sort by

361 publications mentioning hsa-mir-92a-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-92a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 375
Comparison of cell line with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt) and of cell line with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) enabled us to identify 16 down-regulated and 3 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2. When patient sample and cell line results were analyzed, they had in common four down-regulated putative targets of miR-92a: CIC, FOXP1, INADL, and SMG1. [score:18]
Comparison of cell line with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt) and of cell line with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) enabled us to identify 16 down-regulated and 3 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2. When patient samples and cell line results were analyzed, they had in common four down-regulated miR-92a associated mRNA, which were putative targets: CIC, FOXP1, INADL, and SMG1 (Supplementary figures 4 and 5). [score:18]
Comparison of cell line with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt) and of cell line with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) enabled us to identify 16 down-regulated and 3 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2. When patient samples and cell line results were analyzed, they had in common four down-regulated miR-92a associated mRNA, which were putative targets: CIC, FOXP1, INADL, and SMG1 (Supplementary figures 4 and 5). [score:18]
A higher expression of miR-92a and the down-regulation of FOXP1 mRNA and protein expression were also found in human samples of PMBL, while miR-92a expression was low and FOXP1 was high in DLBCL. [score:10]
Comparison of the filtered gene lists from PMBL and DLBCL patients enabled us to identify 32 down-regulated and 1 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2 (q-value < 0.05). [score:9]
Comparison of the filtered gene lists from PMBL and DLBCL patients enabled us to identify 32 down-regulated and 17 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2 (q-value < 0.05). [score:9]
Karpas wt has the same proliferation rates as Karpas hsa-miR-92a-1. FOXP1 overexpression induced by miR-92a downregulation was rescued using a siRNA targeting FOXP1 on Karpas miZip-92a cells. [score:8]
Figure 3 A. For the 8 PMBL and 9 DLBCL patients with available cryopreserved samples, the bioinformatics approach identified 4 genes, CIC, FOXP1, INADL and SMG1, as putative targets of miR-92a, down-regulated in PMBL and cell lines overexpressing miR-92a. [score:8]
A. For the 8 PMBL and 9 DLBCL patients with available cryopreserved samples, the bioinformatics approach identified 4 genes, CIC, FOXP1, INADL and SMG1, as putative targets of miR-92a, down-regulated in PMBL and cell lines overexpressing miR-92a. [score:8]
Karpas wt has the same proliferation rates as Karpas hsa-miR-92a-1. FOXP1 overexpression induced by miR-92a downregulation was rescued using a siRNA targeting FOXP1 on Karpas miZip-92a cells. [score:8]
In this study, when we compared expression level of miR-17∼92 in PMBL and DLBCL, we showed a down-regulation of every miRs in PMBL except for miR-92a, that was significantly overexpressed. [score:7]
To identify miR-92a targets in PMBL, we combined in silico miR-92a target prediction and gene expression profile in PMBL and DLBCL patient samples, and in the four cell lines (Figure 2). [score:7]
In silico target prediction for miR-92a was carried out using the CoMeTa tool (Co -expression Meta-analysis of miRNA Targets, http://cometa. [score:7]
The only gene whose expression is significantly different between transduced Karpas cells underexpressing and those overexpressing miR-92a is FOXP1 * p =< 0.001. [score:7]
To demonstrate that FOXP1 was a direct target of miR-92a, we performed a luciferase reporter activity test using 293T-cells expressing a GLuc-3′UTR [FOXP1] fusion mRNA, which were transfected with a miR-92a mimic. [score:6]
Western blot of FOXP1 on the four cell lines studied showed an overexpression of FOXP1 when miR-92a was down-regulated. [score:6]
Analyses of FOXP1 expressionQuantification of mRNA expression of putative miR-92a targets was performed from available snap-frozen samples from 8 patients with PMBL and 9 with DLBCL, and from the wild type and the two transfected Karpas cell lines, with Q-RT-PCR using GoScript™-Reverse-Transcription System (Promega, France), GoTaq [®] qPCR Master Mix (Promega, France), and taqman primers and probes for FOXP1 (Hs00544877_m1), CIC (Hs00943425_g1), SMG1 (Hs00247891_m1), and INADL (Hs00195106_m1). [score:6]
Using combined in silico prediction and transcriptomic analyses, we identified four possible down-regulated targets for miR-92a. [score:6]
NF-κB is also activated in PMBL [2, 8, 52], but FOXP1, which we identified as the target of miR-92a, is down-regulated in PMBL, and cannot be involved in the same way as in DLBCL. [score:6]
In situ analyses in PMBL and DLBCL human samples confirmed that FOXP1 RNA and protein expressions were significantly lower in PMBL than in DLBCL, in accordance with the higher miR-92a expression found in PMBL than in DLBCL. [score:5]
Figure 2Analysis of the CoMeTa database, chosen to limit the number of false positive targets by a ranking method, provided a list of 1815 putative in silico target-genes of miR-92a. [score:5]
Karpas wt also had a significantly lower apoptosis rate than Karpas hsa-miR-92a-1 cells under -expressing FOXP1 after 48h, and a higher apoptosis rate than Karpas miRZip-92a cells overexpressing FOXP1 after 72h. [score:5]
Cytometric analyses of apoptosis showed that, after 48h, Karpas miRZip-92a cells overexpressing FOXP1 had a significantly lower apoptosis rate than Karpas hsa-miR-92a-1 cells under -expressing FOXP1 (Figure 5A). [score:5]
To study the function of miR-92a in human PMBL, we transduced human Karpas cells to let them overexpress or underexpress miR-92a. [score:5]
Analysis of the CoMeTa database, chosen to limit the number of false positive targets likely to result from a ranking method, provided a list of 1815 putative in silico target-genes of miR-92a. [score:5]
B. The expression level of each putative target of miR-92a was assessed using Q-RT-PCR in the three Karpas cell lines. [score:5]
Analysis of the CoMeTa database, chosen to limit the number of false positive targets by a ranking method, provided a list of 1815 putative in silico target-genes of miR-92a. [score:5]
Figure 4 FOXP1 as target of miR-92a in PMBL A. Western blot shows a FOXP1 protein expression in Karpas miRZip-92a that was 4.4 times higher than in Karpas hsa-miR-92a-1 * p =< 0.05. [score:5]
The same comparisons were carried out for human cell lines with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) versus human cell lines with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt). [score:5]
We used the miRNA target prediction database TargetScan to identify a 7mer-A1 miR-92a-3p binding site on the FOXP1 3′UTR, which is conserved across vertebrates (Supplementary figure 6). [score:5]
Karpas wt also had a significantly lower apoptosis rate than Karpas hsa-miR-92a-1 cells (under -expressing FOXP1) after 48h, and a higher apoptosis rate than Karpas miRZip-92a cells (overexpressing FOXP1) after 72h (p < 0.05). [score:5]
There was no up-regulated miR-92a associated mRNA. [score:4]
Transcriptomic analyses showed that the down-regulated transcripts of miR-92a associated genes CIC, FOXP1, INADL, and SMG1 were highly discriminant between PMBL and DLBCL patient samples (q-val < 0.001)(Figure 3A). [score:4]
Quantification of mRNA expression of putative miR-92a targets was performed from available snap-frozen samples from 8 patients with PMBL and 9 with DLBCL, and from the wild type and the two transfected Karpas cell lines, with Q-RT-PCR using GoScript™-Reverse-Transcription System (Promega, France), GoTaq [®] qPCR Master Mix (Promega, France), and taqman primers and probes for FOXP1 (Hs00544877_m1), CIC (Hs00943425_g1), SMG1 (Hs00247891_m1), and INADL (Hs00195106_m1). [score:4]
We identified here an overexpression of miR-92a in a series of PMBL compared to DLBCL human samples, and, using a combined bioinformatics and transcriptomic approach, we showed that FOXP1 was the main target of miR-92a in PMBL. [score:4]
3′UTR assay together with protein expression analysis in transfected cell lines, enabled us to identify FOXP1 as the target of miR-92a in PMBL, a result not previously established. [score:4]
In conclusion, we demonstrated the post-transcription regulation by miR-92a through FOXP1 targeting in PMBL. [score:4]
Karpas wt cells (25×10 [4] per milliliter) were transduced with VSV-G pseudotype viral particles (Ozyme, France) (MOI [(Karpas)]=90) that included miRZip-92a anti miR-92a construct (Ozyme, France) on RetroNectin precoated dishes (Takara, Ozyme, France) to induce a low expression of miR-92a. [score:3]
D. Luciferase reporter activity test using 293T-cells expressing a GLuc-3′UTR [FOXP1] fusion mRNA, transfected with a miR-92a mimic (hsa-miR-92a-3p mimic) or a negative control (cel-miR-39-3p mimic) shows a significantly lower luciferase activity in Gluc-FOXP1-3′UTR-2 transfected cells. [score:3]
In the wild-type cell lines studied, we found that, as in human samples, miR-92a expression was significantly higher in Karpas than in SU-DHL-5 (Karpas 9.09 (Q1-Q3, 9-9.25); SU-DHL-5 3.3 (Q1-Q3, 3.16-3.31); P =< 0.002) and miR-18a significantly lower (Karpas 0.57 (Q1-Q3, 0.56-0.62); SU-DHL-5 1.17 (Q1-Q3, 0.98-1.37); P =< 0.02). [score:3]
Overall these results were in favor of FOXP1 as a target of miR-92a. [score:3]
We obtained a list of putative miR-92a targets. [score:3]
A high expression of miR-92a was induced by the inclusion of hsa-miR-92a-1 pre-miRNA construct (Ozyme, France) on RetroNectin precoated dishes. [score:3]
A. Western blot shows a FOXP1 protein expression in Karpas miRZip-92a that was 4.4 times higher than in Karpas hsa-miR-92a-1 * p =< 0.05. [score:3]
miR-92a target identification in PMBL. [score:3]
Karpas wt FOXP1 mRNA expression level was also significantly lower than Karpas miRZIP-92a (0.47 fold, p<0.001) and significantly higher than Karpas hsa-miR-92a-1 (3.44 fold, p < 0.001). [score:3]
Overall, these results demonstrated a strong association between miR-92a expression level and FOXP1. [score:3]
In addition, Kendall statistic test on Q-RT-PCR results gave a negative correlation between FOXP1 and miR-92a expression levels (tau=-0.59; p-val < 0.05)(Figure 3C). [score:3]
The tree Karpas cell lines were cultured for 7 days A. Flow cytometry analyses of the two transduced Karpas cell lines show a significantly higher apoptosis rate, using Annexin V test, in Karpas hsa-miR-92a-1 (overexpressing miR-92a) than in Karpas miRZip-92a, at 48h, 72h and 96h. [score:3]
Karpas wt FOXP1 protein expression was also lower than Karpas miRZIP-92a (2.3 times) and higher than Karpas hsa-miR-92a-1 (0.5 times). [score:3]
In addition, when these transduced cells were injected into NOD-SCID mice, a significantly higher overall survival, together with a less-severe mediastinal involvement, was observed in mice injected with Karpas cells overexpressing miR-92a. [score:3]
We found a significantly higher rate of apoptosis and lower rate of proliferation in cells overexpressing miR-92a. [score:3]
FOXP1 as target of miR-92a in PMBL. [score:3]
FOXP1 as a target of miR-92a in PMBL. [score:3]
B. FOXP1 nuclear expressing cells on smears from the four cell lines studied were significantly more numerous in Karpas miRZip-92a than in Karpas hsa-miR-92a-1 and Karpas wt (p < 0.05) (scale bar: 5μm). [score:3]
Functional analyses of miR-92a expression in PMBL cell lines. [score:3]
Figure 5The tree Karpas cell lines were cultured for 7 days A. Flow cytometry analyses of the two transduced Karpas cell lines show a significantly higher apoptosis rate, using Annexin V test, in Karpas hsa-miR-92a-1 (overexpressing miR-92a) than in Karpas miRZip-92a, at 48h, 72h and 96h. [score:3]
A combination of in silico prediction and transcriptomic analyses enabled us to identify FOXP1 as a main miR-92a target gene in PMBL, a result so far not established. [score:3]
B. Flow cytometry analyses of the two transduced Karpas cell lines show a significantly lower proliferative rate in Karpas hsa-miR-92a-1 (overexpressing miR-92a) than in Karpas miRZip-92a, at 24h, 48h, 72h and 96h. [score:3]
In the 20 DBLCL studied, there was no significant difference for miR-92a expression in GCB versus ABC subtypes (Supplementary Figure 2). [score:3]
Bioinformatic approach for miR-92a target identification. [score:3]
The normalized datasets were filtered through the CoMeTa miR-92a putative target-gene list. [score:3]
Microarray analyses and miR-92a target prediction. [score:3]
These results showed the presence of a functional miR-92a binding site on the 3′ extremity of the FOXP1 3′UTR, and thus demonstrated that FOXP1 was a target of miR-92a. [score:3]
In vivo studies using the transduced cell lines in mice enabled us to demonstrate a tumor suppressor effect of miR-92a and an oncogenic effect of FOXP1. [score:3]
Overall, these results indicated a tumor-suppressor role of miR-92a in PMBL. [score:3]
miR-92a was overexpressed in PMBL compared to DLBCL, but not to cHL. [score:2]
C. When the expression levels of FOXP1 and miR-92a were compared in PMBL and DLBCL samples, there were significantly lower levels of FOXP1 and higher levels of miR-92a in PMBL samples. [score:2]
A significantly higher expression, about 4.4 times greater of FOXP1 protein was found in Karpas miRZip-92a compared to Karpas hsa-miR-92a-1 (p < 0.05)(Figure 4A). [score:2]
We concluded to a post-transcriptional regulation by miR-92a through FOXP1 targeting in PMBL, with a clinico-pathological relevance for better characterisation of PMBL. [score:2]
MiR-92a, overexpressed in our series of PMBL human samples and Karpas cell line, can exert antagonist biological functions in experimental conditions: in the Eμ-myc Burkitt’s lymphoma mo del, it promotes c-Myc -induced apoptosis [19, 38]; in mouse embryonic fibroblasts, and in primary B-cells, it enhances c-Myc -induced cell proliferation [38]. [score:2]
Mir-92a can be tested using a simple PCR performed on small RNA fragments extracted from formalin-fixed, paraffin-embedded tissues, and FOXP1 expression can be assessed using common immunohistochemistry on paraffin sections. [score:2]
When DLBCL and cHL were compared, five miRNAs of the miR-17-92a cluster, but not miR-92a, and the miR-106a and miR-106b of the paralog clusters, were significantly overexpressed in DLBCL. [score:2]
For human cell lines, 10×10 [6] cells were collected for Karpas wt, Karpas miRZip-92a, Karpas hsa-miR-92a-1 and SU-DHL-5 wt. [score:1]
When we compared PMBL and DLBCL results for the miR-17∼92 cluster, we found that only miR-92a had a significantly higher level of expression in PMBL compared to DLBCL (PMBL median 4.64 (interquartile range (Q1-Q3), 2.47-10.75); DLBCL 1.92 (Q1-Q3, 1.08-2.87); P =< 0.001). [score:1]
We found a higher level of miR-92a in PMBL than in DLBCL, but not in cHL. [score:1]
Karpas wt has the same proliferation rates as Karpas hsa-miR-92a-1. C. Pathological study of the lung and mediastinum performed at day 40 shows an extensive mediastinal infiltration (arrows) of lymphoma cells (higher magnification) in mice injected with Karpas miRZip-92a, while mice injected with Karpas hsa-miR-92a-1 and euthanised at the same date have no mediastinal infiltration. [score:1]
5×10 [6] cells of each wild type Karpas, Karpas hsa-miR-92a-1, Karpas miRZIP-92a, Karpas miRZIP-92a + siRNA FOXP1 and Karpas miRZip-92a + siRNA scramble cell lines were cultured on a 6wells-Petri-dish for 7 days. [score:1]
For the SU-DHL-5 wt, Karpas wt, Karpas hsa-miR-92a-1 and Karpas miRZip-92a human cell lines studied, 10×10 [6] cells were used. [score:1]
miR-92a, FOXP1, and apoptosis, proliferation and tumorigenicity. [score:1]
The tumorigenicity of Karpas wt, Karpas miRZip-92a and Karpas hsa-miR-92a-1 cell lines was assessed after injection of 10×106 cells into three groups of 10 NOD-SCID mice. [score:1]
5×10 [6] cells of each wild type Karpas, Karpas hsa-miR-92a-1, Karpas miRZIP-92a, Karpas miRZIP-92a + siRNA FOXP1 and Karpas miRZip-92a + siRNA scramble cell lines were uniformly labeled in Vybrant [®] DiD cell-labeling solution (Invitrogen, France) and cultured in a 6wells-Petri-dish for 7 days. [score:1]
To perform this, we chose the 293T-cell line because it had already been efficiently transfected with miR-92a [30]. [score:1]
Since Karpas miRZip-92a mice were the first to die, whenever one mouse in this group died, a mouse from the Karpas hsa-miR-92a-1 group was also euthanised and systematic concomitant pathological analyses were performed. [score:1]
When proliferation was studied, Karpas miRZip-92a cells had a significantly higher proliferation rate after 24h than Karpas wt and Karpas hsa-miR-92a-1 cells (Figure 5B). [score:1]
Each group had intravenous injections of 10×10 [6] Karpas wt, Karpas hsa-miR92a-1 or Karpas miRZip-92a cells. [score:1]
To compare tumor extension in the different organs for Karpas miRZip-92a and Karpas hsa-miR-92a-1 cell lines at the same time-point, two other groups of 10 six-week-old NOD-SCID female mice had similar injections. [score:1]
miR-92a expression levels were measured using RT-qPCR (Supplementary figure 1) Laser-microdissection was performed on each tissue sample using a PALM-Microbeam/Zeiss system (Zeiss, Wetzlar, Germany). [score:1]
A massive involvement of mediastinal area by lymphoma cells was found in 8/10 mice injected with Karpas miRZip-92a cells but not in mice (0/10) injected with Karpas hsa-miR-92a-1 cells euthanised at the same date (Figure 5C). [score:1]
Comparison of the tumorigenicity of Karpas miRZip-92a and Karpas hsa-miR-92a-1 in tissue was performed on mice euthanised at the same time in two series of 10 mice. [score:1]
The same cells were in a second step transfected with 50nM of hsa-miR-92a-3p mimic (Exiqon, France) using lipofection. [score:1]
[1 to 20 of 91 sentences]
2
[+] score: 247
Other miRNAs from this paper: hsa-mir-92a-2, dme-mir-184, dme-mir-92a, dme-mir-310, hsa-mir-184
Potential targets should show increased mRNA levels (indicated by the Input) and/or translating mRNA levels (indicated by the immunoprecipitation (IP)/Input) with mir-92a downregulation, and decreased mRNA levels with mir-92a upregulation. [score:11]
mir-92a suppresses sirt2 translation but not mRNA levelsTo identify a mir-92a target responsible for the observed phenotypes, translating ribosome affinity purification (TRAP) was performed on flies with mir-92a either up- or downregulated throughout the circadian system (Tim-GAL4;UAS-RiboTag;UAS-mir-92aOE compared to Tim-GAL4;UAS-RiboTag/+ (control), and Tim-GAL4;UAS-RiboTag;UAS-mir-92aSP compared to Tim-GAL4;UAS-RiboTag/UAS-scramble (control)). [score:10]
The data therefore suggest that mir-92a suppresses sirt2 expression by inhibiting its translation without markedly affecting mRNA stability (Fig. 5a). [score:9]
Sirt2 RNAi phenocopies mir-92a overexpressionIf by downregulating sirt2 expression, sirt2 RNAi should phenocopy mir-92aOE. [score:8]
As nighttime light pulses are known to fire these cells 8, light/changing neuronal excitability as well as the core clock regulates mir-92a expression (Fig. 4a); this is the same conclusion drawn from the daily regulation of mir-92a expression (Fig. 1). [score:7]
In addition, mir-92a expression levels are regulated by light either directly by unknown mechanisms or indirectly through effects of light on the core clock. [score:6]
To identify a mir-92a target responsible for the observed phenotypes, translating ribosome affinity purification (TRAP) was performed on flies with mir-92a either up- or downregulated throughout the circadian system (Tim-GAL4;UAS-RiboTag;UAS-mir-92aOE compared to Tim-GAL4;UAS-RiboTag/+ (control), and Tim-GAL4;UAS-RiboTag;UAS-mir-92aSP compared to Tim-GAL4;UAS-RiboTag/UAS-scramble (control)). [score:6]
To this end, mir-92a was overexpressed, or knocked down using a miRNA sponge (SP), in PDF cells with co -expression of mCD8::GFP (PDF-GAL4;UAS-mCD8::GFP;UAS-mir-92aOE or UAS-mir-92aSP, respectively) 29. [score:6]
Cycling mir-92a levels target sirt2 by imposing higher levels of suppression at night and lower in the morning. [score:5]
The results confirm that mir-92a suppresses sirt2 expression both in vitro and in vivo. [score:5]
mir-92a suppresses sirt2 translation but not mRNA levels. [score:5]
In addition, these targets should have predicted mir-92a -binding sites in their 3′UTRs with TargetScan (http://www. [score:5]
Mef2 for example is a predicted target of mir-92a according to TargetScan and known to affect PDF projection morphology 31. [score:5]
To test whether the effect of mir-92a on neuronal excitability is restricted to PDF cells, mir-92a levels were either up- or downregulated in neurons regulating fly sleep. [score:5]
Although mir-92a knockdown in these cells had no effect (Fig. 3b), there are many possible reasons for a negative result, for example, the GAL4 driver is not sufficiently strong, or endogenous mir-92a is not well expressed in these neurons. [score:4]
Knockdown of sirt2 in flies co -expressing the mir-92aSP in dopaminergic neurons increased the sleep duration back to normal levels, indistinguishable from WT flies, indicating once again that sir2 activity is epistatic to mir-92a (Fig. 6d). [score:4]
Indeed, sleep duration is significantly increased in the overexpression flies, and sleep duration is significantly reduced when mir-92a is knocked down (Fig. 3a). [score:4]
The circadian core clock in PDF cells regulates daily cycling expression of mir-92a. [score:4]
Moreover, a mutation of the mir-92a -binding site in the 3′UTR eliminates the mir-92a suppression (Fig. 5b). [score:4]
Knockdown of mir-92a in PDF cells resulted in decreases of sleep duration in both the LP and dark period, whereas overexpression decreases and broadens evening peak activity (Supplementary Fig. 9B). [score:4]
However, in the late night at ZT21, mir-92a downregulation by light contributes to a more rapid increase in excitability and therefore facilitates the phase advance that occurs at this time. [score:4]
In contrast, the knockdown results in the opposite, namely the defasciculated state, with no significant differences between the control (scramble, PDF-GAL4;UAS-mCD8::GFP;UAS-scramble) and knockdown (mir-92aSP, PDF-GAL4;UAS-mCD8::GFP;UAS-mir-92aSP) at ZT2 but an ∼24% increase in maximal axonal crosses in the mir-92a knockdown at ZT14 (Fig. 2a and Supplementary Fig. 3). [score:4]
To confirm that mir-92a suppresses sirt2 expression by binding to the predicted site in the 3′UTR, a luciferase reporter assay was performed in S2 cells. [score:4]
These speculations about the response of mir-92a levels to light do not address the fact that overexpression or knockdown of mir-92a in PDF cells changes the magnitude of the phase shift responses (Fig. 4b). [score:4]
In both cases, these mir-92a-related miRNAs downregulate neuronal excitability, consistent with what we report here. [score:4]
However, our data gave no indication that mef2 expression is regulated by mir-92a. [score:4]
Consistent with the in vivo CaLexA results, knocking down mir-92a levels resulted in an ∼224% increase in baseline fluorescence levels at ZT18–22, and overexpression resulted in an ∼40.6% decrease at ZT6–10 (Supplementary Fig. 6). [score:4]
This was despite a similar trend as the KCl stimulation, namely decreased responses with mir-92a overexpression and increases with mir-92a knockdown (Supplementary Fig. 5). [score:4]
Overexpression of mir-92a in these neurons (TH-GAL4; UAS-mir-92aOE) might lower their excitability and therefore increase sleep. [score:3]
To this end, the Ca [2+] sensor GCaMP6 was co-expressed with either UAS-mir-92a or UAS-mir-92aSP under the control of PDF-GSG. [score:3]
Taking all the results into consideration, we suggest that mir-92a expression is under the control of light and the core molecular clock in PDF cells. [score:3]
Sirt2 RNAi phenocopies mir-92a overexpression. [score:3]
Flies expressing Tim-GAL4;UAS-RiboTag (FLAG tag) in addition to mir-92a manipulation (UAS-mir-92aOE (w1118 as control) or UAS-mir-92aSP (UAS-scramble as control)) were collected on dry ice and decapitated. [score:3]
We identified sirt2 mRNA as a mir-92a target responsible for many of the observed phenotypes (Fig. 6). [score:3]
Overexpression of mir-92a in these cells led to a significant decrease in sleep duration, consistent with the neuronal excitability hypothesis (Fig. 3b). [score:3]
mir-92a expression levels are normalized to 2S rRNA. [score:3]
Specifically, overexpression of mir-92a shows an ∼37% decrease in maximal axonal crosses at ZT2 and no significant differences in axonal crosses at ZT14 (Fig. 2a and Supplementary Fig. 3). [score:3]
mir-92a suppresses neuronal excitability. [score:3]
Flies expressing ArcLight in PDF cells (PDF-GAL4;UAS-ArcLight) in addition to mir-92a manipulation were imaged for fluorescence-level changes with KCl perfusion at 60 s and wash-out at 115 s indicated by the black bars. [score:3]
It is also plausible that other mir-92a targets are relevant. [score:3]
In addition, adulthood-specific (PDF-GSG) sirt2 RNAi decreased PDF neuron responsiveness to nicotine stimulation (Supplementary Fig. 14), comparable to the effect of mir-92a overexpression (Supplementary Fig. 5). [score:3]
Similar to the response of rno-mir-92a expression to changing neuronal excitability, light pulses in the night also rapidly change PDF cell mir-92a levels. [score:3]
In the first day of constant darkness (DD1), miRNA cycling persists but with a 4–8 h phase advance compared to LD, suggesting that light also affects mir-92a expression (Fig. 1b and Supplementary Fig. 2). [score:2]
SP represents the mir-92a sponge for the knockdown 29. [score:2]
The results indicate no detectable changes in sirt2 mRNA input levels between WT and mir-92a OE or knockdown flies, whereas the IP/Input levels anticorrelate with mir-92a levels. [score:2]
Compared with wild-type (WT) flies (w1118, PDF-GAL4;UAS-mCD8::GFP/+ in a w1118 genetic background), overexpression of mir-92a (mir-92aOE, PDF-GAL4;UAS-mCD8::GFP;UAS-mir-92aOE) specifically in PDF cells maintains projections in the fasciculated state at both ZT2 and ZT14 as indicated by non-cycling and low numbers of axonal crosses (Fig. 2a). [score:2]
This observation is consistent with an effect of mir-92a levels on neuronal excitability, with the direction of the effects possibly due to a more labile or sensitive circadian clock when the neuronal excitability of PDF cells is decreased by mir-92aOE and the opposite by the mir-92aSP. [score:2]
All of these assays indicate that mir-92a suppresses the neuronal excitability of PDF cells (Fig. 2 and Supplementary Figs 3–6). [score:2]
Compared to WT, overexpressing mir-92a significantly lowers the luciferase levels, especially during the light period (LP) when mir-92a levels are low (Fig. 2c). [score:2]
How light and firing have opposite effects on mir-92a levels at these two times and the mechanisms involved, for example, transcriptional or post-transcriptional regulation, are currently unknown. [score:2]
To address this possibility more directly, we tested how mir-92a levels affect PDF cell depolarization with high concentration of KCl, by monitoring changes in fluorescence levels of the voltage sensor ArcLight (PDF-GAL4;UAS-ArcLight;UAS-mir-92aOE or UAS-mir-92aSP); they decrease when neurons are depolarized 11. [score:2]
Manipulation of mir-92a levels in sleep -regulating neurons affects sleep duration. [score:2]
mir-92a levels in sleep -regulating neurons affects sleep. [score:2]
Clock/light regulates mir-92a oscillations in PDF cells. [score:2]
On the contrary, knocking down mir-92a increases luciferase levels, especially during the dark period when mir-92a levels are high (Fig. 2c). [score:2]
miR-92a function and neuronal excitability are therefore also upstream of the clock; this effect of mir-92a is probably indirect through its effect on firing and the effect of firing on the core clock (Fig. 7) 8. It has been previously reported that mice with lower neuronal excitability in the suprachiasmatic nucleus show bigger phase delays with an early-night light pulse. [score:2]
The same results were obtained (Supplementary Fig. 4), indicating that adult-specific manipulation of mir-92a levels changes the fasciculation–defasciculation state of the PDF termini. [score:1]
We focus here on mir-92a, as it was the only identified miRNA under core clock control and peaking during the nighttime (Fig. 1). [score:1]
We focus in this manuscript on mir-92a. [score:1]
This is similar to sirt2 RNAi in dopaminergic neurons and opposite to mir-92a null flies (Fig. 3c and 6c). [score:1]
Consistent with a homeostatic view, we speculate that the observed increase in mir-92a levels with a ZT15 early-night light pulse lowers PDF cell excitability and thereby helps keeps the flies longer in the ‘night' state, contributing to the early-night phase delay. [score:1]
mir-92a levels increased by approximately twofold in PDF cells after the ZT15 light pulse, and they decreased by ∼2.5-fold after the ZT21 light pulse (Fig. 4a). [score:1]
An independent approach to address mir-92a function was to monitor Ca [2+] levels in PDF cells using an in vivo imaging system. [score:1]
In addition, sirt2 RNAi abolished the effect of the mir-92aSP in maintaining the PDF projections defasciculated in both the day and the night, indicating that sirt2 is epistatic to (downstream of) mir-92a (Supplementary Fig. 12). [score:1]
This possibility might also be relevant to the circadian cycling of mir-92a levels. [score:1]
Light also affects the neuronal excitability of PDF cells, which changes mir-92a levels possibly through the core clock 8. Results. [score:1]
Importantly, this cluster shares the same seed sequences as mir-92a, and rat rno-mir-92a belongs to the same family as Drosophila mir-92a. [score:1]
There is no indication of residual mir-92a cycling in this background, indicating that it is indeed downstream of the core molecular clock (Fig. 1c). [score:1]
Rat mir-92a is also implicated in synaptic scaling 32, suggesting that fly. [score:1]
RT–qPCR quantification of mir-92a levels in PDF cells under LD (a) or DD (b) conditions in WT flies (PDF-GAL4;UAS-mCD8::GFP) or per [0] (per [0]; PDF-GAL4;UAS-mCD8::GFP) mutant flies under LD conditions (c). [score:1]
There is one predicted mir-92a -binding site in the sirt2 3′UTR. [score:1]
mir-92a levels in PDF cells oscillate under both 12 hour LD and DD cycles and are controlled by the molecular clock. [score:1]
mir-92a levels were manipulated in either (a) wake-promoting neurons (TH-GAL4) or (b) sleep-promoting neurons (PDFR-GAL4). [score:1]
)mir-92a levels increased by approximately twofold in PDF cells after the ZT15 light pulse, and they decreased by ∼2.5-fold after the ZT21 light pulse (Fig. 4a). [score:1]
Although robust increases of fluorescence levels were induced by 3 × 10 [−6] M nicotine, we obtained negative results with the mir-92a manipulations. [score:1]
Light pulses at night alter mir-92a levels in PDF cells and manipulation of mir-92a levels affects the phase shift response. [score:1]
Since, we wanted to test whether neuronal excitability also affects mir-92a levels. [score:1]
Manipulation of mir-92a levels affects neuronal excitability in PDF cells. [score:1]
included Ub-GAL4, UAS-mir-92a, UAS-dsRed, UAS-mir-184 and psiCHECK2. [score:1]
To further test the effect of mir-92a, nicotine was used to stimulate PDF cells and PDF-GSG was used to focus on adult-specific effects. [score:1]
mir-92a and light -induced phase shifts. [score:1]
Since sirt2 mRNA does not cycle in PDF cells 52, the purpose of cycling mir-92a levels may be to generate cycling SIRT2 levels; high levels in the morning would contribute to higher neuronal excitability at this time. [score:1]
Stem–loop qPCR confirmed the results for mir-92a (Supplementary Fig. 18). [score:1]
The results appear specific for PDF cells: the light pulses had no effects on mir-92a levels in dopaminergic neurons, which are not activated by light (Supplementary Fig. 8). [score:1]
[1 to 20 of 84 sentences]
3
[+] score: 234
Previous results inhibited that miR-92a-3p was aberrant up-regulated not only in human glioma cell lines but also in glioma samples [18], suggesting that down-regulation of miR-92a-3p may exert antitumor effects in glioma. [score:9]
More importantly, miR-92a-3p is also reported to be up-regulated in human glioma samples and regulates glioma apoptosis through targeting Bim [18]. [score:7]
The data suggested that down-regulation of miR-92a-3p result in a robust increase of mRNA and protein levels of CDH1 in glioma cell, whereas up-regulation of miR-92a-3p induced a considerable decrease in the mRNA and protein levels of Notch-1in GSCs (Figure 4B). [score:7]
In this study, we concentrated our intention on miR-92a-3p and identified that down-regulation of miR-92a-3p inhibited the malignancy of glioma cells significantly in vitro as well as impeded the formation of xenograft tumors in vivo. [score:6]
Reduction of Notch-1 by specific siRNA could also inhibit the self-renewal ability of GSCs, suggesting that miR-92a-3p affects the maintenance of stemness of GSCs by down -regulating Notch-1 expression. [score:6]
Similarly, the expression pattern of Notch-1 was also consistent with miR-92a-3p in glioma cells (Figure S1), which indicated that miR-92a-3p may regulate different targets in glioma cells and GSCs. [score:6]
As shown in Figure 6E,F, down-regulation of Notch-1 could mimic the suppression effect of miR-92a-3p mimics on the stem-like traits of GSCs. [score:6]
Over-Expression of miR-92a-3p Suppresses the Self-Renewal Ablity of Glioma Stem-Like Cells. [score:5]
Previous studies reported that miRNA could bind and silence hundreds of mRNA targets in various microenvironments [19, 20], we wonder whether the different effect of miR-92a-3p in two cell types is a multi-target result. [score:5]
To confirm this possibility, we integrated bioinformatics analysis and mRNA and protein expression profiling to detect the downstream targets of miR-92a-3p. [score:5]
In addition, elevating of miR-92a also resulted in a marked reduction in the expression of cancer stem-like cells marker CD133 and Nestin (Figure 3D), which is consistent with the inhibitory effect of miR-92a-3p on the tumor spheres formation capability of GSCs. [score:5]
The miR-92a-3p inhibitor (miR-92a-3p I), negative control (NC) inhibitor, miR-92a-3p mimics, negative control (NC) mimics, Notch-1 siRNA, and negative control siRNA (siRNA-NC) were chemically synthesized by GenePharma (Shanghai, China). [score:5]
Furthermore, forced expression of CDH1 could mimic the inhibitory role of miR-92a-3p in glioma cell metastasis. [score:5]
Shigoka M. Tsuchida A. Matsudo T. Nagakawa Y. Saito H. Suzuki Y. Aoki T. Murakami Y. Toyoda H. Kumada T. Deregulation of miR-92a expression is implicated in hepatocellular carcinoma development Pathol. [score:5]
Interestingly, the CDH1 expression was positive correlated with the expression of miR-92a-3p in GSCs. [score:5]
Glioma cells or GSCs were cultured in 96-well plates and co -transfected with wild or mutant luciferase reporter vectors and miR-92a-3p inhibitor or negative control inhibitor using Lipofectamine 2000 (Invitrogen). [score:5]
Further we wonder whether the conversed function of miR-92a-3p is mediated by CDH1 and Notch-1. In glioma cells, CDH1 expression was elevated after being transfected with an over-expressed plasmid containing only the coding region of CDH1 (Figure 6A). [score:5]
By overlapping the lists of miR-92a-3p’s targets generated by two prediction tools, we narrowed the candidate targets of miR-92a-3p down to 10 genes (Table S1) mostly involved in cell proliferation, migration, invasion, or self-renewal ability of stem cells. [score:5]
Interestingly, up-regulation of miR-92a-3p decreased the stem-like traits of glioma derived GSCs. [score:4]
As the two pathways are always activated in glioma cells and GSCs [23, 24, 25, 26], we hypothesize that CDH1 and Nocth-1 could be the direct targets of miR-92a. [score:4]
In line with previous studies, our findings revealed that knockdown of miR-92a-3p led to a marked increase of CDH1 and a subsequent decrease of the expression level of nuclear β-catenin, while the total protein level of it remains unchanged. [score:4]
Interestingly, miR-92a-3p expression level was significantly over-expressed in glioma cells compared with GSCs (Figure 3A). [score:4]
Niu H. Wang K. Zhang A. Yang S. Song Z. Wang W. Qian C. Li X. Zhu Y. Wang Y. miR-92a is a critical regulator of the apoptosis pathway in glioblastoma with inverse expression of BCL2L11 Oncol. [score:4]
The finding that knockdown of miR-92a-3p suppresses the malignancy of glioma cells raised the possibility that it may control the stem-like trait of GSCs. [score:4]
To determine the function of miR-92a-3p in glioma carcinogenesis, we assessed the role of miR-92a-3p inhibition on tumorgenesis in vivo. [score:3]
org (August 2010 Release) [50] were used to predict the potential target genes of miR-92a-3p. [score:3]
miR-92a-3p expression level was decreased by up to 80% in two glioma cell lines post -transfected with miR-92a-3p I (Figure 1A). [score:3]
Furthermore, increasing miR-92a-3p significantly inhibits the self-renewal capability of GSCs. [score:3]
The results indicated that overexpression of miR-92a-3p in GSCs impaired their ability to form tumor spheres (Figure 3C). [score:3]
Recently, miR-92a-3p, a highly conserved microRNA, was reported to predominantly express in colorectal carcinoma [27], hepatocellular carcinoma [28], and esophageal squamous cell carcinoma [29]. [score:3]
The relative expression of miR-92a-3p was detected with Quantitative reverse transcription-polymerase chain reaction (qRT-PCR). [score:3]
Depleting Endogenous miR-92a-3p Inhibits the Proliferationand Metastasis of Glioma Cells In Vitro While Preventing Xenograft Growth of Glioma In Vivo. [score:3]
In an effort to elucidate the underlying molecular mechanism of miR-92a-3p in glioma cells and GSCs, we applied bioinformatics and predicted that CDH1 and Notch-1 are the potential target genes of miR-92a-3p. [score:3]
In addition to its involvement in tumor development, miR-92a-3p has been found to be a regulator of human embryonic stem cell differentiation [30], suggesting that miR-92a-3p may be associated with the maintenance of cell stemness. [score:3]
In addition, a markedly negative correlation between the expression of miR-92a-3p and CDH1 and Notch-1 was found in glioma cells and GSCs specifically. [score:3]
Western blotting results showed that decreasing miR-92a-3p represses the protein level of nuclear β-catenin, whereas the total expression level of β-catenin remains unchanged in glioma cells (Figure 5A). [score:3]
These findings suggest that miR-92a-3p functions through targeting various pathways in glioma cells and GSCs. [score:3]
Further we identified that miR-92a-3p targeted CDH1 and Notch-1 in these cell types, respectively. [score:3]
In the present study, we observed that depression of miR-92a-3p suppressed the malignancy of glioma cells in vitro and in vivo, which are in consistent with the results that miR-92a-3p promoted the apoptosis of glioma cells [18]. [score:3]
First of all, we confirmed that miR-92a-3p expression in glioma stem-like cell lines U87s and U251s were increased after miR-92a-3p mimics transfection (Figure 3B). [score:3]
Likewise, in our study, Western blotting analysis demonstrated that the expression of Notch-1 and Akt phosophorylation were reduced significantly in GSCs post-transfection of miR-92a-3p mimics. [score:3]
Collectively, these data demonstrated that miR-92a-3p targeted CDH1/β-catenin and Notch-1/Akt signaling pathways in glioma cells and GSCs, respectively. [score:3]
Mechanically, we demonstrated that miR-92a-3p targeted CDH1/β-catenin signaling in glioma cells, while Notch-1/Akt signaling was the downstream pathway of miR-92a-3p in GSCs. [score:3]
The above results revealed that miR-92a-3p could diminish the stemness of GSCs as a tumor suppressor. [score:3]
Interestingly, these results demonstrated that miR-92a-3p could serve as either an onco-miR or a tumor suppressor or in different cell types. [score:3]
2.4. miR-92a-3p Targets CDH1 in Glioma Cells While Bingding to the 3’UTR of Notch-1 in GSCs. [score:3]
miR-92a-3p controlled these phenotypes by targeting CDH1 and Notch-1 and subsequently affected the β-catenin and Akt signaling pathways in a context -dependent manner. [score:3]
These data suggested that the negative regulation of miR-92a-3p I on the migration and invasion ability of glioma cells was partly by blocking CDH-1/β-catenin signaling pathway. [score:2]
Together, these results implied that miR-92a-3p could directly acts on CDH1 or Notch-1 in a context -dependent manner. [score:2]
These data revealed that miR-92a-3p may play critical roles in the development of glioma. [score:2]
It has been reported that miR-92a-3p act like an onco-miR in human colorectal cancer cells through regulating the PTEN/PI3K/AKT signaling pathway [17]. [score:2]
Transwell assay implied that inhibition of miR-92a could markedly attenuate both glioma cell migration and invasion. [score:2]
However, the expression level of miR-92a-3p was reduced in GSCs when compared with it in glioma cells. [score:2]
These results strongly suggested that CDH1 and Notch-1 play an essential effect in the regulation of miR-92a-3p on glioma cells and GSCs, respectively. [score:2]
The above results suggested that miR-92a-3p may play a part in the maintenance of glioma proliferation and metastasis in vitro. [score:1]
Therefore, we proposed that CDH1/β-catenin and Notch-1/Akt may be the downstream signaling pathway of miR-92a-3p in two cell types. [score:1]
As a consequence, the migration and invasion ability was markedly repressed, which is consistent with the effect of miR-92a-3p I on glioma cells (Figure 6B,C). [score:1]
GSCs were dissociated to single cells and transfected with miR-92a-3p mimics or negative control mimics as described above. [score:1]
As displayed in Figure 1E,F the volumes and weights of tumors were prominent decreased in the miR-92a-3p I group in comparison with the NC group. [score:1]
The luciferase activity of wild-type 3′ UTR of CDH1 was much greater in the miR-92a-3p I group than that of the NC group. [score:1]
Ke T. W. Wei P. L. Yeh K. T. Chen W. T. Cheng Y. W. miR-92a promotes cell metastasis of colorectal cancer through PTEN -mediated PI3K/AKT pathway Ann. [score:1]
In an effort to examine the function of miR-92a-3p on GSCs, qRT-PCR analysis was used to investigate the miR-92a-3p expression pattern in glioma cells and GSCs. [score:1]
CDH1and Notch-1 Is Required for miR-92a-3p to Exert Various Effects in Gliomas and GSCs, Respectively. [score:1]
To test this hypothesis, miR-92a-3p I was uesd to deplete endogenous miR-92a-3p in U87 and U251 cell lines. [score:1]
Furthermore, luciferase reporter plasmids of the wild-type or mutant 3′ UTR region of CDH1 and Notch-1 were conducted and co -transfected with miR-92a-3p I and miR-92a-3p mimics, respectively. [score:1]
When the mean tumor volume reached about 100 mm [3], 200 pmol NC or miR-92a-3p I in 10 µL Lipofectamine 2000 were treated with all nude mice every two days for 28 days. [score:1]
Meanwhile, the Luciferase intensity of wild type 3′ UTR of Notch-1 was lower when co -transfected with miR-92a-3p mimics in GSCs. [score:1]
2.5. miR-92a-3p Affected Glioma and GSCs Differently by Acting on CDH1/β-Catenin and Notch-1/Akt Signaling Pathways. [score:1]
miR-92a-3p belongs to the miR-17-92 family that plays a critical role in modulating cell viability, apoptosis and metastasis [15, 16]. [score:1]
We further estimate the function of miR-92a-3p on the self-renewal capability of GSCs. [score:1]
As illustrated in Figure 5B, increasing miR-92a-3p reduced the phosphorylation level of Akt in GSCs. [score:1]
When the tumor volume reached about 100 mm [3], all nude mice were treated with 200 pmol miR-92a-3p I or scramble oligo combined with 10 µL Lipofectamine 2000 via local injection of the established xenograft tumor once every two days for 28 days. [score:1]
Chen Z. L. Zhao X. H. Wang J. W. Li B. Z. Wang Z. Sun J. Tan F. W. Ding D. P. Xu X. H. Zhou F. microRNA-92a promotes lymph node metastasis of human esophageal squamous cell carcinoma via E-cadherin J. Biol. [score:1]
Similarly, the number of invaded cells was also markedly reduced in glioma cells after treatment with miR-92a-3p I (Figure 1D). [score:1]
Tsuchida A. Ohno S. Wu W. Borjigin N. Fujita K. Aoki T. Ueda S. Takanashi M. Kuroda M. miR-92 is a key oncogenic component of the miR-17–92 cluster in colon cancer Cancer Sci. [score:1]
In summary, our current results reported the multiple functions of miR-92a-3p on the malignancy of glioma cells and self-renewal of GSCs for the first time. [score:1]
The wild-type or mutant CDH1/Notch-1 3′ UTR luciferase reporter containing the predicted binding site for miR-92a-3p was chemical synthesized and cloned to the pGL3-Control Vector (Promega, Madison, WI, USA). [score:1]
How does miR-92a-3p exert conversed effects in glioma cells and GSCs? [score:1]
As illustrated in Figure 1B, the proliferation rate was significantly lower from day 3 to 5 in the miR-92a-3p I group than that in the negative control (NC) group. [score:1]
[1 to 20 of 79 sentences]
4
[+] score: 196
In the colon, up-regulated miR-17-92a promotes neoplasia through various pathways, e. g. miR-18a and miR-19 directly repress TSP-1 and CTGF, respectively, to promote angiogenesis [24] and miR-92a down-regulates BCL2L11 expression thereby reducing apoptosis [44]. [score:10]
n = 3 Previous studies revealed a miR-92 target sequence in the 3′ UTR of p57, a tumor suppressor; miR-92 binding to this site inhibits p57 expression in a variety of cancers [16, 35, 36]. [score:9]
Over-expressed miR-92a inhibits p57 mRNA translation, thus attenuating the cellular actions of p57 protein. [score:7]
Fig. 6HDAC inhibitors, SAHA and valproic acid, suppressed expression of pri-miR-17-92a, miR-92a and c-Myc in colon cancer cells. [score:7]
Fig. 7Over -expression of miR-92a attenuates butyrate -induced p57 expression by blocking p57 translation. [score:7]
As shown in Fig.   6a, we observed a 5-fold decrease in pri-miR-17-92a expression following treatment with 5 μM SAHA or 1 mM valproic acid for 24 h. SAHA or valproic acid treatment also down-regulated the level of mature miR-92a level of by ~30 % (Fig.   6b). [score:6]
Effects of other HDAC inhibitors, SAHA and valproate, on miR-92a and c-Myc expression. [score:5]
The effect of butyrate on p57 mRNA translation is mediated via reduced c-Myc protein expression, which decreases miR-17-92a cluster transcription and miR-92a levels. [score:5]
In HCT-116 cells, we tested the effects of two other HDAC inhibitors, SAHA and valproic acid [32– 34], on miR-92a and c-Myc expression in HCT-116 cells. [score:5]
Exogenous miR-92a inhibited butyrate -induced p57 expression and reversed the beneficial actions of butyrate on colon cancer cell proliferation and apoptosis. [score:5]
These results suggest that miR-92a inhibits p57 translation, not transcription. [score:5]
These results show that maintaining high level c-Myc expression is essential for miR-17-92a transcription and that silencing c-Myc expression mimics the effects of butyrate treatment on miR-92a transcription. [score:5]
As a first step to understanding how expression of this cluster is regulated, we used miRNA microarrays to analyze miR-92a expression in colon cancer compared to adjacent normal colon tissue from the same individual. [score:5]
Butyrate c-Myc miR-92a HDAC inhibitor miRNA p57 Colon cancer Disruption of the unique balance between dietary residue, intestinal flora and the host colonic mucosa that maintains intestinal homeostasis may trigger or promote diseases of the colon, including neoplasia. [score:5]
Adding exogenous miR-92a reversed butyrate -induced p57 expression, growth inhibition, and apoptosis. [score:5]
Often, p57 is epigenetically silenced in cancer [45, 46], partially due to transcriptional regulation by histone deaceylation/methylation and translational regulation by miRNAs such as miR-221/222, miR-25, miR-92b and miR-92a (Fig.   9a) [16, 35, 47– 49]. [score:5]
c-Myc knockdown significantly reduced expression of pri-miR-17-92a (Fig.   4c) and mature miR-92 (Fig.   4d). [score:4]
As shown in Fig.   1c, 24-h treatment of HCT116 cells with 2 mM butyrate down-regulated the levels of all pri-miR-17-92a, pre-miR-92a, and mature miR-92a. [score:4]
As shown in Fig.   1a, in each of five paired samples we observed increased miR-92a expression in cancer compared to normal colon; mean miR-92a expression was seven-fold greater in the cancer samples. [score:4]
Here, we hypothesized that in colon cancer microbe-derived butyrate suppresses oncogenic miR-92a via regulation of c-Myc. [score:4]
These results suggested that butyrate’s effects on miR92a inhibition were likely mediated by transcriptional regulation of pri-miR-17-92a and less likely a consequence of altered miRNA processing. [score:4]
To reveal the mechanism whereby butyrate regulates miR-92a expression, we examined the effects of butyrate treatment over 24 h in HCT116 cells. [score:4]
Silencing c-Myc protein expression reduced levels of miR-92a. [score:3]
Fig. 9Butyrate decreases c-Myc and miR-92a levels and increases p57 expression in colon cancer cells. [score:3]
Silencing c-Myc expression reduced miR-92a levels. [score:3]
Inhibition of pri-miR-17-92a, pre-miR-92a and miR-92a by butyrate was confirmed in a second human colon cancer cell line, HT29 (Fig.   1d). [score:3]
Fig. 8Over -expression of miR-92a reverses butyrate -induced effects on colon cancer cell proliferation and apoptosis. [score:3]
As shown in Fig.   8c, butyrate -induced reduction of HCT116 cell proliferation was significantly reversed by over -expressing miR-92a. [score:3]
Again, butyrate -induced inhibition of colon cancer cell proliferation was attenuated by adding miR-92a but not control miRNA (Fig.   8e). [score:3]
To overexpress miR-92a, an engineered miR-92a mimetic molecule (Ambion’s Pre-mir MiRNA Precursor Molecules) was used to transfect HCT116 cells according to the manufacturer’s protocol. [score:3]
Butyrate treatment diminishes miR-92a over -expression in human colon cancer cells. [score:3]
Our findings identify a novel cellular mechanism whereby butyrate inhibits miR-92a transcription by reducing c-Myc, thus augmenting p57 levels. [score:3]
Effects of butyrate treatment on miR-92a and c-Myc expression. [score:3]
Fig. 4Effect of silencing c-Myc expression on miR-92a in HCT116 cells. [score:3]
Anti-proliferative actions of butyrate are attenuated by over -expressing miR-92a. [score:3]
To elucidate the mechanism underlying miR-92a effects on p57 expression, we transfected miR-92a -mimic molecules into HCT116 cells. [score:3]
Fig. 2Time course of changes in expression of miR-92a, c-Myc, Drosha and p57 following butyrate treatment. [score:3]
Butyrate treatment of both HCT116 and HT29 human colon cancer cells reduced the levels of primary miR-17-92a (pri-miR-17-92a), precursor, and mature miR-92a; these effects were shared by other HDAC inhibitors (suberoylanilide hydroxamic acid (SAHA) and valproic acid). [score:3]
The effects of butyrate and other histone deacetylase inhibitors (suberoylanilide hydroxamic acid (SAHA) and valproic acid) on primary (pri-miR17-92a), precursor and mature miR-92a were analyzed in HCT-116 and HT-29 human colon cancer cells using qPCR. [score:3]
Simultaneously, butyrate decreases miR92a levels, thereby permitting p57 mRNA translation (Fig.   9b). [score:3]
In addition to the aforementioned miR-17 and miR-20a, the miR-17-92a cluster encodes miR-18a, miR-19a/b and miR-92a. [score:1]
Using both microarray and qPCR, we detected increased miR-92a levels in sporadic human colon cancer. [score:1]
Collectively, these findings support a key role for miR-92a in mediating the functional effects of butyrate treatment on colon cancer cells. [score:1]
Transfection with exogenous miR-92a attenuates butyrate-stimulated p57 protein induction. [score:1]
Butyrate induced a seven-fold increase in p57 mRNA levels, an effect unaltered by miR-92a mimetics (Fig.   7c). [score:1]
Collectively, the interactions between butyrate, c-Myc, miR-92a and p57 mediate butyrate’s anti-proliferative and pro-apoptotic effects, both relevant to colon neoplasia The actions of butyrate exemplify interactions between diet, bacteria, and host epithelial cells that are critical to maintaining gut homeostasis. [score:1]
HCT116 human colon cancer cells were transfected with miR-92a mimetics or control miRNA (miR-C) using Lipofectamine 2000 and then treated with 2 mM butyrate for 24 h prior to harvest. [score:1]
In the present study, we demonstrate a parallel pathway involving miR-92a and p57 that contributes to butyrate’s anti-cancer effects (Fig.   9). [score:1]
In contrast, butyrate induction of p57 protein levels was significantly attenuated by transfection with miR-92a mimetics (Figs.   7d and e). [score:1]
We analyzed the effects of treating HCT116 and HT29 human colon cancer cells with the same dose (2 mM) of butyrate on miR-92a expression using qPCR to measure the abundance of primary (pri-miR-17-92a and pri-miR-106a-92a), precursor (pre-miR-92a), and mature miR-92a. [score:1]
Silencing c-Myc in HCT116 cells decreased C12 orf25 promoter activity and levels of both pri-miR-17-92a and mature miR92a, thus mimicking the actions of butyrate. [score:1]
To examine the role of miR-92a in mediating butyrate’s anti-proliferative and pro-apoptotic actions, prior to butyrate exposure HCT116 cells were transfected with exogenous miR-92a or control miRNA (miR-C), the same treatment as Fig.   7b- e. Butyrate -induced cleavage of caspase-3 was attenuated by exogenous miR-92a but not control miRNA (Fig.   8a and b). [score:1]
With butyrate treatment, mature miR-92a decreased gradually whereas pre-miR-92a and pri-miR-17-92a showed much steeper initial declines; pri-miR-17-92a levels in particular dropped sharply within the first 2 h after butyrate treatment. [score:1]
In response to butyrate treatment, we observed a 10-fold decrease in the initial miRNA transcript, pri-miR17-92a, and the levels of pre-miR-92a and mature miR-92a were decreased by 67 % and 52 %, respectively (Fig.   1c). [score:1]
Treating human colon cancer cells with butyrate reduced the levels of pri-miR17-92a, precursor and mature miR-92a, as well as c-Myc. [score:1]
In HCT116 cells with control and reduced levels of c-Myc expression, qPCR was used to measure the abundance of c pri-miR-17-92a and d miR-92a. [score:1]
As shown in Fig.   7b, transfection with miR-92a mimetics rescued cells from the effects of butyrate treatment, maintaining high levels of miR-92a. [score:1]
Thus, miR-92a -dependent p57 induction may contribute to butyrate’s anti-cancer effects. [score:1]
c Relative cell count after miR-92a transfection and butyrate treatment. [score:1]
b HCT116 cells were transfected with miR-92a mimetics or control miRNA (miR-C) using Lipofectamine 2000 then treated with 2 mM butyrate for 24 h prior to harvest. [score:1]
Following butyrate treatment and miR-92a -mimic transfection, apoptosis was analyzed by and caspase-3 immunoblotting. [score:1]
In HCT116 and HT29 human colon cancer cells, butyrate treatment reduced miR92a levels at all processing stages, amongst which the initial pri-miR-17-92a transcripts showed the most rapid and largest declines after butyrate treatment. [score:1]
[1 to 20 of 62 sentences]
5
[+] score: 182
The results suggested that the expression of miR-92 was upregulated in C33A-pEGFP-N1-16E6 cells and downregulated in HPV16 E6-knockdown cells. [score:10]
The downregulation of miR-92 may lead to an increase in the apoptosis of SiHa cells, which correlates with the activation of caspase-3. PTEN protein expression is significantly downregulated in cervical cancer. [score:9]
To confirm whether miR-92 expression may affect cervical cancer cells, the present study examined the expression of miR-92 in 34 cervical cancer tissue samples and 34 normal cervical tissue samples The results revealed the level of miR-92 expression in the cervical cancer tissues to be significantly higher than in the normal cervical tissues. [score:7]
qPCR demonstrated that the inhibition of endogenous miR-92 by anti-miR-92 resulted in an upregulation of PTEN mRNA (Fig. 5B). [score:6]
miR-92 expression was observed to be downregulated following the transfection with E6 siRNA (Fig. 2E). [score:6]
The expression of miR-92 was downregulated following transfection with the E6 siRNA (P<0.05; Fig. 2H). [score:6]
Correlation between HPV16 infection and the upregulation of miR-92 expression in cervical cancer. [score:6]
org/) has predicted hundreds of miR-92 targets and the tumor suppressor PTEN is one of the most prominent. [score:5]
It has been reported that the decreased expression of miR-92 may decrease cancer cell proliferation and increase the levels of PTEN, BCL2L11 and CDKN1A expression (19). [score:5]
The tumor suppressor gene, PTEN, was significantly downregulated in the SiHa-miR-92 -mimic cells compared with the SiHa-NC cells. [score:5]
miR-92 has been shown to post-transcriptionally inhibit PTEN expression in various types of human cancer cells. [score:5]
Effects of miR-92 on the regulation of PTEN protein expression in SiHa cells. [score:4]
Increases or decreases in the expression of miR-92 may alter multiple biological processes in human cervical cancer cells, including proliferation, apoptosis and migration, most likely through the regulation of the PTEN protein. [score:4]
These results suggest that miR-92 upregulation may play a role in the malignant progression of cervical cancer. [score:4]
To determine the effects of miR-92 on PTEN protein expression in cervical cancer, anti-miR-92 and the miR-92 mimic were transfected into the SiHa cells. [score:3]
PTEN is a potential target of miR-92, which has been reported in a number of human tumors. [score:3]
The effects of miR-92 on the endogenous expression of PTEN were then examined. [score:3]
qPCR was used to detect miR-92 expression. [score:3]
This indicated that HPV16 infection induces carcinogenesis, most likely by altering the expression of specific miRNAs, including miR-92. [score:3]
From these results, it was concluded that the overexpression of miR-92 may be partially caused by HPV16 infection. [score:3]
The expression of miR-92 increased 5.74-fold following the transfection of pEGFP-N1-16E6 into the C33A cells (P<0.05; Fig. 2F). [score:3]
A western blot analysis revealed that the expression levels of the PTEN protein in the SiHa cells that were transfected with anti-miR-92 were higher than in those that were transfected with the miR-92 -mimic (Fig. 4D). [score:3]
HPV16 E6 is able to increase miR-92 expression in SiHa- and C33A-pEGFP-N1-16E6 cells. [score:3]
miR-92 expression was 3.79-fold higher in the SiHa cells than in the C33A cells (Fig. 2A). [score:3]
Standard curves were generated and the relative amount of miR-92 expression was normalized to U6 snRNA. [score:3]
Following 6 h of transfection, miR-92 expression was detected using qPCR. [score:3]
miR-92 expression in cervical cancer tissues. [score:3]
Elucidating the role of miR-92 requires further research with regard to the number of tumor vessels that are involved in cervical disease. [score:3]
The present study aimed to examine miR-92 expression in HPV16 -positive squamous cervical carcinomas (SCCs). [score:3]
In conclusion, miR-92 is overexpressed in SCC tissues and cervical cancer cell lines. [score:3]
However, miR-92 may be the superior biomarker due to its broad impact on several targets and pathways involved in cervical cancer. [score:3]
miR-92 expression levels were shown to be 8.67-fold higher in the SiHa-miR-92 mimic cells than in the SiHa cells (Fig. 3A). [score:3]
miR-92 expression was quantified in 34 tumor samples and 34 normal cervical tissues using qPCR (Fig. 1A). [score:3]
As in previous studies conducted on other types of cancer, miR-92 was observed to be able to dramatically increase cell proliferation, inhibit apoptosis and promote cell migration in cervical cancer lines. [score:3]
Oncogenic miR-92 has been reported to be frequently overexpressed in a variety of human cancers (18). [score:3]
Therefore, the present data indicate that miR-92 plays a number of roles in the development of cervical cancer. [score:2]
miR-92 expression was 5.56-fold higher in the SCC tissues compared with the corresponding non-tumor tissues. [score:2]
Effects of miR-92-knockdown on caspase-3 -dependent apoptosis in SiHa cells. [score:2]
qPCR revealed that miR-92 expression was 3.56-fold higher (Fig. 1B) in the HPV16 -positive cervical cancer tissues compared with the HPV16 -negative tissues. [score:2]
The invasive activity of the SiHa cells increased following transfection with the miR-92 -mimic. [score:1]
The overexpression of miR-92 in the HPV16 -positive cervical cancer tissues and SiHa cells prompted an investigation into the possible roles that miR-92 may play in tumorigenesis. [score:1]
The SiHa cells were transfected with miR-92 -mimic, anti-miR-92 and NC using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:1]
The roles of miR-92 and PTEN were investigated in cervical cancer cell lines and the introduction of miR-92 was analyzed with regard to PTEN protein and mRNA expression. [score:1]
A qPCR analysis of miR-92 was used to detect the transfection efficiency. [score:1]
SiHa cells (1×10 [6]) were transfected with anti-miR-92 or anti-miRNA-NC for 48 h. The cells were suspended in 200 μl PBS and subcutaneously injected into the right and left posterior flanks of the same female BALB/c athymic nude mouse. [score:1]
To further examine the effects of miR-92 on the in vivo growth of cervical carcinoma, anti-miR-92 and NC -transfected SiHa cells were independently injected subcutaneously into the two anterior flanks of the same nude mouse. [score:1]
Effects of miR-92 on SCC cell proliferation in vitro. [score:1]
Effects of miR-92 on cell migration. [score:1]
The miR-17-92 cluster encodes six miRNAs, miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92, which are located in a coding region of the open reading frame (ORF) of the C13orf25 gene (6– 8). [score:1]
The SiHa cells were transfected with the miR-92 -mimic and NC in 6-well plates. [score:1]
The miR-92 -mimic, anti-miR-92, negative control (NC), E6 siRNA and E6 siRNA-NC were purchased from Shanghai GenePharma Co. [score:1]
The identification of oncogenic miR-92 may serve as a biomarker for SCC. [score:1]
HPV16 E6 siRNA was transfected into SiHa cells and the pEGFP-N1-HPV16E6 plasmid and HPV16 E6 siRNA were transfected into C33A cells in order to detect the correlation between HPV16 E6 and miR-92. [score:1]
Whether miR-92 has any association with HPV remains undetermined. [score:1]
To further analyze the possible mechanisms underlying the increased sensitivity of the SiHa cells caused by anti-miR-92, the rate of apoptosis at 48 h post-transfection was detected in the SiHa cells that were transfected with anti-miR-92 and NC. [score:1]
However, the correlation between miR-92 and PTEN has not previously been reported in cervical cancer. [score:1]
The tissue structure and cell morphology of the SiHa cells that were transfected with anti-miR-92 did not differ from those that were transfected with the NC miRNAs (Fig. 6A), however, fewer tumors formed (7/10 vs. [score:1]
In order to further investigate the role of miR-92 in cervical cancer, miR-92 expression levels were assessed in HPV16 -positive and HPV16 -negative cervical cancer tissues. [score:1]
The Transwell method was used to determine the effects of miR-92 on cell migration. [score:1]
To elucidate the mechanisms underlying the increase in chemosensitivity induced by miR-92, the effects of miR-92 on apoptosis were analyzed using SiHa cells. [score:1]
However, the correlation between PTEN and miR-92 in cervical cancer remains unknown. [score:1]
These findings indicate that miR-92 is involved in the proliferation of SCC. [score:1]
Effects of anti-miR-92 on tumorigenesis in cervical cancer xenografts. [score:1]
However, our understanding of the potential role of miR-92 in cervical cancer remains limited. [score:1]
These results indicate that miR-92 increases proliferation and invasion in cervical cancer cells. [score:1]
The miR-92 expression fold change was evaluated using the 2 [−ΔΔCt] method. [score:1]
The SiHa cells were transfected with miR-92 -mimic and NC. [score:1]
The correlation between miR-92 expression and clinical status was also evaluated. [score:1]
[1 to 20 of 68 sentences]
6
[+] score: 181
Consistently with the up-regulation of the miR-17∼92 cluster in tumors, miR-92a is highly expressed in colon cancer tissues and targets the anti-apoptotic molecule BCL-2-interacting mediator of cell death (BIM) and the tumor suppressor PTEN [9], [10]. [score:10]
MiR-92a was shown to be down-regulated in endothelial cells by shear stress and its inhibition increased the expression of anti-atherosclerotic factors such as Krüpple-like factor 2 (KLF2) and the deacetylase SIRT1 leading to an improved vascular healing and inhibition of atherosclerosis [13]– [16]. [score:9]
Such targets may include BMP7 and Smad7, which are predicted targets of miR-92a, and p63, which is a validated target of miR-92a [21]. [score:7]
Analysis of the phenotype of mice overexpressing miR-92a targets revealed that mice overexpressing PTEN also showed a dwarfism [25]. [score:7]
For the generation of conditional endothelial, cardiomyocyte- or hematopoietic-miR-92a knock-out mice (miR-92a [fl/fl]Tie2-Cre, miR-92 [fl/fl]αMHC-Cre and miR-92 [fl/fl]Vav-Cre), the miR-92a recombined chimeric mice were first bred with C57BL/6J wild type and Flp recombinase expressing deleter mice to excise the neomycin selection cassette and then mated with the respective Cre deleter lines expressing Cre recombinase under the control of Tie2, αMHC or Vav promoter. [score:6]
To determine whether the deletion of miR-92a might have affected the expression of other cluster members, we additionally detected all other mature members of the family and paralog miRNAs that might have been compensatory up-regulated. [score:6]
The polycistronic miR-17∼92 cluster, which comprises the mature miRNAs miR-17, -18a, -19a/b, -20a, and miR-92a, contributes to the pathogenesis of a variety of human diseases, including cancer, cardiovascular disease and congenital developmental defects [2], [4], [5]. [score:6]
MiR-92a has several predicted or validated additional targets that were shown to regulate skeletal development and likely a combination of derepressed targets contributes to the observed phenotype. [score:6]
In the cardiovascular system, inhibition of miR-92a enhances neovascularization after hind limb or myocardial ischemia [11] and a pro-angiogenic effect after miR-92a inhibition contributed to fracture healing [12]. [score:5]
The molecular targets, through which miR-92a regulates skeletal development, are unclear. [score:5]
The miR-92a [−/−] phenotype partially copies the previously reported skeletal development defects of miR-17∼92 cluster knock-out mice [6] and of humans with a reduced expression of the cluster [7]. [score:5]
Moreover, inactivation of miR-92a in zebrafish increased noggin3 expression leading to an inhibition of Bmp signaling and abnormal behavior of chondrogenic progenitors during pharyngeal cartilage formation [24]. [score:5]
These findings identify a regulatory function for miR-92a in growth and skeletal development, whereas miR-92a is not responsible for other defects in heart or B cell development that were observed in miR-17∼92 cluster mutants. [score:4]
Since PTEN is a known target of miR-92a [10], one may speculate that a de-repression of PTEN during embryonic development may have contributed to the observed organ size reduction of miR-92a [−/−] mice. [score:4]
Here, we demonstrate that genetic deletion of miR-92a does not affect heart and lung development or B cell survival, but reflects the skeletal development defects observed in full cluster knock-outs. [score:4]
MiR-92a [−/−] mice, generated as described above, lack miR-92a expression in various tissues (Figure 1A/B, Figure S1A/B). [score:3]
Expression levels of miR-92a paralog miRNAs miR-25 (C) and miR-363 (D) in heart of WT and miR-92a [−/−] mice. [score:3]
These findings are in agreement with studies showing that pharmacological inhibition of miR-92a does not influence skeletal anabolic responses to mechanical loading [18]. [score:3]
Moreover, we did not observe effects of miR-92a inhibition on osteoblast or chondrocytes proliferation or apoptosis in vitro (data not shown). [score:3]
Moreover, pharmacological inhibition of miR-92a even promoted fracture healing [12]. [score:3]
The constitutive and conditional deletion of miR-92a-1, which is expressed by the miR-17∼92 cluster, was generated by homologous recombination in 129Sv/Pas embryonic stem (ES) cells by genOway (Lyon, France). [score:3]
Expression of miR-92a and other cluster members. [score:3]
This may be explained by the fact that miR-92a is profoundly induced in ischemic tissue and inhibition of miR-92a may preferentially block this response. [score:3]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
A defect in vascular or heart development was further excluded by demonstrating that mice lacking miR-92a in endothelial cells or cardiomyocytes showed no embryonic or postnatal developmental defect (Figure S3G/H). [score:3]
For this purpose, a targeting vector containing the homologous genomic miR-92a-1 sequences flanked by loxP sites and a neomycin gene flanked by FRT sites was used. [score:3]
MiR-92a [−/−] show growth and skeletal development defectClose examination of miR-92a [−/−] mice revealed that the body weight was reduced in miR-92a [−/−] mice during postnatal development and adulthood in both males and females (Figure 3A/B, Figure S5). [score:3]
The current study additionally documents that miR-92a regulates skeletal development. [score:3]
This is consistent with our previous findings showing that pharmacological miR-92a inhibition only increased angiogenesis after induction of ischemia, whereas no change of capillary density occurred in non-ischemic control tissue [11]. [score:3]
For the generation of constitutive miR-92a deficient mice (miR-92a [−/−]), the miR-92a recombined chimeric mice were bred with a deleter line constitutively expressing the Cre recombinase. [score:3]
Expression levels of the miR-17∼92 cluster members in lower leg muscles of the hind limbs (A) and femurs (B) of WT, miR-92a [+/−] and miR-92a [−/−] mice. [score:3]
However, the present study suggests that miR-92a predominantly contributes to developmental defects but seems not to interfere with bone metabolism. [score:2]
The lack of defects in the hematopoietic system is further supported by the findings that miR-92a [fl/fl]Vav-Cre mice lacking miR-92a in hematopoietic cells do not show any phenotype during embryonic or postnatal development (Figure S4I). [score:2]
As shown in Figure 3D, miR-92a [−/−] embryos showed a reduced weight at embryonic day E15.5 indicating that the growth retardation occurs during embryonic development. [score:2]
Close examination of miR-92a [−/−] mice revealed that the body weight was reduced in miR-92a [−/−] mice during postnatal development and adulthood in both males and females (Figure 3A/B, Figure S5). [score:2]
Representative pictures (E) and quantification (F) of the vascularization of the lower leg muscles of the hind limb of adult female WT and miR-92a [−/−] mice determined as ratio of laminin stained capillaries (white) and isolectin stained capillaries (green). [score:1]
At both time points, the number of miR-92a [−/−] mice reflected the expected Men delian ratio (Figure S2). [score:1]
Although miR-92a was shown to profoundly affect endothelial cell functions in vitro and in vivo [11], [13], we did not observe a change in capillary density in uninjured miR-92a [−/−] mice. [score:1]
Thus, miR-92a [−/−] mice were smaller than their littermates, showed reduced skull size and tibia length and exhibit the typical shortening of the 5 [th] mesophalanx bone as it has been reported for miR-17∼92 [Δ/+] mice [7]. [score:1]
miR-92a flox forw: AATGTGTGTCTTAGAGGCCTAGTAGTGAAGAGG. [score:1]
Moreover, in skeletal tissue only miR-18a was slightly reduced in miR-92a [−/−] mice. [score:1]
MiR-92a [−/−] show growth and skeletal development defect. [score:1]
Constitutive deletion of miR-92a in mice causes skeletal defects. [score:1]
However, none of the cell populations differed in WT versus miR-92a [−/−] mice (Figure 2). [score:1]
Observed as well as by Men delian ratios predicted percentage of E9.5 (A) and E15.5 (B) WT, miR-92a [+/−] and miR-92a [−/−] embryos derived from mating miR-92a [+/−] mice. [score:1]
miR-92a KO rev: AAGACATTAGTAACCCACCCCCATTCC. [score:1]
Observed as well as by Men delian ratios predicted percentage of miR-92a [fl/fl] and miR-92a [fl/fl]Tie2Cre [+/−] mice (endothelial cell and progenitor-specific miR-92a deletion) (G) and miR-92a [fl/fl]αMHC-Cre [+/−] mice (cardiomyocyte-specific miR-92a deletion) (H) derived from mating miR-92a [fl/fl] with either miR-92a [fl/fl]Tie2Cre [+/−] or miR-92a [fl/fl]αMHC-Cre [+/−] mice. [score:1]
miR-92a flox rev: CACCCCCATTCCTGAAAGCTTATAGC. [score:1]
To determine at which time point miR-92a [−/−] mice are dying, we harvested embryos at E9.5 and E15.5. [score:1]
Body weight of female juvenile (A) and adult (B) WT, miR-92a [+/−] and miR-92a [−/−] mice. [score:1]
However, the contribution of miR-92a for the observed defects in miR-17∼92 cluster deficient mice has not been elucidated. [score:1]
Bone density was not affected in adult miR-92a [−/−] mice, suggesting that deletion of miR-92a at least under baseline conditions does not significantly affect bone metabolism. [score:1]
Figure S2Proportion of miR-92a [−/−] embryos is in accordance with the expected Men delian ratio. [score:1]
Generation of constitutive and conditional miR-92a deficient mice. [score:1]
A SkyScan 1176 micro-CT system (RJL Micro & Analytic GmbH, Karlsdorf-Neuthard, Germany) was used to perform oversize scans of WT and miR-92a [−/−] mice with the following settings: 180°C scan; rotation step = 2.5 deg. [score:1]
All other cluster members and the paralog microRNAs miR-25 and miR-363 were not changed in miR-92a [−/−] mice (Figure S1C/D). [score:1]
However, the bone density was not different between miR-92a [−/−] mice and wild type littermates (Figure 4H). [score:1]
Indeed, recent studies confirmed that a genetic deletion of miR-92a in endothelial cells improves re-endothelialization after denudation [26]. [score:1]
Since miR-17∼92 cluster knock-out mice revealed defects in hematopoietic cell development, we characterized the hematopoietic phenotype of miR-92a [−/−] mice. [score:1]
Beside skeletal defects, miR-92a [−/−] mice revealed an overall reduction of organ sizes. [score:1]
However, the reduction of miR-19b and miR-20a in muscle tissue of miR-92a [−/−] mice was less than 50%. [score:1]
miR-92a KO forw: CTGTCCTGTTATTGAGCACTGGTCTATGG. [score:1]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
Body weight of male juvenile (A) and adult (B) WT, miR-92a [+/−] and miR-92a [−/−] mice. [score:1]
Interestingly, the weight of all organs was significantly reduced in adult miR-92a [−/−] mice, however, no significant differences were observed if organ weight was normalized to total body weight suggesting that miR-92a [−/−] mice are overall simply smaller in size (Figure 3C (right panel)). [score:1]
MiR-92a [−/−] mice are viable and fertile, but a reduced Men delian ratio was observed suggesting that some mice die during embryonic or early neonatal development (Figure 1D). [score:1]
If chi-square test was statistically significant, following further analysis were performed: To test whether the number of observations in each group, say k among n trials, could still plausibly explained by the assumed probabilities, 95%-confidence intervals [p [1], p [2]] for binomial proportions have been calculated, using the Software R. The edges, defined by P [p1](X≥k) = 0.025 and P [p2](X≤k) = 0.025, are computable as quantiles for Beta distributions, according to Clopper-Pearson: p [1] = F [−1](0.025; k, n−k+1) and p [2] = F [−1](0.025; k+1, n−k); where F(q; a, b) denotes the distribution function for a Beta distribution with shape parameters a, b. MiR-92a [−/−] mice, generated as described above, lack miR-92a expression in various tissues (Figure 1A/B, Figure S1A/B). [score:1]
Figure S3Under basal conditions, miR-92a [−/−] mice do not show obvious defects of the cardiovascular system. [score:1]
In conclusion, the findings of the present study provide insights into the function of miR-92a. [score:1]
MiR-92a [−/−] mice have no hematopoietic defectsSince miR-17∼92 cluster knock-out mice revealed defects in hematopoietic cell development, we characterized the hematopoietic phenotype of miR-92a [−/−] mice. [score:1]
MiR-92a [−/−] mice showed a partial postnatal lethalityMiR-92a [−/−] mice are viable and fertile, but a reduced Men delian ratio was observed suggesting that some mice die during embryonic or early neonatal development (Figure 1D). [score:1]
[1 to 20 of 71 sentences]
7
[+] score: 175
SNHG14 was targeted and inhibited by miR-92a-3p and acted as a tumour-suppressing gene, which inhibited the malignant behaviour of glioma cells. [score:9]
analysis revealed that the induced expression of miR-92a-3p significantly reduced Bim expression in both U251 and U87 cells, confirming that it is one of the direct targets of miR-92a-3p (Figure 4G). [score:8]
miR-92a-3p significantly inhibited SNHG14 expression in both U251 and U87 cells (Figure 3G), whereas silencing SNHG14 did not affect miR-92a-3p expression (data not shown). [score:7]
SNHG14 was downregulated in glioma tissues, whereas miR-92a-3p was significantly upregulated in the same paired 29 tumour and NAT samples (Figure 3B). [score:7]
Moreover, miR-92a-3p overexpression significantly reversed the tumour suppression effects induced by SNHG14 overexpression in glioma. [score:7]
The miR-92a-3p mimics, negative control mimics (NC mimics), miR-92a-3p inhibitor, and negative control inhibitor (NC inhibitor) were purchased from GenePharma (Shanghai, China). [score:7]
However, CDKN2B-AS was involved in the pathogenesis of coronary artery disease by targeting miR-92a-3p through GATA2, MAP1B and ARG1 regulation [49]. [score:6]
miR-92a-3p was significantly upregulated in glioma and exerted oncogenic functions in glioma cells through inhibiting Bim. [score:6]
Inversely, suppressing miR-92a-3p enhanced SNHG14 expression (Figure 3H). [score:5]
Though up to date, SNHG14 is targeted by miR-145-5p and miR-92a-3p, it is very possible that more and more miRNAs may be identified to target SNHG14 in the future. [score:5]
miR-92a-3p expression was also upregulated in the glioma cell lines when compared with that in the normal cells (Figure 3C). [score:5]
miR-92a-3p has been reported to target and repress Bim expression in glioma [17]. [score:5]
miR-92a-3p abrogation inhibits cell growth and induces apoptosis by targeting Bim [17]. [score:5]
In addition, SNHG14 was experimentally confirmed as a direct and specific target of miR-92a-3p. [score:4]
miR-92a-3p promotes epithelial-mesenchymal transition and regulates cell migration and invasion through the PI3K/AKT signalling pathway by targeting PTEN in non-small cell lung cancer [44]. [score:4]
Furthermore, the percentage of apoptotic cells was slightly decreased after miR-92a-3p overexpression (Figure 4F). [score:3]
Unfortunately, there were no other reports about the lncRNAs targeted by miR-92a-3p in glioma. [score:3]
These results suggested that SNHG14 was targeted by miR-92a-3p. [score:3]
In this study, we found that miR-92a-3p could promote cell proliferation and invasion and reduce apoptosis by targeting Bim, which is consistent with previous reports. [score:3]
miR-92a-3p promotes tumour growth and reduces apoptosis by suppressing FBXW7 in osteosarcoma [47]. [score:3]
The expression levels of mature miR-92a-3p were quantified using TaqMan miRNA probes and an ABI Prism 7500 system (Applied Biosystems, USA) according to previous methods [54]. [score:3]
miR-92a-3p suppresses SNHG14 function. [score:3]
Further, the percentage of apoptotic cells was significantly decreased by miR-92a-3p after SNHG14 overexpression in U251 (Figure 5E) and U87 cells (Figure 4F). [score:3]
Taken together, these results suggest that SNHG14 and miR-92a-3p may be potential therapeutic targets for glioma therapy. [score:3]
miR-92a-3p promotes glioma cell malignancy in vitro and inhibits the stemness of glioma stem cells [48]. [score:3]
Figure 4miR-92a-3p promoted glioma cell proliferation in vitro(A) The relative expression levels of miR-92a-3p in glioma cell lines transfected with miR-92a-3p mimics. [score:3]
Inhibition of the function of miR-92a-3p represses the proliferation of pancreatic cancer cells through the miR-92a-3p/DUSP10/JNK signalling axis [46]. [score:3]
After transfection, miR-92a-3p expression was significantly increased in the U251 and U87 cells (Figure 4A). [score:3]
miR-92a-3p increases the metastasis capability of nasopharyngeal carcinoma by targeting the PTEN/AKT pathway [45]. [score:3]
miR-92a-3p inhibited SNHG14 function in glioma. [score:3]
Taken together, SNHG14 inhibited cell proliferation and migration and promoted apoptosis by sponging miR-92a-3p in glioma. [score:3]
miR-92a-3p promotes cell proliferation and cell cycle progression via inhibiting p21 [42] or FBXW7 [43] in cervical cancer. [score:3]
A Spearman correlation analysis suggested a negative relationship between SNHG14 and miR-92a-3p expression (r = −0.568, p = 0.0013; Figure 3D). [score:3]
We further clarified the regulatory relationship between SNHG14 and miR-92a-3p. [score:2]
As in glioma, miR-92a-3p also functions as an onco-miRNA in tumour development. [score:2]
miR-92a-3p, a member of the miR-17-92 cluster, is frequently dysregulated in a variety of cancer types and plays a critical role in cellular physiology [41]. [score:2]
The CCK-8 assay showed that miR-92a-3p overexpression significantly promoted cell proliferation in U251 (Figure 4B) and U87 cells (Figure 4C). [score:2]
LncRNA SNHG14 directly interacted with miR-92a-3p in glioma cells. [score:2]
Additionally, miR-92a-3p could directly bind to SNHG14. [score:2]
Taken together, these data indicated that miR-92a-3p could directly bind to SNHG14 in glioma cells. [score:2]
The negative control mimics or miR-92a-3p mimics were transfected into glioma cells, and the levels of Bim protein were examined at 48 h after transfection. [score:1]
Finally, mechanistic investigations revealed that SNHG14 inhibited glioma progression by acting as a sponge for miR-92a-3p. [score:1]
miR-92a-3p promotes glioma progression. [score:1]
Empty vector, pcDNA-SNHG14 negative control; mimics NC, miR-92a-3p mimics negative control. [score:1]
The predicted sites of miR-92a-3p binding to the SNHG14 sequence are illustrated in Figure 3A. [score:1]
Subsequently, a luciferase reporter assay was performed to confirm whether miR-92a-3p could directly bind to SNHG14; cells were co -transfected with miR-92a-3p mimics and the SNHG14-Wt or SNHG14-Mut vector. [score:1]
Furthermore, we found that miR-92a-3p acted as an oncogene in glioma. [score:1]
Figure 3(A) A bioinformatics tool (StarBase2.0) revealed the predicted binding sites between SNHG14 and miR-92a-3p. [score:1]
We transfected NC mimics or miR-92a-3p mimics into glioma cells. [score:1]
However, there were no reports about the relationship between miR-92a-3p/SNHG14 and TMZ resistance. [score:1]
SNHG14 interacts with miR-92a-3p in glioma cells. [score:1]
The relative levels of miR-92a-3p in cultured cells or tissue samples were normalized to those of U6. [score:1]
Pearson’s correlation coefficients were calculated to determine the significance of the relationship between SNHG14 and miR-92a-3p expression. [score:1]
miR-92a-3p promoted glioma cell proliferation in vitro. [score:1]
A SNHG14 fragment containing the predicted miR-92a-3p binding site and its mutant sequence were cloned into a pGL3 vector (Promega, USA). [score:1]
Then, we found that there was a negative correlation between SNHG14 and miR-92a-3p. [score:1]
The number of invaded cells was significantly reduced after transfection with pcDNA-SNHG14, whereas miR-92a-3p mimics reversed this effect in both U251 (Figure 5C) and U87 cells (Figure 5D). [score:1]
[1 to 20 of 57 sentences]
8
[+] score: 101
Out of 11 miRs, 3 miRs were reliably detected and significantly up-regulated: miR-21, miR-92a, and miR-99a while the expression of miR-1, miR-22, and let-7f was down-regulated (Fig.   1). [score:9]
Moreover, the expression of miR-21 was up-regulated in symptomatic compare to asymptomatic carotid plaques whereas the expression of miR-92a and -99a was not regulated [10]. [score:9]
Our search for predicted target genes of miR-92a and -99a found 308 and 32 potential targets, respectively, using TargetScan PicTar database (see Supplementary Tables  S2 and S3). [score:7]
These potential target genes of miR-92a as well as several pathways with impact on atherosclerosis are listed in Table  3 and depicted in Fig.   2. Table 3 Predicted miR-92a target genes and their impact on atherosclerosis via PicTar. [score:5]
By searching miRs target gene predicting database and available published reference, we found 17 potential miR-92a target genes related to vascular inflammation and atherosclerosis (Fig.   2) and only 3 with anti-atherogenic properties, which are RGS3, KLF2 and GDF11 (Table  3). [score:5]
Furthermore, specific in vivo blockade of miR-21 as well as miR-92a expression could reduce vascular inflammation and altered the development of atherosclerosis, decreasing plaque size and promoting a more stable lesion phenotype. [score:4]
Several miRs such as miR-92a, which modulate ECs proliferation and inflammation, are up-regulated by disturbed flow in ECs, and contribute to atherosclerosis [31]. [score:4]
SOCS5 has been identified as a novel miR-92a target that is involved in the regulation of endothelial inflammation [36]. [score:4]
Previous studies showed that the key endothelial transcription factors, KLF2 and KLF4, are direct targets of miR-92a [31]. [score:4]
PAF-AH Platelet-Activating Factor AcetylHydrolase modulation of inflammation and plaque formationKarabina et al., 2010, Biochimie Figure 2 Molecular imaging of target genes of miR-92a at different stages of atherosclerotic plaque progression. [score:3]
The examples of appropriate target gene of miR-92a at each stage of plaque progression are listed in black in the middle of the figure. [score:3]
In terms of translational implications, administration of locked nucleic acid (LNA) -modified antisense miR-92a (LNA-92a) prevents ischemic injury in pigs and ameliorates hyperlipidemia -induced atherosclerosis in mice [38]. [score:3]
Preferential expression of miR-92a in coronary, but not in carotid lesions that are subjected to low shear stress is in agreement with our in vivo data [10]. [score:3]
We performed bioinformatic sequence analysis of miR-92 and -99, which showed differential expression between the advanced atherosclerotic plaques and control group in qRT-PCR validation. [score:3]
Loyer X Inhibition of microRNA-92a prevents endothelial dysfunction and atherosclerosis in miceCirc Res. [score:3]
Thus, our data present significant evidence that plaque miRNA represent a potential atherosclerosis marker and has unique expression profiling in different arterial regions: miR-21 is a specific miRNA marker of human symptomatic carotid atherosclerotic plaques whereas miR-92a belongs to miRNA profiling of human advanced CAP. [score:3]
At the molecular level, miR-92a targets KLF2, KLF4, and possibly Sirtuin 1 (SIRT1), all of which are tightly associated with redox balance, eNOS-derived NO bioavailability, and the inflammatory state [31]. [score:3]
Hinkel R Inhibition of microRNA-92a protects against ischemia/reperfusion injury in a large-animal mo delCirculation. [score:3]
We focused on targets predicted by at least two prediction data bases and containing a miR-92-8mer or miR-99-8mer seed match in the respective 3′UTR region 7, 20. [score:3]
Interestingly, many of the miR-92a target genes are related to atherosclerosis. [score:3]
Stimuli such as disturbed flow and oxidized lipids that impose oxidative stress in ECs induce miR-92a, a crucial miRNA that inhibits EC angiogenesis and impairs EC function [35]. [score:3]
The expression of miR-92a in the advanced CAP, which usually show a pronounced macrophage content (macrophage marker CD68) reinforce our conclusion that the antiatherogenic effects, which could be observed after miR-92a blockade resulted not only from protection against endothelial dysfunction, but from controlling by both innate and adaptive immunity. [score:3]
Here, we provide strong evidence that miR-92a as an atheromiR, being preferentially expressed in ECs is a potential biomarker for human coronary atherosclerosis. [score:3]
Furthermore, we demonstrate that miR-92a is expressed in human coronary atherosclerotic lesions, more frequent in left anterior descending artery (LAD, Table  1), where the endothelial shear stress is higher compared to the Ramus circumflexus (RCx) and right coronary artery (RCA). [score:2]
Interestingly, miR-21 belongs to mechanosensitive miRs with pro- and anti-atherogenic effect, whereas miR-92a is a mechanosensitive athero-miR and was shown to induce endothelial dysfunction and pro-atherogenic responses 30– 32. [score:1]
Other ways low levels of monocytic miR-92a in STEMI patients likely represent a compensatory protective mechanism that might be boosted in response to acute MI. [score:1]
Fang Y Davies PF Site-specific microrna-92a regulation of kruppel-like factors 4 and 2 in atherosusceptible endotheliumArterioscler Thromb Vasc Biol. [score:1]
This was likely because of the antiadhesive effect of miR-92a blockade in ECs, possibly involving KLF2 [39]. [score:1]
Recently, our selective analysis of patients with ST-Elevation MI (STEMI) revealed lower levels of miR-92a as well as no regulation of miR-21 in circulating monocytes compared with control patients [12]. [score:1]
These endothelial miRs include miR-92a, miR-21, miR-29, and members of the let-7 family (let-7f) (Table  2). [score:1]
[1 to 20 of 30 sentences]
9
[+] score: 100
Transfection with miR-92a mimic had no significant effect on levels of expression of either of the pri-transcripts (Figure 9). [score:3]
Transfection with miR-19a mimic resulted in significantly increased expression of both pri-miR-17 - and pri-miR-92a-1 transcript (Figure 9). [score:3]
Results presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
It is, however, noteworthy, that miR-92a-transfectants (exhibiting no change in proliferation) yielded an entirely different population of miRNAs (these transfectants also rarely exhibiting significant changes in expression of any cluster miRNAs, Figures 6– 9). [score:3]
Figure 8 Levels of expression of the microRNAs encoded by the miR-106a-363 cluster in cultured, human squamous carcinoma cells (E10) following transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
In contrast, with miRNAs found differentially expressed following transfection with miR-92a mimic (Figure 3) these associations were not found (Figure 5). [score:3]
The miRNAs (53, 43, 61 and 29) found differentially expressed following transfection with miR-19a - miR-20b -, miR-92a -, or miR-363-5p mimic were subjected to bioinformatic analysis using Ingenuity Pathways Analysis. [score:3]
Figure 3 MicroRNAs differentially expressed in cultured human squamous carcinoma (E10) cells transfected with scrambled control, miR-19a -, miR-20b -, miR-92a, or miR-363-5p- mimic. [score:3]
Transfection with miR-20b mimic, however, significantly increased expression of pri-miR-17, while that of the pri-miR-92a-1 transcript was unaffected (Figure 9). [score:3]
Figure 7 Levels of expression of the microRNAs encoded by the miR-106b-25 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Microarray results suggested that levels of expression of five members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-19b, and miR-92a) were significantly decreased only in cells transfected with miR-363-5p mimic (Figure 3). [score:3]
ANOVA (P ≤ 0.05) was used for the isolation of the 53 mirNA differentially expressed in transfectants with miR-19a mimic (A), 43 miRNAs in miR-20b transfectants (B), 61 miRNAs in miR-92a transfectants (C) and 29 miRNAs in transfectants with miR-363-5p mimic (D). [score:3]
The heat-map presented in Figure 3 resulted from hierarchical clustering of 53, 43, 61 and 29 miRNAs found differentially expressed (p ≤ 0.05) in E10 cells transfected with mimic for miR-19a (A), miR-20b (B), miR-92a (C), or miR-363-5p - (D), respectively. [score:3]
Results presented in Figure 6 also show levels of expression of the various miRNAs of the miR-17-92 cluster after transfection with mimics for miR-19a, miR-20b or miR-92a. [score:3]
In cells transfected with miR-19a -, miR-20b -, or miR-92a mimic, the primary transcripts exhibited significantly increased levels of expression (Figure 9). [score:3]
Using the level of expression of the pri-miR-17 (5′-end) transcript as reference, that of pri-miR-92a-1(3′-end) was 4.6 ± 0.7 fold higher and those of pri-miR-106b (5′-end) and pri-miR-25 (3′-end) were 8.4 ± 2.0 - and 52.1 ± 4.1-fold higher, respectively. [score:3]
In cells transfected with miR-19a - or miR-92a mimic no systematic changes in expression of miRNAs was apparent (Figures 7B,D). [score:3]
Effects of transfection cultured human squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on expression of the primary transcripts pri-17-92, pri-106a-363, and pri-106b-25. [score:3]
In cells transfected with miR-92a -mimic a distinctly separate population of miRNAs were found differentially expressed, not containing any mirNA encoded by any one of the three paralogous clusters (C). [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
The cluster derived from miR-92-transfectants, however, yielded no such significantly associations (Figure 5) lend support to the suggestion that the anti-proliferative mechanism entails altered expression of miRNAs. [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
presented in Figure 6 also show levels of expression of the various miRNAs of the miR-17-92 cluster after transfection with mimics for miR-19a, miR-20b or miR-92a. [score:3]
In cells transfected with miR-363-5p mimic levels of expression of both pri-miR-17 and pri-miR-92a-1 were significantly decreased. [score:3]
Figure 6 Levels of expression of the microRNAs encoded by the miR-17-92 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Profiling of miRNAs which were differentially expressed in E10 cells transfected with miR-19a-, miR-20b-, miR-92a-, or miR-363-5p mimic. [score:3]
presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
Only miR-19b, miR-20b, miR-92a, and miR-106a were detectable in these cells. [score:1]
The levels of expression of hsa-pri-miR-17, hsa-pri-miR-92a-1, hsa-pri-miR-106b, hsa-pri-miR-25, hsa-pri-miR-106a, and hsa-pri-miR-92a-2 were measured in E10 cells after transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-106a-363 or miR-106b-25 clusters. [score:1]
Figure 2Effects of transfection with mimic for miR-19a, miR-20b, miR-92a, miR-363-3p (miR-363), or miR-363-5p (miR-363 [*]) on cell densities of cultured human squamous carcinoma (E10) cells. [score:1]
Effects of transfection with miR-18a, miR-19a-, miR-20b-, miR-92a-, miR-363-3p or miR-363-5p mimic on proliferation of cultured carcinoma cells. [score:1]
Results in Figure 9A show the level of expression of hsa-pri-miR-92a-1 was higher than that of hsa-pri-miR-17 in all cells investigated. [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
Transfections were carried out using 20 nM of miR-19a -, miR-20b -, or miR-92a -, or miR-363-3-p -, or miR-363-5-p mimic or Allstar scrambled control (Qiagen, Hilden, Germany), or with transfection reagent only (MOCK). [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) or scrambled control. [score:1]
in Figure 9A show the level of expression of hsa-pri-miR-92a-1 was higher than that of hsa-pri-miR-17 in all cells investigated. [score:1]
The 4% decrease in the high intensity fluorescence peak observed with transfectants for miR-92a mimic was presumably too small to cause a detectable change in cell density (Figure 2A3). [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with mimic for miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control as shown in the Figure. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control shown in the Figure. [score:1]
Microarrays were used to profile miRNAs in cultured human oral squamous carcinoma cells (E10) 72 h after transfection with mimics for miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic or with scrambled control. [score:1]
Cells counts following transfection with scrambled control or with mimic for miR-20b, miR-92a, miR-363-3p, or miR-363-5p (means derived from three separate transfections with SD indicated, A3). [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-17-92 cluster. [score:1]
Neither significantly decreased number of cells, nor altered cell morphology, were found with cells transfected with miR-18a - or miR-92a mimic (Figure 2A3). [score:1]
Total RNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-19a, miR-20b -, miR-92a - miR-363-5p mimic or scrambled control. [score:1]
[1 to 20 of 46 sentences]
10
[+] score: 79
Other miRNAs from this paper: hsa-mir-92a-2, hsa-mir-92b
miRCURY LNA microRNA Inhibitor™ Strongly Inhibits miR-92a For inhibition of miR-92a, the miRCURY LNA microRNA Inhibitor™ was transfected to HL-60 cells with the X-tremeGENE siRNA Transfection Reagent. [score:9]
In this study, we used the same technology to suppress already up-regulated miR-92a in an APL cell line. [score:6]
It is suggested that miR-92a target’s estrogen receptor (ERβ1) mRNA hence down regulating its expression in breast cancer [27]. [score:6]
Perhaps in human APL, p63 expression is inhibited by miR-92a and induces the cell proliferation. [score:5]
The miRCURY LNA microRNA Inhibitor™ for hsa-miR-92a and microRNA inhibitor negative control (scrambled) oligonucleotides were purchased from Exiqon, Denmark. [score:5]
Manni et al. reported in a mouse acute myeloid leukemia cell line that miR-92 inhibits p63 expression and that this protein has an important role in cell proliferation [22]. [score:5]
In AML, miR-92a overexpression was observed, as well as its inverse relationship with p63 protein expression in murine CD32myeloid cells [22, 21]. [score:5]
Expression of miR-92a was evaluated by reverse transcriptase microRNA real time PCR in HL-60 cells transfected with the miRCURY LNA microRNA Inhibitor™ (LNA-anti-miR group), the microRNA inhibitor scrambled oligonucleotides (scrambled LNA group), and untreated HL-60 cells (untreated groups), at 24, 48, and 72 h post-transfection. [score:5]
Inhibition of miR-92a Decreased Viable HL-60 Cells To assess the effect of miR-92a inhibition on cell viability, the MTT assay was performed 24, 48, and 72 h after transfection. [score:4]
Based on this evidence, we have proposed to examine the effects of miR-92a inhibition on HL-60 cell line proliferation and viability as a basic preliminary step in developing a novel therapeutic strategy for AML. [score:3]
Reverse Transcriptase microRNA Real Time Polymerase Chain Reaction Reverse transcriptase (RT) microRNA real time polymerase chain reaction (PCR) was performed to determine the efficiency of miR-92a inhibition by LNA-anti-miR. [score:3]
In this study, we have used LNA-anti-miR to the inhibition of miR-92a in APL (AML-M3) cell line. [score:3]
Prevention of cellular proliferation subsequent to the LNA transfection is indicative of successful inhibition of miR92a in the cell line under study. [score:3]
As a conclusion, taken together, our data suggest that inhibition of miR-92a with LNA-anti-miR may provide an alternative approach for the treatment of APL. [score:3]
It has been shown that there is an increased expression of miR-92a in AML[20, 21]. [score:3]
The expression of miR-92a was at the lowest level 24 h after transfection and gradually increased in the next two time points [Figure 2]. [score:3]
Although, miR-92a expression was a little lower in the scrambled LNA -transfected cells compared to the untreated cells, the differences were not statistically significant. [score:2]
However, in all three time points, the expression of miR-92a was considerably lower in the LNA-anti-miR group compared to the control groups (p<0.025). [score:2]
Assessment of the miR-92a level by real time PCR 24, 48, and 72 h after transfection. [score:1]
As well, the MTT assay showed that inhibition of miR92a is associated with decreased cell viability after 24, 48, and 72 h. Although, probably due to the transfection reagent toxicity, cell viability was minimally decreased in the scrambled LNA transfected cells compared to the normal controls (untreated cells) but this difference was not statistically significant. [score:1]
Cell Transfection The nucleotide sequences of miR-92a were obtained from www. [score:1]
MiR-92a is a member of the miR-17-92 cluster located on chromosome 13q31.3. [score:1]
[1 to 20 of 22 sentences]
11
[+] score: 77
Coincidently, our target gene analysis showed that all the 4 up-regulated miRNAs (miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) target TP53, cyclin -dependent kinase inhibitor 1A (CDKN1A) and cyclin -dependent kinase inhibitor 2A (CDKN2A). [score:12]
The up-regulated and down-regulated miRNAs (miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-342-3p, and miR-663) may be involved in the regulation of transcription, DNA -dependent positive regulation of transcription from RNA polymerase II promoter, protein amino acid phosphorylation, and negative regulation of transcription from RNA polymerase II promoter. [score:10]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
Moreover, the up-regulated miRNAs (miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) target BH3-interacting domain (BID), TP53 and PTEN. [score:6]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
showed that the most significant biological processes targeted by at least two of various miRNAs (miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) were regulation of transcription, DNA -dependent positive regulation of transcription from RNA polymerase II promoter, protein amino acid phosphorylation, negative regulation of transcription from RNA polymerase II promoter, and G1/S transition of mitotic cell cycle (Fig.   5a). [score:6]
Our study showed that high expression of miR-20b, miR-92a-3p, and miR-92b can down-regulate Fas -associated protein with death domain (FADD), which is known as an adaptor molecule that bridges the Fas-receptor [46] and is involved in apoptosis [47]. [score:6]
Our data indicates that the unique 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) expression signature could be involved in the development of HBV- related HCC, suggesting interesting potential novel therapeutic options. [score:4]
a Main biological processes influenced by genes targeted by two or more miRNAs from miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p. [score:3]
a Relationship among target genes predicted by miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p. [score:3]
By miRNA expression profile, we found that miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p, and miR-92b are specifically altered in HBV-related HCC. [score:3]
c Main pathways influenced by genes targeted by two or more miRNAs from miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p. [score:3]
IPA-obtained network showing the relationships among 6 co-regulated miRNAs (miR-150, miR-342-3p, miR-92a-3p, miR-92b, and miR-376c-3p) HBV infection is a major health problem that leads to a significant rise in mortality and is reported to be closely related to HCC [20]. [score:2]
IPA-obtained network showing the relationships among 6 co-regulated miRNAs (miR-150, miR-342-3p, miR-92a-3p, miR-92b, and miR-376c-3p) To evaluate the effect of HBV infection on the change in expression of miRNAs, 12 pairs of samples from HCC and non-tumor tissues (including 6 HBV -positive HCC and 6 HBV -negative HCC and their non-tumor tissues) were collected. [score:2]
In our IPA results, the 6 selected miRNAs (miR-150, miR-342-3p, miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) are shown to comprise a network which linked themselves among AGO2, DICER1, BCL2L11, CCND1, CCND2, CCNE1, CDK7, E2F1, E2F3, TP53, and four other genes (Fig.   6). [score:1]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
Ultimately, miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-342-3p, and miR-663 were selected. [score:1]
The identity of the 12 miRNAs is as follows: miR-21, miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-451, miR-101, miR-424, miR-342-3p, miR-122a, and miR-663. [score:1]
In our study, a network that includes 6 of 7 selected miRNAs (miR-150, miR-342-3p, miR-20b, miR-92, miR-368, and miR-92b) was shown based on accepted databases of molecular interactions reported in the literature using IPA (Fig.   6). [score:1]
[1 to 20 of 19 sentences]
12
[+] score: 59
We also noticed down-regulation of miR-92a in both CD4 [+ ]and CD8 [+ ]lymphocytes with age, in accordance with the report by Hackl, et al. [11] that showed miR-17, miR-19b, miR-20a, and miR-106a were down-regulated in human cells, including CD8 [+ ]lymphocytes, in an aging population. [score:7]
Therefore, it is likely that both reduced miR-17-92a cluster expression and down-regulation of the naïve cytotoxic T-cell fraction with age may lead to reduced amounts of miR-92a derived from naïve cytotoxic T cells (Additional file 3 Figure S1-A to D). [score:6]
We used total RNA obtained from separated lymphocytes of healthy volunteers, and the miR-92a expression levels in specimens were expressed as 'ratios' [14]. [score:5]
There is a significant positive correlation between CD8 [+ ]miR-92a level (x axis) and the percentage of RO [-]CD8 [+]CD27 [+ ]fraction (E) and CD3 [+]CD8 [+]CD62L [+ ]fraction (F) (y axis), which tends to down-regulate with age (closed circles = 20 to 29 years; open circles = 30 to 39 years; open squares = aged 40 to 49 years; closed squares = older than 50 years). [score:4]
However, we do not have any direct evidence for the relationship between antigenic stress and infection status, including cytomegalovirus (CMV) infection [9, 10], that may be linked to the progressive decline of miR-92a expression in naïve cytotoxic T cells. [score:4]
Therefore, we speculated that down-regulation of miR-92a in naïve CD8 [+ ]T cells with ageing may be linked to progressive loss of naïve TCR repertoire diversity due to antigen exposure, including latent viral infection [8]. [score:4]
Although the number of subjects in this study was too small to provide a definitive conclusion, down-regulation of the miR-92a level may indicate exhaustion of naïve T-cells due to alteration of the immunologic condition with ageing, especially in individuals older than 60 years. [score:4]
We therefore set out to determine miR-92a levels in peripheral blood lymphocytes obtained from healthy individuals to ascertain the possible association between the expression level of miR-17-92a and ageing. [score:3]
Click here for file Correlation between age and percentage of lymphocyte fraction or miR-92a expression level. [score:3]
Correlation between age and percentage of lymphocyte fraction or miR-92a expression level. [score:3]
By both direct cloning and real-time PCR methods, Wu et al. also demonstrated that antigen-specific naïve CD8 [+ ]cells obtained from mice had elevated miR-92a [7]. [score:2]
The expression of miR-92a was calculated using 2¯ΔΔ Ct methods, and mean cycle threshold (C [t]) values for all miRNAs were quantified using sequence detection system software (SDS, version 1.02; Applied Biosystems). [score:1]
The miR-92a level in CD8 [+ ]T-cells is negatively correlated with the ratio of central memory to naïve CD8 [+ ]cells (P = 0.0016) or effector memory/naïve CD8 [+ ]cells (P = 0.0073). [score:1]
The miR-92a in separated CD8 [+ ]T cells decreased significantly with age (P = 0.0002) (Figure 1-A), and miR-92a in CD4 [+ ]cells tended to decrease with age (P = 0.0635) (Figure 1-B) (Additional file 1 Table S1). [score:1]
In conclusion, our results suggest that the miR-92a level may represent attrition of human naïve CD8 [+ ]T cells, possibly due to apoptosis of naïve T cells. [score:1]
We separated lymphocytes from 21 healthy volunteers, aged 23 to 58 years (13 men and 8 women), for surface marker and miR-92a level analyses. [score:1]
In contrast, the miR-92a level in CD8 [+ ]T cells was significantly correlated with percentages of the cell fraction of RO [-]CD8 [+]CD27 [+ ]cells (P = 0.0046) (Figure 1-E) and CD3 [+]CD8 [+]CD62L [+ ]cells (P = 0.0011) (Figure 1-F) (Additional file 2 Table S2). [score:1]
The miR-92a in CD4 [+ ]T cells did not show any significant relationship with the lymphocyte subset fraction. [score:1]
In CD4 [+ ]cells, we observed an age-related increase of the ratio of central memory to naïve CD4 [+ ]cells, without any correlation to CD4 [+ ]miR-92a levels (Additional file 3 Figure S1-E and F). [score:1]
Figure 1 Correlation between T-lymphocyte miR-92a level and age. [score:1]
Correlation between miR-92a and percentage of lymphocyte fraction. [score:1]
The CD8 [+ ]T-lymphocyte miR-92a level significantly decreased with age (A), while CD4 [+ ]lymphocytes only showed a tendency for a decrease of miR-92a level with age (B). [score:1]
Click here for file Correlation between miR-92a and percentage of lymphocyte fraction. [score:1]
This suggests that the majority of miR-92a in CD8 [+ ]T-cells may originate from naïve cytotoxic T cells, in accordance with the report by Salaun et al. [6]. [score:1]
By contrast, the miR-92a level in CD4 [+ ]T-cells is not correlated with the ratio of central memory to naïve CD4 [+ ]cells (P = 0.0925) (F). [score:1]
[1 to 20 of 25 sentences]
13
[+] score: 59
The top ranked miRNAs (NPES > 2.8, p = 0.001 and FDR < 0.02) included, miR-19b-3p (miR-19ab family) and miR-92a/b-3p (miR-25/32/92abc/363/363-3p/367 family), were significantly upregulated in eBL tumor cells, and targets tumor suppressor genes such as ATM and NLK, which are observed to be downregulated in eBL. [score:11]
These tumor suppressors were targeted by multiple upregulated miRNAs (miR-19b-3p, miR-26a-5p, miR-30b-5p, miR-92a-5p and miR-27b-3p) which could account for their aberrant expression in eBL. [score:10]
Based on our results, we hypothesize that low NLK levels in eBL tumors, probably due to miRNA (upregulated miR-92a-3p and miR-27b-3p expression) mediated regulation, would reduce the stability and activation of P53 in suppressing eBL lymphomagenesis. [score:9]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Among the upregulated miRNAs in eBL were members of the miR-17~92 cluster (miR-19b-3p, and miR-92a-3p) (logFC > 3), which target tumor suppressor genes such as TP53 [63] and ATM (ataxia telangiectasia mutated) kinase [59, 64], respectively. [score:8]
By observing elevated expression of MYC, miR-19b-3p, miR-92a-3p and miR-92b-3p in eBL tumor cells compared to GC B-cells, we confirm that elevated expression of the miR-17~92 cluster miRNAs is a critical feature facilitating eBL lymphomagenesis. [score:4]
This miRNA gene cluster encodes for six distinct miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92) that share the same seed sequence [68]. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 56
Although miR-92a and miR-133a expression levels showed considerable inter-individual variation in cohort 1, their expression was not different between males and females and was not related to any other parameter such as age, or BMI. [score:5]
Quantitative real-time PCR (qPCR) revealed that miR-34c* and miR-92a were significantly up- and downregulated, respectively, in the exosomes from cAMP -treated brown adipocytes and from serum of mice with active BAT (Fig. 2b,c). [score:4]
The miR-17-92 (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a) cluster was previously described to be regulated by cell cycle via E2F3 binding and by a negative feedback loop through miR-17 that targets E2F2 (ref. [score:4]
Cold-exposure induced a significant downregulation of exosomal miR-92a in BAT (to 6% of the control) and WATi (to 18%), but not in exosomes derived from other tissues (Fig. 2d). [score:4]
Comparison of the abundance of these miRNAs in exosomes and in brown adipocytes revealed that miR-92a and miR-34c* were differentially expressed after cAMP treatment in the exosomes but not in BA (Supplementary Fig. 2a,b). [score:3]
Human serum miR-92a and miR-133a expression levels were not normally distributed in cohort 1 according to Shapiro–Wilk test (P=0.000 and P=0.001, respectively). [score:3]
First in vivo investigations associate genetic knockout and pharmacological inhibition of miR-92a with a HFD-resistant, more healthy phenotype in mice 63. [score:2]
The correlation analysis of Log [10] miR-92a as a dependent variable, and age, sex, BMI, fat mass and glucose uptake rate as independent variables identified glucose uptake rate as only significant predictor of Log [10] miR-92a (Supplementary Table 7). [score:1]
The exosomal samples used for qPCR and ELISA were adjusted to 1.65 mg and 16.5 mg tissue, respectively, to compare exosome/miR-92a release from various tissues. [score:1]
Similar to cohort 1, we observed a correlation between Log [10] miR-92a and BAT activity (glucose uptake rate) (Pearson's correlation, R [2]=0.40, P=0.004, n=19) (Fig. 3h). [score:1]
Whitening of BAT was accompanied with an increased release of miR-92a from BAT (2.75±0.65-fold) and increased exosomal miR-92a levels in serum (2.66±0.19-fold) (Supplementary Fig. 2h). [score:1]
Furthermore, to rule out that single axis logarithmic transformation resulted in such linear correlations, we performed similar analysis for the Log [10] BAT SUVmean−Log [10] miR92a (Pearson's correlation, R [2]=0.18, P<0.05, n=22), as well as the Log [10] BAT SUVmax−Log [10] miR92a (Pearson's correlation, R [2]=0.25, P<0.05, n=22), which resulted in similar correlations (Supplementary Fig. 3c,d, respectively). [score:1]
One individual participating in the cold acclimation study showed a large decrease in miR-92a after cold-exposure along with high increase in BAT activity (ΔBAT SUVmean=1.59, Supplementary Table 3). [score:1]
Interestingly, miR-92a abundance tended to be lower after this cold acclimation period (19.5±12.9 versus 13.6±12.7) and the change in miR-92a levels tended to be negatively related to changes in BAT activity (Pearson's correlation, R [2]=0.29, P=0.11, Fig. 3f) on this cold acclimation period. [score:1]
In total, 22 blood samples were withdrawn at thermoneutrality (Fig. 3b–e) and 15 after mild cold activation for 1–1.5 h (Supplementary Fig. 3e) were used to access exosomal miR-92a levels (Supplementary Tables 3 and 4). [score:1]
Exosomal miR-92a in serum reflects brown fat activity. [score:1]
The highest abundance of miR-92a per exosome was released by WATi followed by WATg, BAT, liver brain and muscle (Fig. 2d). [score:1]
Levels of miR-92a in exosomes released from cAMP-stimulated brown adipocytes were reduced after 4 h and a significant reduction was observed after 24 h (Supplementary Fig. 2c). [score:1]
For the analysis of human exosomal miRNAs, we focused on miR-92a and miR-133a, whereas miR-34c* was not detectable in human serum exosomes. [score:1]
To identify the source of miR-92a in mice, we quantified the amount of miR-92a in exosomes isolated from BAT, WATi, WATg, skeletal muscle, liver and brain. [score:1]
In both cases, we observed a significant correlation between these values and the Log [10] miR-92a value (SUVmax: Pearson's correlation, R [2]=0.28, P=0.011, glucose uptake rate: Pearson's correlation, R [2]=0.26, P=0.016, n=22), (Fig. 3d,e, respectively). [score:1]
In this regard, the relation between exosomal miR-92a abundance in human blood samples and cold -induced BAT activity is highly promising. [score:1]
miR-92a was detectable in all tested samples (Fig. 2d). [score:1]
In addition, individual univariate analyses showed no relations between other parameters and Log [10] miR-92a. [score:1]
Yet, we are the first to relate exosomal miR-92a serum levels with BAT activity in humans. [score:1]
In mice, the increase in BAT mass on prolonged cold-exposure significantly correlated with the reduction of miR-92a abundance in serum (Supplementary Fig. 2d,e). [score:1]
Although miR-92 has been shown to impair angiogenesis 58 and to promote atherosclerosis 59 60, ablation of this miRNA in mice resulted only in bone defects 61. [score:1]
In addition, when considering the group as a whole, we observed a significant negative correlation between Log [10] miR-92a and the BAT SUVmean value (Fig. 3c). [score:1]
In a stepwise multivariable linear regression analysis with Log [10] miR-92a as a dependent variable, and age, sex, BMI, fat mass and BAT SUVmean, SUVmax and glucose uptake rate as independent variables, all three BAT parameters were significant predictors of Log [10] miR-92a (Supplementary Table 6). [score:1]
How to cite this article: Chen, Y. et al. Exosomal microRNA miR-92a concentration in serum reflects human brown fat activity. [score:1]
000430, Life Technologies) was used to quantify miR-92a located on chromosome 14: 115044427-115044506 [+] with the following sequence: 3′- UAUUGCACUUGUCCCGGCCUG -5′. [score:1]
Moreover, we studied miR-92a release in murine obesity. [score:1]
Serum Log [10] miR-92a levels of these acute cold-exposed subjects also tended to inversely correlate with BAT SUVmean (Pearson's correlation, R [2]=0.21, P=0.08, n=15, Supplementary Fig. 3e). [score:1]
Moreover, we analysed miR-92a levels in serum exosomes in subjects (in 15 out of the 22 subjects blood samples were available; Supplementary Tables 3 and 4) that were acutely exposed to cold (ca. [score:1]
In addition, the regression equation obtained in Fig. 3d correctly predicted whether subjects would either show a large increase (>change in median SUVmean [+0.43]) or a small increase/decrease (< change in median SUVmean) in BAT activity on cold acclimation, based on changes in miR-92a (Supplementary Table 3). [score:1]
Therefore, we focused in the current study on miR-92a. [score:1]
The obtained correlation equation is: BAT SUVmean (predicted)=−0.8749 × Log [10] miR-92a+3.5227, (Pearson's correlation, R [2]=0.26, P=0.015, n=22). [score:1]
Interestingly, two patients in this cohort did not show BAT activity (BAT SUVmean was 0.37 or 0.45 in these subjects, respectively) along with high serum level of miR-92a (Fig. 3f, Supplementary Tables 3 and 4). [score:1]
[1 to 20 of 38 sentences]
15
[+] score: 49
Besides it has also been reported to be differentially expressed in the whole blood sample of patients with coronary artery disease which confirms hsa-miR-92a as a possible therapeutic target for cardiovascular diseases [71]. [score:9]
Conservation analysis performed with the PhastCons dataset in UCSC genome browser resulted in high PhastCons scores for most of the co-expressed hubs specially for hsa-miR-92a which was found to be common in both regulatory and co -expression networks. [score:6]
Furthermore hsa-miR-92a appeared as novel hub miR in both regulatory and co -expression network indicating its strong functional role in PD. [score:4]
Of these 23 miRs, hsa-miR-92a appeared as hub in both regulatory and co -expression network indicating its strong functional role in PD. [score:4]
Moreover, hsa-miR-92a appeared as a common hub in both regulatory and co -expression network indicating its strong functional role in PD. [score:4]
In this way our study identified hsa-miR-92a as the common hub between regulatory and co -expression network suggesting its strong functional role in PD. [score:4]
It is noteworthy to mention that hsa-miR-92a was found to be the hub miR in both regulatory and co -expression networks indicating its strong functional role in PD. [score:4]
On the basis of intermediate regulation the regulatory network identified some novel hub miRs(hsa-miR-200c, hsa-miR-200b, hsa-miR-200a, hsa-miR-17, hsa-miR-19a, hsa-miR-20a, hsa-miR-18a, hsa-miR-141 and hsa-miR-92a) which were not reported earlier in association with PD and hence can be considered as potential target for future study. [score:4]
The 9 IR hub miRs in Group 2 regulatory network which play an important role in inter-regulatory signal transduction were hsa-miR-200c, hsa-miR-200b, hsa-miR-200a, hsa-miR-17, hsa-miR-19a, hsa-miR-20a, hsa-miR-18a, hsa-miR-141and hsa-miR-92a. [score:3]
Association of TFs, target mRNAs and significant KEGG pathways with hsa-miR-92a. [score:3]
Furthermore, functional enrichment analysis of the mRNA targets associated with the 23 hub miRs including hsa-miR-92a strengthens their association with several PD related pathways. [score:3]
hsa-miR-92a has been implicated as biomarker in several types of cancers (Pancreatic, Prostate, Ovarian Cancer etc) [69], [70]. [score:1]
[1 to 20 of 12 sentences]
16
[+] score: 47
Overexpression of miR-92a inhibits angiogenesis in ischemic myocardial tissues in mice and is involved in the control of cardiomyocyte survival. [score:5]
In, miR-92a was slightly downregulated in DCM diseased Doberman Pinschers, but this could not be confirmed using the assay. [score:5]
Since all of the diseased dogs received positive inotropic therapy (Pimobendan), this may influence miR-92a expression. [score:5]
Later experiments demonstrated miRNA expression differences in heart failure either caused by idiopathic or ischemic DCM and confirmed the aberrant expression of miR-92 in DCM [49]. [score:5]
As mentioned above, a related miRNA, miR-92, was shown to be downregulated in human DCM tissues [48, 49]. [score:4]
Among other miRNAs, let-7c, miR-21, miR-92 and miR-101 were deregulated in DCM diseased tissue in contrast to healthy controls [48]. [score:4]
With p-values > 0.05 for all tested target assays, revealed no statistically significant difference between diseased and healthy dogs (mmu-miR-142-3p: p = 0.771; mmu-miR-144*: p = 0.421; cfa-let-7c: p = 0.634; cfa-miR-21: p = 0.940; cfa-miR-92a: p = 0.873). [score:4]
Experiments of external inhibition of miR-92a led to improved left ventricular function [90]. [score:3]
While the showed small differences in expression of miR-21 and miR-92a, revealed almost no differences of these miRNAs between the two groups (Figure  4). [score:3]
miR-92a was different between the groups but marginally missed the inclusion criteria for the definition of differential expression (cfa-miR-92a: p: 0.0359; FC: - 1.45; mmu-miR-92a: p: 0.0422; FC: - 1.41;). [score:3]
Expression ratio of miR-92a and miR-21 is nearly 1. No statistically significant differences between the groups are evident. [score:3]
For further analysis, we selected five miRNAs which have been earlier mentioned in literature as being involved in cardiovascular pathology and which also showed a trend for differential expression in the microarray (miR-142-3p, miR-144*, miR-21, let-7c and miR-92a). [score:3]
[1 to 20 of 12 sentences]
17
[+] score: 46
Next, we examined the expression level of miR-92a in leukemic cells. [score:3]
Interestingly, we revealed that discrepant expression of miR-92a between leukemic cells and the plasmas of leukemic patients. [score:3]
As an alternative explanation, cancer cells may specifically digest miR-92a in the plasma directly or indirectly. [score:3]
In contrast, we did not detect miR-92a expression in normal blasts. [score:3]
Interestingly, miR-92a is transcribed from miR-17-92 locus that encode the polycistronic precursor containing seven microRNAs: miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b and miR-92a, and the human microRNA cluster miR-17-92 is amplified and/or overexpressed in several cancers such as acute myeloid leukemia [15], [18], malignant lymphoma [19], lung cancer [20], thyroid cancer [21] and hepatocellular carcinoma [22]. [score:3]
High expression of miR-92a in tumor cells of acute leukemia. [score:3]
We examined 4 cases of AML and 2 cases of ALL, and found that miR-92a was strongly expressed in leukemic cells from both AML and ALL (Figure 3, Case 1–3). [score:3]
15 µl of RT reactions contained 10× RT buffer, 0.15 µl of 100 mM dNTPs with dTTP, 0.188 µl of RNase -inhibitor (20 units/µl), 1 µl of MultiScribe™ Reverse Transcriptase (50 units/µl), 1 µl of each of microRNA specific stem-loop primers (has-miR-92, 4374013; has-miR-638, 4380986; Applied Biosystems) and 10.16 µl of input RNA. [score:2]
One case in the samples showing the miR-92a decrease has t(4;11)(q21;q23) translocation. [score:1]
Nevertheless, it is still unclear that selective decrease of miR-92a in acute leukemia, and we need to study the mechanism of microRNA circulation. [score:1]
In situ hybridaization of miR-92a. [score:1]
What are the physiological roles of miR-638 and miR-92a in the blood vessels and why miR-92a is decreased in plasma of the acute leukemia patients are intriguing questions but remain unclear. [score:1]
The decrease of miR-92a in the plasma may be a very useful clinical marker of acute leukemia. [score:1]
All together, these results suggest that miR-92 has oncogenic potential. [score:1]
At the time we speculate that miR-92a is an essential molecule for proliferation of cells, and cancer cells both actively transcribe miR-92a and take in miR-92a from the blood. [score:1]
In situ hybridization was performed using LNA probes for miR-92a and negative control. [score:1]
The ratio of miR-92a/miR-638 in plasma has strong potential for clinical application as a novel biomarker for detection of leukemia. [score:1]
B. Comparison of the ratio of miR92a signal intensity to miR-638 signal intensity by TaqMan qRT-PCR among the plasmas of normal and leukemia. [score:1]
The probe sequences were as follows; miR-92a, 5′-ACAGGCCGGGACAAGTGCAATA-3′; a scrambled oligonucleotides used for negative control, 5′-GTGTAACACGTCTATACGCCCA-3′. [score:1]
Especially, the ratio of miR-92a/miR-638 in plasma was very useful for distinguishing leukemia patients from healthy body. [score:1]
On the other hand, we observed decrease of miR-92a in all plasma samples of AML and ALL. [score:1]
In this report, we describe that the ratio of miR-92a/miR-638 in plasma was the very sensitive marker for AML and ALL. [score:1]
Locked nucleic acid (LNA) -modified probes for miR-92a and negative control (miRCURY-LNA detection probe, Exiqon). [score:1]
We have revealed that microRNA-638 (miR-638) is stably present in human plasmas, and microRNA-92a (miR-92a) dramatically decreased in the plasmas of acute leukemia patients. [score:1]
0005532.g003 Figure 3 In situ hybridization was performed using LNA probes for miR-92a and negative control. [score:1]
In summary, we have shown that the ratio of miR-92a/miR-638 in blood is firmly associated with diagnosis in acute leukemia patients. [score:1]
Our results have revealed that the decrease of miR-92a in the plasma is a novel class of blood -based leukemia biomarkers, and furthermore raised provocative questions regarding the mechanism of stability and potential biological function of circulating microRNAs. [score:1]
We found that the rank order of signal intensities of miR-92a was dramatically down in the leukemia samples (Figure 2A). [score:1]
Thus, it might be possible that cancer cells specifically take in the exosome that contain miR-92a and, as a result, miR-92a decreases from the blood. [score:1]
The ratio of miR-92a and miR-638 serves as leukemia biomarkers. [score:1]
We next analyzed the levels of miR-92a in the plasma samples from normal (n = 16) and leukemia (AML, n = 54; ALL, n = 7) by TaqMan qRT-PCR. [score:1]
[1 to 20 of 31 sentences]
18
[+] score: 40
The gene expression of the processing machinery components (Drosha, DGCR8 and Dicer) and the production of the selected miRNAs (miR-223, miR-92a, miR-486, miR-125a and miR-146a) are presented in Fig 4. The gene expression of Drosha, DGCR8 and Dicer was upregulated in cells incubated with either sera with added glucose compared to the NG sera (an average of 2 fold, p<0.05, Fig 4A). [score:7]
Exposure of human macrophages to ACS sera compared to SA sera determines an increase of the production of miR-223, miR-92a, miR-486, miR-125a and miR-146a by the upregulation of Drosha, DGCR8 and Dicer expression, this effect being augmented by the increase of sera’s glucose concentration. [score:5]
In our study, the parametric correlations show that miR-92a and miR-486 correlate negatively with two risk factors for CAD: small dense LDL (expressed as LDL-C/apoB-100) and dysfunctional HDL (expressed as PON1 activity/apoA-I). [score:5]
Levels of miR-223 (A), miR-92a (B), miR-486 (C), miR-122 (D), miR-125a (E), miR-146a (F) in sera from Control subjects and coronary artery disease (CAD) patients with stable angina (SA) or acute coronary syndrome (ACS), with/without hyperglycemia. [score:3]
The gene expression of the processing machinery proteins (Drosha, DGCR8 and Dicer) and the selected miRNAs (miR-223, miR-92a, miR-486, miR-125a and miR-146a) levels are presented in Fig 3. 10.1371/journal. [score:3]
The gene expression of the processing machinery proteins (Drosha, DGCR8 and Dicer) and the selected miRNAs (miR-223, miR-92a, miR-486, miR-125a and miR-146a) levels are presented in Fig 3. 10.1371/journal. [score:3]
MiR-486 and miR-92a levels expressed the highest increase in macrophages incubated with ACS sera, compared to control and SA sera. [score:2]
The serum and Lp levels of Homo sapiens (hsa)-miR-223-3p (ID002295), hsa-miR-92a-3p (ID000431), hsa-miR-486-5p (ID001278), hsa-miR-122-5p (ID002245), hsa-miR-125a-5p (ID002198), hsa-miR-146a-5p (ID000468) and cel-miR-39-5p (ID000200) were determined by employing the TaqMan technology. [score:1]
Lai et al. showed that miR-92a induces the reduction of the production of inflammatory cytokines in macrophages by a Toll-like receptor (TLR) -mediated mechanism [31]. [score:1]
In this study, we evaluated the levels of a panel of six miRNAs (miR-223, miR-92a, miR-486, miR-122, miR-125a and miR-146a) in sera and HDL from stable angina (SA) and ACS patients, and the functional effects of ACS and SA patients’ sera, with or without hyperglycemia, on cultured human macrophages, namely on the gene expression of the processing machinery proteins (Dicer, Drosha, DGCR8) and analyzed miRNAs production. [score:1]
The addition of glucose to normoglycemic sera (to mimic the existing concentration in hyperglycemic ones) induces both an increase of the miRNAs (miR-125a, miR-486, miR-92a, miR-146a, and miR-223) levels and of their processing machinery proteins (Drosha, DGCR8 and Dicer). [score:1]
In conclusion, the hyperglycemia in serum is correlated with the increased levels of miR-223, miR-92a, miR-486 in sera and HDL, these miRNAs associated with HDL being able to discriminate between ACS and SA patients. [score:1]
The new data about the effect of hyperglycemia on miRNAs obtained in the present study are: (i) in hyperglycemic ACS sera, miR-223, miR-92a, miR-486, miR-122, miR-125a and miR-146a levels are increased compared to the normoglycemic ACS sera; (ii) in HDL from hyperglycemic ACS compared to normoglycemic sera, miR-223, miR-92a, miR-486 are increased and statistically different between ACS and SA patients; (iii) ACS sera induce an increase of Drosha, DGCR8 and Dicer expression and of miR-223, miR-92a, miR-486, miR-125a and miR-146a production in human macrophages; (iv) the hyperglycemic sera augments the effects observed in human macrophages exposed to normoglycemic sera, mainly in the case of ACS sera. [score:1]
The levels of miR-92a and miR-486 correlated negatively with LDL-C/apoB-100 and PON1 activity/apoA-I. The levels of miR-122 were correlated positively with TG and NEFA levels and negatively with apoE levels. [score:1]
We report that the exposure of human macrophages to ACS sera induces the increase of the intracellular miR-223, miR-92a, miR-486, miR-125a and miR-146a levels in human macrophages, the highest levels being observed for miR-486 and miR-92a. [score:1]
In contrast, Liu et al. reported that the levels of circulating miR-92a are lower in CAD patients than in control subjects and positively correlated with HDL and apoA-I levels [29]. [score:1]
In HDL from all CAD patients, miR-223, miR-92a, miR-486 and miR-122 had the highest levels, miR-223 and miR-486 being the most abundant in HDL [2] and miR-92a in HDL [3] (Fig 2). [score:1]
This suggests that when small dense LDL and dysfunctional HDL coexist, miR-92a and miR-486 levels increase, confirming our previous results that show a preferential association of miR-92a and miR-486 in vulnerable CAD patients [22]. [score:1]
The serum levels of miR-223, miR-92a, miR-486 and miR-146a were correlated positively with the age and BMI of the patients and control subjects and negatively with LDL-C levels. [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 38
In contrast, miR-92 expression was upregulated in WNV-infected Cx. [score:6]
The targets of miR-989 and miR-92 in mosquitoes are not yet known; however, several studies have examined expression of these miRNAs during development. [score:6]
quinquefasciatus while miR-92 is significantly upregulated. [score:4]
Given the dysregulation of miR-989 and miR-92 during WNV infection, it is interesting to speculate that the targets of these miRNAs may play roles in mediating flavivirus infection in the mosquito host. [score:4]
Culex miR-989 and miR-92 expression levels are altered during flavivirus infection. [score:3]
Notably, this pattern of miRNA expression for miR-989 and miR-92 is also found in deep sequencing reads of WNV-infected Cx. [score:3]
Differences in miR-989 and miR-92 expression levels are highlighted. [score:3]
Two miRNAs, miR-92 and miR-989, showed significant changes in expression levels following WNV infection. [score:3]
Five miRNAs, miR-1, miR-317, miR-277, miR-989, and miR-92 were sequenced >120 times and were readily detectable in total RNA isolated from Cx. [score:1]
We additionally investigated the effects of flavivirus infection on miRNA expression and found that miR-92 and miR-989 are significantly changed in response to WNV infection. [score:1]
Five miRNAs, miR-184, miR-275, miR-277, miR-276, and miR-92, were sequenced >500 times and were readily detectable in total RNA isolated from C7/10 cells (Figure 3A). [score:1]
Furthermore, in vertebrates, miR-92 is a member of the conserved miR-17-92 cluster and is associated with oncogenesis and increased cellular proliferation. [score:1]
aegypti mosquitoes; miR-989 is also present in the midgut while miR-92 is present in Ae. [score:1]
In the silkworm Bombyx mori, miR-92 is associated with embryogenesis, a stage of high cellular proliferation and differentiation [49]. [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 36
Other miRNAs from this paper: hsa-mir-92a-2
The ectopic expression of miR-92a in T24 cells also downregulated Dkk-3, and combined transfection with miR-92a and antagomiR-92a restored the expression level of Dkk-3 (Figure 2D). [score:8]
However, the inhibitory effect on growth by the ectopic expression of miR-92a was weak, and SIRT1 expression was increased in T24 cells transfected with miR-92a (Figure 2C,D). [score:7]
Recently, we have validated that Dkk-3 is one of the direct targets of microRNA-92a, and downregulation of Dkk-3 can promote angiogenesis in endothelial cells [16]. [score:7]
Previously, we reported that Dkk-3 is one of the target genes for miR-92a regulation in colorectal cancer cells [16]. [score:4]
The cell count analysis and the expression levels of mRNAs in the cells transfected with miR-92a and those transfected with nonspecific control miRNA were compared by using Student’s t-test. [score:2]
Analysis of the cell-cycle distribution revealed the G [0]/G [1] arrest in T24 cells transfected with siR- Dkk-3, which was severer than that in the cells transfected with miR-92a (Figure 2E,F). [score:1]
At 72 h after the transfection with a non-specific control, siR- Dkk-3 (1 or 2 nM) or miR-92a (10 or 20 nM) was fixed by 4% formaldehyde for 10 min, and the chambers were washed by PBS for 15 min. [score:1]
The mature type of miR-92a (mirVana miRNA mimic; Ambion, Foster City, CA, USA) or short-interfering RNA (siRNA) for Dkk-3 (siR- Dkk-3; Invitrogen, Carlsbad, CA, USA) was used for the transfection of the cells, which was achieved by using cationic liposomes, Lipofectamine RNAiMAX (Invitrogen), according to the manufacturer’s Lipofection protocol. [score:1]
Transfection with miR-92a or Short-Interfering RNA for Dkk-3. 4.3. [score:1]
The effects manifested by the introduction of siR- Dkk-3 or miR-92a into the cells were assessed at selected time points after the transfection. [score:1]
The sequence of the mature type of miR-92a used in this study was 5′-UAUUGCACUUGUCCCGGCCUGU-3′ and those of siR- Dkk-3 were 5′-GAUGAGUAUGAAGUUGGCAGCUUCA-3′ and 5′-CCCTCTTTGGCAGTTGCATTAGTAA-3′. [score:1]
Yamada N. Nakagawa Y. Tsujimura N. Kumazaki M. Noguchi S. Mori T. Hirata I. Maruo K. Akao Y. Role of intracellular and extracellular microRNA-92a in colorectal cancer Transl. [score:1]
Quantification of cellular DNA content at 48 h after transfection with non-specific control, miR-92a (10, 20 or 40 nM) or siR- Dkk-3 (1, 2 or 5 nM) was determined by using a cytometer. [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 31
miR-92a also targets Krüppel-like factor 2 (KLF2), KLF4, and sirtuin 1, thereby promoting inflammatory responses [26, 33, 34]. [score:3]
miR-92a inhibits endothelial cell angiogenesis and impairs endothelial cell function [26, 31– 33]. [score:3]
When miR-92a is overexpressed, blood vessel growth and functional recovery of damaged tissue are restricted [31], which may enhance the incidence of pulmonary edema and ARDS. [score:3]
This study links whole blood expression of miR-181a, miR-92a, and miR-424 to ARDS. [score:3]
miR-181a, miR-92a, and miR-424 are among the top enrich score miRNAs Sepsis and pneumonia are the two most common ARDS-predisposing clinical risks and account for the highest percentage of risk in our study cohort. [score:1]
Three miRNAs—miR-181a, miR-92a, and miR-424—from the discovery cohort remained significantly associated with ARDS in a 373-patient independent validation cohort (FDR q < 0.05) and meta-analysis (p < 0.001). [score:1]
This study identified three promising miRNAs—miR-181a, miR-92a, and miR-424—that are associated with human ARDS. [score:1]
Meta-analysis was conducted based on fixed effect mo del OR odds ratio, CI confidence interval, FDR false discovery rate miR-181a, miR-92a, and miR-424 were the three most significant miRNAs among all 22 miRNAs from the discovery cohort and remained significant in the validation cohort and meta-analysis. [score:1]
Of those 14 miRNAs, miR-181a, miR-92a, and miR-424 demonstrated the strongest associations with ARDS risk (p < 0.001) (Table 1). [score:1]
Addition of miR-181a, miR-92a, and miR-424 to LIPS increased baseline AUC to 0.723 (95% CI 0.667–0.778), with a relative integrated discrimination improvement of 2.40 (p = 0.005) and a category-free net reclassification index of 27.21% (p = 0.01). [score:1]
Meta-analysis was conducted based on fixed effect mo del OR odds ratio, CI confidence interval, FDR false discovery rate miR-181a, miR-92a, and miR-424 were the three most significant miRNAs among all 22 miRNAs from the discovery cohort and remained significant in the validation cohort and meta-analysis. [score:1]
Inflammatory response markers miR-181a and miR-92a were significantly elevated in ARDS patients, while pulmonary artery endothelial cell anti-inflammation marker miR-424 was significantly reduced in ARDS patients. [score:1]
Among patients with sepsis or pneumonia, miR-424, miR-92a, and miR-181a remained significantly associated with ARDS, reinforcing that the association was independent of sepsis or pneumonia. [score:1]
Of note, combination of miR-181a, miR-92a, and miR-424 increased IDI to 2.40 (95% CI 0.72–4.08; p = 0.005) and category-free NRI to 27.21% (95% CI 5.72–48.70; p = 0.014) (Table  4). [score:1]
miR-181a, miR-92a, and miR-424 are among the top enrich score miRNAs. [score:1]
When miR-181a, miR-92a, and miR-424 were computed together with the baseline LIPS mo del, AUC significantly increased to 0.723 (95% CI 0.667–0.778; p = 0.005) (Table  4). [score:1]
miR-181a and miR-92a are risk biomarkers for ARDS, whereas miR-424 is a protective biomarker. [score:1]
Computation of all six miRNAs (miR-181a, miR-92a, miR-424, miR-1290, miR-29b, and miR-331) together with the baseline LIPS mo del further increased AUC to 0.728 (95% CI 0.674–0.783; p = 0.001) (Table  4). [score:1]
Indeed, under the null hypothesis GSEA [17], miR-181a, miR-92a, and miR-424 were significantly overrepresented and enriched among the top six genes on a global miRNA scale (Table 2, 1: Figure S4). [score:1]
Of the 22 miRNAs, 3 miRNAs—miR-181a, miR-92a, and miR-424—remained significant risk factors (OR > 1.0) or protective factors (OR < 1.0) for ARDS in the validation cohort after multiple testing adjustment by FDR (Benjamini–Hochberg) (Table 1). [score:1]
Here, we report that miR-181a and miR-92a are associated with ARDS risk in all tested cohorts and meta-analysis. [score:1]
Thus, we conducted stratification analysis to prove that the top three miRNAs (miR-181a, miR-92a, and miR-424) remained significantly associated with ARDS regardless of sepsis and pneumonia imbalance between our two cohorts. [score:1]
AUC values of miR-181a, miR-92a, and miR-424 were larger than that of sepsis, but smaller than AUC values for LIPS or pneumonia. [score:1]
[1 to 20 of 23 sentences]
22
[+] score: 29
Other miRNAs from this paper: hsa-mir-92a-2
We also examined if the suppressive effect of conditioned medium of MSCs, which overexpress miR-92a, could be mediated by a direct transfer of this microRNA to endothelial cells by extracellular vesicles. [score:6]
Overexpression or down-regulation of miR-92a by nucleofection does not affect MSC viability. [score:6]
We selected miR-92a as a one of the most abundant angio-miRs expressed in MSCs and confirmed its expression by real-time PCR [1]. [score:5]
• Our data point to HGF as a new target of miR-92a. [score:3]
Mir-92a Nucleofection Cell viability Capillary-like tube formation • List of microRNAs expressed in adipose-derived MSCs will help to develop new experiments to study functional activities of these cells. [score:2]
We also analyzed the content of HGF and angiopoietin-1 in these cells and found that intracellular content of HGF was 2.6 times lower in MSCs transfected with pre-miR-92a comparing to scramble transfected cells; however, angiopoietin content within MSCs did not change significantly (see Fig. 2). [score:1]
Addition of recombinant HGF but not angiopoietin-1 to the conditioned medium of MSCs transfected with pre-miR-92a restored its ability to stimulate the tube formation by HUVEC (see Fig. 4). [score:1]
To evaluate a significance of HGF and angiopoietin-1 for tube formation we also supplemented the conditioned medium of MSCs overexpressing miR-92a with recombinant growth factors (R&D). [score:1]
Viability of MSCs transfected with pre-miR-92a, anti-mi-92a or scramble oligos was assessed 48 h post-transfection. [score:1]
MiR-92a in MSCs was detected using miRVana qRT-PCR miRNA detection kit (Ambion), according to manufacturer׳s protocol. [score:1]
We collected conditioned medium of MSCs transfected with pre-miR-92a, anti-miR-92a or scramble oilgos, applied it to HUVEC and analyzed their viability. [score:1]
We examined viability of transfected cells, which was about 90% and did not differ between cells transfected with pre-miR-92a, anti-miR-92a or scramble oilgos (Fig. 1). [score:1]
[1 to 20 of 12 sentences]
23
[+] score: 25
Among the remaining seven predictions, six were validated by more recent studies: miR-92a was determined to directly target the anti-apoptosis molecule BCL-2-interacting mediator of cell death (BIM) in CN tissues and an anti-miR-92a antagomir led to the apoptosis of CN cell lines [67]; overexpressed miR-199a-3p (the 3p arm of the pre-miRNA for miR-199a) contributed to the late TNM stage in CN and transfecting miR-199a-3p inhibitor into CN SW480 cells could significantly limit the cell proliferation [68]; miR-142-3p (the 3p arm of the pre-miRNA for miR-142) functioned as a CN suppressor through targeting CD133, leucine-rich-repeat-containing G-protein-coupled receptor 5 (Lgr5) and ATP binding cassette (ABCG2) [69]; miR-146b enhanced the proliferation of CN by targeting the calcium-sensing receptor (CaSR) and impairing the anti-proliferative and pro-differentiating actions of calcium [70]; miR-150 was found to be a tumor suppressor in CN by targeting c-Myb [71]; overexpressed miR-122 and its concomitantly suppressed target gene, cationic amino acid transporter 1 (CAT1), would contribute to the development of CN liver metastasis [72]. [score:25]
[1 to 20 of 1 sentences]
24
[+] score: 25
Thus, our in vivo data from a population with early CHD offers an interesting glimpse into the transitional stage of CED between normal endothelial function and CHD, as well as a probable role for miR-92a in the progression, complications and potential therapeutic target for coronary artery disease. [score:5]
On the other hand, previous in-vitro studies demonstrated that inhibiting miR-92a tends to improve endothelial function and repair [38] as well as angiogenesis and endothelial cell migration [8], [39]. [score:3]
Prior work in stable CHD has shown a reduction in miR-92a levels compared to controls [22], and even upregulation in miR-92a in the systemic circulation, resulting in a negative transcoronary gradient, in the setting of ACS [23]. [score:3]
Notably, these data show a significantly positive transcoronary gradient for miR-92a, indicating its net release from the coronary circulation (Figure 1c). [score:1]
miRs studied included miR-17, miR-92a, miR-126, miR-34, miR-181b, miR-221, miR-222 (endothelium related), miR-208, 133 (myocardium related), miR-21, miR-145 (vascular smooth muscle related), and miR-155 (Inflammatory cell related). [score:1]
In particular, an absolute and relative decrease in endothelial-related miRs (miR-17, miR-92a, miR-126), smooth muscle miR (miR-145), and inflammatory cell -mediated miR (miR-155) with a converse increase in miR-133a and miR-208a (myocardial -associated miRs) was observed in patients with stable CHD [22]. [score:1]
Our current study is in accord with these latter observations, and a significantly elevated transcoronary gradient of miR-92a may indicate a release into the coronary circulation either causing, or as a result of, endothelial damage. [score:1]
Thus, it is likely that the positive transcoronary gradient of endothelial and anti-fibrotic miRs (miR-92a and miR-133), which may potentially become negative during ACS [23], could reflect a protective retention during ACS. [score:1]
While Fichtlscherer et al. initially showed significant reductions in most absolute and relative endothelial-related miR levels (miR-17, miR-92a, and miR-126) with increases in myocardial and inflammatory-related miRs (miR-133, miR-145, and miR-155) in patients with stable CHD [22], De Rosa et al. showed little to no change in miR levels with stable CAD, but marked increases and decreases in some miR levels with ACS [23]. [score:1]
Multivariate analysis (Spearman's correlation) revealed a few moderate correlations between certain miRs aortic (Table 3), coronary sinus (Table 4), and transcoronary gradients and surrogate markers for CHD found in serum blood draws such as hemoglobin, leukocytes, platelets, total cholesterol, LDL-cholesterol, triglycerides, hs-CRP, and vitamin B12 (miR-21 (p = 0.02), miR-92a (p = 0.02), miR-126 (p = 0.02), miR-133 (p = 0.03), and miR-155 (p = 0.003); (Table 5). [score:1]
On the other hand, in patients with active acute coronary syndromes (ACS) miR-133a and miR-208a (myocardial miRs), miR-126 and miR-92a (endothelial), and miR-155 (inflammatory cell) levels were all found to be increased in aortic blood samples (miR-133a, miR-208a also increased in coronary sinus samples), with increased transcoronary gradient of miR-133 and trends toward negative gradients of miR-92a and miR-126 [23]. [score:1]
Mean aortic miR levels were significantly reduced, after normalization using the delta-CP method, in miR-92a (p = 0.02), miR-126 (p = 0.03), miR-133 (p = 0.03), and miR-155 (p = 0.003). [score:1]
Standard curves were obtained for miR-92a, miR-126, miR-181b, miR-221, and miR-222. [score:1]
Based on these data circulating levels miR-92a and miR-133 could serve as surrogate markers for early coronary atherosclerosis. [score:1]
A recent study uncovered an association between a series of miRs specific to the myocardium (miR-133a, miR-208a), the vasculature (miR-17, miR-92a, miR-126), inflammatory cells (miR-145), smooth muscle and (miR-155) and the presence of stable CHD [22]. [score:1]
Significant associations between miR-92a and total as well as LDL-cholesterol point to a logical correlation between substances known to be harmful to the endothelium (lipids) and miRs thought to be deleterious to endothelial health. [score:1]
In summary, we report significantly elevated transcoronary gradients of miR-92a and miR-133 in patients without early coronary atherosclerosis and demonstrated coronary microvascular endothelial dysfunction. [score:1]
[1 to 20 of 17 sentences]
25
[+] score: 24
Our results show that continuous E6/E7 expression is linked to an upregulation of let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and a downregulation of miR-21–5p, in exosomes secreted from HeLa cells. [score:9]
These findings indicate that continuous HPV E6/E7 oncogene expression determines a signature of seven miRNAs in exosomes secreted from HeLa cells in that it leads to significantly increased let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and decreased miR-21–5p levels. [score:3]
Transfection of a mir-17~92 expression vector led to an increase of miR-17–5p, miR-20a-5p, miR-19b-3p and miR-92a-3p levels, as expected, but not of miR-34a-5p, which served as a negative control (Fig. 6A). [score:3]
miR-17–5p, miR-20a-5p, miR-19b-3p, miR-92a-3p: encoded by the mir-17~92 expression vector; miR-34a-5p: negative control (not encoded by the vector). [score:3]
The oncogenicity of miRNAs has been particularly well demonstrated for members of the miR-17~92 cluster (also called “oncomir-1”; coding for miR-17, miR-20a, miR-18a, miR-19a, miR-19b and miR-92a) and of its paralog cluster miR-106b~25 (coding for miR-106b, miR-93 and miR-25) [18]. [score:1]
miR-20a-5p can block oncogene -induced senescence via p21 repression [109], whereas miR-92a-3p possesses anti-apoptotic potential [110]. [score:1]
They encompass several family members with identical seed regions, including the let-7 family (let-7a-5p, let-7d-5p, let-7f-5p, let-7g-5p), miR-378 family (miR-378a-3p, miR-378c), miR-99 family (miR-99a-5p, miR-100–5p), as well as members of the miR-17~92 cluster (miR-20a-5p, miR-92a-3p). [score:1]
Our observations concerning exosomal miRNA contents could be relevant for intercellular communication in that HPV -positive cells might convey a tumor-promoting message to surrounding cells via exosomes, as has been reported for two of the E6/E7 -dependent exosomal miRNAs, miR-92a-3p [55] and miR-378a-3p [52]. [score:1]
miR-20a-5p and miR-92a-3p are both members of the miR-17~92 cluster. [score:1]
A statistically significant and > 1.5-fold decrease upon E6/E7 silencing was detected for exosomal let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p, whereas miR-21–5p exhibited a statistically significant and > 1.5-fold increase upon E6/E7 silencing (illustrated in bold in S4 Table). [score:1]
[1 to 20 of 10 sentences]
26
[+] score: 24
[A] The expression of candidate biomarkers, miR-200a, miR-200b, miR-200c and miR-182 and [B] the expression of candidate normalizers, miR-103, miR-638, miR-92a and RNU48 in SEOC and OSE(tsT) cell lines by qRT-PCR normalized to Z30 and plotted as log [10] ratios. [score:5]
[B] Heatmap showing expression relative to OSE(tsT) cells (ie OSE(tsT) set to log [2]0) for candidate biomarkers in SEOC cell lines (miR-200a, b, c, and miR-182) and candidate endogenous controls for normalization (miR-638, miR-92a and miR-103). [score:3]
For the current study, miR-103, miR-92a, miR-638 and RNU48 were assessed as potential endogenous normalizers and miR-103 chosen as it had low differential expression between the SEOC and healthy cohorts (P = 0.768). [score:3]
miR-103, miR-92a and miR -638 had relatively invariant expression across all ovarian cell lines, and with small-nucleolar C/D box 48 (RNU48) were assessed in RNA extracted from serum as candidate endogenous normalizers. [score:3]
miR-92a was also rejected as it had recently been reported to be differentially expressed in serum of women with EOC [27]. [score:3]
Therefore, we compared CA-125 levels with miR-92a expression. [score:2]
No correlations were found between subject age and miR-103, miR-92a or miR-638 levels (Additional file 1: Figure S1), and no significant differences between the SEOC and healthy groups were observed for miR-103 (P = 0.768) or miR-92a (P = 0.367; Figure 3). [score:1]
qRT-PCR assays were performed on RNA from the cell lines and confirmed that miR-92a and miR-103 were not differentially expressed in any of the SEOC cell lines compared to OSE(tsT) cells (P > 0.05; Figure 2B). [score:1]
From this list, miRNA previously reported to be detected in serum or plasma were selected for further analysis, specifically, miR-92a, miR-103 [12, 14, 27] and miR-638 [28] (Figure 1B). [score:1]
A previous small study found that sera from 3 patients with low CA-125 levels had elevated miR-92a levels [27]. [score:1]
We found no association between subject age and serum miRNA levels for miR-200a, b, c, (or miR-103, miR-92a, miR-182, miR-638 or RNU48). [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 24
A comparison was performed between the miRNAs upregulated in both MMTBI and STBI group which identified a signature of 10 miRNAs viz miR-151-5p, miR-195, miR-20a, miR-328, miR-362-3p, miR-30d, miR-451, miR-486, miR-505* and miR-92a, with increased expression in both MMTBI and STBI groups (Fig. 2, Common miRNAs in MMTBI and STBI are highlighted in bold in Tables 1 and 2). [score:6]
This analysis identified 30 genes as direct targets for the 8 miRNA candidate miR-151-5p, miR-195, miR-328-3p, miR-362-3p, miR-30d, miR-20a, miR-486 and miR-92a. [score:4]
In our study, miR-16 and miR-92a were significantly upregulated in both MMTBI and STBI. [score:4]
There were significant differences between the two groups for all but two of the selected miRNA (see asterisks): miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p = 0.101); miR-92a (p < 0.001); miR-486 (p = 0.006); miR-505 (p = 0.008); and miR-362 (p = 0.035); miR-151 (p = 0.065); and miR-20a (p = 0.012). [score:1]
In fact, in one of the studies, miR-92a levels were increased in CSF and blood of the patients who suffered an aneurysmal subarachnoid hemorrhage 30. [score:1]
The analysis identified the AUC values as miR-195 (0.81, p value < 0.003), miR-30d (0.75, p value < 0.016), miR-451 (0.82, p value < 0.002), miR-328 (0.73, p value < 0.030), miR-92a (0.86, p value < 0.001), miR-486 (0.81, p value < 0.003), miR-505 (0.82, p value < 0.002), miR-362 (0.79, p value < 0.006), miR-151 (0.66, p value < 0.123), miR-20a (0.78, 0.007). [score:1]
There were significant differences between the two groups for all but two of the selected miRNA: miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p < 0.101); miR-92a (p < 0.001); miR-486 (p < 0.006); miR-505 (p < 0.008); and miR-362 (p < 0.035); miR-151 (p < 0.065); and miR-20a (p < 0.012) (Fig. 5). [score:1]
Among these miR-92a has been previously reported as a biomarker for STBI but it was not found to be sensitive biomarker for MMTBI 22. [score:1]
The AUC’s were: miR-195 (0.81), miR-30d (0.75), miR-451 (0.82), miR-328 (0.73), miR-92a (0.86), miR-486 (0.81), miR-505 (0.82), miR-362 (0.79), miR-151 (0.66), miR-20a (0.78). [score:1]
Comparison of miRNAs modulated in this study with that of serum miRNA from blast induced MMTBI in rats show common miRNAs such as miR-20a, miR-362-3p, miR-195, miR-451 and miR-92a. [score:1]
In a previous report, two miRNAs, miR-16 and miR-92a were identified using a microarray based screening method in human plasma samples after STBI and these were reported as specific and sensitive markers of STBI. [score:1]
The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p, miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. [score:1]
MiR-16 and miR-92a were reported as biomarkers of STBI in humans 22. [score:1]
[1 to 20 of 13 sentences]
28
[+] score: 23
CSF2RB was down-regulated (FC 0.38) and associated with 10 miRNAs; miR-92a-3p was up-regulated as CSF2RB was down-regulated and there was a seed-region match between the gene and miRNA. [score:10]
Ten of these miRNAs had seed-region matches and six of these miRNAs, miR-150-5p, miR-196b-5p, miR-203a, miR-20b-5p, miR-501-3p, and miR-92a-3p, had negative beta coefficients between differentially expressed miRNA and mRNA, suggesting a greater likelihood for direct binding that would alter the gene expression. [score:6]
Increased miRNA expression of miR-124-3p, miR-145-3p, miR-193b-3p, and miR-934 in carcinomas was associated with worse survival while increased expression of other miRNAs (i. e. miR-17-5p, miR-19b-3p, miR-20a-5p, miR-20b-5p, miR-425-5p, miR-92a-3p, and miR-93-5p) in carcinoma tissue improved survival. [score:5]
MiR-20b-5p and miR-501-3p were associated with CTSS, miR-92a-5p was associated with CSF2RB, and miR-203a was inversely associated with BCL2. [score:1]
CSF2RB was associated with ten miRNAs, five of which had a seed-region match, and one miRNA, miR-92a-3p, had a negative beta coefficient. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 23
Other miRNAs from this paper: hsa-let-7b, hsa-mir-92a-2, hsa-mir-92b, hsa-mir-762, hsa-mir-1207
Using a mo del of corneal epithelial cells exposed to natural human tear fluid, we showed that; 1) tear fluid treatment followed by bacterial antigens upregulates miR-762 and miR-1207, and down-regulates miR-92 and let-7b compared to bacterial antigens alone, 2) miR-762 negatively regulates the expression of genes encoding the antimicrobial RNase7, the immunomodulator ST2, and the RhoGTP -binding protein Rab5a, but not the defensins hBD-2 or hBD-3, 3) over -expression of miR-762 suppresses RNase7 and ST2 mRNA levels, and increases bacterial internalization, and 4) tear fluid alone induces miR-762 expression, which negatively regulates genes encoding RNase7 and ST2. [score:16]
MiR-762 and miR-1207 were both significantly upregulated; miR-92 and let-7b were both significantly downregulated. [score:7]
[1 to 20 of 2 sentences]
30
[+] score: 22
In addition, DIM upregulated the protein expression of E-cadherin and downregulated the protein expression of vimentin by attenuating miR-92a and the NF-κB receptor activator [148]. [score:11]
DIM upregulated the protein expression of E-cadherin and downregulated the protein expression of vimentin by attenuating miR-92a and the NF-κB receptor activator. [score:11]
[1 to 20 of 2 sentences]
31
[+] score: 22
We tested this experimental strategy in HEK293T cells with three putative targets of miR-92a that were identified by Crosslinking, Ligation And Sequencing of Hybrids (CLASH) 7. Although, in general, CLASH binding results were supported by transcript upregulation upon miR-92a inhibition 7, this assay cannot discriminate between direct and indirect miRNA -mediated regulation. [score:10]
Three MREs identified by CLASH analysis, and whose expression appears upregulated upon loss of miR-92a function were analysed 7. PCMTD1 contains a classical ‘seed’ sequence, whereas MAPRE1 and C9orf7 contain non-canonical binding motifs. [score:6]
Interestingly, C9orf7 is targeted by miR-92a via a non-canonical motif through complementary base pairing with its 3′ end, demonstrating that such interactions can be biologically relevant. [score:3]
The seed region of miR-92a is highlighted by a green box. [score:1]
Complementary base pairing is indicated, and motifs deleted by HDR are highlighted in bold (miR-92a ‘seed’ or miR-92a ‘motif’). [score:1]
This analysis revealed that no endogenous MREs were removed, except for the miR-92 family following integration of the T7-MRE [mut] barcode, as intended (Supplementary Table 1). [score:1]
[1 to 20 of 6 sentences]
32
[+] score: 22
These miRNAs had overlapping and cooperative effects on tumor suppressor genes with miR-19b directly targeting PTEN and BIM; miR-20a directly targeting PTEN, BIM and PHF6; miR-92 directly targeting IKAROS/ IKZF1, PTEN, BIM, NF1 and FBXW7, and miR-223 directly targeting FBXW7, respectively. [score:15]
Mavrakis et al. [46] further identified five miRNAs (miR-19b, miR-20a, miR-26a, miR-92 and miR-223) that contributed to leukemogenesis and acted as multi -targeted regulators of several tumor suppressor genes (IKAROS/ IKZF1, PTEN, BIM, PHF6, NF1 and FBXW7). [score:6]
Three of these miRNAs (miR-19b, miR-20a, and miR-92) belong to the oncogenic miR-17-92 cluster. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 22
a T cells were transfected with let-7i, miR-19b, miR-25 or miR-92a and then cultured under stimulation with anti-CD3 and anti-CD28 mAbs for 72 h. The phenotype was determined by flow cytometry based on cytokine expression (IFN-γ, IL-17A) and transcription factor expression (Foxp3). [score:5]
Gandhi et al. previously described upregulation of miR-25 [40] and miR-92a [39] in the sera or plasma of patients with MS, although it is unclear whether these changes reflect the altered exosomal miRNA profiles. [score:4]
Materials used for transfection in this study were as follows: MISSION Human miRNA Mimics of hsa-let-7i-5p, hsa-miR-19b-3p, hsa-miR-25-3p and hsa-miR-92a-3p, and MISSION miRNA Negative Control 2 (all from Sigma-Aldrich, MO, USA); mirVana microRNA inhibitor of hsa-let-7i-5p and a negative control (Thermo Fisher Scientific, MA, USA); Silencer Select validated siRNAs of TGFBR1 and IGF1R, and Silencer Select Negative Control No. [score:3]
Subsequent analysis of the expression of exosomal miRNAs has demonstrated that the miRNA expression profiles in MS-derived exosomes are characterised by overabundance of four miRNAs: let-7i, miR-19b, miR-25 and miR-92a (Fig.   2). [score:3]
Subsequently, we selected four miRNAs, let-7i, miR-19b, miR-25 and miR-92a for further analysis, the expression of which showed most significant differences between MS-exosome and HC-exosome (Fig.   2b). [score:3]
Since miR-25 and miR-92a belong to the same family of miRNAs [42], we speculated that miR-19b, miR-25 and miR-92a in exosomes may have some function distinct from that of let-7i in MS pathogenesis, although we have not experimentally addressed this possibility yet. [score:1]
Error bars represent the mean ± s. d. s. d. standard deviation, n. s. not significant, A. U. arbitrary unit, RT-qPCR reverse transcription quantitative polymerase chain reaction, PBS phosphate-buffered saline Treg cells but not Th1 or Th17 cells are affected by let-7iTo evaluate the functionality of the miRNAs upregulated in MS-exosome, CD3 [+] T cells from healthy donors were transfected with let-7i, miR-19b, miR-25 or miR-92a, and cultured with anti-CD3 and anti-CD28 mAbs for 72 h. Subsequently, the frequencies of inflammatory and regulatory T cell populations were evaluated by flow cytometer. [score:1]
Error bars represent the mean ± s. d. s. d. standard deviation, n. s. not significant, A. U. arbitrary unit, RT-qPCR reverse transcription quantitative polymerase chain reaction, PBS phosphate-buffered saline To evaluate the functionality of the miRNAs upregulated in MS-exosome, CD3 [+] T cells from healthy donors were transfected with let-7i, miR-19b, miR-25 or miR-92a, and cultured with anti-CD3 and anti-CD28 mAbs for 72 h. Subsequently, the frequencies of inflammatory and regulatory T cell populations were evaluated by flow cytometer. [score:1]
MiR-19b and miR-92a belong to both the miR-17-92 and miR-106a-363 clusters [42]. [score:1]
[1 to 20 of 9 sentences]
34
[+] score: 21
Previous miRNA expression analysis had shown high expression of miR-25 in colorectal carcinoma 38. miR-92a was implicated in human hepatocellular carcinoma development and miR-92a in human blood had the potential to be a noninvasive molecular marker for the diagnosis of human hepatocellular carcinoma 39. [score:6]
The present systematic review identified one most consistently reported upregulated miRNA, miRNA-21, which was consistently reported to be differentially expressed in 10 studies followed by miR-25, miR-92, and miR-223 in eight studies. [score:6]
Expression profiling studies had shown that miR-92 is overexpressed in oral carcinoma 40. [score:5]
From our study after miR-21, the most consistently reported upregulated microRNAs in eight studies were miR-25, miR-92, and miR-223. [score:4]
[1 to 20 of 4 sentences]
35
[+] score: 20
This is noteworthy, since miR-454 and miR-92a do not share common targets except for one gene, and finding such a functional overlap between two such miRNA target sets is unlikely (p = 0.021). [score:5]
Intriguingly, calcium signaling is a major biological processes involved in neuronal plasticity [26], [27], implying a role of miR-92a and miR-454 in regulating genes associated with neurodevelopmental plasticity. [score:3]
It would be interesting to test miR-454 and miR-92a as potential regulators of neurodevelopmental plasticity in vivo. [score:3]
Furthermore, targets of two out of the three miRNAs tested, miR-454 (n = 18) and miR-92a (n = 20), showed enrichment in the same KEGG term: “calcium signaling” pathway (Figure 5E, Table S9). [score:3]
“Union” indicates the union of verified targets for the miR-320b, miR-454, and miR-92a. [score:3]
To validate some of the predicted miRNA regulatory effects, we conducted an additional set of experiments with the miRNAs miR-92a, miR-454, and miR-320b. [score:2]
Briefly, we transfected two human neuroblastoma cell lines, SH-SY5Y and SK-N-SH, with three miRNA constructs containing mature sequences for miR-92a, miR-454, and miR-320b, based on miRBase [48], as well as two negative controls. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
MiR-92a was down-regulated in IPF samples, while WISP1 was upregulated, and Berschneider et al. [28] provide evidence for WISP1 regulation by miR-92a in pulmonary fibrosis. [score:8]
Lai et al. [30], demonstrated that stimulation of TLR production in macrophages down-regulates miR-92a. [score:4]
Berschneider et al. [28], using human tissue from idiopathic pulmonary fibrosis (IPF) patients, determined that this condition is mediated by the WNT1-inducible signaling pathway protein-1 (WISP1), which is a target of miR-92a. [score:3]
Bta-miR-92a was down-regulated in the positive, compared to the negative group for the study herein. [score:3]
Serum antibody to M. bovis microRNA Negative Positive SE P-value bta-let-7b 11,691 15,421 1,200 0.0336 bta-miR-24-3p 15,908 24,390 1,495 0.0002 bta-miR-92a 83,405 64,330 4,156 0.0023 bta-miR-423-5p 124,920 101,818 6,315 0.0133 A total of 21 microRNAs were associated with season (Table 3). [score:1]
Bta-miR-92a is a candidate to be used as a diagnostic tool in animals exposed to the pathogen. [score:1]
[1 to 20 of 6 sentences]
37
[+] score: 19
miR-92a are ubiquitously expressed in majority of cell types and target genes involved in cell cycle regulation and cell signaling and thus are necessary during all stages of mammalian development and essential for the proliferation of cells [53]. [score:7]
The expression of a few iPSC/ESC markers (gene/miRNAs) either did not change significantly (IFITM2, IFITM1, DIAPH2, NUMB, REST, BRIX1, TFCP2L1, FGF5, and miR-92a) or was significantly (FC ≤ −2.0, FDR ≤ 0.05) downregulated (PTEN and IL6ST) in our reprogrammed iPSCs. [score:6]
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 3 sentences]
38
[+] score: 19
Notably, hsa-miR-92a-3p (among the up-regulated miRNAs) and hsa-miR-6807-5p (among the down-regulated miRNAs) had the most target genes, 1329 and 439, respectively (Figure 3). [score:9]
Consistent with previous studies [46, 47], among the up-regulated miRNAs, hsa-miR-92a-3p, -21-3p and -27a-5p were identified as UV -induced miRNAs in human keratinocyte. [score:4]
For example, has-miR-92a-3p and -27a-5p were highly expressed in UV-exposed human dermal papilla cells, while hsa-miR-21 was activated in mouse fibroblast upon UV exposure. [score:3]
Among the DEmiRNAs, has-miR-92a-3p and -6807-5p have the most number of target genes, 131 and 53, respectively (Figure 5). [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 19
Additionally, both miR-92 and miR-17-3p were not expressed higher in patients with gastric cancer or inflammatory bowel disease, confirming their specificity [151]. [score:5]
For example, the miR-17-miR-92 cluster in T-cell acute lymphoblastic leukemia reduces the level of the transcription factor E2F1 [95, 96], the let-7 family represses Ras and Myc oncogenes in cancers [97, 98], and the miR-15a/miR-16-1 cluster down-regulates Bcl-2 and induces apoptosis in a leukemic cell line mo del [99]. [score:4]
They then analyzed a validation cohort of 90 colorectal cancer patients and 50 healthy controls and found that the expression of miR-92 in plasma could distinguish colorectal cancer patients from healthy control patients with 89% sensitivity and 70% specificity. [score:3]
Two miRNAs, miR-29a and miR-92a, were identified from a training set and confirmed in the larger validation set to be upregulated in CRC plasma compared to controls. [score:3]
In a training population of 25 colorectal cancer patients and 20 healthy controls, the expression levels miR-92 and miR-17-3p were found to be elevated in the plasma of colorectal cancer patients. [score:3]
Together, the data indicated that plasma miR-29a and miR-92a have strong potential as novel noninvasive biomarkers for early detection of CRC [153]. [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 19
MiR-150 was reported to function as a key regulator in the tumorigenesis and progression of CN by targeting c-Myb [39]; miR-92a played a critical role in the CN development and an anti-miR-92a antagomir could lead to the apoptosis of CN cells [40]; miR-199a-3p, the 3p arm of the pre-miRNA for miR-199a, exhibited a higher expression in CN tissues, resulting a significantly lower survival rate for the patients [41]; miR-142-3p, the 3p arm of the pre-miRNA for miR-142, could suppress the CN cell growth via downregulating three CN -associated proteins CD133, Lgr5, and ABCG2 [42]; an inverse correlation observed between the levels of miR-101 and the EP4 receptor protein in CN suggested that miR-101 might serve as a therapeutic target for the cancer [43]; miR-146b, with its expression inhibited, would lead to a high CsSR protein receptor level and reduce CN proliferation [44]. [score:18]
Tsuchida A miR-92 is a key oncogenic component of the miR-17-92 cluster in colon cancerCancer Sci. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 19
[66] Zhou et al [67] indicated that miR-92a was upregulated in cervical cancer and promoted cell proliferation and invasion by suppressing the expression level of Fbxw7. [score:8]
Zhou C Shen L Mao L miR-92a is upregulated in cervical cancer and promotes cell proliferation and invasion by targeting FBXW7. [score:6]
What is more, several proteins such as, RITA, EBP2, Numb4, SGK1,,, Pin1, FAM83D, C/EBPδ, Hes-5, presenilin, miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a are found to regulate the expression of Fbxw7. [score:4]
MicroRNAs (miRNAs) Including miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 19
The forced expression of miR-92a in cancer cells markedly suppressed peritoneal dissemination in vivo, suggesting that targeting miR-92a may prove to be a novel and effective gene therapy for patients with ovarian cancer. [score:7]
MiR-21, miR-29a, miR-92, miR-93, and miR-126 were significantly overexpressed in the serum of ovarian cancer patients compared to controls, while miR-99b, miR-127, and miR-155 were significantly underexpressed. [score:4]
Ohyagi-Hara et al. described the involvement of miR-92a in the expression of integrin α5, a known key player in ovarian cancer adhesion and dissemination [74, 75]. [score:3]
The levels of integrin α5 and miR-92a expression were significantly and inversely correlated in ovarian cancer cells. [score:3]
miR-92a is in the miR-17/92 family cluster, which includes miR-17, miR-18, miR-19a, mir-19b, miR-20, and miR-92. [score:1]
6.5. miR-92a. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
Ohyashiki K. Umezu T. Yoshizawa S. Ito Y. Ohyashiki M. Kawashima H. Tanaka M. Kuroda M. Ohyashiki J. H. Clinical impact of down-regulated plasma miR-92a levels in non-Hodgkin’s lymphoma PLoS ONE 2011 10.1371/journal. [score:4]
Tanaka M. Oikawa K. Takanashi M. Kudo M. Ohyashiki J. Ohyashiki K. Kuroda M. Down-regulation of miR-92 in human plasma is a novel marker for acute leukemia patients PLoS ONE 2009 10.1371/journal. [score:4]
[52, 54, 55]In addition, microRNA clusters miR-17 and miR-92 have been detected at high levels in HM, and given their function in regulating monocyte development as well as B and T cell differentiation and maturation [18, 132], they are also thought to contribute to the maturation of the infant’s immune system early in life. [score:3]
[52, 54, 55] In addition, microRNA clusters miR-17 and miR-92 have been detected at high levels in HM, and given their function in regulating monocyte development as well as B and T cell differentiation and maturation [18, 132], they are also thought to contribute to the maturation of the infant’s immune system early in life. [score:3]
In this study, immune-related microRNAs (miR-30a, miR-223, miR-92a) were highly expressed in bovine milk-derived extracellular vesicles, which were uptaken in vitro by splenocytes and intestinal cells. [score:3]
[52, 55, 56] miR-92a B and T cells. [score:1]
[1 to 20 of 6 sentences]
44
[+] score: 18
In contrast, downregulated HRMs in hESCs (miR-92a-1-5p and miR-92a-2-5p) were predicted to target HIF1A directly creating a negative feedback loop to suppress HIF signal transduction. [score:9]
Upregulation (miR-4271,-4306, -520a-5p, -148b-3p and miR-146a-5p) and down regulation (miR-92a-1-5p, -92a-2-5p,-34c-5p, -138-5p and miR-4304) were checked in the array -based line (SHEF1) and in a second independent line (SHEF2) using quantitative stem loop RT-PCR (Fig 1c and 1d, S1a and S1b Fig). [score:5]
However, while stem loop qRT-PCR results confirmed the down-regulation of miR-92a-1-5p, miR-92a-2-5p and miR-34c-5p, the level of miR-4304 remained largely unaffected (Fig 1d, S1b Fig). [score:4]
[1 to 20 of 3 sentences]
45
[+] score: 17
Twelve radiation -suppressed miRNAs were identified, i. e. let-7d, miR-15a, miR-17, miR-30d, miR-92a, miR-197, miR-221, miR-320b, miR-342, miR-361, miR-501 and miR-671, and a significantly different expression between prostate cancer and the corresponding adjacent part was found, including 11 upregulated and 1 downregulated (Fig. 3B). [score:11]
Our results are consistent with those of previous studies and demonstrated that miR-25, miR-17, miR-30d and miR-92a are overexpressed, and miR-221 is downregulated in prostate cancer (9, 42– 44). [score:6]
[1 to 20 of 2 sentences]
46
[+] score: 17
Deregulation of miR-92a expression is implicated in hepatocellular carcinoma development. [score:5]
Integrated genomic profiling identifies microRNA-92a regulation of IQGAP2 in locally advanced rectal cancer. [score:2]
MicroRNA-92a functions as an oncogene in colorectal cancer by targeting PTEN. [score:2]
MicroRNA-92a Promotes Colorectal Cancer Cell Growth and Migration by Inhibiting KLF4. [score:2]
Several members of this cluster, such as miR-17 (Ng et al., 2009; Yu et al., 2012), miR-20a (Schetter et al., 2008; Motoyama et al., 2009; Earle et al., 2010; Yu et al., 2012), miR-92a (Motoyama et al., 2009; Ng et al., 2009; Earle et al., 2010; Tsuchida et al., 2011; Schee et al., 2012; Wu et al., 2012; Yu et al., 2012) and miR-18a (Motoyama et al., 2009; Brunet Vega et al., 2013; Zhang et al., 2013b), are all reportedly increased in CRC tumors and in serum/plasma, with their elevated levels correlating with recurrence and poor prognosis. [score:1]
Clinical relevance of microRNA miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 in colorectal cancer. [score:1]
miR-92 is a key oncogenic component of the miR-17-92 cluster in colon cancer. [score:1]
Detection of miR-92a and miR-21 in stool samples as potential screening biomarkers for colorectal cancer and polyps. [score:1]
Impact on cell to plasma ratio of miR-92a in patients with acute leukemia: in vivo assessment of cell to plasma ratio of miR-92a. [score:1]
Importantly, serum levels of miR-18a (Zhang et al., 2013b) and miR-92a (Huang et al., 2010; Wu et al., 2012) miRNAs decrease following tumor resection. [score:1]
[1 to 20 of 10 sentences]
47
[+] score: 17
The modulation of miRNA expression following E6/E7 siRNA treatment was further confirmed by real-time quantitative PCR (RT-qPCR) for approximately three-quarters of the targets and among them, let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423-3p, miR-7-5p, miR-92a-3p were downregulated and miR-21-5p was upregulated. [score:11]
Li M. Guan X. Sun Y. Mi J. Shu X. Liu F. Li C. miR-92a family and their target genes in tumorigenesis and metastasisExp. [score:3]
Moreover, the miR-7-5p favors cell proliferation [96], the miR-20a-5p blocks oncogene -induced senescence by targeting p21 [97], and miR-92a-3p possesses anti-apoptotic properties [98]. [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 17
This experiment showed for the first time that hsa-miR-92 targets the 3′UTR of the RFX1 transcript, which is in turn known to inhibit PCNA expression. [score:7]
To explain the positive correlation between PCNA and the two miRNAs, we hypothesized that one or many other genes could be inhibited by miR-92 and miR-32 and that these genes could be negative regulators of PCNA (Figure 3A). [score:4]
This results in a positive correlation in expression between hsa-miR-32, hsa-miR-92 and PCNA. [score:3]
A. hsa-miR-32 and hsa-miR-92 (Figure 2B) repress RFX1 via a 3′UTR sequence. [score:1]
To further explore this substantial family of CPC pairs, we focused on the PCNA gene (proliferating cell nuclear antigen) involved in cell replication and DNA repair because it was highly positively correlated with both hsa-miR-92 and hsa-miR-32. [score:1]
This relationship explains the positive correlation found between hsa-miR-92 and the PCNA gene. [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 16
Overall, the expression profile of miRNAs in hNPCs is very distinct from the expression profile of miRNAs that have previously been reported for the adult human brain, where miR-92 is expressed at low levels, whereas other miRNA families, such as let-7 and miR-124, dominate the expression profile (see e. g. Boudreau et al., 2014). [score:9]
The miR-92 family constitutes a large proportion of all miRNA families expressed in NE cells patterned towards FB, MB and HB. [score:3]
Moreover, the miR-92 family was specifically associated with neural progenitors, which suggests that they play a role in regulating human neural progenitor proliferation or specification. [score:2]
This analysis revealed that the miR-92 family dominates FB, MB NE and MB FP cells, making up a large proportion of all miRNA reads (Fig.  4A,B,D). [score:1]
In forebrain- and midbrain-patterned cells, miR-92a and miR-92b compose >70% of all miRNAs. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 16
The expression of miR-106a, miR-106b, miR-17-5p, miR-92, miR-93, miR-190, miR-20a and miR-130 were highest in EB (panel B). [score:3]
The expression of miR-106a, miR-106b, miR-17-5p, miR-92, miR-93, miR-130a, miR-20a and miR-190 were much higher in EB than in either hES cells or adult cells (Figure 6, panel B). [score:3]
It should not be forgotten that hES cells contain spontaneously differentiated cells, so it is difficult to precisely determine which type of cells express miR-92. [score:3]
The expression of miR-92 has been reported in human embryonic stem (ES) cells [16, 26], mouse ES cells[20] or human EB [17] depending on the reference sample used for comparison. [score:3]
For miR-106b, miR-92, miR-93, miR-130a and miR-190, the difference in their expression between EB and hES cells and between EB and adult cells were significant (P < 0.05). [score:3]
One was the Oncomir cluster consisting of miR-17-5p, miR-20a, miR-18a, miR-19a, miR-19b, and miR-92a located on chromosome 13. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 16
Other miRNAs from this paper: hsa-mir-92a-2
Concerning the role of LAcmvIL-10, it was recently observed that its expression in latently infected CD34 [+] cells resulted in the downregulation of cellular microRNA hsa-miR-92a, which upregulates the myeloid transcription factor GATA2 (Poole et al., 2013, 2014). [score:9]
Subsequently, cIL-10 may downregulate the expression of cellular microRNA hsa-miR-92a, thus inducing the secretion of the cellular CCL8 (Poole et al., 2014). [score:6]
Latency -associated viral interleukin-10 (IL-10) encoded by human cytomegalovirus modulates cellular and CCL8 Secretion during latent infection through changes in the cellular microRNA hsa-miR-92a. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 16
We found that miR-31-5p and miR-338-5p were up-regulated in S-IPF patients (p < 0.05), but down-regulated in AE-IPF patients (p < 0.05), while miR-25-3p and miR-92-3p were up-regulated in AE-IPF group, but down-regulated in S-IPF group. [score:13]
We found that 4 of them, miR-132-3p, miR-338-5p, miR-92-3p and miR-31-5p, were not differentially expressed between AE-IPF and S-IPF groups (data not shown). [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 16
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
There were also non significant trends towards preferential expression of miR-19b and miR-92 in the central memory cells. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
[1 to 20 of 4 sentences]
54
[+] score: 15
Gene expression studies showed that IR -induced alterations in miRNAome in H9 cell line (2 hr post-IR) involve the up-regulation of only two miRNA genes, namely, hsa-miR-1973 and hsa-miR-92a (Table 2). [score:6]
Int J Mol Med 57 Shigoka M Tsuchida A Matsudo T Nagakawa Y Saito H 2010 Deregulation of miR-92a expression is implicated in hepatocellular carcinoma development. [score:5]
A large number of overexpressed IR-responsive miRNAs that we identified in our work were found to be deregulated in human cancers, such as hsa-mir-513 [55], hsa-mir-744 [56], hsa-mir-92a [57], [58], hsa-mir-1228* [59], hsa-mir-671-5p [60], hsa-mir-638 [38], hsa-mir-370 [61], and hsa-mir-675 [62]. [score:4]
[1 to 20 of 3 sentences]
55
[+] score: 15
Direct regulation of craniofacial development genes by miR-17-92 Target genes that are repressed by miR-17-92 have a mixture of miR-17/20a/106b and miR-92a/25 family seed sites in their 3′UTRs (Figure S6). [score:6]
Furthermore, in situ analysis with locked nuclei acid (LNA) probes to detect mature miR-17 and miR-92a showed that miR-17 and miR-92a were highly expressed in branchial arch and frontonasal process (Figure 2 B–D, G–H). [score:3]
Target genes that are repressed by miR-17-92 have a mixture of miR-17/20a/106b and miR-92a/25 family seed sites in their 3′UTRs (Figure S6). [score:3]
The miR-17-92 cluster, encoding miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a-1, is within a region on chromosome 13q that when deletion is associated with CL/P, lung hypoplasia, microphthalmia, microcephaly, and small stature in human patients and has phenotypic similarities to Feingold syndrome [5], [6]. [score:1]
The Tbx3 3′ UTR contained both a miR-17/20a/106b family seed site and a miR-92a/25 family seed site (Figure S6D–E). [score:1]
In situ analysis of pri-miR-17-92 (E, F) and mature miR-17 and miR-92a (B–D, G–H) at facial area. [score:1]
[1 to 20 of 6 sentences]
56
[+] score: 15
The expression levels of nine miRNAs, such as miR-16, miR-92a, miR-130b, miR-21, miR-320, and miR-106b, were significantly upregulated in the PDV group (Fig 1C and 1E). [score:6]
Although we emphasized the expression of miR-21 in this study, we also observed a significant increase in the expression of miR-16, miR-92a, miR-130b, and miR-320. [score:5]
Previously, the upregulation of miR-16 and miR-92a was reported to be induced by vascular endothelial growth factor (VEGF) stimulation, and further reported to be functionally associated with the promotion of cell proliferation and migration of vascular endothelial cells [34, 35]. [score:4]
[1 to 20 of 3 sentences]
57
[+] score: 14
Consistent with the changes observed in the two cell lines we found an increased expression of miR-101, miR-34a, miR-424, miR-21, and a decreased expression of miR-504 and miR-92a in the NB patient group with high LMNA expression compared with the specimen group with low LMNA expression (Fig. 3B). [score:8]
Among the most differentially expressed miRNAs between SH-SY5Y and LAN-5 cell lines, we chose miR-101, miR-34a, miR-424, miR-21, miR-504 and miR-92a which clearly represent the phenotypic differences between the two cell lines as concerns tumorigenicity and NB tumor progression, regulation of cell cycle, differentiation and targeting of MYCN. [score:6]
[1 to 20 of 2 sentences]
58
[+] score: 14
Consistent with those data, in our study, curcumin upregulated miR-103, miR-22, and miR-23b and downregulated miR-195, miR-15b, miR-196, and miR-92. [score:7]
In our investigation, miR-17 and miR-92 of the cluster were induced by H [2]O [2] -mediated stress, whereas curcumin treatments significantly downregulated the expression of the cluster. [score:4]
Based on statistical significance (p<0.05) and 2 -FC, curcumin pretreatment attenuated the H [2]O [2] -induced expression of 17 miRNAs (miR-15b, miR-17, miR-21, miR-26b, miR-27b, miR-28–3p, miR-30b, miR-30d, miR-92a, miR-125a-5p, miR-141, miR-196b,, miR-195, miR-302a, miR-302c, miR-320a, and miR-9), which were also significantly reduced by the curcumin treatment alone (Figure 4, Table 2). [score:3]
[1 to 20 of 3 sentences]
59
[+] score: 14
Amongst the 13 miRNAs we selected, 6 miRNAs (miR-28-5p, miR-125b-5p, miR-150-5p, miR-155-5p, miR-223-3p, and miR-92a-3p) show up-regulated expression and 3 miRNAs (miR-29a-3p, miR-29b-3p, and miR-133b) show down-regulation of expression in patient samples, compared to uninfected counterparts. [score:10]
Regular progressors (ART positive) have lower expression (Fig. 6C) of miR-92a-3p compared to rapid progressors (ART positive). [score:2]
However, four miRNAs (miR-382-5p, miR-155-5p, miR-150-5p and miR-92a-3p) showed differences in a few patient subgroups. [score:1]
In our study, there are 6 miRNAs (miR-28-5p, miR-125b-5p, miR-150-5p, miR-155-5p, miR-223-3p and miR-92a-3p) that are up regulated in patients (compared to uninfected controls). [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 13
But the relative expression levels of miR-18a, miR-19a, miR-19b-1, and miR-92a-1 did not show significantly changed after treatment with GEN (Figure 4). [score:3]
In this study, we found that in infertile male subjects, sperm motility was lower in relative higher GEN dose group (Group3) while the relative expression levels of seminal plasma miR-19b-1, miR-20a and miR-92a-1 were higher in corresponding groups. [score:3]
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
It is interesting that the relative expression levels of miR-19b-1, miR-20a and miR-92a-1 were higher in Group 3 compared to Group 1 (Figure 2, P < 0.05). [score:2]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
[1 to 20 of 6 sentences]
61
[+] score: 13
miR-92a-3p inhibition also reduced TNF-α production by ∼50%, suggesting its involvement in regulating TLR7 -mediated immune induction, while miR-18a-5p and miR-17-5p inhibition only had a modest effect on RNA sensing (Figure 1A). [score:6]
To distinguish the direct contribution of miR-19 and -92 in TLR7 sensing from a potential off-target effect of the 2′OMe AMOs used, experiments were replicated in BMMs from miR-17∼92 [flox/ flox] × LysMCre mice—where levels of mature miR-17-5p, miR-19a-3p and miR-92a-3p were decreased by ∼70% (Figure 1B). [score:4]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
In this work, we originally set out to study the role of the individual members of the miR-17∼92 cluster of miRNAs (miR-17/20a, miR-19a/b, miR-18a and miR-92a) on TLR7 -driven NF-κB signalling in mouse primary macrophages. [score:1]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 13
For the efficient target DSC2, miR-323-3p and miR-92a repressed it only in normal stage, and it had contribution to the process of ‘bundle of His cell to Purkinje myocyte communication’ only in CIN I stage. [score:3]
For the efficient target SLC11A2, miR-92a repressed it only in normal stage, thus it had contribution to the processes of ‘zinc ion transmembrane transport’, ‘cobalt ion transport’, ‘copper ion transmembrane transport’, and ‘cadmium ion transmembrane transport’ only in CIN I stage. [score:3]
For the efficient target COL12A1, miR-92a repressed it only in normal stage, and it had contribution to the processes of ‘extracellular matrix organization’, ‘extracellular matrix disassembly’, ‘collagen catabolic process’, and ‘collagen fibril organization’ only in CIN I stage. [score:3]
Our finding suggests that based on miR-92a’s differential regulation on COL12A1, the interaction between cell and surrounding matrix may be enhanced in CIN I stage to promote cell invasion. [score:2]
Our finding suggests that through miR-92a’s differential regulation on SLC11A2, the ion transport in cells may be enhanced in CIN I stage, which may promote virion synthesis. [score:2]
[1 to 20 of 5 sentences]
63
[+] score: 12
The expression correlation between miR-92a and miR-92b is 0.2, and the expression correlation between miR-25 and miR-92b is 0.172. [score:5]
MiR-25 and miR-92a show a high expression correlation (PCC = 0.798), whereas miR-92b has distinct expression patterns with miR-25 and miR-92a. [score:5]
For example, three miRNAs including miR-25, miR-92a and miR-92b are from the miR-25 family. [score:1]
Both miR-25 and miR-92a were found to play roles in cell proliferation [31], [47]. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 12
In order to validate the miRNAs that were significantly deregulated in the array (miR-26a-1-3p and miR-576-3p) and to verify the expression of the miRNAs only detected in infected cells in the expression profile array (miR-217, miR-26a-2-3p and miR-92a-1-5p), we designed specific primers for each miRNA and checked its expression by RT-qPCR (Fig 3). [score:7]
To confirm the robustness of our analysis, we further validated the expression of three other less stable star miRNAs: the highly significant miRNA miR-26a-1-3p and two miRNAs detected only upon infection, miR-26a-2-3p and miR-92a-1-5p (Fig 3C). [score:3]
For the purpose of display in the heatmap, k-nearest neighbors method (k = 5) was performed to predict the missing values in uninfected cells for miR-217, miR-26a-2-3p and miR-92a-5p. [score:1]
For the purpose of display, missing values of uninfected cells for miR-217, miR-26a-2-3p and miR-92a-5p were predicted by k-nearest neighbors method and imputed after normalization as described in section. [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 12
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
In nine out of ten cases, we observed the same direction of song response by TaqMan as in the small RNA-seq experiment, although the P-value by TaqMan was below 0.05 in only five cases (tgu-miR-124, tgu-miR-29a, tgu-miR-92, tgu-129-5p, and tgu-miR-2954-3p, Additional File 1, Table S4). [score:2]
Five conserved miRNAs showed significant and consistent changes in copy number after song exposure across three biological replications of the song-silence comparison, with two increasing (tgu-miR-25, tgu-miR-192) and three decreasing (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p). [score:1]
Three miRNAs consistently decreased after song (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p) and two increased (tgu-miR-25, tgu-miR-192). [score:1]
To test for song-specificity of the miRNA response, we conducted a further TaqMan experiment assessing the levels of six miRNAs (tgu-miR-124, tgu-miR-92, tgu-miR-129-5p, and three miRNAs derived from the tgu-miR-2954 locus, next section), in birds who had heard either a normal song or a carefully matched non-song acoustic stimulus, "song enveloped noise" (SEN). [score:1]
In these same animals, normal song, but not SEN, triggered a significant decrease in the levels of tgu-miR-124, tgu-mir-129-5p, tgu-miR-92 and tgu-miR-2954-3p (Additional File 2, Figure S3 panels A-C, H). [score:1]
[1 to 20 of 7 sentences]
66
[+] score: 12
gov identifiers Mirna Therapeutics miR-34 Primary liver cancer or solid cancers with liver involvementMimicLNPs (Smarticles) Tumor regression, enhanced survival and inhibited the growth of non-hepatic tumors Phase 1, completed NCT01829971 Mirvirasen (Santaris Pharma A/S and Hoffmann-La Roche) miR-122 Hepatitis CAnti-miRLNA -modified antisense inhibitor delivery system Reduction in viral plasma RNA levels compared from baseline Phase 2a NCT02031133 MRG-201 (MiRagen Therapeutics) miR-29 SclerodermaMimicCholesterol-conjugated miRNA duplex Reduction in aberrant cell proliferation Phase 1 NCT02603224 RG-125/AZD4076 (Regulus Therapeutics) miR-103/107 Type 2 diabetes, non-alcoholic fatty liver diseasesAntimiRGalNAc-conjugated Phase I/IIa, ongoing NCT02826525 MRG-106 (miRagen Therapeutics) miR-155 Cutaneous T cell lymphoma and mycosis fungoidesAntimiRLNA -modified antisense inhibitor Phase 1 NCT02580552 miRagen Therapeutics miR-92 Pheripheral artery disease Improves recovery of damaged tissue, enhance blood vessel growth Pre-clinical – Another challenge in using miRNA -based therapeutics is their targeted delivery. [score:12]
[1 to 20 of 1 sentences]
67
[+] score: 12
MiR-17, miR-19, and miR-92 played a role in resistance to apoptosis, since thet could directly inhibit the produced pro-apoptotic proteins through the MAPK/ERK and PI3 K/AKT signaling pathways, which were important in cell survival regulation [52]. [score:5]
Chen et al. [13] found that multiple myeloma patients with high expression of miR-17, miR-20, and miR-92 had shorter progression-free survival (PFS) compared to those with low expression. [score:4]
The following search terms and combinations were used in keyword and subject heading searches: (“miR-17-92 cluster” OR “miR-17” OR “miR-18a” OR “miR-19a” OR “miR-19b” OR “miR-20a” OR “miR-92a” OR “miR-106a” OR “miR-106b”) and (“neoplasm” OR “neoplasia” OR “cancer” OR “tumor” OR “carcinoma” OR “adenoma”) and (“prognosis” OR “survival” OR “mortality” OR “outcome”). [score:1]
Sofie et al. [16] demonstrated that patients with high level of miR-92a had better clinical outcomes than patients with low level. [score:1]
The miR-17-92 family maps to human chromosome 13 (13q31.3) and encodes for the miR-17–92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, miR-92a) and two paralogs (miR-106a, miR-106b) [12]. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 12
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 11
GWAS SNP miRNA target site SNP CHR BP Distance to GWAS SNP miRNA target site SNP alleles LD R2 microRNA Target gene Target transcript rs113948889 rs112215626 12 2,059,337 44,833 G/A 1 hsa-miR-4775 DCP1B ENST00000540622 rs113948889 rs1044950 12 2,061,982 42,188 T/C 1 hsa-miR-138-5p DCP1B ENST00000541700 rs113948889 rs34730825 12 2,064,602 39,568 C/T 1 hsa-miR-3147 DCP1B ENST00000543381 rs113948889 rs111963484 12 2,102,086 2,084 C/A 1 hsa-miR-4270 DCP1B ENST00000535873 rs113948889 rs111963484 12 2,102,086 2,084 C/A 1 hsa-miR-4441 DCP1B ENST00000535873 rs113948889 rs111963484 12 2,102,086 2,084 C/A 1 hsa-miR-505-5p DCP1B ENST00000535873 rs113948889 rs112637373 12 2,102,271 99 G/T 1 hsa-miR-2909 DCP1B ENST00000535873 rs113948889 rs34730825 12 2,064,602 39,568 C/T 1 hsa-miR-92a-1-5p DCP1B ENST00000543381 Legend: Predicted miRNA target site SNPs in linkage disequilibrium with GWAS SNP rs113948889 listed in descending order of predicted effect on miRNA-to-mRNA binding. [score:11]
[1 to 20 of 1 sentences]
70
[+] score: 11
Other miRNAs from this paper: hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-92a-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-187, hsa-mir-181a-1, hsa-mir-221, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-152, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-193a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-148b, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-454, ssa-mir-10a-1, ssa-mir-10a-2, ssa-mir-10b-1, ssa-mir-10b-2, ssa-mir-10b-3, ssa-mir-10b-4, ssa-mir-10d-1, ssa-mir-10d-2, ssa-mir-122-1, ssa-mir-122-2, ssa-mir-125b-1, ssa-mir-125b-2, ssa-mir-125b-3, ssa-mir-146a-1, ssa-mir-146a-2, ssa-mir-146a-3, ssa-mir-148a, ssa-mir-148b, ssa-mir-152, ssa-mir-16a-1, ssa-mir-16a-2, ssa-mir-181a-1, ssa-mir-181a-2, ssa-mir-181a-3, ssa-mir-181a-4, ssa-mir-181a-5, ssa-mir-181b, ssa-mir-181c, ssa-mir-192a-1, ssa-mir-192a-2, ssa-mir-192b, ssa-mir-193, ssa-mir-21a-1, ssa-mir-21a-2, ssa-mir-21b, ssa-mir-221, ssa-mir-23a-3, ssa-mir-23a-4, ssa-mir-23a-1, ssa-mir-23a-2, ssa-mir-25-1, ssa-mir-25-2, ssa-mir-25-3, ssa-mir-26a-1, ssa-mir-26a-2, ssa-mir-26a-3, ssa-mir-26a-4, ssa-mir-26a-5, ssa-mir-26a-6, ssa-mir-26b, ssa-mir-26d, ssa-mir-30a-3, ssa-mir-30a-4, ssa-mir-30a-1, ssa-mir-30a-2, ssa-mir-30b, ssa-mir-30c-1, ssa-mir-30c-2, ssa-mir-30d-1, ssa-mir-30d-2, ssa-mir-30e-1, ssa-mir-30e-2, ssa-mir-30e-3, ssa-mir-454, ssa-mir-462a, ssa-mir-92a-1, ssa-mir-92a-2, ssa-mir-92a-3, ssa-mir-92a-4, ssa-mir-92b
We focused on 6 aberrantly expressed miRNAs found in our study (MiR122, MiR92a(b), MiR146a, MiR148a, MiR221) for which contributions to a disease state of liver in humans have been proven. [score:5]
The up-regulated miRNAs were MiR21b-5p, MiR10a-5p, MiR125b-5p, MiR462a-5p, and MiR92a-3p. [score:4]
These findings provide evidence that subsets of miRNA genes, including mir10, mir122, and mir92, are commonly deregulated in vertebrate liver tissue and can potentially underlie initiation and progression of destructive processes in liver cells. [score:2]
[1 to 20 of 3 sentences]
71
[+] score: 11
In colorectal cancer, the presence of the KRAS mutation was associated with upregulation of miR-127-3p, miR-92a, and miR-486-3p and downregulation of miR-378, which constituted a miRNA signature capable of predicting colorectal cancers resistant to EGFR antagonists [54]. [score:8]
Ng et al. revealed that expression of miR-92 in plasma is significantly elevated and differentiated CRC from gastric cancer or normal subjects of CRC patients with a high sensitivity of 89% and specificity of 70%; thus miR-92 in plasma could have roles as a potential marker for CRC screening [68]. [score:3]
[1 to 20 of 2 sentences]
72
[+] score: 11
Interestingly, several immune-related miRNAs were abundant in the milk (Figure 1b): miR-155, a regulator of T- and B-cell maturation and the innate immune response; miR-181a and miR-181b, regulators of B-cell differentiation and CD4+ T-cell selection; miR-17 and miR-92 cluster: a ubiquitous regulator of B-cell, T-cell and monocyte development, miR-125b, a negative regulator of tumor necrosis factor-α production, activation and sensitivity; miR-146b, a negative regulator of the innate immune response; miR-223, a regulator of neutrophil proliferation and activation; and let-7i, a regulator of Toll-like receptor 4 expression in human cholangiocytes. [score:11]
[1 to 20 of 1 sentences]
73
[+] score: 11
miR-92a is among the most consistently up-regulated miRNAs in gastric cancer [31], and miR-20a is involved in the carcinogenesis of gastric cancer through modulation of the EGR2 signaling pathway [43]. [score:4]
Zhang G. Zhou H. Xiao H. Liu Z. Tian H. Zhou T. microRNA-92a functions as an oncogene in colorectal cancer by targeting pten Dig. [score:3]
After 5 days of infection all miRNAs in the miR-17-92 cluster were significantly down-regulated as compared to uninfected cells with the exception of miR-92 (Figure 1A). [score:3]
Interestingly miR-92 was the only miRNA in this study not affected by either E. faecalis infection or ROS treatment. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 11
Expression profiling of human airway biopsies revealed several highly expressed miRNAs, including miR-92, miR-200c, miR-26a, miR-16, let-7b, miR-125a and miR-125b, which together comprised 55.5% of the total miRNA species analysed. [score:5]
Alveolar macrophages possessed the highest number of highly expressed miRNAs than the other cell types and included miR-92, miR-223, miR-191, miR-30a-5p, miR-320, miR-342, miR-146b and miR-142-3p. [score:3]
This analysis revealed that miR-92, miR-26a, miR-200c, miR-16, let-7b, miR-125a, and miR-125b were the most highly expressed in human airway tissue, having levels more than 70-fold higher than the average miRNA and contributing 55.5% of the total mRNA detected in airway biopsies. [score:3]
[1 to 20 of 3 sentences]
75
[+] score: 11
5) 7 hsa-mir-19a dbDEMC 32 hsa-mir-30d dbDEMC 8 hsa-mir-92a HMDD, miR2Disease 33 hsa-mir-451 literature 9 hsa-mir-210 miR2Disease 34 hsa-mir-152 dbDEMC 10 hsa-mir-19b dbDEMC, miR2Disease 35 hsa-mir-215 dbDEMC 11 hsa-mir-224 dbDEMC, miR2Disease 36 hsa-mir-130a dbDEMC, HMDD 12 hsa-let-7f dbDEMC, miR2Disease 37 hsa-mir-499 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
76
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
In the genome, miR-92a/19b showed three copies; miR-363 and miR-20b had two copies; while miR-17, miR-18a and miR-106a had one copy. [score:1]
MiR-92a belongs to the miR-17 ~92 cluster with seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a) and was first described as an oncogenic miRNA cluster involved in B-cell lymphoma [61]. [score:1]
[1 to 20 of 5 sentences]
77
[+] score: 11
Although a trend toward the overexpression of miR-33, miR-34 and miR-92a was observed, no evidence for a statistically significant difference in miRNA expression at this early stage of the disease was found. [score:7]
The study conducted at the beginning of the pathological process revealed a trend toward a decrease in miR-1 and an increase in miR-33, miR-92a and miR-100 levels, however, the observed changes in miRNA expression were not statistically significant. [score:3]
In the case of SCA7 the level of miR-33 and miR-92 tended to be higher and the level of miR-375 was found to be lower but these differences were not statistically significant. [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 10
The proapoptotic gene BIM is also a direct target of miR-92a [55, 56]. [score:4]
miR-17, miR-20a, and miR-92 also illustrated the importance of collaboration in the regulation of Isl1 and Tbx1 during cardiac development [69]. [score:3]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
[1 to 20 of 5 sentences]
79
[+] score: 10
Liao W. Zhang H. Feng C. Wang T. Zhang Y. Tang S. Downregulation of TrkA protein expression by miRNA-92a promotes the proliferation and migration of human neuroblastoma cellsMol. [score:6]
In the presence of MYCN amplification several miRNAs, including miR-17-5p, miR-92, miR-93, miR-99, miR-106a, and miR-221, are upregulated. [score:4]
[1 to 20 of 2 sentences]
80
[+] score: 10
MiR-92 was reported to play a regulated role in the proliferation of myeloid cells [42], while miR-192 suppressed cell proliferation and induced apoptosis. [score:4]
Among the miRNAs with high abundance (more than 100,000 counts), 12 miRNAs (mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f) were most highly expressed in M. fissipes metamorphosis. [score:3]
The expression levels of mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f were highest in this study, implying their potential significant functions in M. fissipes metamorphosis. [score:3]
[1 to 20 of 3 sentences]
81
[+] score: 10
Since co-expressed miRNAs have been shown to coordinately regulate canonical cell signaling networks associated with cell death and cell survival [18], it is notable that we found that all members of the miR-17-92 cluster (miR-17-5p, miR-18a, miR-19a, miR-92a) are upregulated after TBI and these miRNAs co-target and possibly negatively co-regulate many TBI-altered genes. [score:10]
[1 to 20 of 1 sentences]
82
[+] score: 10
It is seen that the expression of miR-17, miR-18a, miR-19, miR-20a, miR-21, miR-31, miR-92a, and miR-224 is upregulated in lung cancer cells and inhibition of their expression can reduce cell growth and invasion capacities [7, 39– 41]. [score:10]
[1 to 20 of 1 sentences]
83
[+] score: 10
The observed inhibition is plotted as a function of the level of the individual, endogenous miRNA or, in the case of the miR-92-3p sensor, the relevant miRNA family, detected in either RISC (Figure 3A) or the total miRNA pool (Figure 3B). [score:3]
As shown in Figure 1A, and detailed in Supplementary Table S1, we observed that several of these highly expressed miRNAs were either more highly RISC associated (e. g., miR-197-3p, miR-191-5p, miR-92a-3p and miR-92b-3p) or significantly less RISC associated (e. g., miR-22-3p, miR-27b-3p and miR-101-3p) than the average miRNA. [score:3]
However, because miR-92a-3p, miR-92b-3p and miR-25 bear the same seed sequence, we predict that all three of these miRNAs would target the same miRNA sensor in this assay and sequencing reads specific for these three miRNAs were therefore pooled in this experiment. [score:2]
As shown in Figure 1C, we were able to fully confirm the preferential RISC association of miR-92a-3p/miR-92b-3p and miR-197-3p, and the weak RISC association of miR-101-3p and miR-22-3p, by analysis. [score:1]
Conversely, the closely similar miR-92a-3p and miR-92b-3p were either both slightly overrepresented in RISC, e. g. in SH-SY5Y cells and the LCL, or were found at comparable levels in the RISC -associated and total miRNA pools, e. g., in A549 cells. [score:1]
[1 to 20 of 5 sentences]
84
[+] score: 9
T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematological malignancy that is classified into different genetic subtypes based upon the aberrant expression of specific transcription factor oncogenes (TAL, TLX1, TLX3 or HOXA) or the arrest at a specific stage of T-cell differentiation (immature T-ALL) 1– 4. Notably, these molecular subgroups are characterized by unique mRNA and long non-coding RNA expression signatures, which partially reflect their putative cell of origin 1, 2, 5. MicroRNAs (miRNAs) are short non-coding RNAs that function as post-transcriptional repressors of specific target genes 6, 7. Several studies have previously described a role for miRNAs in malignant T-cell transformation, including the identification of both an oncogenic (miR-19b, mir-20a, miR-26a, miR-92 and miR-223) [8] as well as a tumor suppressor (miR-150, miR-155, miR-200 and miR-193b-3p) 9, 10 miRNA network involved in T-ALL disease biology. [score:9]
[1 to 20 of 1 sentences]
85
[+] score: 9
Meanwhile, it has been reported that the miR-17-92 cluster, which yields six mature miRNAs including miR-92, is upregulated and promotes adipogenesis by inhibiting the key cell cycle regulator and tumor suppressor gene Rb2/p130 [47]. [score:9]
[1 to 20 of 1 sentences]
86
[+] score: 9
However, when we looked more closely to the miRNAs from Table 1 corresponding to conserved miRNA families, we noticed a trend to overexpression of mir-33 and mir-92a in all ataxia mo dels (Table 2), although the statistical significance is below threshold in independent analysis. [score:3]
However, like in ataxia mo dels, mir-92a present trend to overexpression in all FTD mo dels (Table 2), although the statistical significance is below threshold in independent analysis. [score:3]
In the case of Drosophila mo dels particular attention should be brought to the two members of conserved mir family, mir-33, and mir-92a, that show trend toward overexpression in some mo dels, albeit not statistically significant at this early time point. [score:3]
[1 to 20 of 3 sentences]
87
[+] score: 9
Guo et al. [23] found a significant correlation between miR-92 expression and regional lymph node involvement and clinical stage of the tumor, while there was no significant association between expression of miR-92 and age. [score:5]
This suggested the possibility of up-regulated miR-92 levels as a prognostic biomarker. [score:4]
[1 to 20 of 2 sentences]
88
[+] score: 9
Hypermethylation of the human Dkk3 promoter [26] may be the mechanism for the downregulation in various tumour types, as is repression of Dkk3 by the MYCN regulated miRNA-92 [27], [28]. [score:5]
In addition there are two recent studies showing that Dkk3 expression is regulated by miRNA-92 in neuroblastoma cell lines [27], [28]. [score:4]
[1 to 20 of 2 sentences]
89
[+] score: 9
ADIPOR2 is targeted by the downregulated miRNAs miR-181d, miR-92a, miR-204 and miR-196b-5p. [score:6]
MiR-92a is generally downregulated in animal mo dels of diabetes [67]. [score:3]
[1 to 20 of 2 sentences]
90
[+] score: 9
A senescent cell phenotype reduced the expression of proliferation-stimulating/apoptosis-suppressing miR-21, miR-214, and miR-92 and increased the expression of tumor suppressors and apoptotic markers; inflammation-repressing miR-126 was reduced, whereas inflammatory proteins had a higher level in senescent human aortic endothelial cells (53). [score:9]
[1 to 20 of 1 sentences]
91
[+] score: 9
As miR-92a expression was unchanged between BCR-ABL -positive and -negative ALL cells (Figure 1), we transduced TonB cells to overexpress miR-17∼19b, a derivative of miR-17∼92 suitable for transgenic expression. [score:7]
Furthermore, BCR-ABL -positive ALL samples exhibited a 9- to 32-fold reduction in miRNA expression compared to BCR-ABL -negative ALL cells, with the exception of miR-92 which was therefore not further analysed. [score:2]
[1 to 20 of 2 sentences]
92
[+] score: 9
miRNA Chromosomal location Cells/Animals tested Results Reference miR-21 Chr17 Human HEK293, LNCaP, MCF-7 and HCT-116 cells The miR-21 gene was knocked out with over 90% reduction of the miR-21 levelsHo et al. (2015) miR-29a Chr7 Human HEK293 cells Complete knock-out of the miR-29a geneHo et al. (2015) miRNA cluster (miR-17a-1, miR-92a-1) Chr1 Zebrafish The deletion of this miRNA cluster gene from dre-miR-17a-1 to dre-miR-92a-2 was obtained in the zebrafish embryos injected with the CRISPR/Cas9 in combination with the gRNAsXiao et al. (2013) miR-17 Chr13 Human HCT-116 and HT-29 cells The miR-17 expression was decreased by up to 96% and the knock-down phenotype was stable in the human cells and miceChang et al. (2016) Mice miR-141 Chr12 Human HCT-116 and HT-29 cells Nearly 96% reduction in the miR-141 levels was achieved with long-term stability of the knock-down phenotype and in control of crossing off-target effect on other members in the same familyChang et al. (2016) Mice Table 2 Summary of the lncRNA genes successfully edited by the CRISPR/Cas9 system. [score:9]
[1 to 20 of 1 sentences]
93
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-328, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1246, hsa-mir-1908, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Thus, the expression level of miR-92a affects the proliferation of hepatoma cell lines HepG2, OR6 and SN1a cells. [score:3]
Also, the exosomal miR-92a derived from leukemic cells can regulate integrin α5 to promote migration regulations and proliferation of endothelial cells and tube formation (Umezu et al., 2013). [score:3]
Herrera et al. (2010) MiR-92a, and MiR-638The hepatocellular carcinoma (HCC) cell lines HepG2, OR6 and SN1a cells The blood plasma samples of hepatocellular carcinoma cells (HCC) patients and healthy donors qRT-PCR analysis, and MTT assay The miR-92a is highly expressed in hepatocellular carcinoma (HCC). [score:2]
[1 to 20 of 3 sentences]
94
[+] score: 8
Expression pattern of 30 miRNAs (miR-17-3p, miR-92, miR-135b, miR-222, miR-95, etc. ) [score:3]
Further validation with an independent set of plasma samples (n = 180) indicated that miR-92 differentiates CRC not only from normal subjects but also from gastric cancer and inflammatory bowel disease. [score:3]
Both miR-17-3p and miR-92 were significantly elevated (p < 0.0005). [score:1]
miR-92 has reasonable sensitivity for CRC detection and compares favorably with the fecal occult blood test [50]. [score:1]
[1 to 20 of 4 sentences]
95
[+] score: 8
Su X. Wang H. Ge W. Yang M. Hou J. Chen T. Li N. Cao X. An in vivo method to identify microRNA targets not predicted by computation algorithms: p21 Targeting by miR-92a in cancer Cancer Res. [score:5]
miR-92a was suggested to target p21 in various cancer cell lines [45], and miR-1826 was shown as a prognostic biomarker for colorectal cancer [46], whereas miR-638 promotes melanoma metastasis and protects these cells from autophagy and apoptosis [47]. [score:3]
[1 to 20 of 2 sentences]
96
[+] score: 8
The results showed that the expression levels of miR-92a-3p and miR-191-3p were 385 and 4.6 fold higher than the expression level of miR-26b-5p (Figure  2C). [score:5]
To validate the sequencing data, we selected three miRNAs with different read counts for qPCR quantification; namely, miR-92a-3p, which had a high read count, and miR-191-3p and miR-26b-5p, which had relatively low counts. [score:1]
These relative abundance ratios were close to the ratios from the sequencing data using the Illumina kit (441 fold for miR-92a-3p versus miR-26b-5p, and 10.7 fold for miR-191-3p versus miR-26b-5p). [score:1]
To validate the RNA sequencing data, we performed a qPCR analysis of miR-92a-3p, miR-191-3p, miR26b-5p, and β-actin. [score:1]
[1 to 20 of 4 sentences]
97
[+] score: 8
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
[1 to 20 of 2 sentences]
98
[+] score: 8
miRNA profiling of leukemia patients has shown circulating miRNA-92a to be considerably downregulated in the case of malignancy [56]. [score:4]
16 healthy controls 723 microRNA Microarray (Agilent Technologies) miRNA-638 miRNA-92a Lung CancerChen et al. [24] Tumor vs. [score:1]
20 healthy controls 2. validation180 samples 95QuantitativeRT-PCR Array RNU6B miR-17-3p and miR-92 Gastric CancerTsujiura et al. [85] Tumor vs. [score:1]
miRNA-92 and miRNA-17-3p were confirmed as diagnostic markers for colon cancer in an independent validation study [57]. [score:1]
11 healthy controls 365QuantitativeRT-PCR arrays U44/U48 and miRNA-142-3p miRNA-21, miRNA-92, miRNA-93, miRNA-126, miRNA-29a, miRNA-155, miRNA-127 and miRNA-99b Pancreatic CancerHo et al. [28] Tumor vs. [score:1]
[1 to 20 of 5 sentences]
99
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Out of the most abundant miRNAs in bovine plasma, miR-486 and miR-92a are reportedly expressed primarily in erythrocytes, and miR-191 is expressed primarily in platelets [31, 35]. [score:5]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)])Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)]) Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
Common miRNAs identified across studies include miR-486, miR-92a, miR-192 and miR-423-5p. [score:1]
[1 to 20 of 4 sentences]
100
[+] score: 8
Our data in the present study are consistent with the above findings showing the upregulation of miR-517, miR-92a, miR-127, and miR-181a in Exo [Hypoxic]. [score:4]
Among these, 15 miRNAs (miR-143, miR-146a, miR-181a, miR-204, miR-222, miR-27a, miR-335, miR-433, miR-491, miR-502, miR-521, miR-92a, miR-127, miR-135b and miR-451) target 211 mRNAs when the confidence limit was set as “Experimentally Observed” only. [score:3]
Similarly, miR-92 is involved in induction of angiogenesis and enhancement of endothelial cell migration [25]. [score:1]
[1 to 20 of 3 sentences]