sort by

194 publications mentioning mmu-mir-30e (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-30e. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 326
The tumor suppressor genes PTEN (Phosphatase and tensin homolog), JNK (c-Jun N-terminal kinase), RB1 as well as an additional inhibitor of NF-κB, NKIRAS1 (NF-κB inhibitor-interacting Ras-like protein 1) are among the putative miR-30e* targets. [score:9]
To test whether miR30e* could be altering the expression of other NF- κB target genes in prostate cancer cells miR-30e* was inhibited and expression was assessed after 24 hours via qRT-PCR. [score:9]
Inhibition of miR-30e* had no effect on the expression of senescence -associated β-galactosidase (Figure 2C; * P > 0.05) or cleaved caspase-3 (Figure 2D; * P > 0.05) suggesting that miR-30e* is not altering cell viability by inhibiting the percentage of cells that enter senescence or altering the rate of apoptotic cell death. [score:7]
miR-30e* inhibition did however significantly reduce the percentage Ki67 expressing cells (Figure 2E; ** P ≤ 0.01) suggesting that the decrease in the cell viability following miR-30e* inhibition (Figure 2A & 2B) was due in part to a reduction in proliferation. [score:7]
miR-30e* inhibition led to a significant decrease in the expression of TNF- α and VEGF mRNA as well as marginally reduced the expression of IL-10, IL-6 and iNOS (Supplementary Figure 5). [score:7]
To test whether the targeting of IκBα by miR-30e* regulates NF-κB p65 nuclear translocation in vivo TRAMP C2H cells expressing miR-30e* resistant IκBα were injected subcutaneously into male C57BL/6 mice. [score:6]
To determine whether the effects of miR-30e* inhibition on CaP cell proliferation were due to the direct inhibition of IκBα by miR-30e*, TRAMP C2H cells were transfected with a plasmid encoding a doxycycline inducible miR-30e* resistant IκBα-HA fusion protein (Figure 4A). [score:6]
There is also evidence suggesting that the tumor suppressor gene p53, a gene often mutated or lost in CaP [40], negatively regulates miR-30e* expression. [score:6]
miR-30e* resistant IκBα TRAMP C2H tumors expressed significantly less Ki-67 and cyclin D1 suggesting the miR-30e*: IκBα axis regulates proliferation though the NF-κB target gene cyclin-D1 (Figure 5C & 5D; *** P ≤0.005). [score:6]
miR-30e* inhibition reduced the levels of phosphorylated Rb, but had no effect on total Rb expression levels (Figure 5B; * P ≤0.05). [score:5]
NKIRAS1 is a potent inhibitor of NF-κB, although the role NKIRAS1 plays in CaP is not well elucidated; the regulation of NF-κB activation by miR-30e* makes this interesting future direction. [score:5]
Thus, miR-30e* inhibition has the potential to provide a novel way to target NF-κB hyper-activation in the clinic and provide a window for minimally toxic therapeutic intervention with docetaxel in CaP patients. [score:5]
Treatment of TRAMP C2H cells with docetaxel effectively decreased cell viability while combination treatment of docetaxel and miR-30e* inhibition significantly enhanced docetaxel efficacy (Figure 5E; * P ≤ 0.05), suggesting that inhibition of miR-30e* increases CaP cell sensitivity to chemotherapeutics. [score:5]
Our results indicated that the effects of miR-30e* in CaP cells are a result of miR-30e* inhibition of IκBα expression. [score:5]
To validate that elevated miR-30e* expression in CaP was not a mo del specific phenomenon, miR-30e* expression in the Hi-MYC transgenic CaP mo del [30] was also analyzed (Figure 1B). [score:5]
The mo del we propose (Figure 6) suggests that, miR-30e* becomes hyper expressed in CaP cells as the disease progresses. [score:5]
The importance of the loss of these genes as a function CaP progression in correlation with the increase in miR-30e* throughout disease progression makes these predicted miR-30e* targets very interesting. [score:5]
Cells were then transfected with either a miR-30e* inhibitor or control scramble oligos or treated with Bay 11-7085 inhibitor. [score:5]
org, miR-30e* has 7,931 predicted targets and a number of these predicted targets are known to play an important role in CaP progression. [score:5]
Inhibition of miR-30e* in CaP cells did not lead to changes in MMP9, suggesting that the effects of miR-30e*/NF-κB are cell-type specific and may be the result of different microenvironments or co -expression of different miRs. [score:5]
miR-30e* inhibition in TRAMP C2H cells did not significantly alter the expression of functional MMP9 (Supplementary Figure 6). [score:5]
Consistent with decreased NF-κB activity and cell proliferation, a significant reduction in cyclin D1 protein expression was observed in vitro in miR-30e* inhibited TRAMP C2H cells (Figure 5A; * P ≤ 0.05). [score:5]
miR-30e* regulates cyclin D1 expression. [score:4]
These findings suggest that miR-30e* positively regulates prostate tumor cell proliferation via the NF-κB target gene cyclin-D1. [score:4]
The mechanisms that drive miR-30e* upregulation in CaP are unknown. [score:4]
To determine how miR-30e* regulated CaP cell viability, the effects of miR-30e* inhibition on cell senescence, death and proliferation were tested. [score:4]
To determine if the specific targeting of IκBα by miR-30e* regulated NF-κB p65 activation miR30e* resistant IκBα C2H cells were administered subcutaneously in C57BL/6 mice (C). [score:4]
Analysis of a comprehensive list of microRNA in relation to these specific gene mutations revealed that miR-30e* was overexpressed relative to adjacent healthy tissue in all subtypes and was further elevated in 3/6 of the subtypes defined by having ERG, ETV1 and SPOP fusion proteins respectively. [score:4]
To assess if miR-30e* regulates prostate cancer cell proliferation and the expression of cyclin D1 in vivo IHC was performed. [score:4]
In contrast, Jiang et al. [27] has shown that miR-30e* contributes to glioma growth and progression indirectly via an increase in NF-κB mediated expression of MMP9, which augments tumor angiogenesis. [score:4]
Mechanistically, miR-30e* increases NF-κB activation, increases the expression of cyclin D1 which prompts the phosphorylation of Rb, a critical regulator of CaP proliferation. [score:4]
While our data demonstrates that NF-κB activation by miR-30e* directly regulates CaP cell proliferation, we also provide evidence that miR-30e* regulates other pathways important in CaP growth. [score:4]
Figure 5The miR-30e*: IκBα axis regulates cyclin D1 and proliferation in vivoThe expression of cyclin D1 (A) and Rb (total and phosphorylated) (B) were evaluated in C2H cells treated with or without miR-30e* inhibitor for 24h via western blot analysis. [score:4]
Six hours later cells were washed and then transfected with miR-30e* inhibitor for 24 hours. [score:3]
Additionally, pretreating CaP cells with a miR-30e* inhibitor sensitizes the cells to the chemotherapeutic docetaxel. [score:3]
Inhibition of miR-30e* led to a significant decrease in NF-κB activity (Figure 3A; * P ≤ 0.05). [score:3]
Prostates were analyzed for miR-30e* and U6 snRNA expression via qRT-PCR. [score:3]
Cells were then transfected with miR-30e* inhibitor. [score:3]
Cells were transfected with miR-30e* inhibitor oligos, scramble oligos, IκBα super repressor, HA-tag wild type IκBα pTetOne or HA-tag miR-30e* resistant IκBα pTetOne using lipofectamine 2000 and OPTI-MEM according to the manufacturer's protocol. [score:3]
In this study we demonstrate that miR-30e* is over-expressed in murine mo dels of CaP. [score:3]
miR-30e* gene expression has been ascribed to being driven by two different promoters. [score:3]
Luciferase was then evaluated in control and miR-30e* inhibited cells 24 hours post inhibition. [score:3]
miR-30e* inhibition sensitizes prostate cancer cells to docetaxel. [score:3]
TRAMP C2H cells stably expressing pTetOne-NHA-miR-30e* sensitive-IκBα (WT IκBα) or pTetOne-NHA-miR-30e* resistant IκBα (miR-30e* resistant IκBα) were grown in complete TRAMP media with 10% tetracycline-free FBS in tissue culture flasks in the presence of hygromycin B (3μg/mL). [score:3]
In human glioma hyper -expression of miR-30e* constitutively drives NF-κB activation [27]. [score:3]
The expression of cyclin D1 (A) and Rb (total and phosphorylated) (B) were evaluated in C2H cells treated with or without miR-30e* inhibitor for 24h via western blot analysis. [score:3]
These studies support our finding that miR-30e* is overexpressed in prostate cancer. [score:3]
Lee et al. [35] demonstrated that a decrease in miR-30e* expression correlated with a decrease in proliferation and viability of normal dermal papilla cells. [score:3]
We report that miR-30e*, a NF-κB activating miR, is hyper-expressed in two murine mo dels of autochthonous CaP relative to healthy controls. [score:3]
Yet the expression and biological impact of miR-30e* in CaP is unknown. [score:3]
Figure 2 (A) C2H cells or (B) PC3M cells were transfected with either miR-30e* inhibitor oligos (■) or control scramble oligos. [score:3]
Confirmation of miR-30e* inhibition was performed in both TRAMP C2H and PC3M cells (Supplementary Figure 1A & 1B; * P ≤ 0.05 ***P ≤ 0.001). [score:3]
miR-30e* targets IκBα mRNA thus increasing NF-κB activation. [score:3]
miR-30e* is overexpressed in murine mo dels of prostate cancer. [score:3]
Our studies indicate that inhibition of miR-30e* effectively lowers the minimal effective dose of docetaxel required to kill CaP cells (Figure 5E). [score:3]
IκBα sequesters p65:p50 in the cytoplasm and is a confirmed target of miR-30e* [27]. [score:3]
The expression of miR-30e* was examined in two autochthonous experimental mouse mo dels of CaP; the TRansgenic Adenocarcinoma of the Mouse Prostate (TRAMP) mo del system and the HI-Myc mo del. [score:3]
Figure 6 miR-30e* targets IκBα mRNA thus increasing NF-κB activation. [score:3]
Cells expressing miR-30e* resistant IκBα exhibited a significant reduction in proliferation (Figure 4B; day 1: * P ≤ 0.05, day 2: * P ≤ 0.05 and day 3: ** P ≤ 0.01). [score:3]
miR-30e* expression was significantly elevated in prostates isolated from Hi-MYC transgenic mice relative to aged-matched control prostates isolated from FVB mice. [score:3]
There was also a significant difference between 7 and 9 months in experimental mice echoing the TRAMP data suggesting miR-30e* may increase with disease progression (Figure 1B; 7 vs 9 months, * P ≤ 0.05). [score:3]
Inhibition of miR-30e* reduced the viability of TRAMP C2H tumor cells, a cell line derived from the TRAMP mo del (Figure 2A; **** P ≤ 0.001). [score:3]
The loss of Rb contributes to tumor progression and androgen receptor activity in CaP [45] yet in inhibition of miR-30e* did not affect total Rb levels (Figure 5B). [score:3]
miR-30e* expression is elevated in CaP. [score:3]
We show that miR-30e* drives CaP cell proliferation by targeting IκBα. [score:3]
An example is miR-30e* which inhibits IκBα [27]. [score:3]
miR-30e* targets IκBα, thus increasing the level of free NF-κB to translocate to the nucleus. [score:3]
Similar results were observed when miR-30e* was inhibited in the human CaP cell line PC3M (Figure 2B; day 1: ** P ≤ 0.01 and day 2: * P ≤ 0.05). [score:3]
Cells were then transfected with miR-30e* inhibitor and 24 hours later cells were rinsed with sterile PBS twice and harvested. [score:3]
miR-30e* regulates CaP cell proliferation. [score:2]
The microRNA-30e*: NF-κB axis regulates prostate cancer cell proliferation and therapeutic resistance. [score:2]
This data confirms previous findings from Jiang et al. suggesting miR-30e* positively regulates NF- κB activation through IκBα. [score:2]
Jiang et al [27] has shown that miR-30e* augments human glioma tumor growth by NF-κB dependent regulation of MMP9 [27]. [score:2]
miR-30e* regulates prostate cancer cell viability. [score:2]
miR-30e* regulates prostate cancer cell proliferation and tumor growth through IκBα. [score:2]
miR-30e* expression was significantly higher in TRAMP prostates when compared to syngeneic age-matched C57BL/6 control prostates at multiple age points (Figure 1A; * P ≤ 0.05). [score:2]
DMEM, RPMI640, OPTI-MEM medias, Trypsin-EDTA (0.05%), miR-30e* inhibitor oligos, miR-30e* specific qRTPCR primers, Pre-miR™ miRNA Precursor Molecules—Negative Control #2, lipofectamine 2000, NuPAGE® Novex® 10% Bis-Tris Protein Gels, Nitrocellulose Pre-Cut Blotting Membranes, TRIzol, mirVana™ miRNA Isolation Kit as well as the mirVana™ qRT-PCR miRNA Detection Kit were all purchased from Thermo Fisher Scientific (Waltham, MA). [score:2]
Mutation of this miR-30e* seed sequence in the 3’UTR of IκBα was previously described by Jiang et al [27]. [score:2]
miR-30e* regulates NF-κB activity which is essential for prostate cancer cell viability. [score:2]
The miR-30e*: IκBα axis regulates cyclin D1 and proliferation in vivo. [score:2]
Our work suggests that miR-30e* drives CaP progression directly via augmentation NF-κB dependent tumor cell proliferation. [score:2]
At ages which have been shown to be tumor bearing miR-30e* expression was significantly elevated compared to control mice (7 & 9 months; * P ≤ 0.05). [score:2]
To determine whether prostate tumor growth was negatively affected by inhibiting the interaction of miR-30e* with IκBα, miR-30e* resistant IκBα tumor growth was assessed and compared to tumors from mice fed with normal control chow. [score:2]
miR-30e* is not alone it its ability to regulate NF- κB activation. [score:2]
A separate study by Liao et al. [39] reports that miR-30e is driven off its own promoter and can be activated by β-catenin / TCF4. [score:1]
Evaluation of the clinical significance of this finding revealed that targeting the miR30e*: IκBα axis can control prostate tumor growth. [score:1]
Patel et al. [38] suggests that miR30e is an intronic miR located within the nuclear factor ϒ C (NF-ϒC) gene however, it is unclear whether the NF-ϒC gene promoter or one of several cryptic promoters and possible transcription factor binding sites located within the NF-ϒC gene drive miR30e transcription. [score:1]
We further demonstrated that miR-30e* mediated hyper-activation of NF-κB contributes to CaP cell proliferation and viability. [score:1]
Doxycycline induction of miR-30e* resistant IκBα in the tumors was confirmed by western blot (Supplementary Figure 4). [score:1]
miR-30e* resistant IκBα C2H tumors displayed a significant reduction in nuclear NF-κB p65 relative to tumors from control chow fed mice (Figure 4C; **** P ≤ 0.001). [score:1]
Hosako et al investigated miR profiles from embryos deficient for p53 [−/−] and discovered increased expression of miR-30e* [41]. [score:1]
miR30e* resistant IκBα C2H cells were administered subcutaneously in C57BL/6 mice. [score:1]
Traditionally, miRs alter mRNA networks and it would be naïve to think that miR-30e* is an exception. [score:1]
miR-30e* was significantly elevated in patients that eventually developed biochemical recurrence following treatment relative to patients who did not. [score:1]
miR-30e* resistant Tramp C2H tumors were resected when tumor volume reached 800mm [3] from euthanized mice. [score:1]
Several studies support a role for miR-30e* in NF-κB driven cell proliferation and CaP. [score:1]
Figure 4 (A) Plasmid maps for doxycycline inducible N-terminal HA tagged miR-30e* sensitive IκBα and miR-30e* resistant IκBα pTetOne plasmids. [score:1]
miR-30e* resistant Tramp C2H cells were harvested from tissue culture flasks in vitro using Trypsin-EDTA (0.05%) during log phase growth. [score:1]
To test this mo del in vivo, miR-30e* resistant IκBα TRAMP C2H tumors as well as corresponding control tumors were immunohistochemically stained for Ki-67 and Cyclin D1 (Figure 5C & 5D). [score:1]
Doxycycline chow induced miR-30e* resistant IκBα while mice on normal chow maintained normal IκBα in the CaP cells. [score:1]
[1 to 20 of 100 sentences]
2
[+] score: 299
In this study, the miR-30e expression was down-regulated in human BC, and over -expression of miR-30e inhibits the ability of cell proliferation, migration and invasion in BC cells. [score:10]
Then, we will investigate: (1) what is the role of miR-30e in breast cancer cell growth, migration and invasion; (2) what is the direct target of miR-30e that is associated with cancer development; and (3) whether forced miR-30e expression inhibits cell growth, migration, invasion and chemoresistance via this direct target. [score:10]
Finally, miR-30e suppressed constitutive phosphorylation of AKT and ERK1/2, and inhibited expression of HIF-1α and VEGF via targeting IRS1. [score:9]
Forced expression of miR-30e also markedly reduced the wound-healing rate, and overexpression of IRS1 reverses the inhibitory effects of miR-30e. [score:7]
Finally, our results suggested that overexpression of miR-30e suppressed cell proliferation, cell migration and invasion by inhibiting IRS1. [score:7]
Although we confirmed that miR-30e could inhibit the phenotype of BC by targeting IRS1, there might be other targets of miR-30e, which could also affect the growth of BC cells. [score:7]
Previous studies reported the downregulation of miR-30 family members during osteoblast differentiation from mouse preosteoblast cell lines 18, 19. miR-30a/b/c/d were demonstrated to be able to negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 [19]. [score:7]
Taken together, our study indicated that IRS1 was a direct downstream target of miR-30e and was involved in the miR-30e -induced suppression of the activity of cell migration and invasion in breast cancer cell. [score:6]
Among others, miR-30e expression was upregulated in hepatoma patients who did not respond to cisplatin-therapy [30]. [score:6]
We found that the IRS1 expression at the protein level was down-regulated in miR-30e treated cells (Fig.   3c). [score:6]
Secondly, the IRS1 expression was significantly abolished in BC cells expressing miR-30e. [score:5]
MiR-30e regulates cell proliferation, migration, invasion and increases chemosensitivity of MDA-MB-231 cells to paclitaxel by inhibiting its target IRS1. [score:5]
Over -expression of miR-30e dramatically inhibited the normally strong migration and invasive capacity of breast cancer cells (Fig.   2c,d). [score:5]
We also found that the activity of caspase-3, a key executor of cell apoptosis, was significantly upregulated upon treatment by miR-30e plus paclitaxel compared with miR-30e or paclitaxel treatment alone, whereas IRS1 overexpression attenuated the activation of caspase-3 induced by miR-30e plus paclitaxel treatment (Fig.   4g). [score:5]
Overexpression of miR-30e inhibits the ability of cell proliferation, cell migration and invasion in BC cells. [score:5]
Furthermore, our present work provides novel evidences which demonstrating that miR-30e inhibits tumor growth and chemoresistance via targeting IRS1 in breast cancer. [score:5]
Over -expression of IRS1 restored miR-30e -inhibited cellular protein levels of p-AKT and p-ERK1/2 and HIF-1α. [score:5]
Overexpression of IRS1 restored miR-30e -inhibited protein levels of p-AKT, p-ERK1/2, HIF-1α and VEGF. [score:5]
To test the role of IRS1 in cellular function, we showed that forced expression of IRS1 restored miR-30e -inhibited cell proliferation and migration (Fig.   4a,b). [score:5]
Our results suggested that miR-30e -overexpressed suppressed breast cancer cell proliferation, cell migration and invasion. [score:5]
Feng et al. found that miR-30e suppresses proliferation of hepatoma cells via targeting prolyl 4-hydroxylase subunit alpha-1 (P4HA1) mRNA [21]. [score:5]
MiR-30e expression is downregulated in breast cancer tissues and cell lines. [score:5]
These results suggested that miR-30e inhibited PI3K/AKT and MAPK/ERK pathways via targeting IRS1. [score:5]
Figure 2Overexpression of miR-30e inhibits the ability of cell proliferation, migration and invasion in BC cells. [score:5]
In this study, we provided a novel molecular insight of miR-30e impacting BC by suppressing IRS1 expression. [score:5]
Consistent with our previous studies, these results suggested that miR-30e inhibited tumor growth through targeting IRS1 and other downstream signaling molecules in vivo. [score:5]
Over -expression of miR-30e dramatically inhibited the normally strong invasive capacity of MDA-MB-231 cells (Fig.   4c). [score:5]
Taken together, our study provided the first evidence that miR-30e played a significant role in suppressing BC cell growth through inhibition of IRS1. [score:5]
Granot G et al. confirmed that miR-30e induces apoptosis and sensitizes K562 cells to imatinib treatment via regulation of the BCR-ABL protein [22], and miR-30e regulated Ubc9 expression in cancer cells [24]. [score:5]
To confirm that IRS1 was the direct target of miR-30e in BC, human IRS1 3′-UTR, containing either the wild-type or mutant miR-30e binding sequence, was cloned downstream of the firefly luciferase reporter gene in the pMIR-REPORTER vector. [score:4]
In this study, we demonstrated that miR-30e levels were downregulated in human breast cancer specimens using 40 pairs of normal and cancer tissues. [score:4]
Given the important role of IRS1 in regulation of cell proliferation, cell migration and invasion, miR-30e -overexpressing MDA-MB-231 cells were used to analyze cell growth and migration. [score:4]
The results showed that cell growth and migration were attenuated in miR-30e -overexpressed MDA-MB-231 cells compared with MDA-MB-231 cells expressing miR-NC (Fig.   4a,b). [score:4]
MiR-30e inhibits AKT and ERK1/2 pathways via targeting IRS1. [score:4]
Thus, our results indicated that miR-30e was downregulated in breast cancer tissues and cell lines. [score:4]
The results showed that activity of cell growth were attenuated in miR-30e -overexpressed cells compared with cells expressing miR-NC (Fig.   2b). [score:4]
These results suggested that miR-30e directly targeted IRS1 by binding to its 3′-UTRs in BC cells. [score:4]
Previous studies have shown that miR-30e is down-regulated in several cancer types. [score:4]
In contrast, miR-30 family members were upregulated during adipogenic differentiation of adipose tissue-derived stem cells, and miR-30a and miR-30d contributed to adipocyte formation [20]. [score:4]
MiR-30e inhibits tumor growth in vivoIn order to investigate whether overexpression of miR-30e attenuates progression of BC in vivo, we conducted MDA-MB-231 cells to stably express miR-NC or miR-30e, then cells were subsequently implanted into both posterior flanks of immunodeficient mice and the tumor sizes were measured after 10 days. [score:3]
To stably overexpress miR-30e in breast cancer cells, the lentiviral packaging kit was used (Thermo Fisher Scientific). [score:3]
The correlations between miR-30e expression levels and IRS1 levels in human breast cancer tissues were analyzed using Spearman’s rank test. [score:3]
As shown in Fig.   3e, expression of IRS1 and miR-30e were inversely correlated in 40 human BC specimens (Spearman’s correlation r = −0.4775). [score:3]
miR-30e -overexpressed MDA-MB-231 cells were used to analyze activity of cell growth. [score:3]
To date, some genes have been identified as target genes of miR-30e, including Ubc9, Bmi1, P4HA1, ABL and ATG5 21– 25. [score:3]
Our results showed that overexpression of miR-30e in breast cancer cells significantly increased chemosensitivity to treatment of paclitaxel (Fig.   4d). [score:3]
To analyze the underlying molecular mechanism of miR-30e in BC, TargetScan and miRanda (www. [score:3]
The combination of miR-30e and paclitaxel treatment significantly induced cell apoptosis, whereas forced expression of IRS1 partially abolished the effect induced by miR-30e plus paclitaxel treatment (Fig.   4f). [score:3]
Forced expression of miR-30e also markedly reduced the wound-healing rate. [score:3]
These results indicated that miR-30e renders breast cancer cells more sensitive to paclitaxel treatment, miR-30e and paclitaxel combination induced apoptotic effect through targeting IRS1 in breast cancer cells. [score:3]
org) were used to explore potential targets of miR-30e in BC. [score:3]
Next, we determined the correlation between IRS1 and miR-30e expression levels in the same human BC specimens using Spearman’s rank correlation analysis. [score:3]
Here, we observed that HIF-1α and VEGF levels in miR-30e-expressed cells were both reduced (Fig.   3g). [score:3]
Moreover, some downstream pathway proteins, such as p-AKT, p-ERK1/2 and HIF-1α were significantly suppressed by miR-30e in tissues (Fig.   5d). [score:3]
Therefore, future studies are required to identify additional targets and pathways of miR-30e. [score:3]
In our study, IRS1 oncogene was validated as the novel target of miR-30e. [score:3]
To further study whether miR-30e and its target IRS1 play a role in cell apoptosis in the presence of paclitaxel treatment, FACS analysis was performed to detect cell apoptosis rates. [score:3]
Cellular levels of p-AKT and p-ERK1/2 were significantly decreased in cells stably expressing miR-30e compared with miR-NC, while no statistically significant reduction of AKT and ERK1/2 were detected (Fig.   3f). [score:2]
MiR-30e inhibits tumor growth in vivo. [score:2]
In agreement with in vitro studies, the levels of IRS1 from the tumor tissues of miR-30e -expressing group were lower than that of miR-NC group by immunoblotting assay (Fig.   5d). [score:2]
In addition, expression of miR-30e in two breast cancer cell lines MCF-7 and MDA-MB-231, was significantly decreased compared with the normal cells MCF10A (Fig.   1b). [score:2]
The results showed that the expression of miR-30e was consistently lower in the breast cancer tissues compared with normal tissues. [score:2]
MiR-30e-expressed cells generated xenografts that were statistically significantly smaller than control (Fig.   5b). [score:2]
MiR-30e markedly suppressed luciferase activity in IRS1 3′-UTR (WT) reporter constructs. [score:2]
In the present study, miR-30e expression was significantly reduced in BC tissues and cell lines when compared with normal controls, respectively. [score:2]
The miR-30 family is associated with cell differentiation, cellular senescence, apoptosis, and involved in the pathogenesis of tumors and other disorders of the nervous, genital, circulatory, alimentary and respiratory systems 15– 17. [score:1]
Cells were infected by lentivirus carrying miR-30e or miR-NC in the presence of polybrene (Sigma-Aldrich) and selected by puromycin (Sigma-Aldrich) for two week to obtain stable cell lines. [score:1]
In order to investigate whether overexpression of miR-30e attenuates progression of BC in vivo, we conducted MDA-MB-231 cells to stably express miR-NC or miR-30e, then cells were subsequently implanted into both posterior flanks of immunodeficient mice and the tumor sizes were measured after 10 days. [score:1]
MDA-MB-231 cells were transfected with either of the two reporter plasmids, plus either miR-30e or NC vector. [score:1]
The miR-30 family members include miR-30a, miR-30b, miR-30c, miR-30d and miR-30e. [score:1]
Furthermore, cell growth rate in the presence of paclitaxel(4 nM) was assayed by CCK-8 proliferation assay at different time points; interestingly, forced expression of IRS1 reversed miR-30e -induced breast cancer cell chemosentivity to paclitaxel (Fig.   4e). [score:1]
From the 2 [nd] to 4 [th] week, miR-NC -injected group developed significantly larger tumors than miR-30e group (Fig.   5a). [score:1]
Meanwhile, the final tumor weight of miR-NC group was much heavier than miR-30e group (Fig.   5c). [score:1]
Firstly, luciferase reporter assay found that miR-30e directly recognized the 3′-UTR of IRS1 transcripts. [score:1]
Figure  3a shows that the 3′-UTR of IRS1 contained the binding site for the seed region of miR-30e. [score:1]
Cells were transfected with miR-30e or miR-NC according to the manufacturer’s instructions, and then cells were cultured to 95% confluence in 6-well plates. [score:1]
Furthermore, the therapeutic value of miR-30e in reducing cancer invasion, metastasis and chemoresistance should be further validated by independent cohorts and prospective trials. [score:1]
Lentivirus carrying miR-30e or negative control (miR-NC) was packaged using HEK293T cells following the manufacturer’s manual. [score:1]
To study the role of miR-30e in cancer carcinogenesis, stable cell lines were established (Fig.   2a). [score:1]
The miR-30e/IRS1 link may play a role in breast cancer as markers of metastasis and prognostic factors. [score:1]
Male BALB/cA nude mice were subcutaneously injected with 5 × 10 [6] MDA-MB-231 cells infected with lentiviruses harboring miR-NC or miR-30e. [score:1]
The luciferase activity of the reporter in the vector containing the IRS1 3′-UTR WT was significantly reduced by miR-30e, while the IRS1 3′-UTR MT exhibited an insignificantly affected luciferase activity (Fig.   3b). [score:1]
Cells were transfected with miR-30e followed by IRS1 transfection. [score:1]
Cells were seeded in a 24-well plate and co -transfected with the wild type or mutant reporter plasmid, pRL-TK plasmids, and miR-30e or miR-NC. [score:1]
[1 to 20 of 84 sentences]
3
[+] score: 275
miR-30s are abundant in podocytes and are downregulated by TGF-β in vitro and in vivo Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice. [score:15]
B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. Our previous bioinformatics analysis of the glomerular gene expression profiles of Dicer [fl/fl]:NPSH2-Cre mice revealed an enrichment of predicted miR-30 target genes among the upregulated genes [16], suggesting that miR-30s are expressed in podocytes/glomeruli and that their deficiencies due to Dicer deletion contributed to the gene expression changes observed in the podocytes/glomeruli of the mice. [score:14]
The important role of TGF-β in controlling epithelial plasticity by promoting epithelial-to-mesenchymal transition (EMT) is well-documented [34] and is dependent on the coordinated upregulation of miR-155 and the subsequent inhibition of its target, RhoA, and the downregulation of miR-30 in mouse mammary epithelial cells [35]. [score:11]
Together, these results suggest that among the various miRs regulated by TGF-β in kidney disease, the TGF-β -induced downregulation of miR-30 may regulate apoptosis -associated target genes and their associated apoptotic pathways. [score:10]
Overexpression of miR-30 induced, while miR-30 reduction inhibited, the apoptosis of BT-ICs cells through affecting target Itgb3 expression. [score:9]
In silico predictions of miR-30 targets and functionTo obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www. [score:9]
Among the 190 genes that are upregulated in the glomeruli of Dicer [fl/fl]:NPSH2-Cre mice, the predicted miR-30 targets were highly enriched, suggesting a role for miR-30 in the gene expression and homeostasis of podocytes [16]. [score:8]
These findings demonstrate that miR-30s are abundantly expressed in the podocytes and parietal epithelial cells of glomeruli, and TGF-β downregulates miR-30 expression in podocytes both in vivo and in vitro. [score:8]
Moreover, we examined the precursors of these miR-30s in these RNA samples by qPCR, and the result showed that they were also downregulated in the glomeruli of Alb-TGF-β mice (Figure S2), suggesting that TGF-β regulates miR-30 expression at the transcription level. [score:7]
To obtain a list of the most reliable miR-30 target genes, we retrieved the predicted targets that are evolutionarily conserved in mammals (including human, dog, mouse and rat) from three independent databases, TargetScan (http://www. [score:7]
Interestingly, miR-30 has recently been shown to target p53 directly in human cardiomyocytes, resulting in inhibition of Drp1 -mediated mitochondrial fission and apoptosis in response to oxidative stress [20]. [score:6]
Ongoing and future work will be needed to elucidate at the molecular level the mechanisms that mediate the concerted downregulation of all five miR-30 family members downstream of Smad2 and to determine how miR-30s inhibit the phosphorylation/activation of pro-apoptotic p53. [score:6]
However, the reported inhibitory mechanism of a direct miR-30-p53 target pairing differs from that observed in our results. [score:6]
In the current study, we report that miR-30s are expressed selectively and abundantly in glomerular podocytes in mice and that TGF-β profoundly downregulates miR-30 members in podocytes both in vivo and in vitro. [score:6]
We propose that the miR-30 family represents an attractive novel therapeutic target for the protection of podocytes in glomerular diseases, as our study demonstrated that maintenance of miR-30 levels above critical thresholds prevented podocyte apoptosis in the presence of TGF-β. [score:5]
Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A typical miR is predicted to target hundreds of genes based on the presence of its recognition motif(s) in the 3’ untranslated regions (UTRs) of the genes. [score:5]
Sustained expression of miR-30 inhibits TGF-β induced apoptosis of podocytes. [score:5]
Thus, because the miR-30-p53 target pairing is not evolutionarily conserved and is only observed in primate genomes, our findings provide an important, previously unknown alternative mechanism for the inhibition of p53 -mediated apoptosis by miR-30, at least in glomerular podocytes. [score:5]
File S1 Table S1, 155 miR-30 targets that are commonly predicted by TargetScan, PicTar, and miRbase, and conserved among human, dog, mouse and rat. [score:5]
There were 873 genes predicted to be miR-30 targets by TargetScan, 634 by PicTar, and 1,566 by miRbase. [score:5]
To determine whether a putative functional role of miR-30 could be predicted by in silico analysis of miR-30 target genes, we took a stringent approach and searched for potential miR-30 target genes that not only carry evolutionarily conserved miR-30 recognition motifs in their 3’-UTRs (Figure 2A) but also are consistently predicted by the three independent miR databases. [score:5]
uk/enright-srv/microcosm/htdocs/targets/), and then selected the common genes as our predicted miR-30 targets. [score:5]
miR-30 downregulation is required for activation of pro-apoptotic p53 by TGF-β. [score:4]
miR-30 precursors were downregulated in the glomeruli of Alb-TGF-β transgenic mice. [score:4]
Similarly, our results demonstrated for the first time that the concerted downregulation of all miR-30 members was specifically required for the activation of a central mediator of apoptosis, p53, by TGF-β. [score:4]
Downregulation of miR-30 members was required for TGF-β -induced apoptosis in visceral glomerular epithelial cells (podocytes). [score:4]
The finding that the TGF-β -induced downregulation of miR-30 may selectively promote apoptotic outcomes by permitting the activation of p53 expands our understanding of the emerging role of miRNAs in conferring biological specificity in cell type -dependent pluripotent TGF-β signaling networks. [score:4]
Bar graph shows the mean ± S. D. of the relative abundance of miR-30 members in podocytes untreated (white bars) and treated (black bars) with TGF-β for 1, 6, and 24 h. A. miR-30d transcripts were abundantly detected by in situ hybridization in podocytes (yellow arrows) and parietal epithelial cells (white arrows) in adult wildtype (wt) control mice, but not in Alb-TGF-β transgenic (Tg) mice; B. miR-30a, -30b, -30c, -30d, and -30e were significantly downregulated in cultured human podocytes after 6 and 24 hr of TGF-β treatment (5 ng/ml). [score:4]
Mechanistic studies demonstrated a novel and selective functional role for Smad2 -dependent downregulation of miR-30 in the TGF-β -mediated activation of pro-apoptotic p53, and this pathway was required for TGF-β -induced podocyte apoptosis. [score:4]
miR-30 downregulation by TGF-β is mediated by Smad2 -dependent signaling and does not require Smad3. [score:4]
These results suggest that Smad2 -dependent downregulation of miR-30 by TGF-β is required to specifically activate p53 signaling during podocyte apoptosis. [score:4]
TGF-β significantly downregulated levels of miR-30 members in wild-type podocytes and S3 KO podocytes (Figure 6B). [score:4]
In contrast, Smad2 -dependent signaling selectively downregulates miR-30 family transcripts to permit the activation of pro-apoptotic p53, which is required for caspase-3 activation and apoptosis. [score:4]
In contrast, TGF-β had no significant effect on miR-30 levels in S2 KO and D KO podocytes (Figure 6B), demonstrating that Smad2 mediates the TGF-β -induced downregulation of miR-30 in podocytes. [score:4]
B. Immunoblots show total p53 protein expression and GAPDH (loading control) in podocytes as described in A. The novel findings reported in our work connect for the first time the miR-30 family with the TGF-β/Smad signaling network. [score:3]
Thirty out of 116 (26%) of the annotated miR-30 target genes were associated with apoptosis (Figure 2C, Table S2 in File S1). [score:3]
To validate the in silico predictions experimentally, we generated luciferase reporter vectors containing 3’-UTRs with miR-30 recognition sequences from 7 of the predicted target genes. [score:3]
Our results suggest that a high estimated percentage (~ 86%) of the 155 genes could be experimentally validated as genuine targets of miR-30. [score:3]
Thus, we conclude that an essential miR-30 threshold exists in podocytes, above which miR-30s can suppress pro-apoptotic factors and promote cell survival. [score:3]
Among these genes, 155 were predicted to be miR-30 targets in all three databases and were conserved in human, dog, rat and mouse (Table S1 in File S1). [score:3]
B. Bar graph showing the mean ± S. D. of the activity of luciferase reporter constructs carrying 3’ UTR sequence fragments of seven genes randomly chosen from the 155 predicted miR-30 target genes. [score:3]
Lentiviral miR-30 expression sustains miR-30 levels in podocytes treated with TGF-β. [score:3]
Although the precise physiological roles of miR-30s remain poorly understood, miR-30 members may promote tumor invasion and metastasis by targeting Galphai2 in liver cancer cells [19]. [score:3]
In silico predictions of miR-30 targets and function. [score:3]
Table S2, List of cell death associated genes from the 155 predicted miR-30 targets according to analyses of Inguinity System. [score:3]
Apoptosis associated genes are highly enriched among the predicted miR-30 targets. [score:3]
Reporter constructs were cotransfected with either a scrambled miR expression construct (control) or a synthetic miR-30 precursor (pre-miR-30a). [score:3]
Functional annotations were available in the Ingenuity Pathway Analysis software for 116 of the 155 predicted miR-30 targets. [score:3]
Maintenance of sufficient miR-30 levels may provide a new therapeutic strategy to promote podocyte survival and prevent podocyte depletion in progressive glomerular diseases. [score:3]
However, Itgb3 is not expressed in podocytes (data not shown), precluding the involvement of miR-30-Itgb3 pair in podocyte apoptosis. [score:3]
Because we demonstrated that miR-30 was specifically controlled by Smad2, but not Smad3, therapeutic supplementation of miR-30 may provide an approach to target pro-apoptotic TGF-β activity without interfering with homeostatic Smad3- or Cd2ap -dependent activities. [score:3]
To investigate whether miR-30 downregulation by TGF-β had any role in podocyte apoptosis, one of the miR-30 family members, miR-30d, was studied as a representative member of the family. [score:2]
Finally, TGF-β treatment of human podocytes cultured under non-permissive or permissive conditions significantly reduced the levels of all five miR-30 family members beginning at 6 hrs, as determined by qRT-PCR (Figure 1B). [score:1]
A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line). [score:1]
The miR-30 family consists of 5 evolutionarily conserved members, miR-30a through -30e. [score:1]
For example, we demonstrated for the first time that to induce apoptosis in podocytes, TGF-β signaling must decrease protective miR-30 levels specifically through the Smad2 -dependent pathway, whereas Smad3 is not required. [score:1]
miR-30 quantification in the RNA samples was conducted by qRT-PCR using the Ncode miRNA Amplification System (Invitrogen, Carlsbad, CA). [score:1]
Indeed, therapeutic maintenance of miR-30 may protect epithelial cells, including podocytes, from multiple pro-apoptotic stressors, including TGF-β (this work) and oxidative stress and hypoxia [20]. [score:1]
In addition, miR-30 has been implicated in the epithelial-mesenchymal transition (EMT) or mesenchymal-epithelial transition (MET) via TGF-β signaling in anaplastic thyroid carcinomas [22]. [score:1]
Thus, it will be interesting to examine whether restoration of homeostatic miR-30 levels by therapeutic miR-30 replacement therapy will protect the survival of podocytes exposed to a range of common mediators of glomerular injury, including metabolic, mechanic, and toxic stressors. [score:1]
Moreover, we showed that sustaining miR-30 levels above this proposed threshold prevented both increases in protein and in phosphorylation of p53 in podocytes. [score:1]
0075572.g002 Figure 2 A. Alignment of the sequences of mature miR-30 family members with seed sequence motifs (indicated by a line). [score:1]
Note that at the age of 2 weeks the Alb-TGF-β mice had a ~ 20% podocyte loss according to our previous studies [8], which contributed to the miR-30 reduction in the glomeruli of Alb-TGF-β mice. [score:1]
Thus, we propose a novel pro-apoptotic TGF-β-Smad2-miR-30-p53 pathway that is necessary for caspase-3 activation and apoptosis in podocytes (Figure 8). [score:1]
[1 to 20 of 64 sentences]
4
[+] score: 272
This observation also raises the intriguing possibility that miR-30 mediated regulation of the miRNA pathway is a mechanism not specific to muscle cells, but rather a mechanism in all cells expressing miR-30 to antagonize the expression of all miRNA-regulated targets. [score:9]
To identify direct miR-30 family targets, we first utilized TargetScan 6.2 [20] to identify predicted targets. [score:8]
To determine whether modulating miR-30 family miRNA levels affects miRNA repression, we tested the ability of muscle-specific miR-206 to repress a known target, cyclin D1 (Ccnd1)[31], during miR-30 family over -expression or inhibition. [score:7]
Putative direct miR-30 family targets include epigenetic, transcriptional, and post-transcriptional regulators of gene expression. [score:7]
If miR-30 directly regulates the expression of these candidates at the mRNA level, one could expect de-repression in mdx4cv muscles where miR-30 family expression is reduced. [score:7]
Transcriptional, post-transcriptional and epigenetic regulation of gene expression are the most highly enriched GO terms in the set of predicted miR-30 family targets. [score:6]
While no change was observed for Nfyb and Ppargc1a, we found that Runx1, Smarcd2, and Tnrc6a were increased in their expression in the gastrocnemius muscles and that Snai2 trended towards an increase (P = 0.07) (Fig. 6C), indicating that these may be direct miR-30 targets. [score:6]
As expected, over -expression of miR-30a/b/c de-repressed Ccnd1 luciferase reporter activity (Fig. 7A), and miR-30 family inhibition enhanced Ccnd1 repression by miR-206 (Fig. 7B), showing that miR-30 family miRNAs can negatively regulate the activity of other miRNAs. [score:6]
miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animalsIn order to identify miRNAs that are dysregulated during muscle pathogenesis, we hypothesized that, as dystrophic muscle is undergoing constant cycles of degeneration/regeneration, miRNAs differentially expressed between dystrophic and healthy muscle may represent novel biomarkers of muscle homeostasis. [score:6]
Given these dynamic expression changes during adult myogenesis in vitro, changes in miR-30 family expression could also be expected during developmental myogenesis. [score:6]
Note miR-206 and miR-21 (red, overexpressed in mdx4cv) and miR-30 family (green, down-regulated in mdx4cv). [score:6]
When sorted for P-value, the functionally annotated biological processes that are most enriched in the list of predicted miR-30 family targets include the regulation of transcription, gene expression, and macromolecule synthesis (Fig. 6A). [score:6]
To narrow the candidate target list as well as gain insight into the biological processes and pathways that may be regulated by the miR-30 family, we took the 1133 predicted targets and performed gene ontology (GO) analysis using the Database for Annotation, Visualization and Integrated Discovery (DAVID) [21]. [score:6]
If miR-30 family miRNAs control miRNA repression by targeting Tnrc6a, we could expect that high levels of miR-30 would repress Tnrc6a levels resulting in global de-repression of miRNA targets and increased protein synthesis. [score:5]
Given our observed decrease in miR-30 family expression in a pathological setting of constant degeneration/regeneration (mdx4cv), we wanted to examine miR-30 family expression in other mo dels of skeletal muscle pathology, including regeneration after acute injury and muscle disuse atrophy. [score:5]
Numerous functions have been described for the miR-30 family, including regulation of fibrosis, apoptosis, and hypertrophy in cardiomyocytes [32– 34], regulation of pronephros development in the kidneys [35], as well as the regulation of the epithelial-to-mesenchymal transition in hepatocytes [36]. [score:5]
Additionally, miR-30 family miRNAs provide negative feedback on the miRNA pathway by targeting TNRC6A, leading to derepressed miRNA targets and increased protein synthesis. [score:5]
While smoothened is not predicted to be a conserved miR-30 family target in mice, the possibility exits that miR-30 family miRNAs play a critical role in the regulation of embryonic muscle development and fiber type specification. [score:5]
While others have identified Tnrc6a as a miR-30 family target [46], we are the first to show that miR-30 expression modulates the activity of other miRNAs and levels of protein synthesis. [score:5]
’ Therefore, by repressing the set of miR-30 targets present in the given cellular milieu while at the same time reducing the extent of other miRNA -mediated repression, miR-30 family can repress a current gene expression pattern and pave the way for a change in cellular state (Fig. 8). [score:5]
Following withdrawal of serum from the medium, we observed increases in miR-30a-5p (∼1.5 fold), miR-30b (∼2 fold) and miR-30c (∼2 fold) expression as differentiation progressed (Fig. 4A), indicating that the miR-30 family is expressed in myoblasts. [score:5]
To test if the reduction in miR-30 family miRNA expression found in dystrophic, injured and atrophic muscle correlates with expression changes in myoblasts, we measured miR-30a/b/c expression during C [2]C [12] myoblast differentiation in vitro. [score:5]
0118229.g006 Fig 6 (A) GO analysis of predicted miR-30 targets (TargetScan 6.2) is shown sorted by P-value for enriched biological processes. [score:5]
Interestingly, we found that inhibition of Tnrc6a expression by miR-30 family miRNAs reduces the activity of muscle-enriched miR-206, indicating that the miR-30 family constitutes a negative feedback mechanism on the miRNA pathway. [score:5]
0118229.g008 Fig 8 To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis. [score:4]
Tnrc6a, Smarcd2, and Snai2 are regulated by miR-30a/b/cTo validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture. [score:4]
Indeed, after normalizing to protein content, we found a significant ∼2-fold increase (P ≤ 0.05) in [3]H-tyrosine incorporation in miR-30b/d over -expressing myotubes when compared to controls (Fig. 7C), indicating that miR-30 family miRNAs promote high levels of protein synthesis, likely through de-repression of miRNA targets. [score:4]
To promote a myogenic gene program, miR-30 family miRNAs repress the expression of SNAI2 and SMARCD2, both negative regulators of myogenesis. [score:4]
In addition, we identify the chromatin remo deling component Smarcd2, the transcriptional repressor Snai2 and the miRNA pathway component Tnrc6a as direct miR-30 targets. [score:4]
The miR-30 family miRNAs belong to the same seed family and thus share identical seed sequences (S1 Fig. ) and likely regulate an overlapping set of targets. [score:4]
Through in vitro experiments and bioinformatic analysis, we have proposed a novel mechanism whereby miR-30 promotes the differentiation of myoblasts by both restricting the expression of Smarcd2 and Snai2 (both negative regulators of the myogenic gene program), as well as by antagonizing the miRNA pathway through repression of Tnrc6a. [score:4]
In zebrafish, Ketley et al. recently showed that the miR-30 family promotes a fast muscle phenotype during embryonic muscle development and that inhibition of the miR-30 family in zebrafish embryos increased the percentage of slow fibers [37]. [score:4]
After injury, miR-30 family expression is reduced and reaches a minimum on day 3 post-injury (∼4–5 fold reduction in miR-30a/b/c) (Fig. 3A) corresponding to a time point at which the muscle is largely degenerating (S3 Fig. ), indicating a correlation between low miR-30a/b/c levels and muscle degeneration. [score:3]
Human miR-30 family expression. [score:3]
miR-30 regulates miRNA -mediated post-transcriptional regulation and protein synthesis. [score:3]
Here we show that the expression of miR-30 family miRNAs is dynamic in skeletal muscle pathologies, with low miR-30 being correlated with degeneration and muscle mass loss, and high miR-30 associated with myogenesis and protein synthesis. [score:3]
Identifying the cell-type specific expression pattern of the miR-30 family in WT and mdx4cv animals will be necessary to ascertain the pathogenic role of the miR-30 family. [score:3]
Notably, little has been published about the expression and role of the miR-30 family in skeletal muscle. [score:3]
miR-30 family target identification and validation. [score:3]
By deep sequencing small RNAs from wild-type C57Bl/6 (WT) and dystrophic mdx4cv gastrocnemius muscles, we found the miR-30 family miRNAs to be coordinately down-regulated when compared to WT. [score:3]
miR-30 family miRNAs promote a myogenic program in vitro To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts. [score:3]
Our results indicate that expression of the miR-30 family miRNAs is perturbed during alterations in muscle homeostasis in vivo, and that the miR-30 family miRNAs promote myoblast terminal differentiation and restrict proliferation in vitro. [score:3]
To gain insight into whether increased miR-30 family miRNA expression promotes or is merely correlated with myogenesis, we performed gain-of-function experiments in C [2]C [12] myoblasts. [score:3]
While these findings are in agreement with our observations of miR-30 family effects on proliferation and differentiation in vitro, we were unable to assess the expression pattern and function of miR-30 family members in non-muscle cell types in vivo. [score:3]
Another outcome of this hypothesis would be a general increase in protein synthesis in the presence of high miR-30 family miRNA levels, mediated by the de-repression of miRNA targets. [score:3]
We thus wondered whether ectopic miR-30 family miRNA expression could decrease the proportion of proliferating cells. [score:3]
In comparison to a scrambled pre-miR control at equivalent concentrations, EdU incorporation was reduced dose -dependently by 10% and 15% (P ≤ 0.05) in 10nM and 50nM transfected cells, respectively (Fig. 5C), indicating that high miR-30 family expression reduces the proportion of proliferating myoblasts in vitro. [score:3]
miRNA sequencing reveals reduced miR-30 family expression in mdx4cv animals. [score:3]
We also show that miR-30 family expression is reduced in acute pathological conditions including BaCl [2] -induced injury and disuse atrophy. [score:3]
To test if the inverse is true, we utilized chemically modified, antisense oligonucleotides to inhibit miR-30 family function. [score:3]
In agreement with this argument, the validated miR-30 targets include the epigenetic SWI/SNF component Smarcd2, the transcription factor Snai2, and the post-transcriptional miRNA pathway component Tnrc6a. [score:3]
To validate direct regulation of Runx1, Smarcd2, Snai2, and Tnrc6a by miR-30a/b/c, we cloned the full length 3’-UTRs containing miR-30 target sites from C [2]C [12] genomic DNA and inserted the fragments downstream of the Renilla luciferase coding sequence in psiCHECK-2. We then transfected these constructs into C [2]C [12] cells along with synthetic pre-miR-30a/b/c or control pre-miR, and measured the luciferase signal following 24 hours in culture. [score:3]
validation of reduced miR-30 family miRNA expression. [score:3]
Given that fast twitch fiber-types are preferentially affected in DMD [38], it is tempting to speculate that the decrease in miR-30 family expression in mdx4cv muscle is a compensatory mechanism to promote an increase in slow-twitch, fatigue resistant fiber types. [score:3]
To further sort these candidates, we measured the expression levels of their mRNAs in mdx4cv skeletal muscles by, including Galnt7 as a positive control miR-30 target [28]. [score:3]
Interestingly, we also found that the normalized read counts for the entire miR-30 family were strikingly reduced in mdx4cv animals (Fig. 1B), and that the miR-30 family is the 5th most highly expressed miRNA family in skeletal muscle (Fig. 1C). [score:3]
Given the high abundance in skeletal muscle and differential expression, we decided to further investigate the expression and function of miR-30 family miRNAs in mammalian skeletal muscle. [score:3]
miR-30 family expression displayed relative to 15.5 dpc miR-30a-5p levels. [score:3]
In conclusion, we present a miRNA-seq dataset identifying a reduction in miR-30 family miRNA expression in dystrophic mdx4cv skeletal muscles. [score:3]
In another recent publication, Soleimani et al. proposed that miR-30 -mediated regulation of the transcriptional repressor SNAI1 facilitates entry into the myogenic gene program and promotes differentiation of primary mouse myoblasts [26]. [score:2]
miR-30 regulates miRNA -mediated repression and protein synthesis. [score:2]
Many of the studies published on various miR-30 family functions indeed report the regulation of transcription factors [26, 33, 35, 39, 40], indicating that the generalized function of miR-30 may be to control the switch from one cellular state (i. e. proliferating, differentiating, quiescent, etc. ) [score:2]
While the miR-30 family includes 5 mature miRNAs (miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e [NCBI: NR_029533, NR_029534, NR_029716, NR_029718, NR_029602]), for this study we have focused on miR-30a-5p, miR-30b and miR-30c (“miR-30a/b/c”) due to sequence similarity of miR-30a-5p, miR-30d and miR-30e (differing by only one nucleotide each) (S1 Fig. ). [score:1]
Twenty-four hours after transfection, quantification of myogenin -positive (MYOG+) nuclei indicated a striking 65% increase (P = 5e-5)(Fig. 5A), indicating that the miR-30 family promotes terminal differentiation of myoblasts in vitro. [score:1]
As indicated by the percentage of MyHC+ area, 24 hours following transfection antimiR-30 restricted the differentiation of C [2]C [12] myoblasts (Fig. 5B), again indicating that miR-30 family miRNAs promote myoblast differentiation. [score:1]
S1 Fig (A) Alignment of miR-30a-5p, miR-30b, miR-30c, miR-30d and miR-30e shows conserved positions in bold and positions differing from miR-30a-5p in red. [score:1]
miR-30 family miRNAs promote a myogenic program in vitro. [score:1]
miRNA-seq reveals reduced miR-30 family miRNAs in mdx4cv muscles. [score:1]
Accordingly, we first performed barium chloride injury in the gastrocnemius muscles of WT animals to test regeneration after injury in vivo and measured miR-30 family expression on 1, 3, 7 and 14 days post-injury (DPI) in comparison to uninjured contralateral controls. [score:1]
This reduction was least pronounced in the slow-twitch soleus muscle, where baseline miR-30 levels are lower than in the gastrocnemius and TA muscles (S2 Fig. ). [score:1]
Sequence and organization of miR-30 family miRNAs. [score:1]
Mo del for miR-30 family mechanism of action. [score:1]
After reaching a minimum on day 3 post-injury (DPI), miR-30 levels begin to return towards uninjured levels on days 7 and 14. [score:1]
To this end we transfected proliferating C [2]C [12] with a representative synthetic miR-30 family member, miR-30a-5p, then performed 5-ethynyl-2’-deoxyuridine (EdU) proliferation analysis. [score:1]
[1 to 20 of 74 sentences]
5
[+] score: 222
Similarly, western blotting showed that upregulation of miR-30e could inhibit MPTP -induced decrease of TH protein expression. [score:8]
Intriguing, although MPTP -induced α-syn expression was inhibited by miR-30e agomir, we found that the luciferase activity of α-syn was not affected by miR-30e (data not shown), suggesting α-syn is not the direct target of miR-30e. [score:8]
In conclusion, our study demonstrates that miR-30e negatively regulates Nlrp3 expression, which in turn attenuates neuroinflammation in SNpc of PD mice through inhibiting Nlrp3 inflammasome activity. [score:6]
However, miR-30e upregulation abolished MPTP -induced increase of Nlrp3, ASC and Caspase-1 expressions (Fig.   7a, b). [score:6]
Furthermore, considering the critical role of Nlrp3 inflammasome in the development of neurodegenerative diseases [6, 12, 13], our study also indicate that miR-30e induces neuron regeneration at least partially via inhibition Nlrp3 inflammasome -mediated inflammation. [score:6]
We provide convinced evidence that miR-30e improves neuronal damage, neuroinflammaiton and dyskinesia via negatively regulating Nlrp3 expression and inhibiting NLRP3 inflammasome activation in MPTP -induced PD mice mo del. [score:6]
Parkinson’s disease Neuroinflammation Neurodegeneration Nlrp3 inflammasome miR-30e Parkinson’s disease (PD) is the second only to Alzheimer’s disease (AD) as the most common neurodegenerative movement disorder, which is characterized with progressive loss of dopaminergic neurons in the substantia nigra pars compacta (SNpc) and accumulation of α-synuclein (α-syn) in Lewy bodies [1, 2]. [score:5]
The luciferase assay indicated that miR-30e targeted the 3′UTR region of Nlrp3 to negatively regulate Nlrp3 mRNA and protein expression. [score:5]
These data suggest that the activation of Nlrp3 inflammasome may contribute to MPTP -induced neuroinflammation in SNpc, whereas miR-30e inhibits this process by targeting Nlrp3. [score:5]
Moreover, we found that MPTP increased α-syn expression, whereas miR-30e agomir treatment was associated with decreased α-syn expression (Fig.   4c, d). [score:5]
Here, we demonstrated that miR-30e overexpression could effectively attenuate MPTP -induced the increase of α-syn expression in SNpc. [score:5]
showed that miR-30e overexpression effectively decreased the protein expression of Nlrp3 (Fig.   6d). [score:5]
We also determined the effect of miR-30e upregulation on dopaminergic neuronal loss in SNpc of MPTP-PD mice. [score:4]
Furthermore, miR-30e directly targeted to Nlrp3, which in turn mediated Nlrp3 inflammsome activity and inflammation. [score:4]
In the present study, we investigated the alteration of miR-30e in SNpc by qRT-PCR and the results showed that the expression of miR-30e was downregulated gradually after MPTP injection, suggesting miR-30 might also have a role in the pathogenesis of PD. [score:4]
Finally, MPTP significantly increased the time required for the mouse to cross the beam, whereas miR-30e upregulation decreased the latency time on the beam at 3rd and 7th days after the first miR-30e agomir treatment (Fig.   3d). [score:4]
The results showed that miR-30e upregulation almost abolished the increase of TNF-α, COX-2 and iNOS secretion. [score:4]
control, n = 6 Because of the crucial role of miR-30e in regulating Nlrp3 expression, we determined whether miR-30e controls the activity of Nlrp3 inflammasome in SNpc of MPTP-PD mice. [score:4]
Expectedly, the expression of miR-30e in SNpc was markedly higher in miR-30e agomir -treated mice than in negative control -treated mice at 21 days after the first MPTP injection (Fig.   2a). [score:3]
We also detected the effect of miR-30e mimics on endogenous Nlrp3 protein expression. [score:3]
The mRNA expression of miR-30e in SNpc was determined by qRT-PCR. [score:3]
b MiR-30e upregulation attenuated the decrease of body weight in MPTP-PD mice. [score:3]
Moreover, the elevation of IL-18 and IL-1β secretions was markedly inhibited in MPTP -induced PD mice treated with miR-30e agomir (Fig.   7c, d). [score:3]
At 3, 7, 10 and 14 days after the first MPTP injection, miR-30e expression was reduced to 0.91 ± 0.08-fold, 0.84 ± 0.07-fold, 0.61 ± 0.07, and 0.53 ± 0.06-fold of saline -treated mice, respectively (Fig.   1). [score:3]
For overexpression of miR-30e in BV-2 cells, the cells were transfected with miR-30 mimics or negative control miRNA using Lipofectamine 2000 according to the manufacturer’s protocol. [score:3]
MiR-30e was downregulated in SNpc of MPTP-PD mice mo del. [score:3]
These findings indicate that targeting miR-30e by a genetic approach may provide a novel strategy for the treatment of PD. [score:3]
Immunohistochemistry and western blotting analysis for TH expression revealed that the loss of dopamine neuron in PD mice was dramatically less pronounced after miR-30e agomir delivery. [score:3]
MPTP, n = 5 mice in each group First, we examined the expression of miR-30e in SNpc of MPTP -treated mice by qRT-PCR. [score:3]
In the current study, we demonstrated for the first time that Nlrp3 was a potential target of miR-30e. [score:3]
The mRNA expression of miR-30e in SNpc was detected by qRT-PCR. [score:3]
Collectively, these data suggest that miR-30e overexpression can effectively improve the dyskinesia in PD mice mo del. [score:3]
When we co -transfected BV-2 cells with miR-30e mimics and wild-type or mutant Nlrp3 3′UTR reporter, luciferase assay showed that miR-30e overexpression significantly decreased the luciferase activity of wild-type Nlrp3 3′UTR reporter but not in the mutant one (Fig.   6b), suggesting that miR-30e directly binds the mRNA encoding Nlrp3. [score:3]
MiR-30e upregulation improved the dyskinesia induced by MPTP. [score:3]
Nlrp3 is a target gene of miR-30e. [score:3]
org/), we found that Nlrp3 was predicated as a putative target with a conserved miR-30e binding sites in its 3′UTR (Fig.   6a). [score:3]
In consistence, transfection with miR-30e mimics dose -dependently decreased Nlrp3 mRNA expression (Fig.   6c). [score:3]
However, miR-30e treatment markedly suppressed the secretion of these inflammatory mediators induced by MPTP (Fig.   5a–c). [score:3]
First, we examined the expression of miR-30e in SNpc of MPTP -treated mice by qRT-PCR. [score:3]
The results showed that the expression of miR-30e was significantly decreased after intraperitoneal injection of MPTP. [score:3]
showed that total locomotor activity was markedly increased at 1st, 3rd and 7th days after the last MPTP injection, which was significantly inhibited at 3rd and 7th days after the first miR-30e agomir treatment (Fig.   3b). [score:3]
MiR-30e agomir treatment was associated with decreased expression of the above genes (Figure S3 A–E). [score:3]
c BV-2 cells were transfected with different concentrations of miR-30e mimics (5, 10, 20 or 40 nmol/L) for 48 h. Nlrp3 mRNA expression was determined by qRT-PCR. [score:3]
Finally, we explored the mechanisms by which miR-30e inhibited neuroinflammation in SNpc of PD mice. [score:3]
Fig.  1Decreased expression of miR-30e in SNpc after MPTP injection. [score:3]
MPTP, n = 6 mice in each group To explore the mechanisms underlying the neuroprotective effect of miR-30e, we analyzed the potential targets predicted for miR-30e. [score:3]
Consistent with the protein expressions in SNpc, the mRNA levels of the Nlrp3 inflammasome were also decreased after miR-30e agomir treatment. [score:3]
MiR-30e suppressed Nlrp3 inflammasome activation in SNpc of MPTP-PD mice. [score:2]
MiR-30e attenuated dopaminergic neuronal loss and α-syn expression in SNpc of MPTP-PD mice. [score:2]
Although miR-30e has been shown to be involved in the regulation of glioma cells differentiation and invasion [25, 26], the exact role of miR-30e in PD has not been shown previously. [score:2]
Furthermore, we investigated whether miR-30e upregulation improves motor function through protecting against MPTP -induced neuronal damage. [score:2]
The binding of miR-30e to the target gene Nlrp3 was assayed by luciferase experiment. [score:2]
a– d Effect of miR-30e restoration on rota-rod test (a), pole test (b), traction test (c), and beam-crossing task (d) at 1, 3 and 7 days after the first miR-30e agomir treatment, respectively. [score:1]
These results suggest that miR-30e protects against MPTP -induced neuronal damage and dopaminergic neuronal loss. [score:1]
Effect of miR-30e agomir on body weight in MPTP-administrated mice. [score:1]
5 μL of saline containing 20 nmol/L of miR-30e agomir or a scramble sequence control miRNA (negative control) was injected through the catheter per day for 7 consecutive days. [score:1]
However, miR-30e agomir delivery time -dependently increased the limb movements scored (Fig.   3c). [score:1]
Fig.  4Exogenous delivery of miR-30e agomir protected against neuronal damage and dopaminergic neuronal loss in MPTP -induced PD mice mo del. [score:1]
showed that restoration of miR-30e in PD mice could increase the neuronal activity. [score:1]
These results indicate that miR-30e can protect against neuronal injury in MPTP -induced PD mice mo del. [score:1]
In our study, we found that exogenous delivery of miR-30e ameliorated neuronal injury, neuroinflammaiton and dyskinesia in MPTP -induced PD mice. [score:1]
d analysis of Nlrp3 in BV-2 cells transfected with miR-30e mimics or negative control. [score:1]
MPTP, n = 12–16 mice in each group To confirm the effect of miR-30e on neuronal activity, nissl staining was used to detect the level of nissl substance in SNpc. [score:1]
MPTP, n = 5 mice in each group This study uncovers a link between miR-30e and Nlrp3 inflammasome -mediated neuroinflammation in the pathogenesis of PD. [score:1]
a Alignment of miR-30e binding site to Nlrp3 3′UTR was shown. [score:1]
In this study, we found that the reduction of BNDF secretion in SNpc was markedly reversed by miR-30e agomir treatment. [score:1]
MPTP, n = 6–8 mice in each group Since that α-syn -induced neuroinflammaiton has an important role in the pathogenesis of PD [19], we next detected the effect of miR-30e on inflammation in SNpc tissues. [score:1]
The schematic diagram of miR-30e administration is illustrated in Figure S1. [score:1]
Fig.  5Effect MiR-30e agomir on inflammatory markers and BDNF levels in MPTP-PD mice. [score:1]
MPTP resulted in a significant decrease in the number of TH -positive cells, and treatment with miR-30e markedly attenuated this TH loss in SNpc (Fig.   4b). [score:1]
However, delivery of miR-30e agomir in midbrain effectively prolonged the duration time of mice on rotating-stick, decreased the latency to cross straight run way on narrow beam, and increased the grasping force as well as the rate of climbing pole. [score:1]
In vitro miR-30e mimics transfection. [score:1]
However, miR-30e agomir significantly improved body weight on day 21 in MPTP-administrated mice (Fig.   2b). [score:1]
However, miR-30e restoration abolished the above elevations. [score:1]
saline, n = 6 mice in each group To investigate the role of miR-30e in MPTP-PD mice, miR-30e agomir or negative control was injected into the right lateral ventricle of MPTP-PD mice to restore the expression of miR-30e. [score:1]
MiR-30e agomir, miR-30e mimics, and corresponding negative control miRNA were obtained from GenePharm (Shanghai, China). [score:1]
For the delivery of miR-30e in MPTP mice, a stereotactic catheter was surgically implanted into the right lateral ventricle of mice (Bregma: −2 mm, Lateral: 2 mm, Dorsoventral: 3 mm). [score:1]
However, treatment with miR-30e agomir for 3 and 7 days showed significant improvement in rota-rod activity (Fig.   3a). [score:1]
Considering that α-syn-triggered neuroinflammation has an important in the pathogenesis of PD [6], we also examined the effect of miR-30e on inflammatory cytokines secretion in SNpc. [score:1]
Animal mo del and miR-30e agomir delivery. [score:1]
Fig.  2Effect of miR-30e on body weight in MPTP-administrated mice. [score:1]
However, treatment with miR-30e agomir significantly restored the loss of nissl substance (Fig.   4a). [score:1]
In addition, the level of BDNF was significantly lower in the MPTP group than in saline group, and miR-30e agomir treatment could restore the decrease of BDNF level (Fig.   5d). [score:1]
[1 to 20 of 83 sentences]
6
[+] score: 199
Radiation downregulated Mcl-1 and enhanced Bax expression in non- or CT-miR transfected samples, whereas transfection of miR30 -inhibitor maintained Mcl-1 protein levels and suppressed Bax expression in CD34+ cells 24 and 48 h after irradiation. [score:12]
The effect of miR-30 occurred only when both miR-30 and its target sequence were present; suggesting that miR-30 directly inhibits the expression of Mcl-1 through binding to its target sequence in Mcl-1gene. [score:10]
shown in Fig.   6a demonstrate that transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitor suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
Forty-eight h after pre-miR-30 transfection, the level of Mcl-1 expression in CD34+ cells was inhibited significantly, whereas no Mcl-1 downregulation was shown in control- or miR-30 -inhibitor transfected samples compared with non-transfection control (Fig.   6c). [score:9]
a Transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitors suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
We previously reported that radiation upregulated miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30 played a key role in radiation -induced human hematopoietic and their niche osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) and inducing apoptosis in these cells. [score:9]
Furthermore, we found putative miR-30 binding sites in the 3′UTR of Mcl-1 mRNA (Fig.   5b) and demonstrated for the first time that miR-30 directly inhibits the expression of Mcl-1 by binding to its target sequences (Fig.   7c, d). [score:8]
Levels of Mcl-1 expression in CD34+ cells were significantly inhibited 48 h after pre-miR-30 transfection, whereas Bcl-2 was not impacted by miR-30 overexpression in these cells. [score:7]
Transfection of miR-30 inhibitor significantly protected Mcl-1 from radiation -mediated downregulation and maintained the Mcl-1 levels as in sham-irradiated CD34+ cells. [score:6]
To answer this question, we analyzed potential targets of miR-30 family members using the miRNA target prediction database RNAhybrid 2.2 (http://bibiserv. [score:5]
The cells were exposed to different doses of γ-radiation at 24 h after non-transfection, miR-control, or miR-30 inhibitor transfection, and Mcl-1 and Bcl-2 protein expressions were tested by western blot in samples collected at 24 h (48 h post-transfection) and 48 h (72 h post- transfection) after irradiation. [score:5]
As expected, Bcl-2 expression was not changed by radiation nor miR-30 inhibition in CD34+ cells. [score:5]
Thus, our data from the current study suggest an important downstream target of miR-30 in irradiated hematopoietic cells is Mcl-1, and miR-30 is responsible for radiation -induced apoptosis in mouse and human hematopoietic cells through targeting the antiapoptotic factor Mcl-1. The authors declare no conflict of interest. [score:5]
However, when the mir-30 target site from the Mcl-1 3′UTR is inserted into the luciferase construct (pMIR-hMcl-1), expression of luciferase is strongly decreased when cotransfected with pre-miR-30. [score:5]
In this study, expression of miR-30b and miR-30c was determined in mouse serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation, since miR-30 levels in serum were parallel to expression in BM after radiation [15]. [score:5]
Radioprotector delta-tocotrienol suppressed miR-30 expression in mouse serum and cells and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [14, 15]. [score:5]
Radiation -induced Mcl-1 downregulation was miRNA-30 dependent. [score:4]
Western blot assays were used to test Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells as shown in Fig.   6b. [score:4]
In addition, radiation -induced Bax expression was completely blocked by knockdown of miR-30 in CD34+ cells. [score:4]
Antiapoptosis factor Bcl-2 was not impacted by miR-30 overexpression in these cells (Fig.   6b, c). [score:3]
The putative miR-30 binding sites were predicted using target prediction programs RNAhybrid 2.2 [21]. [score:3]
b Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells were evaluated by immunoblotting 24 and 48 h after transfection. [score:3]
Delta-tocotrienol (DT3), a radioprotector, suppressed miR-30 and protected mice and human CD34+ cells from radiation exposure [15]. [score:3]
de/rnahybrid/) [21], and found that members of the miR-30 family were predicted to target the antiapoptosis factor Mcl-1. Figure  5b shows putative binding sites for miR-30b and miR-30c in the 3′UTR of the Mcl- 1 gene. [score:3]
Recently, we further reported that miR-30 expression in mouse BM, liver, jejunum and serum was initiated by radiation -induced proinflammatory factor IL-1β and NFkB activation. [score:3]
irradiated We previously reported that miR-30 played a key role in radiation -induced human CD34+ and osteoblast cell damage through an apoptotic pathway [14], and a radiation countermeasure candidate, delta-tocotrienol (DT3), suppressed radiation -induced miR-30 expression in mouse BM, liver, jejunum and serum, and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [15]. [score:3]
However the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cell damage are not well understood. [score:3]
Pre-miR30, miR30 inhibitor (si-miR30), or control miR (CT-miR) molecules were transfected into CD34+ cells. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
Pre-miR30 (PM11060), miR30 -inhibitor (AM11060) or control-miRNA were purchased from Thermo Fisher Scientific (Grand Island, NY) and transfected into CD34+ cells using the Lipofectamine RNAiMAX (Cat# 13778-075, Invitrogen) according to the manufacturer’s protocol discussed in our previous report [14]. [score:3]
d The firefly luciferase p-MIR-report vector (pMIR) as a control, p-MIR-report vector with Mcl-1 3′UTR (pMIR-hMcl-1), and p-MIR-report vector with mutant 3′UTR (pMIR-MUT) were transiently transfected or cotransfected with an expression plasmid for pre-mir-30 into human CD34+ cells. [score:3]
As shown in Fig.   7d, cotransfection of CD34+ cells with the parental firefly luciferase reporter construct (pMIR-vector control) plus the pre-mir-30 does not significantly change the expression of the reporter. [score:3]
CD34+ cells were transfected with miR-30 inhibitor, precursors (pre-miR30) or control-miR from Life Technologies Co. [score:3]
However, the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cells damage are not well understood. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
In contrast, Bcl-2 expression was not affected by miR-30 in these cells. [score:3]
Knockdown of miR-30 blocked radiation -induced Mcl-1 reduction in CD34+ cells. [score:2]
In the current study as shown in Fig.   7a and b, we further demonstrated that knockdown of miR-30 before irradiation in human CD34+ cells blocked radiation -induced reduction of Mcl-1, and the proapoptotic factor Bax was no longer increased by radiation. [score:2]
In this study, we extend our findings using human hematopoietic stem and progenitor CD34+ cells and an in vivo mouse mo del, to explore the effects and mechanisms of miR-30 on regulation of apoptotic cell death signaling in hematopoietic cells after γ-radiation. [score:2]
A mutation was generated on the Mcl-1 3′-UTR sequence in the complementary site and the 5′end seed region of miR-30, as indicated. [score:2]
Previously we reported that knockdown of miR-30 before irradiation significantly increased clonogenicity in irradiated human CD34+ cells [14]. [score:2]
Luciferase activity in CD34+ cells transfected with pMIR alone, or pre-miRNA-30 precursor cotransfected with pMIR-control, pMIR-hMcl-13′UTR, or pMIR-MUT 3′UTR is shown. [score:1]
β-actin were measured in different treatment groups We next examined the effects of miR-30 on Mcl-1 expression in CD34+ cells after radiation. [score:1]
c Two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329–1351 and 1584–1602 nt) and the alignment of miR-30 with the 3′UTR insert are illustrated. [score:1]
NM_021960) containing two putative miR-30 binding sites (1329–1351 and 1584–1602 nt) or a corresponding multi-base mutant sequence was cloned into the SacI and HindIII sites downstream of the firefly luciferase reporter gene in pMIR-REPORT Luciferase (Ambion, Austin, TX, USA) by BioInnovatise, Inc. [score:1]
There are two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329-1351 and 1584–1602 nt, with the 5′ end of the miR-30 seed sequence in the latter) and the alignment of miR-30 with the 3′UTR insert is illustrated in Fig.   7c. [score:1]
The Pre-miRNA-30 Precursor was co -transfected where indicated in Fig.   7d. [score:1]
The firefly luciferase -report vector plasmid (p-MIR, Ambion, Austin, TX, USA) was modified by insertion of the Mcl-1-derived mir-30 binding sites or a multi-base mutant into the 3′UTR. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shownWe further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
The Ambion pre-miR-30 precursors were co -transfected with pMIR-report, pMIR-hMcl-1-WT, or pMIR-hMcl-1-MUT plasmid. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shown We further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
Our previous studies suggested miR-30 is an apoptosis inducer in mouse and human hematopoietic cells. [score:1]
Our results from both in vitro and in vivo studies suggested miR-30 is an apoptosis inducer after radiation exposure. [score:1]
[1 to 20 of 53 sentences]
7
[+] score: 198
The horizontal dashed line shows p = 0.05, and vertical dashed lines indicate FC = −1.5 and 1.5. e, results of miRhub analysis to test for enrichment of predicted miR-30 target sites in significantly up-regulated (purple) and down-regulated (green) genes at each time point. [score:9]
We found that both highly conserved and species-specific predicted miR-30 targets sites were significantly enriched (p < 0.05) in genes up-regulated at both 48 and 72 h post-transfection, but as expected not in down-regulated genes (Fig. 4 e). [score:9]
To identify genes that might act as post-translational regulators of SOX9 protein in response to LNA30bcd treatment, we performed Gene Ontology Molecular Function enrichment analysis (40, 41) using Enrichr (42) on genes with predicted miR-30 target sites that were significantly up-regulated (FC > 1.5 and FDR < 0.05) relative to mock treated cells at each time point (see supplemental Table S2 for gene lists). [score:9]
Moreover, UBE3A does have a predicted miR-30 target site and is up-regulated in LNA30bcd -treated HIECS. [score:6]
Knockdown of miR-30 in Vitro in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 ProteinTo evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:6]
We performed next generation high throughput RNA sequencing and found that up-regulated genes with predicted miR-30 target sites were most significantly enriched for ubiquitin ligases. [score:6]
We hypothesized that the opposite effect of miR-30 inhibition on SOX9 mRNA and protein levels could be due to miR-30 -mediated regulation of factors that modify SOX9 protein stability without affecting SOX9 RNA levels, such as post-translational modifiers (Fig. 2 e). [score:6]
” Ubiquitin ligase -mediated regulation of SOX9 has been shown previously in chondrocytes (43) and therefore is consistent with our hypothesis that miR-30 may regulate SOX9 protein levels indirectly through control of post-translational modifiers of SOX9. [score:6]
We focused on miR-30 because it has a SOX9 target site that is broadly conserved across vertebrates, including human and rodent, and it is robustly and variably expressed among stem, progenitor, and differentiated cell types of the intestinal epithelium. [score:5]
Agrawal R., Tran U., and Wessely O. (2009) The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1. [score:5]
miR-30 Is Predicted to Target SOX9 and Is Robustly Expressed in the Intestinal Epithelium. [score:5]
Below, we show the conservation of the predicted miR-30 target site (red text) across various species (TargetScan6.2). [score:5]
FIGURE 1. miR-30 is predicted to target the 3′-UTR of SOX9 and is differentially expressed across functionally distinct cell types of the intestinal epithelium. [score:5]
This suggests that miR-30 is able to regulate SOX9 protein expression through post-transcriptional regulation of ubiquitin ligases (Fig. 5 d). [score:5]
To evaluate this hypothesis, we next sought to define the regulatory program that miR-30 directs in HIECs and to identify potential miR-30 targets that may be regulating SOX9 protein levels. [score:4]
Knockdown of miR-30 in Vitro Results in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 Protein. [score:4]
Up-regulation of miR-30 family members in myoblasts promotes differentiation (53). [score:4]
Taken together, our data suggest that miR-30 normally acts to promote proliferation and inhibit enterocyte differentiation in the intestinal epithelium through a broad regulatory program that includes the proteasome pathway. [score:4]
Through time course mRNA profiling following knockdown of a single miRNA family, we found that the effect of treatment with LNA30bcd on miR-30 target genes was only beginning to emerge at 24 h, evident at 48 h, and very robust at 72 h post-transfection. [score:4]
d, cartoon showing mo del of miR-30 regulation of SOX9 mRNA and protein expression levels. [score:4]
FIGURE 2. Knockdown of miR-30 increases SOX9 mRNA and decreases SOX9 protein expression. [score:4]
We observed increased relative luciferase activity in cells transfected with 100 n m LNA30bcd (Fig. 2 d), consistent with direct targeting of SOX9 by miR-30 that has been previously shown in cartilage (35). [score:4]
In Caco-2 cells we observed significant knockdown of miR-30 even 21 days following a single transfection with LNA30bcd; therefore, it would of interest to evaluate gene expression at this time point to determine whether the effects on miR-30 target genes are still robust. [score:4]
Upon knockdown of miR-30 in two intestinal-relevant cell lines, we unexpectedly found inverse effects on SOX9 mRNA and protein expression. [score:4]
Further analyses in vivo (mouse) or through ex vivo culture systems (mouse or human) are warranted to extend the definition of the function of miR-30 across distinct cell types of the intestinal epithelium in health and disease. [score:3]
However, the predicted miR-30 target site in UBE3A is human-specific. [score:3]
miR-30 Promotes IEC Proliferation and Inhibits IEC Differentiation. [score:3]
Moreover, the miR-30 target site and flanking ∼15 bases are highly conserved among most mammals including human, rodent, dog, opossum, and horse, as well as distant vertebrates such as lizard. [score:3]
miR-30b and miR-30e targeting are shown in detail with predicted base paring colored in red. [score:3]
Upon knockdown of these miR-30 family members, we observed a significant increase in SOX9 mRNA at 48 and 72 h post-transfection (Fig. 2 a), which is consistent with alleviation of negative post-transcriptional regulation of SOX9 by miR-30. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b). [score:3]
At 24 h post-transfection, predicted miR-30 target sites were not enriched. [score:3]
FIGURE 6. miR-30 promotes proliferation and inhibits enterocyte differentiation. [score:3]
FIGURE 5. miR-30 target genes in intestinal epithelial cells are over-represented in the ubiquitin ligase pathway. [score:3]
Moreover, only miR-30 family members exhibited differential expression across functionally distinct IECs, leading us to select this miRNA family for follow-up analyses. [score:3]
To evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:3]
This finding is consistent with the relatively higher expression levels of miR-30 in proliferating subpopulations, such as the progenitors, compared with non-proliferating enterocytes (Fig. 1 b). [score:2]
Therefore, given the strong regulatory effect of miR-30 on SOX9 protein, we hypothesized that treatment of HIECs with LNA30bcd would affect this balance as well. [score:2]
Guess M. G., Barthel K. K., Harrison B. C., and Leinwand L. A. (2015) miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway. [score:2]
f, mo del of miR-30 regulation of SOX9 in the intestinal epithelium. [score:2]
Alternatively, knockdown of miR-30 in an osteoblast precursor cell line promotes differentiation (54). [score:2]
To test whether miR-30 regulates enterocyte differentiation of IECs, we transfected Caco-2 cells with 100 n m LNA30bcd and allowed the cells to differentiate on Transwell membranes (see “Experimental Procedures”). [score:2]
Together, these data suggest that our knockdown of miR-30 using LNA30bcd was specific and highly effective in HIECs, particularly in the later time points of our study. [score:2]
Next Generation High Throughput Reveals That miR-30 Regulates Genes Enriched in the Ubiquitin Ligase Pathway. [score:2]
In terms of differentiation, the miR-30 family has been shown to regulate myogenic and osteoblastic differentiation. [score:2]
Although increased proliferation has been seen in many cancer cells in response to reduced miR-30 levels, a number of studies have found knockdown of miR-30 to result in decreased proliferation (52). [score:2]
Knockdown of the miR-30 family in HIECs and Caco-2 cells resulted in reduced proliferation and enhanced enterocyte differentiation. [score:2]
Our analyses provide new evidence that miR-30 plays a significant role in regulating proliferation and differentiation in the intestinal epithelium. [score:2]
More research will be needed to identify the specific miR-30-directed ubiquitin ligase protein that acts on SOX9 protein in intestinal epithelial cells. [score:2]
Wu T., Zhou H., Hong Y., Li J., Jiang X., and Huang H. (2012) miR-30 family members negatively regulate osteoblast differentiation. [score:2]
To test for a direct relationship between miR-30 and the SOX9 3′-UTR, we performed a luciferase reporter assay in Caco-2 cells. [score:1]
To evaluate whether miR-30 influences ubiquitin ligase -mediated degradation of SOX9 protein, we subjected Caco-2 cells to either mock or LNA30bcd transfection and then treated them with vehicle or MG132, a potent proteasome inhibitor. [score:1]
Of these, miR-30 has the strongest predicted base pairing with SOX9, consisting of an 8-mer seed as well as supplementary 3′-end pairing for two of the family members. [score:1]
LNAs against mouse miR-30 family members are cross-reactive with the human miR-30 family. [score:1]
[1 to 20 of 55 sentences]
8
[+] score: 148
To further validate that lincRNA-p21 regulates TGFβ/Smad signaling through interacting with miR-30, we co -transfected lincRNA-p21 siRNA with miR-30 antagomir, showing that lincRNA-p21 siRNA failed to reduce KLF11 expression and suppress TGFβ/Smad signaling when miR-30 was inhibited (Fig.   7G). [score:8]
In our previous study, we found that miR-30 blunted TGF-β/Smad signaling in HSCs by targeting KLF11, which suppressed the transcription of inhibitory Smad7 in TGF-β/Smad pathway [31]. [score:7]
The luciferase activity increased in response to pCI-lincRNA-p21 in a dose -dependent manner, suggesting that ectopically expressed lincRNA-p21 sequestered endogenous miR-30 and prevented it from suppressing luciferase expression (Fig.   2E). [score:7]
We reasoned that, if hepatocyte lincRNA-p21 regulates liver fibrosis by interacting with miR-30, inhibition of miR-30 would show inhibitory effects on the protective function of AdH-shlincp21 in liver fibrosis. [score:6]
Here, we further revealed that the inhibition of KLF11 by miR-30 resulted in the upregulation of Smad7 in hepatocytes (Fig.   7A). [score:6]
Consistent with the histology results, hepatic expression of inflammatory genes, including interleukin-6 (IL-6), chemokine ligand 2 (CCL2) and IL-1β, were suppressed in AdH-miR-30 group (Fig.   3F). [score:5]
Ectopic expression of miR-30 greatly inhibited CCl [4] -induced liver fibrosis as observed by histological examination (Fig.   3A), and significantly decreased collagen deposition and hepatic hydroxyproline level (Fig.   3B). [score:5]
Collectively, these results provide convincing evidence that miR-30 can suppress TGF-β/Smad signaling by targeting KLF11 in hepatocyte. [score:5]
To ascertain the underlying mechanism responsible for miR-30 decrease in response to TGFβ, we determined the expression of pri-miR-30s in TGFβ -treated AML12 cells, showing that TGFβ didn’t obviously suppress the transcription of pri-miR-30s (Supplementary Figure  S4C). [score:5]
Here, our results demonstrate that hepatocyte miR-30 greatly inhibits fibrotic TGF-β/Smad signaling by targeting KLF11 and consequently prevents liver fibrosis. [score:5]
Figure 5Inhibition of miR-30 impairs the effects of lincRNA-p21 knockdown on CCl [4] -induced liver fibrosis. [score:4]
Here, we provide the first evidence that TGF-β -induced lincRNA-p21 inhibited miR-30 by directly binding to them. [score:4]
We previously found that hepatic miR-30s decreased in the fibrotic liver and HSC-specific upregulation of miR-30 prevented liver fibrosis [31]. [score:4]
The presence of competitive miR-30 antagomir abolished the inhibitory effects of lincRNA-p21 knockdown on TGF-β signaling and liver fibrogenesis, indicating that lincRNA-p21 functions as a ceRNA. [score:4]
The expression of hepatic profibrogenic markers (α-SMA, Col1a1, TGF-β1, CTGF and TIMP-1) also significantly increased in anti-miR-30 group (Fig.   5C). [score:3]
In contrast, miR-30 antagomir inhibited endogenous miR-30 and increased the luciferase activity (Fig.   2D). [score:3]
The suppression of luciferase activity by lincRNA-p21 siRNA was reversed by miR-30 antagomir (Supplementary Figure  S5C). [score:3]
AdH-miR-30 could significant increased miR-30b expression in AML12, but not in the cultured HSC cell line HSC-T6 (Supplementary Figure  S2B). [score:3]
Basing on these results, we propose that TGF-β -induced lincRNA-p21 in turn strengthens TGF-β signaling by interacting with miR-30, thus forming a positive feedback loop to ensure lincRNA-p21 expression and mediate the role of TGF-β in promoting liver fibrosis. [score:3]
Hepatocyte miR-30 inhibits liver fibrosis. [score:3]
Notably, TGF-β1, Col1a1 and tissue inhibitor of metalloproteinase-1 (TIMP-1) were also greatly reduced in the AdH-miR-30 -injected mice. [score:3]
Moreover, miR-30b expression increased in the hepatocytes of AdH-miR-30 -injected mice, but not in the HSCs (Fig.   3D). [score:3]
To test this, we constructed adenovirus AdH-miR-30 and AdH-NC that can specifically express miR-30b or control in hepatocyte in vivo under the control of albumin promoter. [score:3]
AML12 cells were transfected with lincRNA-p21 siRNA for 24 h and then treated with TGF-β1 for 2 h. (G) Inhibition of miR-30 impairs the effects of lincRNA-p21 siRNA on TGF-β/Smad signaling. [score:3]
To examine the interactions between lincRNA-p21 and miR-30, the nontumorigenic mouse hepatocyte cell line AML12 were transiently transfected with the expression plasmid pCI-lincRNA-p21 that contains the murine lincRNA-p21 cDNA. [score:3]
However, in anti-miR-30 group, AdH-shlincp21 failed to exert the inhibitory effects (Fig.   5A and B). [score:3]
In the isolated hepatocytes from fibrotic liver injected with AdH-miR-30, ectopic expression of miR-30b led to decrease of KLF11 and increase of Smad7 in hepatocyte in vivo (Fig.   7A). [score:3]
In the present study, we find that hepatocyte lincRNA-p21 can function as a ceRNA by binding miR-30, and therefore participating in the regulation of TGF-β signaling and liver fibrosis. [score:2]
Hepatocyte lincRNA-p21 regulates liver fibrosis through interacting with miR-30. [score:2]
To date, the mechanism of miR-30 deregulation in various states is mostly unknown. [score:2]
To test our hypothesis, anti-miR-30, a phosphorothioate -modified antisense oligonucleotides specific for miR-30, and scrambled control (SCR), were intravenously injected into CCl [4] -treated mice weekly during the liver fibrosis development. [score:2]
However, the injection of miR-30 antisense oligonucleotides decreased miR-30b in the hepatocyte (Fig.   5F). [score:1]
Meanwhile, pCI-lincRNA-p21Mut, in which the predicted miR-30 binding site was mutated, failed to increase the luciferase activity (Fig.   2E). [score:1]
Collectively, our results suggest that hepatocyte lincRNA-p21 contributes to liver fibrosis by interacting with miR-30. [score:1]
miR-30 enrichment was determined by qRT-PCR and normalized to control. [score:1]
Moreover, the transcribing of pri-miR-30 wasn’t affected by TGF-β, and thus strongly suggesting the underlying mechanism responsible for miR-30 decrease in response to TGF-β. [score:1]
The increase of lincRNA-p21 in hepatocyte was associated with the loss of miR-30 during liver fibrosis. [score:1]
Figure 2LincRNA-p21 interacts with miR-30. [score:1]
de/rnahybrid/) further revealed a healthy minimum free energy of hybridization between lincRNA-p21 and miR-30 family members (Supplementary Figure  S1A). [score:1]
However, at this stage, we can’t exclude the possibility that the decrease of miR-30 may be triggered by other mechanisms in liver fibrosis. [score:1]
Notably, increased infiltration of macrophages was limited in AdH-miR-30 group mice (Fig.   3E). [score:1]
The specific association between miR-30 and lincRNA-p21 was also validated by affinity pull-down of miR-30. [score:1]
To confirm the interaction between lincRNA-p21 and miR-30, we inserted the lincRNA-p21 cDNA downstream of the firefly luciferase reporter gene. [score:1]
Two days before the first injection of CCl [4], AdH-miR-30 or AdH-NC was injected into mice via tail vein. [score:1]
Left, AML12 were transfected with miR-30b mimics for 24 h. Right, primary hepatocytes were isolated from fibrotic liver injected with AdH-NC or AdH-miR-30. [score:1]
Thus, we hypothesized that hepatocyte lincRNA-p21 and miR-30 are inversely associated and involved in liver fibrosis. [score:1]
Transfection of miR-30 greatly decreased the luciferase activity of the wild type reporter with normal binding sites for miR-30, but not that with the mutant binding sites. [score:1]
Notably, we have previously reported that TGF-β1 reduced miR-30 in hepatocyte [35]. [score:1]
Moreover, the miR-30s in the isolated hepatocytes from AdH-shlincp21 group mice significantly increased, suggesting that AdH-shlincp21 might prevent liver fibrosis by increasing miR-30 in hepatocyte (Fig.   4F). [score:1]
Figure 7LincRNA-p21 enhances TGF-β/Smad signaling in hepatocyte by interacting with miR-30. [score:1]
Thus, TGFβ -induced lincRNA-p21 might be responsible for the decrease of miR-30. [score:1]
These phenomena depend on the interaction between lincRNA-p21 and miR-30. [score:1]
Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-shlincp21 and SCR (AdH-shlincp21 + SCR, n = 6) and CCl [4] in combination with injection of AdH-shlincp21 and anti-miR-30 (AdH-shlincp21 + anti-miR-30, n = 6). [score:1]
Administration of AdH-miR-30 led to miR-30b increase in the liver tissue (Fig.   3C). [score:1]
Mice were treated with oil (Sham, n = 6), CCl [4] (CCl4, n = 6), CCl [4] in combination with injection of AdH-NC (CCl4 + AdH-NC, n = 6) and CCl [4] in combination with injection of AdH-miR-30 (CCl4 + AdH-miR-30, n = 6). [score:1]
Thus, lincRNA-p21 may be able to function as a ceRNA for miR-30. [score:1]
LincRNA-p21 is physically associated with the miR-30. [score:1]
[1 to 20 of 57 sentences]
9
[+] score: 145
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Searching 3′-UTR of putative target mRNA, targeting sequences which can make base pairing with 5′ seed sequences of miR-30 were found in the 3′-UTR of lifr, eed, pcgf5 and sirt1 utilizing TargetScan (Fig 7B). [score:7]
miR-30 targets were predicted using TargetScan. [score:5]
These data suggest that miR-30 members could be repressing targets at the MSC and osteocytic stages, while repression on target mRNA may be relieved during the intermediate osteoblastic stage. [score:5]
0058796.g009 Figure 9(A) Relative expression levels of miR-30 target mRNA in proliferating/sparse KUSA cells. [score:5]
In fact, runx2 as well as sox9 a master transcription factor for chondrogenesis was upregulated in mRNA level by miR-30d, indicating miR-30 could direct differentiation of MSC. [score:5]
bromo domain recognize acetylated lysine in histone Epige N miR-30e PCGF5 −0.51 polycomb group (PcG) ring fnger 5 Epige Chro miR-30e HELZ −0.46 ZF RNA helicase RNA N TargetScan was utilized for the prediction of targets and scoring. [score:5]
mRNA expression patterns of miR-30 targets in mMSC line. [score:5]
Together with the data of expression patterns in Fig 9 and Fig 2, miR-30 targets were classified into several groups; immediate induction followed by rapid attenuation group (ccn1/2/3, hnrnpa3 vC, eed, hspa5/grp78), immediate reduction and rapid recovery group (runx2 and lifr), the constant induction group (lin28a and opn/spp1) and the constant reduction group (pcgf5 and hnrnpa3 vB). [score:5]
As observed in Fig 11C, suppression of lifr expression by miR-30 may control osteoblast and osteocyte differentiation leading to attenuation of Lif/LifR/Jak-Stat signal. [score:5]
Expression pattern of miR-30 targets. [score:5]
For a better understanding of miR-30 targeting, basal mRNA expression levels of 18 gene products were quantified and compared in proliferating/sparse KUSA-A1 cells (vector transfected control cells). [score:4]
miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1). [score:4]
EED, named after embryonic ectoderm development, is another novel target of miR-30. [score:4]
miR-30 controls expression of LifR and Runx2, the known regulators for osteoblasts. [score:4]
One miR-30 targeting sequence in the 3′-UTR of ctgf/ccn2 has been reported. [score:3]
List of predicted miR-30 targets. [score:3]
A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis. [score:3]
These predictions appear to be specific to each of the miR-30 members; however, 11 nt of the 5′ seed sequence in miR-30 family members are common and the mature miR-30s sequences are quite homologous among miR-30a/d/e or between miR-30b/c (Fig 7A), indicating shared and distinctive targets among miR-30 members. [score:3]
Analysis of miR-30 targeting. [score:3]
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
In addition, two putative miR-30 targeting sites on spp1/osteopontin were found. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesis. [score:3]
miR-30 targeting prediction. [score:3]
As targets of miR-30, we found novel key factors in osteogenesis including Lin28, hnRNPA3, Eed, Pcgf5 and HspA5/Grp78. [score:3]
0058796.g006 Figure 6(A) miR-30 family expression pattern in KUSA-A1 mMSC line with (red bars, Os+) or without (blue bars, Os−) osteoinduction. [score:3]
RNA, Stem C miR-30e LIN28B −0.71 Inhibit pri-let-7 maturation in nucleus. [score:3]
Known target of miR-30. [score:3]
miR-30 targeting in mMSC line. [score:3]
Matching around the 3′ part and intermediate part of miR-30 were tested to those targets. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesisPhysiological production of CCN2/CTGF is more abundant from chondrocytes in cartilage than those in other tissues, while CCN1/2/3, the prototype members of CCN family, control both chondrocytic and osteoblastic differentiation [57, 58). [score:3]
miR-30 expression pattern during KUSA-A1 MSC osteocytogenesis. [score:3]
Prediction of miR-30 targeting. [score:3]
Since miR-30 family members are homologous (Fig 6A) and possibly share targets, we further investigated the miR-30 family expression patterns at four time points with or without osteo-induction. [score:3]
These in silico analyses suggested putative shared and distinctive target mRNA recognition by miR-30 family, the groups of miR-30a/d/e and miR-30b/c. [score:3]
As a result, miR-30a, miR-30c and miR-30d were highly expressed compared with miR-30b or miR-30e (Fig. 6B). [score:2]
Hspa5/grp78, lifr, eed, opn/spp1 and pcgf5 mRNA levels in miR-30 transfected cells were 20–30% lower than those in control cells in both proliferating and confluent cells (Fig 8AB), indicating direct repression of mRNA stability. [score:2]
Moreover, the miR-30 family was predicted to recognize sox9, lrp6, smad2, smad1, notch1, bdnf and a number of epigenetic factors (Table 2). [score:1]
0058796.g007 Figure 7(A) List of mature miR-30 family members. [score:1]
These immediate early induction followed by quick attenuation patterns were shared with those of CCN gene family shown in Fig 2A, indicating these 6 kinds of transcripts are under the control of same factors and the miR-30 family. [score:1]
Mature miR-30 quantification during osteocytogenesis. [score:1]
In addition, miR-30d was induced by osteo-induction (Fig. 5J), and miR-30 family recognition sites were found in the 3′-UTR regions of the runx2 and nov/ ccn3 mRNAs (Fig. S2, S3). [score:1]
These findings suggest that members of the miR-30 family could play an essential role in osteocytic differentiation. [score:1]
ER stress response Chaperone ER miR-30e BRWD1 −0.9 WD repeat domain. [score:1]
Therefore, immediate induction and subsequent rapid repression of ctgf/ccn2 could be controlled by fluctuations in these miRNAs including the miR-30 family. [score:1]
Tuning mo del of canonical and novel osteogenic factors by miRNA-30 family and miR-541 during MSC osteogenesis. [score:1]
WD protein associated, miR-30-specificity. [score:1]
All the miR-30 members once reduced during osteoblastic differentiation stage on day 2 and day 7. Among those members, miR-30a/d/e were increased on day 14 around a late osteocytic stage (Fig 6A). [score:1]
We focused on the miR-30 family and miR-541 in this study, while still further analyzing roles of OstemiR in MSC differentiation. [score:1]
Together with these results and data interpretations, we propose the tuning mo del of canonical and novel osteogenic factors by the OstemiRs including miR-30 family and miR-541. [score:1]
[1 to 20 of 49 sentences]
10
[+] score: 131
To determine whether the radiation -induced IL-1β increase contributed to miR-30 expression and whether DT3 could inhibit the miR-30 expression induced by IL-1β, we used assays to validate the effects of IL-1β on miR-30 expression in CD34+ cells (Fig 5B). [score:8]
DT3 downregulated radiation -induced miR-30 expression and secretion in mouse tissues and serum. [score:6]
Finally, neutralization of IL-1β activation or knockdown of NFκBp65 gene expression in CD34+ cells resulted in complete abrogation of the radiation -induced miR-30 expression in these cells. [score:6]
DT3 downregulated the expression and secretion of radiation -induced miR-30 in mouse tissues and serum. [score:6]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in CD34+ cells. [score:5]
These data suggest that radiation -induced IL-1β may be responsible for miR-30 expression and the radioprotective effects of DT3 may result from inhibition of a storm of radiation -induced inflammatory cytokines. [score:5]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in human CD34+ cells. [score:5]
In the current study, we confirmed expression of radiation -induced miR-30b and miR-30c in mouse tissues and serum, and miR-30 expression in mouse BM, jejunum, and liver within 1 h, that returned to baseline 4 or 8 h after irradiation (data not shown). [score:5]
In this study, we further demonstrated the effects of DT3 and the anti-IL-1β antibody on suppression of radiation or IL-1β -induced miR-30 expression in CD34+ cells. [score:5]
In this study, we confirmed our previous in vitro results and extend our findings using an in vivo mouse mo del, to explore our hypothesis that the radioprotective effects of DT3 are mediated through regulation of miR-30 expression in irradiated cells. [score:4]
To further understand the interaction between miR-30 and IL-1β in response to radiation and DT3, and the mechanisms of DT3 on radiation protection, we explored the role of radiation and DT3 on regulation of miR-30 and IL-1β expression. [score:4]
We further compared the effects of anti-IL-1β antibody and DT3 on miR-30 expression and survival of CD34+ cells after radiation and found that treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in these cells. [score:4]
Due to the ability of miRNA to target multiple transcripts [29], miR-30 has been found in multiple cellular processes to regulate cell death through different genes such as cyclin D1 and D2 [30], integrin b3 (ITGB3) [31], B-Myb [32], and caspase-3 [33]. [score:4]
IL-1β (10 ng/mL) was added to CD34+ culture with the anti-IL-1β antibody (0.2 μg/mL) or the same amount of a nonspecific IgG, and miR-30 expression was tested at 15 min, 30 min, and 1 h after addition of IL-1β. [score:3]
NFκB activation was responsible to radiation (and IL-1β) -induced miR-30 expression in CD34+ cells. [score:3]
DT3 protected against radiation -induced apoptosis in mouse and human CD34+ cells through suppressing of IL-1β -induced NFκB/miR-30 signaling, and significantly enhanced survival after lethal doses of total-body γ-irradiation in mice. [score:3]
Interestingly, IL-1β -induced miR-30 expression was completely blocked by DT3 treatment (Fig 5C). [score:3]
Interestingly, radiation induced miR-30 expression in serum was observed at 4 h and remained elevated up to 24 h post-irradiation. [score:3]
Treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in CD34+ cells. [score:3]
Addition of the anti-IL-1β antibody for 30 min completely neutralized the expression of IL-1β -induced miR-30 in these cells. [score:3]
Cells were used for quantitative real-time PCR to determine the effects of IL-1β neutralization on miR30 expression. [score:3]
DT3 significantly suppressed miR-30 and protected animals from the acute radiation syndrome and increased survival from lethal doses of total-body irradiation. [score:3]
We next evaluated the effects of DT3 on radiation and/or IL-1β -induced miR-30 expression in human hematopoietic CD34+ cells because DT3 had suppressed the radiation -induced IL-1β and its downstream cytokine IL-6 production in mouse spleen (Fig 3) and jejunum [4]. [score:3]
Vehicle, DT3, or a neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy irradiation, and miR-30 expression was examined 1 h after irradiation. [score:3]
DT3 or anti-IL-1β antibody inhibited radiation -induced IL-1β production and reversed IL-1β -induced NFκB/miR-30 stress signaling. [score:3]
We next sought to determine which a stress-response signal-transduction pathway may be involved in this IL-1β -induced miR-30 expression. [score:3]
NFκB activation was responsible for radiation -induced miR-30 expression in CD34+ cells. [score:3]
shown in Fig 5C confirmed that DT3 administration abolished expression of IL-1β -induced miR-30 in CD34+ cells. [score:3]
Modulation of miR-30 expression with IL-1β neutralizing antibody. [score:3]
Finally, vehicle or DT3 was added to CD34+ culture 22 h before IL-1β treatment, and miR-30 expression was examined at 24 h post-DT3 addition and 1 h after IL-1β treatment. [score:3]
It was also observed that anti-IL-1β antibody-treatment blocked the radiation -induced miR-30 expression in control-siRNA transfected cells. [score:3]
DT3 administration abolished IL-1β -induced miR-30 expression in CD34+ cells. [score:3]
Radiation induced both miR-30 subunits between 4–24 h after 7 and 10 Gy TBI. [score:1]
In conclusion, results from our current study demonstrated that an increase of miR-30 in irradiated cells results from a cascade of IL-1β -induced NFκB -dependent stress signals that are responsible for radiation damage in mouse and human cells. [score:1]
This circulating miR-30 increase is specific, reproducible, and radiation dose -dependent in irradiated mouse serum. [score:1]
In contrast, no miR-30 increase was observed after 2 Gy irradiation to siNFκB transfected cells. [score:1]
We found that miR-30 was highly induced by radiation within 1 h in BM (Fig 4B), jejunum, and liver (Fig 4C), but not in kidney cells (data not shown). [score:1]
We believe that the acute secretion of extracellular miR-30 in mouse serum after radiation is likely to derive from a variety of cell types. [score:1]
These results further support our hypothesis that levels of miR-30 in irradiated mouse tissues and serum reflect the severity of radiation damage in these animals. [score:1]
[1 to 20 of 39 sentences]
11
[+] score: 103
In this study, we found that miR-30e over- expression would decrease UCP2 protein level but UCP2 over expression had no effect on miR-30e level (Figure 4A&4B), which indirectly indicates the regulation of miR-30e on UCP2. [score:7]
Furthermore, UCP2, the most wi dely expressed UCP in liver, was reported to be regulated by miR-133a in inflammatory bowel disease [12] and by miR-30e in kidney fibrosis [14]. [score:6]
Except for inflammation change in pathology level, the ALT and AST levels were also increased and decreased after respective UCP2 and miR-30e over expression (Figure 5A&5B), indicating the potential therapeutic effect of miR-30e over expression in AH treatment. [score:5]
In AH rat mo del, miR-30e over expression did significantly increase the miR-30e level and decrease the UCP2 level, while UCP2 over expression significantly increased UCP2 level but had no effect on miR-30e level (Figure 4A&4B). [score:5]
Further studies demonstrated that the effect of miR-30e in liver cancer may be through targeting MTA1 for epithelial to mesenchymal transition [22] and P4HA1 for proliferation suppression [23]. [score:5]
Significantly hydrogen peroxide (C) and ATP (D) down and up regulation after respectively successful UCP2 and miR-30e over expression. [score:4]
Secondly, the direct regulation of miR-30e on UCP2 should be tested in cell mo del using Dual-luciferase reporter gene method, which may further consolidate our indirect results. [score:4]
Finally, UCP2 and miR-30e over expression did not significantly change TCh, TG and HA level, indicating their effect in AH may be not through regulating lipid metabolism and fibrosis formation. [score:4]
The reverse expression of miR-30e and UCP2 supported the possibility of miR-30e regulation on UCP2, as previously reported [14]. [score:4]
Significantly ALT (A) and AST (B) up and down regulation after respectively successful UCP2 and miR-30e over expression. [score:4]
Figure 5Significantly ALT (A) and AST (B) up and down regulation after respectively successful UCP2 and miR-30e over expression. [score:4]
Further study also revealed the potential therapeutic effect of targeting miR-30e-UCP2 pathway in AH and the involvement of ATP and H [2]O [2] as down stream mechanism. [score:3]
Figure 4 (A) Significantly increased miR-30e level in rat at hepatitis stage after miR-30e over expression. [score:3]
UCP2, miR-30e and H-E staining change after over expression. [score:3]
Effect of antagonizing miR-30e and UCP2 expression in the treatment of AH. [score:3]
ALT, AST, H2O2 and ATP change after UCP2 and miR-30e over expression. [score:3]
Furthermore, H [2]O [2] and ATP levels were also significantly decreased and increased after respective UCP2 and miR-30e over expression, hinting the potential involvement of oxidative stress and energy metabolism in the pathogenesis of AH. [score:3]
UCP2 and miR-30e over expression in ASH mo del. [score:3]
Furthermore, respectively increased and decreased inflammatory cell infiltration after UCP2 and miR-30e over expression were observed, as presented by H-E staining (Figure 4C). [score:3]
We found significantly decreased and increased H [2]O [2] and ATP levels after respective UCP2 and miR-30e over expression (Figure 5C&5D). [score:3]
However, the expression and effect of miR-30e in ALD has not been reported hitherto. [score:3]
Though the regulation of miR-30e on UCP2 was previously established [14], their association in liver is still unclear. [score:2]
These results reinforced the possibility of upstream regulation of miR-30e on UCP2. [score:2]
To sum up, our study, for the first time, reported the significantly dys-regulated miR-30e-UCP2 pathway in different stages of ALD. [score:2]
Considering the significant change of miR-30e and UCP2 expression in different stages of ALD, we started to investigate their therapeutic effect in AH. [score:1]
Since miR-30e-UCP2 pathway is significantly changed in ALD, we then explore its effect in AH, an important stage of ALD. [score:1]
Figure 3 (A) Gradually decreased miR-30e level in different stages of ALD, as shown by qRT-PCR. [score:1]
Changes of miR-30e and UCP2 in different stages of ALD. [score:1]
After respectively antagonizing the miR-30e and UCP2 level, we found significantly changed inflammatory cell infiltration (Figure 4C) and ALT/AST level (Figure 5A&5B). [score:1]
In contrast to miR-30e change, western blot showed the significantly gradually increased UCP2 levels in different stages of ALD, starting from AFI to AH and AHF (Figure 3B). [score:1]
Since oxidative stress has participated in the whole process of ALD, we speculated a pathogenic role of miR-30e -UCP2 pathway in ALD progression and tested this hypothesis in the ALD rat mo del with focusing on underlining peroxide and ATP level change. [score:1]
Therefore, we, for the first time, successfully reported the significantly changed miR-30e and UCP2 levels in ALD. [score:1]
Finally, it would be meaningful to detect the miR-30e and UCP2 levels in patients with different stages of ALD. [score:1]
The pCDNA3.1(+)-UCP2 plasmid and miR-30e mimic were utilized to transfect ASH animal mo del by caudal vein injection once a week as an supplementary treatment with ALD establishment. [score:1]
Our results reinforced the importance of miR-30e and UCP2 in ALD. [score:1]
Significantly decreased miR-30e and increased UCP2 in ALD. [score:1]
As shown in Figure 3A, qRT-PCR analysis showed significantly decreased miR-30e level, paralleling with the progression of ALD stages. [score:1]
Therefore, the groups were categorized as followings: ASH group (n=5), ASH+UCP2 group (n=5) and ASH +miR-30e mimic group (n=5). [score:1]
Besides, miR-30e was synthesized and provided by a commercial company (Ji-ma Biotechnology, Shanghai, china) with the following sequence: Sense, 5′ UGUAAACAUCCUUGACUGGAAG 3′; Anti-sense, 5′ UCCAG UCAAGGAUGUUUACAUU 3′. [score:1]
[1 to 20 of 39 sentences]
12
[+] score: 90
Other miRNAs from this paper: mmu-mir-433, mmu-mir-690, mmu-mir-129b
Figure 3Targets and expression regulation of mir-30e-5p in the PFC induced by adolescent high fat diet (HFD) (a) Downregulation of mir-30e-5p expression levels, illustrated by the significantly reduced 2(-Delta(C(T)) values and revealed by a Student’s t-test analysis: * p < 0.05. n = 6 per diet. [score:11]
Of note when looking at gene expression changes in the mouse mPFC after HFD, we find that although mir-30e-5p expression is reduced (Fig.   3a), EFNA3 expression is also reduced (Fig.   4), even though EFNA3 expression was downregulated by mir-30e-5p in a luciferase cell culture assay. [score:11]
We also provided a direct validation that mir-30e-5p (mentioned above) downregulates one of its predicted targets within the axon guidance pathway: Ephrin A3. [score:7]
In particular, given its strong (predicted) capacity to regulate the expression of numerous genes implicated in cognition (see Fig.   3 ), mir-30e-5p emerges as one of the most interesting candidate regulators of gene expression and cognitive function after HFD exposure. [score:7]
Moreover, the IPA software indicated miR-30e-5p as the first upstream regulator of target-genes implicated in cognition (“IPA cognition network”), as 60 genes (out of 63) from the IPA cognition network were predicted target molecules of miR-30e-5p. [score:6]
Interestingly, mir-30e-5p was shown to be similarly down-regulated in an animal mo del of temporal lobe epilepsy [71], whereas mir-30e-5p precursor variants were shown to associate with schizophrenia 72, 73, supporting the relevance of this miRNA for neurological and neuropsychiatric disease. [score:6]
Adolescent HFD reduces the expression of mir-30e-5p, a miRNA with predicted gene targets involved in axon guidance and cognition. [score:5]
Both microarray (Fig.   2a, see MIMAT0000248) and qRT-PCR (Fig.   3a, F [(1,10)] = 5.75, p < 0.05) analyses revealed that miR-30e-5p was significantly downregulated by adolescent HFD. [score:4]
We found that mir-30e-5p led to a significant downregulation of the EFNA3 gene found in both HEK cells and HeLa cells (t [(2)] = 9.55, p < 0.05 and t [(2)] = 5.42, p < 0.05); Fig.   3b and Supplementary Table  3), thus in line with the predictions of the bioinformatics analyses. [score:4]
Predicted targets of miR-30e-5p, which also belong to the cognition network, are reported in Fig.   3c. [score:3]
Mir-30e-5p leads to a downregulation of EFNA3 (average 12% reduction in normalized luciferase activity. [score:3]
Further detailed analysis of individual functions belonging to the behavioral network indicated that targets of miR-30e-5p are significantly implicated in cognition and learning and memory functions. [score:3]
We first aimed at providing a proof-of-principle validation for the predicted targets of miR-30e-5p. [score:3]
We focused on EFNA3 because it was one of three axon guidance genes (top-1 canonical pathway) that was a predicted target of mir-30e-5p. [score:3]
Examining the functional role of mir-30e-5p in the emergence of HFD -induced cognitive abnormalities would thus represent an interesting extension of the present study and a potential promising avenue for the understanding of cognitive deficits in diseases with prefrontal anomalies. [score:3]
Also, our luciferase gene reporter assay allowed to provide a proof-of-concept that at least some of the predictions of our bioinformatics analyses are valid; i. e. we showed that EFNA3 is a target for miR-30e-5p. [score:2]
Of the 38 significantly affected miRNAs (Table  1 and Fig.   2a), mir30e-5p, mir-433-3p and mir-690 are particularly interesting because they are predicted regulators of three biological pathways with essential roles for proper neural functioning, namely Axon guidance, Ephrin Receptor Signaling and Neurotrophin Signaling. [score:2]
Furthermore, when further investigating IPA analysis for miR-30e-5p, we found that, although there is no functional evidence in the literature or experimental data regarding the correlation between miR-30e-5p and cognition, IPA reported ‘behavior’ as the second top biological function affected by the targets of miR-30e-5p (Table  2). [score:1]
Among the miRNAs that we analyzed, miR-30e-5p was particularly interesting when considering the association between HFD and cognition. [score:1]
For example, mir-30e was significantly affected by HFD in both brain regions. [score:1]
Fold change in mir-30e-5p levels obtained by qRT-PCR analyses was analyzed using a Student’s t test (two-tailed). [score:1]
MiR-30e-5p thus represents a very interesting miRNA that might be implicated in some of the cognitive deficits induced by adolescent HFD. [score:1]
on luciferase activity and (b) against the exogenous effects of mir-30e-5p on the luciferase coding sequences (see Supplementary Methods for more details and [54]. [score:1]
Cells were transfected with 100 ng of pEZX-MT06/EFNA3-3′UTR or pEZX-MT06 and 10 pmol of mir-30e-5p (#4464066) and negative control (#4464058) miRNAs mimics (mirVana™, Life Technologies, Zug, Switzerland) per well using Lipofectamine RNAiMAX reagent (Invitrogen) according to the manufacturer’s instructions. [score:1]
[1 to 20 of 24 sentences]
13
[+] score: 62
Here we confirmed that Mtdh represents a target of mi-R30s in DN, and that the expression of all five miR-30 family members is downregulated in the glomeruli form streptozotocin -induced diabetic rats and HG -induced MPC5 cells. [score:8]
Mtdh protein expression was shown to be increased as well after the treatment with the miR-30 inhibitors (Figure 6e), whereas miR-30 mimics significantly reduced Mtdh expression in HG -induced MPC5 cells (Figure 6f). [score:7]
To assess the effects of miR-30s on the expression of Mtdh, we transiently transfected MPC5 cells with miR-30 inhibitors, synthetic miRNA mimics, or their NCs. [score:5]
Furthermore, miR-30 inhibitors significantly increased the expression of Bax and cleaved caspase 3 (Figure 7c). [score:5]
The obtained results demonstrated that miR-30a, -30b, -30c, -30d, and -30e mimics can significantly inhibit the luciferase activity of the wild-type Mtdh 3′-UTR reporter, but not that of the NC, and that this inhibition was reduced when the mutant reporter, with mutated miR-30 -binding site, was used (Figures 5d–h). [score:5]
Transient transfections with siRNAs, Mdth overexpression vector, miR-30 inhibitors, and miR-30 mimics. [score:5]
These cells were transfected with Mtdh siRNA (50 nM; GenePharma, Shanghai, China) or the overexpression (500 ng per well, GenePharma) the mixture of the mimics or inhibitors (RiboBio, Guangzhou, China) of all five miR-30 family members at the final concentrations of 50 nM, using Lipofectamine 2000 (Invitrogen) for 6 h in OPTI-MEM (Gibco BRL), according to the manufacturers' instructions. [score:5]
Mtdh represents a direct target of the members of miR-30 family. [score:4]
Mtdh mRNA level was shown to be significantly increased following the treatment with miR-30 inhibitors (Figure 6c), whereas miR-30s mimics led to a considerable reduction of Mtdh expression induced by HG (Figure 6d), compared with the corresponding NC treatment groups. [score:4]
Therefore, we studied miR-30 expression in the DN glomeruli and HG -induced MPC5 cells. [score:3]
Afterward, OPTI-MEM was replaced with the complete medium containing 1% FBS, and treated with HG for 48 h after the transfection with siRNAs or mimics, whereas the cells treated with miR-30 inhibitors were not treated with HG. [score:3]
MPC5 were transfected with miR-30 inhibitors, mimics, or the respective NCs. [score:3]
analysis demonstrated that the transfection of cells with miR-30 inhibitors significantly increased the percentage of apoptotic cells compared with the NC group (Figure 7a). [score:2]
[44] The 3′-UTR of Mtdh containing putative miR-30 -binding sites was amplified and cloned into PmiR-RB-REPORT dual-luciferase reporter vector (RiboBio). [score:1]
The treatment with miR-30 mimics considerably decreased HG -induced increase in the levels of these proteins (Figure 7d). [score:1]
Conversely, miR-30 mimics considerably reduced the rate of MPC5 apoptosis induced by HG (Figure 7b). [score:1]
[1 to 20 of 16 sentences]
14
[+] score: 57
Among the differentially expressed miRNAs, members of miRNA-30 family (miRNA 30a, b, c, d, and e) were chosen for further studies as they have been found to be: (a) upregulated significantly (fold change ranging from 1.15–1.52) in NSCs from embryos of diabetic pregnancy (Supplementary Table 4); (b) involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015). [score:7]
In the present study, miRNA-30 family was found to be up regulated in NSCs from diabetic pregnancy when compared to control, suggesting that maternal diabetes alters the expression of miRNA-30 family and its target genes, which may perturb brain development in offspring of diabetic mothers. [score:6]
In addition, miRNA-30d expression levels are found to be affected in brains of female schizophrenic patients (Mellios and Sur, 2012), thus emphasizing the importance of miRNA-30 family in brain development and disease. [score:6]
In addition, we found that hyperglycemia increased the expression of miRNA-30 family, in particular miRNA-30b that altered NSC differentiation via down regulation of its target, Sirt1 in NSCs. [score:6]
miRNA-30 family is found to have diverse functions in the brain during development and disease, with well-known roles in regulating epithelial-to-mesenchymal transition (EMT) (Kumarswamy et al., 2012). [score:5]
Members of the miRNA-30 family i. e., miRNA-30a and miRNA-30d, are enriched in layer III pyramidal neurons and have been shown to target BDNF during development (Mellios and Sur, 2012). [score:4]
Among the differentially expressed miRNAs in NSCs from diabetic pregnancy, the miRNA-30 family has been proposed to play critical role in maternal diabetes -induced neural tube anomalies as it has been shown to be involved in neurodevelopmental disorders (Mellios and Sur, 2012; Hancock et al., 2014; Sun et al., 2014; Han et al., 2015). [score:4]
One of the miRNA-30 family members, miRNA-30b is found to target Sirt1 which belongs to the Sirtuin family of proteins with seven members of the family being reported to exist in mammals. [score:3]
Figure 5 (A) qRT-PCR showing the expression pattern of miRNA-30 family. [score:3]
2017.00237/full#supplementary-material Supplementary Figure 1 Gene targets of miR-30 family are depicted. [score:3]
Gene targets of the miRNA-30 family were predicted using IPA (Supplementary Figure 1). [score:3]
Further, quantitative RT-PCR analysis was performed to validate the expression levels of miRNA-30 family (miRNA-30 b, c, d, and e) in NSCs from embryos of diabetic and control pregnancy. [score:3]
miRNA-30 family and brain development. [score:2]
Supplementary Table 4Fold change and p-value of miRNA-30 family. [score:1]
While miR-30b and miR-30d were significantly up regulated in NSCs from embryos of diabetic pregnancy when compared to the control, miRNA-30c and miRNA-30e showed an increasing trend (Figure 5A). [score:1]
[1 to 20 of 15 sentences]
15
[+] score: 56
Another approach to multiple siRNA expression was stimulated by report that a mouse miR30 -based shRNA expression cassette can be driven by Pol II promoters and provide higher knockdown efficiency than those driven by the Pol III U6 promoter [10]. [score:6]
These results suggest that although NP miRNA can be expressed from the mouse miR30 -based cassette in DF-1 cells, the level of target gene knockdown is modest following stable integration of the lentiviral vector. [score:6]
Subsequently, Sun et al showed that a single Pol II promoter can drive three artificial miR30 cassettes to express siRNAs all targeting GFP, resulting in further knockdown of the GFP intensity in the cells [17]. [score:6]
The mouse miR30 -based miRNA expression cassette has been wi dely used to express artificial miRNA in lentiviral vectors [21]. [score:5]
As shown in Figure 1c, transient expression of miR30-NP inhibited Renilla luciferase activity by ∼85%. [score:5]
Inhibition of luciferase activity by NP miRNA expressed from a mouse miR30 -based lentiviral vector. [score:5]
To express anti-influenza artificial miRNA, we replaced the mature miR30 sequences in pLB2 with sequences that target nucleoprotein (NP) of influenza virus (Figure 1b). [score:5]
As a control, Vero cells were transduced with a CPGM lentivirus that expressed miR30 -based miRNA specific for the firefly luciferase transcript. [score:3]
Expression of NP miRNA from the mouse miR30 -based lentiviral vector. [score:3]
Zhou et al reported that two tandem copies of the miR30 -based cassette can be expressed in a single transcript driven by a Pol II promoter [15], [16]. [score:3]
In addition to miR30 -based designs, mouse miR155 -based design has also been used to knockdown multiple genes [19]. [score:2]
In the transient transfection assay, the miR30-NP lentiviral vector and psicheck-2 dual luciferase reporter plasmid, in which the NP target sequence was cloned into the 3′ UTR of the synthetic Renilla luciferase gene, were co -transfected into DF-1 cells. [score:2]
A similar miR30 -based approach was utilized by Zhu et al to knockdown multiple genes [18]. [score:2]
Flanking and hairpin sequences are miR30. [score:1]
0022437.g001 Figure 1(a) Schematic diagram of the miR30-NP lentiviral vector. [score:1]
Psicheck-2 dual luciferase reporter plasmid (50 ng) and miR30-NP lentiviral vector (450 ng) were co -transfected in DF-1 cells. [score:1]
[1 to 20 of 16 sentences]
16
[+] score: 42
In summary, we have established a mouse strain that expresses a tet-regulatable, miR30 -based shRNA targeting the Cox2 transcript, and have demonstrated reversible and functional DOX -mediated suppression of Cox2 gene expression. [score:10]
The targeting vector, pCol-TGM, contains a GFP open reading frame immediately downstream of the TRE promoter, followed by the miR30 -based shRNA expression cassette. [score:5]
To identify appropriate shRNAs, each cloning template containing a COX-2 shRNA sequence was ligated into LMP, a retroviral miR30-shRNA expression vector in which miRNA -based shRNA (shRNAmir) expression is driven from the viral 5′LTR promoter (Fig. 1A). [score:5]
Using the microRNA30 (miR30) precursor RNA as a template, they substituted miR30 stem sequences with designed shRNAs, and showed effective target gene inhibition [15]. [score:5]
The Cox2.2058 shRNA in the LMP shRNA expression cassette was cloned into the miR30 backbone of this targeting vector at the single XhoI /EcoRI site. [score:5]
pCol-TGM contains a miR30 -based expression cassette regulated by an inducible tetracycline response element (TRE) promoter. [score:4]
The LMP retroviral vector, a murine stem cell virus (MSCV) -based vector contains unique XhoI and EcoRI sites within a miR30-shRNA expression cassette, driven by the viral 5′LTR promoter ([17], [20] and Fig. 1A). [score:3]
These shRNA sequences, and their corresponding sense strand predictions, were synthesized as 97 mers and cloned into the miR30 shRNA backbone as described previously [21]. [score:1]
Appropriate products carrying the XhoI /EcoRI restriction sites at their ends and comprising the common and Cox2-specific stem sequences and the 19 bp loop were used to create miR30-adapted shRNAs. [score:1]
This vector contains an XhoI /EcoR1 cloning site for shRNAs within a miR30 backbone (shRNAmir). [score:1]
These sequences comprise the common and gene-specific stem and 19 bp loop of the miR30-context to create miR30-adapted shRNAs specific for Cox2. [score:1]
Using improved prediction methods for the design of miR30 -based shRNAs [20], we identified four 22-mer guide strand sequences; Cox2.284 (1), Cox2.1082 (2), Cox2.2058 (3) and Cox2.3711 (4) (Fig. 1A), complementary to the Cox2 coding region (1 and 2) or the Cox2 3′-UTR sequence (3 and 4). [score:1]
[1 to 20 of 12 sentences]
17
[+] score: 38
The predicted targets of miR-30e and miR-30e-as overlap considerably and there is significant enrichment of targets involved in cardiovascular disease for individual and overlapping predicted targets (67/283 common, p<0.01; 154/648 miR-30e only, p<10 [−6]; and 88/456 miR-30e-as only, p<0.5). [score:9]
Furthermore miR-30e is known to be commonly down-regulated in hypertensive heart disease [46] and regulates connective tissue growth factor in myocardial matrix remo delling [47], suggesting miR-30e and (by association) miR-30e-as have important roles in cardiac biology. [score:7]
Interestingly, both miR-301a and several members of the miR-30 family, which are also commonly longer than 24 nt in our dataset (Table S10), target the mRNA for plasminogen activator inhibitor-1, a protein involved in the pathogenesis of cardiovascular disorders [43]. [score:5]
0030933.g006 Figure 6(A) The miR-30e locus appears to be expressed bi-directionally, giving rise to miRNAs tags sets mapping to both, the sense (known) and antisense strands (novel; suffix –as denotes antisense-derived miRNA). [score:4]
Thirteen of the novel candidate miRNAs (termed ‘miR-N’ plus a serial number), and all of the antisense miRNAs, had expression of a miR* form (e. g. miR-N27 and miR-30e-as; Figure 6), providing additional confidence in suggesting these as a bona fide miRNA. [score:3]
Furthermore, we have verified the expression in HL-1 cells of two novel miRNA and their repective miR* (miR-N4/miR-N4* and miR-N29/miR-N29*) and one antisense miRNA (miR-30e-as) by high stringency PCR with melt curve analysis (Text S1 and Figure S9). [score:3]
The sequences for mature miR-30e and miR-30e-as are notably similar, and miR-30e-as is relatively abundant in the heart biopsy dataset at ∼4% of miR-30e expression. [score:3]
For high stringency PCR to validate novel miRNA expression, annealing temperatures were increased (61°C for miR-30e-as; 62°C for 10 cycles then reducing by 0.3°C per cycle until reaching 58°C for miR-N4, -N4*, -N29 and -N29*). [score:3]
Of the 8 identified novel antisense miRNAs present in our dataset, miR-30e-as is the most abundant and arguably the most interesting (Figure 6A&B, Figure S9). [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 38
In total, 114 miRNAs are significantly changed and can be classified into four groups (Figure 2A); 52 miRNAs, including the miR-30 family, are down-regulated during the first 8 days after infection (Figure 2B), 8 miRNAs are down-regulated before day 2 and up-regulated after day 2 after infection (Figure 2C), 2 miRNAs are up-regulated before day 2 and down-regulated after day 2 after infection (Figure 2D), and the remaining 52 miRNAs, including the miR-17 family, are up-regulated (Figure 2E). [score:19]
The combined miRNA expression, miRNA target and signaling pathway assays revealed that the members of the miR-30 family may negatively regulate genes involved in MAPK signaling and adherens junctions [15], whereas the miR-29 family are involved in activating endogenous pluripotent genes such as Oct4 and Nanog by targeting DNMTs [24]– [27]. [score:7]
Among 41 unique miRNA expression signatures for activation of the iPS reprogramming process, we found 4/6 members of the miR-30 family, that are down-regulated. [score:6]
In the activation step of iPS generation, increased expression of the miR-29 family and decreased expression of the miR-30 family are essential. [score:5]
Two mean signal intensity plots are shown for this group and the miR-30 family. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 37
Notably, the expression levels of miR-30e-5p, miR-210-5p, miR-224-5p miR-196b-5p and miR-669c-5p were significantly upregulated at a magnetic field intensity of 1 mT, but significantly downregulated at 2 mT and 3 mT compared with the sham group. [score:8]
The downregulation of miR-30e-5p might alter the expression of Slc7a11 and might induce apoptosis of GC–2 cells. [score:6]
Furthermore, Usp45 is also potential target of miR-30e-5p which is a regulator of XPF-ERCC1 crucial for efficient DNA repair [43]. [score:4]
In addition, Slc7a11 which might play an important role in conveying resistance to apoptosis is a potential target of miR-30e-5p [42]. [score:3]
The expression levels of miR-26b-5p, miR-30e-5p, miR-210-5p, miR-224-5p, miR-196b-5p, miR-504-3p and miR-669c-5p significantly differed between the ELF-EMF and the sham groups (Fold change > 2.0). [score:3]
0139949.g006 Fig 6 The expression levels of miR-30e-5p, miR-210-5p, miR-224-5p miR-196b-5p and miR-669c-5p were significantly higher in response to a magnetic field intensity of 1 mT but were significantly lower in response to magnetic field intensities of 2 mT and 3 mT than in the sham-exposure group (A, B, C, D and F). [score:3]
The expression levels of miR-30e-5p, miR-210-5p, miR-224-5p miR-196b-5p and miR-669c-5p were significantly higher in response to a magnetic field intensity of 1 mT but were significantly lower in response to magnetic field intensities of 2 mT and 3 mT than in the sham-exposure group (A, B, C, D and F). [score:3]
Following the network analysis and confirmation of the miRNA array data via real-time PCR, we examined the effect of the magnetic field intensity on the expression levels of miR-30e-5p, miR-210-5p, miR-224-5p, miR-196b-5p, miR-504-3p, miR-669c-5p and miR-455-3p (Fig 6). [score:3]
Among the selected miRNAs, the expression levels of miR-26b-5p, miR-30e-5p, miR-210-5p, miR-224-5p, miR-196b-5p, miR-504-3p and miR-669c-5p significantly changed compared with the sham group (Fold change > 2.0). [score:2]
However, miR-30e-5p, miR-210-5p, miR-224-5p, miR-196b-5p, miR-504-3p, miR-669c-5p and miR-455-3p may be closely related to the epigenetic mechanism associated with ELF-EMF exposure at a magnetic field intensity of 3 mT (Fig 5B). [score:1]
This analysis indicated that miR-30e-5p is related to the epithelial mesenchymal transition [44]. [score:1]
[1 to 20 of 11 sentences]
20
[+] score: 36
Here we report that this is indeed the case; in particular, our results show that three microRNAs (miRNAs), mmu-miR-181a-1*, mmu-miR-30e and mmu-miR-34a, show no age -dependent up-regulation in CR animals, seen in ad lib-fed controls, nor reciprocal up-regulation of their target, the Bcl-2 gene. [score:9]
A disparity exists between MMChip results and qPCR in miR-30e expression, when 24 month old CR-fed mice are compared to 24 month old ad lib-fed control mice; the array results show decreased expression, whereas qPCR results show increased expression in 24-month CR-fed mice (Figure 1B). [score:6]
Figure 3. Immunocytochemistry analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) suppression of endogenous Bcl-2 in both 293 (A) and NIH-3T3 (B) cell strains. [score:3]
Immunocytochemistry analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) suppression of endogenous Bcl-2 in both 293 (A) and NIH-3T3 (B) cell strains. [score:3]
)Among these, three microRNAs, mmu-mir-181a-1*, mmu-mir-34a and mmu-mir-30e, exhibit the most significant down-regulation in brains of CR-fed mice, in an age -dependent manner, compared to ad lib-fed mice (Figure 1B). [score:3]
In the present study, our data report that lead microRNAs (mmu-miR-181a-1*, mmu-miR-30e and mmu-miR-34a) are not up-regulated in the older CR mouse brain, compared with their ad lib counterparts. [score:3]
Among these, three microRNAs, mmu-mir-181a-1*, mmu-mir-34a and mmu-mir-30e, exhibit the most significant down-regulation in brains of CR-fed mice, in an age -dependent manner, compared to ad lib-fed mice (Figure 1B). [score:3]
The in situ hybridization was performed for miR-34a, miR-30e and 181a-1* as described previously [34]. [score:1]
Graphical representations of densitometric analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) hybridization in cortex and hippocampal regions. [score:1]
Graphical representations of densitometric analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) staining in cortex and hippocampal regions. [score:1]
In brief, 1 × 10 [6] cells were suspended in 100 μL nucleofector solution, and transfected with 5 μg of plasmids (vector control, scrambled control, mmu-miR-34a, mmu-miR-30e or mmu-miR-181a-1*). [score:1]
For co-transfection, the Bcl-2 3'UTR construct was co -transfected with vector alone, scrambled control, miR-34a, miR-30e and miR-181a-1* (1:1 ratio). [score:1]
Figure 2. (A) In situ hybridization (ISH) detection of miRNAs (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*)in mouse brain tissues from both CR- and Ad lib-fed mice. [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 34
We found that RUNX3 overexpression up-regulated and inhibition downregulated the expression of miR-30a, but had no effect on miR-30e level (Fig.   5B and C). [score:13]
We overexpressed or knocked down RUNX3 in gastric cancer and detected the mRNA expression of miR-30a and miR-30e. [score:6]
Human miR-30a and miR-30e mimics, control mimics, and miR-30a inhibitors and control inhibitors were synthesized from RiBoBio (Guangzhou, China). [score:5]
Therefore, we overexpressed or knocked down RUNX3 in BGC-823 and SGC-7901 cells and used qRT-PCR to detect the miR-30a and miR-30e mRNA levels in these cells. [score:4]
We searched miRNA databases to analyse these differentially expressed miRNAs and found that among the 15 miRNAs, only miR-30a and miR-30e were partly complementary to the conserved site within the 3′ UTR of vimentin (Fig.   5A). [score:3]
Among these miRNAs, miR-30a and miR-30e were predicted to target to vimentin. [score:3]
[1 to 20 of 6 sentences]
22
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
23
[+] score: 29
Finally, the fact that consistent expression of five genes in circulating miRNA expression profiles exists from multiple mouse strains, at different ages, and with different disease mo dels provides strong evidence that miR-146a, miR-16, miR-195, miR-30e, and miR-744 are useful as circulating miRNA endogenous references. [score:7]
As shown in Figure 2, these five serum miRNAs, miR-146a, miR-16, miR-195, miR-30e, and miR-744 were stably expressed in mouse regardless of strain, age, and disease condition. [score:5]
As shown in Figure 2, miR-146a and miR-16 are highly expressed in serum, while miR-30e, miR-195, and miR-744 have lower expression levels. [score:5]
Furthermore, miR-146a and miR-16 are highly expressed in serum, while miR-30e, miR-195, and miR-744 have relatively lower expression. [score:5]
We have found five miRNAs, miR-146a, miR-16, miR-195, miR-30e, and miR-744 to be stably expressed in all tested strains across different ages and conditions. [score:3]
Notably, these five miRNAs, miR-16, miR-744, miR-195, miR-146a, and miR-30e share a 100% identity between human and mouse [32], [33], [34], [35]. [score:1]
0031278.g002 Figure 2−ΔC [T] values of miR-146a, miR-16, miR-195, miR-30e, and miR-744 show stability across all samples (w = weeks). [score:1]
These 72 miRNAs were candidate endogenous controls, following a series of statistical analyses only five genes (miR-146a, miR-16, miR-195, miR-30e, and miR-744) passed the criteria of ANOVA p>0.3, SD<1, and pair-wise |ΔΔ C [T]|<0.5. [score:1]
−ΔC [T] values of miR-146a, miR-16, miR-195, miR-30e, and miR-744 show stability across all samples (w = weeks). [score:1]
[1 to 20 of 9 sentences]
24
[+] score: 27
MiRNA-30c belongs to the miRNA-30 family, which consists of five members that are ubiquitously expressed, all of which are among the most highly expressed miRNAs in the heart. [score:5]
Since the seed region is identical between members of the miRNA-30 family, it can be expected that there is a substantial overlap in the targets that they regulate. [score:4]
Since we observed no changes in overall mitochondrial morphology in our in vivo mo del, our results contradict the in vitro studies reported by Li et al. who found impaired mitochondrial fission in cultured neonatal cardiomyocytes when overexpressing miRNA-30 [17]. [score:3]
Members of the miRNA-30 family also affect mitochondrial fission and apoptosis in cultured neonatal cardiomyocytes, an effect attributed to miRNA-30c targeting of p53 [17]. [score:3]
In addition, in zebrafish, miRNA-30 overexpression with mimic sequences leads to excessive blood vessel sprouting, showing the ability of this miRNA to induce angiogenesis in vivo. [score:3]
As the miRNA-30 family has five members, of which several have genomic duplications, a genetic knock-out approach is highly impractical. [score:2]
Having generated a stable and specific miRNA-30 overexpression mo del we phenotypically compared wildtype and transgenic hearts. [score:2]
112.267732 12 Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, et al. (2009) miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
However, little is known on the role of the miRNA-30 family in the heart in vivo. [score:1]
As a consequence, functional redundancy is expected between the miRNA-30 family members. [score:1]
Uncovering the exact role of miR30 in vivo is highly relevant as miRNA-30c was identified as the top candidate for inducing cardiomyocyte hypertrophy in an unbiased miRNA mimic screen in neonatal rat cardiomyocytes [13]. [score:1]
[1 to 20 of 11 sentences]
25
[+] score: 27
The targeting of Slug mRNA by miR-30 results in downregulation of fascin and upregulation of the tight junction proteins CLDN-1, CLDN-2, and CLDN-3, which downregulates EMT and, ultimately, reduces the rate of breast cancer progression. [score:12]
miR-30 family members, including miR-30a, are downregulated in estrogen receptor–negative and progesterone receptor–negative breast tumors, suggesting that these hormones are involved in de novo synthesis of miR-30 family members [26, 27]. [score:4]
We are currently mapping the specific region that harbors the hormone-response element(s) in the miR-30 promoter and will identify the hormonal mechanism that regulates miR-30 expression, which could help determine the clinical benefit of endocrine therapy in individuals with hormone receptor–positive breast cancer. [score:4]
This supported a suppressive function for miR-30 in breast cancer invasiveness and metastasis in vivo. [score:3]
According to data sorting of the mRNA sequences bound to miRNAs, miR-30 family members (miR-30a, -30b, -30c, -30d, and -30e) share the same seed sequence (Supplementary Figure S1), suggesting that other miR-30 family members may also suppress Snail or Slug. [score:3]
Additional studies are needed to determine whether defects in miR-30 family members act independently or jointly to drive the progression of breast cancer. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 25
To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families. [score:5]
Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C). [score:3]
In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7). [score:2]
Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs. [score:2]
The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. [score:1]
We used a pair of reporters, one of which had an inserted single miR-30 perfect binding site (1xP miR-30) while the other did not have the insertion (Figure 6B). [score:1]
Furthermore, the dose-response trends were highly similar for the majority of the compounds; the pattern was the most striking for the miR-30 experiment in HeLa cells (Figure 6A). [score:1]
For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E). [score:1]
Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites. [score:1]
Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005). [score:1]
Except for the control and 1xP miR-30 reporters, which utilized the SV40 promoter and 3′ UTR, all other reporters were driven by the PGK promoter and had BGH 3′ UTR. [score:1]
Remarkably, the majority of compounds yielded a comparable impact on luciferase activity regardless of the presence of the miR-30 perfect binding site. [score:1]
The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010) into pGL4_SV40 using XbaI and ApoI restriction sites. [score:1]
Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively. [score:1]
Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. [score:1]
To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A). [score:1]
Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites. [score:1]
[1 to 20 of 17 sentences]
27
[+] score: 22
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
Specifically, miR-30b and miR-30c showed more significant differences from miR-30a, miR-30d and miR-30e than from each other and vice versa. [score:1]
Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
Shuffling analysis of miR-30 family members revealed similar specificity, although certain preferences were more significant than others (Fig. 7d). [score:1]
Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown. [score:1]
An exception was G–U wobble interactions, which showed strong preferences such as miR-30 position 3 (Supplementary Fig. 3d). [score:1]
Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference. [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-30c was upregulated by HDI in all the three experiments, miR-30d was upregulated in two of the three experiments, while miR-30b and miR-30e were upregulated in one of the three experiments but were downregulated in the other two experiments. [score:13]
All the five miR-30 miRNAs were expressed in B cells stimulated by LPS plus IL-4. The abundance of miR-30b, miR-30c, miR-30d, and miR-30e were greater than that of miR-30a (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
The miR-30 family consists of five miRNAs (miR-30a, miR-30b, miR-30c, miR-30d, and miR-30e) encoded by different host genes. [score:1]
The miR-30 family members are similar to each other and have identical seed sequences. [score:1]
Like human PRDM1 (48), the 3′ UTR of mouse Prdm1 mRNA contains three highly conserved bindings sites complementary to the seed sequence of miR-30a and other miR-30 family members (Figure 8). [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 20
Both miR30-shRNA and pX330-gFoxp1 inhibited the expression of FOXP1 in the E17.5 neurons as demonstrated by the loss of colocalization of GFP and FOXP1 immunofluorescence in the CP (Fig 2Ca–b and 2Ea–b). [score:5]
Both the targeting and the scramble sequences were also cloned into pCAG-miR30 system (Addgene), which is a pri-miRNA based shRNA -expression vector contributed by Connie Cepko [30]. [score:5]
The miR30 -based shRNA expression system was introduced into the brain by IUE at E14.5. [score:3]
Correspondingly, more neurons were stalled in the IZ when Foxp1 was inhibited (miR30-ScrRNA: 29.2%; miR30-shRNA-b: 53.5%) (Fig 2D), indicating a migratory delay. [score:3]
Therefore, the targeting and scramble sequences were embedded into the murine miR-30 using pCAG-miR30 vector system. [score:3]
At E17.5, a reproducible migration defect was observed in Foxp1 miR30-shRNA-b group by comparison with the control (miR30-ScrRNA) (Fig 2C). [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 19
Inhibiting endogenous background CSE gene expression, and direct administration of H [2]S at 100 microM induced apoptosis in HASMCs[146] Transfected with miR-30 mimics HEK293 cells and primary neonatal rat myocardial cellsOverexpression of miR-30 family members decreases the expression of CSE protein and H [2]S production. [score:10]
Knockdown of miR-30 family members leads to the upregulation of CSE and H [2]S production rates[164]  Diabetes CSE adenovirus gene transfer Transfection of insulin secreting beta cell line INS-1E cellsCSE overexpression stimulates INS-1E cell apoptosis via increased endogenous production of H [2]S. Ad-CSE transfection inhibited ERK1/2 but activated p38 MAPK. [score:9]
[1 to 20 of 2 sentences]
31
[+] score: 19
Thus, members of the miR-30 family were significantly down-regulated so that expression of its main target p53 could be suitably elevated to counteract the higher proliferation in recovering lung tissues, which are more prone to DNA damage and mutation in the presence of increased DNA synthesis [41]. [score:9]
TargetScan analyses also revealed specific miRNAs highly involved in targeting relevant gene functions in repair such as miR-290 and miR-505 at 7 dpi; and let-7, miR-21 and miR-30 at 15 dpi. [score:5]
Hence, miR-30 appears to act as a tumor suppressor, with its subdued expression facilitating proliferation, but concurrently activating the negative feedback loop of p53, thus showcasing the intricate roles that miRNAs play in pulmonary damage and repair [42]. [score:5]
[1 to 20 of 3 sentences]
32
[+] score: 19
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
Interestingly, dihydropyrimidinase-related protein 2, DPYSL2, a highly abundant protein in brain, is targeted by miR-30, 20 and 181 and has been shown to be up-regulated in proteomic studies on APP23 mice already at a very early age [63]. [score:6]
In addition, specific members of the miR-30 family (30c and 30b) were also significantly down-regulated in response to Aβ. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
[1 to 20 of 4 sentences]
33
[+] score: 18
Figure 7(A) Representative images of HUVECs with miR-30b overexpression (HUVEC [miR-30b]) and their negative control (HUVEC [scrambled]); (B) The expression of miR-30b; (C) Representative images of tube-like structures and quantitative analysis of the total tube length (4× magnification microscopic fields); (D) TargetScan shows that 3′ UTR of DLL4 contains conserved miR-30 family binding sites; (E and F) The expression of DLL4 in HUVECs (mRNA and protein, respectively) (* P < 0.05 vs HUVEC [scrambled]). [score:9]
Previous studies reported that DLL4, one of miR-30 family targets, modulates endothelial cell behavior during angiogenesis [31, 45]. [score:3]
TargetScan shows that the 3′ UTR of DLL4 contains the conserved miR-30 family binding sites (Figure 7D). [score:3]
miR-30 family targeted DLL4 in endothelial cells to promote angiogenesis [31]. [score:3]
[1 to 20 of 4 sentences]
34
[+] score: 18
Some of the results are in accordance with previous studies, such as the up-regulation of mmu-miR-221 and mmu-miR222 cluster and the down-regulation of the mmu-miR-200 family, as well as of mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e*. [score:7]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
The down-regulation of mmu-miR-30a*, mmu-miR-30e*, mmu-miR-193 and mmu-miR-378 during HFD -induced obesity is consistent with previous studies [19], [37], [50]. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
[1 to 20 of 4 sentences]
35
[+] score: 18
Thus, the downregulation of miR-133 and miR-30 may contribute to the development of cardiac fibrosis in DBL mice, as both regulate the profibrotic signalling factor, CTGF [30], which was correspondingly upregulated. [score:9]
These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling. [score:5]
Downregulated miRNAs included miR-1 and miR-133a, which are part of the same transcriptional unit, and three miR-30 family members, namely miR-30b, miR-30c and miR-30e. [score:4]
[1 to 20 of 3 sentences]
36
[+] score: 17
Knockdown of NF-κB-p65 by small interfering RNA (siRNA) significantly suppresses radiation -induced miR-30 expression in CD34+ cells [45]. [score:6]
miR-30e targets KRAS for NF-κB, HIF-1 and EPO singling and JUN for only HIF-1 and EPO singling. [score:3]
Nevertheless, suppression of miR-30 and IL-1β protects CD2F1 male mice and human CD34+ cells from radiation injury [45]. [score:3]
miR-29b, and miR-30e in CI may be involved in induced inflammatory damage by activating NF-κB signaling pathway and regulation of osteoblast differentiation [56– 58]. [score:2]
Using IPA program, Fig 10 shows that miR-30e reduction leads to multifactorial changes including IL-1 and TNF-α. [score:1]
Likewise, CI decreased miR-30e by 2.19 fold (Table 1). [score:1]
Zu et al. [59] reported that miR-30e decrease led to hyperactive NF-κB. [score:1]
[1 to 20 of 7 sentences]
37
[+] score: 17
[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21. [score:7]
Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21. [score:7]
There was no significant change in miR-133, miR-30, or miR-101 family members after LPS. [score:1]
Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure). [score:1]
The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7. [score:12]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 17
However we found deregulated at least two genes (Bglap2 and Il1f9) regulated by Runx2, a direct target of miR-30 family [7], [9]. [score:6]
Recent data highlighted a role of miR-30 in the inhibition of EMT in hepatocytes [13], process which is important for mammary gland involution. [score:3]
miR-30 family targets validated in the literature. [score:3]
The miR-30 family is also involved in the control of structural changes in the extracellular matrix of the myocardium [14], in cellular senescence [15] and in the regulation of the apoptosis [16]. [score:2]
These observations could corroborate to recent published data on the miR-30 family that highlighted its role in the differentiation of various cell types including adipocytes [7], B-cells [8] or osteoblasts [9]. [score:1]
The miR-30 family is highly conserved in Vertebrates, it is composed by 6 miRNA (miR-30a, -30b, -30c-1, -30c-2, -30d and -30e) and it is organized in 3 clusters of two miRNA localized on 3 different chromosomes. [score:1]
miR-30b is a member of the miR-30 family, composed of 6 miRNA that are highly conserved in vertebrates. [score:1]
[1 to 20 of 7 sentences]
40
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 16
The most up-regulated miRNAs were miR-689, miR-802, miR-29c, and miR-30e, and their expression levels were increased at least 3-fold. [score:6]
Of the 113 miRNAs with significantly aberrant expressions after RDX exposure, the expression levels of 10 miRNAs were significantly increased in both mouse liver and brain (p < 0.01): miR-99a, miR-30a, miR-30d, miR-30e, miR-22, miR-194, miR-195, miR-15a, miR-139-5p, and miR-101b. [score:5]
In addition, two other members of the miR-30 family (miR-30d and miR-30e) that target BDNF (Mellios et al. 2008) were also overexpressed (Tables 1 and 2, Figure 4). [score:5]
[1 to 20 of 3 sentences]
42
[+] score: 15
Cre-conditional expression of rAAV2/9- CAG::FLEX-rev-hrGFP:mir30(Scn9a) in Agrp [Cre] mice (AGRP [sh(Scn9a)] mice, Figures 4H and 4I) reduced EPSP duration resulting in synaptic potentials that decayed with the membrane time constant (AGRP [sh(Scn9a)]: 116% ± 8% of τ [m], n = 14; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p < 0.001), whereas expression of a scrambled Scn9a shRNA sequence maintained prolonged EPSPs (AGRP [sh(Scn9a-scram)]: 271% ± 3% of τ [m], n = 7; Npy [hrGFP]: 330% ± 20% of τ [m], n = 13; unpaired t test, p = 0.15, Figure 5A). [score:5]
This method couples reporter gene expression (humanized Renilla green fluorescent protein [hrGFP]) to RNA interference with a microRNA (miR30) cassette that was modified (Stegmeier et al., 2005, Stern et al., 2008) to encode a shRNA sequence for Scn9a in the 3′-untranslated region, allowing identification of neurons transduced with the short hairpin RNA (shRNA) (Figures 4A and 4B). [score:5]
Constructs for Scn9a Knockdown miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www. [score:2]
php) and then chose a sequence with <76% homology to RefSeq transcripts in the mouse genome and that also obeyed gui delines for miR30 -based shRNA (Dow et al., 2012, Matveeva et al., 2012) (see the Supplemental). [score:1]
To produce a negative control for this miR30 -based Scn9a shRNA construct, we used a website to produce a scrambled sequence (http://www. [score:1]
miR30 -based shRNA constructs for Scn9a were developed using miR_Scan software (http://www. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 15
Importantly, we describe an shRNA prediction tool that can effectively predict high potency shRNA target sequences when imbedded in the miR30 context, and we show that more than half of the sequences tested had the ability to knockdown gene expression from single copy, Dox-inducible cassette in embryonic stem cells. [score:6]
While we have not yet examined the effect of these modifications with our shRNA selection algorithm, we anticipate that this may further improve the efficiency of miR30 shRNA mediated gene knockdown. [score:2]
pENTR1a-dsRed-m30c was constructed by first cloning dsRed-Express (Clonetech) into pENTR1a (Invitrogen) with SalI/NotI, then the miR30 based context was cloned into NotI/XbaI sites of pENTR1a-dsRed using the following primers: miR30 5’Arm 5’cgtaaGCGGCCGCGTCGACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGG 3, miR30 mid Arm 5’CTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTCGAGCAACCAGATATCGAATTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACT 3’, miR30 3’Arm 5’GGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTCTAGAcgtaa 3’. [score:2]
Recently, site-specific insertion of inducible microRNA-30 context (miR30c) based shRNA cassettes in embryonic stem cells have enabled rapid generation of mice with inducible gene knockdown [1, 2]. [score:2]
Fluorescent miR30-shRNA or Flag tagged NPAS4, SIM2s and SIM2l cDNAs were recombined into pFLP-Inducer or pLVTPT vectors by LR recombination. [score:1]
Recently, a number of high throughput experiments have been performed to identify potent shRNA sequences which, when embedded with the miR30 -based context, successfully produce functional siRNAs [19, 20]. [score:1]
Generation of a miR30 shRNA selection algorithm. [score:1]
[1 to 20 of 7 sentences]
44
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
45
[+] score: 14
For lentiviral -mediated knockdown of Trp53, we generated a vector (pLenti X1 Puro DEST, Addgene 17297) containing the U6 promoter (derived from pENTR/pSM2 (U6), Addgene 17387) driving expression of a previously described (Dickins et al, 2005) miR30 format shRNA against Trp53 (1224) or expressing an empty (ns) miR30 backbone. [score:6]
Cells were infected with adenoviruses expressing GFP (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700), retroviruses (LMP) expressing non-silencing hairpin or miR30-shRNA against Trp53 (Dickins et al, 2005), lentiviruses (L KO. [score:5]
I. Proliferation assays of Vhl [fl/fl] MEFs infected with GFP or Cre and lentiviruses expressing an empty miR30 shRNA (shRNA-ns) or miR30-format shRNA directed against Trp53 (shRNA-Trp53). [score:3]
[1 to 20 of 3 sentences]
46
[+] score: 14
Inhibiting low-density lipoprotein receptor-related protein 6 by miR-30e overexpression significantly downregulates β-catenin/Tcf transcriptional activity and dramatically inhibits osteoblast differentiation [45]. [score:10]
Wang J. Guan X. Guo F. Zhou J. Chang A. Sun B. Cai Y. Ma Z. Dai C. Li X. Mir-30e reciprocally regulates the differentiation of adipocytes and osteoblasts by directly targeting low-density lipoprotein receptor-related protein 6 Cell Death Dis. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 13
Studies have described miRNA binding sites for miR-30 within the extended region of Lhx1 3'UTR, where miR-30 inhibits Lhx1 expression and therefore embryonic kidney differentiation [28] (Figure 2C). [score:5]
MiR-30 was abundantly detected in our miRNA-Seq dataset, where it has been previously shown to be a critical regulator of kidney development [28]. [score:3]
Literature evidence of microRNA association is represented for Lhx1 (miR-30) and Hoxa11 (miR-181) along with other known transcriptional regulatory relationship (dotted arrows). [score:2]
Only Lhx1 has been characterized as target of miR-30 within the context of kidney development [28]. [score:2]
C: Riboprobes used for in situ hybridization (ISH): i) overlapping the canonical region as represented by Affymetrix probeset 1421951_at and ii) overlapping extended 3' signal captured by RNA-Seq and probeset 1450428_at, which also contains a microRNA binding site for miR-30 [28]. [score:1]
[1 to 20 of 5 sentences]
48
[+] score: 13
BIM shRNA knockdown and retroviral expression of miR-17-92The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems). [score:7]
The knockdown of BIM expression was accomplished using LMP miR-30 -based shRNAs with puromycin selection marker (V2LMM_220682 from Open Biosystems). [score:4]
A miR-30 -based shRNA was used to knockdown BIM expression by 80% as measured by Western blot analysis [21] (Supplementary Figure 1). [score:2]
[1 to 20 of 3 sentences]
49
[+] score: 12
Furthermore, inhibition of PI3K expression at the time of reperfusion abrogated p-Akt expression and the anti-autophagy effect of miR-30a induced by Sal B. Taken together, these data demonstrate that Sal B can alleviate I–R-injured myocardial cells through miR-30/PI3K/Akt pathway -mediated suppression of autophagy. [score:9]
Circulating miR-30 has been shown to be positively associated with left ventricular wall thickness, and regarded to be an important marker for the diagnosis of left ventricular hypertrophy due to miR-30a -induced alterations in expression of the beclin-1 gene and autophagy in cardiomyocytes [8]. [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 12
Briefly, the ‘Flp-In' targeting vector, called pCol-TGM, was configured with a GFP ‘spacer' between a tetracycline-regulated element and the miR30 -based expression cassette. [score:6]
Nine shRNA guide sequences predicted to target Rtn1 for knockdown were embedded into a miR30 -based expression cassette of a retroviral DOX-inducible shRNA vector. [score:6]
[1 to 20 of 2 sentences]
51
[+] score: 12
We therefore decided to camouflage the antiviral target sequences as the cell’s own microRNA (miRNA) in similar ways, as miRNA-30-like precursors have been used for the study of gene function before [11] to circumvent a hypothetical cellular response mechanism. [score:3]
Also HBsAg suppression was slightly more efficient, when a miRNA-26-like construct was used, whereby miRNA-122-like and miRNA-30-like constructs exhibited similar efficiency. [score:3]
Eventually we selected a pEPI-U6-miRNA-30-like clone targeting transcripts of HBV ORF X/ORF P for further experiments. [score:3]
To circumvent putative hepatocellular ‘friend or foe’ recognition, we mimicked hsa-miRNA-30-like molecules, which were compared to other miRNA-like constructs for their suppressive potency in prior experiments. [score:2]
D. in HBV-Met treated with miRNA-30 L-X1 versus untreated HBV-Met. [score:1]
[1 to 20 of 5 sentences]
52
[+] score: 11
MiR-30 family members are strongly upregulated during adipogenesis in human cells, and inhibition of miR-30 inhibits adipogenesis [12]. [score:8]
miR-30 family members have also been demonstrated to act as positive regulators of adipocyte differentiation in a human adipose tissue-derived stem cell mo del [35]. [score:2]
The miR-30 family has been found to be important for adipogenesis [12]. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 11
This observation suggests a possible unidentified interaction between miR-30 and BDNF promoter as well as multiple layers of regulation of BDNF level by targeting both 3′-UTR and promoter regions. [score:4]
Members of the miR-30 family were previously reported to target both human and mouse BDNF at the 3′-UTR (55, 56). [score:3]
For example, members of the miR-30 family were good candidates given that they are predominantly nuclear-localized and were predicted to commonly target human and mouse BDNF sense promoter with strong favorable thermodynamic interaction. [score:3]
Experimental evidence for the existence of nuclear miRNAs was also present for the three miRNA families, namely miR-188, miR-671 and miR-30. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 11
Therefore, expression of select miRNAs, including the miR-199 and miR-30 families, decreases during reprogramming and may allow for the upregulation of SIRT1 protein expression. [score:8]
Additionally, all five members of the miR-30 family that potentially target SIRT1 were higher in MEFs than iPS and mESCs. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 10
The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
The two shRNA sequences were placed into miR30 context downstream eGFP CDS and thereby lentiviral vectors expressing the miR-shRNAs, named as FUW-eGFP-miR-shRNA in this article, were constructed (Fig. 1). [score:3]
0030560.g001 Figure 1 The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
To place the shRNA sequences into miR30 context, a 97-mer sequence containing the designed shRNA was retrieved through the RNAi design algorithm, which was then subcloned into the site of pri-miRNA area downstream the eGFP coding sequence (CDS) in pRIME vector as previously described [10]. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 10
Among the miRNAs that were significantly upregulated in SAMP8 compared with SAMR1 mice, miR-30e-5p, miR-125b-5p, and miR-128-3p have also been reported to be upregulated in post-mortem human AD hippocampus (Lukiw, 2007; Cogswell et al., 2008). [score:6]
Notably, our study highlights the upregulation of miR-30e-5p, miR-125b-5p, and miR-128-3p as common epigenetic features in the hippocampus of SAMP8 mice and post-mortem hippocampus from AD patients. [score:4]
[1 to 20 of 2 sentences]
57
[+] score: 10
miR30 is significantly down-regulated in several cancers, including breast cancer [30] and lung cancer [31] and it has been hypothesized that miR30 may play an important role in tumorigenesis and tumor development. [score:5]
The results showed that CLCNs were able to transfect the cells with miR30b as well as DharmaFect did and the miR30-b expression in vitro was increased by using CLCNs or DharmaFect. [score:3]
However, the function of miR30 especially in NSCLC remains unclear [32]. [score:1]
The tissues sections were collected 24 hours after treatment with CLCN D275/miR30 b complexes (1.5 mg/kg). [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 10
Inhibiting low density lipoprotein receptor-related protein 6 by miR30e over expression significantly downregulates β-catenin/Tcf transcriptional activity and dramatically inhibits osteoblasts differentiation [28]. [score:10]
[1 to 20 of 1 sentences]
59
[+] score: 10
An shRNA is expressed under regulation of a U6 promoter and is flanked by pri-miR-30 5′ and 3′ sequences, which are 151 and 128 bp long, respectively. [score:4]
The shRNA sequences (Figure 1B, Table S1) targeting human huntingtin (shHTT) and EGFP (control reagent, shCTRL) were designed using the RNAi Codex database (Olson et al., 2006) with a mir-30 loop between the passenger and guide strands. [score:3]
We have assembled a silencing construct and stably integrated it into the iPSC genome; this construct is based on the piggyBac transposase system (Yusa et al., 2011) and contains anti-HTT or control shRNA in the mir-30 backbone (Paddison et al., 2004), and the gene encoding mOrange2 fluorescent protein (Shaner et al., 2008) as a reporter (Figure 1A). [score:1]
We used a piggyBac transposase system (Yusa et al., 2011) and anti-HTT shRNA in the mir-30 backbone (Paddison et al., 2004) which provides additional possibility for future excision of the reagent if desired. [score:1]
Constructs (Figure 1A) composed of a U6 promoter, a miR-30 5′ flank (151 bp), an shRNA sequence, a miR-30 3′ flank (128 bp), a U6 terminator (TTTTTT), an EF1alpha promoter, an mOrange2 reporter gene, and an SV40 pA site were were synthesized by Genscript (Piscataway, NJ) and cloned into a pPB-HKS-neoL vector obtained, by removing the EGFP reporter gene, from a pPB-UbC. [score:1]
[1 to 20 of 5 sentences]
60
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
These miRNAs (miR-15a, miR-30, miR-182, and miR-804) are involved in cell proliferation, apoptosis, inflammation, epithelial-mesenchymal transition, invasion, oncogene inhibition, and intercellular adhesion. [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 10
Figure 1 Expression of concatenated miR30 -based shRNAs in a single transcript can promote efficient knockdown of at least three target genes. [score:6]
Prom; any of the pol II promoters listed in Fig. 2a, attL1 + attL2; Gateway recombination sites, 5'miR + 3'miR; flanking sequence derived from human miR30. [score:1]
Although we clone shRNAs into our entry vectors using BfuAI compatible linkers, we include Xho I and Eco RI cloning sites in the flanking miR30 sequence to allow subcloning of miR-shRNAs from popular whole genome libraries [2, 7] into our plasmids (Fig. 2b). [score:1]
For shRNAs cloned as BfuAI site-compatible linkers (see methods), shRNA sequence is introduced at the junctions of the 5' and 3' miR30 sequence (light blue). [score:1]
For shRNAs subcloned from commercially available whole genome libraries [2, 7], fragments can be subcloned to the XhoI/EcoRI sites (dark blue) within the 5' and 3' miR30 sequence. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 9
shRNA against GOI was expressed by CAG-LSL-mir30, which is a Cre -dependent shRNA expression vector 14. [score:5]
The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14 (Addgene plasmid #13786). [score:1]
The amplified products were ligated into XhoI/EcoRI sites of pCAG-loxP-stop-loxP-mir30 vector 14. [score:1]
Small hairpin RNA (shRNA) can be transfected into cortical neurons by the IUE -mediated transfection of CAG promotor/microRNA30 -based RNAi vector (CAG-LSL-mir30) 14. [score:1]
pK225 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi)] and pK226 [pCAG-loxP-stop-loxP-mir30 (LacZ RNAi Scramble control)]: For single cell LacZ knockdown, the shRNA against the coding region of LacZ (651–671) and its scramble control were generated by PCR with the template oligonucleotide for LacZ shRNA WL090 and the template oligonucleotide for LacZ shRNA scramble control WL091, respectively, using the primers HM082/HM083. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 9
Murchison et al. first investigated the expression of miRNAs in mouse oocytes, and they demonstrated that the miR-30, miR-16 and let-7 family was overexpressed in mouse germinal vesicle (GV) oocytes, speculating, as a result, that miRNAs might play important regulatory roles in the expression of mRNAs during the process of follicular maturity [23]. [score:6]
Furthermore, Tang et al reported that the miR-30, miR-16, let-7 and miR-17-92 family, which was detected in mature mouse oocytes, dynamically regulated oogenesis and early embryonic development. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 9
Moreover, the down-regulation of 3 microRNAs (microRNA-30e-5p, -340-5p, -142b) resulted in a prediction of 2′324 potentially up-regulated microRNA targets associated with bone morphogenetic proteins (BMP) (P = 5.328E-8), Ephrin (P = 2.44E-12) and cytoskeleton remo deling processes (P = 1.68E-07). [score:9]
[1 to 20 of 1 sentences]
65
[+] score: 9
Let-7f-2-3p (GD 17.0), miR-30e (GD 18.0), and miR-709 (GD 18.0) were upregulated by flutamide in our experiment, whereas they were upregulated by hyperoxia during the postnatal period [60, 61]. [score:7]
Among these, insulin-like growth factor 1 gene (IGF1) was under positive regulation by androgens through miR-215 on GD 17.0, and through miR-30e, miR-1251, miR-709, miR-344f-3p, and miR-466l-5p on GD 18.0. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 8
On the contrary, it has been shown that miR-30 can inhibit the self-renewal and induce apoptosis of breast tumor-initiating cells (BT-ICs) by silencing Ubc9 and ITGB3 [42]. [score:3]
Above evidences indicate that miR-30 is a multifunction gene which can inhibit or induce the apoptosis. [score:3]
miR-30b is one of the miR-30 family which is associated with the development of many types of cancers. [score:2]
[1 to 20 of 3 sentences]
67
[+] score: 8
As a group of tumour suppressors, the miR-30 family has been reported to be downregulated in many human cancers, including colorectal cancer [21], lung cancer 22, 23, thyroid cancer [24], renal cell carcinoma [25] and gastric cancer [26]. [score:6]
MiR-30a is a member of miR-30 family, which also includes miR-30b, miR-30c, miR-30d, and miR-30e. [score:1]
Ye Y 3,3’-diindolylmethane induces anti-human gastric cancer cells by the miR-30e-ATG5 modulating autophagyBiochem. [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 8
To temporarily and reversibly control p53 expression in vivo, we utilized TRE-p53.1224 transgenic mice in which expression of a miR-30 -based p53.1224 shRNA is regulated by a tetracycline-responsive element (TRE) 17. [score:6]
Expression of miR-30 -based p53.1224 shRNA was detected using a Custom TaqMan MicroRNA Assay (Applied Biosystems). [score:2]
[1 to 20 of 2 sentences]
69
[+] score: 8
As shown in Figure 6A, mRNA targets of several miRNA families were found to be significantly upregulated in hypertrophy (false discovery rate (FDR) <0.05), including those targeted by miR-29, miR-1, miR-9, miR-30, and miR-133. [score:8]
[1 to 20 of 1 sentences]
70
[+] score: 8
The miRNA control contains a luciferase shRNA cloned onto the stem of miR-30 [59], while the control shRNA targets firefly luciferase cloned as an shRNA. [score:3]
Tumors and metastases derived from implanted 4T1 cells or 4TO7 cells that were unmodified or infected with retroviruses expressing a control miR-30 stem insert or the miR-141-200c miRNA cluster within the miR-30 stem were stained with PCNA. [score:3]
The miR-30 stem containing an shRNA against firefly luciferase was used as a negative control. [score:1]
To evaluate the effect of miR-200 and Zeb2 on tumor formation and metastasis, we next engineered retroviruses encoding the miR-141-200c cluster mature miRNAs or control virus expressing firefly luciferase shRNA or Zeb2 shRNA within the miR-30 stem. [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 8
miR-494 and miR-30e were both targets on the apoptosis-related gene involved in the regulation of the level of apoptosis in the host; apoptosis is one of the main reasons for the development and growth retardation of S. japonicum in M. fortis [55], which means that it might be also one of the key players in the interaction of S. japonicum and M. fortis. [score:5]
miR-30 was reported to result in an increase in Bcl-2 expression and a decrease in pro-apoptosis genes, such as Bax, and cleavage of caspases [53, 54]. [score:3]
[1 to 20 of 2 sentences]
72
[+] score: 8
We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34). [score:7]
These include 5 members of the broadly conserved let-7 family (mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7e-5p, and mmu-let-7f-5p); 2 members of the miR-30 family (mmu-miR-30a-5p and mmu-miR-30c-5p), and 3 members of the miR-34 family (mmu-miR-34a-5p, mmu-miR-34b-5p and mmu-miR-34c-5p). [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 8
The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study. [score:7]
For mouse kidney, after rule out the miRNAs with very low total signal, we found that miR-10a and miR-30d, as well as other miRNAs in miR-1 and miR-30 families, were relatively enriched in kidney tissue. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 8
Wu et al. found that expression of the miR-30 family was downregulated in mouse preosteoblast differentiation and further found that miR-30 targeted the important transcription factors SMAD1 and RUNX2 [9]. [score:8]
[1 to 20 of 1 sentences]
75
[+] score: 7
In this study, we constructed multi-hairpin amiRNAs based on miR-30 to target endogenous genes of GAPDH, eIF4E and DNA pol α to knockdown their expression more effectively. [score:6]
amiRNAs based on modified human microRNA 30 (miR-30) could achieve more effective gene silencing than previous short-hairpin RNA (shRNA) [11, 13, 31]. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 7
Two of the above mentioned miRNAs (miR-30 and miR-133) were targeted by both aspirin and naproxen. [score:3]
In fact, a couple of miRNAs (miR-27a and miR-133a), targeting inflammation and cell proliferation, had been found to be modulated by the same NSAID in A/J mice aged 10 weeks, whereas other miRNAs (miR-30, miR-101 and miR-344b) affecting later stages of pulmonary carcinogenesis were able to distinguish the mice according to the yield of both microadenomas and adenomas. [score:3]
Most of the other miRNAs distinguishing the mice according to the yield of microadenomas (miR-30, miR-181b, miR-183, miR-301a, miR-350, miR-466a, and miR-466i) were also able to distinguish the mice according to the yield of adenomas. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 7
In these mice, all A1 paralogues expressed are constitutively targeted by a single shRNA embedded in the miR30 backbone, placed in the 3′UTR of the fluorescence marker Venus and expressed under control of the hematopoiesis specific Vav-gene promoter (VV-A1 mice). [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Notably, several large miRNA families (such as the miRNA-15, miRNA-30, and let-7 families) were upregulated in P10 cardiac ventricles, and miRNA-195 (a member of the miRNA-15 family) was shown to be the most highly upregulated miRNA. [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
mRNA targets that showed inversely correlated expression with miRNAs (Additional file 3) include previously validated miRNA/target pairs such as Mef2c with miR-223 [14], Bcl2 with miR-15 or miR-16 [38], Mybl2 with miR-29 or miR-30 family members [39], and Ezh2 with miR-26a [40]. [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
The other miRNAs involved in regulation of CSE are miR-30 that directly inhibits CSE [47], and miR-22 that inhibits SP1 [49]. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
We first utilised these ecotropic MuLE lentiviruses expressing combinations of shRNA or shRNA-miR30 against Cdkn2a, Trp53, Tsc2 and Pten with or without expression of oncogenic Hras [G12V], oncogenic PIK3CA [H1047R] or Myc vectors to attempt to generate panels of genetically-engineered angiosarcoma cell lines by infecting a disease-relevant cell type, namely primary murine endothelial cells from the spleen (pMSECs). [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 6
For instance, miR-125b, miR-504 and miR-30 can target p53 and down-regulate p53 protein levels and function [24– 26]. [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
This resulted in an increased expression of miR-503, miR-30-c2*, miR-183* and miR-198, with miR-503 being the most upregulated (Fig. 1c). [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
miR-29 and miR-30 regulate B-Myb expression during cellular senescence. [score:4]
In agreement with other studies (Grillari et al., 2010; Kato et al., 2011; Martinez et al., 2011) we found a decrease in abundance of members of the family of let-7, miR-30, miR-17-92 cluster and its paralogs miR-106a-363 and miR-106b-25 in WT and 3x-Tg-AD aged mice. [score:1]
These overlapping miRNAs include family members of let-7, miR-30, miR-17-92 cluster and its paralogs. [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 6
This includes miRNA families miR-30 (miR-30a, miR-30d, miR-30e, miR-30b, miR-30c, miR-30e*), miR-24 (miR-24, miR-24-2*), miR-26 (miR-26a, miR-26b), miR-29 (miR-29a, miR-29c), miR-34 (miR-34b-3p, miR-34c*) in Cluster 1 which has high expression in the adulthood stage, and miR-20 (miR-20a, miR-20b) in cluster 5 which has high expression in the early stages of lung organogenesis. [score:5]
For example, there are 5 miRNA members in the miR-30 family that are involved in TGF Beta signaling pathway through the gene “Tgfbr1” and 5 miRNAs (miR-17a, 18a, 20a, 20b, 92a) in miR-17-92 cluster that are involved the same pathway through the gene Smad6. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 6
CCR-14-2829 25977341 4. Qi F The miR-30 family inhibits pulmonary vascular hyperpermeability in the premetastatic phase by direct targeting of Skp2Clin. [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
Our recent data revealed that miR-30e is a downstream target of beta-catenin during intestinal crypt cell differentiation [15]; Hino et al. showed that miR-194 expression was induced by HNF-1alpha during intestinal epithelial cell differentiation [16], suggesting active roles for miRNAs during intestinal development. [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
At 16 months, all 15 miRNAs were significantly downregulated in heart tissue of obese mice compared to heart tissue of normal mice: let-7f-5p (FC: 3.3), miR-10a-5p (FC: 2.6), miRNA-19b-3p (FC: 5.0), miR-25-3p (FC: 2.6), miR30e-5p (FC: 5.6), miR-140-5p (FC: 5.0), miR-155-5p (FC: 1.7), miR-146a-5p (FC: 4.0), miR-181b-5p (3.0), miR-199a-3p (FC: 3.6), miR-322 (FC: 1.5), miR-451 (FC: 1.9), miR-499-5p (FC: 5.4), miR-669m-5p (FC: 1.7) and miR-3473b (FC: 3.4). [score:3]
Lai, L., Wang, N., Zhu, G., Duan, X. & Ling, F. MiRNA-30e mediated cardioprotection of ACE2 in rats with doxorubicin -induced heart failure through inhibiting cardiomyocytes autophagy. [score:2]
Based on previous pre-clinic studies, the miRNAs validated by RT-qPCR in our study are involved in alteration of glucose and lipid metabolism via insulin pathways (let-7f-5p, miR-10a-5p, miR-322) 20– 22, in cardiomyocytes apoptosis (miR-19b-3p, miR-25-3p, miR-30e-5p, miR-140-5p, miR-199a-3p, miR-499) 23– 28, in mitochondrial function (miR-181a/b) [29], in pro-inflammatory signalling (miR-146a-5p, miR-155, miR-181b-3p, miR-3473b) 30– 33, and in cardiac hypertrophy (miR-451) [34] and myocardial fibrosis process (miR-19b) 35, 36. [score:1]
[1 to 20 of 3 sentences]
89
[+] score: 6
This class of miRNAs, poorly expressed in mdx, was upregulated in exon-skipping -treated animals and included muscle specific (miR-1 and miR-133) and more ubiquitous (miR-29 and miR-30) miRNAs. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
A single study reported that CR prevented the age -dependent increase of miR-181a-1, miR-30e and miR-34a, along with the reciprocal up-regulation of their target Bcl-2 gene in mouse brain tissues, suggesting that CR decreased apoptosis and induced a gain in neuronal survival [44]. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
Interestingly, the miR-103-2 (16,537 CPM), miR-107 (2,068 CPM), miR-181 (6,627 CPM) and miR-30 (5,740 CPM) families have not previously been associated with the development of the brain, but were found to be highly expressed in our dataset. [score:4]
MiR-181 plays a crucial role in modulating haematopoietic lineage differentiation [53] whereas miR-30 has been strongly implicated with kidney development and nephropathies [54]. [score:2]
[1 to 20 of 2 sentences]
92
[+] score: 6
Fluorouracil induces autophagy-related gastric carcinoma cell death through Beclin-1 upregulation by miR-30 suppression. [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 6
A number of studies have shown that miRNAs, such as miR-34, miR-125, miR-200, miR-205, miR-328, and miR-30, were down-regulated and acted as tumor suppressors in breast cancer [16– 22]. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
Perhaps more relevant to our experimental mo del of a biliary disease (biliary atresia), only miR-30b/c, -200b, -204 and −320 have been reported to change their expression levels in cholangiocarcinoma tissues or cell lines, [10, 25- 28] with miR-30 family members increasing in lipopolysaccharide -induced NFκB activation in cholangiocytes and after Cryptosporidium parvum infection, and being required for hepatobiliary development [10, 25, 26]. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
Unlike the shared program described between developing cerebellum and MB, only three terms such as activator, DNA binding, and DNA metabolism, were shared between small cell lung cancer upregulated genes and coherent targets in developing lung, involving miR-30, miR-200a, and miR-9, respectively. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 5
MEL cells were transfected with miR30 -based short-hairpin vectors targeting murine Fbxo7 or empty vector as described [15], or infected using MSCV -based vectors to express human Fbxo7 as described [9]. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
miR-142-3p was overexpressed in cells by transient transfection of pADC38, a pGIPZ (GE Dharmacon-Thermofisher, Erembodegem, Belgium) derivative that drives the expression of artificial miRNAs based on the backbone of miR30, from a RNA polymerase II promoter. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
B. Correctly targeted CAGs-LSL-rtTA3 ESCs (Y1), were retargeted by recombinase mediated cassette exchange (RMCE) to introduce a TRE-GFP-miR30 (TGM) construct to the col1a1 recipient locus. [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
hsa-miR-30 and hsa-miR-181 are downregulated [58], and apoptosis is a key mechanism in AD [59]. [score:4]
According to the p-values, we observed that hsa-miR-181a is the best cluster (p-value: 0.0276); hsa-miR-30 is the best miRNA family (p-value: 2.91 × 10 [−3]); and apoptosis having 10 miRNAs is one of the best functions (p-value: 7.97 × 10 [−3]). [score:1]
[1 to 20 of 2 sentences]