. [score:3]
[1 to 20 of 3 sentences]
100
[+] score: 12
Expression of DCN and COL1A2 (upregulated in ASC compared with NTERA-2 cells) was also inversely correlated with expression of the miRNAs with target seed sequences for those genes miR-96, miR-182, miR-205 (DCN) and miR-96 and miR-367 (COL1A2) (downregulated in ASC relative to NTERA-2 cells) (Figure 5). [score:12]
[1 to 20 of 1 sentences]