sort by

380 publications mentioning hsa-mir-30d (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-30d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 199
Radiation downregulated Mcl-1 and enhanced Bax expression in non- or CT-miR transfected samples, whereas transfection of miR30 -inhibitor maintained Mcl-1 protein levels and suppressed Bax expression in CD34+ cells 24 and 48 h after irradiation. [score:12]
The effect of miR-30 occurred only when both miR-30 and its target sequence were present; suggesting that miR-30 directly inhibits the expression of Mcl-1 through binding to its target sequence in Mcl-1gene. [score:10]
shown in Fig.   6a demonstrate that transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitor suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
Forty-eight h after pre-miR-30 transfection, the level of Mcl-1 expression in CD34+ cells was inhibited significantly, whereas no Mcl-1 downregulation was shown in control- or miR-30 -inhibitor transfected samples compared with non-transfection control (Fig.   6c). [score:9]
a Transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitors suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
We previously reported that radiation upregulated miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30 played a key role in radiation -induced human hematopoietic and their niche osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) and inducing apoptosis in these cells. [score:9]
Furthermore, we found putative miR-30 binding sites in the 3′UTR of Mcl-1 mRNA (Fig.   5b) and demonstrated for the first time that miR-30 directly inhibits the expression of Mcl-1 by binding to its target sequences (Fig.   7c, d). [score:8]
Levels of Mcl-1 expression in CD34+ cells were significantly inhibited 48 h after pre-miR-30 transfection, whereas Bcl-2 was not impacted by miR-30 overexpression in these cells. [score:7]
Transfection of miR-30 inhibitor significantly protected Mcl-1 from radiation -mediated downregulation and maintained the Mcl-1 levels as in sham-irradiated CD34+ cells. [score:6]
To answer this question, we analyzed potential targets of miR-30 family members using the miRNA target prediction database RNAhybrid 2.2 (http://bibiserv. [score:5]
The cells were exposed to different doses of γ-radiation at 24 h after non-transfection, miR-control, or miR-30 inhibitor transfection, and Mcl-1 and Bcl-2 protein expressions were tested by western blot in samples collected at 24 h (48 h post-transfection) and 48 h (72 h post- transfection) after irradiation. [score:5]
As expected, Bcl-2 expression was not changed by radiation nor miR-30 inhibition in CD34+ cells. [score:5]
Thus, our data from the current study suggest an important downstream target of miR-30 in irradiated hematopoietic cells is Mcl-1, and miR-30 is responsible for radiation -induced apoptosis in mouse and human hematopoietic cells through targeting the antiapoptotic factor Mcl-1. The authors declare no conflict of interest. [score:5]
However, when the mir-30 target site from the Mcl-1 3′UTR is inserted into the luciferase construct (pMIR-hMcl-1), expression of luciferase is strongly decreased when cotransfected with pre-miR-30. [score:5]
In this study, expression of miR-30b and miR-30c was determined in mouse serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation, since miR-30 levels in serum were parallel to expression in BM after radiation [15]. [score:5]
Radioprotector delta-tocotrienol suppressed miR-30 expression in mouse serum and cells and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [14, 15]. [score:5]
Radiation -induced Mcl-1 downregulation was miRNA-30 dependent. [score:4]
Western blot assays were used to test Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells as shown in Fig.   6b. [score:4]
In addition, radiation -induced Bax expression was completely blocked by knockdown of miR-30 in CD34+ cells. [score:4]
Antiapoptosis factor Bcl-2 was not impacted by miR-30 overexpression in these cells (Fig.   6b, c). [score:3]
The putative miR-30 binding sites were predicted using target prediction programs RNAhybrid 2.2 [21]. [score:3]
b Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells were evaluated by immunoblotting 24 and 48 h after transfection. [score:3]
Delta-tocotrienol (DT3), a radioprotector, suppressed miR-30 and protected mice and human CD34+ cells from radiation exposure [15]. [score:3]
de/rnahybrid/) [21], and found that members of the miR-30 family were predicted to target the antiapoptosis factor Mcl-1. Figure  5b shows putative binding sites for miR-30b and miR-30c in the 3′UTR of the Mcl- 1 gene. [score:3]
Recently, we further reported that miR-30 expression in mouse BM, liver, jejunum and serum was initiated by radiation -induced proinflammatory factor IL-1β and NFkB activation. [score:3]
irradiated We previously reported that miR-30 played a key role in radiation -induced human CD34+ and osteoblast cell damage through an apoptotic pathway [14], and a radiation countermeasure candidate, delta-tocotrienol (DT3), suppressed radiation -induced miR-30 expression in mouse BM, liver, jejunum and serum, and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [15]. [score:3]
However the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cell damage are not well understood. [score:3]
Pre-miR30, miR30 inhibitor (si-miR30), or control miR (CT-miR) molecules were transfected into CD34+ cells. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
Pre-miR30 (PM11060), miR30 -inhibitor (AM11060) or control-miRNA were purchased from Thermo Fisher Scientific (Grand Island, NY) and transfected into CD34+ cells using the Lipofectamine RNAiMAX (Cat# 13778-075, Invitrogen) according to the manufacturer’s protocol discussed in our previous report [14]. [score:3]
d The firefly luciferase p-MIR-report vector (pMIR) as a control, p-MIR-report vector with Mcl-1 3′UTR (pMIR-hMcl-1), and p-MIR-report vector with mutant 3′UTR (pMIR-MUT) were transiently transfected or cotransfected with an expression plasmid for pre-mir-30 into human CD34+ cells. [score:3]
As shown in Fig.   7d, cotransfection of CD34+ cells with the parental firefly luciferase reporter construct (pMIR-vector control) plus the pre-mir-30 does not significantly change the expression of the reporter. [score:3]
CD34+ cells were transfected with miR-30 inhibitor, precursors (pre-miR30) or control-miR from Life Technologies Co. [score:3]
However, the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cells damage are not well understood. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
In contrast, Bcl-2 expression was not affected by miR-30 in these cells. [score:3]
Knockdown of miR-30 blocked radiation -induced Mcl-1 reduction in CD34+ cells. [score:2]
In the current study as shown in Fig.   7a and b, we further demonstrated that knockdown of miR-30 before irradiation in human CD34+ cells blocked radiation -induced reduction of Mcl-1, and the proapoptotic factor Bax was no longer increased by radiation. [score:2]
In this study, we extend our findings using human hematopoietic stem and progenitor CD34+ cells and an in vivo mouse mo del, to explore the effects and mechanisms of miR-30 on regulation of apoptotic cell death signaling in hematopoietic cells after γ-radiation. [score:2]
A mutation was generated on the Mcl-1 3′-UTR sequence in the complementary site and the 5′end seed region of miR-30, as indicated. [score:2]
Previously we reported that knockdown of miR-30 before irradiation significantly increased clonogenicity in irradiated human CD34+ cells [14]. [score:2]
Luciferase activity in CD34+ cells transfected with pMIR alone, or pre-miRNA-30 precursor cotransfected with pMIR-control, pMIR-hMcl-13′UTR, or pMIR-MUT 3′UTR is shown. [score:1]
β-actin were measured in different treatment groups We next examined the effects of miR-30 on Mcl-1 expression in CD34+ cells after radiation. [score:1]
c Two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329–1351 and 1584–1602 nt) and the alignment of miR-30 with the 3′UTR insert are illustrated. [score:1]
NM_021960) containing two putative miR-30 binding sites (1329–1351 and 1584–1602 nt) or a corresponding multi-base mutant sequence was cloned into the SacI and HindIII sites downstream of the firefly luciferase reporter gene in pMIR-REPORT Luciferase (Ambion, Austin, TX, USA) by BioInnovatise, Inc. [score:1]
There are two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329-1351 and 1584–1602 nt, with the 5′ end of the miR-30 seed sequence in the latter) and the alignment of miR-30 with the 3′UTR insert is illustrated in Fig.   7c. [score:1]
The Pre-miRNA-30 Precursor was co -transfected where indicated in Fig.   7d. [score:1]
The firefly luciferase -report vector plasmid (p-MIR, Ambion, Austin, TX, USA) was modified by insertion of the Mcl-1-derived mir-30 binding sites or a multi-base mutant into the 3′UTR. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shownWe further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
The Ambion pre-miR-30 precursors were co -transfected with pMIR-report, pMIR-hMcl-1-WT, or pMIR-hMcl-1-MUT plasmid. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shown We further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
Our previous studies suggested miR-30 is an apoptosis inducer in mouse and human hematopoietic cells. [score:1]
Our results from both in vitro and in vivo studies suggested miR-30 is an apoptosis inducer after radiation exposure. [score:1]
[1 to 20 of 53 sentences]
2
[+] score: 196
Our results have indicated that reduced miR-30* is required for XBP1 activation in the early stages of hypertrophic hearts in vivo and the upregulation of miR-30* and miR-214 inhibit the expression of XBP1 by targeting XBP1 3′ UTR, resulting in VEGF suppression in the maladaptive heart phage. [score:12]
These results suggest that ectopic expression of miR-214 and miR-30* led to a decrease in XBP1 expression, sequentially inhibited the expression of its targets. [score:11]
Together, these results of upregulated miR-214 and reduced miR-30* expression in several forms of heart failure raise the intriguing possibility that disbalance between miR-214 and miR-30* actually cause accumulation of XBP-1 protein in the early phase of cardiac hypertrophy and thereby contribute to impairment of cardiac XBP1 expression in the maladaptive diseased heart. [score:10]
However, along with increasing expression of miR-214 in late stage of hypertrophy, the inhibitory effects of miR-214 become dominant which results in the suppression of XBP-1. In another hand, we also found that XBP1 is a potential target of the miR-30* family. [score:9]
Moreover, the time-course change in the ratio of miR-30a*/miR-214 during cardiac hypertrophy and heart failure (Additional file 1: Fig. S1) show that down-regulation of miR-30a* may minimize the role of increased miR-214 in regulation of XBP-1 in the early phase of cardiac hypertrophy, while increased expression of both miR-214 and miR-30* synergistically lead to suppression of XBP1 in the maladaptive heart. [score:9]
These results provide the first clear link between miRNAs and direct regulation of XBP1 in heart failure and reveal that miR-214 and miR-30* synergistically regulates cardiac VEGF expression and angiogenesis by targeting XBP1 in the progression from adaptive hypertrophy to heart failure. [score:8]
These data suggest that miR-30* can inhibit the expression of XBP1 by directly targeting the 3′-UTR of XBP1 mRNA. [score:8]
XBP1 was declined in response to miR-30* upregulation in maladaptive hypertrophy, further suggesting that miR-30* is able to directly target the XBP1 pathway, either during the period of compensated hypertrophy or during the transition to heart failure. [score:7]
Along with increasing expression of miR-30* in the late stage of hypertrophy, the inhibitory effects of miR-30* on XBP1 become dominant, and results in the suppression of XBP1 and impairment of cardiac angiogenesis. [score:7]
Previous studies shows that expression of miR-30* and miR-30 were significantly down-regulated in mouse heart hypertrophy mo dels and failing human hearts [22, 40]. [score:6]
To further establish the relevance of the above observations of miR-30* with ISO infused hypertrophic mo del, we then analyze the changes in myocardial expression of the miR-30* family and found that the expression trend of miR-30a* in ISO mo del heart was similar with AAC mo del (Fig.   4b). [score:5]
Moreover, we found that miR-30* was significantly reduced in the early phase of cardiac hypertrophic animal mo del and in human failing hearts, while both miR-214 and miR-30* were increased in the maladaptive diseased heart, thereby contribute to impairment of cardiac XBP1 and VEGF expression. [score:5]
Fig.  5miR-214 and miR-30* reduce the target of XBP1 expression in cardiomyocytes. [score:5]
Hence, we therefore examined the expression of VEGF, the downstream target of miR-30*/XBP1, in AAC heart. [score:5]
These data show that dynamic expression of miR-30* and miR-214 caused opposite expression of XBP1 and VEGF in hypertrophic and failing heart. [score:5]
We first analyzed the effect of the miR-30* family on XBP1 expression and found that among these candidates, overexpression of miR-30a* caused a significant decrease in the protein levels of XBP1 s in H9c2 cells, with greater effect than the others (Fig.   3c). [score:5]
miR-214 and miR-30* reduce the expression of XBP1’s targets in cardiomyocyte. [score:5]
In this study, we have established the essential roles of miR-30* in the transition of the hypertrophic heart to the failing heart by down-regulation of XBP1. [score:4]
miR-30* are downregulated in the early phase of cardiac hypertrophy, but restored in maladaptive hypertrophy. [score:4]
Reduced miR-30* caused cardiac XBP1 and VEGF upregulation in hypertrophic and failing heart. [score:4]
Fig.  6Reduced miR-30* caused cardiac XBP1 and VEGF upregulation in hypertrophic and failing human heart. [score:4]
Our study has for the first time established that XBP1 is an important angiogenic factor to maintain normal cardiac function in the early stage of hypertrophy and deregulation of of mir-214 and miR-30* in the hypertrophic and failing hearts inhibits XBP1 and XBP1 -induced angiogenesis results in the transition of hypertrophic hearts into heart failure. [score:4]
The VEGF-A suppressing effect of miR-214 and miR-30* over expression was similar to what was measured after down regulation of XBP1 in H9c2 (2-1) cells (Additional file 1: Fig. S2). [score:4]
Fig.  4Dynamic expression of miR-30* contributed to XBP1 dysregulation in hypertrophic and failing heart. [score:4]
Interestingly, we further found that XBP1 and its downstream target VEGF were attenuated by miR-30* and miR-214 in cardiomyocyte. [score:3]
Potential miRNA binding sites in the XBP1 3′UTR were predicted using these tools, and analysis indicated that XBP1 is an evolutionarily conserved target of miR-30*. [score:3]
miR-30* targets XBP1 in cardiomyocytes. [score:3]
As cardiac expression of XBP-1 was induced in the early adaptive phase, but decreased in the maladaptive phase in hypertrophic and failing heart, it was interesting to monitor the levels of miR-30* in the different phases of AAC -induced cardiac hypertrophy. [score:3]
Real-time PCR analysis confirmed that miR-30* and miR-30 showed a striking decrease in expression in a murine mo del of right ventricular hypertrophy (RVH) and failure (RVF) pulmonary artery constriction (PAC) [41]. [score:3]
d The expression of miR-30* in human failing heart. [score:3]
In particular, we found that restored expression of miR-30* decreased the protein levels of XBP1 s and the mRNA levels of VEGF in H9c2 cells and the luciferase activity of the pMIR-reporter-XBP1-3′UTR (XBP1-3′UTR) vector in 293T cells. [score:3]
a Expression of the miR-214 and miR-30* family in normal mice heart tissue. [score:3]
Next we performed real time PCR to analyze the changes in myocardial miR-30* expression in human failing heart tissue. [score:3]
As with the miR-30 family, miR-30* family members all have the similar ‘‘seed sequence’’ in their 5′ termini, and are abundantly expressed in the heart under physiological conditions [22]. [score:3]
These findings suggest a direct interaction between miR-30* and XBP1 3′ UTR. [score:2]
These reports indicate that distinct miR-30* were regulated during heart failure, suggesting the possibility that this might function as modulators of this process. [score:2]
We extend the previously reported loss of mature miR-30* family in hypertrophic hearts [22, 41, 42], to two rodent mo dels of cardiac hypertrophy and heart failure. [score:1]
Recent study found that miR-30* family was involved with TGF-beta induced-impaired endothelial cells function [42]. [score:1]
XBP1-3′ UTR vector -transfected 293T cells showed a distinct decrease in luciferase activity when co -transfected with miR-30*, while no significant change in luciferase activity was observed following the co-transfection of mut 3′ UTR vector with miR-30* mimics or miR-NC (Fig.   3d). [score:1]
Non-specific negative control oligonucleotides, antimiRNA, mimics, for miR-214 and miR-30* (miR-30a*, miR-30b*, miR-30c-2*, miR-30d*, miR-30e*) and specific siRNA against rat XBP-1 were obtained from RiboBio (Guangzhou, China). [score:1]
n = 6, *P < 0.05 compared with normal controlFinally, we measured the expression of miR-30* and XBP-1s in two normal hearts and six patients with heart failure and the results showed that both XBP-1 and its downstream target VEGF were significantly increased in all failing human hearts, with the mean signal intensity increased compared to normal hearts (Fig.   6c). [score:1]
c Western blot of XBP1 in H9C2 (2-1) cells 48 h after transfection of miR-30* mimics or miRNA negative control (miR-NC) oligonucleotides. [score:1]
We predicted six miRNAs for miR-30* (recently designated miR-30-3p) family, including miR-30a*, miR-30b*, miR-30c-1*, miR-30c-2*, miR-30d*, miR-30e* (Fig.   3a), with potential base pair complementarities to conserved sequences in the XBP1 mRNA 3′UTR (Fig.   3b). [score:1]
a, b Dynamic levels of miR-30* in AAC -treated heart, ISO -induced heart mo del, respectively. [score:1]
n = 6, *P < 0.05 compared with normal control Finally, we measured the expression of miR-30* and XBP-1s in two normal hearts and six patients with heart failure and the results showed that both XBP-1 and its downstream target VEGF were significantly increased in all failing human hearts, with the mean signal intensity increased compared to normal hearts (Fig.   6c). [score:1]
n = 6. b a schematic diagram of the reporter constructs showing the entire XBP1 3′ UTR sequence and the sequence of the miR-30* binding sites within the human XBP1 3′ UTR and MUT 3′ UTR. [score:1]
As we known, the miR-30* family members include miR-30a*, miR-30b*, miR-30c*, miR-30d* and miR-30e* [39]. [score:1]
To measure a direct interaction between miR-30* and its potential binding site within XBP1 mRNA, the pMIR-reporter-XBP1-3′UTR (XBP1-3′UTR) vector or pMIR-reporter -XBP1-3′UTR mut (mut 3′UTR) vector was co -transfected into 293T cells along with miR-30a* mimics or miRNA negative controls (miR-NC) and assayed for expression of a luciferase reporter. [score:1]
[1 to 20 of 48 sentences]
3
[+] score: 195
The horizontal dashed line shows p = 0.05, and vertical dashed lines indicate FC = −1.5 and 1.5. e, results of miRhub analysis to test for enrichment of predicted miR-30 target sites in significantly up-regulated (purple) and down-regulated (green) genes at each time point. [score:9]
We found that both highly conserved and species-specific predicted miR-30 targets sites were significantly enriched (p < 0.05) in genes up-regulated at both 48 and 72 h post-transfection, but as expected not in down-regulated genes (Fig. 4 e). [score:9]
To identify genes that might act as post-translational regulators of SOX9 protein in response to LNA30bcd treatment, we performed Gene Ontology Molecular Function enrichment analysis (40, 41) using Enrichr (42) on genes with predicted miR-30 target sites that were significantly up-regulated (FC > 1.5 and FDR < 0.05) relative to mock treated cells at each time point (see supplemental Table S2 for gene lists). [score:9]
Moreover, UBE3A does have a predicted miR-30 target site and is up-regulated in LNA30bcd -treated HIECS. [score:6]
Knockdown of miR-30 in Vitro in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 ProteinTo evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:6]
We performed next generation high throughput RNA sequencing and found that up-regulated genes with predicted miR-30 target sites were most significantly enriched for ubiquitin ligases. [score:6]
We hypothesized that the opposite effect of miR-30 inhibition on SOX9 mRNA and protein levels could be due to miR-30 -mediated regulation of factors that modify SOX9 protein stability without affecting SOX9 RNA levels, such as post-translational modifiers (Fig. 2 e). [score:6]
” Ubiquitin ligase -mediated regulation of SOX9 has been shown previously in chondrocytes (43) and therefore is consistent with our hypothesis that miR-30 may regulate SOX9 protein levels indirectly through control of post-translational modifiers of SOX9. [score:6]
We focused on miR-30 because it has a SOX9 target site that is broadly conserved across vertebrates, including human and rodent, and it is robustly and variably expressed among stem, progenitor, and differentiated cell types of the intestinal epithelium. [score:5]
Agrawal R., Tran U., and Wessely O. (2009) The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1. [score:5]
miR-30 Is Predicted to Target SOX9 and Is Robustly Expressed in the Intestinal Epithelium. [score:5]
Below, we show the conservation of the predicted miR-30 target site (red text) across various species (TargetScan6.2). [score:5]
FIGURE 1. miR-30 is predicted to target the 3′-UTR of SOX9 and is differentially expressed across functionally distinct cell types of the intestinal epithelium. [score:5]
This suggests that miR-30 is able to regulate SOX9 protein expression through post-transcriptional regulation of ubiquitin ligases (Fig. 5 d). [score:5]
To evaluate this hypothesis, we next sought to define the regulatory program that miR-30 directs in HIECs and to identify potential miR-30 targets that may be regulating SOX9 protein levels. [score:4]
Knockdown of miR-30 in Vitro Results in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 Protein. [score:4]
Up-regulation of miR-30 family members in myoblasts promotes differentiation (53). [score:4]
Taken together, our data suggest that miR-30 normally acts to promote proliferation and inhibit enterocyte differentiation in the intestinal epithelium through a broad regulatory program that includes the proteasome pathway. [score:4]
Through time course mRNA profiling following knockdown of a single miRNA family, we found that the effect of treatment with LNA30bcd on miR-30 target genes was only beginning to emerge at 24 h, evident at 48 h, and very robust at 72 h post-transfection. [score:4]
d, cartoon showing mo del of miR-30 regulation of SOX9 mRNA and protein expression levels. [score:4]
FIGURE 2. Knockdown of miR-30 increases SOX9 mRNA and decreases SOX9 protein expression. [score:4]
We observed increased relative luciferase activity in cells transfected with 100 n m LNA30bcd (Fig. 2 d), consistent with direct targeting of SOX9 by miR-30 that has been previously shown in cartilage (35). [score:4]
In Caco-2 cells we observed significant knockdown of miR-30 even 21 days following a single transfection with LNA30bcd; therefore, it would of interest to evaluate gene expression at this time point to determine whether the effects on miR-30 target genes are still robust. [score:4]
Upon knockdown of miR-30 in two intestinal-relevant cell lines, we unexpectedly found inverse effects on SOX9 mRNA and protein expression. [score:4]
Further analyses in vivo (mouse) or through ex vivo culture systems (mouse or human) are warranted to extend the definition of the function of miR-30 across distinct cell types of the intestinal epithelium in health and disease. [score:3]
However, the predicted miR-30 target site in UBE3A is human-specific. [score:3]
miR-30 Promotes IEC Proliferation and Inhibits IEC Differentiation. [score:3]
Moreover, the miR-30 target site and flanking ∼15 bases are highly conserved among most mammals including human, rodent, dog, opossum, and horse, as well as distant vertebrates such as lizard. [score:3]
Upon knockdown of these miR-30 family members, we observed a significant increase in SOX9 mRNA at 48 and 72 h post-transfection (Fig. 2 a), which is consistent with alleviation of negative post-transcriptional regulation of SOX9 by miR-30. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
To evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:3]
In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b). [score:3]
At 24 h post-transfection, predicted miR-30 target sites were not enriched. [score:3]
FIGURE 6. miR-30 promotes proliferation and inhibits enterocyte differentiation. [score:3]
FIGURE 5. miR-30 target genes in intestinal epithelial cells are over-represented in the ubiquitin ligase pathway. [score:3]
Moreover, only miR-30 family members exhibited differential expression across functionally distinct IECs, leading us to select this miRNA family for follow-up analyses. [score:3]
This finding is consistent with the relatively higher expression levels of miR-30 in proliferating subpopulations, such as the progenitors, compared with non-proliferating enterocytes (Fig. 1 b). [score:2]
Therefore, given the strong regulatory effect of miR-30 on SOX9 protein, we hypothesized that treatment of HIECs with LNA30bcd would affect this balance as well. [score:2]
Guess M. G., Barthel K. K., Harrison B. C., and Leinwand L. A. (2015) miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway. [score:2]
f, mo del of miR-30 regulation of SOX9 in the intestinal epithelium. [score:2]
Alternatively, knockdown of miR-30 in an osteoblast precursor cell line promotes differentiation (54). [score:2]
To test whether miR-30 regulates enterocyte differentiation of IECs, we transfected Caco-2 cells with 100 n m LNA30bcd and allowed the cells to differentiate on Transwell membranes (see “Experimental Procedures”). [score:2]
Together, these data suggest that our knockdown of miR-30 using LNA30bcd was specific and highly effective in HIECs, particularly in the later time points of our study. [score:2]
Next Generation High Throughput Reveals That miR-30 Regulates Genes Enriched in the Ubiquitin Ligase Pathway. [score:2]
In terms of differentiation, the miR-30 family has been shown to regulate myogenic and osteoblastic differentiation. [score:2]
Although increased proliferation has been seen in many cancer cells in response to reduced miR-30 levels, a number of studies have found knockdown of miR-30 to result in decreased proliferation (52). [score:2]
Knockdown of the miR-30 family in HIECs and Caco-2 cells resulted in reduced proliferation and enhanced enterocyte differentiation. [score:2]
Our analyses provide new evidence that miR-30 plays a significant role in regulating proliferation and differentiation in the intestinal epithelium. [score:2]
More research will be needed to identify the specific miR-30-directed ubiquitin ligase protein that acts on SOX9 protein in intestinal epithelial cells. [score:2]
Wu T., Zhou H., Hong Y., Li J., Jiang X., and Huang H. (2012) miR-30 family members negatively regulate osteoblast differentiation. [score:2]
To test for a direct relationship between miR-30 and the SOX9 3′-UTR, we performed a luciferase reporter assay in Caco-2 cells. [score:1]
To evaluate whether miR-30 influences ubiquitin ligase -mediated degradation of SOX9 protein, we subjected Caco-2 cells to either mock or LNA30bcd transfection and then treated them with vehicle or MG132, a potent proteasome inhibitor. [score:1]
Of these, miR-30 has the strongest predicted base pairing with SOX9, consisting of an 8-mer seed as well as supplementary 3′-end pairing for two of the family members. [score:1]
LNAs against mouse miR-30 family members are cross-reactive with the human miR-30 family. [score:1]
[1 to 20 of 54 sentences]
4
[+] score: 194
CBFB was down-regulated after over -expression of miR-30a and -miR30d, and slightly up-regulated in the antimiR-30 condition. [score:9]
The level of expression of each gene in control cells (anti-miR-neg or pre-miR-neg) was taken as 1. To identify molecular mechanisms that would regulate the effects of miR-30 miRNAs on adipogenesis, bioinformatics prediction of their targets was performed with TargetScan. [score:8]
Inhibition of the miR-30 family was achieved with the transfection of a combination of three oligonucleotides that can target and inhibit activity of the whole miR-30 family. [score:7]
The up-regulation of miR-30 expression is triggered at early stages of adipocyte differentiation (day 3) and increases until terminal differentiation. [score:6]
Although expressed at lower levels than the highly abundant miR-30 family, two members of the miR-642 family were the most highly up-regulated miRNA in our adipogenesis mo del. [score:6]
The expression profile of the miRNAs that were strongly up-regulated during adipogenesis (miR-642a-3p, miR-378, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, and miR-193b) was validated by quantitative PCR (qPCR; Additional file 4). [score:6]
Moreover, as adipose tissue-derived stem cells can differentiate into either adipocytes or osteoblasts, the down-regulation of the osteogenesis regulator RUNX2 represents a plausible mechanism by which miR-30 miRNAs may contribute to adipogenic differentiation of adipose tissue-derived stem cells. [score:5]
In order to test whether RUNX2 is targeted by the miR-30 family, we cloned two regions of its 3' UTR that contain the predicted miR-30 binding sites into the pSi-CHECK™-2 vector, downstream of the Renilla translational stop codon (Figure 5a,b). [score:5]
Finally, we checked for the expression of the adipogenic -induced transcripts C/EBPβ, PPARγ and fatty acid binding protein (FABP) 4. These genes showed consistent profiles after inactivation of the miR-30 family and over -expression of miR-30a (Figure 4c). [score:5]
Inhibition of the miR-30 family blocked adipogenesis, whilst over -expression of miR-30a and miR-30d stimulated this process. [score:5]
Quantitative RT-PCR confirmation of inhibition or over -expression of the miR-30 family. [score:5]
Given their up-regulation after induction of adipogenesis and their high abundance in adipocytes, we focused on the role of miR-30 family members in adipogenesis. [score:4]
In addition to miR-30 miRNAs, we identified potent up-regulation of other miRNA families, such as miR-378 (35.7-fold), during adipogenic differentiation. [score:4]
Altogether, these data strongly support a direct and functional link between RUNX2 and miR-30, but does not exclude the contribution of additional miR-30 targets. [score:4]
We then focused our study on the miR-30 family, which was also up-regulated during adipogenic differentiation and for which the role in adipogenesis had not yet been elucidated. [score:4]
Finally, we sought to establish a direct link between miR-30 effects on adipogenesis and RUNX2 targeting. [score:4]
We additionally showed that both miR-30a and miR-30d target the transcription factor RUNX2, and stimulate adipogenesis via the modulation of this major regulator of osteogenesis. [score:4]
In addition to miR-378, our data confirmed that the miR-30 family was up-regulated in adipogenesis (Table 1). [score:4]
Up-regulation of miR-642a-3p, miR-378/378* and miR-30 miRNAs suggests their contribution to adipogenesis. [score:4]
In conclusion, RUNX2 targeting is, at least in part, responsible for miR-30 positive effects on adipocyte differentiation. [score:3]
Screen shot from TargetScan (release 5.1) showing conserved and poorly conserved miR-30 family putative binding sites located in the 3' UTR of human RUNX2. [score:3]
The level of expression of each gene in the pre-miR-30a condition was taken as 1. HEK-293T cells were co -transfected with either construct together with the following synthetic pre-miRNAs: negative control, miR-30a, miR-30d or miR-378 (as RUNX2 does not bear any putative binding site for this miRNA, miR-378 was used here as an additional control). [score:3]
For the target protection experiment, sub-confluent hMADS cells were transfected with TSBs, which are custom designed LNA oligonucleotides with a phosphorothioate backbone (Exiqon); the sequences were 5'-ACATGAAGTAAACACACA-3' for miR-30-TSB and 5'-CAGTCGAAGCTGTTTAC-3' for TSB-neg (mismatch control). [score:3]
In the list of predicted miR-30 targets, we noticed the presence of CBFB (core binding factor beta), a co-transcription factor that forms a heterodimer with RUNX proteins [28]. [score:3]
We used the target site blocker (TSB) strategy to mask miR-30 binding sites 2 and 3 in the RUNX2 3' UTR. [score:3]
Morphological observation and coloration of lipid droplets showed that inactivation of the miR-30 family impaired adipogenesis and that over -expression of miR-30a and miR-30d improved adipogenesis (Figure 4a). [score:3]
We altered their expression by transfecting synthetic miR-30 miRNAs or the corresponding antagomirs. [score:3]
Thus, these results demonstrate that RUNX2 is a bona fide target of miR-30a and miR-30d. [score:3]
Importantly, we also showed that miR-30 stimulation of adipogenesis was impaired by masking miR-30 binding sites in the 3' UTR of RUNX2, and preliminary data suggest that miR-30 inhibition might stimulate osteogenesis. [score:3]
The level of expression of each gene in the pre-miR-30a condition was taken as 1. HEK-293T cells were co -transfected with either construct together with the following synthetic pre-miRNAs: negative control, miR-30a, miR-30d or miR-378 (as RUNX2 does not bear any putative binding site for this miRNA, miR-378 was used here as an additional control). [score:3]
Over -expression was obtained with transfection of pre-miRNAs for miR-30a and miR-30d. [score:3]
The simultaneous use of these three oligonucleotides successfully inhibited all miRNAs from the miR-30 family (Exiqon, personal communication; Additional file 6). [score:3]
Figure 5 RUNX2 mRNA is a primary target for miR-30a and miR-30d. [score:3]
We show here for the first time that miR-30 miRNAs target RUNX2. [score:3]
miR-30 miRNAs stimulate adipogenesis via inhibition of the osteogenesis transcription factor RUNX2. [score:3]
However, we found that miR-204 and miR-211 were expressed at extremely low levels - for example, below our 0.03% threshold - while miR-30 represented 4.9% of the miRNA reads in adipocytes. [score:3]
Using miRonTop [27], we verified that predicted miR-30 targets were correctly enriched in these experiments. [score:3]
Interestingly, over -expression of miR-30a and miR-30d was sufficient to enhance this activity at day 4 (fold induction of 1.6; Figure 4b). [score:3]
Thus, it is tempting to speculate that RUNX2 inhibition is required for adipocyte differentiation and that miR-30 miRNAs play a critical role in this process. [score:3]
In order to dissect the molecular mechanisms involved in the effects of miR-30 on adipogenesis, we searched for predicted target genes. [score:3]
In an attempt to identify the ones that were regulated at the RNA level, we performed a transcriptome analysis of hMADS cells that were transfected with pre-miR-30a or pre-miR-30d and then submitted to adipocyte differentiation for 4 days. [score:2]
Overall, our data suggest that the miR-30 family plays a central role in adipocyte development. [score:2]
In particular, miR-30a and miR-30d are encoded by genes located on distinct chromosomes, suggesting coordinated regulation of distinct genomic regions. [score:2]
Figure 4 The miR-30 family positively regulates hMADS cell adipocyte differentiation. [score:2]
Our investigations focused on the transcription factor RUNX2, a major regulator of osteogenesis, which we established as a bona fide target of miR-30a and miR-30d. [score:2]
In particular, we show that the miR-30 family is a positive, key regulator of adipocyte differentiation in a human adipose tissue-derived stem cell mo del. [score:2]
Thus, in our system, this very low abundance of miR-204 and miR-211 suggests that their impact on RUNX2 and differentiation is minor when compared with the highly expressed miR-30 family. [score:2]
In bold is the 'seed' region with a conserved anchoring adenosine that is complementary to the first nucleotide of miR-30a and miR-30d (underlined). [score:1]
Statistical scores were highest for the miR-30 family (P-value = 5.32.10 [-10]), showing its strong overall impact in these cells. [score:1]
The first region covers positions 32 to 332 of the RUNX2 3' UTR and contains a poorly vertebrate-conserved putative miR-30 binding site (positions 229 to 235 of the RUNX2 3' UTR). [score:1]
Gain and loss of function studies reveal that the miR-30 family favors adipogenesis. [score:1]
Inactivation of the miR-30 family drastically reduced GPDH activity at day 10 (fold reduction of 23.9). [score:1]
The day after this first transfection, hMADS cells were co -transfected with miR-30 Pre-miR™ miRNA precursor molecules (Ambion) at a final concentration of 40 nM, together with the miR-30-TSB again, or the mismatch control TSB. [score:1]
The representation is limited to the region around the miR-30a and miR-30d complementary sites. [score:1]
This is probably not due to a deep sequencing cloning bias, as miR-204 detection was above average and better than that of miR-30 in a synthetic equimolar miRNA panel that we sequenced in similar conditions (data not shown). [score:1]
Since CBFB was shown to be essential for functions of RUNX1 and RUNX2 [28], these additional data may explain the drastic effect of miR-30 on adipogenesis. [score:1]
Transfection with RUNX2 miR-30-specific TSB, but not a control TSB, significantly decreased miR-30a stimulation of adipogenesis (Figure 5E). [score:1]
Even though none of the miR-30 family members are encoded within introns of pro-adipogenic sites, their increased abundance is likely to reflect a major role in differentiation. [score:1]
Transfection of sub-confluent hMADS cells with pre-miR-30a or pre-miR-30d induced a 0.61-fold or 0.48-fold decrease in RUNX2 protein levels, respectively (Figure 5d). [score:1]
Interestingly, the relative abundance of the miR-30 family varies from 1.1% in undifferentiated cells to 4.9% in adipocyte-differentiated cells (Figure 2b). [score:1]
In particular, miR-30a and miR-30d accounted for 3.7% of all sequenced miRNAs in adipocyte-differentiated hMADS cells. [score:1]
Of note, all miR-30 miRNAs do not belong to the same genomic cluster (Additional file 8). [score:1]
Table S2: miR-30 family identifiers, genomic coordinates and mature sequences. [score:1]
Synthetic miRNAs (miR-30a, miR-30d and miR-378) as well as negative control (miR-Neg) were purchased from Ambion. [score:1]
Amongst the adipogenesis -induced miRNAs, miR-30 reached the highest levels during differentiation. [score:1]
[1 to 20 of 65 sentences]
5
[+] score: 192
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Searching 3′-UTR of putative target mRNA, targeting sequences which can make base pairing with 5′ seed sequences of miR-30 were found in the 3′-UTR of lifr, eed, pcgf5 and sirt1 utilizing TargetScan (Fig 7B). [score:7]
Furthermore, mRNA expression pattern of miR-30d targets during osteogenesis of KUSA cells were quantified. [score:5]
miR-30 targets were predicted using TargetScan. [score:5]
In fact, runx2 as well as sox9 a master transcription factor for chondrogenesis was upregulated in mRNA level by miR-30d, indicating miR-30 could direct differentiation of MSC. [score:5]
Our data also indicate that miR-30b/c represses runx2 mRNA; however, overexpression of miR-30d increased runx2 expression, through unknown mechanisms. [score:5]
These data suggest that miR-30 members could be repressing targets at the MSC and osteocytic stages, while repression on target mRNA may be relieved during the intermediate osteoblastic stage. [score:5]
0058796.g009 Figure 9(A) Relative expression levels of miR-30 target mRNA in proliferating/sparse KUSA cells. [score:5]
These data suggested targets of miR-30d and context -dependent effect of miR-30d on RNA regulators including lin28 and hnRNPA3 and on differentiation regulators including runx2, sox9 and ccn1/2. [score:5]
mRNA expression patterns of miR-30 targets in mMSC line. [score:5]
Together with the data of expression patterns in Fig 9 and Fig 2, miR-30 targets were classified into several groups; immediate induction followed by rapid attenuation group (ccn1/2/3, hnrnpa3 vC, eed, hspa5/grp78), immediate reduction and rapid recovery group (runx2 and lifr), the constant induction group (lin28a and opn/spp1) and the constant reduction group (pcgf5 and hnrnpa3 vB). [score:5]
As observed in Fig 11C, suppression of lifr expression by miR-30 may control osteoblast and osteocyte differentiation leading to attenuation of Lif/LifR/Jak-Stat signal. [score:5]
Expression pattern of miR-30 targets. [score:5]
For a better understanding of miR-30 targeting, basal mRNA expression levels of 18 gene products were quantified and compared in proliferating/sparse KUSA-A1 cells (vector transfected control cells). [score:4]
miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1). [score:4]
EED, named after embryonic ectoderm development, is another novel target of miR-30. [score:4]
The cohort of miRNA, which was upregulated during osteoblast maturation, including miR-30d, miR-155, miR-21 and miR-16, constitutes a marker of osteocytic differentiation and these miRNA may possibly repress stemness maintenance in osteoblasts. [score:4]
miR-30 controls expression of LifR and Runx2, the known regulators for osteoblasts. [score:4]
One miR-30 targeting sequence in the 3′-UTR of ctgf/ccn2 has been reported. [score:3]
List of predicted miR-30 targets. [score:3]
A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis. [score:3]
In the miRNA PCR array, miR-30d showed an increased expression level in osteocytogenesis of KUSA-A1. [score:3]
These predictions appear to be specific to each of the miR-30 members; however, 11 nt of the 5′ seed sequence in miR-30 family members are common and the mature miR-30s sequences are quite homologous among miR-30a/d/e or between miR-30b/c (Fig 7A), indicating shared and distinctive targets among miR-30 members. [score:3]
Analysis of miR-30 targeting. [score:3]
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
In addition, two putative miR-30 targeting sites on spp1/osteopontin were found. [score:3]
Here we discuss about roles of these factors in bone formation as well as canonical osteogenic factors including Runx2, LifR, Opn/Spp1 and the CCN family, which are the targets of miR-30d. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesis. [score:3]
miR-30 targeting prediction. [score:3]
As targets of miR-30, we found novel key factors in osteogenesis including Lin28, hnRNPA3, Eed, Pcgf5 and HspA5/Grp78. [score:3]
0058796.g006 Figure 6(A) miR-30 family expression pattern in KUSA-A1 mMSC line with (red bars, Os+) or without (blue bars, Os−) osteoinduction. [score:3]
Known target of miR-30. [score:3]
In order to clarify the function of miR-30d on target mRNAs, qRT-PCR was carried out in stable miR-30d transfected KUSA-A1 and in control vector transfectant. [score:3]
miR-30 targeting in mMSC line. [score:3]
Matching around the 3′ part and intermediate part of miR-30 were tested to those targets. [score:3]
Note the different expression levels: miR-30d>30a>30e: miR-30c>30b. [score:3]
After repeated osteo-induction (2w+), miR-30d and miR-30c were induced, and the expression levels of miR-503, miR-322 and miR-125b-3p were the most powerfully repressed (Fig. 4B, E). [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesisPhysiological production of CCN2/CTGF is more abundant from chondrocytes in cartilage than those in other tissues, while CCN1/2/3, the prototype members of CCN family, control both chondrocytic and osteoblastic differentiation [57, 58). [score:3]
miR-30 expression pattern during KUSA-A1 MSC osteocytogenesis. [score:3]
Prediction of miR-30 targeting. [score:3]
Since miR-30 family members are homologous (Fig 6A) and possibly share targets, we further investigated the miR-30 family expression patterns at four time points with or without osteo-induction. [score:3]
These in silico analyses suggested putative shared and distinctive target mRNA recognition by miR-30 family, the groups of miR-30a/d/e and miR-30b/c. [score:3]
The expression level of miR-30d was higher in the 4h+, 2w- and 2w+ condition than in the 4h− condition (Fig. 4A–F). [score:3]
As a result, miR-30a, miR-30c and miR-30d were highly expressed compared with miR-30b or miR-30e (Fig. 6B). [score:2]
In a result of direct analysis of ctgf/ccn2 mRNA, miR-30d reduced ctgf/ccn2 mRNA levels in confluent KUSA-A1, while not in proliferating cells (Fig 8), indicating that miR-30d attenuate basal ctgf/ccn2 level in idling MSCs. [score:2]
The difference in speed or stage of differentiation may result in difference in expression signature of miRNA, e. g., mouse miR-30d was induced on 4 h or 14 days after the osteo-induction compared with the control, while human miR-30d showed waving induction and reduction during osteogenesis (Fig S2). [score:2]
Hspa5/grp78, lifr, eed, opn/spp1 and pcgf5 mRNA levels in miR-30 transfected cells were 20–30% lower than those in control cells in both proliferating and confluent cells (Fig 8AB), indicating direct repression of mRNA stability. [score:2]
Moreover, the miR-30 family was predicted to recognize sox9, lrp6, smad2, smad1, notch1, bdnf and a number of epigenetic factors (Table 2). [score:1]
Not only 5′ seed sequences but also 3′ sequences of miR-30d matched to the lifr, eed and sirt1 3′-UTR. [score:1]
0058796.g007 Figure 7(A) List of mature miR-30 family members. [score:1]
In a result, hnrnpa3 variant B level in proliferating/sparse miR-30d tranfectant was around 50% lower than that in the vector transfected control (Fig 8A), while no significant change in confluent cells (Fig 8B), indicating context dependent repression of hnrnpa3 vB by miR-30d. [score:1]
miR-30d and miR150 as well as other miRNAs were induced by long-term culture for 2 weeks in the absence of differentiation stimulus, while miR-503 and miR-744 were reduced by the long-term culture (Fig. 4C, F). [score:1]
miRNA sequences of step loop part of pre-miR-21, pre-miR-30d, and pre-miR-322 were obtained from miRBase. [score:1]
Runx2 and sox9 mRNA level in miR-30d transfectants were higher than that in the control (Fig 8AB). [score:1]
0058796.g008 Figure 8(A) Effects of miR-30d on mRNA levels in proliferating/sparse KUSA-A1 cells. [score:1]
These immediate early induction followed by quick attenuation patterns were shared with those of CCN gene family shown in Fig 2A, indicating these 6 kinds of transcripts are under the control of same factors and the miR-30 family. [score:1]
In addition, miR-30d was induced by osteo-induction (Fig. 5J), and miR-30 family recognition sites were found in the 3′-UTR regions of the runx2 and nov/ ccn3 mRNAs (Fig. S2, S3). [score:1]
Lin28a mRNA level in confluent miR-30d tranfectant was around 50% lower than that in the vector transfected control (Fig 8A, left), while around 50% higher in proliferating cells (Fig 8A, right), indicating context dependence as well. [score:1]
Dev EC miR-30d GRP78/HSPA5 ref. [score:1]
vec, vector transfectant; 30d, miR-30d transfectant. [score:1]
Mature miR-30 quantification during osteocytogenesis. [score:1]
These findings suggest that members of the miR-30 family could play an essential role in osteocytic differentiation. [score:1]
Therefore, immediate induction and subsequent rapid repression of ctgf/ccn2 could be controlled by fluctuations in these miRNAs including the miR-30 family. [score:1]
The infected cells were selected by puromycin (2 ug/mL) in 10 days for cloning of miR-21 and miR-30d stable transfectant and in 2 weeks for miR-322 stable cells. [score:1]
Tuning mo del of canonical and novel osteogenic factors by miRNA-30 family and miR-541 during MSC osteogenesis. [score:1]
WD protein associated, miR-30-specificity. [score:1]
However, miR-30d was increased only by single stimulation as indicated by qRT-PCR (Fig. 5I, J). [score:1]
Ccn2/ctgf and ccn1/cyr61 mRNA levels in confluent miR-30d cells were lower than those in the control (Fig 8B), while these gene product levels in proliferating miR-30d cells were higher than those in the control (Fig 8A). [score:1]
All the miR-30 members once reduced during osteoblastic differentiation stage on day 2 and day 7. Among those members, miR-30a/d/e were increased on day 14 around a late osteocytic stage (Fig 6A). [score:1]
Indeed, by a single stimulation for osteocytic differentiation, not only the miR-30d but also miR-155 was induced (Fig. 4A, D). [score:1]
We focused on the miR-30 family and miR-541 in this study, while still further analyzing roles of OstemiR in MSC differentiation. [score:1]
miRNA array analysis showed that miR-30d was induced by single stimulation (4h+), repeated stimulation (2w+) and prolonged culture in the absence of stimulation (2w−). [score:1]
Together with these results and data interpretations, we propose the tuning mo del of canonical and novel osteogenic factors by the OstemiRs including miR-30 family and miR-541. [score:1]
In our study, only hnrnpa3 variant C was induced upon osteo-induction, but not variant B, and context -dependent effect of miR-30d on hnRNPA3 variants was suggested. [score:1]
[1 to 20 of 73 sentences]
6
[+] score: 131
To determine whether the radiation -induced IL-1β increase contributed to miR-30 expression and whether DT3 could inhibit the miR-30 expression induced by IL-1β, we used assays to validate the effects of IL-1β on miR-30 expression in CD34+ cells (Fig 5B). [score:8]
DT3 downregulated radiation -induced miR-30 expression and secretion in mouse tissues and serum. [score:6]
Finally, neutralization of IL-1β activation or knockdown of NFκBp65 gene expression in CD34+ cells resulted in complete abrogation of the radiation -induced miR-30 expression in these cells. [score:6]
DT3 downregulated the expression and secretion of radiation -induced miR-30 in mouse tissues and serum. [score:6]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in CD34+ cells. [score:5]
These data suggest that radiation -induced IL-1β may be responsible for miR-30 expression and the radioprotective effects of DT3 may result from inhibition of a storm of radiation -induced inflammatory cytokines. [score:5]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in human CD34+ cells. [score:5]
In the current study, we confirmed expression of radiation -induced miR-30b and miR-30c in mouse tissues and serum, and miR-30 expression in mouse BM, jejunum, and liver within 1 h, that returned to baseline 4 or 8 h after irradiation (data not shown). [score:5]
In this study, we further demonstrated the effects of DT3 and the anti-IL-1β antibody on suppression of radiation or IL-1β -induced miR-30 expression in CD34+ cells. [score:5]
In this study, we confirmed our previous in vitro results and extend our findings using an in vivo mouse mo del, to explore our hypothesis that the radioprotective effects of DT3 are mediated through regulation of miR-30 expression in irradiated cells. [score:4]
To further understand the interaction between miR-30 and IL-1β in response to radiation and DT3, and the mechanisms of DT3 on radiation protection, we explored the role of radiation and DT3 on regulation of miR-30 and IL-1β expression. [score:4]
We further compared the effects of anti-IL-1β antibody and DT3 on miR-30 expression and survival of CD34+ cells after radiation and found that treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in these cells. [score:4]
Due to the ability of miRNA to target multiple transcripts [29], miR-30 has been found in multiple cellular processes to regulate cell death through different genes such as cyclin D1 and D2 [30], integrin b3 (ITGB3) [31], B-Myb [32], and caspase-3 [33]. [score:4]
IL-1β (10 ng/mL) was added to CD34+ culture with the anti-IL-1β antibody (0.2 μg/mL) or the same amount of a nonspecific IgG, and miR-30 expression was tested at 15 min, 30 min, and 1 h after addition of IL-1β. [score:3]
NFκB activation was responsible to radiation (and IL-1β) -induced miR-30 expression in CD34+ cells. [score:3]
DT3 protected against radiation -induced apoptosis in mouse and human CD34+ cells through suppressing of IL-1β -induced NFκB/miR-30 signaling, and significantly enhanced survival after lethal doses of total-body γ-irradiation in mice. [score:3]
Interestingly, IL-1β -induced miR-30 expression was completely blocked by DT3 treatment (Fig 5C). [score:3]
Interestingly, radiation induced miR-30 expression in serum was observed at 4 h and remained elevated up to 24 h post-irradiation. [score:3]
Treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in CD34+ cells. [score:3]
Addition of the anti-IL-1β antibody for 30 min completely neutralized the expression of IL-1β -induced miR-30 in these cells. [score:3]
Cells were used for quantitative real-time PCR to determine the effects of IL-1β neutralization on miR30 expression. [score:3]
DT3 significantly suppressed miR-30 and protected animals from the acute radiation syndrome and increased survival from lethal doses of total-body irradiation. [score:3]
We next evaluated the effects of DT3 on radiation and/or IL-1β -induced miR-30 expression in human hematopoietic CD34+ cells because DT3 had suppressed the radiation -induced IL-1β and its downstream cytokine IL-6 production in mouse spleen (Fig 3) and jejunum [4]. [score:3]
Vehicle, DT3, or a neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy irradiation, and miR-30 expression was examined 1 h after irradiation. [score:3]
DT3 or anti-IL-1β antibody inhibited radiation -induced IL-1β production and reversed IL-1β -induced NFκB/miR-30 stress signaling. [score:3]
We next sought to determine which a stress-response signal-transduction pathway may be involved in this IL-1β -induced miR-30 expression. [score:3]
NFκB activation was responsible for radiation -induced miR-30 expression in CD34+ cells. [score:3]
shown in Fig 5C confirmed that DT3 administration abolished expression of IL-1β -induced miR-30 in CD34+ cells. [score:3]
Modulation of miR-30 expression with IL-1β neutralizing antibody. [score:3]
Finally, vehicle or DT3 was added to CD34+ culture 22 h before IL-1β treatment, and miR-30 expression was examined at 24 h post-DT3 addition and 1 h after IL-1β treatment. [score:3]
It was also observed that anti-IL-1β antibody-treatment blocked the radiation -induced miR-30 expression in control-siRNA transfected cells. [score:3]
DT3 administration abolished IL-1β -induced miR-30 expression in CD34+ cells. [score:3]
Radiation induced both miR-30 subunits between 4–24 h after 7 and 10 Gy TBI. [score:1]
In conclusion, results from our current study demonstrated that an increase of miR-30 in irradiated cells results from a cascade of IL-1β -induced NFκB -dependent stress signals that are responsible for radiation damage in mouse and human cells. [score:1]
This circulating miR-30 increase is specific, reproducible, and radiation dose -dependent in irradiated mouse serum. [score:1]
In contrast, no miR-30 increase was observed after 2 Gy irradiation to siNFκB transfected cells. [score:1]
We found that miR-30 was highly induced by radiation within 1 h in BM (Fig 4B), jejunum, and liver (Fig 4C), but not in kidney cells (data not shown). [score:1]
We believe that the acute secretion of extracellular miR-30 in mouse serum after radiation is likely to derive from a variety of cell types. [score:1]
These results further support our hypothesis that levels of miR-30 in irradiated mouse tissues and serum reflect the severity of radiation damage in these animals. [score:1]
[1 to 20 of 39 sentences]
7
[+] score: 127
On the basis of our previous study showing that EZH2 inhibits miR-30d and that miR-30d suppresses KPNB1 [5], we postulated that the EZH2 inhibitor DZNep would restore miR-30d expression with subsequent inhibition of KPNB1 expression. [score:13]
In this study, we found that pharmacological inhibition of EZH2 by DZNep depleted EZH2 expression, induced expression of miR-30a and miR-30d, and inhibited KPNB1 expression in MPNST cells. [score:11]
Pharmacological inhibition of EZH2 with DZNep inhibits MPNST cell growth and induces apoptosis in vitroBecause of the importance of EZH2-regulated miR-30d expression that modulates KPNB1 in MPNST cell survival and apoptosis in vitro and in vivo [5], pharmacological inhibition of EZH2 represents a promising therapeutic approach for this tumor type. [score:10]
Together, these data demonstrated that DZNep depletes EZH2 expression, resulting in increased miR-30d expression and activity, which in turn inhibits KPNB1 expression in MPNST cells. [score:9]
Similar to miR-30d, miR-30a inhibited KPNB1 by targeting the KPNB1 3’ untranslated region in MPNST cells. [score:7]
Consistently, DZNep treatment also reduced EZH2 and KPNB1 protein levels and upregulated miR-30d expression in MPNST cells. [score:6]
Because of the importance of EZH2-regulated miR-30d expression that modulates KPNB1 in MPNST cell survival and apoptosis in vitro and in vivo [5], pharmacological inhibition of EZH2 represents a promising therapeutic approach for this tumor type. [score:6]
Because miR-30a shares the same “seed sequence” with other miR-30 family miRNAs for targeting mRNA (Figure  5A), we hypothesized that EZH2 may also regulate miR-30a and that miR-30a may inhibit KPNB1 in MPNST cells. [score:6]
Another report showed that miR-30d targets EZH2 directly [26], indicating that EZH2 and miR-30d inhibit each other and form a negative-feedback loop. [score:6]
We found that DZNep depletes EZH2, subsequently induces miR-30d and miR-30a expression that inhibit Karyopherin β1 (KPNB1) in MPNST cells. [score:5]
We also found that EZH2 inhibited expression of another miR-30 family member, miR-30a, in MPNST cells. [score:5]
More importantly, we used the standard miR-30d targeting reporter construct to determine whether DZNep treatment induced functional miR-30d expression in MPNST cells. [score:5]
These microarray studies revealed that, in addition to miR-30d, another miR-30 family member, miR-30a, was also upregulated in EZH2-knockdown cells compared with negative controls in MPNST724, S462, and STS26T cells [5]. [score:4]
miR-30d expression was normalized to SNORD47. [score:3]
Figure 2 DZNep inhibited EZH2/miR-30d/KPNB1 signaling in MPNST cells. [score:3]
In our previous study, we showed that EZH2 inhibited miR-30d promoter activity in MPNST cells [5]. [score:3]
showed that DZNep treatment restored the expression of miR-30d (Figure  2B). [score:3]
Data showed that DZNep treatment significantly inhibited miR-30d reporter activity in S462 cells (Figure  2D). [score:3]
To further confirm that DZNep -dependent KNPB1 inhibition occurs through miR-30d activation, we transfected wild-type or mutant KPNB1 3’UTR reporter constructs into S462 cells and then treated the cells with either vehicle control or DZNep. [score:3]
To determine whether EZH2 depletion by DZNep treatment also affects miR-30d expression in MPNST cells, we performed qRT-PCR analyses. [score:3]
miR-30d and miR-200b target sequence reporters were constructed by cloning 3 repeats of miR-30d and miR-200b perfect binding sequences into the 3’ end of the luciferase gene of an empty pLightSwitch vector (SwitchGear Genomics) using Xba I and Xho I sites (Additional file 1: Table S1). [score:3]
Therefore, we demonstrated that DZNep induced MPNST cells apoptosis by depleting EZH2 protein and enhancing the expression and activity of miR-30d in MPNST cells. [score:3]
Together with our findings, these data suggest that EZH2-regulated miR-200 and miR-30 family members may modulate cell survival and EMT in numerous different cancers. [score:2]
Here, we tested the effects of DZNep on miR-30d promoter activity in MPNST cells. [score:1]
The miR-200 and miR-30 families have been shown to induce mesenchymal-epithelial transition [25]. [score:1]
A miR-30d promoter construct was generated previously [5]. [score:1]
We found that DZNep treatment also increased the promoter activities of miR-30d in S462 cells (Figure  2C). [score:1]
Previously, we demonstrated that the EZH2/miR-30d/karyopherin (importin) beta 1 (KPNB1) signaling pathway is critical for malignant peripheral nerve sheath tumor (MPNST) cell survival in vitro and for tumorigenesis in vivo. [score:1]
[1 to 20 of 28 sentences]
8
[+] score: 102
Interestingly, miR-30 family members respond to radiation differently in CD34+ and hFOB cells and radiation oppositely regulated miR-30 expression in these cells: miR-30b, miR-30c and miR-30d were upregulated in CD34+ cells whereas miR-30c was downregulated in hFOB cells (Figure 1). [score:10]
Furthermore, our data show that radiation regulates miR-30 expression in the opposite manner in CD34+ and hFOB cells, with enhanced miR-30b, miR-30c and miR-30d expression in CD34+ cells (which are sensitive to radiation damage), and decreased miR-30c expression in the relatively radio-resistant hFOB cells. [score:8]
Next, we analyzed potential targets of miR-30 family members using the miRNA target prediction database TargetScan 5.1 (http://www. [score:7]
miR-30b, miR-30c and miR-30d were upregulated in CD34+ cells whereas miR-30c was downregulated in hFOB cells. [score:7]
miR-30 family members are involved in regulation of p53 -induced mitochondrial fission and cell apoptosis [11], regulation of B-Myb expression during cellular senescence [12], and play important roles in epithelial, mesenchymal, osteoblast cell growth and differentiation [13]- [15]. [score:5]
Our data suggest that CD34+ and hFOB cells have different miRNA expression patterns after irradiation and that radiation -induced miR-30 expression in CD34+ cells may aggravate cell death. [score:5]
Radiation -induced REDD1 expression was inhibited by pre-miR30 transfection. [score:5]
Fresh thawed human hematopoietic progenitor CD34+ cells were transfected with miR-30c inhibitor or control miRNA and were exposed to 2 Gy radiation at 24 h post-transfection of miR-30 inhibitor or control molecule. [score:5]
Since multiple potential targets of miRNAs have been suggested (5), validating miR-30 targets in irradiated CD34+ cells will be important to understand the roles of miR-30 in these cells after radiation injury. [score:5]
Interestingly, miR-30 has potential target sites located in the 3′UTR of REDD1 gene, and we show here that REDD1 is a target of miR30c in response to γ-radiation in primary human hematopoietic CD34+ and hFOB cells. [score:5]
The profiles of miRNA expression in human CD34+ cells and osteoblast cells in response to γ-radiation were completely different, and only Let-7 and miR-30 miRNA families were regulated by radiation in both types of cells (Table 1) with increased Let-7f in CD34+ cells and increased let-7g in hFOB cells. [score:4]
Interestingly, miR-30 family member expression in irradiated CD34+ and hFOB cells were changed in opposite directions. [score:4]
org), and found that members of the miR-30 family were predicted to target the stress-response gene REDD1. [score:3]
miRNA Real-Time RT-PCR validation of miR-30 family member expressions in CD34+ and hFOB cells. [score:3]
Recent studies suggested that miR-30 is one of the most common known tumor suppressor miRNAs [10]. [score:3]
from two experiments showed that transfection of miR30 inhibitor resulted in significant colony number increases in irradiated cells. [score:3]
hsa-miR-30 expression after γ-irradiation (Quantitative Real Time-PCR). [score:3]
To confirm the miRNA microarray findings, the changes in miRNA expression for miR-30 family were validated by RT-PCR. [score:3]
miR-30a, miR-30d and miR-30e expression was not significantly altered after γ-radiation in CD34+ and hFOB cells as revealed by RT-PCR (data not shown). [score:3]
There is abundant evidence of miR-30 in regulation of cell growth, differentiation, apoptosis and senescence in hematopoietic [25], osteoblast [15], adipocyte [26], epithelial and pancreatic cells [27] through different signal transduction pathways. [score:2]
Levels of OD were dramatically lower in pre-miR30 -transfected hFOB cells in both irradiated and non-irradiated samples, compared with controls and miR30 inhibitor -transfected samples (p<0.01). [score:2]
Nevertheless, Let-7 and miR-30 families were regulated by radiation in both CD34+ and hFOB cells. [score:2]
Using bioinformatics analysis we found a potential binding site of miR-30 in the 3′ UTR of REDD1 gene. [score:1]
miR-30 family members, miR -30a,-30b, -30c, 30d and 30e, were examined in both irradiated and non-irradiated CD34+ and hFOB cells using quantitative real-time RT-PCR. [score:1]
Hence manipulation of miR-30 may be a useful approach to explore the mechanisms of radiation -induced apoptosis and/or premature senescence in mammalian hematopoietic tissues. [score:1]
Hence we explored interactions between the miR-30 family and REDD1. [score:1]
However, effects of miR-30 on ionizing radiation -induced cell damage have not been reported. [score:1]
[1 to 20 of 27 sentences]
9
[+] score: 98
Wyman et al. showed that miR-30c, miR-30d and miR-30e were upregulated, while miR-493 was downregulated in ovarian carcinomas when compared to normal, and expression of miR-30a was specific to the clear cell histological type [19]. [score:8]
org) we identified nine miRNAs that regulate these three genes: miR-368 targeting MINT31, miR-181d, miR-30a-3p, miR-30c, miR-30d, miR-30e-3p, miR-370, miR-493-5p and miR-532-5p targeting CDH13, and miR-181d targeting RASSF1. [score:8]
Expression of four miRNAs (miR-30c, 30d, 30e-3p, and 370) was significantly different between benign neoplasms and ovarian carcinoma: expression of miR-30c (P = 0.02), miR-30d (P = 0.001) and miR-30e-3p (P <0.0001) was higher while expression of miR-370 (P = 0.05) was lower in ovarian carcinomas. [score:7]
Expression of miR-30c, miR-30d, miR-30e-3p and miR-532-5p was significantly downregulated among Her2/neu -positive ovarian carcinomas. [score:6]
However, we did not detect any significant association between miRNA expression and platinum sensitivity in our study, although miR-30d were marginally upregulated in subjects who were platinum sensitive. [score:6]
Expression of miR-30c (P = 0.01), miR-30d (P = 0.002), miR-30e-3p (P = 0.008) and miR-532-5p (P = 0.002) were significantly downregulated in Her2/neu -positive ovarian carcinomas (Figure 3). [score:6]
Interestingly, miR-30d was also downregulated in subjects who had recurrent disease (P = 0.15). [score:6]
Although expression of miR-30d was marginally upregulated in ovarian carcinomas which were platinum sensitive (P = 0.054) as opposed to those that were platinum resistant, none of the nine miRNAs were significantly associated with platinum sensitivity (data not shown). [score:6]
In multivariate analyses, higher expression of miR-181d, miR-30c, miR-30d, and miR-30e-3p was associated with significantly better disease-free or overall survival. [score:5]
Lastly, expression of miR-30c (P = 0.04) and miR-30d (P = 0.04) were significantly higher in serous carcinomas than in mucinous samples, and expression of miR-30e-3p (P = 0.04) was significantly higher in clear cell than in endometrioid carcinomas. [score:5]
We showed that expression of miR-30d was significantly associated with both overall survival and disease-free survival in the multivariate analysis. [score:5]
Finally, lower expression of miR-30c, miR-30d, miR-30e-3p and miR-532-5p was significantly associated with overexpression of Her-2/neu. [score:5]
Laios et al. showed significant downregulation of miR-30d in patients with recurrent ovarian carcinomas [26]. [score:4]
However, upregulation of miR-30d was correlated with shorter time to recurrence and reduced overall survival in melanoma [44] and non-small cell lung cancer [45]. [score:4]
Expression of miR-30d (P = 0.03) was significantly higher in clear cell samples than in mucinous samples. [score:3]
Expression of four miRNAs (miR-30c, miR-30d, miR-30e-3p, miR-370) was significantly different between carcinomas and benign ovarian tissues as well as between carcinoma and borderline tissues. [score:3]
Among ovarian carcinomas, expression of four miRNAs (miR-30a-3p, miR-30c, miR-30d, miR-30e-3p) was lowest in mucinous and highest in clear cell samples. [score:3]
We identified that several miRNAs (miR-30a-3p, miR-30c, miR-30d, and miR-30e-3p) differently expressed in ovarian carcinoma with different histological types and this finding is pertinent to the fact that different histological types are biologically and pathogenetically distinct entities [16]. [score:3]
Scatter plots of expression of miR-30a-3p, miR-30c, miR-30d and miR-30e-3p indicated significant differences among different histological types. [score:3]
In a univariate mo del investigating disease-free survival, there was a moderate decreased risk of recurrence for miR-181d (P = 0.25), miR-30c (P = 0.14), miR-30d (P = 0.07), and miR-30e-3p (P = 0.11). [score:1]
In univariate mo dels investigating overall survival, there was a moderate decreased risk of death associated with increased expression of miR-30d (P = 0.06). [score:1]
[1 to 20 of 21 sentences]
10
[+] score: 94
In our study, we did not observe significantly increased platinum -induced apoptotic activity 24 hours after over -expressing miR-30d in S KOV-3 cells; however we did observe decreased ABCD2 expression 24 hours after miR-30d over -expression. [score:7]
ABCD2 mRNA expression and miR-30d expression were found to be negatively correlated at p = 8.57 × 10 [-5] (Figure  4C), suggesting a regulatory relationship. [score:6]
When S KOV-3 cells were transfected with miR-30d mimic, we observed an increase in miR-30d expression (Figure  5B, p = 0.001) and a decrease in ABCD2 expression (Figure  5C, p = 0.047). [score:5]
Notably, the single SNP-miR-gene relationship (namely, rs11138019 genotype, miR-30d expression, and ABCD2 expression) seen for cisplatin was also found for carboplatin (shown in bold in Table  2). [score:5]
For example, miR-30d has been suggested to be an oncomir, regulating tumor cell proliferation [24], and senescence through regulation of tumor suppressor gene p53[25]. [score:5]
The decrease in ABCD2 following miR-30d over -expression was of much smaller magnitude than the decrease in ABCD2 after using targeted siRNA. [score:5]
To confirm transfection efficiency and examine the effect of miR-30d over -expression on ABCD2 expression, S KOV-3 cells were plated at 0.25 × 10 [6] cells/well in 6-well plates, transfected with 40nM siRNA, miRNA mimic, scramble control or water using 8 uL of DharmaFECT transfection reagent 1 in 2 mL of transfection media per well. [score:5]
Over -expression of miR-30d in vitro caused a decrease in ABCD2 expression, suggesting a functional relationship between the two. [score:5]
The SNP rs11138019 was correlated with ABCD2 expression at p = 3.00 × 10 [-5] (Figure  4D) and with miR-30d expression at p = 0.044 (Figure  4E). [score:5]
We performed ABCD2 siRNA knockdown and miR-30d over -expression experiments in S KOV-3 using DharmaFECT Transfection Reagent 1 and existing Dharmacon DharmaFECT General Transfection protocol (Thermo Scientific). [score:4]
miR-30d expression p = 0.044. [score:3]
Of particular interest was one SNP (rs11138019), which was associated with the expression of both miR-30d and the gene ABCD2, which were themselves correlated with both carboplatin and cisplatin drug-specific phenotype in the HapMap samples. [score:3]
B) miR-30d expression vs. [score:3]
Through our integrative pyramid analysis, we identified a SNP (rs11138019) associated with the expression of miR-30d and ABCD2; importantly, the SNP, miRNA and mRNA correlated with both carboplatin- and cisplatin- specific sensitivity in the HapMap LCL samples. [score:3]
We also identified a positive correlation between miR-30d expression and the platinum DSPs (p = 0.004 and p = 0.020 for carboplatin and cisplatin respectively Figure  4B). [score:3]
C) miR-30d expression vs. [score:3]
It is likely that the moderate effect of miR-30d on ABCD2 expression was not enough to induce a phenotypic change large enough to be measurable with our endpoint assay, whereas the sensitizing effect could be seen when directly manipulating expression levels of ABCD2 through siRNA. [score:3]
Our study also identified a potential gene target of miR-30d, ABCD2 (ATP-Binding Cassette Sub-Family D Member 2). [score:3]
C) Decreased ABCD2 expression 24 hours after transfection with miR-30d mimic (normalized to B2M housekeeping control) compared to scramble control siRNA (p = 0.047); data not shown for ABCD2 siRNA as remaining amount of ABCD2 mRNA was no longer quantifiable by qPCR 24 hours after transfection. [score:2]
miR-30d has been shown to play an important role in several biological processes related to cancer development and progression. [score:2]
B) Increased miR-30d expression 24 hours after transfection with 40nM miR-30d mimic (normalized to RNU6 housekeeping control) compared to scrambled control siRNA (p = 0.001). [score:2]
miR-30d overexpression was confirmed by quantitative PCR (qPCR) using primers purchased from Exiqon (Woburn, MA). [score:2]
00E-059.45E-051.00E-021.88E-02   DDR2  1.00E-05 2.00E-025.72E-03   ECOP  1.00E-04 4.76E-042.31E-03   EIF2AK3  1.00E-05 3.41E-051.54E-02   HMOX1  1.00E-04 2.55E-033.76E-02   HSPC159  7.00E-05 2.00E-021.27E-02   LARGE  5.00E-05 1.93E-041.05E-03   MEF2D  4.00E-05 1.11E-047.53E-03   PDK2  3.00E-05 2.38E-052.44E-02   PIK3R5  1.00E-04 8.33E-031.86E-02   RBM47  1.00E-04 4. 48E-045.55E-03   USP53  2.00E-05 3.00E-024.77E-02  hsa-miR-30d ABCD2  4.42E-023.00E-053.80E-038.57E-051.88E-02   DDR2  1.00E-05 3.55E-055.72E-03   ECOP  1.00E-04 3.52E-032.31E-03   HMOX1  1.00E-04 3.09E-033.76E-02   HSPC159  7.00E-05 4.68E-041.27E-02   LARGE  5.00E-05 1.00E-021.05E-03   PDK2  3.00E-05 1.00E-022.44E-02   PIK3R5  1.00E-04 1.46E-031.86E-02   USP53  2.00E-05 3. 12E-044.77E-02 hsa-miR-363 ABCD2 1.28E-023.00E-051.13E-031.74E-041.88E-02   DDR2  1.00E-05 3.94E-055.72E-03   ECOP  1.00E-04 3.00E-022.31E-03   EIF2AK3  1.00E-05 4.00E-031.54E-02   HSPC159  7.00E-05 1.35E-031.27E-02   LARGE  5.00E-05 1.07E-051.05E-03   MEF2D  4.00E-05 1.00E-027.53E-03   PDK2  3.00E-05 1.36E-042.44E-02   PIK3R5  1.00E-04 1.66E-061.86E-02   USP53  2.00E-05 3. 99E-064.77E-02rs4919716hsa-miR-20b ECOP1.95E-053.00E-029.00E-059.45E-054.76E-042.31E-03   FURIN  1.00E-04 3.00E-024.27E-02   MTMR14  8.00E-05 7.63E-031.73E-02 hsa-miR-30b ECOP 4.09E-029.00E-057.08E-033.57E-032.31E-03   FURIN  1.00E-04 2.43E-054.27E-02   MTMR14  8.00E-05 5.77E-031.73E-02 hsa-miR-30d ECOP 2.10E-029.00E-053.80E-033.52E-032.31E-03   FURIN  1.00E-04 1.69E-054. [score:1]
#1027416), miR-30d mimic (cat. [score:1]
Knockdown of ABCD2 was confirmed by qPCR of ABCD2 gene under the ABCD2 siRNA, miR-30d mimic, and scramble conditions at 24 hours after transfection using Applied Biosystems Taqman primer/probe sets. [score:1]
miR-30d is associated with poor clinical outcomes in ovarian cancer patients [26], and has been identified as a potential prognostic marker of prostate cancer [27]. [score:1]
A Student’s t-test was conducted to compare the percent caspase activity induced by cisplatin after treating the cells with either ABCD2 siRNA, miR-30d mimic, or scramble control at each concentration. [score:1]
The relationships between ABCD2 and miR-30d, and ABCD2 and platin sensitivity were experimentally validated, suggesting a functional role of ABCD2 and miR-30d in sensitivity to platinating agents. [score:1]
Figure 5 Functional validation of ABCD2 and miR-30d. [score:1]
Functional validation of miR-30d, ABCD2 and platinum sensitivity. [score:1]
A recent study reported that miR-30d was amplified in more than 30% of multiple types of human solid tumors [26], suggesting a therapeutic role of the platinums in these cancers. [score:1]
Functional testing supports the function of ABCD2 and potentially miR-30d in conferring platinum resistance. [score:1]
[1 to 20 of 32 sentences]
11
[+] score: 93
Here, we demonstrated that a sublethal dose of H [2]O [2] (200 µM) up-regulated the expression of miR-30b, a member of the miR-30 family, which inhibited the expression of endogenous catalase both at the transcript and protein levels. [score:10]
Also, the expression of miR-30d was significantly up-regulated in metastasized hepatocellular carcinoma tissues [38]. [score:6]
The expression of miR-30d was also seen to be up-regulated by H [2]O [2] treatment (p = 0.049). [score:6]
Using TargetScan and miRanda algorithms, the human catalase was predicted to be the putative target of miR-30. [score:5]
Our in silico analyses demonstrated that miR-30c and miR-30e are localized in the intron of nuclear transcription factor Y, gamma (NF-YC) on chromosome 1. miR-30a derived from the intronic sequence of ‘chromosome 6 ORF155’, a putative transcription factor, is located on chromosome 6. miR-30b and miR-30d are possibly clustered and expressed under the control of the promoter of ZFAT (zinc finger and AT hook domain containing) gene located on the chromosome 8. The sensitivity of miR-30b/miR-30d to H [2]O [2], as demonstrated in our experiment, is possibly mediated through the transcriptional regulation of the promoter of ZFAT gene. [score:4]
To determine the potential role of miR-30 in H [2]O [2] -mediated cellular effects on antioxidative defense system in ARPE-19 cells, we selected a H [2]O [2] -upregulated miRNA, miR-30b. [score:4]
The bioinformatic analysis for the target site of miR-30 in catalase 3′-UTR is shown in Figure 1. [score:3]
The 8 bp seed sequences of miR-30 and the putative target site in catalase 3′-UTR in both the panels are highlighted in bold. [score:3]
In summary, all five members of the miR-30 family are expressed in human RPE cells of which miR-30b and miR-30d are found to be sensitive to H [2]O [2]. [score:3]
The transcriptional regulation of the members of miR-30 family seems to be different from each other, since they are regulated by different promoters of their respective genes. [score:3]
0042542.g001 Figure 1Panel A: Complimentarity between the members of miR-30 family and the putative human catalase 3′-UTR site targeted (318–324 bp downstream from the human catalase stop codon). [score:3]
The H [2]O [2] treatment in our experiment did not influence the expression of the other three members (miR-30a, miR-30c, and miR-30e) of miR-30 family. [score:3]
As shown in Figure 1, all five members of the miR-30 family (miR-30a through miR-30e) have one 8 bp conserved target site in catalase 3′-UTR. [score:3]
miR-30 targeting human catalase is sensitive to H [2]O [2]. [score:3]
The expression levels of miR-30 family members were determined by qRT-PCR using snRNA U5 as an internal control. [score:3]
It is possible that the mechanisms involving the epigenetic regulation at the DNA level [13] and transcription factor at the transcriptional level [17] regulate the genes that mediate the transcription of miR-30b and miR-30d. [score:3]
This finding is not consistent with the work done in rat cardiac cells, where miR-30b and miR-30d expression was reported to be reduced by H [2]O [2] mediated-oxidative stress [36]. [score:3]
Panel A: Complimentarity between the members of miR-30 family and the putative human catalase 3′-UTR site targeted (318–324 bp downstream from the human catalase stop codon). [score:3]
Moreover, absence of G∶U wobble pairing in the seed sequence and the substantial 3′ pairing of miR-30 with the catalase 3′-UTR strongly led us to believe that the catalase 3′-UTR could be a target of miR-30. [score:3]
In the future, the promoter analysis of the gene of miR-30b/miR-30d is expected to reveal the mechanism of the ROS -mediated gene regulation of miR-30b/miR-30d. [score:2]
Response of miR-30b to H [2]O [2] In order to investigate whether the expression of miR-30 family members was influenced by H [2]O [2], ARPE-19 cells were treated with vehicle or 200 µM H [2]O [2] for 18 h. The expression level of miR-30b as determined by qRT-PCR was found to be sensitive to H [2]O [2] (p = 0.004) when compared with the control. [score:2]
The expression of other members of miR-30 family (miR-30a, miR-30c, and miR-30e) was not observed to be altered by H [2]O [2] treatment, as compared to the control (Figure 4 ). [score:2]
The plasmid containing mutant catalase 3′-UTR (pmirGLO-Cat-3′-UTR-mut) was generated using QuikChange Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, CA) by changing the core of the three miR-30 binding sites from 5′-TGTTTAC-3′ to 5′-T CT AT GC-3′. [score:2]
In order to investigate whether the expression of miR-30 family members was influenced by H [2]O [2], ARPE-19 cells were treated with vehicle or 200 µM H [2]O [2] for 18 h. The expression level of miR-30b as determined by qRT-PCR was found to be sensitive to H [2]O [2] (p = 0.004) when compared with the control. [score:2]
The molecular mechanism of ROS -mediated gene regulation of the miR-30 family members has not been demonstrated yet. [score:2]
H [2]O [2] increased the expression levels of miR-30b (p = 0.004) and miR-30d (p = 0.049) miRNAs as compared to the control. [score:2]
In our investigation, we found that the expression of miR-30b and miR-30d was sensitive to H [2]O [2] stimulation. [score:1]
The miR-30 family is comprised of five distinct mature miRNA sequences, which are organized into three clusters: miR-30a/miR-30c-2, miR-30d/miR-30b, and miR-30e/miR-30c-1 [39]. [score:1]
The human catalase 3′-UTR contains one putative miRNA binding site for the members of miR-30 family. [score:1]
Although the mature miRNA sequences of all the members of miR-30 family share a common 8-mer conserved seed sequence, the flanking sequences between the members are substantially different from each other (Figure 1A ). [score:1]
In silico analysis of these databases demonstrated that the human catalase 3′-UTR harbors a single binding site for the members of miR-30 family. [score:1]
[1 to 20 of 31 sentences]
12
[+] score: 84
Previous studies have shown that miR-10a can target IL-12/IL-23p40 expression [32] and pro-apoptotic protein Bim [33], while miR-30d can negatively regulate apoptotic caspase CASP3 [34] and tumor suppressor p53 gene [35]. [score:8]
The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study. [score:7]
Serving as negative regulators of cell apoptosis, miR-10a and miR-30d have been found to be upregulated in various cancer tissues, such as prostate cancer [36]. [score:5]
This result was further validated using a TaqMan probe -based qRT-PCR, we detected the expression of miR-10a, miR-30d and miR-192 in various mouse organs: the heart, spleen, kidney, colon and lung. [score:3]
In addition, urinary miR-10a and miR-30d are highly enriched to the kidney; therefore, the elevation of these miRNAs may be directly linked to the injuries of kidney. [score:2]
Because miR-10a and miR-30d are enriched in kidney tissue (Figure 1), urinary miR-10a and miR-30d are probably derived directly from the kidneys, particularly when kidney injury has occurred. [score:2]
The elevation of kidney-enriched miR-10a and miR-30d in urine (Figure 2) but not serum (Figure S2) during renal I/R indicated that these miRNAs may be directly correlated with kidney injury. [score:2]
Identification of miR-10a and miR-30d as kidney-specific miRNAs. [score:1]
This hypothesis is supported by our observation that the elevation of miR-10a and miR-30d concentrations occurred only in urine and not in serum when mice were treated with renal I/R. [score:1]
Next, we tested whether miR-10a and miR-30d are released into animal urine under normal and injury conditions. [score:1]
However, it could also be true that renal cells and tissues actively release more miR-10a and miR-30d into circulation under the stress. [score:1]
Note that, following renal I/R, the levels of mouse kidney miR-10a and miR-30d are decreased whereas the levels of pre-miR-10a and pre-miR-30d are not changed. [score:1]
The role of tissue miR-10a and miR-30d in kidney function also strengthens our conclusion that urinary miR-10a and miR-30d can serve as indicators for kidney injury. [score:1]
We used both I/R -induced acute kidney injury and STZ diabetes -induced chronic kidney injury animal mo dels and showed that changes in the levels of urinary miR-10a and miR-30d occurred as a result of renal damage. [score:1]
Importantly, when kidney injury occurred, the levels of miR-10a and miR-30d in urine were strikingly elevated, while their levels in the serum were not increased. [score:1]
Interestingly, we found that the miR-10a and miR-30d levels in serum were not correlated with kidney injury. [score:1]
More importantly, the levels of urinary miR-10a and miR-30d were significantly increased in mice with either unilateral ischemia/reperfusion or bilateral ischemia/reperfusion. [score:1]
In the present study, we observed increases in the urinary concentrations of miR-10a and miR-30d corresponding to kidney injuries. [score:1]
High levels of urinary kidney-enriched miR-10a and miR-30d clearly indicate the kidney injuries in FSGS patients. [score:1]
In contrast, reduction of miR-10a and miR-30d in kidney cells would cause cell apoptosis and damage, which may finally lead to renal dysfunction. [score:1]
To find out whether the elevation of urinary miR-10a and miR-30d also occurs in patient with kidney injuries, we assessed the levels of urinary miR-10a and miR-30d in FSGS patients. [score:1]
For mouse kidney, after rule out the miRNAs with very low total signal, we found that miR-10a and miR-30d, as well as other miRNAs in miR-1 and miR-30 families, were relatively enriched in kidney tissue. [score:1]
Figure S3 The levels of miR-10a, miR-30d, pre-miR-10a and pre-miR-30d in mouse kidney tissues detected by TaqMan probe -based qRT-PCR with U6 serving as an internal control. [score:1]
After bilateral renal I/R, the level of miR-30d in serum was still unchanged, while the level of miR-10a was reduced. [score:1]
The results for the human urine samples further confirmed the feasibility of using the urinary miR-10a and miR-30d levels to detect kidney injury in humans. [score:1]
Elevation of the urinary miR-10a and miR-30d levels can be detected in mice with unilateral I/R in which the protein levels were not changed, suggesting that the urinary miR-10a and miR-30d levels can reflect mild or early kidney injury. [score:1]
Figure S2 Level of serum miR-10a and miR-30d in mice with/without renal ischemia-reperfusion injury. [score:1]
Elevation of the urinary miR-10a and miR-30d levels but not serum miR-10a and miR-30d in mice with STZ diabetes -associated kidney injury. [score:1]
0051140.g003 Figure 3Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered. [score:1]
As shown in Figure S3A, both miR-10a and miR-30d in mouse kidney were significantly reduced during renal I/R. [score:1]
Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered. [score:1]
Furthermore, urinary miR-10a and miR-30d exhibited a diagnostic sensitivity that was considerably superior to that of BUN when the results were correlated to the histopathological results. [score:1]
Next we determined the levels of miR-10a and miR-30d in mouse kidney tissue with or without renal I/R. [score:1]
Elevation of miR-10a and miR-30d levels in the urine of FSGS patients. [score:1]
A) Levels of miR-10a and miR-30d in mouse kidney with or without renal I/R. [score:1]
Interestingly, although the chronic hyperglycemia caused an elevation of urinary miR-10a and miR-30d likely due to the kidney damage, a short period of high blood glucose exposure did not increase the level of these kidney-specific miRNAs in urine. [score:1]
Through decreasing the levels of these apoptotic or pro-apoptotic proteins and inflammatory cytokines, miR-10a and miR-30d might provide a protection to kidney tissues/cells. [score:1]
Interestingly, the levels of pre-miR-10a and pre-miR-30d in mouse kidney tissues were not changed (Figure S3B). [score:1]
By comparing the levels of miRNA in sera and urine, we found that kidney-enriched miRNAs, such as miR-10a and miR-30d, were present in urine, and their concentrations were approximately 1/10 of those in sera. [score:1]
In summary, our study demonstrated that miR-10 and miR-30d are stably present in human and animal urine and that the elevation of the urinary miR-10a and miR-30d levels can serve as a novel urine -based biomarker of kidney injury. [score:1]
As shown in Figure S2, no alteration of miR-10a or miR-30d in mouse serum was observed after unilateral renal I/R. [score:1]
Therefore, we also detected the levels of miR-10a and miR-30d in mouse serum with or without renal I/R. [score:1]
As shown in Figure 4, we found that the urinary miR-10a and miR-30d levels in FSGS patients were significantly higher than those in healthy volunteers, indicating the severity of the kidney injuries in these patients. [score:1]
Together, these results strongly suggest that urinary miR-10a and miR-30d could serve as sensitive and specific biomarkers for kidney injury. [score:1]
As shown in Figure 1, we found that mouse kidneys contained a significantly higher level of miR-10a and miR-30d than did other tissues, confirming that these two miRNAs are kidney specific. [score:1]
Moreover, pre-miR-10a and pre-miR-30d were not detected in mouse urine by qRT-PCR (data not shown). [score:1]
Using different mouse renal injury mo dels, we reported that miR-10a and miR-30d were readily detected in urine and that their levels specifically correlated with mouse kidney injury induced by renal ischemia-reperfusion or STZ treatment. [score:1]
Clarifying the role of miR-10a and miR-30d in the tumorigenesis processes of these cancer cells may be helpful for understanding the correlation between urinary miR-10a/miR-30d and kidney injures. [score:1]
Elevation of the urinary miR-10a and miR-30d levels in mice with renal I/R -mediated injury. [score:1]
These results strongly suggest that urinary miR-10a and miR-30d can serve as ideal biomarkers for kidney injury. [score:1]
B, no alteration in the serum miR-30d level in mice with either SS or DS I/R treatment was observed. [score:1]
Therefore, an elevation of urinary miR-10a/miR-30d levels correlates to a decrease of kidney miR-10a/miR-30d levels, which links to cell apoptosis and kidney injury/damage. [score:1]
C–D, significant elevation of the urinary miR-10a (C) and miR-30d (D) levels in mice with either SS I/R or DS I/R. [score:1]
These results suggest that the elevation of urinary miR-10a and miR-30d levels may specifically reflect hyperglycemia -induced kidney injury. [score:1]
Urine samples from normal male C57BL/6J mice (6–8 weeks old, 22–25 g) and male C57BL/6J mice with kidney injuries were collected, and absolute levels of miR-10a and miR-30d were assessed. [score:1]
B) Levels of pre-miR-10a and pre-miR-30d in mouse kidney with or without renal I/R. [score:1]
These results collectively suggest that elevation of mouse urinary miR-10a and miR-30d during renal I/R is likely due to the release of mature miR-10a and miR-30d from mouse kidney tissue. [score:1]
Alteration of the urinary miR-10a and miR-30d levels in FSGS patients. [score:1]
Identification of miR-10a and miR-30d as mouse kidney-enriched miRNAs. [score:1]
To test whether urinary miR-10a and miR-30d can be biomarkers for diabetes -induced renal injury, we employed streptozotocin (STZ) -treated diabetic mice as another kidney injury mo del. [score:1]
The elevation of the urinary levels of miR-10a and miR-30d was also confirmed in urine samples from patients with focal segmental glomerulosclerosis (FSGS). [score:1]
By challenging 12 h–fasting mice with an intraperitoneal injection of glucose (2 g/kg of body weight), we found no elevation of urinary miR-10a and miR-30d within 1–3 h (data not shown). [score:1]
[1 to 20 of 62 sentences]
13
[+] score: 81
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30b, hsa-mir-30c-1, hsa-mir-30e
In the process of generating stable EGFP knockdown cell lines in human Jurkat T cells by using an anti-EGFP shRNA expressed from CMV -driven miR30-backbone expression vectors (shRNA-miRs, see Figure 1A for design of the constructs), we noted a much reduced target knockdown (52.7%) as compared to identical shRNAs expressed from the mouse polymerase III U6 promoter (90.2%, see Figure 1B, top panels). [score:10]
Since this processing could be impacted by the number of mRNA copies present in the cell, we thus chose to correlate the relative mCherry expression with viruses not expressing the miR-30 cassette to the percentage of target knockdown in cells expressing the shRNAs. [score:10]
B) EGFP -expressing Jurkat T cells (top panels) or 293T cells (lower panels) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a mouse U6 promoter (U6 anti-EGFP shRNA) or from a miR-30 backbone expressed from a CMV promoter (miR-context anti-EGFP shRNA) or the relevant control viruses that lack shRNA inserts. [score:7]
EGFP -expressing human immune cell types (Raji B cells, Jurkat T cells, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoter. [score:5]
EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoters. [score:5]
2±2.4 72.2±2.4 60.2±0.4 56.7±4.9 76.7±0.7EGFP -expressing human cell lines (see top row) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoters (left column). [score:5]
0026213.g003 Figure 3 EGFP -expressing human immune cell types (Raji B cells, Jurkat T cells, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoter. [score:5]
0026213.g006 Figure 6EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoters. [score:5]
EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoter. [score:5]
0026213.g005 Figure 5EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoter. [score:5]
We set out to explore the nature of this discrepancy, and assessed whether the potency of the polymerase II promoter used to express the miR30-backbone anti-EGFP shRNAs could impact the shRNA-directed silencing in Jurkat T cells. [score:4]
Monitoring EGFP knockdown by shRNAs expressed from miR-30 backbone vectors. [score:4]
For all lines, there was a clear correlation between promoter strength (as determined by mCherry expression) and EGFP-knockdown by the miR30-backbone anti-EGFP shRNA, suggesting that the strength of the promoter is a major determinant for shRNA-miR potency. [score:4]
B) mCherry expression is reduced upon cloning of an shRNA-containing miR-30 cassette in the 3′UTR of the fluorescent protein. [score:3]
As additional controls, cells were infected with the same viruses lacking a miR-30-anti-EGFP unit. [score:1]
Various mammalian and viral polymerase II promoters (CMV, PGK, UbiC, CAGGS, EF1A) were cloned upstream of mCherry in the miR30-anti-EGFP vectors and control (mCherry alone) vectors. [score:1]
To this end, we cloned five different polymerase II promoters upstream the miR-30 anti-EGFP shRNA cassette that is located in the 3′UTR of the fluorescent protein mCherry to mark cells that have been infected with the lentiviral construct. [score:1]
A similar anti-EGFP shRNA sequence with the miR30 loop (bold) was cloned between miR30 pricursor arms (underlined and italic) downstream of mCherry in the same vector (AAGAAGGTATATTGCTGTTGACAGTGAGCG TCAAGCTGACCCTGAAGTTCAT TAGTGAAGCCACAGATGTAATGAACTTCAGGGTCAGCTTGC TGCCTACTGCCTCGGACTTCAAGGGG ), the U6 promoter unit was removed. [score:1]
[1 to 20 of 18 sentences]
14
[+] score: 79
Let-7c, miR-17, miR20a, and miR-30d were the four miRNAs out of the 275 analyzed by both RT-qPCR and RNAseq that showed differential expression (p<0.05) between normal and diseased cells with the same direction in change (up- or down-regulated) by both methods. [score:9]
A decrease in miR-30d expression was seen when comparing between VICs of mildly diseased and severely diseased valves (c). [score:7]
When comparing between VICs from severely diseased valves and mildly diseased valves, a decrease in miR-30d expression level was seen (p = 0.031 PCR, p = 0.031 RNAseq, FC = -3.8) (Fig 7c). [score:7]
RT-qPCR and RNAseq analyses showed a decrease in miR-30d expression in VICs from severely diseased valves compared with mildly diseased valves. [score:6]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
Given the increase in median age for the dogs in the mildly and severely diseased group, we have also analyzed the effect of age on miRNA expression levels and did not find any age -associated change in let-7c, miR-17, miR-20a, and miR-30d. [score:5]
We have demonstrated that miRNA dysregulation (let-7c, miR-17, miR-20a, and miR-30d) may participate in canine MMVD development, and these miRNA should be explored further as potential therapeutic targets. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
PCA and HCL analyses of the four miRNAs of interest (let-7c, miR-17, miR-20a, and miR-30d) using both RT-qPCR and RNAseq data also supported the observed miRNA differences between VICs from severely diseased valves and those from normal and mildly diseased valves. [score:5]
Melman et al. showed that miR-30d may play a role in protecting cells from apoptosis by targeting mitogen -associated kinase 4 (MAP4K4), a downstream effector of tumor necrosis factor (TNF). [score:3]
And in their canine mo del, they showed a decrease in miR-30d expression in coronary blood was seen tachypacing -induced heart failure [29]. [score:3]
Because our candidate miRNA (let-7c, miR-17, miR-20a, and miR-30d) were deemed differentially expressed by both techniques, we believe that the probability for false positive or spurious changes is decreased, thus strengthening our findings. [score:3]
In addition, miRNA profiling of VICs using both RT-qPCR and RNAseq showed decreases in expressions of let-7c, miR-17, miR-20a, and miR-30d. [score:3]
Let-7c, miR-17, miR-20a, and miR-30d were decreased in VICs of diseased valves. [score:3]
Loss of miR-30d and putative dysregulation of apoptosis. [score:2]
In this study of canine MMVD, we observed dysregulated miRNAs associated with the control of myofibroblastic differentiation, extracellular matrix (let-7c, miR-17, miR-20a), and senescence and apoptosis (miR-17, miR-20a, miR-30d) [23– 31]. [score:2]
Hierarchical clustering of let-7c, miR-17, miR-20a, and miR-30d using both RT-qPCR and RNAseq data. [score:1]
Normalized RT-qPCR C [q] number and RNAseq count number for let-7c, miR-17, miR-20a, and miR-30d. [score:1]
Principal component analysis of let-7c, miR-17, miR-20a, and miR-30d using both RT-qPCR and RNAseq data. [score:1]
In addition, it is unclear if let-7a, miR-17, miR-20a, and miR-30d are differentially sorted into exosomes by VICs. [score:1]
severe (p<0.05) cfa-let-7c, cfa-miR-10a, cfa-miR-1307, cfa-miR-132, cfa-miR-136, cfa-miR-181a, cfa-miR-181b, cfa-miR-196b, cfa-miR-20a, cfa-miR-30d, cfa-miR-33b, cfa-miR-34c, cfa-miR-497, cfa-miR-499, cfa-miR-676 Mild vs. [score:1]
0188617.g007 Fig 7Normalized RT-qPCR C [q] number and RNAseq count number for let-7c, miR-17, miR-20a, and miR-30d. [score:1]
[1 to 20 of 22 sentences]
15
[+] score: 78
To do this, we injected the neurone -targeted gene knock-down system (LV-mCMV/SYN-tTA + LV-Tretight-GFP-miR30-shRNA/Luc) with LVV to express Luc in astrocytes (LV-GfaABC [1]D-Luc) and, conversely, the astrocyte -targeted knock-down system (LV-mCMV/GfaABC [1]D-tTA+ LV-Tretight-GFP-miR30-shRNA/Luc) together with LVV for neuronal Luc expression (LV-SYN-Luc). [score:11]
LTR, lentiviral long terminal repeats; Tretight, a modified tetracycline and Dox-responsive promoter derived from pTRE-tight (Clontech); GFP, green fluorescence protein; miR30-shRNA/Luc, miR30 -based shRNA targeting firefly Luc gene; miR30-shRNA/nNOS, miR30 -based shRNA targeting rat neuronal nitric oxide synthase gene; Luc, firefly Luc gene; GfaABC [1]D, a compact glial fibrillary acidic protein promoter (690 bp); SYN, human synapsin 1 promoter (470 bp); mCMV, minimal CMV core promoter (65 bp); GAL4BDp65, a chimeric transactivator consisting of a part of the transactivation domain of the murine NF-κBp65 protein fused to the DNA binding domain of GAL4 protein from yeast; WPRE, woodchuck hepatitis post-transcriptional regulatory element. [score:6]
To this end, we constructed a binary Dox-controllable and cell-specific miR30 -based RNAi system to express shRNAs targeting a reporter gene for Luc and an endogenous gene for nNOS. [score:5]
a: LV-mCMV/GfaABC [1]D-tTA controlled miR30-shRNA/Luc didn't knockdown Luc expression in neurones. [score:4]
b: LV-mCMV/SYN-tTA controlled miR30-shRNA/Luc didn't knockdown Luc expression in glia. [score:4]
These results demonstrate that bidirectional transcriptionally amplified SYN and GfaABC [1]D promoters provide a sufficient level of tTA to activate the Tretight promoter which then drives the synthesis of GFP-miR30-shRNA/Luc transcript to induce substantial Luc knock-down. [score:3]
tTA binds to Tretight promoter in LV-Tretight-GFP-miR30-shRNA/Luc and activates the expression of shRNA/Luc. [score:3]
In these constructs gene targeting sequences were embedded in the precursor miRNA context derived from miR30, one of the most well-studied miRNA in mammals. [score:3]
Abbreviation Vector combination Function LVVs-miRLuc-neuroneLV-SYN-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/SYN-tTA Neurone-specific Luc knock-down system. [score:2]
LVVs-miRnNOS-neuroneLV-Tretight-GFP-miR30-shRNA/nNOS+ LV-mCMV/SYN-tTA Neurone-specific nNOS knock-down system. [score:2]
LVVs-miRLuc-control2LV-GfaABC [1]D-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc + LV-GfaABC1D-WPRE Control combination used in Luc knock-down experiments for the astrocyte-specific system. [score:2]
LVVs-miRnNOS -negative control1LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/SYN-tTA Negative control combination used in nNOS knock-down experiments for the neurone-specific system. [score:2]
Again, the anti-Luc construct LV-Tretight-GFP-miR30-shRNA/Luc (treatments 4 in Figure 4c and Figure 4d) did not trigger nNOS knock-down. [score:2]
LVVs-miRnNOS-control2LV-Tretight-GFP-miR30-shRNA/nNOS + LV-GfaABC [1]D-WPRE Control combination used in nNOS knockdown experiments for the astrocyte-specific system. [score:2]
LVVs-miRLuc-gliaLV-GfaABC [1]D-Luc+LV-Tretight-GFP-miR30-shRNA/Luc+LV-mCMV/GfaABC1D-tTA Astrocyte-specific Luc knock-down system. [score:2]
LVVs-miRnNOS-control1 LV-Tretight-GFP-miR30-shRNA/nNOS + LV-SYN-WPRE Control combination used in nNOS knockdown experiments for the neurone-specific system. [score:2]
LVVs-miRnNOS-glia LV-Tretight-GFP-miR30-shRNA/nNOS + LV-mCMV/GfaABC1D-tTA Astrocyte-specific Luc knock-down system. [score:2]
Lentiviral systems developed in the course of this study enable tight Dox-controllable and cell-specific miR30 -based RNAi gene knock-down. [score:2]
LVVs-miRLuc-control1LV-SYN-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc+ LV-SYN-WPRE Control combination used in Luc knock-down experiments for the neurone-specific system. [score:2]
LVVs-miRnNOS -negative control2LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/GfaABC1D-tTA Negative control combination used in nNOS knock-down experiments for the astrocyte-specific system. [score:2]
It is important to note that anti-Luc construct, LV-Tretight-GFP-miR30-shRNA/Luc (treatment 4 in Figure 4a and Figure 4b), was without effect in either cell line, indicating that the nNOS knock-down was sequence-specific. [score:2]
Figure 3Analyses of the efficacy of miR30-shRNA/Luc in vivo in adult rat brain. [score:1]
First, the effect of miR30-shRNA/Luc was assessed in cell lines. [score:1]
To examine whether the different RNAi efficiency in DVC and HIP is caused by different processing of RNAi, we performed northern blotting analysis to assess the ratio between mature -RNAi and precursor-miR30 -RNAi in these two regions. [score:1]
Analysis of the effects of miR30-shRNA/Luc in vivo. [score:1]
We first confirmed the efficacy of the anti-nNOS construct, LV-Tretight-GFP-miR30-shRNA/nNOS in PC12 and 1321N1 cells. [score:1]
Figure 4Western-blot analyses of the functions of miR30-shRNA/nNOS both in vitro (a, b) and in vivo (c, d). [score:1]
A: LVVs-miRLuc-control1; B: LV-SYN-Luc + LV-Tretight-GFP-miR30-shRNA/Luc + LV-mCMV/GfaABC [1]D-tTA. [score:1]
To construct the LV-Tretight-GFP-miR30-shRNA/nNOS shuttle vector, we replaced the Luc shRNA sequence in the LV-Tretight-GFP-miR30-shRNA/Luc shuttle vector with the nNOS shRNA. [score:1]
Figure 2Analyses of the functions of miR30-shRNA/Luc in vitro. [score:1]
A': LVVs-miRLuc-control2; B': LV-GfaABC [1]D-Luc + LV-Tretight-GFP-miR30-shRNA/Luc + LV-mCMV/SYN-tTA. [score:1]
To generate the LV-Tretight-GFP-miR30-shRNA/Luc shuttle vector, we excised the Tretight fragment containing the modified Tet-responsive promoter from pTRE-Tight-DsRed2 (Clontech) and inserted it into the pTYF-SW Linker and cloned, into the obtained vector, PCR product of GFP-miR30-shRNA/Luc cassette from pPRIME-CMV-GFP-FF3 (kindly provided by F. Stegmeier, Harvard Medical School) downstream of Tretight promoter. [score:1]
Our constructs, following the design of Stegmeir et al. used flanking and loop sequences from an endogenous miR30 [37]. [score:1]
Analyses of the functions of miR30-shRNA/Luc in vitro. [score:1]
[1 to 20 of 34 sentences]
16
[+] score: 77
miR-30d exerted a ~30%, statistically significant, down-regulation of ADAM12-L expression in SUM159PT cells and no apparent inhibition of ADAM12-L expression in SUM1315MO2 cells. [score:10]
We have selected to study two representative miRNAs from each family: miR-29b (a potent inhibitor of breast tumor metastasis [34]) and miR-29c (associated with a significantly reduced risk of dying from breast cancer [41]), miR-30b and miR-30d (both significantly down-regulated in ER -negative and progesterone receptor (PR) -negative breast tumors [42]), and miR-200b and miR-200c (both representing key negative regulators of EMT and anoikis resistance [30- 32]). [score:7]
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
To test whether miR-30b or miR-30d directly targets the ADAM12-L 3′UTR, we used the luciferase reporter in SUM159PT cells. [score:4]
In contrast, miR-30d seemed to down-regulate ADAM12-L in SUM159PT cells, but this effect was not reproduced in SUM1315MO2 cells, and the ADAM12-L 3′UTR reporter activity was not diminished in response to miR-30d. [score:4]
We conclude that the miR-30 family does not contribute significantly to the regulation of ADAM12-L expression in the two cell lines examined here. [score:4]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
Down-regulation of miR-30 family members was observed in non-adherent mammospheres compared to breast cancer cells under adherent conditions [37]. [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
miRNA profiling of 51 breast cancer cell lines has previously established that miR-29b/c, miR-30d, and miR-200b/c are under-expressed in claudin-low breast cancer cell lines (ref. [score:3]
Destruction of the potential miR-30 target site by mutagenesis eliminated the effect of miR-30b mimic. [score:3]
Reduction of miR-30 levels was reported to promote self-renewal and to inhibit apoptosis in breast tumor-initiating cells [36]. [score:3]
The miR-30 family appears to modulate the stem-like properties of breast cancer cells as well. [score:1]
Transfection of miR-30b mimic elicited a significant decrease in luciferase activity but miR-30d mimic did not (Figure  3C). [score:1]
Among the three miRNA families tested, miR-30 elicited the least consistent effects. [score:1]
Both miR-30b and miR-30d had only minor effects on ADAM12-L protein levels in SUM159PT and SUM1315MO2 cells. [score:1]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
[1 to 20 of 21 sentences]
17
[+] score: 66
It might occur at the stage of disease initiation: compared with normal Wistar rat, varied copy number of mir-30b and mir-30d in GK might result in altered expression level at some specific developmental stages and at some specific tissues, and the altered expression of mir-30b and mir-30d might then lead to dysfunction of some specific targets, contributing to the development of T2D. [score:10]
We then mapped these microRNA targets to KEGG pathways, and found that 5(2), 12(6), 10(4), 14(12), 4(5) and 1(3) targets of mir-30b(mir-30d) belonged to the pathways of “type II diabetes (04930)”, “Type I diabetes (04940)”, “pancreatic cancer (05212)”, “insulin signaling (04910)”, “PPAR signaling (03320)” and “maturity onset diabetes of the young (04950)”, respectively (Table 4). [score:5]
In addition to the aforementioned study of the expression of mir-30d, there were several other expression profiling reports suggesting the involvement of mir-30 family in diabetes or adipogenesis [47]– [49]. [score:5]
It turned out that 39 and 35 targets of mir-30b and mir-30d occurred in this T2D gene list respectively, and were both significantly overrepresented (p = 0.000273 and 0.00152, detailed targets listed in Table 3), supporting the hypothesis of mir-30b and mir-30d's involvement in T2D. [score:5]
Since rno-mir-30b was processed to two mature forms, rno-miR-30b-3p and rno-miR-30b-5p, their targets were combined for further analysis; and it was the same with rno-mir-30d, where the targets of rno-miR-30d and rno-miR-30d* were merged. [score:5]
A recent publication reported that altered expression of mir-30d, as a response to glucose, influences insulin gene expression in mouse Min6, a pancreatic island cell line [38]. [score:5]
Among them, Pparg and Akt2 (targets of mir-30b), Hnf1b, Hnf4a, and Lmna (targets of mir-30d), are well-known genes implicated in T2D or insulin resistance. [score:5]
The targets of rno-mir-30b and rno-mir-30d involved in diabetes-related pathways. [score:3]
microRNA Predicted targets rno-mir-30b Aire, Akt2 *, Bud13, Cblb, Cdc123, Eif4e, Elf1, Fgb, Gcg, Hdac3, Irf4, Kcnj5, Klrg1, Mapk8, Med14, Mgea5, Mttp, Neurod1, Nfkb1, Nmu, Parl, Pbx1, Pfkl, Pik3r2, Pparg *, Ppargc1b, Prkce, Prmt2, Rapgef4, Rpa2, Rrad, Serpine1, Slc2a10, Socs1, Srebf1, Tlr4, Ubl5, Ucp2, Wdr42a rno-mir-30d Ace, Cblb, Cdh15, Cp, Cyb5r4, Egfr, Foxo1, Hdac3, Hnf1b *, Hnf4a *, Inpp5k, Irf4, Lgr5, Lmna *, Neurod1, Nfkb2, Nfkbia, Nr1i3, Nr4a1, Parl, Pbx1, Pik3r2, Ppargc1b, Ppp1r3d, Prkar2b, Ptf1a, Rbp4, Rrad, Sell, Sirt1, Slc2a10, Socs1, Sorcs1, Srebf1, Tlr4 *Well-known genes implicated in T2D or insulin resistance. [score:3]
Targets of rno-mir-30b and rno-mir-30d in T2D-related genes. [score:3]
As for the microRNA expression dataset GSE13920, we simply looked at the mean signal intensities after removing mean background noise for each probe of mir-30b and mir-30d. [score:3]
Taken together, there were 1868 and 1776 targets for rno-mir-30b and rno-mir-30d, respectively. [score:3]
Table S11 Pathway mapping and enrichment of the targets of rno-mir-30d. [score:3]
The down-regulation of Zfat in muscles is consistent with that of mir-30b and mir-30d, that is, all of them are inconsistent with the CNV gain, suggesting further investigations are still needed to confirm these results and to unveil detailed mechanisms. [score:2]
A non-redundant set of CNV regions with the total length of about 36 Mb was identified, including several novel T2D susceptibility loci involving 16 protein-coding genes (Il18r1, Cyp4a3, Sult2a1, Sult2a2, Sult2al1, Nos2, Pstpip1, Ugt2b, Uxs1, RT1-A1, RT1-A3, RT1-Db1, RT1-N1, RT1-N3, RT1-O, and RT1-S2) and two microRNA genes (rno-mir-30b and rno-mir-30d). [score:1]
The microRNA rno-mir-30b and rno-mir-30d located in T2D QTLs. [score:1]
We noticed that there was a protein-coding gene named Zfat which is located at the same gain CNVR as mir-30b and mir-30d are positioned in. [score:1]
By comparing the genomic positions of known rat microRNA genes with those of GK/Wistar CNVRs, we found that rno-mir-30b and rno-mir-30d were simultaneously covered by a “gain” region on chromosome 7 in all three samples (Table S9) within a region of only 3.8 Kb. [score:1]
We proposed that the altered copy number of mir-30b and mir-30d in GK rats could contribute to the pathogenesis of T2D. [score:1]
0014077.g002 Figure 2The microRNA rno-mir-30b and rno-mir-30d located in T2D QTLs. [score:1]
[1 to 20 of 20 sentences]
18
[+] score: 59
To calculate the expression of the target gene miR-30* relative to each of the EC candidates, the ΔΔCt method was used, with ΔΔCt = (Ct target gene, test sample-Ct endogenous control gene, test sample)-(Ct target gene, calibrator sample-Ct endogenous control gene, calibrator sample). [score:7]
For example, in the BEN and BM breast tissues, the expression of miR-30* could be made to appear up- or down-regulated relative to normal breast tissue depending on the EC gene used (Fig. 2A). [score:6]
Downregulation of miR-30* has previously been shown to increase transcription of mRNAs involved in processes such as angiogenesis (thrombospondin I, cysteine-rich, angiogenic inducer) and cell cycle transition (cyclin -dependent kinase 6) [38]. [score:4]
MiR-30* expression was significantly different between the tissue subgroups (P < 0.05) except when using miR-26b as a single EC. [score:3]
Significant differences in miR-30* expression were detected between tissue groups using either the one EC (P = 0.007) or the two EC (P = 0.01) approach, however the BM and MF tissue groups were found to be significantly different using the EC pair, let-7a and miR-16 but this was not detected when let-7a was used as the sole EC gene. [score:3]
Effect of EC on Relative Quantity of miR-30*To assess the effect of EC on relative quantitation of the target gene, miR-30*, this miRNA was normalised using each of the candidate EC genes in turn. [score:3]
miR-30* was differentially expressed between groups using either the top 2 or the top 5 most stable ECs (p < 0.05). [score:3]
To assess the effect of EC on relative quantitation of the target gene, miR-30*, this miRNA was normalised using each of the candidate EC genes in turn. [score:3]
Conversely, the 5 gene approach identified a significant difference in miR-30* expression between the MF and VBM tissues, not detected when using the most stable pair. [score:3]
Significant differences in miR-30* expression were detected between the tissue groups using either the top two ECs (P = 0.01) or the top five ECs (P = 0.002, Fig. 2B). [score:3]
The differences in miR-30* expression detected between the tissue groups varied greatly depending on which single EC was used for normalisation. [score:3]
MiR-30*, previously referred to as miR-30a-3p, targets RNA involved in several cancer-related biological processes [38] and was chosen as a target gene to investigate the effect of EC gene selection on relative quantitation. [score:3]
Significant differences in miR-30* expression were detected between the tissue groups using either the top two ECs (P = 0.01) or the top five ECs (P = 0.002, Fig. 2B), however the post-hoc analyses varied slightly in that the two gene normalisation detected a difference between the BEN and MF tissue groups not detected by the five EC gene approach. [score:3]
Thus the effect of using either let-7a as a single gene or using the recommended EC pair, let-7a and miR-16, on miR-30* expression was assessed. [score:3]
Only normalisation with RNU48 detected a significant difference in miR-30* expression between the MF and VBM tissue groups. [score:3]
Depending on the normaliser, miR-30* expression was either significantly different between tissue groups (P < 0.05) or no differences were detected. [score:3]
Figure 3Boxplot of miR-30* relative quantities in benign (BEN, clear), bone metastases (BM, dark), metastases free (MF, dashed) and visceral and bone metastases (VBM, shaded) tissues using different normalisation strategies. [score:1]
MiR-30* was normalised using the top two EC genes and using the top five EC genes to assess what effect this would have on miR-30* relative quantification. [score:1]
Effect of EC on Relative Quantity of miR-30*. [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 58
Recent studies showed that miR-30a regulated growth of breast cancer cells [26], down-regulation of miR-30 maintained self-renewal and inhibited apoptosis in breast tumor-initiating cells [27], miR-30 regulated B-Myb expression during cellular senescence [28]. [score:10]
As miRNAs are a group of post-transcriptional gene regulators which potentially play a critical role in tumorigenesis by regulating the expression of their target genes, the target genes of miR-30 that functioned in NSCLC pathogenesis was further analyzed. [score:9]
Increasing evidences indicate that miR-30 expression is down-regulated in numerous human cancers including non-small cell lung cancer (NSCLC) which hypothesizes that miR-30 may play an important role in tumorigenesis. [score:6]
As the down-regulation of miR-30 is related to a number of cancers, it has been hypothesized that miR-30 may play an important role in tumorigenesis and tumor development. [score:5]
miR-30 is significantly down-regulated in several cancers, including breast cancer [17], malignant peripheral nerve sheath tumors [18], glioma [19], and lung cancer [20]. [score:4]
Human miR-30 is down-regulated in several tumor types including NSCLC [20]. [score:4]
s were conducted to explore the impact of miR-30 overexpression on the proliferation of human NSCLC cells. [score:3]
The effect of miR-30 on endogenous levels of this target were subsequently confirmed via (WB). [score:3]
Luciferase reporter assays were employed to validate regulation of a putative target of miR-30. [score:3]
This suggests miR-30 is a potential tumor suppressor. [score:3]
Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed to determine the expression level of miR-30 in NSCLC specimens and adjacent non-tumor tissues. [score:3]
In this study, we focused on miR-30 which was decreased in several tumor types including NSCLC. [score:1]
However, the function of miR-30 especially in NSCLC remains unclear. [score:1]
Human miR-30 family including miR-30a, miR-30b, miR-30c, miR-30d and miR-30e have the samilar sequence. [score:1]
However, the role of miR-30 in cancers especially in NSCLC is not very much known. [score:1]
The aim of this study was to investigate the target gene of miR-30 and its roles in tumor growth of NSCLC. [score:1]
[1 to 20 of 16 sentences]
20
[+] score: 57
Mutation of the ARE-motif further downregulated reporter expression, whereas the double mutation of miR-30 binding sites abolished the downregulatory effect of the calretinin 3′UTR. [score:11]
Utilizing several prediction algorithms, miR-30 family members were identified as potential candidates targeting calretinin mRNA; overexpression or inhibition experiments revealed that only miR-30e-5p is able to modulate calretinin protein levels through the calretinin 3′UTR. [score:7]
FIGURE 4Members of miR-30 family are abundantly expressed in mesothelioma cell lines and miR-30e-5p regulates calretinin expression. [score:6]
The observation that the double miR-30 mutant construct (pmiRGLO-CALB2-3′UTR-mir30-dmt) abolished the downregulatory effect mediated by CALB2-3′UTR, led us to identify the critical miR-30 member conveying this effect. [score:4]
In contrast, mutation of both miR-30 binding sites restored the expression of the luciferase reporter to the level of the empty vector. [score:4]
This downregulatory effect is possibly conveyed through the second miR-30 binding site alone. [score:4]
We then generated an additional four constructs harboring mutations of the consensus sequence for the predicted ARE motif and miR-30 binding sites and transiently transfected all variants into ONE58 cells to test for their effects on luciferase expression (Figures 2C,D). [score:4]
Based on the analysis of 1319 differentially expressed genes, Cheng et al. (2016) identified the miR-30 family amongst the top 20 enriched miRNA families in mesothelioma. [score:3]
The AREsite2 software (Fallmann et al., 2016) revealed a putative ARE motif (AUUUA) within the first stretch, and TargetScan7.1 software predicted two binding sites for the miR-30 family and one for miR-9, within the second conserved stretch (Figures 2A,B). [score:3]
Interestingly, unlike the other miR-30 members where the 3p arm was almost absent, both the miR-30e-5p and-3p arms were expressed in ZL55, ONE58, ACC-MESO-4 cells. [score:3]
Four additional luciferase reporter constructs carrying mutations in either ARE and/or miR-30 binding sites were generated and their activity was tested in ONE58 cells. [score:2]
The miR-30 family includes five members, miR-30a through miR-30e and is evolutionary well conserved. [score:1]
Calretinin 3′UTR Harbors a Functional ARE Motif and miR-30 Sites. [score:1]
Levels are shown relative to the miR-30d-5p in ZL55 cells according to the –ΔΔCt method. [score:1]
So far there was no study on the biological function of the miR-30 family or AUBP in mesothelioma. [score:1]
Upon miR-30-5p mimetic treatment (red) no change is observed on calretinin protein levels due to exogenous CALB2-3′UTR that sponges miR-30e-5p. [score:1]
The QuickChange Site-Directed mutagenesis kit (200518, Agilent technologies) was employed to introduce mutations in the ARE or miR-30 sites with the following primers: pmiRGLO-CALB2-3′UTRmtARE (74425 Addgene), 5′-ctctgttggacatagaagcccagaccatacagcgagggagctcat-3′, 5′-atgagctccctcgctgtatggtctgggcttctatgtccaacagag-3′; pmiRGLO-CALB2-3′UTRmir30mt (74428 Addgene), 5′-cgtgctccttttctctttgggtttcttttatcccaaagaagagtttacagacaat-3′, 5′-attgtctgtaaactcttctttgggataaaagaaacccaaagagaaaaggagcacg-3′; pmiRGLO-CALB2-3′UTRmir30dmt (74429 Addgene), 5′-ttgggtttcttttatcccaaagaagattatccagacaataaaatggaaaggtcctgc-3′, 5′-gcaggacctttccattttattgtctggataatcttctttgggataaaagaaacccaa-3′ and, a combination of primers above to construct pmiRGLO-CALB2-3′UTR-mir30dmt-mtARE (74430 Addgene). [score:1]
[1 to 20 of 17 sentences]
21
[+] score: 56
Another approach to multiple siRNA expression was stimulated by report that a mouse miR30 -based shRNA expression cassette can be driven by Pol II promoters and provide higher knockdown efficiency than those driven by the Pol III U6 promoter [10]. [score:6]
These results suggest that although NP miRNA can be expressed from the mouse miR30 -based cassette in DF-1 cells, the level of target gene knockdown is modest following stable integration of the lentiviral vector. [score:6]
Subsequently, Sun et al showed that a single Pol II promoter can drive three artificial miR30 cassettes to express siRNAs all targeting GFP, resulting in further knockdown of the GFP intensity in the cells [17]. [score:6]
The mouse miR30 -based miRNA expression cassette has been wi dely used to express artificial miRNA in lentiviral vectors [21]. [score:5]
As shown in Figure 1c, transient expression of miR30-NP inhibited Renilla luciferase activity by ∼85%. [score:5]
Inhibition of luciferase activity by NP miRNA expressed from a mouse miR30 -based lentiviral vector. [score:5]
To express anti-influenza artificial miRNA, we replaced the mature miR30 sequences in pLB2 with sequences that target nucleoprotein (NP) of influenza virus (Figure 1b). [score:5]
As a control, Vero cells were transduced with a CPGM lentivirus that expressed miR30 -based miRNA specific for the firefly luciferase transcript. [score:3]
Expression of NP miRNA from the mouse miR30 -based lentiviral vector. [score:3]
Zhou et al reported that two tandem copies of the miR30 -based cassette can be expressed in a single transcript driven by a Pol II promoter [15], [16]. [score:3]
In addition to miR30 -based designs, mouse miR155 -based design has also been used to knockdown multiple genes [19]. [score:2]
In the transient transfection assay, the miR30-NP lentiviral vector and psicheck-2 dual luciferase reporter plasmid, in which the NP target sequence was cloned into the 3′ UTR of the synthetic Renilla luciferase gene, were co -transfected into DF-1 cells. [score:2]
A similar miR30 -based approach was utilized by Zhu et al to knockdown multiple genes [18]. [score:2]
Flanking and hairpin sequences are miR30. [score:1]
0022437.g001 Figure 1(a) Schematic diagram of the miR30-NP lentiviral vector. [score:1]
Psicheck-2 dual luciferase reporter plasmid (50 ng) and miR30-NP lentiviral vector (450 ng) were co -transfected in DF-1 cells. [score:1]
[1 to 20 of 16 sentences]
22
[+] score: 52
Using 15 down-regulated miRNAs (let-7 g, miR-101, miR-133a, miR-150, miR-15a, miR-16, miR-29b, miR-29c, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b and miR-342), known to be associated with cancer, we found 16.5% and 11.0% of our PLS-predicted miRNA-targets, on average, were also predicted as targets for the corresponding miRNAs by TargetScan5.1 and miRanda, respectively (Table 2). [score:10]
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
This network (Figure 2B) indicated that two mRNAs (V KORC1 and CSTB; in red) were predicted to be targets of five miR-30 miRNAs, six mRNAs (ANXA2, GPATCH3, OAZ1, PSMB4, SLC7A11, ZNF37A; in turquoise) were targeted by four of the miRNAs, and ten mRNAs (CAPG, C7orf28A, DAP, GPX1, ITPA, MMP11, NEBL, POLR2H, S100A11 and GTF2IRD1; 3 in green and 7 in blue) were targeted by three of the miRNAs (Figure 2B). [score:7]
Moreover, we found that five out of 25 of our PLS-predicted targets (20%) for miR-30d were also predicted as targets for this miRNA by both TargetScan5.1 and miRanda. [score:7]
We developed a network to demonstrate the overlapping miRNA targets for miRNAs in the miR-30 family (a-e) (Figure 2B) since these miRNAs have a large number of mRNA targets. [score:5]
The maximum number of predicted targets was 25 for miR-30d, and the minimum number of predicted targets was one for miR-1, miR-100 and rno-miR-140 (Table 1). [score:5]
With the aid of IPA pathway designer, we found that 27 of the 31 down-regulated miRNAs were linked to one or more mRNA networks and 20 of them (let-7 g, miR-101, miR-126, miR-133a, miR-142-5p, miR-150, miR-15a, miR-26b, miR-28, miR-29b, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b, miR-99a, mmu-miR-151, mmu-miR-342 and rno-miR-151) were involved in all of the top 4 networks. [score:4]
The number of predicted targets for each member of the miR-30 family (a-e) was 22, 20, 15, 25 and 17, respectively. [score:3]
The number of targets for miR-30 a-e was 22, 20, 15, 25 and 17, respectively (Table 3). [score:3]
B. A sub-network depicting miRNA-mRNA interactions predicted from the miR-30 family. [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 49
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-125b-1, hsa-mir-125b-2, hsa-mir-33b
In our study, we found that AR-42 upregulated miR-30d, miR-33, and miR-125b in both BxPC-3 (Fig 4C) and PANC-1 (Fig 4D) cells, which suggested that AR-42 suppresses p53 expression by inducing the expression of several p53 -targeting miRNAs. [score:12]
Meanwhile, according to our results, AR-42 upregulated expression levels of three miRNA, miR-30d, miR-33, and miR-125b (Fig 4C and 4D), which have been previously shown to inhibit p53 gene expression. [score:10]
In addition, AR-42 increased expression levels of negative regulators of p53 (miR-125b, miR-30d, and miR33), which could contribute to lower expression level of mutant p53 in pancreatic cancer cells. [score:6]
Upregulation of miR-30d by AR-42 suggested an important clue about the interplay between autophagy and p53 expression in pancreatic cancer cell progression. [score:6]
MicroRNA-30d (miR-30d), miR-33, and miR-125b have been shown to inhibit p53 mRNA expression [27]. [score:5]
Expression levels of miR-30d, miR-33, and miR-125b were determined by real-time PCR of AR-42 treated BxPC-3 (C) and PANC-1 (D) cells for 24, 48 and 72 h. Expression levels of miRNAs were normalized by that of the reference gene U6. [score:5]
Furthermore, miR-30d has been shown to repress the expression of important autophagy genes BECN1, BNIP3L, ATG12, ATG5, and ATG2. [score:3]
MiR-30d also inhibited autophagosome formation and conversion of LC3B-I to LC3B-II in different cancers [58]. [score:2]
[1 to 20 of 8 sentences]
24
[+] score: 47
Using miR223 for normalization of miRNA expression levels, we confirmed significantly greater miR423-5p (p<0.05), miR30d (p<0.05), miR10b (p<0.05) and miR126 (p<0.001) expression in patients with low collateral capacity (Fig 3). [score:5]
Interestingly, miR30d and miR126 showed significantly greater expression in CTO patients relative to healthy individuals (p<0.01 and p<0.001, respectively; Fig 5), wherebymiR126 showed over two-fold greater expression in CTO patients. [score:5]
The present study shows that miR423-5p, miR30d, miR10b and miR126 are up-regulated in plasma of CTO patients with low coronary collateral artery capacity. [score:4]
There is limited information directly linking miR10b and miR30d to heart disease. [score:4]
There was no significant correlation between the expression levels of these miRNAs (miR423-5p, miR10b, miR30d or miR126) with CFI (S2 Fig). [score:3]
S2 Fig No significant correlation seen between relative expression levels of selected microRNAs (A: miR423-5p, B: miR30d, C: miR10b, D: miR126) and collateral flow index (CFI) values. [score:3]
We also sought to compare the expression level of these miRNAs (miR423-5p, miR30d, miR10b and miR126) between healthy individuals (n = 19) relative to our CTO patient population (n = 41). [score:3]
CFI: collateral flow index; miRNA: microRNA (TIF) No significant correlation seen between relative expression levels of selected microRNAs (A: miR423-5p, B: miR30d, C: miR10b, D: miR126) and collateral flow index (CFI) values. [score:3]
We also determined significantly greater expression of miR30d (p<0.05) and miR126 (p<0.001) in CTO patients relative to healthy controls. [score:3]
We confirmed significantly elevated levels of miR423-5p (p<0.05), miR10b (p<0.05), miR30d (p<0.05) and miR126 (p<0.001) in patients with insufficient collateral network development. [score:2]
Significantly greater miR126, miR30d, miR423-5p and miR10b expression (p-value of 0.011, 0.029, 0.050 and 0.051, respectively) were seen in the plasma of patients with low collateral capacity compared to those with high collateral capacity. [score:2]
Compared to healthy individuals, miR30d and miR126 show elevated expression in CTO patients. [score:2]
MiR30d is known to promote cardiomyocyte pyroptosis through the suppression of foxo3a; cardiomyocyte pyroptosis is pro-inflammatory programmed cell death of cardiomyocytes [26]. [score:2]
With the exception of miR126, the other miRNAs described in this study (miR423-5p, miR10b, miR30d), displayed significant discriminatory power only in a multivariate logistic regression mo del with age and gender. [score:1]
In conclusion, we have identified circulating miRNAs associated with insufficient collateral artery function (miR423-5p, miR10b, miR30d and miR126) in CTO patients. [score:1]
However, no other associations were found between the level of miR423-5p, miR30d or miR126 and the level of circulating leukocyte subsets. [score:1]
In this study we have identified miR423-5p, miR30d, miR10b and miR126 as circulating biomarkers to discriminate between patients with low versus high collateral artery capacity. [score:1]
However, we did note significantly elevated levels of miR30d and mir126 in CTO patients relative to healthy individuals. [score:1]
MiR30d has shown to be secreted by cardiomyocytes [26], while miR423-5p has been linked to cardiac origin [29]. [score:1]
[1 to 20 of 19 sentences]
25
[+] score: 44
0036157.g003 Figure 3 Activities of two miRNAs, including miR30 (A), miR-N367 (B), were imaged in live HeLa cell cultures that were transfected with the indicator vectors pmiR30:4tar(30), pmiR-N367:4tar(n) and their control vectors with miRNAs or target sequences only, respectively. [score:3]
Activities of two miRNAs, including miR30 (A), miR-N367 (B), were imaged in live HeLa cell cultures that were transfected with the indicator vectors pmiR30:4tar(30), pmiR-N367:4tar(n) and their control vectors with miRNAs or target sequences only, respectively. [score:3]
uk/) as byproducts, miR30 -based precursor stem-loops were used to exclusively express miR423-5p and miR-S1-5p [9] (see Figure S2A, B). [score:3]
The miRNA expression vector pmiR423-5p was constructed by inserting the miR30 precursor stem-loops based artificial pre-miR423-5p sequences into the EcoR V and Not I sites of. [score:3]
0036157.g002 Figure 2. (A) Sequences of miR30, hiv1-miR-N367 and their non-fully complementary targets. [score:3]
The miRNA expression vector pmiR-S1-5p was constructed by inserting the artificial pre-miR-S1-5p sequences that are based on the miR30 precursor stem-loops into the EcoR V and Not I sites of. [score:3]
The construction of is outlined in Figure 1. The miR30 expression vector pmiR30 was constructed by inserting the miR30 precursor (pre-miR30) sequences into the EcoR V and Not I sites of vector. [score:3]
Figure S4 Relative expression level determination of miR30, miR423-5p and miR192 using real-time quantitative PCR method. [score:3]
The construction of is outlined in Figure 1. The miR30 expression vector pmiR30 was constructed by inserting the miR30 precursor (pre-miR30) sequences into the EcoR V and Not I sites of vector. [score:3]
uk/) as a byproduct, the miR30 -based precursor stem-loops were used to exclusively express miR192 [9] (see Figure S2C). [score:3]
The miRNA expression vector pmiR192 was constructed by inserting the miR30 precursor stem-loops based artificial pre-miR192 sequences into the EcoR V and Not I sites of. [score:3]
For the fluorescence reporter assays, the indicator vector pmiR30:4tar(30) was constructed by the stepwise insertion of four tandem copies of miR30 non-fully complementary target sequence (tar(30)) into the 3′-UTR of the mCherry gene in pmiR30 using the Bgl II/Hind III and Hind III/EcoR I restriction sites. [score:2]
The expression of miR30, miR423-5p and miR192 was compared to mock transfected sample using 2 [–ΔΔCT] method. [score:2]
Figure S2 Secondary structure mo dels for artificial pre-miRNA based on stem-loops of miR-30 precursor. [score:1]
The vectors pmiR30 and pmiR-N367 were constructed to produce high levels of the human-encoded miR30 [12] and the HIV-1-encoded miR-N367, respectively. [score:1]
A. Secondary structure mo del for artificial pre-miR-S1-5p based on stem-loops of miR-30 precursor; B. Secondary structure mo del for artificial pre-miR423-5p based on stem-loops of miR-30 precursor; C. Secondary structure mo del for artificial pre-miR192 based on stem-loops of miR-30 precursor. [score:1]
* Artificial pre-miRNAs which were designed being based on stem-loops of miR-30 precursor (ref 9). [score:1]
The pre-miR30 sequences were generated by overlap extension PCR with the following two partially complementary oligonucleotides: 5′-CTCGTGATCTGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGT-3′ and 5′-ATGTTATCCGCGGCCGCAAAAACTCGTGGATCCGCAGCTGCAAACATCCGACTGAAAGCCCATC-3′. [score:1]
As shown in Figure 2B, Northern blot analysis readily revealed detectable levels of the specific miRNAs in all of the HeLa cultures transfected with constructs producing the pre-miRNA sequences of miR30 and miR-N367. [score:1]
HeLa cells were mock -transfected (mock) or transfected with plasmids pmiR30, pmiR-N367 individually, and the location of the mature miR30 and miR-N367 is indicated. [score:1]
[1 to 20 of 20 sentences]
26
[+] score: 42
To illustrate the impact of miRNA overexpression on the expression of their target genes, we have selected two microRNAs, miR-30 and -128, that were previously shown to be upregulated during myogenic differentiation [26, 27], but their function in myogenesis is not well-established. [score:10]
Similarly, overexpressing miR-30 led to the downregulation of three of its five randomly selected transcriptome-supported targets. [score:8]
Transcriptome-supported target genes of miR-128 and miR-30 were downregulated when human rhabdomyosarcoma cells were transfected with lentiviral constructs overexpressing miR-128 (E) and miR-30 (F). [score:8]
Two remaining miR-30 target genes, PPIA and CASD1 could not be validated via qRT-PCR, as we did not observed significant changes in its expression level following miRNA precursor transfection (data not shown). [score:5]
Instead, our predictions suggest that miR-30 might target genes involved in the regulation of protein phosphorylation and kinase activity, cell cycle control, intracellular transport, cytoskeleton organization, protein ubiquitination, DNA damage response and nucleotide biosynthesis (Figure  5, Additional file 9). [score:4]
These qRT-PCR validated miR-30 targets include PLXNB (plexin B2), C11orf45 (chromosome 11 open reading frame 45) and ATP2B1 (ATPase, Ca++ transporting, plasma membrane 1) (Figures  4D). [score:3]
miR-30 was shown to induce apoptosis [71] and regulate cell motility by influencing extracellular the matrix remo delling process [72- 74]. [score:2]
Human rhabdomyosarcoma cells (RD) were transfected with plasmids coding for miR-128 and miR-30 precursors or scrambled sequence (scr) (B). [score:1]
phrGFP-1 vector was from Stratagen, pcDNA3.2/V5 hsa-mir-128 (#26308) [115] and pCMV-miR30 (#20875) [116] vectors were provided by Addgene. [score:1]
[1 to 20 of 9 sentences]
27
[+] score: 42
The antagomirs designed to inhibit the expression of endogenous miR-30 members and Antagomir Negative Control were obtained from Ribobio. [score:5]
HWJMSC-EVs Deliver and Restore the Expression of miR-30 in Injured Rat Kidney. [score:3]
Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) showed that IRI caused lower expression of miR-30b, miR-30c, and miR-30d (miR-30a and miR-30e did not exist in rat kidney) and EVs treatment entirely reversed the reduction (Figure 2(a)). [score:3]
Mitochondrial Apoptotic Pathways Are Inhibited by EVs-Derived miR-30. [score:3]
Meanwhile, antagomir -treated EVs group revealed lower miR-30 expression as well as the vehicle group (Figure 2(c)). [score:3]
We demonstrated that hWJMSC-EVs may ameliorate acute renal IRI by inhibition of mitochondrial fission via miR-30. [score:3]
We next explored the miR-30 expression of rat kidney during IRI in vivo. [score:3]
Given that miR-30 has been reported to regulate mitochondrial fission through the DRP1 pathway on cardiomyocytes [20], we hypothesized that human Wharton Jelly MSCs (hWJMSCs) derived EVs may be involved in the modulation of mitochondrial fission via miR-30, thereby protecting kidney from IRI. [score:2]
To understand how hWJMSC-EVs exert effects on mitochondrial fission, we test whether EVs-derived miR-30 family plays a crucial role in regulating mitochondrial fission through DRP1. [score:2]
EVs-Derived miR-30 Members Regulate Mitochondrial Fission through DRP1. [score:2]
To further explore the mechanism of miR-30 reversion, we used specific miR-30 antagomir to treat MSCs. [score:1]
As we expected, miR-30 antagomir mitigated this effect, especially in miR-30b/c/d antagomir cotreated group. [score:1]
The miR-30 family is involved in several cellular processes, including cardiomyocytes exposed to oxidative stress or ischemia injury and apoptosis of type II alveolar epithelial cells [20, 32, 33]. [score:1]
Here we have identified a miR-30-related antiapoptotic pathway involving DRP1 and mitochondria, which may be one of the mechanisms by which hWJMSC-EVs alleviate renal ischemia reperfusion injury. [score:1]
The absence of miR-30 in EVs canceled the miR-30 restoration effects in normal EVs treatment group in vitro. [score:1]
Then, we treated hWJMSCs with miR-30 antagomir. [score:1]
The levels of miR-30 family members analyzed by qRT-PCR were normalized to that of U6. [score:1]
The sequence of miR-30b antagomir is 5′-AGCUGAGUGUAGGAUGUUUACA-3′; miR-30c antagomir is 5′-GCUGAGAGUGUAGGAUGUUUACA-3′; miR-30d antagomir is 5′-CUUCCAGUCGGGGAUGUUUAGA-3′. [score:1]
Taken together, it appears that EVs-derived miR-30 can block the mitochondrial apoptotic pathways. [score:1]
We used at least six rats for each group: (1) sham (n = 6); (2) vehicle (n = 6); (3) EVs (n = 6); (4) EVs + antagomir control (n = 6); (5) EVs + antagomir miR-30b (n = 6); (6) EVs + antagomir miR-30c (n = 6); (7) EVs + antagomir miR-30d (n = 6); (8) EVs + antagomir miR-30b/c/d (n = 6). [score:1]
Our research reveals links among EVs, miR-30, and DRP1 in the apoptotic program of the kidney. [score:1]
Our results suggest that modulation of miR-30 from EVs may represent a therapeutic approach to treat apoptosis-related renal ischemia reperfusion injury. [score:1]
The absence of miR-30 in EVs canceled the miR-30 restoration effects in normal EVs treatment group. [score:1]
[1 to 20 of 23 sentences]
28
[+] score: 35
Our data suggest that the miR-30(a–d) cluster and miR130a/301are significantly associated with gene targets found in pathways that involve HCV entry and replication, and thus, may play a role in the pathogenesis of chronic liver disease. [score:5]
Several miR-30 targets including the Suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) genes contained conserved 8 mer sites that matched the seed region of miR-30c (Table 2). [score:5]
The GOMir tool JTarget, using five major miRNA-mRNA prediction databases, identified a list of mRNA targets for miR-30, miR-130a, miR-192, miR-301 and miR-324-5p [21]. [score:5]
We hypothesize that the down regulation of miR-30 in HCV-infected Huh7.5 cells may alter the expression of genes involved in the ubiquitin and actin cytoskeleton pathways that create a permissive environment for viral replication and this “proviral effect” is diminished with the addition of IFN-α. [score:4]
Bioinformatic analysis predicted that mRNAs of gene targets associated with the miR-30 cluster were concentrated in 2 major pathways – ubiquitin mediated proteolysis and regulation of actin cytoskeleton (Fig. S2, Fig. S3). [score:4]
Figure S3 MiR-30(a–d) -associated gene targets in the Regulation of Actin Cytoskeleton pathway. [score:3]
The DAVID Pathway analysis tool applied to the same data sets revealed targeted bio-pathways for the miR-30 cluster (miR-30a, miR-30b, miR-30c and miR-30d) and miR-130a/301 cluster (Table 1). [score:3]
The miR-30(a-d) cluster and miR-130a/301 and their putative mRNA targets were predicted to be associated with cellular pathways that involve Hepatitis C virus entry, propagation and host response to viral infection. [score:3]
Figure S2 MiR-30(a–d) -associated gene targets in the Ubiquitin-Mediated Proteolysis pathway. [score:2]
Two pathways, ubiquitin -mediated proteolysis and regulation of actin cytoskeleton, were predicted for MiR-30 at a p-value of 3.2×10 [−3] and 6.33×10 [−3] respectively. [score:1]
[1 to 20 of 10 sentences]
29
[+] score: 34
Two members of the miR-30 family (miR-30b and miR-30d), putative regulators of the genes implicated in oxidative stress -mediated ocular diseases, were significantly (miR-30b: p=0.001, FC 3.52; miR-30d: p=0.001, FC 2.14) upregulated under the oxidative environment, and curcumin alone significantly (p<0.05) reduced the expression of all five members of the miR-30 family, compared to the controls, and significantly reduced induction by H [2]O [2] (Figure 5). [score:8]
All five members of the miR-30 family (miR-30a-e) were upregulated and downregulated by H [2]O [2] and curcumin, respectively. [score:7]
H [2]O [2] treatment significantly upregulated miR-30b and miR-30d, two members of the miR-30 family, which is consistent with our previous results [17], and all five members of the family were downregulated by the curcumin treatments. [score:7]
In silico analysis suggests that the expression of miR-30b and miR-30d, but not the other three members of the family, is regulated by the promoter of the zinc finger and AT hook domain–containing (ZFAT) gene. [score:4]
Based on statistical significance (p<0.05) and 2 -FC, curcumin pretreatment attenuated the H [2]O [2] -induced expression of 17 miRNAs (miR-15b, miR-17, miR-21, miR-26b, miR-27b, miR-28–3p, miR-30b, miR-30d, miR-92a, miR-125a-5p, miR-141, miR-196b,, miR-195, miR-302a, miR-302c, miR-320a, and miR-9), which were also significantly reduced by the curcumin treatment alone (Figure 4, Table 2). [score:3]
However, only miR-30b and miR-30d were differentially expressed more than twofold after H [2]O [2] treatment. [score:3]
The mechanism of ROS -mediated gene regulation of miR-30b and miR-30d seems to be different from that of the other three members of the family. [score:2]
[1 to 20 of 7 sentences]
30
[+] score: 33
Among these candidates, miR-30a-3p was selected for further analysis because its expression was down regulated in Poly (I:C)- and IFN-γ-activated RAFLS and SScHDF; such inverse correlation with the expression of BAFF transcripts in the same cells and the same conditions indicated that miR-30-3p family members might have a role in the regulation of BAFF expression. [score:9]
The prediction provided by bioinformatic tools and this inverse correlation between miR-30 family members and BAFF expression prompted us to analyze their likely direct interaction. [score:4]
Importantly, additional results (data not shown) indicate that additional members (and closely related) of the miR-30a-3p family (miR30-d-3p and -e-3p) also regulate BAFF expression in RAFLS and SScHDF stimulated with Poly (I:C) or IFN-γ. [score:4]
MiR-144*, miR-30d-3p, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p and miR-302c* expression was determined by RT-qPCR in RAFLS (n = 3) and SScHDF (n = 3) stimulated with Poly (I:C) (10 µg/mL) or IFN-γ (0.1 or 5 ng/mL) for 72 h. were normalized to U6snRNA and expressed as fold change compared with samples from RAFLS or SScHDF incubated with medium. [score:4]
uk/enright-srv/microcosm/htdocs/targets/v5) identified several miRNAs candidates: miR-144*, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p, miR-302c* and miR-30 family members (miR-30a, d and e which share the same seed sequence). [score:3]
To evaluate the possible involvement of these miRNAs in BAFF regulation, we first performed RT-qPCR analysis to quantify their expression in RAFLS and SScHDF treated with Poly(I:C) or IFN-γ for 6 h, 48 h and 72 h. This analysis revealed that miR-144*, miR-30d-3p, miR-340, miR-626, miR-330-3p and miR-302c* could not be detected in RAFLS and SScHDF (figure 1S). [score:2]
A. Luciferase reporter constructs with wild-type or mutated (for miR-30-3p binding sites) BAFF 3′UTR were generated. [score:1]
D. NHDF (n = 3) transfected with miR-30-3p antisense, were stimulated with poly (I:C). [score:1]
C. NFLS (n = 3) and NHDF (n = 3) were transfected with miR-30-3p antisense oligonucleotides (20 pM/sample) or with an AllStars negative control (CT). [score:1]
Similar results were obtained upon transfection of miR-30e-3p and miR-30d-3p (data not shown). [score:1]
For this, we added anti-BAFF antibodies to poly (I:C)-stimulated NHDF treated with miR-30-3p antagomiRs. [score:1]
0111266.g003 Figure 3 A. Luciferase reporter constructs with wild-type or mutated (for miR-30-3p binding sites) BAFF 3′UTR were generated. [score:1]
In this study, we found that miR-30a-3p (and miR30d-3p and e-3p, which exhibit high sequence homology) is predicted to bind the 3′UTR region of BAFF transcripts. [score:1]
[1 to 20 of 13 sentences]
31
[+] score: 32
In contrast, neither knockdown nor overexpression of miR-30 substantially altered the expression of p66Shc, p52Shc, and p46Shc. [score:6]
As shown in Fig. 1(D), nascent Shc protein synthesis in AS-let-7a -expressing cells was ~3.2- to 4.1-fold higher than what was observed in control cells, while Shc translation in AS-miR-30 -expressing cells was comparable with that measured in control cells. [score:5]
The levels of p66Shc mRNA, which could potentially be used for synthesis of all Shc proteins, were not substantially altered by modulating let-7a or miR-30 abundance (Fig. 1C), suggesting that let-7a does not affect Shc expression at the level of mRNA turnover and instead may affect Shc translation. [score:5]
The effect of let-7a was specific, as inhibition of let7c, let-7d, miR-9, miR-22, and miR-30 did not affect the levels of Shc proteins, while inhibition of let-7b moderately increased the levels of Shc proteins (Fig. S2). [score:5]
To test this hypothesis, IDH4 cells transiently expressing antisense let-7a or antisense miR-30 were incubated in medium containing L-[[35]S] methionine and L-[[35]S] cysteine for 20 min, cell lysates were then prepared and subjected to immunoprecipitation to analyze the level of nascent Shc proteins. [score:3]
In addition, transfection of cells with inhibitor of let-7c, let7d, miR-9, miR-22, or miR-30 did not alter the levels of Shc proteins (Fig. S2B,C). [score:3]
In control reactions, knockdown of let-7a or miR-30 did not influence the levels of nascent GAPDH. [score:2]
Using the cells described in Fig. 3(A,B), the levels of let-7a, miR-30, U6, as well as p66Shc mRNA levels in 2BS and IDH4 cells progressing toward senescence were determined by Northern blot analysis (Fig. 3D) and by conventional RT-PCR analysis (Fig. 3E) respectively. [score:1]
In contrast, the levels of miR-30, U6, and p66Shc mRNA remained unchanged during senescence of 2BS (Fig. 3D) and IDH4 cells (Fig. 3E). [score:1]
As shown in the Fig. S2(A), transfection of IDH4 cells with let-7a siRNA, but not miR-30 siRNA, elevated the levels of Shc proteins. [score:1]
[1 to 20 of 10 sentences]
32
[+] score: 31
Since previous microarray -based analysis had indicated that members of the miR-30 family were downregulated in latency III cells compared to latency I cells or EBV -negative cells, we examined the role of these miRs in RGC-32 translation control. [score:5]
Although we found that miR-30c and miR-30d could direct translational repression via the RGC-32 3′UTR in reporter assays, mutation of the miR-30 binding site in the RGC-32 3′UTR did not relieve repression mediated by the RGC-32 3′UTR. [score:4]
We were also not able to confirm previously published reports (54) of miR-30c or miR-30d downregulation in the latency III cell lines we examined. [score:4]
We therefore conclude that the miR-30 family have the potential to repress RGC-32 expression, but are not the main mediators of RGC-32 3′UTR directed repression in the B cells used in our assays. [score:3]
In contrast, miR-30 with a mutated seed sequence did not repress reporter gene expression. [score:3]
We found that the miR-30 family of miRNAs were predicted to target the 3′UTR of RGC-32. [score:3]
However, when we mutated the miR-30 target sequence in the RGC-32 3′UTR reporter construct, we did not observe any loss of 3′UTR mediated repression in our transient transfection assays (Figure S7C). [score:2]
We were also unable to detect any differences in miR-30c or miR-30d expression between latency I and latency III cells using sensitive Taqman PCR assays, in contrast to the previous microarray -based study (data not shown). [score:2]
Interestingly, a previous microarray analysis detected lower miR-30c and miR-30d expression in latency III cell lines compared to latency I or EBV -negative cells (54). [score:2]
For miRNA experiments, 2 × 10 [4] HeLa cells were plated in a 96-well plate 24 h prior to transfection with 100 ng of psicheck2 RGC32 3′UTR ΔDSE or psicheck2 RGC-32 ORF in combination with 100 nM of miR-30c, miR-30d or a mutant miR-30c (Invitrogen) using Dharmafect Duo transfection reagent (Dharmacon, GE Healthcare). [score:1]
The miR-30 family (miR-30a, b, c, d, e) were the only miRNAs identified by most programmes used (Supplementary Figure S7A). [score:1]
We therefore investigated whether miR30-c and miR30-d were able to repress reporter gene expression via the RGC-32 3′UTR when they were transfected into cells. [score:1]
[1 to 20 of 12 sentences]
33
[+] score: 27
A comparison was performed between the miRNAs upregulated in both MMTBI and STBI group which identified a signature of 10 miRNAs viz miR-151-5p, miR-195, miR-20a, miR-328, miR-362-3p, miR-30d, miR-451, miR-486, miR-505* and miR-92a, with increased expression in both MMTBI and STBI groups (Fig. 2, Common miRNAs in MMTBI and STBI are highlighted in bold in Tables 1 and 2). [score:6]
Validation in CSF samples showed that expression of miR-328, miR-362-3p miR-486 and miR-451 was significantly upregulated, however; no significant elevation in levels of miR-151-5p, miR-30d and miR-20a was detected. [score:6]
No significant upregulation in the level of miR-30d was observed between control and injury groups. [score:4]
This analysis identified 30 genes as direct targets for the 8 miRNA candidate miR-151-5p, miR-195, miR-328-3p, miR-362-3p, miR-30d, miR-20a, miR-486 and miR-92a. [score:4]
MiR-30d was also predicted to target adrenoceptors and GABA receptor signaling. [score:2]
The analysis identified the AUC values as miR-195 (0.81, p value < 0.003), miR-30d (0.75, p value < 0.016), miR-451 (0.82, p value < 0.002), miR-328 (0.73, p value < 0.030), miR-92a (0.86, p value < 0.001), miR-486 (0.81, p value < 0.003), miR-505 (0.82, p value < 0.002), miR-362 (0.79, p value < 0.006), miR-151 (0.66, p value < 0.123), miR-20a (0.78, 0.007). [score:1]
There were significant differences between the two groups for all but two of the selected miRNA: miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p < 0.101); miR-92a (p < 0.001); miR-486 (p < 0.006); miR-505 (p < 0.008); and miR-362 (p < 0.035); miR-151 (p < 0.065); and miR-20a (p < 0.012) (Fig. 5). [score:1]
The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p, miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. [score:1]
The AUC’s were: miR-195 (0.81), miR-30d (0.75), miR-451 (0.82), miR-328 (0.73), miR-92a (0.86), miR-486 (0.81), miR-505 (0.82), miR-362 (0.79), miR-151 (0.66), miR-20a (0.78). [score:1]
There were significant differences between the two groups for all but two of the selected miRNA (see asterisks): miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p = 0.101); miR-92a (p < 0.001); miR-486 (p = 0.006); miR-505 (p = 0.008); and miR-362 (p = 0.035); miR-151 (p = 0.065); and miR-20a (p = 0.012). [score:1]
[1 to 20 of 10 sentences]
34
[+] score: 26
miR-30d itself usually targets importin subunit beta-1 (KPNB1, encoded by KPNB1) and suppresses its translation. [score:7]
Importantly, the overexpression of EZH2 and KPNB1 in MPNST is negatively correlated with miR-30d expression [61]. [score:5]
The knockdown of KPNB1 results in enhanced apoptosis of MPNST cells, an effect also observed with EZH2-knockdown and miR-30d overexpression [61]. [score:5]
For example, EZH2 directly targets the promoter region of miR-30d, and thus represses its transcription [61]. [score:4]
Therefore, the EZH2–miR-30d–KPNB1-axis could serve as a target in anticancer therapy for patients with MPNST. [score:3]
Zhang P. Garnett J. Creighton C. J. Al Sannaa G. A. Igram D. R. Lazar A. Liu X. Liu C. Pollock R. E. EZH2-miR-30d-KPNB1 pathway regulates malignant peripheral nerve sheath tumour cell survival and tumourigenesisJ. [score:2]
[1 to 20 of 6 sentences]
35
[+] score: 26
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30b, hsa-mir-30c-1, hsa-mir-30e
MicroRNA30 -based shRNA (miRshRNA) encoded in expression plasmid DNA was shown to have higher gene downregulation activity than conventional shRNA. [score:6]
MicroRNA30-Based shRNA Expressed by RRV Has Higher Potent Gene Downregulation Activity than Conventional shRNA. [score:5]
We generated human U6 promoter driven-MLV -based RRV expressing conventional shRNA (RRV-shGFP) or microRNA30 -based shRNA (RRV-miRGFP) targeted to GFP (Figure 1). [score:5]
Although construction of multiple shRNA or miRshRNA cassettes have been reported in various expression vectors, 17, 22, 39, 40 incorporating such a design in an RRV genome could be technically challenging due to the repeated sequence in miRNA30-derived backbone in the same vector that may lead to early emergence of deletion mutants. [score:3]
RRVs derived from pAC3-yCD2 [41] containing human H1, U6 Pol III, or RSV Pol II promoter were generated to express conventional 21-nucleotide stem shRNA (shGFP and shPDL1) or microRNA30-derived shRNA with a 21-nucleotide stem as described [37] against GFP (miRGFP), human PDL1 (miRPDL1), human IDO-1 (miRIDO1), or human TGF-β2 (miRTGFb2) (Table S4 for sequences tested). [score:3]
For example, processing and stability of miRNA30 could be affected by such changes. [score:1]
Our short-term vector stability data indicate that miRNA30-derived miRshRNA in general is stable in the RRV genome in various cell lines tested. [score:1]
3, 9, 10 With increasing understanding of miRNA processing, Zeng et al. first demonstrated that artificially designed miRNA derived from miRNA-30 (miRshRNA) can function as siRNA. [score:1]
10, 25 One of the advantages of generating siRNA from the miR30-derived shRNA backbone is potential further minimization of type I IFN response. [score:1]
[1 to 20 of 9 sentences]
36
[+] score: 26
Recent studies have also revealed that the miR-30 family is downregulated in tumors, where it is involved in EMT and participates in the mechanisms of tumor development and progression in several types of cancer. [score:5]
The miR-30 family has been reported to suppress EMT by targeting Snail in human hepatocytes and pancreatic epithelial cells [28, 29]. [score:5]
Although these reports suggest that the miR-30 family works as a tumor suppressor via regulating EMT, their roles in CCA have not been fully elucidated. [score:4]
These results suggested that miR-30e was the most important candidate miRNA among the miR-30 family for suppressing EMT in CCA. [score:3]
This indicated that miR-30e has the potential to be an onco-suppressor gene, similar to the other miR-30 family members. [score:3]
Thus, we assessed miR-30 family expression in HuCCT1 cells after incubation with TGF-β. [score:3]
The newly-identified miR-30 family is composed of miR-30a, miR-30b, miR-30c, miR-30d and miR-30e, and there have been inconsistent results regarding their function in cancer [26]. [score:1]
RNA was extracted and qRT-PCR for the miR-30 family was performed. [score:1]
Figure 3RNA was extracted and qRT-PCR for the miR-30 family was performed. [score:1]
[1 to 20 of 9 sentences]
37
[+] score: 25
To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families. [score:5]
Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C). [score:3]
In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7). [score:2]
Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs. [score:2]
The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. [score:1]
We used a pair of reporters, one of which had an inserted single miR-30 perfect binding site (1xP miR-30) while the other did not have the insertion (Figure 6B). [score:1]
Furthermore, the dose-response trends were highly similar for the majority of the compounds; the pattern was the most striking for the miR-30 experiment in HeLa cells (Figure 6A). [score:1]
For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E). [score:1]
Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites. [score:1]
Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005). [score:1]
Except for the control and 1xP miR-30 reporters, which utilized the SV40 promoter and 3′ UTR, all other reporters were driven by the PGK promoter and had BGH 3′ UTR. [score:1]
Remarkably, the majority of compounds yielded a comparable impact on luciferase activity regardless of the presence of the miR-30 perfect binding site. [score:1]
The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010) into pGL4_SV40 using XbaI and ApoI restriction sites. [score:1]
Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively. [score:1]
Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. [score:1]
To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A). [score:1]
Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites. [score:1]
[1 to 20 of 17 sentences]
38
[+] score: 22
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
Specifically, miR-30b and miR-30c showed more significant differences from miR-30a, miR-30d and miR-30e than from each other and vice versa. [score:1]
Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
Shuffling analysis of miR-30 family members revealed similar specificity, although certain preferences were more significant than others (Fig. 7d). [score:1]
Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown. [score:1]
An exception was G–U wobble interactions, which showed strong preferences such as miR-30 position 3 (Supplementary Fig. 3d). [score:1]
Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference. [score:1]
[1 to 20 of 10 sentences]
39
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-30c was upregulated by HDI in all the three experiments, miR-30d was upregulated in two of the three experiments, while miR-30b and miR-30e were upregulated in one of the three experiments but were downregulated in the other two experiments. [score:13]
All the five miR-30 miRNAs were expressed in B cells stimulated by LPS plus IL-4. The abundance of miR-30b, miR-30c, miR-30d, and miR-30e were greater than that of miR-30a (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
The miR-30 family consists of five miRNAs (miR-30a, miR-30b, miR-30c, miR-30d, and miR-30e) encoded by different host genes. [score:1]
The miR-30 family members are similar to each other and have identical seed sequences. [score:1]
Like human PRDM1 (48), the 3′ UTR of mouse Prdm1 mRNA contains three highly conserved bindings sites complementary to the seed sequence of miR-30a and other miR-30 family members (Figure 8). [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 22
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-155
In prostate cancer (PCa), elevated expression of miR-30d that targets SOCS1 mRNA is associated with increased risk of disease recurrence. [score:7]
In fact, elevated miR-30d expression in PCa specimens correlates with early biochemical recurrence, supporting a tumor suppressor role for SOCS1 in PCa [15]. [score:5]
Moreover, the finding that SOCS1 staining was reduced but not abolished in PCa specimens is consistent with the earlier reports that repression by CpG methylation occurs only in a small subset of PCa, whereas the expression of the SOCS1 -targeting miR-30d is more frequent [14, 15]. [score:5]
Even though methylation of the SOCS1 promoter occurs only in 20% of PCa cases, increased expression of the SOCS1 -targeting micro -RNA, miR-30d, has been reported to occur frequently in PCa [14, 15]. [score:5]
[1 to 20 of 4 sentences]
41
[+] score: 21
Zhao 44 observed a decrease in miR-30d expression in the islets of diabetic db/db mice, in which MAP4K4 expression level was elevated and overexpression of miR-30d protected β-cells against TNF- α suppression on both insulin transcription and insulin secretion. [score:9]
In the consistently reported downregulated miRNAs, miR-375 was reported in six studies followed by two miRNAs, miR-148a, and miR-30d in five studies. [score:4]
In this systematic review study, we found miR-148a and miR-30d were consistently reported downregulated in five studies. [score:4]
MiR-375 was reported to be consistently downregulated in six studies followed by miR-148a and miR-30d in five studies. [score:4]
[1 to 20 of 4 sentences]
42
[+] score: 20
Based on expression levels, the predicted miRNA target genes and reported neuron-related miRNA 17 18, 5 miRNAs from microarray results (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were selected for validation. [score:5]
Based on expression levels, the predicted miRNA target genes and reported neuron-related miRNA 17 18, 5 miRNAs (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were selected for validation. [score:5]
We chose the 5 miRNAs (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) for validation not just based on the previous reports or the expression levels, but also the predicted target genes. [score:5]
In addition, 17 miRNAs (miR-136, miR-143, miR-148a, miR-15b, miR-18a, miR-181a, miR-181a*, miR-20b, miR-27b, miR-29b, miR-30d, miR-30e*, miR-301a, miR-376a, miR-376b, miR-410 and miR-7), which are differentially expressed in our retinal induction treatment, are involved in the regulation of developing mouse retina 25. [score:4]
Five significant miRNAs from the microarray profile (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were validated using TaqMan PCR approach. [score:1]
[1 to 20 of 5 sentences]
43
[+] score: 19
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
Interestingly, dihydropyrimidinase-related protein 2, DPYSL2, a highly abundant protein in brain, is targeted by miR-30, 20 and 181 and has been shown to be up-regulated in proteomic studies on APP23 mice already at a very early age [63]. [score:6]
In addition, specific members of the miR-30 family (30c and 30b) were also significantly down-regulated in response to Aβ. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
[1 to 20 of 4 sentences]
44
[+] score: 18
Twelve radiation -suppressed miRNAs were identified, i. e. let-7d, miR-15a, miR-17, miR-30d, miR-92a, miR-197, miR-221, miR-320b, miR-342, miR-361, miR-501 and miR-671, and a significantly different expression between prostate cancer and the corresponding adjacent part was found, including 11 upregulated and 1 downregulated (Fig. 3B). [score:11]
Our results are consistent with those of previous studies and demonstrated that miR-25, miR-17, miR-30d and miR-92a are overexpressed, and miR-221 is downregulated in prostate cancer (9, 42– 44). [score:6]
In the present study, we also identified radiation-response miRNAs that had been reported in other types of cancer but not in prostate cancer, such as miR-25, miR-15a, miR-30d, miR-125a, miR-221 and miR-342 (21, 56– 63). [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 18
The backbone of miR-30 is one of the most frequently used microRNA sequence to direct the processing and maturation of shRNA, because its stem sequence could be substituted with exogenous sequences that match different target genes and to produce 12 times more mature shRNAs than simple hairpin designs [12], [14], and its ability to prevent interferon-stimulated gene expression and associated off-target effects and toxicity in cultured cells and mouse brain [17], [28]. [score:8]
Efficient Knockdown of Reporter Gene In Vivo by Mir-shRNAIt has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:4]
It has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:3]
In combination with a natural backbone of the primary miR-30 microRNA (miRNA), higher amounts of synthetic shRNAs can be produced from the pol III promoter than from the simple hairpin design [12]. [score:1]
We first identified zebrafish homologues of mammalian miR-30 and miR-155 genes based on their sequence identity (data not shown), and cloned both zebrafish pri-miR-30e (409 bp) and pri-miR-155 (447 bp) genomic precursor sequences into the pCS2 [+] vector (Figure 1A. [score:1]
The resultant construct mir-shRNA [EGFP-ORF] contained the same sequence (including a di-nucleotide bugle [17]) as the native miR-30e precursor, except that the strand of the mir-30 hairpin stem has been replaced with the 22 nt-long sequences complementary to EGFP open reading frame (ORF) at the position of 121–142 (Figure 1A and Figure 2A). [score:1]
[1 to 20 of 6 sentences]
46
[+] score: 18
For example, miR-221, and miR-222 are up-regulated, while miR-34a, miR-18a, miR-30d and miR-34b are down-regulated in colon cancer [54- 56]. [score:7]
Our qRT-PCR results showed that miR-18a, miR-193, miR-221, miR-222 and miR-7 were down-regulated, whereas miR-195, miR-30d and miR-34a were up-regulated in Par-4 -transfected cells when compared with empty vector -transfected cells (Figure 8C). [score:6]
Eleven (miR-30d, miR-10b, miR-34a, miR-195, miR-222, miR-221, miR-31, miR-7, miR-663, miR-193b and miR-18a) out of 22 deregulated microRNAs accounted for the 283 predicted target mRNAs linked to cell death (e. g. pro- or anti-apoptotic genes) (see Additional file 8). [score:4]
Fold changes for miR-18a, miR-193b, mi-195, miR-221, miR-222, miR-30d, miR-30d, miR-34a and miR-7 are indicated. [score:1]
[1 to 20 of 4 sentences]
47
[+] score: 17
Now, using samples from the same parent study cohort, we have uncovered new evidence that supports the existence of obesity- and T2DM-related mechanisms that upregulate the production of the secreted antiangiogenic factor SFRP4 in the AbdAT, in close association with the expression of fat tissue-derived miRNAs (specifically miR-30d, miR-146a). [score:6]
AbdAT miR-30d and miR-146a positively and significantly correlated with AbdAT expression levels of SFRP4 (r [miR. [score:3]
Taken together, our current and previously published work discussed in this manuscript suggests an important role for the apparently coregulated (in AbdAT) miRNA trio miR-24/miR-30d/miR-146a and SFRP4 in obesity-related pathological events leading to insulin resistance and T2DM. [score:2]
The positive correlations between the levels of miR-24, miR-146a, and miR-30d and the levels of SFRP4 transcripts in adipose tissue suggest regulatory loops between these molecules. [score:2]
This study suggests a novel association between the elevated levels of miRNAs miR-24, miR-30d, and miR-146a (apparently coregulated) and the level of SFRP4 transcript in AbdAT of subjects with obesity and T2DM. [score:2]
Abdominal Adipose Tissue Levels of miR-30d and miR-146a Positively Correlate with the Antiangiogenic Factor SFRP4 in the Same Tissue. [score:1]
We show here, for the first time to our knowledge, that correlated levels of miR-24, miR-30d, and miR-146a are elevated in AbdAT from people with obesity and diabetes. [score:1]
[1 to 20 of 7 sentences]
48
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7. [score:12]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 16
A detailed search of the whole HIV-1 genome sequence also displayed similarity between 2 full-length human miRNAs (hsa-miR-30d and hsa-miR-424) and the gag-pol protein-encoding regions or pol only of 4 HIV-1 isolates (Table 4). [score:1]
Number and Percentage of Nucleotide Matches Seed Matches hsa-miR-30d AY169802 HIV-1 Strain 3 taaacatccccga 15 13/13 5/6 Group O #98CMA104 ||||||||||||| (100%) (83%) Cameroon Complete 6901 taaacatccccga 688 genome hsa-miR-374a AJ429907 HIV-1 Strain 4 taatacaacctgataag 20 13/17 4/6 Group M #00NE079 |||||| | |||| || (76%) (67%) Subtype 6cpx Envelope 175 taataccaattgatcag 191 Niger AF391235 HIV-1 Clone 2 tataatacaacctgataa 19 17/18 6/6 Group M #TV006c9.1 ||||||||||| |||||| (94%) (100%) Subtype C Envelope 542 tataatacaacttgataa 559 South Africa hsa-miR-424 GU080167 HIV-1 Clone 6 gcaattcatgtttt 19 14/14 2/6 Group M 704MC009F |||||||||||||| (100%) (33%) Subtype C Envelope 417 gcaattcatgtttt 404 South Africa 10.1371/journal. [score:1]
The finding of several viral sequences homologous to cellular miR-30d, miR-30e, miR-374a, miR-424 and miRNA-195 in different regions of the HIV-1 genome but primarily in the envelope regions of several HIV-1 strains indicate that the phenomenon of cellular miRNA-like sequences in the HIV-1 genome may be widespread. [score:1]
In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424) within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. [score:1]
Both full-length cellular miRNAs (hsa-miR-424 and hsa-miR-30d) exhibited 76%–100% homology domains within the gag-pol regions of four isolates from three HIV-1 strains (Table 4). [score:1]
F3 | ||||| | ||||||||||| 82% 83% Kenya Envelope gene 381 tttaaactgcattgactggaag 402 hsa-miR-424 AM181808 HIV-1 Isolate 33 gtgttctaaatggttcaaaacgtgaggcgctgctatac 70 29/384/6 * Subtype 13cpx #01CMVP/CE |||||||||||||||| ||| | | |||||||| 76% 67% Cameroon Gag-Pol 1049 gtgttctaaatggttctaaaattttcgtcatgctatac 1012 GU207082 HIV-1 isolate 33 gtgttctaaatggttcaaaacgtgaggcgctgctatac 70 29/384/6 * Subtype 13cpx #VP_CE_104 |||||||||||||||| ||| | | |||||||| 76% 67% Cameroon Pol gene 817 gtgttctaaatggttctaaaattttcgtcatgctatac 780 GQ344965 HIV-1 isolate 33 gtgttctaaatggttcaaaacgtgaggcgctgcta 67 27/354/6 * Subtype AG #06CM06BDH |||||||||||||||| ||| | || ||||| 77% 67% Cameroon Pol gene 520 gtgttctaaatggttctaaaattttggtcatgcta 486 hsa-miR-30d GQ288251 HIV-1 isolate 23 ggaagctgtaagacacag 40 18/18 0/6 Subtype B #3077_051503 |||||||||||||||||| 100% 0% US Pol gene 120 ggaagctgtaagacacag 103 * Represents seed matches which are in the reverse complementary strand. [score:1]
The five sequences highlighted in red represent the 5 African microRNA-like sequences identified in Table 2. Next, we used the Clustal program to similarly align the homologous regions of hsa-miR-424, miR-374a, and miR-30d (Table 3) to the HXB2 genome. [score:1]
The miR-424-like, miR-374a-like, miR-30d-like, and miR-195-like sequences are embedded in the hypervariable regions corresponding to V1, V2, V4 and V5 respectively and are depicted in blue. [score:1]
Our results show that the ‘hsa-miR-424-like’ sequence maps inside the V1 region of the HXB2 env gene at nucleotide positions 6682–6694, ‘hsa-miR-374a-like’ maps inside the V2 region (position 6763–-6781), and ‘miR-30d-like’ lies inside the V4 domain at positions 7386–7398 (Figure 3). [score:1]
Our results indicated that 2 out of the 8 predicted miRNAs (hsa-miR-424 and hsa-miR-30d), showed homologies in different regions within the HIV-1 genome (Table 4). [score:1]
A total of 17 papers were found to report on a wide range of functionalities of miR-195, 6 citations were associated with miR-30d function, 8 papers discussed miR-424 gene function and only 1 citation described miR-374a function. [score:1]
Thus, out of the 8 miRNAs that we identified for further analysis, 5 (hsa-miR-195, hsa-miR-424, hsa-miR-30d, hsa-miR-30e and hsa-miR-374a) showed homology domains in the HIV-1 genomes of several strains, and 3 (hsa-mir-15b, hsa-miR-16-1 and hsa-miR-16-2) did not. [score:1]
These analyses indicated that in addition to hsa-miR-195, there are three other cellular mature miRNAs (hsa-miR-424, hsa-miR-374a, hsa-miR-30d) that displayed 13–18 nucleotide length homologous regions within the Env genes of four different HIV-1 strains (Table 3). [score:1]
We have conducted a thorough literature search for the possible biological functions of cellular hsa-miR-195, miR-30d, miR-424 and miR-374a as it relates to HIV infection. [score:1]
The five sequences highlighted in red represent the 5 African microRNA-like sequences identified in Table 2. Next, we used the Clustal program to similarly align the homologous regions of hsa-miR-424, miR-374a, and miR-30d (Table 3) to the HXB2 genome. [score:1]
In addition, we have identified sequence similarities between 3 other mature human miRNAs (hsa-miR-30d, hsa-miR-374a and hsa-miR-424) (Table 3) and one full-length miRNA (hsa-miR-30e) within the HIV-1 envelope regions (Table 4). [score:1]
[1 to 20 of 16 sentences]
51
[+] score: 16
More recently, it is demonstrated that up-regulated expression of miR-30 in breast cancer-initiating cells inhibits their self-renewal capacity by reducing the ubiquitin-conjugating enzyme 9 (Ubc9). [score:8]
Integrin β3 (ITGB3) is another direct target of miR-30, which contributes to apoptosis (22). [score:4]
These miRNAs include miR-200c, Let-7, miR-30, but presently, little is known about the mechanism by which it functions to regulate BT-IC self-renewal. [score:2]
A previous report has shown that unligated ITGB3 recruits caspase-8 to the cell membrane and activated caspase-8-mediates apoptosis in a death receptor-independent manner (25), while miR-30 induces apoptosis not in the death receptor-independent manner but through an unclear pathway. [score:1]
Other miRNAs, such as miR-30, miR-17-5p, miR-9, are phase-specific. [score:1]
[1 to 20 of 5 sentences]
52
[+] score: 16
Because EZH2 is a target of miR-25 (Esposito et al., 2012), miR-26a (Sander et al., 2008), miR-30d (Esposito et al., 2012), miR-101 (Varambally et al., 2008), and (Derfoul et al., 2011), downregulation of miR-25, miR-26a, miR-30d, miR-101, and in human cancers are associated with EZH2 upregulation and malignant phenotypes. [score:9]
Down-regulation of the miR-25 and miR-30d contributes to the development of anaplastic thyroid carcinoma targeting the polycomb protein EZH2. [score:7]
[1 to 20 of 2 sentences]
53
[+] score: 16
miRNA-25 and miRNA-30d directly target the 3′-UTR of TP53 to down-regulate p53 protein levels and to reduce the expression of genes that are transcriptionally activated by p53 [37]. [score:9]
Further TP53 targeting miRNAs are miRNA-30d, miRNA-25, and miRNA-504 [37]. [score:3]
miRNA-30d has also been found in porcine milk exosomes and in human milk [35, 39, 40]. [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
Notably, miRNA-30d has been detected as a major signature miRNA of mature raw and commercial milk of dairy cows [38]. [score:1]
[1 to 20 of 6 sentences]
54
[+] score: 16
The four genes were not identified as targets of miR-30 due to the inability to link them to the “four genes” mention, and subsequently to the “15 upregulated target genes” mention. [score:8]
An example is the following sentence: “Among 15 upregulated target genes of the miR-30 miRNA, four genes known to be expressed and/or functional in podocytes were identified, including receptor for advanced glycation end product, vimentin, heat-shock protein 20, and immediate early response 3” (PMID 18776119). [score:8]
[1 to 20 of 2 sentences]
55
[+] score: 14
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein. [score:4]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 14
And a larger flanking region may be necessary for optimal target knockdown by a mir-30 -based cassette [117]. [score:4]
However, it is noteworthy that a contradicting study shows shRNA with 19-nt stem and 9-nt loop may outperform the miR-30 based scaffold for target knockdown in some experimental setting [133]. [score:4]
To date, the well-defined endogenous miR-26a [123] and miR-30 [113, 116] have been used as typical scaffolds for the expression of RNAi triggers. [score:3]
Recently, second-generation shRNA libraries covering mouse and human genomes have been designed in the backbone or pri-miR30, showing improvement over the conventional shRNAs [132]. [score:1]
Successes of employing this pri-miR-Pol II system have been reported for miR-30 [118] and miR-155 [114]. [score:1]
Zeng et al. [116] have demonstrated that miR-30 miRNA backbone including siRNA sequences effectively degrades mRNAs of endogenous human genes such as the polypyrimidine tract binding protein. [score:1]
[1 to 20 of 6 sentences]
57
[+] score: 14
In fact, growing evidence of indirect p53 deregulation in MM through MDM2 overexpression, TP53 promoter hypermethylation and alterations in certain miRNAs that directly or indirectly affect p53 expression, such as miR-25, miR-30d, miR-125a-5p and miR-214, have been reported. [score:9]
Two miRNAs, miR-25 and miR-30d, which directly interact with the 3′-UTR of the human TP53 mRNA [107] are downregulated in MM and their levels are inversely correlated to TP53 mRNA. [score:5]
[1 to 20 of 2 sentences]
58
[+] score: 14
miR-30a-3p was decreased in acute cellular rejection 50. miR-30d-5p was down-regulated in progressive kidney disease from diabetic and/or hypertensive nephropathy 51. [score:6]
Therefore one could speculate that miR-30 family members play a role in the complex network of podocytopathia -associated up-regulation of TGF-ß 53. [score:4]
TGF-ß treatment of podocytes in vitro resulted in a diminished expression of all miR-30 family members 52. [score:3]
In order to provide a set of reference miRNAs one could suggest the intersection of the best 15 reference genes from both algorithms geNormPlus and NormFinder (miR-10b-3p, miR-1260a, miR-127-3p, miR-1274a, miR-181a-5p, miR-181a-2-3p, miR-195-5p, miR-26b-5p, miR-28-5p, miR-30a-3p, miR-30a-5p, miR-30d-5p, miR-361-5p, miR-720, miR-92a-3p). [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
60
[+] score: 14
For lentiviral -mediated knockdown of Trp53, we generated a vector (pLenti X1 Puro DEST, Addgene 17297) containing the U6 promoter (derived from pENTR/pSM2 (U6), Addgene 17387) driving expression of a previously described (Dickins et al, 2005) miR30 format shRNA against Trp53 (1224) or expressing an empty (ns) miR30 backbone. [score:6]
Cells were infected with adenoviruses expressing GFP (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700), retroviruses (LMP) expressing non-silencing hairpin or miR30-shRNA against Trp53 (Dickins et al, 2005), lentiviruses (L KO. [score:5]
I. Proliferation assays of Vhl [fl/fl] MEFs infected with GFP or Cre and lentiviruses expressing an empty miR30 shRNA (shRNA-ns) or miR30-format shRNA directed against Trp53 (shRNA-Trp53). [score:3]
[1 to 20 of 3 sentences]
61
[+] score: 14
Figure 4 in 9 patients with obvious coherent dysregulations of the 5 validated miRNAsExpression levels of these miRNAs (2 [−ΔCt] scale at Y-axis) were normalized by the mean Ct value of miR-30d and miR-93. [score:4]
Expression levels of these miRNAs (2 [−ΔCt] scale at Y-axis) were normalized by the mean Ct value of miR-30d and miR-93. [score:3]
Figure 3Expression levels of these miRNAs (2 [−ΔCt] scale at Y-axis) were normalized by the mean Ct value of miR-30d and miR-93. [score:3]
Expression levels of the miRNAs (2 [−ΔCt] scale at Y-axis) were normalized by the mean Ct value of miR-30d and miR-93. [score:3]
Suggested endogenous miRNA controls (miR-30d, miR-93) were selected to normalizing miRNA profiles of seminal plasma [36, 37]. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 14
For example, the down-regulation of miR-30 family and miR-107 can up-regulated p53 expression in human cell lines (Li et al., 2010), and overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells (Le et al., 2009). [score:13]
Thus, reduced levels of both the miR-30 family and miR-107 in old adults seem to protect these individuals from malignant mesothelioma and neuroblastoma, whereas reduced levels of the let-7 family in old adults seem to promote tumor progression. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 13
It has been shown that CCNE2 levels are upregulated in NSCLC tissues, and that miR-30d-5p, by targeting CCNE2, inhibits lung cancer cell proliferation and motility [38]. [score:8]
Chen D MicroRNA-30d-5p inhibits tumour cell proliferation and motility by directly targeting CCNE2 in non-small cell lung cancerCancer Lett. [score:5]
[1 to 20 of 2 sentences]
64
[+] score: 13
In addition, in agreement with previous studies showing that the miR-30 family members inhibit the EMT process and confer epithelial phenotype to cancer cells including pancreatic and hepatocellular carcinomas [34], [35], our data demonstrated that FHIT-activated miR-30c inhibits TGF-β -induced EMT in NSCLC A549 cells through direct targeting of mesenchymal markers, VIM and FN1, and activation of epithelial marker and metastasis suppressor, E-cadherin (Figure 6I). [score:10]
In fact, this miRNA may function as an anti-metastatic miRNA in several types of human cancer; it has been shown that miR-30 inhibits metastasis in vivo and in vitro in a metastatic breast cancer mo del [31], [32]. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 12
For example, the median log2 expression level change of the top 150 TargetScan conserved targets was 0.096 (6.9%) for mir-29 knockdown in fetal lung fibroblasts [89], 0.131 (9.5%) for mir-145 transfection of MB-231 breast cancer cells [90], 0.173 (12.7%) for mir-30 overexpression in melanoma cell lines [91], and 0.465 (38.0%) for mir-7 overexpression in A549 cancer cells [92]. [score:12]
[1 to 20 of 1 sentences]
66
[+] score: 12
Some of the upregulated miRNAs included, miR-499, miR-372, miR-18a, miR-21 and miR-30d, while let-7c and miR-198 were downregulated. [score:7]
The upregulation of miR-30d seems unique to our analysis. [score:4]
html) for the first 789 bp 3’UTR of PDCD4 MicroRNA Fold change miR-372 4.82 miR-499 2.89 miR-18a 2.82 miR-200c 2.69 miR-130a 2.59 miR-21 2.29 miR-30d 2.21 miR-409-5p 2.14 miR-20a 2.12 let-7c 0.45 miR-198 0.40 The array data were then confirmed by QRT-PCR of 4 representative miRNAs using ten tumour and adjacent normal samples. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 12
The remaining 14 (miR-18a-5p, miR-146a-5p, miR-30d-5p, miR-17-5p, miR-200a-3p, miR-19b-3p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-192-5p, miR-296-5p, miR-29a-3p, and miR-133a-3p) were upregulated in HCM patients with T [1] < 470 ms compared with those with T [1] ≥ 470 ms, and 11 (except miR-192-5p, miR-296-5p and miR-133a-3p) were significantly inversely correlated with postcontrast T [1] values. [score:3]
miR-29 is the best characterized direct regulator of extracelluar matrix protein synthesis [29], while miR-30 and miR-133a target connective tissue growth factor (CTGF) [30]. [score:3]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs Validation of by real-time PCRWe validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
miR-30d comes from both cardiomyocytes and cardiac fibroblasts. [score:1]
8 miRNAs (miR-18a-5p, miR-30d-5p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-296-5p, and miR-29a-3p) were selected by the mo del and the AUC for the combination of these 8 miRNAs remained 0.87 (Fig.   4). [score:1]
Among 14 miRNAs identified in our study, the roles of miR-21, miR-29a, miR-30d and miR-133a in myocardial fibrosis are well established. [score:1]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs We validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
Several miRNAs, particularly, miR-21, miR-29, miR-30, and miR-133, have been implicated in the control of myocardial fibrosis [15, 16]. [score:1]
[1 to 20 of 8 sentences]
68
[+] score: 12
Meanwhile, overexpressing miR-30 could inhibit apoptosis through repression of p53 expression in cardiomyocytes [48], but upregulation of miR-30 in breast cancer cells induced apoptosis by targeting Ubc9 [49]. [score:12]
[1 to 20 of 1 sentences]
69
[+] score: 12
Jeon MJ MicroRNA-30d and microRNA-181a regulate HOXA11 expression in the uterosacral ligaments and are overexpressed in pelvic organ prolapseJ. [score:6]
For example, a kidney developing gene, Homeobox A11 (HOXA11), was regulated by three miRNAs in KIRC and suppressed expression was observed during progression (3-fold, miR-769-3p (Stage I); 2.9-fold, miR-484 (Stage II); 2.1-fold, miR-30d-5p (Stage III); 2.2-fold, none (Stage IV)) (Fig.   4A). [score:6]
[1 to 20 of 2 sentences]
70
[+] score: 12
Briefly, the ‘Flp-In' targeting vector, called pCol-TGM, was configured with a GFP ‘spacer' between a tetracycline-regulated element and the miR30 -based expression cassette. [score:6]
Nine shRNA guide sequences predicted to target Rtn1 for knockdown were embedded into a miR30 -based expression cassette of a retroviral DOX-inducible shRNA vector. [score:6]
[1 to 20 of 2 sentences]
71
[+] score: 12
Total PDE-derived cells from 110 PD patients (82 new, 28 prevalent) showed significant miRNA upregulation of miR-15a, miR-21, and miR-192 when comparing new, prevalent and UF groups, while miR-17, miR-30, and miR-377 expression was similar between groups [36]. [score:6]
miR-30 significantly correlated with GFR and no detectable expression of miR-216a and miR-217 was found in patient samples [36]. [score:3]
Chen et al. [36] selected the following candidate miRNAs based on a report on EMT and kidney disease [46]: miR-15a, miR-17-92, miR-21, miR-30, miR-192, miR-216a, miR-217, and miR-377 [36]. [score:3]
[1 to 20 of 3 sentences]
72
[+] score: 12
Other miRNAs from this paper: hsa-mir-25, hsa-mir-210, hsa-mir-1285-1, hsa-mir-1285-2
In addition, we recently discovered that p53 was targeted by miR-1285, miR-25 and miR-30d through analysis using both bioinformatics tools (miRGen, TargetScan, Pictar, and Miranda) and the most current literature [25, 26, 27]. [score:5]
As shown in Figure 5a, qPCR analysis revealed a significant MeHg -induced downregulation of the three miRNAs in ihNPCs (miR-30d fold change: 10 nM, 0.25 ± 0.02; 50 nM, 0.58 ± 0.04; miR-1285 fold change: 10 nM, 0.87 ± 0.11; 50 nM, 0.13 ± 0.01; miR-25 fold change: 10 nM, 0.68 ± 0.03; 50 nM, 0.78 ± 0.07). [score:4]
Therefore, we examined the changes in these miRNAs (miR-30d, miR-1285, miR-25), which may have a potential impact on p53 expression. [score:3]
[1 to 20 of 3 sentences]
73
[+] score: 11
This observation suggests a possible unidentified interaction between miR-30 and BDNF promoter as well as multiple layers of regulation of BDNF level by targeting both 3′-UTR and promoter regions. [score:4]
Members of the miR-30 family were previously reported to target both human and mouse BDNF at the 3′-UTR (55, 56). [score:3]
For example, members of the miR-30 family were good candidates given that they are predominantly nuclear-localized and were predicted to commonly target human and mouse BDNF sense promoter with strong favorable thermodynamic interaction. [score:3]
Experimental evidence for the existence of nuclear miRNAs was also present for the three miRNA families, namely miR-188, miR-671 and miR-30. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 11
For example, these studies reported up to seven fold differences in miRNA expression levels between receptive (LH day 7) and non-receptive (cycle day 12 or LH day 2) endometrium, where miR-30d, miR-30b, miR-31, miR-193a-5p, miR-203 showed up-regulation and miR-503 down-regulation in receptive endometrium [17, 18, 20]. [score:9]
17 Altmäe S, Martinez-Conejero JA, Esteban FJ, Ruiz-Alonso M, Stavreus-Evers A et al. (2013) MicroRNAs miR-30b, miR-30d, and miR-494 regulate human endometrial receptivity. [score:2]
[1 to 20 of 2 sentences]
75
[+] score: 11
pAPM is a lentiviral vector expressing puromycin-resistance and a miR30 -based knockdown cassette from the spleen focus forming virus LTR [48, 63, 64]. [score:4]
Jurkat T cells (A) or primary human CD4 [+] T cells (B) were transduced with lentiviral vectors bearing a puromycin resistance cassette and miR30 -based knockdown cassettes targeting either luciferase (black squares), CypA (gray diamonds), or TRIM5 (white triangles). [score:4]
As a control for miR30 lentiviral vector transduction and puromycin selection, Jurkat T cells were transduced with an otherwise isogenic lentiviral vector targeting luciferase (Luc), a gene that is not present in these cells. [score:3]
[1 to 20 of 3 sentences]
76
[+] score: 11
Based on our prior miRNA sequencing of human airway smooth muscle cells, [28] of the miRNAs in the PC [20] network (Fig 2), two, miR-16-5p and miR-30d-5p, are significantly expressed. [score:3]
The strongest association was found with PC [20] and hsa-miR-296-5p, as shown in Fig 1. Sensitivity analysis (S1 Table) revealed no significant changes in parameters for the mo dels with the exception of non-significance of hsa-miR-30d. [score:1]
As mentioned, several of our other AHR associated miRNA, including hsa-miR-30d, -128, -138, and -203a, have been detected in studies involving human airway cells of asthmatics [14]. [score:1]
This bimodality likely explains non-significance in the sensitivity analysis, while suggesting that miR-30d may still have functional relationship with AHR. [score:1]
HASM cells were transfected with 10 nM of either scramble control or miR-16-5p mimic (left panel; or miR-30d-5p in right panel). [score:1]
of miR-16-5p and miR-30d-5p in human airway smooth muscle cells (HASM) demonstrated effects on cell growth and average cell diameter, respectively, supporting a mechanistic link to these findings. [score:1]
These miRNA appear to be associated with individual and pathway evidence of immune modulation that could affect AHR; complementary functional validation of miR-16-5p and miR-30d-5p in HASM demonstrate effects on cell growth and diameter, respectively. [score:1]
0180329.g005 Fig 5 HASM cells were transfected with 10 nM of either scramble control or miR-16-5p mimic (left panel; or miR-30d-5p in right panel). [score:1]
For the miR-16 and miR-30d experiments, the p-value is 0.0009 and 0.03, respectively. [score:1]
[1 to 20 of 9 sentences]
77
[+] score: 11
miR-30 and miR-133 are cardiomyocyte-enriched miRNAs which regulate connective tissue growth factor (CTGF)–a key molecule in the process of fibrosis and therefore an attractive therapeutic target of heart diseases. [score:6]
Downregulation of miR-30 is related to endoplasmic reticulum stress in cardiac muscle and vascular smooth muscle cells [34]. [score:4]
On the other hand the results of the study conducted by Goren et al. revealed elevated levels of miR-30 in the serum of stable chronic systolic heart failure patients [21]. [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
Zhang and Pan (2009) have evaluated the effects of Hexahydro-1, 3, 5-trinitro-1, 3, 5-triazine (also known as hexogen or cyclonite) (RDX) on miRNA expression in mouse brain and liver, most of the miRNAs that showed altered expression, including let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181, were related to toxicant-metabolizing enzymes, and genes related to carcinogenesis, and neurotoxicity, in addition, consistent with the known neurotoxic effects of RDX, the authors documented significant changes in miRNA expression in the brains of RDX -treated animals, such as miR-206, miR-30a, miR-30c, miR-30d, and miR-195. [score:5]
[1 to 20 of 2 sentences]
79
[+] score: 11
5) 7 hsa-mir-19a dbDEMC 32 hsa-mir-30d dbDEMC 8 hsa-mir-92a HMDD, miR2Disease 33 hsa-mir-451 literature 9 hsa-mir-210 miR2Disease 34 hsa-mir-152 dbDEMC 10 hsa-mir-19b dbDEMC, miR2Disease 35 hsa-mir-215 dbDEMC 11 hsa-mir-224 dbDEMC, miR2Disease 36 hsa-mir-130a dbDEMC, HMDD 12 hsa-let-7f dbDEMC, miR2Disease 37 hsa-mir-499 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
80
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
The miR-30(b/c/d/e) family regulates kidney development by targeting the transcription factor Xlim1/Lhx1 in Xenopus[66]. [score:5]
In addition, ssc-moRNA-3, belonging to new type of miRNA termed moRNA, was found at the 5’ end of pre-miR-30. [score:1]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
The let-7 family had 9 members, miR-181 family had 4 members (miR-181a/b/c/d) and miR-30 family had 5 members (miR-30a/b/c/d/e). [score:1]
#: due to miRNAs classification by seed sequence, 3p and 5p of miR-30 represent different miRNAs families. [score:1]
Similarly, miR-30a was the most abundant in the miR-30 family. [score:1]
At the 5’ end of pre-miR-30, a 18 nt RNA sequence was found to be generated from the loop, downstream of ssc-miR-30a-5p (Figure 10C). [score:1]
[1 to 20 of 7 sentences]
81
[+] score: 11
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
[1 to 20 of 1 sentences]
82
[+] score: 11
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30b, hsa-mir-30c-1, hsa-mir-30e
The structural difference between the microRNA and the shRNA is that the microRNA contains flanking miR30 sequences while in the shRNA these sequences were removed, but the GRB2 targeting sequence is identical in both these suppressive RNAs. [score:5]
We cloned potential microRNA targeting sequences for GRB2 into a modified form of the human miR30 microRNA in viral packaging vectors that have a gene for YFP to identify transduced cells. [score:3]
However, there was no large difference in the effectiveness of each type of targeting sequence, since our studies in HuT78 T cell line performed utilizing both miR30 and shRNA constructs had identical results (data not shown). [score:3]
[1 to 20 of 3 sentences]
83
[+] score: 10
The miR-30 family has been shown to be down-regulated in mdx4cv mice (mo dels for Duchenne muscular dystrophy), with in vitro analysis indicating that miR-30 miRNAs are decreased following injury and are increased during myoblast differentiation [45]. [score:4]
Two members of the miR-30 family, miR-30b-5p and miR-30e-5p, had decreased expression post-exercise. [score:3]
The largest number of gene targets were identified for the miR-30 family members. [score:3]
[1 to 20 of 3 sentences]
84
[+] score: 10
The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
The two shRNA sequences were placed into miR30 context downstream eGFP CDS and thereby lentiviral vectors expressing the miR-shRNAs, named as FUW-eGFP-miR-shRNA in this article, were constructed (Fig. 1). [score:3]
0030560.g001 Figure 1 The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
To place the shRNA sequences into miR30 context, a 97-mer sequence containing the designed shRNA was retrieved through the RNAi design algorithm, which was then subcloned into the site of pri-miRNA area downstream the eGFP coding sequence (CDS) in pRIME vector as previously described [10]. [score:1]
[1 to 20 of 4 sentences]
85
[+] score: 10
Notably the microRNAs upregulated in the control fascia accounting for the greatest differential in read count are heavily enriched in previously validated anti-fibrotic extracellular matrix targeting microRNAs (Table  1), including let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [27, 28], miR-27a-3p, miR-27b-3p [29, 30], miR-10a-5p [31], miR-26a-5p [32– 35], miR-101-3p [36– 39], and miR-10b-5p [40], as well as anti-proliferative microRNAs including, miR-126-3p [41– 47], miR-99a-5p [48– 54], miR-125a-5p [55– 59], and miR-139-5p [60– 62]. [score:6]
Our studies confirmed enrichment of microRNAs miR-10b, miR-7f, miR-101, miR-26a, miR-26b, miR-29a, and miR-30 in non-diseased palmar fascia samples. [score:3]
Established anti-fibrotic microRNAs identified in our analysis include let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [28, 29], miR-27b-3p [30, 31], miR-10a-5p [33], miR-26a-5p [37– 40], miR-101-3p [41– 44], miR-27a-3p and miR-10b-5p [45]. [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 10
miR30 is significantly down-regulated in several cancers, including breast cancer [30] and lung cancer [31] and it has been hypothesized that miR30 may play an important role in tumorigenesis and tumor development. [score:5]
The results showed that CLCNs were able to transfect the cells with miR30b as well as DharmaFect did and the miR30-b expression in vitro was increased by using CLCNs or DharmaFect. [score:3]
However, the function of miR30 especially in NSCLC remains unclear [32]. [score:1]
The tissues sections were collected 24 hours after treatment with CLCN D275/miR30 b complexes (1.5 mg/kg). [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 10
A direct target gene of miR-30 is integrin β3 [18]. [score:4]
Of note, the expression of most members of the miR-30 family including miR-30b, -30c, and -30d, were also reduced in CK2β -depleted cells. [score:3]
It has been reported that a miR-30 reduction maintains self-renewal and inhibits apoptosis in breast tumour-initiating cells [18]. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 10
Moreover, members of the miR-30 family regulate apoptosis by controlling mitochondrial fission, suppressing p53 [57] and caspase 3 translation [58], as well as tumor necrosis factor-related apoptosis inducing ligand -mediated apoptosis [59]. [score:6]
In our data set, we detected a significant down-regulation of miR-30d, miR-30e*, and miR-30a 20 hours after irradiation (see Additional file 14). [score:4]
[1 to 20 of 2 sentences]
89
[+] score: 10
For example, MMP16, predicted target of miRs miR-27, miR-30 and miR-140, is an important protein regulating bone homeostasis through regulating osteocyte differentiation [58]. [score:5]
Among the miR expression of which was differentially expressed in the osteogenic tissues from adult and old donors, miRs with known function in bone biology were validated: let-7 [52], miR-21 [53], miR-30 [54], miR-96 [55], miR-27 [56], and miR-140 [57]. [score:5]
[1 to 20 of 2 sentences]
90
[+] score: 10
For bladder cancer, Takahiro et al. demonstrated that KRT7 mRNA was significantly down-regulated by transfection of miR-30-3p, miR-133a and miR-199a in the bladder cancer cell line (KK47), suggesting that these three miRNAs may have a tumor suppressive role via the mechanism underlying transcriptional repression of KRT7 [9]. [score:6]
Figure  1 shows that target genes of four miRNAs such as hsa-miR-221, hsa-miR-30-3p, hsa-miR-133a and hsa-miR-21 were enriched in three pathways. [score:3]
Of note, nine miRNAs such as hsa-miR-199a*, hsa-miR-143, hsa-miR-127, hsa-miR-30-3p, hsa-miR-221, hsa-miR-21, hsa-miR-101, hsa-miR-129 and hsa-miR-133a were listed (Table  2). [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 10
The miRNAs downregulated the most included the miR-141/miR-200 and miR-30 families, as well as miR-192, miR-204, and miR-215, which play key roles in maintaining epithelial cell phenotype [17, 18], and their downregulation is in accordance with the EMT-like change occurring in cultured BCD cells. [score:7]
hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA 000564 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU 000268 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG 000174 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC 000149 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG 000420 hsa-miR-200a UAACACUGUCUGGUAACGAUGU 000502 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA 002251 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA 002300 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG 000402 Total protein was extracted from cells by incubation with a lysis buffer containing 0.5% NP-40 and protease inhibitor cocktail for 10 min. [score:3]
[1 to 20 of 2 sentences]
92
[+] score: 10
Similarly, CCNE2 expression is increased in NSCLC, over-expressed CCNE2 facilitates NSCLC cell growth and the effect can be abolished by reintroduction of miR-30d-5p (Chen et al., 2015). [score:5]
MicroRNA-30d-5p inhibits tumour cell proliferation and motility by directly targeting CCNE2 in non-small cell lung cancer. [score:5]
[1 to 20 of 2 sentences]
93
[+] score: 10
An shRNA is expressed under regulation of a U6 promoter and is flanked by pri-miR-30 5′ and 3′ sequences, which are 151 and 128 bp long, respectively. [score:4]
The shRNA sequences (Figure 1B, Table S1) targeting human huntingtin (shHTT) and EGFP (control reagent, shCTRL) were designed using the RNAi Codex database (Olson et al., 2006) with a mir-30 loop between the passenger and guide strands. [score:3]
We have assembled a silencing construct and stably integrated it into the iPSC genome; this construct is based on the piggyBac transposase system (Yusa et al., 2011) and contains anti-HTT or control shRNA in the mir-30 backbone (Paddison et al., 2004), and the gene encoding mOrange2 fluorescent protein (Shaner et al., 2008) as a reporter (Figure 1A). [score:1]
We used a piggyBac transposase system (Yusa et al., 2011) and anti-HTT shRNA in the mir-30 backbone (Paddison et al., 2004) which provides additional possibility for future excision of the reagent if desired. [score:1]
Constructs (Figure 1A) composed of a U6 promoter, a miR-30 5′ flank (151 bp), an shRNA sequence, a miR-30 3′ flank (128 bp), a U6 terminator (TTTTTT), an EF1alpha promoter, an mOrange2 reporter gene, and an SV40 pA site were were synthesized by Genscript (Piscataway, NJ) and cloned into a pPB-HKS-neoL vector obtained, by removing the EGFP reporter gene, from a pPB-UbC. [score:1]
[1 to 20 of 5 sentences]
94
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
These miRNAs (miR-15a, miR-30, miR-182, and miR-804) are involved in cell proliferation, apoptosis, inflammation, epithelial-mesenchymal transition, invasion, oncogene inhibition, and intercellular adhesion. [score:3]
[1 to 20 of 2 sentences]
95
[+] score: 10
mmu-miR30 -based plasmids: Artificial miRNA expressing the dre-miR30 cassette was amplified from pCS2-mir-linker (gift from Dr Min Deng) 7. Primers used (52_Forw_miR30 and 53_Rev_miR30) were designed to add BamHI in 5′ of the dre-miR30 cassette, as well as BglII and XhoI in 3′, thus allowing easy chaining of dre-miR30 (Fig. 1). [score:2]
According to the cell-specific observations above, miR218 and miR155 backbones led to potent global knockdown with ∼74 and 83% reduction in red fluorescence, respectively, while the miR30 backbone reduced fluorescence modestly by ∼33%. [score:2]
However, the backbone based on dre-miR30 achieved only weak red fluorescence inhibition compared with mmu-miR155 or hsa-miR218 backbones. [score:2]
The sequence used in our experiments may not be compatible with the pri-dre-miR30 sequence. [score:1]
Both the PCR product and pME -RNAi651 plasmid were digested by BamHI and XhoI to exchange the mmu-miR155 backbone with the dre-miR30 one (plasmid was purified before ligase reaction). [score:1]
pME -RNAi651 is based on a mmu-miR155 backbone, pME -RNAi661 on a dre-miR30 backbone and pME -RNAi671 on a hsa-miR218 backbone. [score:1]
Nonetheless, pri-dre-miR30 still presents limitations in terms of use. [score:1]
[1 to 20 of 7 sentences]
96
[+] score: 9
Using microarray analysis, miRNA expression pattern in hearts revealed that miR-1, miR-29, miR-30, miR-133, and miR-150 have often been found to be down-regulated while miR-21, miR-125, miR-195, miR-199, and miR-214 are up-regulated with hypertrophy. [score:9]
[1 to 20 of 1 sentences]
97
[+] score: 9
Based on these observations, we hypothesize that miR-30 overexpression in FF pools from women with PCOS might lead to FOXL-2 inhibition/down-regulation in ovarian follicles, thus promoting PCOS symptom development. [score:9]
[1 to 20 of 1 sentences]
98
[+] score: 9
Many earlier reports suggested that miR-30 family could be a potent tumor suppressor in some cancers and its direct overexpression could induce the molecular mechanisms of extrinsic and intrinsic pathways of apoptosis. [score:6]
A few earlier studies reported an important role of the miR-30 family in sensitizing tumor cells to the conventional therapeutic agents via suppression of Beclin-1 mediated autophagy [29, 30]. [score:3]
[1 to 20 of 2 sentences]
99
[+] score: 9
In brain tissue, hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), a common environmental contaminant, induced the over -expression of miR-206, miR-30 and miR-195, which then inhibited the expression of the target BDNF gene and contributed to neuro-toxicity and CNS disorders. [score:9]
[1 to 20 of 1 sentences]
100
[+] score: 9
The expression levels for the mir-30 family are shown in Fig. 1. The family members arise from several different genomic loci, both from miRNA clusters and distinct miRNA genes. [score:3]
In addition to miR-21, members of the miR-29 family (miR-29a/b/c-3p) and miR-30 family (miR-30a/b/c/d/e-5p) are also highly expressed in fibroblasts. [score:3]
Several of the detected pericardial fluid miRNAs arise from the same genomic locations (cluster miRNAs), and/or belong to a miRNA family, the largest miRNA families detected being let-7, mir-10, mir-30, mir-29, mir-15, mir-17, and mir-181. [score:1]
MicroRNA gene family miR-30. [score:1]
Eight miRNAs (miR-215, miR-30d-5p, miR-218–5p, miR-146–5p, miR-21–5p, miR-30e-3p, miR-23a-3p and miR-181a-5p) were found to be differentially detected between the NYHA classes (ANOVA, p<0.05), but they failed to pass Benjamini-Hochberg correction for false positivity in multiple testing (Figs. 3B and 3D). [score:1]
[1 to 20 of 5 sentences]