133 publications mentioning mmu-mir-10b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-10b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Collectively, these findings have several implications: (a) miR-10b* down-regulation has a profound impact on breast cancer proliferation by disabling proper cell cycle regulation; (b) the expression of BUB1, PLK1 and CCNA2 proteins, whose respective transcripts are targets of miR-10b*, is dysregulated in different human cancers.

We found that miR-10b* controls cell cycle progression and proliferation by targeting the expression of BUB1, PLK1 and CCNA2, and that low expression levels of these three genes are, to various extents, predictive of less aggressive disease and of longer relapse- and metastasis-free survival.

Among these miRs, we identified two (miR-10b* and miR-139-5p) that were down-regulated and three (miR-425, miR-454 and miR-301a) that were up-regulated for all three subtypes (Fig 1D and E and Supporting Information Fig S1A).

Indeed, miR-10b is highly expressed in metastatic breast cancer as well as in other advanced tumours such as pancreatic ductal carcinoma (Bloomston et al, 2007; Preis et al, 2011) and glioblastoma tumours (Ciafre et al, 2005), while we show here that miR-10b* is down-regulated through hypermethylation of its regulatory regions in primary breast cancers.

We identified 736 putative target genes and since many of these are likely to be false positives, we used a publicly available dataset (Enerly et al, 2011) that contains expression data for both miR-10b* and mRNA from 100 breast cancer patients to provide a filter for putative targets.

Forty-two of the predicted target genes of miR-10b* were significantly (10% FDR) anti-correlated with the miR's expression levels, and we selected these as our candidate targets.

Indeed, we found that down-regulation of miR-10b* occurs also in gastric and head and neck tumours when compared to their matched peritumoural tissues (Unpublished observation by FB, VC, AS, FG and GB); (c) the fine deciphering of the molecular events governing the expression of the miR-10b locus (miR-10b* and miR-10b) may disclose novel therapeutic targets to tackle breast tumourigenesis.

Thus, up-regulation of miR-425, miR-454 and miR-301a and down-regulation of miR-10b* and miR-139-5p were definitively confirmed.

We demonstrate that miR-10b* targets the expression of PLK1, BUB1 and CCNA2 cell cycle regulatory proteins.

miR-10b* down-regulates the expression of BUB1, PLK1 and CCNA2 proteins in breast cancer cell lines.

: In the present study, we show that down-regulation of miR-10b* expression, through hypermethylation of its regulatory regions, occurs specifically in breast tumour specimens when compared to their matched peritumoural samples.

To elucidate the biological significance of the down-regulation of miR-10b* and miR-139-5p in breast cancer, we analysed potential correlations between their expression and commonly known clinical attributes.

To examine the effect of miR-10b* expression on the protein levels of these targets, MCF7, MDA-MB-468 and SKBR3 cells (which have a lower level of miR-10b* expression compared with MCF10A cells, see Supporting Information Fig S4D) were transfected with miR-10b* mimic or control mimic and the protein levels of BUB1, PLK1 and CCNA2 were analysed by Western blot.

Altogether, these results indicate that methylation of CpG islands may underlie down-regulation of miR-10b* expression in breast cancer samples.

This suggests that down-regulation of miR-10b* expression might precede those oncogenic alterations, which contribute to breast cancer subtype specificity.

: In the present study, we show that down-regulation of miR-10b* expression, through hypermethylation of its regulatory regions, occurs specifically in breast tumour specimens when compared to their matched peritumoural samples.

To unravel the molecular mechanisms through which miR-10b* exerts its tumour suppressor functions and is involved in the regulation of cell cycle and proliferation, we first searched for putative miR-10b* target mRNAs.

To formally demonstrate that miR-10b* targets BUB1, PLK1 and CCNA2 mRNAs, the 3′-UTR of each of the three targets was cloned down-stream to the Renilla luciferase gene into the psiCHEK2 vector (Supporting Information Fig S4C).

We showed that down-regulation of miR-10b* expression occurs specifically in breast tumour specimens when compared to their matched peritumoural samples.

A. SPIN-ordered expression matrix of miR-10b* and its seven predicted target genes connected to cell cycle, across 100 breast cancer tumours.

Figure 4 A. SPIN-ordered expression matrix of miR-10b* and its seven predicted target genes connected to cell cycle, across 100 breast cancer tumours.

Restoration of miR-10b* expression by using mimic 10b* reduces PLK1, BUB1 and CCNA2 protein expression in diverse breast cancer cell lines (Fig 4E–G).

The computational analysis reveals that putative target genes of miR-10b* which are anti-correlated to the miR expression levels, are involved in various cellular pathways (Supporting Information Table S5A).

Clinical association of miR-10b* target gene expression with survival of breast cancer patients.

uk/enright-srv/microcosm/htdocs/targets/v5/) is the only one that provides targets of miR-10b*.

It has been shown that miR-10b suppresses the synthesis of Hoxd10 protein increasing the expression of the pro-metastatic gene products RhoC, urokinase activator plasminogen receptor (uPAR), a3-integrin and MT1-MMP (Ma et al, 2007; Sasayama et al, 2009; Sun et al, 2011).

The association between expression levels of miR-10b* target genes (BUB1, PLK1 and CCNA2) and disease (A)/relapse (B)/distant metastasis (C) – free survival was evaluated by in three public datasets, Ivshina et al. (Ivshina et al, 2006), 249 patients, Miller et al. (Miller et al, 2005), 237 patients and Loi et al. (Loi et al, 2007), 135 patients.

Here, we document that down-regulation of miR-10b* correlates with aberrant expression of PLK1, BUB1 and CCNA2 proteins in breast cancer specimens when compared to their matched peritumoural samples.

Conversely, silencing of miR-10b expression suppresses metastasis in a mouse mammary tumour mo del (Ma et al, 2010).

The knock-down of each miR-10b* target in each experimental condition tested caused a significant reduction (albeit to different extents) in the colony-forming ability of MCF7 cells (Supporting Information Fig S4G–S4L).

To provide further evidence to the role of CpG island methylation to the down-regulation of miR-10b* expression, we investigated the methylation status of the two CpG islands mentioned above using genomic DNA derived from six matched tumour and peritumoural breast tissues.

miR-10b* falls among those miRs whose deregulated expression features in all of the three breast cancer subtypes.

IMPACT: Since miR-10b* down-regulation is an alteration common to the three major breast cancer subtypes, it might represent a critical molecular event for breast cancer establishment.

This might suggest that down-regulation of miR-10b* promotes aberrant breast cancer cell proliferation, which is later paired with increased migration, invasion and metastasis as a consequence of the transcriptional activation of miR-10b (Fig 7).

CpG island hypermethylation contributes to microRNA-10b* down-regulation in breast cancer samples.

A partial recovery of the luciferase activity was observed when vectors carrying targets 3′-UTR of BUB1, PLK1 and CCNA2, with mutations in the miR-10b* complementary sequences, were tested (Fig 4B–D).

IMPACT: Since miR-10b* down-regulation is an alteration common to the three major breast cancer subtypes, it might represent a critical molecular event for breast cancer establishment.

The ability of miR-10b* expression to inhibit cell proliferation was further confirmed by colony formation assays in MCF7 cells (Fig 3K).

In primary breast tumours, miR-10b* is down-regulated by promoter hypermethylation.

Thus, restoration of miR-10b* expression might hold therapeutic potential for breast cancer treatment.

It has been reported that miR-10b antagomir suppresses breast cancer metastasis in vitro and in vivo without having any effect on the primary breast tumours (Ma et al, 2010).

miR-10b* inhibits the proliferation of breast cancer cell lines.

The miR-10b* antagomiR expression increases the protein levels of PLK1, BUB1 and CCNA2 in MCF-10A cells (Fig 4H–J).

In metastatic breast tumours, it has been reported (Ma et al, 2007, 2010) that the over -expression of miR-10b is strictly related to the invasive program that leads to metastasis formation.

Analysis of these miR-10b* targets by immunohistochemistry (IHC) in ten matched breast tumour and peritumoural tissues (from the cohort analysed by microarray miR profiling) showed remarkable increased staining of BUB1, PLK1 and CCNA2 in the tumour tissues (Fig 4K).

Specifically, we calculated the correlation between the expression levels of these 736 putative target genes and those of miR-10b*.

The expression of miR-10b/10b* is regained when breast cancer cell lines are treated with demethylating agents (Fig 2).

A. Box-plots of the expression levels of miR-10b* and miR-139-5p for tumours of different sizes (pT1 < pT2 < pT3).

A trend of association between low miR-10b* expression level and worse prognosis was also evidenced by of the Enerly et al dataset (Enerly et al, 2011; Supporting Information Fig S5).

As shown in Fig 6B, local delivery of synthetic miR-10b* induced a specific inhibitory response and robustly interfered with tumour growth.

We calculated the Pearson correlation and corresponding p-values between expression levels of miR-10b* and its 736 predicted target genes.

RT-qPCR analysis of pri-miR-10b (D), mature miR-10b* and miR-10b (E) expression was performed in MCF7 breast cancer cells treated with the demethylating agent 5-aza-dC versus untreated cells (NT).

As shown in Fig 3A, a statistically significant negative correlation was found between miR-10b* expression and tumour size (T).

Conversely, the transfection of an inhibitor of miR-10b* activity in untransformed MCF10A cells leads to an increase of BUB1, PLK1 and CCNA2 protein levels (Fig 4H–J and Supporting Information Fig S4E and S4F).

As shown in Fig 4E–G, miR-10b* exogenous expression strongly reduced the amount of BUB1, PLK1 and CCNA2 protein in all cell lines.

The expression analyses demonstrated that the microRNA-10b* precursor (Fig 2D), as well as the mature miR-10b and -10b* (Fig 2E), are induced in MCF7 cells following 5-aza-dC pharmacological treatment.

Overall, in vivo observations on the effect of miR-10b* expression in breast cancer tumours together with those observed in cell lines confirm the key role of miR-10b* in the control of breast cancer cell proliferation.

Accordingly, the percentage of Ki67 -positive cells in the miR-10b*-over -expressing MCF7 and MDA-MB-468 populations was substantially lower than in control cells (Fig 3D).

C [t] values were used to calculate absolute miR-10b* copy numbers and expressed relative to the average expression in control tumours (1.0).

This may suggest that alteration of miR-10b* expression plays a role in establishing also other types of tumours.

miR-10b* expression affects breast cancer cells proliferation.

We found that microRNA-10b* was downregulated in tumoural samples of all three types when compared to their matched peritumoural counterparts.

We next analysed the effect of miR-10b* or miR-139-5p expression on cell-cycle distribution by flow cytometry.

miR-10b* targets the 3′-UTR region of BUB1, PLK1 and CCNA2 transcripts (Fig 4B–D).

Overexpression of miR-10b in non-metastatic breast tumours leads to tumour invasion and distant metastasis in xenotransplantation mo dels (Ma et al, 2007).

Other validated mRNA targets of miR-10b include KLF4 in human oesophageal cancer cell lines (Tian et al, 2010) and the nuclear receptor co-repressor 2 (NCOR2) in neuroblastomas (Foley et al, 2011).

Expression vectors carrying a luciferase reporter followed by the 3′-UTR regions of BUB1 (B), PLK1 (C) or CCNA2 (D), in their wild-type form (black bars) or mutated in the miR-10b* complementary sequence (grey bars), were transfected in H1299 cells in the presence of mimic-10b* or control mimic.

In MDA-MB-468 cells over -expressing miR-10b*, there was a significant decrease in G1 phase accompanied by an increase in the subG1 phase of the cell cycle compared to control cells (Fig 3E and F), indicating perturbation of cell cycle.

In the present study, we identified miR-10b* as a master regulator of breast cancer cell proliferation.

In miR-10b*-over -expressing MCF7 cells, we observed a decrease in S phase accompanied by an increased sub-G1 fraction of the cell cycle compared to control cells (Fig 3H and I and Supporting Information Fig S3C).

To investigate whether the down-regulation of miR-10b* and miR-139-5p could be attributable to hypermethylation events occurring during breast carcinogenesis, we first examined the genomic loci of miR-10b* and miR-139-5p for the presence of CpG islands (Supporting Information Fig S2A and S2B).

Ki-67 and Cyclin D1 protein expression was significantly (Ki67 p = 0.009; CCND1 p = 0.0008) decreased in their levels in the tumours injected with miR-10b*, compared to control tumours [Fig 6D and E (IV–V)].

The 5-bromo-2′-deoxyuridine (BrdU) incorporation assay confirmed that miR-10b*-over -expressing MCF7 cells are less proliferating than control cells (Fig 3J and Supporting Information Fig S3D).

miR-10b* represses cell cycle regulatory genes with prognostic power in breast cancer.

Soft agar colony formation assays indicated that miR-10b* over -expression reduced the ability of cells to grow in an anchorage-independent manner (Fig 3L).

Our findings, together with those published by Weinberg's group (Ma et al, 2007, 2010), highlight the key roles of the miR-10b locus in breast cancer establishment (miR-10b*) and spreading (miR-10b).

miR-10b* -treated tumours also showed a significantly higher number of TUNEL -positive cells than those injected with control mimic (Supporting Information Fig S6).

Interestingly, the miR-10b/10b* locus appears to undergo both epigenetic modifications and transcriptional activation in breast tumours.

Total RNA was prepared from tumours harvested 5 day post the final treatment and RT–qPCR was performed using probe specific for miR-10b*.

Figure 2 A. Schematic representation of the miR-10b and miR-139-5p genomic loci.

Four representative mice for control group (numbered on x-axis #1, #2, #4 and #6) and miR-10b* group (numbered on x-axis #3, #4, #5 and #6) were shown.

Three weeks after injection, when tumour cells had formed solid and palpable tumours with an average volume of 100 mm [3], animals were subdivided into two groups and either treated with miR-10b* mimic or a negative control miR.

On days 22, 24, 27 and 30 from cells inoculation, synthetic miR-10b* or control double-stranded and ready-to-use miRs conjugated with the siPORT transfection reagent were intratumourally delivered into groups of seven animals.

We also provide evidence that injection of synthetic miR-10b* impaired tumour growth of xenografted human breast tumours.

Immunoprecipitated genomic DNA from MCF7 cell line was quantified by using qPCR with TaqMan assays directed to miR-10b* CpG islands #1 and #2 and miR-139-5p CpG Island #1. C. MeDIP experiment of MCF7 cells treated with 5-aza-dC.

The BUB1-, PLK1- and CCNA2-encode mRNA contains 3′-UTR elements that are partially complementary to miR-10b* (Supporting Information Fig S4B).

A. Relative miR-10b* abundance in MDA-MB-468 tumours.

This finding is in line with the methylation status of CpG islands upstream of miR-10b*.

A half millilitre aliquot of cell suspension (obtained from MCF7 and MDA_MB_468 cells transfected or not with miR-10b* oligos), was mixed with 0.5 ml of 0.4% trypan blue dye and left for 5 min at room temperature.

To explore the therapeutic potential of miR-10b* in established tumours, we subcutaneously inoculated immunodeficient SCID mice with human MDA-MB-468 breast cancer cells.

miR-10b and miR-10b* are generated from a common precursor.

Since altered cell proliferation correlates with tumour size, we investigated the effects of miR-10b* expression on cell proliferation.

The distribution of tumour volumes among the groups of miR-10b* -treated and control mice at the time of the last injection is shown in Fig 6C.

Indeed, TUNEL assay performed under the same experimental conditions clearly confirmed an increase in the percentage of apoptotic cells in the miR-10b*-over -expressing population compared to control cells (Fig 3G and Supporting Information Fig S3A and S3B).

On the other hand, very little is known about the role of miR-10b* in breast transformation.

Growth curves of MDA-MB-468 (B) and MCF7 (C) cells transfected with miR-10b* (MIM 10b*) or miR-139-5p (MIM 139-5p) or control mimic (CTRL) were performed harvesting the cells after 24, 48 and 72 h from transfection.

The inoculations were performed administering miR-10b* mimic by four intra-tumoural injections each every 3 days.

A. Schematic representation of the miR-10b and miR-139-5p genomic loci.

Methylation of miR-10b/10b* promoter CpG islands has been recently shown in gastric cancer specimens (Kim et al, 2011).

Intra-tumoural delivery of miR-10b* reduces tumour size in a breast cancer xenograft mo del.

miR-10b locus is hypermethylated in breast cancer.

Lower levels of miR-10b* correspond to higher tumour sizes (Fig 3A).

For miR-10b* injection experiment, 50 µl synthetic miRNA (Austin, TX, USA; pre-miR, cat.

As shown in Fig 2B, both CpG islands upstream of miR-10b* were found to be methylated.

Figure 7miR-10b and miR-10b* are generated from a common precursor.

This is due to hypermethylation of CpG islands found upstream from the miR10b/10b* locus.

Finally, we showed that intratumoural delivery of miR-10b* impaired breast xenograft tumour growth.

Given that miR-10b* is an intergenic miR, we analysed a 5 Kb-long region upstream from the miR-10b* precursor coding sequence using the UCSC Genome Browser.

As shown in Fig 2G, MeDIP analysis demonstrated a higher methylation degree of both CpG islands located upstream to miR-10b* in the tumour samples in comparison to matched peritumour samples.

Of note, methylation of miR10b/10b* CpG islands was abrogated when 5-Aza-2′-deoxycytidine (5-aza-dC), a demethylating agent, was added to the MCF7 cell culture (Fig 2C).

As shown in Fig 4B, miR10b* co-transfection significantly decreased the Renilla luciferase activity of the vector encoding the BUB1 3′-UTR.

Figure 6 A. Relative miR-10b* abundance in MDA-MB-468 tumours.

2

Preview studies have shown that miR-10b inhibits the translation of HOXD10 mRNA, thereby affecting the expression of downstream targets of this transcription factor.

miR-10b inhibitor was transfected into MHCC-97H cell to reduce miR-10b expression, while miR-10b expression vector was transfected into MHCC-97L cell to increase miR-10b expression.

The present study provides evidence to support that miR-10b, a microRNA overexpressed in HCC, inhibits the expression of the HOXD10 post-transcriptionally by binding to the 3′UTR of the HOXD10 mRNA, thereby promoting the RhoC/ uPAR/ MMPs induced cell invasion and migration.

To test whether miR-10b expression affected endogenous HOXD10 expression, we transfected miR-10b inhibitor and control plasmid into MHCC-97H, and an increase of HOXD10 protein level was observed.

miR-10b, induced by the pro-metastatic transcription factor TWIST1, proceeds to inhibit translation of mRNA of HOXD10, a transcription factor already known for its roles in cell motility [10], resulting in increased expression of a pro-metastatic gene, RhoC and tumor invasive factors, urokinase-type plasminogen activator receptor (uPAR) [6].

Real-time RT-PCR showed that overexpression or inhibition of miR-10b had no effect on HOXD10 mRNA level (Figure  5b), which indicated the post-transcriptional regulation of miR-10b on HOXD10 mRNA.

Expression of all genes was decreased by the miR-10b inhibitor (Figure  5c), which indicated that RhoC, uPAR, MMP-2 and MMP-9 were regulated by miR-10b in HCC cell.

The results showed that all of them were up-regulated by miR-10b over -expression (Figure  5c).

Then, we utilized miR-10b expression vector to up-regulate the level of miR-10b in MHCC-97L cells, which led to a 2.02 fold increase in invasion (P < 0.05, Figure  2d).

miR-10b modulates invasion factors RhoC, uPAR and MMPs expression via the target HOXD10 gene.

Overexpression of miR-10b in MHCC-97L cells increased cell motility and invasiveness, whereas inhibition of miR-10b in MHCC-97H cells reduced cell motility and invasiveness in vitro and in vivo.

When transfected with the miR-10b inhibitor, MHCC-97H cells lost their invasion potential while MHCC-97L cells’ invasive ability was enhanced by the miR-10b over -expression.

As shown in Figure  1a, miR-10b expression levels were overexpressed in HCC tissues than those in ANT tissues.

Our results showed that miR-10b expression levels were overexpressed in HCC tissues than those in ANT tissues.

The expression of miR-10b in metastatic HCC tissues (HHCC and LHCC) was significantly higher than in non-metastatic HCC tissues (NHCC, Figure  1c), which indicated that the miR-10b expression was correlated with the HCC metastatic ability.

Furthermore, we found that miR-10b induced HCC cell invasion and migration by modulating the HOXD10 target gene RhoC, uPAR, MMP-2 and MMP-9 expression.

Indeed, we found that miR-10b transduced cells exhibited robust expression of RhoC protein, whereas RhoC expression in the control cells was relatively low.

We used antisense miR-10b, which could decrease miR-10b expression, and miR-10b expression vector, which could increase miR-10b levels.

The expression of miR-10b was calculated as the normalized ratio of the expression level of miR-10b in HCC tissues to the expression level of miR-10b in ANT tissues.

Our results suggested that miR-10b was overexpressed in HCC and promoted HCC cell migration and invasion through the HOXD10/ RhoC/ uPAR/ MMPs pathway which may provide a novel bio-target for HCC therapy.

Judging from data between the controls and miR-10b overexpressed groups at the points of the experiment, miR-10b overexpression resulted in a mean increasing in tumor growth.

miR-10b inhibits the translation of mRNA encoding HOXD10, which modulates many genes that promote invasion, migration, extracellular matrix remo deling and tumor progression [10].

To examine the role of miR-10b in the proliferation of HCC cells, MTT proliferation assay were performed with MHCC-97H cells transfected with miR-10b inhibitor and MHCC-97L cells transfected with miR-10b expression vector, respectively.

HOXD10 is a direct target of miR-10b.

Next we explored the molecular mechanism underlying its function and found that HOXD10 was a direct target of miR-10b in HCC.

Therefore, HOXD10 is a direct and functional target of miR-10b which may result in an increased expression of a cluster of well characterized pro-metastatic genes.

It is also demonstrated that HOXD10 is negatively regulated by miR-10b at the posttranscriptional level, via a specific target site within the 3′UTR.

Then, we identified the role of miR-10b in HCC cell migration and invasion; furthermore, we also examined the direct binding target of miR-10b.

s showed that miR-10b could bind to the 3′UTR of HOXD10 and down-regulate the luciferase activity.

Thus, our data suggested important roles for miR-10b in HCC development and implicate this miRNA’s potential application as a target for cancer therapies.

The results showed that the inhibition of miR-10b expression led to significant reduction in invasion compared to the control cells (P < 0.05, Figure  2d).

These findings indicated that miR-10b is overexpressed in HCC tissues and cells, and might play some role in the invasion and migration of HCC cells.

When expression levels of miR-10b were compared between subgroups, miR-10b was significantly higher in HCC (NHCC, LHCC and HHCC) groups compared to the normal liver (BT and NL) groups and miR-10b expression was positively correlated with the tumor’s stage (Figure  1b).

The expression of miR-10b was correlated with HCC metastatic ability.

Recently, miR-10b is identified as a miRNA highly expressed in many human cancers, promoting cell migration and invasion.

Using HCC tumor mo dels, the control mice showed the apparent presence of primary tumor, whereas those injected with miR-10b expression vector increased the volume of tumors during the same observation period (Figure  3).

We also detected the miR-10b expression in HCC and normal liver cell lines.

In contrast, expression levels of miR-10b in HepG2, BEL-7402 and MHCC-97L cells were relatively lower.

We also showed that HOXD10 was negatively regulated by miR-10b at the posttranscriptional level, via a specific target site within the 3′UTR by luciferase reporter assay.

Figure 4 The HOXD10 3′UTR is a target of miR-10b.

Consistent with these results, overexpression of miR-10b in MHCC-97L cells showed a decrease in the HOXD10 protein level (Figure  5a).

miR-10b is over-expressed in HCC tissues and cell lines.

One-way ANOVA was used to compare the miR-10b expression in different groups.

miR-10b expression in MHCC-97H, FHCC-98, SMMC-7721 and HCC-9724 cells was relatively higher.

Briefly, 1 × 10 [6] cells were seeded in six-well plates, cultured overnight, and transfected with miR-10b or miR-10b inhibitor and the respective controls.

The higher expression of miR-10b in HCC cells with high metastatic potential suggested a causal role for miR-10b in the migration and invasion of HCC cells.

As shown in Figure  1d, miR-10b expression levels in HCC cell lines were significantly higher than those of normal liver cell lines.

Cultured cells were transfected with miR-10b expression vector, antisense miR-10b (anti-miR-10b), scramble miRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.

Then we analyzed miR-10b levels after transfection by real-time RT-PCR and found that miR-10b levels were significantly reduced by the miR-10b inhibitors (decreased about 0.57 fold compared with the control cells, P < 0.05, Figure  2a) and elevated by the miR-10b expression vector (increased about 2.75 fold compared with the control in the MHCC-97L cells, P < 0.01, Figure  2a).

Then, we examined the levels of these migration and invasion factors after transfection with miR-10b express vector in MHCC-97L cells.

Furthermore, miR-10b expression in HCC cell with high metastatic potential was statistically significantly higher than that with high metastatic potential HCC cell.

The transfection of miR-10b expression vector resulted in an opposite effect.

A total of 5 × 10 [6] MHCC-97L cells stably expressing miR-10b were resuspend in Matrigel (BD, 1 mg/ml) and injected subcutaneously into nude mice.

Also, because miR-10b expression of HCC cell line MHCC-97H was high and MHCC-97L was relatively low in our study, it is interesting to investigate the association between miR-10b expression and the invasive potential or migration levels using these cell lines.

To verify whether miR-10b directly targeted HOXD10 in HCC cell lines, luciferase reporter assays were carried out.

The cells of 80% confluence in 24-well plates were transiently transfected with firefly luciferase reporter gene constructs and miR-10b expressing plasmid.

There was a quicker closing in MHCC-97L cells with miR-10b overexpression (P < 0.05, Figure  2c).

The miR-10b inhibitors and scramble miRNA were designed and synthesized in GenePharma Inc.

The expression of miR-10b correlates with HCC metastatic ability in vitro and in vivo.

The expression of miR-10b in metastatic HCC tissues was significantly higher than those in non-metastatic HCC tissues.

So, we transfected miR-10b inhibitors and found that HOXD10 protein levels were elevated while RhoC, uPAR, MMP-2 and MMP-9 levels were decreased.

We found that miR-10b expression was increased in human HCC tissues and cell lines compared with normal control, respectively.

We next asked whether miR-10b could promote HCC development in vivo.

In our study, we demonstrated that miR-10b expression is increased in human HCC tissues and cell lines compared with matching adjacent non-tumor tissue and normal liver cell lines.

Identification of miR-10b as an important regulator of tumor cell migration and invasion emphasizes an essential role of this miRNA in mediating hepatic oncogenesis and tumor behavior.

In addition a study detecting the microRNA profiling in hepatocellular tumors compared to benign hepatic tumors and non-tumor liver tissues shown that the expression of miR-10b was increased in HCC [12, 13].

For the over -expression of miR-10b, genomic fragment of Homo sapiens miR-10b precursor was amplified by PCR using the primer pairs: 5′-GGC GGA TCC CAA GCC CAT TAG GCT ACC TG-3′ and 5′- CCG GAA TTC TGA GGA GCT TCT GGA GAG GA -3′ [8].

HOXD10 has been reported to be regulated by miR-10b in human breast cancer [3].

These results indicated that miR-10b served as a tumor metastasis factor in HCC cell through the HOXD10/ RhoC/ uPAR/ MMPs pathway.

The results showed that miR-10b could significantly promoter HCC cell proliferation (P < 0.05, Figure  2b).

MHCC-97L and HepG2 cells were transfected with pcDNA3.1-miR-10b and pmirGLO-HOXD10-3′UTR or pmirGLO-HOXD10-3′UTR-mut.

However, the specific function of miR-10b in hepatocellular carcinoma (HCC) is unclear at this point.

These results indicated that miR-10b could contribute to the HCC progress through promoting tumor cell proliferation, migration and invasion.

The expression levels of miR-10b were first evaluated in sixty paired of HCC and ANT tissues by real time RT-PCR.

miR-10b HCC invasion migration RhoC uPAR MMPs Hepatocellular carcinoma (HCC) is one of the most common malignancies and leading causes of cancer-related death worldwide, especially in Asian Pacific regions, which has a highly invasive malignant behavior and recurrence rate and remains one of the tumors most refractory to treatment [1].

Nowadays, MMPs have also been reported participating in the miR-10b mediated tumor invasion and metastasis [11].

Next, the wound-healing assay showed that MHCC-97H cells with miR-10b inhibitor presented a slower closing of scratch wound, compared with the negative control.

The effect of miR-10b on HCC in vivo was validated by murine xenograft mo del.

We constructed pmirGLO-HOXD10-3′UTR and pmirGLO-HOXD10-3′UTR-mut with a substitution of four nucleotides within the miR-10b binding site (Figure  4a).

The in vivo mice experiments also proved role of miR-10b in HCC proliferation.

Figure 3 miR-10b increases HCC growth in vivo.

The PCR product was cloned into pcDNA3.1 (Invitrogen) named as pcDNA3.1-miR-10b.

To further investigate the signaling pathway, we measured RhoC, uPAR, MMP-2 and MMP-9 protein expression levels after transfection with miR-10b inhibitor in MHCC-97H cells.

Among these miRNAs, miR-10b is first reported to induce breast cancer cell invasion and metastasis [3], which is also found to be associated with tumor invasive potential in pancreatic cancer [5], glioma [6], nasopharyngeal carcinoma [7], esophageal cancer [8] and neurofibromatosis [9].

Lower panel, diagram of the luciferase reporter plasmids: plasmid with the full length wild-type HOXD10 3′UTR (pmirGLO-HOXD10-3′UTR) insert and plasmid with a mutant HOXD10 3′UTR (pmirGLO-HOXD10-3′UTR-mut) which carried a substitution of four nucleotides within the miR-10b binding site.

These observations indicated a positive role for miR-10b in migration and invasion of human HCC cell lines.

miR-10b promotes HCC cell migration and invasion through the HOXD10/ uPAR/ RhoC/ MMPs pathway.

miR-10b promotes HCC cell proliferation, migration and invasion.

These findings imply that miR-10b might be a valuable candidate for anticancer therapy.

MHCC-97H cells were transfected with anti-miR-10b and nonsense sequence.

The U6 small nuclear RNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA were used as internal controls for miR-10b and other gene mRNA, respectively.

However, the function of miR-10b in HCC cell invasion and metastasis was still unknown.

In this study, we investigated the role and the functional target of miR-10b in human hepatocellular carcinoma.

Figure 2 miR-10b promotes HCC cell migration and invasion.

miR-10b was first discovered initiating breast cancer invasion and metastasis [3].

But the exact function of miR-10b in HCC is still unknown.

3

CSMD1 expression was higher in HepG2 cells transfected with the miR-10b inhibitors, whereas CSMD1 expression was reduced in HepG2 cells transfected with miR-10b mimics We next performed qRT-PCR and found that miR-10b overexpression reduced CSMD1 expression, and conversely, knockdown of miR-10b resulted in increased CSMD1 expression in cultured cells (p < 0.01, Fig.   5b).

CSMD1 expression was higher in HepG2 cells transfected with the miR-10b inhibitors, whereas CSMD1 expression was reduced in HepG2 cells transfected with miR-10b mimics We next performed qRT-PCR and found that miR-10b overexpression reduced CSMD1 expression, and conversely, knockdown of miR-10b resulted in increased CSMD1 expression in cultured cells (p < 0.01, Fig.   5b).

In vitro, overexpression of miR-10b enhanced HCC cell viability, migration, and invasion; whereas, downregulation of miR-10b expression suppressed these properties in HCC cells.

miR-10b overexpression decreased CSMD1 expression; miR-10b knockdown increased CSMD1 expression in cultured cells c Immunocytochemistry.

As expected, CSMD1 expression was higher in HepG2 cells transfected with the miR-10b inhibitors, whereas CSMD1 expression was reduced in HepG2 cells transfected with miR-10b mimics (Fig.   5c, p < 0.01).

We showed that miR-10b is overexpressed in HCC tissues and miR-10b mimics promoted HCC cell viability and invasion via targeting CSMD1 expression.

miR-10b overexpression markedly suppressed luciferase expression in HepG2 cells transfected with pMIR-CSMD1-3’-UTR-WT but not pMIR-CSMD1-3’-UTR-mut1.

Our study demonstrates that CSMD1 is indeed a direct target of miR-10b in HCC, and miR-10b can mediate an oncogenic effect in HCC by targeting CSMD1.

We therefore performed a luciferase reporter assay to confirm the binding ability of miR-10b to CSMD1 cDNA and found that miR-10b overexpression markedly suppressed luciferase expression in HepG2 cells transfected with pMIR-CSMD1-3’-UTR-WT but not pMIR-CSMD1-3’-UTR-mut1 (Fig.   5a).

miR-10b mimics induced nearly complete wound healing by 48 h, while the mnc group did not demonstrate any healing at 72 h. miR-10b inhibitors or inhibitor negative control (inc) did not induce wound healing at 72 h, but the inc group healed better compared to the inhibitor group.

miR-10b mimics induced wound healing at 48 h, while the mnc group did not demonstrated wound healing at 72 h. miR-10b inhibitors and inc did not induce wound healing at 72 h, but the inc group demonstrated better wound healing compared to the inhibitors We next performed bioinformatics analyses using online tools of TargetScan, PicTar, miRanda, RNAhybrid, or DIANA-microT, and then identified two miR-10b binding sites in the CSMD1 3’-UTR: 707–713 and 2158–2164.

Our findings suggest that miR-10b acts as an oncogene by targeting the tumor suppressor gene, CSMD1, in HCC.

To test the oncogenic activity of miR-10b in HCC, we transfected hsa-miR-10b mimics (10b-m), mimics negative control (mnc), hsa-miR-10b inhibitors (10b-i), or inhibitors negative control (inc) into HepG2 cells (Fig.   2).

HepG2 cells were transfected with hsa-miR-10b mimics (10b-m), mimics negative control (mnc), hsa-miR-10b inhibitors (10b-i), or inhibitors negative control (inc).

Further, overexpression of miR-10b inhibited tumor cell apoptosis.

10b-m, mnc, Hsa-miR-10b inhibitors (10b-i), inhibitors negative control (inc) as well as CSMD1 siRNA were obtained from GenePharma (Shanghai, China).

We transfected hsa-miR-10b mimics (10b-m), mimics negative control (mnc), hsa-miR-10b inhibitors (10b-i), or inhibitors negative control (inc) into HepG2 cells.

In addition, the wound healing ability of cells overexpressing miR-10b was significantly higher compared to the cells with knockdown of miR-10b expression.

HepG2 cells were transfected with hsa-miR-10b mimics (10b-m), mimics negative control (mnc), hsa-miR-10b inhibitors (10b-i), inhibitors negative control (inc).

Knockdown of CSMD1 expression enhanced invasion of HepG2 cells To investigate the role of miR-10b in HCC, we first assessed the expression level of miR-10b in 45 primary HCC and adjacent matched tissues.

miR-10b transfected cells exhibited lower rates of cell death (0.48 % of early apoptotic cells and 0.27 % of late apoptotic cells) compared to their negative control transfected counterparts (1.24 % of early apoptotic cells, 1.24 and 0.91 % of late apoptotic cells; p < 0.01) Next, we assessed the effects of miR-10b on cell migration and invasion in HepG2 cells by overexpressing miR-10b mimics, and using inhibitors of miR-10b as well as their respective negative controls.

Furthermore, CSMD1 participates in endothelial-to-mesenchymal transition (EndoMT), is a direct target of miR-10b [10, 22].

Up-regulation of miR-10b has been shown to promote invasion and metastasis in breast cancer and esophageal cancer [14, 16].

In contrast, tumor cell migration and invasion were reduced by 40 %, respectively (p < 0.01, Fig.   4a- b), after knockdown of miR-10b expression.

A previous study using Agilent human miRNA microarray detected significant upregulation of miR-10b in HCC tissues [15].

HCC cell lines were used to assess the effects of miR-10b mimics or inhibitors on cell viability, migration, invasion, cell cycle distribution, and colony formation.

Previous studies showed that miR-10b was overexpressed in a variety of human cancers, such as breast cancer, malignant glioma, nasopharyngeal carcinoma, pancreatic cancer, and HCC [10– 14].

After transfection of 10b-m, the expression of mir-10b was significantly increased, whereas 10b-i elicited the opposite result Fig. 3Effects of miR-10b on HepG2 cell viability, colony formation, and apoptosis.

These data indicate that miR-10b expression is elevated in HCC.

Immunocytochemical, immunohistochemical, and qRT-PCR data indicated that miR-10b decreased CSMD1 expression in HCC cells.

Indeed, qRT-PCR data confirmed miR-10b expression in xenografts (Fig.   6b).

In conclusion, we analyzed miR-10b expression in HCC tissue samples and investigated its effects on cells and found that overexpression of miR-10b enhanced HCC cell viability, migration, and invasion.

CSMD1 is a gene target of miR-10b in HCC cells.

Fig. 1Overexpression of miR-10b in HCC tissues and cells.

Among them, miRNA-10b (miR-10b) has been reported to be highly expressed in many types of human cancers, such as breast, pancreatic, and nasopharyngeal cancers, malignant glioma, and HCC [10– 14].

These data indicate that miR-10b overexpression promotes tumor cell viability and migration (p < 0.01, Fig.   4c).

Next, these RNA samples were amplified using an ABI 7500 fast Real-Time PCR system (ABI, Foster city, CA, USA) and U6 RNA was used as an internal control for miR-10b expression.

Expression of CSMD1 mRNA after transfection with hsa-miR-10b mimics (10b-m) or hsa-miR-10b inhibitors (10b-i) was measured by qRT-PCR in HepG2.

Overexpression of miR-10b in HCC tissues and hepatoma cell lines.

In this study, we obtained paraffin blocks from each patient and isolated total cellular RNA for detection of miR-10b expression.

miR-10b inhibitors reduced the rate of colony formation by 17.5 and 4.25 %, respectively (p < 0.01).

Liao CG, Kong LM, Zhou P, Yang XL, Huang JG, Zhang HL, et al. miR-10b is overexpressed in hepatocellular carcinoma cell proliferation, migration and invasion through RhoC, uPAR and MMPs.

Other studies have shown that miR-10b induces invasion of breast cancer through targeting E-cadherin, and Syndecan-1 [19, 20].

Our findings are consistent with previous observations regarding the effects of miR-10b overexpression.

This study assessed expression and the oncogenic activity of miRNA-10b (miR-10b) in HCC.

miR-10b expression was nearly 3-fold higher in HepG2 compared to HL-7702 cells In HCC cell lines, miR-10b expression was almost 3-fold higher in HepG2 cells compared to HL-7702 cells.

In contrast, miR-10b inhibition reduced cell viability.

Some studies have revealed that miR-10b promotes metastasis of glioma cells through regulation of HOXD10, Bim, TFAP2C, P16, and P21 [13, 18].

Bioinformatics and luciferase reporter assay demonstrated that CSMD1 was the target gene of miR-10b.

The expression level of miR-10b was significantly increased in tumor tissues compared to normal liver tissues.

miR-10b mimics led to over 50 % increase in cell invasion capacity, whereas knockdown of miR-10b reduced invasion by 40 %.

miR-10b mimics led to a 2-fold increase in cell migration, whereas knockdown of miR-10b reduced migration by 40 %.

Fig. 6Effects of miR-10b on regulation of tumor cell xenograft growth.

Similarly, miR-10b expression was nearly 3-fold higher in HepG2 cells compared to HL-7702 cells (Fig.   1b).

Consistent with previous reports, our current study showed that miR-10b was overexpressed in HCC tissue samples compared to adjacent non-tumor tissues and in a HCC HepG2 cell line.

Liu Y, Zhao J, Zhang PY, Zhang Y, Sun SY, Yu SY, et al. MicroRNA-10b targets E-cadherin and modulates breast cancer metastasis.

miR-10b was highly expressed in HCC tissues compared to normal tissues.

The results demonstrated that the expression level of miR-10b was higher in HCC samples compared to adjacent non-tumor tissue samples (−1.4590 ± 0.69542 vs.

The results showed that the miR-10b inhibitor reduced the rate of colony formation by 17.5 and 4.25 % respectively in colony formation and soft agar colony formation assays (p < 0.01, Fig.   3b).

Luciferase assay was used to assess miR-10b binding to the 3’-untranslated region (3’-UTR) of CSMD1.

These findings provide important information toward the goal of developing miR-10b and CSMD1 as promising candidates for effective HCC therapeutic strategies.

HepG2 cells were co -transfected with pMIR/CSMD1 3’-UTR or mutated pMIR mu-CADM1 3’-UTR plus miR-10b mimics or negative control (NC).

miR-10b enhances HCC cell viability and colony formation but reduces apoptosis.

Bioinformatics analyses revealed that there are two binding sites for miR-10b in the CSMD1 3’ UTR: 707–713 and 2158–2164.

Following 2 weeks, 50 μl miR-10b mimics or negative control (NC) were injected into the tumor lesion every 3 days (Riobobio, Guangzhou, China).

The data showed that miR-10b injection promoted growth of tumor cell xenografts in nude mice (Fig.   6a).

In this study, we assessed miR-10b expression in HCC and then investigated its oncogenic activity and the underlying molecular mechanisms in HCC cells.

a miR-10b injection promoted xenograft growth in nude mice.

Previous studies have shed light on the relationship between miR-10b and cancer.

b The relative levels of miR-10b expression in xenografts and nude mouse liver tissues were measured by qRT-PCR.

miR-10b is located in the HOX gene cluster on chromosome 2, suggesting that it is closely related to tumor invasion and metastasis.

To investigate the role of miR-10b in HCC, we first assessed the expression level of miR-10b in 45 primary HCC and adjacent matched tissues.

In our study, we further explored the molecular mechanism between miR-10b and CSMD1.

b The relative levels of miR-10b expression in normal human hepatocytes and HepG2 cells were measured using qRT-PCR.

In our current study, we found that miR-10b also enhanced HepG2 cell migration and invasion in vitro.

miR-10b mimics increased cell viability after 24–72 h of transfection.

We found that miR-10b mimics led to a 2-fold increase in cell migration and over 50 % increase in cell invasion capacity.

Hepatocellular carcinoma miR-10b CSMD1 Oncogene Hepatocellular carcinoma (HCC) is a significant health problem, contributing to more than 600,000 cancer-related deaths globally each year.

In HCC, miR-10b induces cell invasion by modulating RhoC, uPAR, MMP-2, and MMP-9 via HOXD10 [21].

miR-10b agomir or agomir negative control (NC) were injected into tumor lesions.

Fig. 4Effects of miR-10b on HCC cell migration and invasion.

These results demonstrate that miR-10b binds to the 707–713 site but not the 2158–2164 site of the CSMD1 3’-UTR.

Forty-five paired human HCC and adjacent non-tumor tissues were collected for qRT-PCR and immunohistochemistry analysis of miR-10b and CUB and Sushi multiple domains 1 (CSMD1), respectively.

HepG2 cells were cultured in 24-well plates and transiently transfected with 100 ng pMIR-CSMD1 or pMIR-CSMD1-mut vector and 50 pmol hsa-miR-10b mimics (10b-m) or mimics negative control (mnc) using Lipofectamine 2000 (Invitrogen).

As shown in Fig.   3a, miR-10b mimics increased cell viability after 24–72 h transfection.

a Relative levels of miR-10b expression in HCC tissues (n = 45) and normal liver tissue (n = 45) were measured using qRT-PCR.

HepG2 cells were seeded and transiently transfected with miR-10b or NC for 24 h. After cells reached approximately 100 % confluency, a linear wound was made across the confluent cell layer using 200 μl pipette tips.

Taken together, our data are consistent with previous findings showing that miR-10b promotes HCC metastasis [17], which suggests that miR-10b exerts oncogenic activity in HCC.

miR-10b promotes xenograft growth in nude mice.

HepG2 cells were seeded and transiently transfected with miR-10b or NC for 24 h. For flow cytometry, cells were collected and stained with the Annexin V-PE/7-AAD apoptosis detection kit (KeyGEN, Nanjing, China) or cell cycle detection kit (KeyGEN) according to the manufacturer’s instructions.

Usually, the in vivo half-life of miR-10b mimics is short; thus, we used a miR-10b agomir, a synthetic modified miR-10b analogue with a long in vivo half-life.

HepG2 cells were seeded and transiently transfected with miR-10b or NC for 24 h. 200 cells were then seeded into 60 mm dishes and grown for 2 weeks.

We analyzed the clinicopathological data from these patients to further determine if there was an association between miR-10b and CSMD1.

miR-10b promotes HCC cell migration and invasion.

Injection of miR-10b mimics into tumor cell xenografts also promoted xenograft growth in nude mice.

4

Hierarchical clustering of the differentiated expressed genes (DEGs) showed that the DEG expression patterns were quite similar regardless of whether miR-10a or miR-10b was overexpressed in GCs, implying similar functions for miR-10a and miR-10b in GCs (Fig. 4B).

To determine whether BDNF was direct target of miR-10a and miR-10b, the putative miR-10 target 3′ UTR was cloned into a reporter plasmid downstream of a luciferase gene (Fig. 5F).

To summarize, these results showed that FSH, FGF9 and TGF pathway signalling could inhibit miR-10a and miR-10b expression in hGCs, mGCs and rGCs, which suggests that the FSH/FGF9 and TGF-β pathway may function as an upstream regulator of miR-10a and miR-10b in GCs; these effects were conserved among different species (Fig. 3D).

Similar to GCs overexpressing the miR-10 family, proliferation was inhibited (Fig. 6A) and apoptosis was induced (Fig. 6B) upon BDNF knockdown.

To further identify the associated pathways and direct targets of miR-10a and miR-10b in GCs, RNA-seq was performed for miR-10a/b -overexpressing granulosa cells (Fig. 4A).

In conclusion, we found that miR-10 family members, including miR-10a and miR-10b, are expressed at basal levels in GCs but are highly expressed in theca and stroma cells within the ovary.

miR-10a and miR-10b directly targeted BDNF in GCs, suggesting that the miR-10 family might also affect other normal ovary functions apart from GC development.

Here, we demonstrated that two members in the miR-10 family, miR-10a and miR-10b, function as anti-proliferation and pro-apoptosis factors in human, mouse and rat GCs by directly targeting the 3′ UTR of BDNF in GCs.

Gene ontology results suggested that miR-10a and miR-10b target genes were highly related to cell growth, proliferation, development and reproduction (Fig. 4C and Supplementary Fig. 1D).

miR-10a and miR-10b expression in granulosa cells is regulated by extrinsic/intrinsic signals.

BDNF is a direct target of the miR-10 family in granulosa cells.

To prove that the downstream target of the miR-10 family, BDNF, could mediate the function of the miR-10 family in GCs, shRNA was used to knockdown BDNF in GCs (Supplementary Fig. 1G).

These results indicated that BDNF was a direct target of miR-10a and miR-10b in GCs.

Using fluorescence in situ hybridization (FISH), both miR-10a and miR-10b were shown to be expressed in mouse and rat GCs (Fig. 1C and Supplementary Fig. 1C).

miR-10 family expression in normal and atretic granulosa cells.

miR-10 family expression was abundant in the remaining GCs in atretic follicles (Fig. 1F).

A putative miR-10 binding site in the BDNF 3′-untranslated region (UTR) was also identified (Fig. 5B).

By using RNA-seq and qPCR, miR-10a and miR-10b were shown to inhibit many key genes within the TGF-β pathway, including ligands, receptors and transcription factors.

To further confirm that the anti-proliferative and pro-apoptotic functions of the miR-10 family in GCs are at least partially via BDNF, recombinant BDNF was used to treat miR-10a/b -overexpressing GCs.

By using RNA-seq screening, bioinformatics prediction, qPCR, Western blot analysis, luciferase reporter assays and FISH-IF validation, BDNF was identified as a direct target of the miR-10 family in GCs.

As validated by, BDNF was inhibited at the mRNA by the miR-10 family in GCs (Fig. 5D).

The opposite expression patterns for BDNF and the miR-10 family in GCs further indicated the repressive effect of miR-10a/b on BDNF (Fig. 5C).

MiRNAs are small non-coding RNAs that repress mRNA translation at the post-transcriptional level 7. Many miRNAs that share a common “seed sequence” form a family and are located on different chromosomes in the genome; one such example is the miR-10 family, which is a highly conserved family among different species.

As shown in Fig. 3B, treatment with these TGF-β superfamily ligands inhibited miR-10a and miR-10b in GCs.

In this study, we found that these critical regulatory factors could repress miR-10a and miR-10b in granulosa cells, further indicating the negative roles of the miR-10 family during folliculogenesis.

Both miR-10a and miR-10b could repress proliferation and induce apoptosis in human, mouse and rat granulosa cells, at least partly through repressing BDNF by directly binding to its 3′ UTR.

Taken together, these results suggest that miR-10a and miR-10b might play a negative role in follicle development.

How to cite this article: Jiajie, T. et al. Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells.

However, the function of the miR-10 family is still unknown in other species, such as humans, mice and rats.

The general function of the miR-10 family in granulosa cells.

As expected, BDNF could rescue GC apoptosis caused by miR-10a and miR-10b mimic transfection (Fig. 6D).

miR-10 family members repressed proliferation and induced apoptosis in granulosa cells.

miR-10a and miR-10b mimic treatment significantly reduced the viability of human, mouse and rat GCs (Fig. 2A).

The miR-10 family has two members, miR-10a and miR-10b.

In contrast, apoptosis was induced by miR-10a and miR-10b in GCs of different species (Fig. 2C).

Taken together, the results showed that BDNF could at least partially mediate the function of the miR-10 family in GCs.

Some essential genes in this pathway, including ACVR2A, ACVR2B, SMAD1, SMAD3, BMP4 and AMH, were significantly repressed by both miR-10a and miR-10b in GCs (Fig. 4E).

We also identified six asymmetric bulges in the structures of the hsa-miR-10a and hsa-miR-10b duplexes (Fig. 1B).

BDNF rescues miR-10 family-caused effects in GCs.

BDNF rescues miR-10a- and miR-10b -induced proliferation repression and apoptosis induction in GCs.

It was also reported that miR-10 could repress proliferation in porcine granulosa cells 19.

These data confirmed that the miR-10 family simultaneously represses proliferation and induces apoptosis in GCs; this effect is conserved among humans, mice and rats.

HEK293T cells grown in 24-well plates were transfected with 50 nM miR-10a and miR-10b mimic (GenePharma, China) and 100 ng of pmirGLO vector (Promega, USA) tagged with either a BDNF 3′ UTR that includes the miR-10 binding sites or the empty plasmid using Lipofectamine 2000 (Invitrogen, USA).

The nucleotide sequence of the miR-10a and miR-10b precursors are highly conserved in mammals (Fig. 1A).

Both miR-10a and miR-10b gradually decreased during follicle maturation (Fig. 1D) and increased by follicle atresia, as determined by (Fig. 1E).

BMP4 and BMP15 are from the BMP family, and Activin A is a member of the Activin family, and all are components of the TGF-β pathway 23, suggesting that the TGF-β signalling pathway might also repress the miR-10 family in GCs.

Moreover, the miR-10 family and the TGF-β pathway form a negative feedback loop in GCs.

This study provides new insights into how the miR-10 family functions in the female reproductive system.

These results indicate that the miR-10 family has similar functions in GCs in different species.

miRCURY LNA miRNA detection probes for miR-10a and miR-10b were purchased from Exiqon (613307–310 and 613028–310, respectively; Vedbaek, Denmark).

The seed region (UCAAGUA) of miR-10 is conserved among vertebrate species.

As expected, the mediator of FSH in GCs, cAMP, also greatly repressed miR-10a and miR-10b in GCs (Fig. 3A).

miR-10 family is highly conserved among different species.

Consistent with these observations, our data showed that the miR-10 family decreased proliferation and induced apoptosis in granulosa cell.

Identification of miR-10a and miR-10b in granulosa cells.

By using Ki-67 staining, the proliferation of GCs was also found to be repressed by the miR-10 family (Fig. 2B).

Effects of exposure to hormone and growth factors on miR-10a and miR-10b in granulosa cells.

The effect of the miR-10 family on GCs on a transcriptome-wide scale.

miR-10 was identified as a specific marker for mouse granulosa cells from previous miRNA-sequencing results 17.

The results showed that FGF9 could also greatly repress the miR-10 family in GCs (Fig. 3A).

The mature hsa-miR-10a-5p and hsa-miR-10b-5p sequences are UACCCUGUAGAUCCGAAUUUGUG and UACCCUGUAGAACCGAAUUUGUG, respectively, and have only one different nucleotide.

To further explore whether BDNF mediates the function of the miR-10 family in GC apoptosis, GCs were co -treated with miR-10 family mimics in the presence of recombinant BDNF or vehicle control.

All of the cells were transfected with 20 nM of either miR-10a or miR-10b mimic (GenePharma) using the Lipofectamine RNAiMAX transfection reagent and Opti-MEM medium (Life Technologies) according to the manufacturer’s instructions.

Additionally, many hormones and growth factors in the ovary repressed the miR-10 family in GCs.

These results indicate that the miR-10a and miR-10b precursors and mature sequences are highly conserved and might have similar functions in mammals.

Follicle-stimulating hormone (FSH) could stimulate granulosa cells to convert androgens to oestradiol via aromatase 20 and maintain GC proliferation and maturation 21. miR-10a and miR-10b were significantly decreased by recombinant human FSH in hGCs, mGCs and rGCs (Fig. 3A).

These results indicate that autocrine and/or endocrine signals from hormones or growth factors during granulosa cell differentiation are involved in repressing the miR-10 family in GCs.

The results showed that both the miR-10a and miR-10b mimics repressed the fluorescence from the 3′ UTR compared with the negative control, indicating that miR-10a and miR-10b could directly bind to the BDNF 3′ UTR.

Considering that TGF-β superfamily ligands could greatly repress the miR-10 family in GCs, this result suggests that the miR-10 family and the TGF-β pathway might be involved in a negative feedback loop.

miR-10a and miR-10b repress proliferation and induce apoptosis in human, mouse and rat granulosa cells.

Based on small RNA-seq from a previous study, miR-10 is a specific marker for mouse granulosa cells 17.

Both miR-10a and miR-10b were induced by TGF-β1 in GC.

5

miR-10b is expressed in a similar temporal and spatial pattern as the Hoxd4 P2 transcripts in the developing E9.5 mouse embryo, with an anterior expression border that is considerably posterior to the r6/7 anterior expression border [23], [26].

The expression profiles of Hoxd4 and miR-10b during P19 differentiation as measured by qRT-PCR are similar, with low basal expression levels in undifferentiated P19 cells and strong induction of their expression upon neural differentiation, peaking at day 3 or 4 and declining thereafter.

Such an arrangement would facilitate the co-regulated expression of both Hoxd4 and miR-10b during development, as activation of the P2 promoter would lead to production of both miR-10b and HOXD4.

In situ hybridizations with both the P1 and P2 ex 1–3 probes showed an expression domain that is posterior to the r6/7 boundary, similar to the expression domain of mature miR-10b in the E9.5 embryo.

miR-10a and miR-10b are expressed in the central nervous system and trunk in a sub-domain of the Hoxb4 and Hoxd4 expression domains.

Drosha-cleaved Hoxd4 P1 and P2/pri- miR-10b transcripts are all expressed posterior to the rhombomere 6/7 boundary in the mouse embryoUsing a probe against the Hoxd4 5′ coding and non-coding region (P1+P2 ex5, Fig. 4A), Hoxd4 transcripts have been shown to have an anterior expression boundary between r6 and r7 within the developing hindbrain of mice.

The expression of Hoxd4 and miR-10b is co-ordinately regulated in differentiating P19 cellsTo determine if the expression of pri- miR-10b is controlled by the Hoxd4 neural enhancer, the relative levels of Hoxd4 P1, P2 and miR-10b transcripts were measured in differentiating P19 mouse EC cells.

When compared to the Hoxd4 P1 and P2 transcripts, we observed that the miR-10b peaked a day later, on day 4. This delay in the expression peak may reflect differences in processing or stability; however, the overall expression profile is similar.

The expression of Hoxd4 and miR-10b is co-ordinately regulated in differentiating P19 cells.

miR-10b is found 5′ to Hoxd4 and regulates metastasis and cell migration in human breast cancer cells via suppression of Hoxd10 [14]– [16].

These data are consistent with a role for the Hoxd4 3′ neural enhancer in directing expression of both Hoxd4 and miR-10b transcripts.

This is supported by in situ data that showed an extensive overlap of mature miR-10b and Hoxd4 expression both spatially and temporally [23], [26].

0025689.g002 Figure 2Expression profiles of Hoxd4 P1, P2 and miR-10b in differentiating P19 cells.

However, miR-10b and Hoxd4 P2 and P1 transcripts are not detected in the anterior-most Hoxd4 expression domain up to r6/7 [26].

Expression profiles of Hoxd4 P1, P2 and miR-10b in differentiating P19 cells.

The coordinated regulation of both genes suggests that they may have shared functions during early development such as has been described for the shared repressive functions of the miR-10 family and hoxb4 in zebrafish [35].

Drosha-cleaved Hoxd4 P1 and P2/pri- miR-10b transcripts are all expressed posterior to the rhombomere 6/7 boundary in the mouse embryo.

miR-10b expression was induced together with Hoxd4 P1 and P2 transcripts and likewise peaked on day 4 (D4).

In zebrafish, miR-10b is expressed in the spinal cord with an anterior boundary somewhat posterior to the r6/7 boundary [35].

First, a P1 probe was designed to be just downstream of miR-10b and spanning the 5′ untranslated region (5′ UTR) of the Drosha-cleaved P1 transcripts (probe name  =  P1, Fig. 4A).

In a fashion similar to the Hoxd4 transcripts, the miR-10b transcripts were first expressed at very low levels in undifferentiated cells and were then strongly induced upon RA treatment and aggregation, peaking at day 4 (Fig 2, miR-10b at D4).

Second, expression of the Hoxd4/miR-10b transcript may be dependent on the neural enhancer located 3′ to the Hoxd4 coding region.

In summary, miR-10b expression was shown to be induced together with Hoxd4 P1 and P2 transcripts during P19 differentiation.

miR-10b is found directly upstream of the P1 promoter, in intron 4 of the P2 transcript.

Our data are therefore consistent with both Hoxd4 and miR-10b transcripts coming under the control of this same regulatory region.

A shared promoter and common regulatory elements for Hoxd4 and miR-10b A significant majority of human miRNAs resides in intronic regions and in the same orientation as the host coding genes [42].

A shared promoter and common regulatory elements for Hoxd4 and miR-10b.

We conclude that Hoxd4 P1 transcripts are indeed the result of Drosha cleavage of the pri- mir-10b transcript and, contrary to our previous interpretation [26], are not generated by transcriptional initiation from a distinct promoter, but by the action of Drosha on transcripts initiated at the P2 promoter.

This is consistent with our observation that transcripts initiating at Hoxd4 P2 have the potential to encode both miR-10b and HOXD4.

This is within a single nucleotide of the previously mapped P1 start site (a cluster of 4 nt underlined and denoted “P1” on pri- miR-10b).

Similar to miR-10b and Hoxd4, miR-10a is located in a conserved position 5′ to Hoxb4 (Fig. 1A).

For example, both the position and sequence of the miR-10 family are conserved in Drosophila, ancestral vertebrates, teleosts and mammals [10]– [12].

Black arrows show the Drosha cleavage sites on the pri- miR-10b/a hairpin.

The 5′ ends of all four clones began with 5′-TATGG-3′, mapping precisely to the predicted Drosha cleavage site on the pri- miR-10b transcript, 11 nt from the base of the pri-miRNA stem junction [41].

Drosha cleavage of the Hoxb4/ pri-miR-10a transcript generates similar uncapped Hoxb4 transcriptsSimilar to miR-10b and Hoxd4, miR-10a is located in a conserved position 5′ to Hoxb4 (Fig. 1A).

There are three known microRNAs or miRNA families embedded in vertebrate Hox clusters: miR-10, miR-615 and miR-196 (Fig. 1A).

The location of mouse miR-10b immediately adjacent to the presumptive P1 transcriptional start site and within the intron separating exons 4 and 5 of the P2 transcript (Fig. 1B) raised several questions regarding Hoxd4 and the biogenesis of miR-10b.

qPCR analysis showed that both miR-10a and Hoxb4 transcripts are induced in a similar manner to miR-10b and Hoxd4 transcripts during RA -induced P19 neural differentiation (unpublished observations).

The non IRES Reporter plasmid was made by cloning a 3.2 kb fragment amplified from PSNlacZpA (Zhang et al. 2000) starting from the Hoxd4 ATG start codon and extending throughout the entire lacZ coding sequence into SpeI and PmeI sites in the pMIR-REPORT Luciferase plasmid from the PSNlacZpA (Zhang et al. 2000) starting from approximately 140 bp upstream from the Drosha cleavage site of miR-10b to the sequence just 5′ of the Hoxd4 ATG start codon into SpeI sites in the non IRES Reporter plasmid.

The nucleotides in red show the miRNA duplex formed by the mature miR-10b/a (top strand) and miR-10b/a* (bottom strand) sequence.

In other words, pri- miR-10b and the Hoxd4 P2 transcript are one and the same.

Together, these observations suggest that P1 transcripts are generated by Drosha cleavage of the primary microRNA for miR-10b.

All Hoxd4 P1, P2 and miR-10b transcripts were barely detectable in undifferentiated P19 cells (Fig 2, P1, P2, miR-10b at 0 h).

The zebrafish miR-10 family is also found to repress hoxb1a and hoxb3a within the spinal cord in cooperation with hoxb4a [35].

We have established that the 5′ ends of Hoxd4 P1 transcripts are not capped, bear a terminal phosphate and map to the predicted Drosha cleavage site at the base of the stem of the pri- miR-10b stem-loop.

Distribution of Hoxd4/miR-10b transcripts along the embryonic AP axis.

A similar situation exists in mouse where a long-range Hoxd3 transcript initiated from the Hoxd4 P2 promoter has the potential to code for miR-10b as well (NM_010468).

The most likely origin for pri- miR-10b is a transcript initiating at P2 (Fig. 1B).

First, P2 may serve to encode both HOXD4 and miR-10b.

To determine if the expression of pri- miR-10b is controlled by the Hoxd4 neural enhancer, the relative levels of Hoxd4 P1, P2 and miR-10b transcripts were measured in differentiating P19 mouse EC cells.

In other words, the Hoxd4 P2 transcript could also serve as the primary miR-10b transcript that is the substrate for processing by Drosha.

The remaining two miR-10 family members, miR-10c and miR-10d, are located at homologous positions near sites from which 4 [th] group paralogs have been lost in the HoxBa and (vestigial) HoxDb clusters [48].

P1, P2 and nestin were normalized to 18S RNA ; miR-10b was normalized to U6 snoRNA.

0025689.g004 Figure 4Distribution of Hoxd4/miR-10b transcripts along the embryonic AP axis.

In the zebrafish genome, three miR-10 members, miR-10b-1, miR-10b-2, and miR-10c, are positioned upstream of the Hox group 4 paralogs hoxd4a, hoxc4a and hoxb4a, respectively [48].

In mammals, the sequence of mature miR-10a and miR-10b differs by a single nucleotide.

The cleavage site is exactly 11 bp from the bottom of both the pri- miR-10b and pri- miR-10a stem junction on the downstream side.

A miR-10 family member is embedded 5′ to the coding region of each of these Hox genes.

The relationship between the miR-10 family and Hox4 genes is surprisingly well conserved through evolution.

6

Thus, we analyzed the key targets for miR-21, i. e. PTEN, and PDCD4; and the key target for miR-10b, i. e. HOXD10 and other apoptotic targets such as Caspase-3, all to confirm translational silencing when using antagomiR-21 and antagomiR-10b delivered through targeted and non -targeted nanoparticles, with and without TMZ treatment.

HOXD10 has been reported as a direct target of miR-10b in human breast and esophageal cancers and its downregulation in GBM has been shown to affect cell invasion, tumor proliferation, and migration [15, 36, 37].

Indeed, previous cell culture studies have demonstrated non -targeted PLGA nanoparticles to be efficient nanocarriers for intracellular delivery and subsequent sustained release of antagomiR-21 and antagomiR-10b, leading to prolonged suppression of endogenous oncomiR functions in U87MG, Ln229, and T98G GBM cells in which baseline elevated expression of miR-21 and miR-10b was shown [15].

We evaluated the mRNA expression of PTEN, PDCD4, HOXD10, and p53 as indicators of miR-21 and miR-10b suppression in U87MG cells after co- delivering antagomiR-21 and antagomiR-10b using cRGD -targeted and non -targeted PLGA-PEG nanoparticles, with and without TMZ treatment.

The qRT-PCR and immunoblot assays performed on the key targets of miR-21 and miR-10b reveal increased expression of PTEN, PDCD4, and CASP3 in U87MG cells treated with targeted nanoparticles, when compared with non -targeted nanoparticles.

MiR-10b has been found to regulate the expression of RhoC and uPAR via targeting the transcription factor HoxD10 [14].

qRT-PCR analysis detects the modulation of downstream target genes of miR-21 and miR-10b expression in cells treated with PLGA-PEG nanoparticles.

Thus, targeting miR-10b results in increased expression of HOXD10 [36].

Immunoblot analysis detects the modulation of downstream target genes of miR-21 and miR-10b expression in cells treated with PLGA-PEG nanoparticles.

To further validate the antiproliferative and chemosensitive effects of targeted and non -targeted nanoparticles plus the subsequent effects with TMZ treatment, we evaluated the downstream key targets for miR-21 and miR-10b, such as PTEN, PDCD4, HOXD10, and p53.

Another microRNA, miR-10b is also overexpressed in GBM and increases the invasive capabilities of these high-grade tumors.

Indeed, inhibition of miR-21 and miR-10b has also been found to induce cell cycle arrest and reduce migration and apoptosis [15, 16], and enhance response of GBM cells to TMZ [17, 18].

Therefore co -inhibition of miR-21 and miR-10b enhances the sensitivity of GBM cells towards subsequent TMZ, but the significant antiproliferation effect occurs after TMZ treatment only.

This result is in agreement with previous findings establishing that co -inhibition of miR-21 and miR-10b enhances the sensitivity of GBM cells to subsequent TMZ treatment.

Thus, targeting miR-21 and miR-10b using antisense microRNAs (antagomiRs) may represent a useful anticancer molecular therapy for GBM.

In our study, owing to the low endogenous levels of miR-10b in cells, we do not see any significant differences in the relative gene expression of HOXD10.

HoxD10 is an important indicator of miR-10b suppression.

There was no significant difference in HOXD10 expression, likely owing to the low copy number of miR-10b in U87MG cells [15].

We performed real-time PCR using 5 μl of cDNA (50 ng of RNA equivalent) combined with TaqMan real-time PCR reagents for targets of miR-21 (PTEN and PDCD4) and miR-10b (HoxD10) and p53 in a total reaction volume of 20 μl.

The endogenous levels of miR-21 and miR-10b are elevated in GBM cells [12], and studies that have targeted these miRNAs using antisense oligonucleotides have disrupted the oncogenic properties of these cells [15, 26, 27].

P53 is known to be a target for miR-21 and miR-10b [22, 23].

MiR10b is also pro-angiogenic; it represses the expression of HOXD10, which is known to exert anti-angiogenic effects.

Similar to previous findings, we attributed the lack of difference in HOXD10 expression to the likely low endogenous levels of miR-10b in U87MG cells (500 to 1,500 copies/cell), as compared to miR-21 (60,000 copies/cell) [15].

7

The link between miR-10b expression and breast cancer cell proliferation is partially attributed to inhibition of the transcription factor TBX5, leading to repression of the tumor suppressor PTEN 9. However, our studies failed to provide clear evidence of TBX5 or PTEN upregulation by inhibition of miR-10b, suggesting that an alternative pathway may be behind the observed therapeutic effect in this mo del (Suppl.

HOXD10 was selected because it is the most well-known direct target of miR-10b 1. Its expression is the only direct method to evaluate successful delivery of MN-anti-miR10b, since inhibition of miR-10b by the therapeutic is achieved through the formation of stable heteroduplexes between the antagomir and miR-10b, hence, the need to use HOXD10 expression as a marker for inhibition of miR-10b.

The direct miR-10b target, HOXD10, was upregulated in the regressing group compared to the non-regressing group, indicating inefficient inhibition of miR-10b in the animals that failed to regress metastases.

By contrast, E-cadherin does not appear to be directly influenced by miR-10b expression, consistent with the literature 8. Whereas E-cadherin expression appeared similar between regressing and non-regressing animals, the expression level of HOXD10 was markedly higher in the regressing animals relative to the animals that failed to regress (Fig. 4 and Suppl.

The specific targeting of the metastatic niche is a function of the therapeutic target, miR-10b.

To further look into the mechanism behind the observed effect mediated by miR-10b inhibition, we analyzed the abundance of additional validated miR-10b targets.

It also proved that in the responding animals, miR-10b was successfully inhibited.

Immunostaining showing the expression of E-cadherin and HOXD10 in lung sections from animals with evidence of metastatic regression and animals that failed to regress lung metastases in response to treatment with MN-anti-miR10b and low-dose doxorubicin.

Fig. 8, all cell lines were associated with nanomolar IC50 values and were highly sensitive to the pro-apoptotic effect of MN-anti-miR10b, suggesting that miR-10b inhibition has a global effect on the viability of human metastatic tumor cells.

This result is consistent with our earlier findings that miR-10b inhibition causes a dramatic reduction in proliferation and increase in apoptosis in metastatic breast cancer cells 4. While the combination treatment with MN-anti-miR10b and low-dose doxorubicin resulted in metastatic regression in 65% of the animals, there was a 35% failure in that group to regress established lung metastases.

This result is consistent with our earlier findings that miR-10b inhibition causes a dramatic reduction in proliferation and increase in apoptosis in metastatic breast cancer cells 4. While the combination treatment with MN-anti-miR10b and low-dose doxorubicin resulted in metastatic regression in 65% of the animals, there was a 35% failure in that group to regress established lung metastases.

This strongly suggested that the failure of some of the animals to regress metastases stemmed from inadequate inhibition of miR-10b by the nanodrug.

These included RHOC 1, PTEN, and TBX5 9. Consistent with the literature, we observed a strong inhibition of the pro-metastatic RHOC in the lungs of animals treated with MN-anti-miR10b and doxorubicin, compared to the control groups (Suppl.

The majority of the animals treated with MN-anti-miR10b and low-dose doxorubicin presented with no evidence of lung macrometastases at necropsy.

As a first step towards developing a therapeutic approach for stage IV breast cancer, we needed to establish delivery of the MN-anti-miR10b nanodrug to distant metastatic sites.

By contrast, in the group treated with MN-anti-miR10b in combination with low-dose doxorubicin, only one animal out of 17, presented with lung metastases and a single bone metastatic lesion (Suppl.

The following treatment groups were used: Group 1: PBS only (n = 3), Group 2: High-dose doxorubicin (n = 6), Group 3: MN-scr-miR with low-dose doxorubicin (n = 13), and Group 4: MN-anti–miR-10b with low-dose doxorubicin (n = 17).

To determine MN-anti–miR-10b accumulation in tissue, the sections were stained using incubation with an anti-firefly luciferase antibody (1:50 dilution; Abcam, Cambridge, MA) at 4 °C overnight, followed by incubation with a Texas Red–conjugated goat anti-rabbit secondary antibody (1:50 dilution, Santa Cruz Biotechnology, Santa Cruz, CA) at room temperature for 1 hour.

By contrast, in the mice treated with the active nanodrug (MN-anti-miR10b) and low-dose doxorubicin, regression of distant metastases was evident by week 6 (Fig. 2a and b and Suppl.

In the present investigation we take advantage of this knowledge and apply the miR-10b -inhibitory nanodrug, MN-anti-miR10b, in a very aggressive mo del of stage IV metastatic breast cancer (4T1 breast adenocarcinoma).

To determine the effect of MN-anti-miR10b on breast cancer cells derived from multiple metastatic sites, the following cell lines were used: human MDA-231-BoM-1833, MDA-231-LM2-4175, and MDA-231-BrM2-831 metastatic to bone, lungs, and brain (kindly provided by Dr.

The 5′-Thiol-Modifier C6 disulfide (5′-ThioMC6) was inserted into both the anti-miR10b and scrambled oligos for conjugation to magnetic nanoparticles.

Therapeutic Effect of the Combination Treatment with MN-anti-miR10b and Low-dose Doxorubicin.

The therapeutic protocol consisted of concurrent injections of MN-anti–miR-10b or MN-scr-miR intravenously (30 mg/kg as iron, 20 mg/kg as oligo), and doxorubicin (intraperitoneally; 2 mg/kg for low-dose or 8 mg/kg for high dose; Sigma, St Louis, MO).

Metastatic burden and survival of mice treated with MN-anti-miR10b and low-dose doxorubicin.

An additional observation that stemmed from these studies was that in the mice treated with MN-anti-miR10b and low-dose doxorubicin, there was a significantly lower incidence of detectable multiple organ metastases at the end-point of the study.

8

Interestingly, intestinal miR-10a expression has previously been shown to be downregulated by microbiota in mice [75], and considering the antibacterial functions of Lpo in innate immunity, it is alluring to suggest that miR-10 could function as the sensor of immune stimuli in this environment where its downregulation would induce Lpo as an antibacterial mechanism in normal epithelium.

Co -expression of miR-10 and Hox genes during development [6], [7] and experimental evidence of miR-10 targeting of HOX transcripts [8]– [10] has suggested a role for this miRNA family in development.

Importantly, both up- and downregulation of miR-10 has been reported in several cancers and although the number of studies where such deregulation was causally linked to the pathogenesis of cancer remains scarce (for a review, see [4]), some miR-10 targets have been demonstrated to be mechanistically linked to metastasis, invasion and migration as well as cell proliferation [9], [10], [13]– [16].

Nevertheless, these results are in agreement with the virtual lack of phenotypic differences upon inhibition or overexpression of miR-10 during zebra fish development [7].

A change in mRNA expression in one cell type could therefore be masked by the lack of change in another, which could be due to alternative miRNA-independent regulations or a potential rescue by miR-10b.

Although adaptation to loss of miR-10a or functional redundancy by the remaining miR-10b could account for the invariable levels of miR-10 intestinal targets in the absence of miR-10a, low levels of mRNA deregulation upon miRNA alterations have been previously observed [39], [40].

Figure S2 miR-10 expression levels in a panel of different organs.

Particular interest in the miR-10 family members arises from their conserved genomic location in Hox clusters and the increasing amount of evidence for their implication in vertebrate biology and human disease [4].

Profiling of WT mouse tissues for miR-10a and miR-10b revealed that miR-10a was relatively highly expressed in the mouse intestinal tract (Figure S2).

The miR-10 miRNA family members are encoded in evolutionarily conserved loci within the Homeobox (Hox) gene clusters of developmental regulators [4], [5].

Mammalian miR-10a and miR-10b are located upstream from HoxB4 and HoxD4 respectively and they present a very high degree of sequence conservation, differing at their eleventh nucleotide only (U and A respectively), which thermodynamically enables them to target a fully overlapping set of mRNAs [11],.

miR-10a (A) and miR-10b (B) expression levels in different organs of B6 mice as detected by qRT-PCR.

Despite the body of evidence suggesting a role for miR-10 in Hox regulation, the miR-10a [−/−] mice showed an absence of major developmental defects in the posterior trunk.

A double inactivation of miR-10a and miR-10b would allow disambiguation of the miR-10 role in mammalian development.

qRT-PCR using specific primers for miR-10b on the same RNA showed no significant difference in the level of this close member of the miR-10 family, suggesting no occurrence of dose -dependent compensation via trans-regulation of miR-10b in the absence of miR-10a (Figure S1D).

internal amplified a 273 bp fragment corresponding to the miR-10 WT allele and 361 bp for the floxed miR-10a KO allele, L_chkinsrtmiR10a.

In the case of miR-10a [−/−] mice, the lack of appreciable phenotypes could be explained by redundancy and functional compensation by miR-10b, which levels remained unaffected in miR-10a KO mice.

Detection of mature miR-10a (C) and miR-10b (D) by qRT-PCR in intestines of miR-10a [+/+] (WT) and miR-10a [−/−] (KO) mice.

9

We found that five miRNAs were significantly upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was significantly downregulated (miR-29b) in aggressive clone compared to non-aggressive one.

Five of these miRNAs were upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was downregulated (miR29-b) in the aggressive S2B11 clone compared to S2D10 (Figure 6A).

MiR-10b is upregulated in DCIS lesions compared to normal breast tissue [23], and miR-10b overexpression is associated with enhanced cell migration and invasion in breast cancer [24].

Knockdown of miR-10b in S2B11 and S2G7 clones decreased significantly the number of migrated cells and overexpressing miR-10b in S2D10 and S2F10 clones caused a significant increase in the number of migrated cells (Figure 6C).

When miR-10b was knocked down in the S2B11 and S2G7 clones, their invasive ability was significantly decreased, whereas upon miR-10b overexpression the invasive capacity of S2D10 and S2F10 clones increased significantly (Figure 6B).

When miR-10b was knocked down in the S2B11 and S2G7 clones, mammosphere formation was significantly decreased, whereas upon miR10b overexpression mammosphere formation increased significantly in S2D10 and S2F10 clones (Figure 6D).

miR-10b increases migration and invasion capacity of aggressive CD49f [+]/CD44 [+]/CD24 [−] single-cell derived clonesTo elucidate the pathways conferring migration and invasion to aggressive CD49f [+]/CD44 [+]/CD24 [−] single-cell derived clones, we used a PCR array to screen miRNAs in aggressive clone that are associated with breast cancer S2B11 and non-aggressive clone S2D10 and identified six miRNAs that were differentially expressed between these clones.

Finally, enhanced expression of K14, ARF6, and miR-10b helps these specific clones for migration and invasion.

HD Fugene (Promega) was used to transfect the cells with shRoR, sponge-miR-10b and RoR and miR-10b overexpressing plasmids.

Based on these previous reports and given that our aggressive S2B11 clone had increased miR-10b expression, we hypothesized that miR-10b might have a key role in maintenance of the aggressive behavior of our clones.

miR-10b is a key regulator for of migration and invasion capacity in aggressive CD49f [+]/CD44 [+]/CD24 [−] single-cell derived clones.

Furthermore, knockdown of miR-10b significantly decreased the invasive capacity of the tumor cells (Figure 7H).

When either RoR or miR-10b was knocked down in primary tumor cells, their migration (Figure 7E and Figure 7G) and mammosphere formation (Figure 7F and Figure 7I) were significantly decreased.

Our data revealed that the more aggressive clones within DCIS cells have lower global DNA methylation compared to less aggressive clones and have enhanced expression of stem-cell, proliferation and invasion related genes and non-coding RNAs including SOX2, OCT4, K14, ARF6, Ki67, RoR and miR-10b.

Next, we wanted to confirm our findings linking RoR and miR-10b to the enhanced self-renewal, migration and invasion of single-cell derived clones in S2B11 primary tumor cells.

We identified lincRNA-RoR and miR-10b as key molecules to increase self-renewal, migratory, and invasive capacities of aggressive clones.

Finally, we wanted to see if miR-10b has also a role in the self-renewal of our aggressive clones.

These results demonstrate that miR-10b enhances the migration and invasion capacity of single-cell derived clones.

miR-10b increases migration and invasion capacity of aggressive CD49f [+]/CD44 [+]/CD24 [−] single-cell derived clones.

pBabe–lincRNA-RoR (plasmid 45763) [19], pBabe-puro-miR-10b sponge (plasmid 25043) [28] and MDH1-PGK-GFP miR-10b (plasmid 16070) [24] were purchased from Addgene.

Consistent with earlier reports, our data confirmed that miR-10b increases the mammosphere formation, migration and invasion ability of the aggressive clones [23, 24].

We first tested whether miR-10b is responsible for the increased invasive capacity of the aggressive clones (Figure 3C).

10

It is reported that miR-10b is down-regulated in breast tumour tissue but over-expressed in patients with metastatic disease burden [16], [17], [18], [19].

The authors acknowledge the limitation of a small number of mice with nodal metastases (n = 3), however despite this the specificity of miR-10b’s role in tumour invasion in this study was further validated by the fact that this up-regulation did not hold true for miR-195,497 and 221.

In contrast to miR-10b however, miR-221 was not seen to be over-expressed in diseased lymph nodes compared to controls.

Tumour induction site influenced expression of miR-10b with significantly higher levels expressed in MFP tumours compared to SC tumour (p<0.05, Figure 2A), with highest detected in malignant lymph nodes (n = 3, p<0.05, Figure 2A).

Moreover it was demonstrated that miR-10b expression was highest in all diseased lymph nodes compared to primary tumour and healthy tissue (p<0.05, p<0.01) respectively.

However in tissue, miR-10b was seen to have a direct relationship with disease progression, but remained undetected in the circulation at all time points examined.

0050459.g002 Figure 2(A) miR-10b expression.

RNA was extracted from cultured MDA-MB-231 cells, reverse transcribed and RQ-PCR carried out targeting miR-195, miR-497, miR-221, and miR-10b.

Unlike miR-10b, miR-221 was readily detectable in the circulation of both diseased and healthy animals.

This metastatic potential of MFP tumours was further highlighted in the study by significantly elevated miR-10b expression relative to SC tumours.

The expression of a panel of breast cancer associated miRNAs (miR-10b, miR-221, miR-195 and miR-497) was examined on the basis of their reported relevance [29], [30].

MiR-10b expression was not detectable in the cells prior to inoculation in vivo.

MiR-10b has previously been highlighted as a potential marker for disease progression and invasion [16], [44], [45], [46].

Interestingly, miR-10b was not detected in the circulation of any animal (healthy or tumour bearing) at any time point highlighting the importance of miR-10b at a tumour micro-environment level rather than in the circulation.

Indeed therapeutic silencing of miR-10b is being investigated as an approach to block or reduce disease metastases.

Multiple studies have also outlined the association of elevated miR-10b as an indicator of poor prognosis and survival prediction [46], [47].

Prior to in vivo inoculation, expression of miR-10, miR-221, miR-195 and miR-497 was investigated in the cultured MDA-MB-231 cell line.

We have established that there was a significant positive correlation between miR-10b and miR -221 in all tissues, which to our knowledge has not been previously documented.

11

A miRNA array analysis revealed that among the miRNAs that are downregulated during osteoblastic differentiation, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a seemed most likely to target the osteogenesis-related transcription factors Dlx5 and Msx2, acting as potential inhibitors of osteogenesis by directly targeting these osteogenesis-related transcription factors.

In our preliminary experiment, transfection of anti-miR-124a and anti-miR-181a did not induce osteoblastic differentiation in mouse iPS cells (data not shown), suggesting that suppression of miR-124a and miR181a, which directly target Dlx5 and Msx2, is not sufficient to induce osteoblastic differentiation of mouse iPS cells, but that suppression of at least one miRNA of miR-10a, miR-10b, miR-9-3p and miR-19b besides miR-124a and miR-181a is required for osteoblastic differentiation.

We focused on the 6 miRNAs, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a that were significantly downregulated during BMP-4 -induced osteoblastic differentiation, and they seemed to target the transcription factors Dlx5 and Msx2 and to be associated with osteoblast differentiation (Table 3).

A miRNA array analysis revealed that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a were significantly downregulated.

0043800.g003 Figure 3 (A) Time course of miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a expression in differentiated iPS cells.

The protocol shown in Fig. 5A was used to induce osteoblastic differentiation with 6 anti-miRNAs (anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-9-3p, and anti-miR-19b) targeting Msx2 or Dlx5 in iPS cells.

Six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a putatively targeted Dlx5 and Msx2 mRNA (Table 3).

Considering the putative target genes in Table 3, miR-10a, miR-10b, miR-19b and miR-9-3p may constitute a control mechanism for Dlx5 and Msx2.

In the present study, we demonstrate that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a miRNAs, especially miR-124a and miR-181a, are important regulatory factors in osteoblastic differentiation of mouse iPS cells.

The miRNA miR10b also may affect BMP, Wnt and FGF signals.

What are functions of these 6 miRNAs including miR-124a, miR-181a, miR-10a, miR-10b, miR-9-3p, and miR-19b in osteoblastic differentiation of mouse iPS cells?

For functional studies examining the effects of the anti-miRNAs on cell differentiation, the mouse iPS cells were transfected on day 1 and day 8 after EB formation with anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p for 72 h, followed by culture in GMEM without osteogenic factor.

0043800.g005 Figure 5(A) Schematic representation of the osteoblast differentiation protocol for iPS cells which were transfected with 6 anti-miRNAs including anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p.

Although it has been reported that a number of miRNAs, miR-204/211 [13], miR-125b [14], miR-133 and miR-135 [15], miR-141 and miR-200a [16], and miR-29b [17], were involved in osteoblastic differentiation, a few papers have been reported with regard to the functions of miR-10a, miR-10b, miR-9-3p and miR-19b.

12

Since we observed miR-10b to be downregulated in male breast cancers, we therefore decided to analyze HOXD10 expression in formalin-fixed paraffin-embedded tissue samples obtained from 10 male breast cancer patients and five gynecomastia patients.

For instance, miR-10b overexpression leads to tumor invasion and metastasis by suppressing HOXD10 and indirectly activating the prometastatic gene RHOC [14].

miR-10b has been previously described as downregulated in female breast cancer compared with normal tissue [10], but it has been also associated with the induction of tumor invasion and metastasis of breast cancer derived cells by targeting HOXD10 [14].

In fact, miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed whereas miR-26b, miR-607 and miR-135b were overexpressed in cancer samples examined, in comparison with the gynecomastia samples.

miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed.

The HOXD10 gene represses the expression of genes involved in cell migration and extracellular matrix remo deling in breast cancer cells, and it is regulated by miR-10b [14].

Other miRNAs similarly altered after the enrichment, such as miR-191, miR-454, miR-10a, miR-374a, miR-10b, miR-218, miR-140-3p and miR-126, were downregulated in cancer.

On the other hand, miR-145 [10, 20], miR-10b [10], let-7g [19], miR-125a-5p [10, 31], miR-125b [31] and miR-126 [40] have been described as downregulated.

Our IHC study supports previous reports on the relationship of miR-10b and miR-126 and their respective gene targets [14, 39].

Previous studies have demonstrated that there is a large number of deregulated miRNAs in human breast cancer (in particular, miR-10b, miR-17-5p, miR-21, miR-27a, miR-27b, miR-125a, miR-125b, miR-126, miR-145, miR-155, miR-200c, miR-206, miR-336 and the let-7 family) [9- 31].

analysisTo confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2).

According to previous reports in female breast carcinogenesis, the most interesting and promising miRNAs of this male breast cancer signature are miR-10b, miR-126, miR-125a-5p and miR-125b [14, 31, 40].

Gee and colleagues, however, showed that miR-10b is not significantly associated with breast cancer metastasis in a large series of early-stage breast cancers [41].

To confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2).

13

For instance, the expression of only 19 out of 156 TargetScan predicted targets were inversely correlated with the expression of miR-10b, and 9 out of 101 for miR-412 (Table 3).

miR-10b, which targets HOXD10, was additionally shown to be down-regulated in all the breast carcinomas from metastasis-free patients [42].

miR-10b, -148a, -150, -199a and -486 were only expressed in normal mammary epithelium and not tumors, suggesting that they may have tumor suppressor activities.

One of these, miR-10b, has been shown to be down-regulated in human breast carcinoma compared to normal breast tissue.

Interestingly, we identified five miRNAs - miR-10b, -148a, -150, -199a and -486 - that are down-regulated in all of the mammary tumors compared to normal mammary gland tissue irrespective of the initiating genetic lesion.

The solid curves show the correlation coefficients for only those mRNAs that are predicted targets of miR-10b, miR-412 or miR-494.

This pattern is a departure from a normal distribution and indicates that the tissue transcript levels of a subset of mRNAs, which have a predicted miRNA target sequence in the 3' UTR, are reduced by miR-10b, miR-412 and miR-494, respectively.

For instance, for miRNAs miR-10b, miR-412 and miR-494, the distribution curve of the correlation coefficients for all mRNAs and that for target mRNAs are notably different, with the latter showing a distinct shift that extended towards negative Pearson correlation coefficients (Additional file 9).

Four of these miRNAs - miR-10b, -148a, -150, -199a - have been implicated in mouse mammary gland development [38].

Several miRNAs - miR-10b, miR-373, miR-520c, miR-335 and miR-206 - appear to promote late stages of mammary tumor progression by impacting critical steps in the metastatic cascade such as epithelial-to-mesenchymal transition (EMT), apoptosis, and angiogenesis [6].

Global distribution of the Pearson correlation coefficients between mRNAs and (a) miR-10b, (b) miR-412 and (c) miR-494.

14

Furthermore, miR-10b is significantly downregulated in rejected allografts, and miR-10b inhibition in human endothelial cells recapitulated apoptosis, release of pro-inflammatory cytokines/chemokine, and chemotaxis of macrophages 22.

For the HC group, miR-26a, miR-146a, and miR-486 presented a Glo to TI ratio above 1.5, meaning that they were abundantly expressed in Glo rather than in TI, but miR-21a and miR-10b showed a 0.99 and 1.18 ratio, respectively, meaning that they were comparatively expressed in both Glo and TI.

Furthermore, the levels of miR-21a, miR-10a, and miR-10b were less than 1.0 in dogs with KD, meaning that they tended to be expressed in TI rather than in Glo in dogs with KD.

Although differences in miR-10b and miR-10a levels did not match between TaqMan PCR and, we analyzed these miRNAs because their read number was high (Table 1), and they are highly expressed in human urine 13 as well as in dog and cat kidneys 4. This methodological difference might be affected by the differences between individual samples in TaqMan PCR and pooled samples in.

1.2 in HC), miR-10b was expressed in both Glo and TI, but this ratio decreased with aging.

When the expression levels were corrected to that of miR-191, the levels of miR-146a, miR-21a, miR-10a, and miR-10b tended to be higher in UExo of KD dogs than in UExo of HC dogs.

Decreased Glo miRNAs in KD such as miR-26a, miR-10a, and miR-10b significantly and strongly correlated with renal dysfunction and Glo injuries in dogs.

Urinary Cr was significantly and positively correlated with miR-26a, miR-486, miR-10a, miR-10b, and miR-191.

Significant differences were detected in miR-26a, miR-10a, and miR-10b between the groups.

Furthermore, serum BUN and Cr as well as Glo and TI damage scores, and KD score were negatively correlated with TI levels of miR-10b.

Furthermore, miR-10b level decreased in UExo in KD dogs.

Serum Cr was significantly and negatively correlated with miR-26a, miR-10a, miR-10b, and miR-191 and positively correlated with miR-21a.

miR-10b decreased in both the Glo and TI of KD dogs, and this change was significantly correlated with renal dysfunctions.

Both TI damage score and KD score were negatively correlated with Glo levels of miR-486, miR-10a, and miR-10b.

Serum BUN and Cr, and Glo damage score were negatively correlated with Glo levels of miR-26a, miR-10a, and miR-10b.

miR-3107, miR-486a, miR-21a, miR-10a, and miR-10b satisfied these requirements.

Serum BUN was significantly and negatively correlated with miR-26a and miR-10b.

A significant difference was detected in miR-10b levels between the groups.

miR-10b was negatively correlated with age.

Based on the Glo/TI ratio of miR-10b (0.8 in KD vs.

15

There was a strikingly high level of conservation of HOX gene sequence and structure and non-protein coding genes including the microRNAs miR-196a, miR-196b, miR-10a and miR-10b and the long non-coding RNAs HOTAIR, HOTAIRM1 and HOXA11AS that play critical roles in regulating gene expression and controlling development.

The prediction of microRNA target analysis showed that several known microRNA targets, such as miR-10, miR-414 and miR-464, were found in the tammar HOX clusters.

In this study, we also predicted targets of miRNAs, and found the targets of miR-10a miR-10b miR-414 and miR-466 in the HOX clusters (Additional file 9).

Non-coding RNAs known to be involved in regulation of HOX gene expression [16, 17], include the highly conserved microRNAs [18], such as miR-196[19] and miR-10[20].

Using the tammar as a reference and searching the microRNA database we were able to identify four known HOX microRNAs (miR-196a miR-196b miR-10a and miR-10b), and most significantly, we uncovered one new potential microRNA, meu-miR-6313 in the tammar which was expressed in testis and fibroblasts.

Regarding targets of miRNAs in the tammar HOX clusters, valid miRNA hits to miR-10a, miR-10b, miR-414 and miR-466 were confirmed (details referred to Additional file 9).

In silico analysis as well in vitro and in vivo experiments have shown that the miRNAs miR-10 and miR-196 target several HOX genes, such as HOXA5/7/9, HOXB1/6/7/8, HOXC8, HOXD8, HOXA1/3/7, HOXB3 and HOXD10 [18- 20, 50, 51].

We found that miR-10a and miR-10b were strongly expressed in the testis.

By microRNA deep sequencing and comparative genomic analyses, two conserved microRNAs (miR-10a and miR-10b) were identified and one new candidate microRNA with typical hairpin precursor structure that is expressed in both fibroblasts and testes was found.

We examined the presence of known microRNAs, miR-196a1, miR-196a2, miR-196b, miR-10a and miR-10b, previously described in the human, mouse and zebrafish HOX clusters.

Interestingly, the long-coding RNAs (HOTAIR, HOTAIRM1 and HOXA11AS) and microRNAs (miR-196a2, miR-196b, miR-10a and miR-10b) were highly conserved in this marsupial.

16

Several of these miRs have previously been shown to exert regulatory effects in the heart: miR-486-3p, upregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to be upregulated in the hearts of swim-trained mice and involved in the antifibrotic effects of exercise [37]; Let-7e, upregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to have an antiarrhythmic effect mediated via a downregulation of the β1 adrenergic receptor in myocardial infarction rats [38]; finally, miR-10b-5p, downregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to regulate the key cardiac transcription factor Tbx5, known to be involved with the cardiac conduction system.

After applying a 5% Benjamini–Hochberg false discovery rate correction, miR-5099, miR-486-3p, miR-423-5p, Let-7d-3p, miR-676-3p, miR-181b-5p, and Let-7e-5p were significantly upregulated and miR-10b-5p downregulated (Figure 2E, hatched bars).

Wang F Yang XY Zhao JY Yu LW Zhang P Duan WY Chong M Gui YH miR-10a and miR-10b target the 3’-untranslated region of TBX5 to repress its expression.

17

[29] ST2 stromal cells unknownInduced double-strand DNA breaks and reactive oxygen speciesaccumulation in transfected cells [30] miR-22-3p SIRT1 CDK6 SP1Induced growth suppression and acquisition of a senescentphenotype in human normal and cancer cells [31] human HDAC6Promoted osteogenic differentiation and inhibits adipogenic differentiationof human adipose tissue-derived mesenchymal stem cells [32] human miR-31-5p RhoBTB1Repression of miR-31 inhibited colon cancer cell proliferation andcolony formation in soft agarose [33] HT29 cells unknownIs associated with marked change in the expression of specificmiRNA during aging in skeletal muscle [34] mouse miR-378-5p NephronectinGalNT-7Inhibited osteoblast differentiation [35] MC3T3-E1 miR-382-5p unknownDownregulated in skeletal muscle of old mice [34] mouseIn order to validate the sequencing data, we selected several miRNAs from Table 2 for additional qRT-PCR validation, which the minimum normalized read count of miRNAs was 5 in young, adult and old groups, including miR-210 [29], miR-22 [31], [32], miR-31 [36], [37], and miR-10b [16](Figure 3).

[29] ST2 stromal cells unknownInduced double-strand DNA breaks and reactive oxygen speciesaccumulation in transfected cells [30] miR-22-3p SIRT1 CDK6 SP1Induced growth suppression and acquisition of a senescentphenotype in human normal and cancer cells [31] human HDAC6Promoted osteogenic differentiation and inhibits adipogenic differentiationof human adipose tissue-derived mesenchymal stem cells [32] human miR-31-5p RhoBTB1Repression of miR-31 inhibited colon cancer cell proliferation andcolony formation in soft agarose [33] HT29 cells unknownIs associated with marked change in the expression of specificmiRNA during aging in skeletal muscle [34] mouse miR-378-5p NephronectinGalNT-7Inhibited osteoblast differentiation [35] MC3T3-E1 miR-382-5p unknownDownregulated in skeletal muscle of old mice [34] mouse In order to validate the sequencing data, we selected several miRNAs from Table 2 for additional qRT-PCR validation, which the minimum normalized read count of miRNAs was 5 in young, adult and old groups, including miR-210 [29], miR-22 [31], [32], miR-31 [36], [37], and miR-10b [16](Figure 3).

Except for miR-10b, other miRNAs showed similar expression trends in qPCR and deep sequencing data.

18

Cluster analysis of over-expressed miRNAs (Figure S1A) and under-expressed miRNAs (Figure S1B) indicated that some deregulated miRNAs might play their roles in groups, such as up-regulated miR-10b and miR-21 and down-regulated miR-200a* and miR-148b*.

Most importantly, miR-10b, the second most over-expressed miRNA in SP-HCCs, has been found to be highly expressed in metastatic breast cancer cells and has been shown to positively regulate cell migration and invasion [53].

MiR-10b inhibits the synthesis of the HOXD10 protein and permits the expression of the pro-metastatic gene product RHOC, which in turn favors cancer cell migration and invasion [53].

In this study, miR-10b, miR-21 and miR-92b were frequently over-expressed.

Gastroenterology 138 S-116 63 Moriarty CH Pursell B Mercurio AM 2010 miR-10b targets Tiam1: implications for Rac activation and carcinoma migration.

19

MiR-10b, which we detected as significantly downregulated in senescent MEFs and aged liver, is upregulated in breast cancer and gliomas and its expression closely correlates with tumor cell metastatic potential [60].

Of the ten miRNAs downregulated in Ercc1 [−/−] MEFs, eight (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) were also down-regulated in both the progeroid and old WT mouse livers compared to the WT young (20 week) control mouse livers (Figure 1).

Additionally, we demonstrate that several miRNAs differentially expressed in the Ercc1 [−/−] MEFs (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) were also dysregulated in liver tissues of both progeroid Ercc1 [−/Δ] and old WT mice compared to young WT mice.

Previously confirmed gene targets of the miRNAs identified in this study that are linked to cellular senescence and aging (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) are listed in Supplemental Table S1.

Eight miRNAs (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b) are significantly downregulated in the livers of progeroid Ercc1 [−/Δ] and naturally aged mice compared to young adult mice (Figure 1).

In summary, we identified several miRNAs that are similarly dysregulated in senescent primary MEFs and senescent tissues of progeroid and naturally aged mice (miR-449a, miR-455*, miR-128, miR-497, miR-543, miR-450b-3p, miR-872 and miR-10b).

We analyzed the levels of 13 miRNAs confirmed to be dysregulated in P7 Ercc1 [−/−] MEFs compared to P3 Ercc1 [−/−] MEFs (miR-680, miR-320, miR-22, miR-449a, miR-455*, miR-675-3p, miR-128, miR-497, miR-543, miR-450b-3p, miR-872, miR-369-5p and miR-10b) in RNA samples prepared from the livers of WT young (20 weeks), the progeroid Ercc1 [−/Δ] mice, and WT old mice (30 months).

20

miR10b is a transcriptional target of Twist1 in cancer cells and is involved in repression of Hoxd10 expression [22], [23], suggesting that Twist1 may regulate Hoxd10 expression via control of this miRNA.

Therefore, lack of regulation by miR10b may not account for Hoxd10 upregulation in TAM E9.5 limb buds.

qRT-PCR analysis showed that miR10b is expressed in E11.5 forelimb bud tissues (Fig. S2) but its expression did not change significantly in either the anterior or posterior fragments of the C KO limb buds.

Figure S2 miR10b is not significantly downregulated in conditional mutant limb buds.

qRT-PCR for miR10b in anterior (A) and posterior (P) halves of E11.5 forelimb buds dissected from control (fl/wt) and TAM E9.5 (cko) embryos.

21

For instance, miR-206 was upregulated in cTECs, mTEC [high], and mTEC [low]; miR-10b was downregulated in cTECs but upregulated in mTEC [high] and mTEC [low]; miR-181c was downregulated in cTECs and mTEC [high] but upregulated in mTEC [low]; and miR-363 was downregulated in cTECs, mTEC [low], and mTEC [high] (33).

From the set of the 87 Aire -dependent miRNAs identified in this study, we identified 6 miRNAs (miR-10, miR-30e*, miR142-3p, miR-425, miR-338-3p, and miR-297) that were shared with the set of Aire -dependent miRNAs identified by in vitro Aire-knockdown of an mTEC cell line (35) and 4 miRNAs (miR-206, miR-10b, miR-181c, and miR-363) whose expression was previously detected in TECs.

22

It is interesting that only wild-type BRMS1 and the NLS2,2 mutant had the ability to down-regulate the pro-metastatic miR-10b.

Concomitantly, the pro-metastatic gene, miR-10b, was down-regulated by both wild-type and the NLS2,2 BRMS1 mutant protein.

NLS2 is important for down-regulation of miR-10b.

miR-10b, a pro-metastatic miRNA, was significantly down-regulated by both BRMS1 and the NLS2,2 mutant but not by NLS1,1 or NLS2,1 (Fig. 6).

NLS2 is important for miR-10b down regulation.

0055966.g006 Figure 6 was used to evaluate the expression levels of miR-10b normalized to the endogenous control RNU6B.

was used to evaluate the expression levels of miR-10b normalized to the endogenous control RNU6B.

Only the wild-type and NLS2,2 mutant decreased the level of miR-10b.

23

Furthermore, by performing a literature review, we found that miR-10a, miR-10b and miR-107 were previously reported to be involved in the regulation of hematopoietic gene expression [15, 19], and miR-299-3p is predicted to target the 3′-UTRs of both human and mouse GP1BA gene.

Therefore, we chose to assess four miRNAs (miR-10a, miR-10b, miR-107, and miR-299-3p) and investigate if they can target the 3′-UTR and regulate the expression of human GP Ibα (Figure 1A).

Furthermore, although there has been no report in the literature identifying a role for miR-10b and its host gene, HoxD4 (Homeobox D4), in megakaryopoiesis, Garzon et al. reported that in the late stage of megakaryopoiesis this miRNA is significantly down-regulated by ~12-fold [15].

PCR conditions for miR-10a and miR-10b were as follows: 95 °C for 15 min followed by 40 cycles of 94 °C for 15 s, 57 °C for 30 s and 70 °C for 40 s. The 2−ΔΔ Ct method was used to determine relative expression levels.

Meanwhile, because miR-10a and -10b do not introduce any mutations to the GP Ibα coding sequence, and thereby do not alter the amino acid composition in the mature GP Ibα protein, it is unlikely that miR-10a and miR-10b can alter GP Ib-IX-V complex formation.

However, sustaining high levels of miR-10a and miR-10b cause degradation of GP Ibα mRNA, resulting in low amounts of GP Ibα protein.

24

We found a significant up-regulation of oncogenic miRNAs and a significant down-regulation of tumor-suppressing miRNAs, which included let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181.

For example, the expression levels of miR-206 and miR-497 were increased significantly by 26- and 9-fold, respectively, whereas the expression of miR-10b was decreased significantly by 14-fold (Table 1).

The fold change miRNA expression ranged from 14-fold down (miR-10b) to 26.5-fold up (miR-206) in the brain, compared with only 10-fold down (miR-574-5p) to 6.5-fold up (miR-689) in the liver (Tables 1 and 2).

In brain tissues, we detected 58 miRNAs in treated mice but not in controls, whereas we detected only four miRNAs (miR-10a, miR-10b, miR-712*, and miR-715) in control brain tissues but not in treated samples [see Supplemental Material, Table 3 (http://www.

In this study, we found that many cancer-related miRNAs, such as let-7, miR-17-92, miR-10b, 125b, miR-146, miR-15, miR-200, and miR-16, were significantly affected by RDX exposure (Table 4).

25

Interestingly, both, ATF-126 and Maspin cDNA, up-regulated miRNAs with potential tumor suppressive functions, such as miR-1 [23], [24] and miR-34 [25], while down -regulating oncogenes and metastasis promoters, including miR-10b [26] (Fig. 6C ).

In addition to activation of potential tumor suppressive miRNAs, both ATF-126 and Maspin cDNA down-regulated putative oncogenes, including miRNA-10b.

Expression of miR-10b, miR-1, miR-34a, miR363, and miR-124 was validated in two independent assays using hydrolysis probes (Table S4).

26

A detailed analysis was made on the four most significantly down-regulated miRNAs, namely miR-33, miR-330, miR-181a, and miR-10b, as determined through microarray analysis and qRT-PCR.

In addition, miR-10b shows altered expression levels within breast cancer tissue and is one of the most consistently dysregulated miRNAs able to predict tumor classification (Iorio et al., 2005; Ma et al., 2007).

These findings suggest that miR-33, miR-330, and miR-10b may influence cellular disease state, specifically related to cancer.

A stringent computational matching approach was used to identify predicted mRNA targets for miR-33, miR-330, miR-181a, and miR-10b.

Tumour invasion and metastasis initiated by microRNA-10b in breast cancer.

27

TIP30 is down-regulated in various human tumors due to DNA methylation or posttranscriptional regulation by miR10b [14, 15].

Previous studies have suggested that the expression of TIP30 could be activated by JAK/STAT3 pathway or suppressed by DNA methylation and mir-10b.

In PDAC, TIP30 is a direct target of mir-10b.

28

Among the miRNAs that are significantly upregulated by endogenous and exogenous RS, we found miR-10b, 27b, 181a and all the members of the miR-34 family miRNAs.

Overexpression of all the aforementioned miRNAs except mir-10b repressed luciferase activity regulated by the corresponding MCM 3’UTR, confirming in silico predictions (Fig 6B and 6C; see Methods).

Primary WT MEFs transfected with miR-34 miRNA mimics for 48h significantly inhibit DNA replication (two sided t-test, *, p<0.05, **, p<0.005), but not miR-10b, 27b or 181a mimics.

Mcm2-7 mRNA levels were not reduced after miR-10b, 181a or 27b over -expression (S5B Fig), while miR-27b and 181a repressed MCM4 but not other MCMs studied (Fig 6F).

29

This statistical analysis further revealed that miR-125b and miR-10b were upregulated in cultures exposed to either damaged lysate, while hsa-miR-34a expression was down-regulated in both LPS and lysate treated cultures (Table 2).

Hsa-miR-214 expression clustered with other miRs (such as miR-10b and miR-125b) when donor PBMCs were exposed to both types of cell lysate (Figure 1A, middle panel).

Using a Taqman microRNA profiling low-density PCR array we identified several microRNA genes, including miR-34c, miR-214, miR-210, miR-125b and miR-10b in human PBMCs, which are involved in the inflammatory response to damaged cells.

Some of the other “DAMPmiRs” that clustered together with miR-214 include miR-125b and miR-10b, where the latter can be involved in metastasis [22], [23].

30

Treatment days miRNAExpression change [#] Predicted mRNA target(s)Expression change [#]GD 8/11 [†] miR-1192 ↑ Atf1, Gng4, Map3k1, Rpe, Setd2, Stxbp6, Zc3h6 ↓ miR-532-5p ↑ Atf1, Itpripl2, Stxbp6 ↓GD 14/16 [*] miR-10b ↓ Aak1 ↑ miR-184 ↓ Myl9 ↑ miR-302c ↑ Ccdc6, Mfap3, Ptpro, Rnd3, Rpl36a/r, Sema3c, Stoml3, Supt3h ↓ miR-342-5p ↓ Aak1, Cables2, Rhog ↑ miR-343 ↑ Asic4, Dcn, Gpr116, Ptpro, Stoml3 ↓ miR-449b ↓ Ina ↑PD 4/7 [†] miR-26b ↑ Adam9, Chsy1, Cnr1, Exoc8, Hs6st1, Lingo1, Map3k7, Mras, Pfkfb3, Ppm1b, Rhou, Sema6d, Shank2, Tab3, Tdrd7, Ube2j1 ↓ miR-34b-5p ↓ Kitl ↑ miR-184 ↑ Ncor2, Prkcb ↓ miR-721 ↑ Akap11, B4galt, Cnr1, Efnb2, Fam20b, Ino80, Irf1, Lrrk2, Ncoa3, Pfkfb3, Ppargc1a, Rbm9, Shank2, Spen, Sphk2, Tsc1, Wdfy3 ↓ miR-1970 ↓ Arhgap6 ↑ # Significance for expression change was 1.2-fold, p < 0.05.

Further, we also identified miR-10b to be down-regulated in the adult brain, which has been previously identified as ethanol-responsive (Wang et al., 2009).

Other studies have implicated specific miRNAs depending on cell type or ethanol treatment paradigm and our results have replicated some of these same molecules, including miR-335 [identified by Sathyan et al. (2007)] and miR-10b [identified by Mantha et al. (2014) and Wang et al. (2009)].

31

Interestingly, while we found no significant impact of miRNA overexpression on embryo weight (Fig. 5, right panel), placentas overexpressing miR-10b-5p were larger (Fig. 5, centre panel).

We analysed the effect of overexpression on foetal and placental weight when (a) the litter contained at least 4 mice, and (b) there was at least a 100-fold increase in mature miRNA expression level for exogenous miRNAs (mir-517a, -525, -2b, -14, -276a, -77, -230) or at least a 10-fold increase for endogenous miRNAs (mir-10b, -107, -122, -187, -675, -1192).

Using cDNA microarrays, followed by PCR validation, we failed to detect a distinctly dysregulated target for miR-10b-5p (not shown).

32

Consistent with previous observations in GBMs, we observed recurrent up-regulation of miR-10b [22] and miR-21 [21] in our sample set; miR-10b was up-regulated more than 100-fold in two out of four AA and two out of four GBM tumors; miR-21 was up-regulated 5- to 30-fold in two out of four AA and all four GBM tumors.

From our analyses, we identified a number of miRNAs that have been described previously in GBM tumors such as miR-10b (see [22]) and the apoptosis regulator miR-21 (see [21, 22, 31]).

33

TWIST1 is able to inhibit c-MYC induced apoptosis [1] and directly regulates the expression of several other oncogenes such as GLI1 [2], miR-10b [3] and AKT2 [4].

E. g. the oncogenic miR-10b is directly activated by TWIST1 and promotes the invasion and metastasis through repressing HOXD10 expression [3].

34

For example, in mouse [14], miR-10b is highly expressed in spinal cord; miR-124 is wi dely expressed in brain tissues; miR-200b, miR-128a, miR-128b, miR-429 are specifically expressed in olfactory bulb; miR-200a is highly expressed in olfactory bulb; miR-7b is highly expressed in hypothalamus.

35

Altered expression of many miRNAs is seen in several tumor types: e. g. B-cell lymphomas (clustered miR-17) [2], [3], malignant lymphomas (miR-15a, miR-16-1; targeting BCL2) [4], glioblastoma tumors (miR-21up-regulation) [5], colorectal neoplasia (miR-143, miR-145 down-regulated) [6], lung cancer (miR-29) [7], and breast cancer (miR-10b) [8], with several more tumor types under analysis.

36

miRNAs can act as tumor suppressors (e. g. miR-15a and miR-16-1 [4]), oncogenes (e. g. miR-155 [5], [6] and miR-21 [7], [8], [9], [10]) and as promoters (e. g. miR-10b, miR-182 and miR-29a [11], [12], [13]) or suppressors (e. g. miR-335 and miR-126 [14]) of metastasis.

In our study, some of these miRNAs (miR-10b, miR-373, miR-520c and miR-29a) were not probed in our microarrays and others (miR-21, miR-126 and miR-335) showed no significant differences in expression amongst the 4 isogenic cell lines.

miR-10b promoted metastatic transformation of breast cancer cells, while miR-373 and miR-520c enhanced extravasation and metastatic development [11], [48].

37

Target sequences of TALENs are as follows; TGGGGCCTCCAGGAGCC and TGTTGATTTTGTGGTTT for the gene desert on mouse chromosome 11, TCTGTGTGTATCCCCAG and TTGATATAACCCATGGA for mmu-mir-146a, TCTGTATATACCCTGTA and TGACCACAAAATTCCTT for mmu-mir-10a and TGTAACGTTGTCTATAT and TGGGTACCACACAAATT for mmu-mir-10b.

This result implying that at least three TALEN pairs, for the gene desert, mmu-mir-146a and mmu-mir-10b, could be useful for making knockout mouse.

We examined the genome editing activities of TALEN pairs for the gene desert, mmu-mir-146a, mmu-mir-10a and mmu-mir-10b in NIH3T3 cultured cell line.

To test this, we ordered construction of TALENs for specific gene desert of mouse genome, which is located on chromosome 11, mmu-mir-146a, mmu-mir-10a and mmu-mir-10b from Cellectis bioresearch.

Since F1 pups should be heterozygous, it seems likely that founder of mmu-mir-10a mutant 3 and mmu-mir-10b mutant 1 are heterozygous mutants without mosaicism.

Higher concentration of RNA mixture for microinjection enabled us to produce mmu-mir-10b, prompted us to try microinjection of TALEN mRNAs at the concentration of 500 ng/µl for generating mmu-mir-10a deficient mice.

Both mutants have mutated mmu-mir-10b and wild type mmu-mir-10a alleles (Fig. 2B).

38

Twist -induced miR-10b, and miR-10b was found to inhibit the expression of the HOXD10 protein, permitting the expression of the pro-metastatic gene product, RHOC [102].

miR-10b belongs to the class of regulatory small cellular RNAs, termed microRNA (miRNA), that act as mediators of the RNA interference pathway.

The contribution of Twist towards malignancy may use as an additional mechanism the induction of miR-10b in breast cancer cells [102].

39

The metastasis -associated microRNA miR-10b was found to downregulate MICB, thereby impairing the ability of tumor cells to be eliminated by NK killing.

MiR-10b downregulates the stress -induced cell surface molecule MICB, a critical ligand for cancer cell recognition by natural killer cells.

Conversely, using an in vivo mo del of lung metastasis, more tumor cells overexpressing miR-10b were present in the lungs compared with control tumor cells (Tsukerman et al., 2012).

40

These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI.

In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI.

41

Conversely, there are miRs having the negative role in regulation of cell proliferation and are often down-regulated in cancer cells, such as let-7c, miR-10b, miR-15a, miR-31, miR-34, miR-145, miR-223 [7].

The miRs upregulated in cancer cells often have the oncogenic role, and the well-known examples of this class are miR-10b, miR-17-92, miR-122 and miR-155 [6].

42

It is possible that antagomiR-10a had off-target effects, e. g. inhibition of miR-10b and miR-125a, which has sequence homology or interaction with other targets.

Alternatively, miR-10b might compensate for the absence of miR-10a in miR-10a -deficient Treg, since miRNAs are often redundant [21].

43

Hepatic expression of tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22 and miR-125b, and tumor promoting miRNAs, miR-10b and miR-99b in NASH-HCC mo del male and female mice.

As shown in Fig. 4, the tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were lower, whereas the tumor-promoting miRNAs, miR-10b and miR-99b were higher in males than in females in both the STZ-HFD group and the control group.

44

The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study.

In summary, our study demonstrated that miR-10 and miR-30d are stably present in human and animal urine and that the elevation of the urinary miR-10a and miR-30d levels can serve as a novel urine -based biomarker of kidney injury.

45

The mir-196 family regulates Hox8 and Hox7 genes, the function of mir10 is unknown.

A few microRNAs are apparently linked to protein coding genes, most notably mir-10 and mir-196 which are located in the (short) intergenic regions in the Hox gene clusters of vertebrates [4- 7].

The mir10 and the mir196 precursors are located at specific positions in the Hox gene clusters [4- 7].

mir10 is a good example of this typical substitution pattern, which gives rise to a hairpin structure.

The mir-10b CNB shows the typical pattern of substitutions in a microRNA precursor hairpin: There are two well-conserved arms, of which the mature microRNA is almost absolutely conserved, and a much more variable loop region.

Nevertheless, it is conserved across all vertebrate species as shown in Figure 5. Figure 4Alignment and predicted RNA structure of mir-10b.

Nevertheless, it is conserved across all vertebrate species as shown in Figure 5. Figure 4Alignment and predicted RNA structure of mir-10b.

46

Seven miRNAs showed differential expression (Figure 1a, Figure S2a); miR-1 and miR-542-3p showed decreased expression, whereas miR-132, miR-214, miRNA-31, miR-210 and miR-10b showed increased expression.

47

Three were downregulated (miR-10b, miR-188, and miR-200c) and three were upregulated (miR-494, miR-297, and miR-181c) (Figures 1B,C).

48

In addition to miR-720, many of the 68 miRNAs modulated by ADAM8 have been found to be upregulated in breast cancer or previously implicated in tumorigenesis (such as miR-19a, miR-106b, miR-181a-2, miR-30a, miR-93, miR-30d, and miR-10b) [37, 40, 75– 78].

Ma L Role of miR-10b in breast cancer metastasisBreast Cancer Res.

For example, miR-10b has been shown to promote metastasis of 4T1 cell line-derived breast tumors in a mouse mammary mo del [8].

49

The reaction was performed with initial preheating at 95°C for 2 min followed by 40 cycles of denaturing at 94°C for 15 s, annealing at 58°C for miR-21, miR-29b-1, let7-g, miR-10b, miR-451a, miR-17, and miR-18a, or 62°C for miR-145a and miR-31 for 30 s, and elongation at 70°C for 30 s. The expression of tumour-derived miRNAs was rated relatively to U6 and rpl30 and the concentration of serum-derived miRNAs was normalised to serum volume.

The analysis of miRNA profiles showed that the altered pool of miRNAs contained a considerable number of ascertained tumour -associated miRNAs, both oncogenic and tumour-suppressing, such as miRNAs from the let-7 family, mir-107, mir-155, mir-15, mir-16, mir-21, mir-10b, mir-145, mir-451a, mir-29b1, mir-17, mir-18a, and others.

50

Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies.

51

The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128].

52

Furthermore, both miR-10b and miR-148a expression are known to regulated by genomic CpG methylation 31, 35.

We also noted increases in miRNAs associated with regulating cellular identity and proliferation including, miR-10b [31], miR-21a [32], miR-486a [33], and miR-148a.

53

We observed that processing of both pri-miR-183 and pri-miR-182, but not a control pri-miR-10b, was significantly increased upon inhibition of nuclear PP1 by NIPP1 overexpression (Fig. 3b–d).

Briefly, fragments of pri-mir-182 and pri-mir-183, and the control pri-miR-10b, containing the hairpin and 100 bp flanking sequence were amplified from genomic DNA.

54

Both, pri -mir-10 and pri -mir-206 were significantly upregulated upon VPA treatment, suggesting that VPA affects the transcription and not the processing of these two miRNAs.

In the future studies chromatin immunoprecipitation (CHIP) analysis of the mir-10 promoter region may be helpful to clarify whether VPA induces the acetylation/activation of histone complexes in the regulatory regions of the mir-10a locus.

55

Zheng L., Lv G. C., Sheng J., and Yang Y. D. 2010 Effect of miRNA-10b in regulating cellular steatosis level by targeting PPAR-alpha expression, a novel mechanism for the pathogenesis of NAFLD.

56

The brain weight was not affected by drug treatments in WT mice (Fig. 1i; n = 6 WT UNT = 0.42 ± 0.01 g; n = 7 WT VEH = 0.44 ± 0.01 g; n = 7 WT DMI10 = 0.41 ± 0.01 g; n = 6 WT MIR10 = 0.41 ± 0.02 g; n = 6 WT MIR50 = 0.42 ± 0.01 g; One Way ANOVA, p = 0.503).

were weighed every day during the 14 days of treatment, and at p28, the KO-VEH group showed around 30% lower body weight with respect to the WT-VEH group and this difference was maintained until p41 irrespective of the drug treatment (Fig. 1g,h; n = 7 WT VEH = 21.81 ± 0.68 g; n = 8 WT DMI10 = 19.05 ± 0.62 g; n = 6 WT MIR10 = 20.46 ± 0.84 g; n = 6 WT MIR50 = 20.61 ± 1.50 g ; n = 7 KO VEH = 16.22 ± 1.20 g; n = 17 KO DMI10 = 14.40 ± 0.96 g; n = 7 KO MIR10 = 16.13 ± 1.22 g; n = 15 KO MIR50 = 15.20 ± 0.98 g; t-test, p = 0.002 VEH; p = 0.005 DMI10; p = 0.017 MIR10; p = 0.002 MIR50).

Louis, MO, USA), desipramine 10 mg/Kg (DMI10; Vinci-Biochem, Florence, Italy), mirtazapine 10–50 mg/Kg (MIR10–50, Abcam, Cambridge, UK).

Values are represented as mean ± SEM; *p = 0.002 VEH; **p = 0.005 DMI10; *p = 0.017 MIR10; **p = 0.002 MIR50 (t-test; n = as in (g)).

We observed a slight but not significant increase in brain weight with desipramine (DMI10 = 86.3%), and mirtazapine 10 mg/Kg (MIR10 = 86.0%) (n = 8 DMI10 0.36 ± 0.010 g, n = 6 MIR10 0.36 ± 0.013 g).

57

Pattern 3 and 4 were unique to Group B (increased miR-10b and decreased miR-680, respectively); Pattern 5 was common to both Groups B and C and contained 29 miRNAs whose expression was increased; and Pattern 6 was comprised of 35 Group C miRNAs whose expression was likewise increased.

58

These findings demonstrated that schistosomal eggs release EVs during development in vitro and these 30–100 nm sized vesicles carry miRNAs that are both parasite-specific and homologs of mammalian (host) (e. g. mouse miR-10) miRNAs.

Among the 13 known Sja-miRNAs identified in the egg EVs, Sja-bantam, Sja-miR-10 and Sja-miR-3479-3p were all previously detected in serum obtained from rabbits infected with S. japonicum [39].

We found 13 known S. japonicum miRNAs (reads >100) present in the schistosomal egg EV libraries (Table  2 and Additional file 2: Table S1), including three miRNAs (miR-10, bantam and miR-3479-3p) that were present in the plasma of S. japonicum infected host rabbits in a previous study [39].

Interestingly, bantam and miR-10 were significantly enriched in the libraries of EVs derived from schistosomal adult worms, whereas miR-3479-3p did not appear in those EV libraries [33].

59

For instance, although miRNAs are known to predominantly act in translational repression, miR-10 has been recently found to bind a group of transcripts containing a terminal oligo-pyrimidine (TOP) motif and to induce their translation [47].

60

Two conserved miRNA families with multiple members, i. e. miR-133 and miR-10, had individual members with large differential 5′-isomiR arm abundances.

One such example is the miR-10 family where 5′-isomiRs of the same seed ‘CCCUGUA’ contributed to 21.8% and 28.6% of the miR-10a-5p abundances in human and mouse, respectively.

We observed that miRNA orthologues (miR-10, miR-133, miR-137 and miR-79 in Table 3) swapped major miRNAs and 5′-isomiRs and had largely different 5′-isomiR arm abundances across human, mouse, fruitfly and worm.

For example, miR-10-5p.

iso1 in human and mouse had a high arm abundance, whereas miR-10-5p.

61

However, the observation of reduced miR-10b-5p, miR-674-3p, miR-3535, and miR-378c expression upon Nrf2 ablation suggests that Nrf2 may be involved in the basal regulation of these miRNAs in the heart.

Expression changes were validated for 12 miRNAs using specific primer assays in real-time and revealed a significant decrease in miR-10b-5p, miR-674-3p, miR-3535, and miR-378c while miR-30b-5p, miR-208a-5p, miR-350-3p, and miR-582-5p, and miR-1249-3p levels were increased.

62

NI MV OpenArray RT-qPCR hsa-miR-328 − 2.5* ± 0.93Not tested [a] hsa-miR-335* − 3.0* ± 1.13Not tested [a] mmu-miR-16* 2.8** ± 0.65Not tested [a] mmu-miR-21* 5.0** ± 0.88Not tested [a] mmu-miR-297a* 5.8* ± 1.60Not tested [a] mmu-miR-685 3.0* ± 1.00Not tested [a] mmu-miR-1949 5.0* ± 1.69Not tested [a] hsa-miR-590-5p Unique to NINot validated [b] rno-miR-450 Unique to CMNot validated [b] mmu-miR-10b 2.7* ± 0.85Not validated [b] hsa-miR-146a 3.2** ± 0.68 7.2* ± 2.74 hsa-miR-150 1.8* ± 0.64 2.7 (ns) ± 2.26 hsa-miR-205 2.3* ± 0.75 − 0.5 (ns) ± 1.89 hsa-miR-486 2.3*** ± 0.18 4.7 (ns) ± 1. 45 mmu-miR-193b − 2.7** ± 0.62 − 7.5* ± 0 62 mmu-miR-215 2.1* ± 0.554.6 (ns) ± 99.39 [c] mmu-miR-467a − 2.0* ± 0.69 − 5.6 (ns) ± 0.96 The list of significantly differentially expressed miRNA in CM vs NI MV from the was compared with the results obtained by.

Two additional miRNA—miR-590-5p and miR-450—were selected among those unique to either CM or NI MV for verification; however, as amplification was not adequate across all samples and biological groups, data for these two miRNA as well as for miR-10b, were not shown (Table  1).

The database was searched with the full names of each murine miRNA as per the ThermoFisher Scientific product information and miRBase version 21: mmu-miR-16-1-3p, mmu-miR-21a-3p, mmu-miR-146a-5p, mmu-miR-150-5p, mmu-miR-193b-3p, mmu-miR-205-5p, mmu-miR-215-5p, mmu-miR-297a-3p, mmu-miR-328-3p, mmu-miR-335-3p, mmu-miR-467a-5p, mmu-miR-486a-5p, mmu-miR-685, mmu-miR-1949, and rno-miR-10b-5p.

miR-10b, results were not shown, due to poor RT-qPCR amplification across all sample types.

63

In addition, the miR-10, 15, 17, and 181 families were similarly regulated.

Other miRNA families that are commonly regulated after ionizing radiation include the miR-10, 15, 17, and 181 families.

The miR-10 family includes four miRNAs (miR-10, 99, 100, and 125).

64

Among the targets for differentially expressed miRNAs in spleen of M. fortis, miR-328*, miR-10a and miR-10b had important roles in the immune response (involved in Toll-like receptor signaling pathway in miR-10a and miR-10b) and signal pathway induction (involved in MAPK signaling pathway and Wnt signaling pathway in miR-328*).

65

Since then, it has been discovered that a number of other miRNAs, including miR-17 [13, 19], miR-27 [19, 20, 41], miR-24 [19], miR-10 [19, 20], and let-7 [12, 19, 20], play an important role in lymphoma biology.

This key circulating miRNA signature consists of ten miRNAs (let-7c, let-7b, miR-15a, miR-18a, miR-27a, miR-155, miR-24, miR-130a, miR-10b, and miR-497), which were responsible for DLBCL initiation and was present prior to the formation of visible tumor.

Since miRNAs can have different aliases, the 10 miRNAs (Fig 1) are identified as the following for the rest of this manuscript: let-7 = let-7b, let-7a-5p = let-7c, miR-10 = miR-10b, miR-130 = miR-130a, miR-155 = miR-155, miR-27 = miR27a, miR-24-3p = miR-24, miR-17 = miR-18a, miR-15 = miR-15a, and miR-16-5p = miR-497.

This miRNA signature consists of 10 miRNAs: miR-130, miR-27, miR-17, miR-10, miR-155, let-7a-5p, let-7, miR-24-3p, miR-15, and miR-16-5p.

The following miRNAs were categorized as oncomiRs for DLBCL: miR-10b [44], miR-155 [9, 19, 29, 44], let-7b [31, 42], miR-18a [1, 14, 41, 44], and miR-130a [44, 46].

66

Ssc-miR-182, ssc-miR-187, ssc-miR-136, ssc-miR-210, ssc-miR-217 and ssc-miR-10b participate in regulation Neurotrophin signaling pathway by targeting corresponding genes, including BNDF, SHC4, KRAS and FOXO3.

67

Three of these (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p) were further detected in the plasma of S. japonicum-infected mice by stem-loop RT-PCR analysis [22].

Sja-miR-10-5p was excluded from analysis due to its high sequence homology with mammalian host orthologs.

Detection of parasite-derived miRNAs in the serum of C57BL/6 and BALB/c mice during S. japonicum infectionUsing a deep sequencing method, Cheng et al. identified the presence of five schistosome-specific miRNAs (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p, sja-miR-3096 and sja-miR-8185) in the plasma of S. japonicum-infected rabbits.

Using a deep sequencing method, Cheng et al. identified the presence of five schistosome-specific miRNAs (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p, sja-miR-3096 and sja-miR-8185) in the plasma of S. japonicum-infected rabbits.

68

Furthermore, expression of several miRs, including miR-10b and miR-196, was detected in the developing limb and found to be involved in the specification of limb development [13, 14].

69

For instance, miR-10b and miR-34a have been shown to regulate cellular steatosis by targeting PPAR α.

70

showed that expression levels of miR-335, miR-10b, miR-944, miR-301a, miR-18b, miR-204, miR-130b, and miR-188-5p were similar in both assays (Fig. 1B).

These include miRNAs with known roles in breast cancer development such as miR-7, miR-10b, miR-21, miR-100, miR-155, miR-195, miR-221, and miR-218.

71

Others, the mir-10, 99, 100, 125 family for example, diverge in the mature forms (See additional file 8: The mir-10, 99, 100, 125 family).

Sequence alignment and selected secondary structure of the miRNAs in the mir-10, 99, 100, 125 family.

Click here for file The mir-10, 99, 100, 125 family.

The mir-10, 99, 100, 125 family.

72

Recent in vitro analyses have suggested that RhoC may mediate cancer cell invasion via control of other molecules, such as formin (FMNL2 [10] and FMNL3 [11]) at lamellipodia or through spatial resolution of RhoC at invadopodia [12] or, possibly, via upstream regulators such as Notch-1 [6], mir10b [3], p38γ -mediated RhoC ubiquitination [13] or RhoGDP dissociation inhibitor α (RhoGDIα) [14].

73

In the peripheral CD3 [+] T lymphocytes of DBA-2/J strain, we found 11 miRNAs (miR-302c, miR-691, miR-712, miR-125a-3p, miR-29b*, miR-30b*, miR-10b, miR-149, miR-141, miR-1897-5p and miR-690) that were up-regulated.

74

This observation is not in agreement with other studies of miRNAs in pig skeletal muscle [32, 33]; instead, miR-10b had the highest expression in both groups of our study, accounting for 36% and 26% of total normalized miRNA reads, respectively.

The top nine most abundant miRNAs shared between the two groups were ssc-miR-10b, ssc-miR-22-3p, ssc-miR-486, ssc-miR-26a, ssc-miR-27b-3p, ssc-miR-191, ssc-miR-378, ssc-126-5p and ssc-miR-181.

75

Two miRNAs, miR-10b, and miR-873, were significantly downregulated in EtOHc-4D and AW8 neurons (data not shown).

76

qPCR confirmation of exosome-specific expression on miR-10b and miR-208.

To validate these data we performed qPCR with pre-amplification cycle for two exosome-specific miRNAs, miR-10b and miR-208.

77

These mRNAs are positively regulated by miR-10b and negatively regulated by binding of specific factors to the 5′UTR of the mRNA [29].

78

Some scientists have established the potential usefulness of miRNAs as therapeutic molecules against cancers, including the inhibition of cancer cell proliferation by miR-26a in a mouse mo del of hepatocellular carcinoma and the prevention of metastasis formation via the silencing of miR-10b.

79

The miRNA families that change expression in both mice and rats were: mir-7, mir-9, mir-10, mir-15, mir-17, mir-26, mir-29, mir-30, mir-101, mir-130, mir-181, mir-204, mir-339, mir-340, mir-368, mir-434, mir-467.

80

Meanwhile, the expression of miR-21, miR-10a, miR-126, miR-10b, miR-19a, miR-19b was significantly increased after adding into HUVECs culture, suggesting that HUVECs might release these miRs (Table 1).

81

Notably, a study published after submission of this manuscript identified 5 miRNAs derived from S. japonicum in the plasma of infected rabbits and 3 of these are identical or homologous to those identified here: bantam, miR-3479-3p and miR-10-5p [70], providing independent validation for the presence of trematode miRNAs in the serum of infected animals.

22962218:+ 7 sma-miR-10-5p AACCCUGUAGACCCGAGUUUGG S_mansoni.

The other 2 miRNAs, sma-miR-10-5p and sma-let-7-3p, were excluded from analysis because they are highly similar to homologous mouse miRNAs that are present at >100 fold higher read frequencies (Table S3).

82

Furthermore, recent data indicate that WISP2 can block expression of miR-10b [20], a non-coding RNA known to play a role in invasion and metastasis [21].

83

In cells with an activated MAPK/ERK pathway, the expression levels of let-7a, miR-10, miR-22, miR-26, miR-34, and miR-125a were lower, and those of miR-20, miR-25, and miR-135b, were higher (Supplementary Table 1).

84

Several miRNAs, including miR-10b, miR-126, and the miR-200 family, have been identified as promoters or suppressors of breast cancer metastasis [21– 25].

85

Interestingly, palbociclib also reduced expression of two other miRNAs elevated in PN GBM, miR-130b (in both G44 and G559 PN GSC lines) and miR-10b (in G559 PN GSC line).

86

Hoss et al highlighted Mir10b in particular; this microRNA has increased expression with CAG length in 10-month data, concordant with the human results, but moves in the opposite direction in both 6-month data sets (S4 Fig).

87

We then performed qRT-PCR on RNA isolated from shControl and shDICER tumors to evaluate relative abundance of several mRNAs coding for cell cycle regulators, stemness, and prodifferentiation markers including SOX2, BMI1, CCNE1, GFAP, and NESTIN (Figure 6a), as well as their corresponding targeting miRNAs, let-7b, miR-21, miR-10b, miR-103a, and miR-99b (Figure 6b).

We validated four of the miRNAs for their incorporation into the RISC complex by qRT-PCR; namely, miR-103a, miR-210, miR-10b, and miR-21 (Figure 1c).

88

Therefore, the TWIST-1/miR10/p53 axis can serve as a potential new target for therapeutic interventions in advanced myelodysplastic syndromes [13].

89

And IL-17A would be suppressed by miR-10b to participate the pathological processes of ankylosing spondylitis [31].

90

For example, miR-10b promotes breast tumor metastasis, while miR-335 and miR-126 suppress the metastasis [9], [10].

91

We noticed a significant change in the expression of several microRNAs in livers of Crtc2 [L KO] mice including miR-34a, miR-10b, and miR-146b (Supplementary Table  1).

92

To date, several dysregulated miRNAs have been demonstrated to be involved in NPC cell migration, invasion and metastasis, such as miR-29c, miR-451, miR-10b, miR-93, and miR-124 [17– 21].

Tumour invasion and metastasis initiated by microRNA-10b in breast cancer.

93

M113.5073840) 106 Liu X, Dong C, Jiang Z, Wu WK, Chan MT, Zhang J, Li H, Qin K, Sun X 2015 MicroRNA-10b downregulation mediates acute rejection of renal allografts by derepressing BCL2L11.

94

In NPC, several miRNAs have been reported to act as oncogenes or suppressor genes, including miR-10b, which was shown to promote the metastasis of NPC cells in our previous studies (6– 8).

95

Firstly, several studies have established pro-oncogenic or tumour-suppressive roles of individual microRNAs firmly linking these to cancer etiology as exemplified by miR-155, miR-10b and miR-21 [17- 19].

96

For example, miR-10b promotes breast cancer cell invasion and metastasis by targeting syndecan-1 (SDC1) in MDA-MB-231 and MCF-7 cells [6].

97

The expression trend of 12 of them (i. e. miR-21, miR-10b and miR-124) was in line with previously published results, whereas 2 miRNAs (miR-137 and miR-218) showed an opposite trend [24].

98

Among the other miRNAs, the miR-183/96/182 family and miR-10b target BDNF as well [51, 53].

99

After three steps of screening (Supplementary information), only three of them (miR-100, miR-10b and miR-9) remained significantly enriched in the polymerase immunoprecipitates.

Of them, 4 miRNAs (miR-9, miR-10b, miR-124 and miR-100) remained to have a ≥ 1.5-fold difference (Figure 5B, lower panel).

Indeed, the miR-9, miR-10b and miR-100 were discovered physically interact with preC-pol.

100

For instance, a group of miRNAs, such as miR-10b [10] and miR-21 [11] are able to initiate invasion and metastasis in breast cancer, whereas some of other miRNAs including miR-200 family [12] and miR-126 [13] exert their inhibitory effect on invasion and metastasis in breast cancer.