1268 publications mentioning hsa-let-7a-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name let-7a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Thus, in let-7 mutants, larval genes turned off by lin-29 will be up-regulated in addition to direct targets of let-7. In lin-29 mutants, the same downstream larval genes should be up-regulated, yet the upstream direct targets of let-7 should be unaffected.

The developmental defects observed in let-7 mutants are caused by the over -expression of direct regulatory targets such as lin-41 and hbl-1, and some of these defects can be suppressed by RNAi knockdown of these targets in let-7 mutants [6], [7], [9], [10].

The large number of down-regulated genes in let-7(n2853) mutants likely represents indirect targets, reflecting mis-regulation of direct targets that transcriptionally regulate some of these genes.

From the three prediction methods, there were 167 unique direct target candidates, including the known targets lin-41, daf-12, and hbl-1. Elimination of likely indirect downstream targets of let-7 regulationWe also employed an alternative filter to select potential let-7 targets independent of preconceptions about base pairing requirements.

Unexpectedly, a subset of the genes that suppressed let-7 mutant phenotypes also suppressed a lin-28 phenotype that is due to up-regulation of let-7 expression, suggesting nonlinear pathways between these targets and let-7 in vulval precursor cells.

Enrichment of let-7 complementary sequences in the 3′ UTRs of genes up-regulated in let-7 mutantsDirect mRNA targets of miRNAs typically have partially complementary miRNA binding sites, making prediction of miRNA targets from genomic sequence difficult [42], and many groups have developed a variety of rules for target recognition [11], [36], [38], [39], [40], [41], [69].

This approach was sensitive enough to detect the established let-7 targets, lin-41, daf-12 and hbl-1. While these genes are regulated at the mRNA level, other targets that are only subject to translational repression would be missed by focusing on transcripts up-regulated in let-7 mutants.

At least three of these genes, which encode transport proteins and a modifying enzyme, appear to be new direct targets of let-7. In conclusion, let-7 appears to regulate a variety of direct targets, which in turn influences the expression of hundreds of other genes.

The up-regulated genes represent direct, including the known targets lin-41, daf-12, and hbl-1, and indirect targets of let-7 repression.

The let-7(n2853) mutation changes the fifth G to an A in the mature let-7 miRNA [6], which destabilizes target interactions and results in up-regulation of lin-41 mRNA, an established let-7 target [7], [67], [70].

Furthermore, we found let-7 complementary sites (LCS) within the ALG-1 binding sites of these targets (Figure 5B), supporting these genes as new direct targets of let-7. Interestingly, T27D12.1 and opt-2, which contain predicted target sites in coding exon sequences, showed weak mis-regulation at the mRNA level in let-7(n2853) versus WT worms (Figure 5C).

Widespread gene mis-regulation in worms deficient for let-7 activityWe have previously shown let-7 -dependent mRNA destabilization of known direct targets [67], suggesting that in addition to giving a general picture of let-7 function, microarray analysis of gene-misregulation in let-7 mutants will provide a basis for the discovery of new direct targets.

To further investigate the regulatory relationships between let-7 and the up-regulated genes, a combination of computational and molecular-genetic criteria were used to enrich for direct target candidates among the up-regulated genes.

Candidate RNAi clones from the rupturing suppression screen were tested for suppression of the cell cycle exit defect in let-7(n2853) mutants also carrying the integrated transgene Int[scm::GFP], which expresses a nuclear localized GFP specifically expressed in seam cells.

Nonetheless, the observation that RNAi of many different genes results in suppression of the rupturing phenotype in let-7 mutants points to the existence of cross-regulatory pathways that are sensitive to down-regulation of a single target.

To score for suppression of the extra seam cell phenotype, let-7 mutants expressing nuclear GFP in seam cells (let-7(n2853); Int[scm::GFP]) were grown at the restrictive temperature (25 °C) on bacteria expressing dsRNA against candidate targets and the vector control.

Since early accumulation of let-7 miRNA is expected to cause premature down-regulation of targets, we anticipated that further silencing of potential targets by RNAi would enhance the pmuv phenotype in lin-28(n719) worms.

This gene lacks predicted target sites for let-7 in its 3′UTR but came through our screen as a modestly up-regulated gene in let-7(n2853) that was capable of suppressing the extra seam cell phenotype of these mutants.

We have previously shown let-7 -dependent mRNA destabilization of known direct targets [67], suggesting that in addition to giving a general picture of let-7 function, microarray analysis of gene-misregulation in let-7 mutants will provide a basis for the discovery of new direct targets.

From the three prediction methods, there were 167 unique direct target candidates, including the known targets lin-41, daf-12, and hbl-1. We also employed an alternative filter to select potential let-7 targets independent of preconceptions about base pairing requirements.

Our approach for discovering new let-7 regulatory targets takes advantage of let-7 dependent expression differences of the known targets, including lin-41 [67], [68].

One of the targets, opt-2, may be a general downstream effector in the let-7 pathway as down-regulation of opt-2 suppresses phenotypes in the vulva and seam cells.

Combining the candidates that emerged from the computational and mRNA expression analyses, there were 340 candidates to test for genetic interactions with let-7. Several transcription factors suppress vulval rupture in let-7 mutantsTo identify functionally important genes among the list of candidates, we used RNAi screens to find genetic interactions by suppression of let-7 mutant phenotypes.

However, the microarray data revealed that thousands of genes are mis-regulated when there is insufficient let-7 activity, supporting a widespread role for this miRNA in regulating, directly and indirectly, gene expression.

Illustrating the role of let-7 as a master regulator of development, the up-regulated genes were enriched for Biological Process Gene Ontology (GO) terms representing larval growth and development (Table S1).

Novel targets associated with ALG-1 in a let-7–dependent mannermiRNAs repress target mRNA expression through their association with Argonaute proteins allowing them to act as sequence-specific guides for the RISC complex [4], [5].

In comparison to WT, 930 common genes were up-regulated in both let-7(n2853) and lin-29(n333) and 649 common genes were down-regulated in both.

Candidate let-7 targets differentially affect vulva formationThe twenty-three candidate let-7 targets were also tested for potential roles in a vulva formation abnormality due to precocious let-7 expression.

let-7 regulates developmental timing, in part, through the direct target genes lin-41 and hbl-1 [6], [7], [9], [10].

The abnormally low expression of let-7 detected in various types of tumors has been linked, in some cases, to aberrant up-regulation of LIN-28 [24].

In contrast, prmt-1 and the positive control lin-41, which contain 3′UTR target sites, were up-regulated over three-fold at the mRNA level in the let-7 mutant worms.

Three of these suppressors, opt-2, prmt-1, T27D12.1, are likely direct targets of let-7 since their association with Argonaute is dependent on this miRNA.

The relevance of the up-regulated genes for let-7 phenotypes was tested through RNAi -based suppressor screens.

Two of the let-7(n2853) suppressors identified in Grosshans et al., 2005, lin-59 and lss-18, were found to be up-regulated in let-7 mutants by our microarray analyses.

Thus, the pmuv phenotype is dependent on let-7, and suggests that the precocious expression of let-7 in the lin-28 mutants might prematurely repress targets needed to regulate vulval cell patterning.

Accordingly, the fold change in let-7 target mRNA expression for lin-41, for example, is less dramatic in let-7(n2853) compared to wild type at the L4 stage than it is in stages before (L2) and after (L4) let-7 expression in wild type worms [67].

Surprisingly, there were also several candidates that decreased the percentage of pmuv in lin-28(n719) worms including, nhr-25, hbl-1, sox-1, prmt-1, and nduf-7. Since this effect is also observed when let-7 is removed from lin-28(n719), these suppressors potentially feedback to regulate the expression or function of let-7 in vulval precursor cells.

A combined approach, incorporating let-7 target predictions by PicTar, reporter assays and screens for suppression of rupturing in let-7(n2853), resulted in twelve potential new targets [38].

Of the nineteen candidates up-regulated in let-7 mutants, nine also suppressed rupturing in let-7(n2853).

Typically, expression of let-7 family miRNAs is negligible in stem cells and in early embryonic tissues and is then up-regulated as cells take on more differentiated fates.

Over one-third of the genes up and down-regulated in let-7(n2853) were changed in the same direction in lin-29 mutants, indicating that failure to trigger the lin-29 -dependent transcriptional program also accounts for many of the mis-regulated genes in let-7 mutants.

Since then, many genes that promote cell division or antagonize the differentiated state have been implicated as direct or indirect targets of let-7 regulation [28], [29], [30], [31], [32], [33].

The more conventional miRNA target, prmt-1, has an LCS within its 3′UTR and was previously predicted by the mirWIP and PITA algorithms as a let-7 target [40], [41].

By analyzing gene -expression in lin-29 versus let-7 mutants, novel targets can be found that may not have obvious binding sites.

Loss of this miRNA alone results in extensive changes in gene expression and abnormal development in multiple tissues, supporting the role of let-7 as a master gene regulator.

Suppressors of the supernumerary seam cell divisions in let-7(n2853) represent a diverse set of gene functions and there is only modest overlap with the rupturing suppressors, suggesting that the two phenotypes are likely under separate genetic control (Table 3).

Three genes, prmt-1, opt-2, and T27D12.1, were found to associate with the miRNA complex in a let-7 dependent manner and, thus, emerged as likely novel direct targets of let-7. A large fraction of the transcriptome is mis-regulated in let-7(n2853) worms.

Considering that the two well-established targets of let-7, lin-41, and daf-12, suppress both the rupturing vulva and extra seam cell phenotypes of let-7 mutants, it was surprising to find almost entirely distinct sets of new genes affecting one phenotype versus the other.

The twenty-three candidate let-7 targets were also tested for potential roles in a vulva formation abnormality due to precocious let-7 expression.

Another likely direct target, T27D12.1, also seems to be regulated by let-7 through sequences in its open reading frame.

Fourteen new genes were found to suppress the bursting vulva phenotype when subjected to RNAi conditions, none of which overlapped with the previously described suppressors of this let-7 phenotype [11], [74].

We have undertaken a multi-step approach for the discovery and validation of let-7 targets in C. elegans, beginning with analysis of global, let-7 -dependent gene expression changes, and followed by genetic interaction analysis of candidates.

Among the suppressors were lin-41 and daf-12, which suppress two other let-7 phenotypes, vulval rupture and alae formation [6], [7], [11].

In lin-28(n719) mutants, let-7 miRNA is expressed precociously, resulting in premature repression of its targets.

Therefore, in vivo expression changes were analyzed in wild-type (WT) and let-7 mutant animals using microarray analysis to identify a list of relevant candidate target genes.

To grow a population of let-7(mn112) mutants to be able to score suppression, we generated a transgenic strain in which the worms were maintained by the presence of an extrachromosomal array (Ex[let-7(+); myo-2::GFP]), which contains a let-7 rescue fragment, allowing the mutants to survive, and the myo-2 promoter driving expression of a GFP marker in the pharynx to indicate the presence of the array (Figure 2A).

Since these effects are due to mis-regulation of let-7 targets, identification of the biologically relevant genes regulated by this miRNA has been a paramount research goal.

Elimination of likely indirect downstream targets of let-7 regulation.

Although several groups have attempted to identify let-7 targets in C. elegans, the criteria and, consequently, the predicted targets from these approaches have minimal overlap [11], [36], [38], [39], [40], [41], [69].

Thus, let-7 functions as a tumor suppressor in at least in some settings, where it represses the expression of genes needed for oncogenesis.

Combining the candidates that emerged from the computational and mRNA expression analyses, there were 340 candidates to test for genetic interactions with let-7. To identify functionally important genes among the list of candidates, we used RNAi screens to find genetic interactions by suppression of let-7 mutant phenotypes.

Multiple lines of molecular and genetic evidence support opt-2, prmt-1 and T27D12.1 as new direct targets of let-7 regulation.

Genes involved in translation make up another class of let-7(n2853) suppressors [74].

Many of the genes we identified as suppressors of vulva rupturing encode transcription factors, a category also prominent on the list of potential let-7 targets described in Grosshans et al., 2005 [11].

6-mer enrichment in genes up-regulated in let-7(n2853) versus non-regulated genes was computed using methods described in [106].

A set of the up-regulated genes proved to be biologically relevant for the developmental abnormalities that arise in the absence of let-7 activity.

We postulated that other direct targets would also be mis-regulated in let-7 mutants.

RNAi mediated suppression of vulval rupturing in let-7 mutants has been used to find new genetic interactions in sets of computationally predicted targets and in genes on chromosome I [11], [38], [74].

Reporters driven by the let-7 promoter also show intestinal expression, suggesting that let-7 miRNA is available for directly regulating opt-2 in this tissue [96], [97], [98].

This group included the known let-7 targets, such as daf-12 and lin-41, as well as hbl-1, which is also a target of other let-7 miRNA family members (Table 3) [7], [9], [10], [11], [85], [86], [87].

Sheets 2 and 3 show the results of DAVID analysis for genes up- or down-regulated in let-7(n2853), respectively.

Our analyses indicate that let-7 regulates a large cast of genes, both directly and indirectly.

We uncovered new targets of let-7 that contribute to these phenotypes when they fail to be properly regulated.

Final validation of direct targets was confirmed by let-7 dependent RISC association (Figure 1).

Based on enrichment in the WT compared to let-7 RIP from 4 independent experiments, three new targets were identified, T27D12.1, prmt-1, and opt-2. (B) let-7 complementary sites (LCS) are present in each of the newly identified targets.

158 genes that were up-regulated in let-7 mutants had at least one of these two 6-mers in their 3′ UTRs.

In fact of our list of let-7 suppressors, only lin-41 and daf-12 were mis-regulated by more than two-fold by microarray analyses.

To enrich for biologically relevant candidates and allow for non-canonical binding sites, we searched for enriched 6-mer sequences in the 3′ UTRs of the genes up-regulated in let-7 mutants.

This is due at least in part to direct targeting of several metabolic genes by let-7 miRNA.

Genetic mutation or RNAi depletion of any one of these let-7 targets is sufficient to at least partially rescue the lethality of let-7 mutants.

In C. elegans, processing of the let-7 miRNA early in larval development is inhibited by LIN-28 protein [21], [23].

Several of these genes also affect let-7 dependent phenotypes seen in lin-28 mutants revealing a complex genetic interaction with let-7. By showing let-7 dependent association with Argonaute, we were able to confirm three new direct targets of let-7 with binding sites in the 3′ UTRs as well as in coding regions.

By using reproducibility in the direction of change, instead of the absolute fold difference in mRNA levels, we identified twenty new genes in the let-7 pathway that exhibited only modest expression differences in let-7 mutants.

Several transcription factors, such as the nuclear hormone receptor daf-12, the forkhead transcription factor pha-4 and the zinc finger protein die-1, genetically interact with let-7 and are also likely direct targets [11].

Down-regulation of prmt-1 by let-7 in late larval stages could influence the lifespan of worms by causing reduced methylation and, hence, activity of DAF-16.

Enrichment of let-7 complementary sequences in the 3′ UTRs of genes up-regulated in let-7 mutants.

We selected the 192 genes that were up-regulated in both of the let-7(n2853) vs.

Two conserved 6-mers complementary to let-7 mature sequence were enriched in the 3′ UTRs in the up-regulated gene set (Table S1).

Sheet 5 lists the enriched motifs found in the 3′UTRs of genes up-regulated in let-7(n2853).

Genes regulated by let-7 are expected to be enriched in wild-type samples versus let-7 mutant samples, while genes targeted by other miRNAs should be amplified similarly in both strains.

The ability of opt-2 RNAi to suppress let-7 phenotypes in vulval and seam cells suggests that signaling from the intestine influences development of these tissues.

How let-7 positively regulates the expression of LIN-29 protein is presently unknown.

Sheets 2 and 3 show the results of DAVID analysis for genes up- or down-regulated in let-7(n2853) versus lin-29(n333), respectively.

Table S3Differential gene expression in let-7(n2853) versus lin-29(n333) worms.

Negative regulation of lin-41 by let-7 in late larval stages allows the transcription factor LIN-29 to accumulate and to directly control the terminal differentiation of multiple cell types [6], [7], [72], [73].

In fact, one of the first discovered targets of let-7 in humans is RAS, a notorious oncogene [27].

These results suggest that some of the candidate genes may have a more complicated relationship with let-7, possibly affecting let-7 expression or activity in tissue-specific feedback loops.

1003353.g002 Figure 2Novel suppressors of vulval rupture in let-7 null mutants.

Our screen identified eight new genes that suppress the supernumerary seam cell divisions of let-7(n2853) mutants.

Through a combination of genetic and molecular screens in C. elegans, we have uncovered twenty-three genes that are up-regulated in let-7 mutants and contribute to the developmental abnormalities characteristic of these mutants.

Sheet 1 shows the microarray results of mRNA expression in let-7(n2853) versus N2 wildtype worms at the L4 stage.

In the presence of the let-7(mn112) null allele, the pmuv phenotype is no longer observed in lin-28(n719) worms, and 100% of the double mutant population expresses the pvul phenotype (Figure 4A).

Feedback loops between let-7 family members and targets, such as daf-12 and hbl-1, in other tissues have been previously demonstrated [9], [10], [85], [86], [87], [90].

1003353.g001 Figure 1Shown is a flowchart outlining the experiments and analyses leading to the discovery of 3 new potential let-7 targets.

While some direct targets of the let-7 miRNA are known, a full picture of the let-7 regulatory network remains largely uncharacterized.

1003353.g004 Figure 4Differential effects of let-7 target candidates on vulva formation.

Genes down-regulated more than 2-fold in let-7(n2853) compared to wild-type.

Surprisingly, another set of genes significantly decreased the incidence of pmuv in lin-28(n719) (Figure 4B) and, in the case of nhr-25, the pvul phenotype was also suppressed in the lin-28(n719);let-7(mn112) double mutants (Figure 4C).

Phenotypic suppressors of let-7 mutants.

Enrichment of a different set of transcription factors was also noted by the Slack lab as genetic suppressors of their computational let-7 predictions [11].

Also enriched was AACCTA, complementary to nucleotides 9–14 of let-7, which overlaps with the newly described “centered sites” observed for some miRNA target interactions [43].

Several transcription factors suppress vulval rupture in let-7 mutants.

Candidate let-7 targets differentially affect vulva formation.

Suppression of supernumerary seam cell nuclei in let-7 mutants.

However, they failed suppress vulva rupturing in the null let-7(mn112) background and, thus, did not appear on our final list of candidates.

Thus lin-41 and daf-12 RNAi are sufficient to suppress all previously described phenotypes of let-7 mutants.

As expected, the nucleotides TACCTC, which are complementary to the let-7 seed sequence (nucleotides 2–7 of a mature miRNA), were enriched, consistent with the prevailing mo del for miRNA target recognition [42].

1003353.g003 Figure 3Suppression of supernumerary seam cell nuclei in let-7 mutants.

However, these candidates failed to suppress the rupturing of let-7(mn112) worms, in agreement with the previous study [11].

Novel suppressors of vulval rupture in let-7 null mutants.

Before this study, opt-2 was not a predicted let-7 target because it lacks complementarity to the 5′ end of the miRNA (seed) in its 3′UTR.

Novel targets associated with ALG-1 in a let-7–dependent manner.

Argonaute associates with targets in a let-7–dependent manner.

adt-2 had similar levels in the WT and let-7(n2853) mutant strains suggesting it may be targeted by a different miRNA, which could mask any let-7 dependent RISC association.

1003353.g005 Figure 5Argonaute associates with targets in a let-7–dependent manner.

let-7–dependent seam cell cycle exit is controlled by a diverse set of downstream genesTo broaden the search for genes that interact with let-7 beyond those involved in vulval rupture, we reasoned that novel targets might control other phenotypes found in let-7 mutants.

A distinction from these studies is that we screened for suppression in null let-7(mn112) worms as opposed to the weaker let-7(n2853) strain.

The known targets lin-41 and daf-12, served as positive controls with both showing let-7 -dependent enrichment in the ALG-1 IP.

The loss of function lin-28(n719) mutants exhibit a partially penetrant temperature-sensitive protruding multiple vulva (pmuv) phenotype that is dependent on let-7. At 25 °C, this phenotype is expressed in ∼67% of the lin-28(n719) population with the remaining worms displaying a single protruding vulva (pvul) (Figure 4A).

Table S1Differential gene expression in let-7(n2853) versus N2 wildtype worms.

We combined several molecular and genetic methods to identify physiologically relevant targets of let-7 in C. elegans.

Sheet 1 shows the microarray results of mRNA expression in let-7(n2853) versus lin-29(n333) worms at the L4 stage.

Using the Ahringer feeding RNAi library [75], the Vidal feeding RNAi library [76] and a few clones we generated, 308 genes out of the 340 candidates were tested for suppression of vulval rupturing in the let-7(mn112) null strain.

Shown is a flowchart outlining the experiments and analyses leading to the discovery of 3 new potential let-7 targets.

Bursting suppression was scored as more than 25% non-bursting, non-green (non-rescued) 40 hr adult PQ79 mnDp1(X/V)/+; unc-3(ed151) let-7(mn112); Ex[let-7(+); myo-2::GFP] worms grown at 25°C.

Here we utilized molecular and genetic approaches to identify biologically relevant targets of the let-7 miRNA in Caenorhabditis elegans.

Genes up-regulated more than 2-fold in let-7(n2853) compared to wild-type.

Another group tested 181 genes with various criteria for being potential let-7 targets for changes in protein levels in WT versus let-7(n2853) worms [54].

To broaden the search for genes that interact with let-7 beyond those involved in vulval rupture, we reasoned that novel targets might control other phenotypes found in let-7 mutants.

Differential effects of let-7 target candidates on vulva formation.

One of the first discovered miRNAs, let-7, generally promotes cellular differentiation pathways through a repertoire of targets that is yet to be fully described.

prmt-1 has a broad expression pattern that is largely overlapping with let-7 transcriptional reporters [96], [97], [98], [101].

Consistent with its role in promoting differentiated states, decreased expression of let-7 miRNA has been associated with numerous types of cancer [14].

In worms and mammalian cells, the LIN-28 RNA binding protein is largely responsible for keeping let-7 miRNA levels low during early development [15].

let-7 is near the end of a genetic pathway controlling developmental timing in C. elegans [71].

To understand how let-7 or any miRNA controls a cellular process, the genes it regulates must be identified.

Widespread gene mis-regulation in worms deficient for let-7 activity.

lin-14 was also used as a negative control because it is a known target of a different miRNA, lin-4, and as expected there was no significant change in ALG-1 binding in let-7 mutants compared to WT.

These phenotypes place let-7 in the heterochronic pathway, which includes genes that regulate the temporal identity of cell divisions and fates [6], [8].

let-7 was originally discovered as a miRNA controlling developmental timing in Caenorhabditis elegans [6], [7].

These caveats were avoided by using the let-7(mn112) strain containing the extrachromosomal let-7 rescue construct, as RNAi clones that affected development regardless of the presence of the let-7 transgene could be flagged.

The let-7 mutant worms display an array of developmental timing defects at the larval to adult transition including rupturing (Rup) of the intestine and gonads through the vulva [6], [7].

Given the highly conserved nature of let-7 from worms to humans, our studies highlight new genes and pathways potentially under let-7 regulation across species.

Loss of let-7 activity in C. elegans results in multiple developmental abnormalities and, ultimately, death.

In let-7 mutants, lin-41 persists in late larval stages where it can continue to negatively regulate lin-29 [6], [7].

Four independent RIPs were analyzed, and targets enriched in the wild-type for at least 2 of the 4 replicates were considered to be dependent on let-7 for ALG-1 association.

The let-7 miRNA is a wi dely conserved animal miRNA and its role in regulating differentiation also appears to be conserved [12], [13], [14].

To identify globally the genes regulated by let-7, six independent and paired wild-type and let-7(n2853) fourth larval stage (L4) RNA samples were labeled and hybridized to Affymetrix arrays.

The heterochronic gene lin-29 is downstream of let-7 and is a master regulator of seam cell differentiation [6], [73].

Our combination of molecular and genetic screens revealed a complex network of genes that interact with let-7 in C. elegans.

Fifty to one hundred lin-28(n719) or lin-28(n719);let-7(mn112) worms were grown on RNAi until 48 hr (25°C) adults and then scored for the protruding multivulva (Pmuv) or protruding single vulva (Pvul) phenotypes.

Figure S2 Conservation of potential let-7 complementary sites (LCSs) in mammalian prmt-1. (A) Genome browser track showing the last exon of PRMT1.

While prmt-1 has ALG-1 binding sites in its 3′UTR as well as coding exon sequences, only the 3′UTR site includes an obvious let-7 complementary site.

These genetic analyses revealed twenty new downstream effectors of let-7 phenotypes, including multiple transcription factors and metabolic proteins.

Figure S1Seam cell fusion proceeds normally in let-7 mutants.

Loss of let-7 activity results in lethality in worms and contributes to oncogenesis in mammalian tissues [14], [89].

This partially penetrant pmuv phenotype is dependent on let-7 because lin-28(n719);let-7(mn112) strains only produce single protruding vulvas.

let-7–dependent seam cell cycle exit is controlled by a diverse set of downstream genes.

In addition to the rupturing phenotype, let-7 mutants also have defects in the terminal differentiation of their seam cells, a specialized type of hypodermal cell [6], [7], [82].

3′UTR locations complementary to let-7 are drawn as black rectangles.

Remarkably, the introduction of let-7 miRNA into lung or breast tumors in mouse mo dels has been shown to halt tumor growth in vivo [31], [34], [35].

The failure of seam cells to properly differentiate in let-7 mutants seems to be largely due to a lack of lin-29 activity [6], [7].

Strains used in this study include the following: wild type (WT) Bristol N2, MT7626 let-7(n2853), MT333 lin-29(n333), MT1524 lin-28(n719), PQ79 mnDp1(X/V)/+; unc-3(ed151) let-7(mn112); Ex[let-7(+); myo-2::GFP], PQ270 mnDp1(X/V)/+; unc-3(ed151) let-7(mn112); lin-28(n719), PQ293 let-7(n2853); Int[scm::GFP].

Synchronized WT and let-7(n2853) worms were grown at 25°C for 29 hours before being cross-linked by UV treatment.

Additionally, lateral hypodermal seam cells fail to terminally differentiate at the larval to adult transition in let-7 mutants.

This enhanced phenotype is dependent on let-7 because the pmuv phenotype is almost entirely absent in lin-28 mutant worms that also lack let-7 activity (lin-28(n719);let-7(mn112)) (Figure 4C).

However, a single ALG-1 binding site is present in the second last exon of opt-2 and this region includes a predicted let-7 binding site.

Three of the paired replicates of WT and let-7(n2853) were also paired with lin-29(n333) replicates for array analysis.

Interestingly, seam cell fusion was unaffected in let-7(mn112) null mutants, suggesting that some aspects of seam cell terminal differentiation are let-7 independent (Figure S1).

The let-7 miRNA is exceptional in its conservation and essential role in cellular differentiation across species [13].

WT and the let-7(n2853) vs.

To test if let-7 is responsible for the interaction of ALG-1 with these genes, we analyzed their association with ALG-1 using in wild-type and let-7(n2853) worms (Figure 5A).

RNA was isolated from WT and let-7(n2853) worms grown at 25°C for 28 hours.

Three of these genes, lin-41, daf-12 and hbl-1, are the best previously characterized let-7 targets in C. elegans, validating the sensitivity of our approach [6], [7], [9], [10], [11].

LIN-28 prevents the maturation of let-7 family miRNAs by blocking Drosha or Dicer processing or promoting destabilization of let-7 precursors [16], [17], [18], [19], [20], [21], [22], [23].

Fused seam cells are seen in WT (A) and let-7(mn112) (B) at the young adult stage by the lack of junctions between cells (white arrowheads), which are apparent in lin-29(n333) worms where seam cell fusion fails (C).

Additionally, let-7 and LIN-28 have opposing effects on insulin sensitivity in mice [25], [26].

Three lin-29(n333) mutant L4 RNA samples paired with wildtype and let-7(n2853) samples were collected, labeled and hybridized to Affymetrix microarrays.

In let-7 mutants, the seam cells inappropriately undergo the larval type division instead of differentiating to the adult fate, where the cells normally fuse and cease dividing [6].

However, let-7(n2853) is a temperature sensitive loss of function strain that maintains some let-7 activity even at the non-permissive temperatures.

Six paired replicates of L4 RNA from WT or let-7(n2853) worms were prepared and labeled as per manufacturer's instructions (Affymetrix, Santa Clara) and hybridized to Affymetrix C. elegans Gene microarrays.

Exit of the seam cells from the cell cycle and secretion of alae have been shown to be retarded in let-7 mutants [6], [7], [82].

Homozygous let-7(mn112) mutants die at the late larval stages and must be maintained by a wild-type copy of the let-7 gene coming from a balanced translocation or a rescuing transgene [6], [7].

While it is not entirely understood why let-7 mutants rupture through the vulva, it has been postulated that improper cell fusions during vulva formation cause weakening and destabilization of this structure.

Seam cell nuclei were counted at 40 hr (25°C) in 20 adult PQ293 let-7(n2853); Int[scm::GFP] worms grown on vector control or gene specific RNAi plates for one generation.

Although there is not a canonical LCS in the 3′UTRs of mammalian homologs of prmt-1, there are several well conserved potential let-7 binding sites (Figure S2).

2

Owing to differences in RRM2 expression and gemcitabine chemosensitization upon overexpression of pre -let-7 members, we suspected that some of these precursors failed to process into mature let-7 forms in MIA PaCa-2. Hence, we quantified relative mature let-7 levels by qRT-PCR in various pre- let-7 -expressing MIA PaCa-2 clones and compared them with mock-transduced MIA PaCa-2. Interestingly, significant increases (averages range from 2–5-fold) in mature let-7 forms were identified in all pre- let-7 -overexpressing cells tested, except for pre- let-7-a-1 -overexpressing cells which did not show any alteration in mature let-7a levels (Fig. 3A ).

Consistently, earlier studies have implicated a causal relationship between let-7 and RRM2, identifying downregulation of many let-7 family members in RRM2 -overexpressing, gemcitabine-resistant pancreatic cancer cells or a reduction in RRM2 expression after let-7 overexpression [17], [18].

Taken together, these data likely suggest that let-7 members may endogenously inhibit RRM2 expression by direct post-transcriptional repression in MIA PaCa-2. Human let-7 Precursors Differentially Modify RRM2 Expression and Gemcitabine Chemosensitization in MIA PaCa-2We next attempted to generate stable clones of MIA PaCa-2 that overexpresses one of ten human let-7 precursors [27] to study their effects on RRM2 protein and chemosensitivity.

Taken together, these data likely suggest that let-7 members may endogenously inhibit RRM2 expression by direct post-transcriptional repression in MIA PaCa-2. A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE.

In searching for putative miRNA inhibitors of RRM2 by computational miRNA target prediction algorithms, we found the let-7 family of tumor suppressor miRNAs to possess a seed match for base pairing with the 3′ UTR of RRM2 (context score percentile: 94; TargetScanHuman 5.1).

In order to test whether the let-7 -mediated increase in gemcitabine cytotoxicity was facilitated by RRM2 suppression, we overexpressed RRM2 cDNA with or without the 3′ UTR regions into MIA PaCa-2 expressing pre- let-7a-3. Our results identified lower gemcitabine cytotoxicity IC [50] in cells expressing RRM2 with the 3′ UTR (69.34±3.4 nM) compared with those without the 3′ UTR (383.4±20.3 nM).

Using qRT-PCR and primers that either flank the entire stem-loop structure (which detect miRNA precursors) or the mature sequence (which detects mature miRNA), we quantified the intracellular levels of all three let-7a precursors as well as mature let-7a in various pancreatic cancer cells transiently overexpressing pre- let-7a-1, pre- let-7a-2, or pre- let-7a-3. While precursor forms were highly expressed in all three cases (3–38-fold increase), mature let-7a was only consistently increased in pre- let-7a-3 -expressing cells but not in those expressing pre- let-7a-1 (L3.6pl, MIA PaCa-2) (Fig. 3B ).

Using qRT-PCR and primers that either flank the entire stem-loop structure (which detect miRNA precursors) or the mature sequence (which detects mature miRNA), we quantified the intracellular levels of all three let-7a precursors as well as mature let-7a in various pancreatic cancer cells transiently overexpressing pre- let-7a-1, pre- let-7a-2, or pre- let-7a-3. While precursor forms were highly expressed in all three cases (3–38-fold increase), mature let-7a was only consistently increased in pre- let-7a-3 -expressing cells but not in those expressing pre- let-7a-1 (L3.6pl, MIA PaCa-2) (Fig. 3B ).

Nevertheless, pre- let-7 -mediated alterations in RRM2 expression may not be just because of a simple translation inhibition process.

Second, certain miRNAs, including members of the let-7 family, have been shown to activate rather than suppress target gene expressions under specific cellular environments [36].

Although our data unequivocally identify defective processing of pre -let-7a-1 and pre -let-7a-1 as a key reason for the observed failure to increase mature let-7a expression, it was unexpected to find RRM2 expression increased in pre -let-7a-1 -overexpressing cells.

Interestingly, Western blotting analysis showed significant reductions in RRM2 protein expression only in MIA PaCa-2 stably expressing pre -let-7a-3, pre -let-7e, pre -let-7f-1, and pre -let-7i but only minimally in MIA PaCa-2 cells expressing pre -let-7b, pre -let-7d, and pre -let-7-f-2 cells (Fig. 2A ).

MIA PaCa-2 exhibited reduced expression of let-7a, let-7b, let-7c, let-7e, let-7f, and let-7g, PANC-1 exhibited reduced expression of let-7b, let-7c, let-7d, let-7g, let-7h, and let-7i, and BxPC-3 exhibited reduced expression of let-7b, let-7c, let-7d, let-7f, and let-7i (Fig. 1C ).

D, RRM2 is a direct target of let-7. 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1, let-7a-2, let-7a-3, let-7b, and miR-214 (negative control) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct.

We then tested the direct interaction of let-7 with RRM2 by transfecting a luciferase -expression construct fused to the 3′ UTR of RRM2 into 293Ta (ATCC-CRL-9078) [23] and MIA PaCa-2 transiently overexpressing let-7 members.

LIN-28 and SET Oncoprotein Affect Mature let-7 Expression and Chemosensitization Differentially in Gemcitabine-sensitive Versus Gemcitabine-resistant Cells: Pronounced Growth Suppression with SET knockdownWe next examined whether manipulating LIN-28 and SET, which produced the highest changes in let-7a levels in our screen (Fig. 5B ), could influence the biogenesis of various let-7 miRNAs.

While all let-7 members significantly decreased luciferase expression in 239Ta cells, many let-7 members brought a significant decrease in luciferase expression in MIA PaCa-2 cells as well (Fig. 1D ), suggesting that the direct binding of let-7 to the RRM2 3′ UTR causes RRM2 repression.

LIN-28 and SET Oncoprotein Affect Mature let-7 Expression and Chemosensitization Differentially in Gemcitabine-sensitive Versus Gemcitabine-resistant Cells: Pronounced Growth Suppression with SET knockdown.

To assess the let-7 control of RRM2 expression, we subsequently profiled the aforementioned cell lines for relative expression of all let-7 family members by qRT-PCR.

Several Novel RNA -binding Proteins Influence Mature let-7a Biogenesis in MIA PaCa-2In order to study whether misexpression of regulatory proteins were responsible for the observed defects in let-7a processing in pancreatic cancer cells, we first investigated the expression of LIN-28, a pluripotent stem cell protein that has been well-established to negatively regulate let-7 biogenesis [28], [29].

Recently, forced expression of let-7 miRNAs was shown to inhibit pancreatic cancer cell proliferation in vitro but not tumor growth in vivo suggesting the presence of complex functional ramifications [22].

0053436.g002 Figure 2Differential RRM2 expression and gemcitabine chemosensitization by let-7 precursors in MIA PaCa-2. A, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members.

For instance, unlike the majority of let-7 precursors that decreased RRM2 expression, pre- let-7a-1 and pre -let-7a-2 stimulated RRM2 expression while other let-7 members (i. e., pre- let-7f-2) did not significantly alter RRM2 levels.

First, the diverse targets, even for closely-related miRNAs such as those within the let-7 family [27], can evoke markedly different cellular outcomes based on the collective effect of their individual targets.

Comparisons with computationally predicted RRM2 targeting miRNAs identified that in addition to reduction in several let-7 members, mir-140-3p, the miR-30 family, and miR-342-5p were also found to potentially contribute to the overall induction of RRM2 expression in Capan-1-GR cells (Fig. 4F ).

RRM2 and let-7 are Inversely Expressed in Human Pancreatic Cancer CellsWe first verified RRM2 expression in pancreatic cancer cell lines that were categorized earlier as inherently gemcitabine-sensitive or -resistant [23].

n = 3. B, Relative expression of precursor (filled bars; right axis) and mature (open bars; left axis) let-7 forms in pancreatic cancer cells transiently expressing let-7a precursors.

Finally, since let-7 overexpression increases the G2/M fraction of fibroblasts [25] and RRM2 expression is specific to S-phase cells, we evaluated the role of let-7 in reducing RRM2 expression by decreasing the proportion of MIA PaCa-2 in S-phase.

In order to study whether misexpression of regulatory proteins were responsible for the observed defects in let-7a processing in pancreatic cancer cells, we first investigated the expression of LIN-28, a pluripotent stem cell protein that has been well-established to negatively regulate let-7 biogenesis [28], [29].

0053436.g003 Figure 3Defective processing of pre- let-7a-1, but not pre- let-7a-3, into let-7a in MIA PaCa-2. A, Relative expression of mature forms of let-7 in MIA PaCa-2 stably expressing pre- let-7 family members.

None to only a few let-7 members had significantly reduced expressions in the remaining cell lines that expressed similar levels of RRM2 protein as HPDE (i. e., L3.6pl: none; AsPC-1: let-7c; Capan-1: let-7c, let-7f) (Fig. 1C ).

Likewise, even when mature let-7 increased with overexpression of other precursors (i. e., pre- let-7d, pre- let-7f-2), no alterations in RRM2 expression were observed.

These data identify that RRM2 expressional outcomes significantly differ with the overexpression of specific pre- let-7 subtypes in pancreatic cancer cells.

Third, since precursor let-7 forms are also capable of binding to target transcripts similar to mature let-7 [37], increased levels of pre- let-7a-1, even in the absence of mature let-7, could force incorporation of RRM2 into RISC, perhaps modulating gene expression.

Interestingly, significantly lower expressions of most of the let-7 miRNAs were observed only in cell lines with relatively greater RRM2 expression.

Varied consequences upon overexpressing mammalian let-7 precursors in MIA PaCa-2, in particular the effects on RRM2 expression and gemcitabine chemosensitivity, suggest the existence of intricately controlled mechanisms.

A striking example within let-7a precursors is that pre- let-7a-3 reduced RRM2 expression and improved gemcitabine chemosensitivity, whereas pre- let-7a-1 and pre- let-7a-2 induced RRM2 expression with no significant reductions in gemcitabine chemosensitivity.

A, Relative expression of mature forms of let-7 in MIA PaCa-2 stably expressing pre- let-7 family members.

Human let-7 Precursors Differentially Modify RRM2 Expression and Gemcitabine Chemosensitization in MIA PaCa-2. Differential RRM2 expression and gemcitabine chemosensitization by let-7 precursors in MIA PaCa-2..

It is likely that SET inhibits the transcription of many miRNAs, perhaps including tumor suppressors such as let-7, while silencing of SET removes this block.

Further, overexpression of let-7 was found to increase the radiosensitization of pancreatic tumor cells [19], while inhibition of RRM2 was identified to sensitize pancreatic tumors to ultraviolent radiation [20], [21].

These results suggest that the reduction in RRM2 protein as a result of pre- let-7a-3 overexpression was facilitated by post-transcriptional repression of RRM2, although RRM2-independent mechanisms are likely to play predominant roles in other pre- let-7 -overexpressing cells (e. g., pre- let-7f-2).

Furthermore, let-7 regulatory proteins can also be targeted.

Here we report an intricate regulation of RRM2 expression and gemcitabine chemosensitization by let-7 a precursors and identify that the miRNA transcriptional/processing machinery involved in mature let-7a biogenesis is likely to act as a crucial factor when considering let-7a -based therapeutics for pancreatic cancer.

Levels of two other known regulators of let-7 biogenesis, KHSRP (positive regulator) and hnRNP-A1 (negative regulator) [30], were not notably different between the various pancreatic cancer cell lines tested and HPDE (Fig. 5A ).

However, further analysis of the ratios of mature (let-7a) to precursor forms indicated a ∼16-fold reduction in the pre- let-7a-1 -expressing MIA PaCa-2 cells when compared with pre- let-7a-3 -expressing MIA PaCa-2 cells.

Defective Processing of let-7a Precursors and RRM2 Overexpression Identified in Patient-derived PDAC Tissues.

Figure S1 Lack of cell cycle changes in MIA PaCa-2 expressing pre- let-7 members.

RRM2 and let-7 are Inversely Expressed in Human Pancreatic Cancer Cells.

Interestingly, significant reductions in gemcitabine cytotoxic IC [50] estimations were identified in almost all pre- let-7 -expressing MIA PaCa-2 stable clones generated with the only exception being pre- let-7a-1 whose introduction brought no differences (Fig. 2C ).

MIA PaCa-2 stably expressing pre- let-7a-1, pre- let-7a-2, pre- let-7a-3, pre- let-7b, pre- let-7d, pre- let-7e, pre- let-7f-1, pre- let-7f-2, and pre- let-7i were generated successfully by lentiviral gene transfer; however, repeated attempts to stably transduce pre- let-7c and pre- let-7g failed due to a lack of surviving colonies.

B, Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members.

A direct role of LIN-28, a zinc finger protein that promotes pluripotency in embryonic stem cells [28], [29], was readily evident in the defective processing of let-7a as observed by increases in mature let-7 levels upon LIN-28 knockdown and the concurrent enhancement of chemosensitivity.

Generation of MIA PaCa-2 Stable Cells Overexpressing Pre- let-7 MembersFIV-let-7 constructs (let-7a-2, let-7a-3, let-7b, let-7c, let-7e, let-7f-1, let-7f-2, let-7g, and let-7i) from GeneCopoeia (Rockville, MD) and HIV-let-7 constructs (let-7a-1 and let-7d) from System Biosciences (Mountain View, CA) were used.

As we did not observe an overexpression in mature let-7a in MIA PaCa-2 (Fig. 3A ), we chose to investigate, in detail, the expression/processing of all three let-7a precursor forms (pre- let-7a-1, pre- let-7a-2, and pre- let-7a-3) that are derived from three separate genes (chromosomal locations 9q22.32, 11q24.1, and 22q13.31, respectively) [27].

Acquired gemcitabine resistance is accompanied with RRM2 overexpression and defective let-7a precursor processing.

Generation of MIA PaCa-2 Stable Cells Overexpressing Pre- let-7 Members.

A and B, Relative expression of primary let-7a transcripts (A) and mature let-7a (B) in 2 normal pancreatic tissues and 10 PDAC samples representing various tumor stages.

D and E, Relative expression of precursor and mature let-7a in Capan-1 (D) and L3.6pl (E) cells induced to acquire gemcitabine resistance.

C and D, Relative expression of mature let-7 members in LIN-28- (filled bars) or SET-silenced (open bars) MIA PaCa- 2 (C) and L3.6pl (D).

A, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members.

E and F, Relative expression of primary let-7a transcripts (E) and mature let-7a (F) in matched normal-PDAC pairs.

0053436.g004 Figure 4Acquired gemcitabine resistance is accompanied with RRM2 overexpression and defective let-7a precursor processing.

These results support an inverse relationship between RRM2 and let-7 expression in pancreatic cancer cells.

Taken together, these data identify defective processing in a rank order of pre- let-7a-2>pre- let-7a-1>pre- let-7a-3 and the defects to follow a trend with increased RRM2 expression in human PDAC tissues.

Our study identified reduced let-7 expression to contribute to the RRM2 -mediated inherent chemoresistance in poorly differentiated pancreatic cancer cells.

Defective Processing of let-7a Precursors and RRM2 Overexpression Identified in Patient-derived PDAC Tissues In vitro results so far demonstrated defective processing of let-7a precursors in poorly differentiated pancreatic cancer cells with critical influences on growth and chemosensitivity.

We next attempted to generate stable clones of MIA PaCa-2 that overexpresses one of ten human let-7 precursors [27] to study their effects on RRM2 protein and chemosensitivity.

0053436.g007 Figure 7Defective processing of let-7a precursors and RRM2 overexpression in resected human PDAC tissues.

Under these conditions, however, no prominent decreases in S-phase cells were observed in any of the pre- let-7 overexpressing MIA PaCa-2 (Fig. S1).

Cells expressing pre- let-7a-2 showed intermediate levels (Fig. 3B ).

Together, these results identify LIN-28 and SET oncoprotein to differentially modulate let-7 expression and chemosensitivity in gemcitabine-sensitive versus –resistant pancreatic cancer cells with LIN-28 selectively influencing gemcitabine chemosensitivity in poorly differentiated pancreatic cancer cells (i. e., MIA PaCa-2).

In summary, RRM2 was found to be a key determinant of both inherent and acquired gemcitabine with reduced let-7 expression likely to contribute to RRM2 -mediated inherent chemoresistance in poorly differentiated pancreatic cancer cells.

Identification of the interaction between let-7 miRNA and the 3′ UTR of RRM2 transcripts and the concomitant decrease in RRM2 protein expression in the absence of prominent cell cycle alterations provide supportive evidence for the let-7 -mediated post-transcriptional repression of RRM2.

Even the increase in relative let-7a levels was only modest (∼2.2-fold in pre- let-7a-3 -expressing MIA PaCa-2 cells).

Significant overexpression of RRM2 protein was identified in all 6 out of 6 matched PDAC samples (Fig. 7D ), and defective processing of one or more let-7a precursors was also clearly identified in all 6 PDAC tissues (Fig. 7E– G ).

Defective processing of let-7a precursors and RRM2 overexpression in resected human PDAC tissues.

While qRT-PCR showed that knockdown of LIN-28 (Fig. 6B ) only increased mature let-7 levels in MIA PaCa-2 (8 out of 8 let-7 members) and not L3.6pl, knockdown of SET (Fig. 6B ) increased the levels of let-7 members in both L3.6pl (6 out of 8 let-7 members) and MIA PaCa-2 (8 out of 8 let-7 members) (Fig. 6C–D ).

Our findings that let-7 is capable of influencing gemcitabine chemosensitivity along with its tumor suppressive and differentiation-promoting functions in solid tumors extend its promise as a therapeutic candidate for pancreatic cancer.

Next, to investigate the correlation between defective let-7 processing and RRM2 expression, we profiled 6 matched normal and PDAC tissues (i. e., derived from the same donors) for let-7 and RRM2 expressions.

These data persuaded us to test for the existence of additional regulators of let-7 biogenesis in drug-resistant pancreatic cancer cells.

Evidently, we noticed pre- let-7a-1 to moderately activate RRM2 expression in reporter -based RNA interference assays in MIA PaCa-2 (Fig. 1 D) despite its inability to process pre- let-7-a-1 to mature let-7a.

The observed increase in both precursor and mature let-7 levels upon SET knockdown supports this hypothesis.

C, MIA PaCa-2 cells stably overexpressing pre- let-7 family members (red) or vector alone (blue) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay.

For example, the direct introduction of mature let-7 forms is likely to bring enhanced outcomes in a heterogenic tumor population than the pre- let-7 forms.

While analysis of the ratios of precursor to mature let-7a indicated that all three let-7a precursors were subject to a certain level of post-transcriptional processing, pre- let-7a-2 and pre- let-7a-3 were found to be the most and east regulated by this step, respectively.

B–E, Screening for regulators of let-7a biogenesis.

It displayed several putative candidates that could have a direct impact on post-transcriptional let-7 processing (Thoc4, Cldn1, Npm1, Igfbp5, ESR1, Lrp1 and LIN-28; Fig. 4C–E ).

However, the ability of pancreatic cancer cells to restore or augment mature let-7 expression must be carefully considered when choosing let-7 as a therapeutic candidate.

0053436.g005 Figure 5Screening for putative let-7a biogenesis regulators in MIA PaCa-2. A, Western blotting analysis of LIN-28A (26 kDa), hnRNP-A1 (36 kDa), KHSRP (∼66–70 kDa), and β-actin (45 kDA) in whole cell lysates of normal and cancerous pancreatic cells.

Overall, these data expand our current understanding of let-7 regulation of growth control in pancreatic cancers.

Hence, to study the potential interplay between let-7 and RRM2 and to further explore the opportunity of utilizing let-7 for pancreatic cancer therapeutics, we sought to determine the direct impact of the human let-7 family on RRM2 -mediated inherent gemcitabine resistance.

Several Novel RNA -binding Proteins Influence Mature let-7a Biogenesis in MIA PaCa-2. Screening for putative let-7a biogenesis regulators in MIA PaCa-2..

An inverse relation of RRM2 and let-7 in human pancreatic cancer cells.

In addition, distinct let-7 precursors were identified to improve chemosensitization in gemcitabine-resistant pancreatic cancer cells partially via post-transcriptional repression of RRM2.

Likewise, careful selection of pre- let-7 subfamilies can also overcome defects associated with let-7 processing machinery in pancreatic cancer cells.

Silencing of LIN-28 and SET showed differential let-7 biogenesis, growth, and gemcitabine chemosensitivity effects.

Conversely, pri- let-7a levels were found to be significantly increased in Stage IB, Stage IIA, and Stage IIB (moderately to poorly differentiated) PDAC tissues (Fig. 7A ).

let-7a Processing Defects Progressively Increase with Pancreatic Cancer Cell Acquired Gemcitabine Resistance.

Defective Processing of Pre- let-7a-1 in MIA PaCa-2Although we used pre- let-7 members for generating all stable MIA PaCa-2 clones, functional RNA interference was expected to be mediated by the mature let-7 miRNAs generated after a series of intracellular RNA processing events.

Specifically, shRNAs against Insig-2, Gnas, Sfrs2, PANK-1, LOC-440396, SET, and LIN-28 showed a >2-fold increase in mature let-7a levels (Fig. 5B ).

When silencing Insig-2, LOC-440396, Gnas, PANK-1, and SET, increases in mature let-7a levels were associated with concurrent increases in three let-7a precursors; however, the LIN-28 silencing -mediated increase in mature let-7a levels was associated with a decrease in all three precursors (Fig. 5C–E ).

Consequently, the ratios of mature let-7a to pre -let-7a forms were found to be highly reduced in Stage IB, Stage IIA, and Stage IIB PDAC tissues (Fig. 7C ) corroborating the increasing defects in pre- let-7a processing with pancreatic tumor progression.

On the basis of this conclusion, we hypothesized that the let-7a processing defects would be present in poorly differentiated, high-grade pancreatic tumors.

Silencing SET not only increased mature let-7a levels but also other members within the let-7 family in both poorly differentiated MIA PaCa-2 and well-differentiated L3.6pl.

Collectively, these data suggest pre- let-7a-3 may be likely to act as one of the preferable candidates among let-7a precursors for therapeutic selections against pancreatic cancer.

Furthermore, in both matched and unmatched PDAC tissues, reduction in precursor processing (>2-fold accumulation of the precursor form) to mature let-7a was more frequently noticed with pre- let-7a-2 (4 out of 6 matched PDAC tissues; 9 out of 10 unmatched PDAC tissues) and pre- let-7a-1 (4 out of 6 matched PDACs; 5 out of 10 unmatched PDACs) than that observed with pre- let-7a-3 (2 out of 6 matched PDACs; 3 out of 10 unmatched PDACs).

Since most let-7 members [27] seemed to negatively influence RRM2 expression, we further investigated whether pre- let-7 could augment chemosensitivity of MIA PaCa-2 to gemcitabine.

Maximal accumulation of precursors was noticed with pre- let-7a-2 (Capan-1-GR) and pre- let-7a-1 (Capan-1-GR and L3.6pl-GR).

In addition, Thoc4, Cldn1, Npm1, Igfbp5, ESR1, and Lrp1 also showed moderate but significant increases in let-7a levels with concomitant reductions in one or more pre- let-7a levels (Fig. 5C–E ).

Subsequently, variations in both precursor and mature let-7a forms were tested in these 45 clones.

Although moderate, the mature let-7a progressively decreased, and precursor let-7a forms severely accumulated in a progressive, dose -dependent fashion in both Capan-1-GR (Fig. 4D ) and L3.6pl-GR (Fig. 4E ).

MIA PaCa-2 cells transiently infected with lentiviruses harboring empty (control) or various pre -let-7 members were subjected to cell cycle analysis (48 h after transfection) as described earlier [23].

n = 3. C, Schematic representation of the structures of pre- let-7a-1 and pre- let-7a-3. Sequences of mature and passenger let-7a strands within the precursors are boxed in continuous or broken lines, respectively.

0053436.g006 Figure 6Silencing of LIN-28 and SET showed differential let-7 biogenesis, growth, and gemcitabine chemosensitivity effects.

These data identified multiple RNA binding proteins influencing mature let-7a levels in pancreatic cancer cells.

To validate this clinical relevance, we quantified the three precursor let-7a forms and mature let-7a in resected pancreatic ductal adenocarcinoma (PDAC) tissues representing four different stages (Stages IA, IB, IIA, and IIB) and varying degrees of differentiation (well-differentiated, moderately differentiated, moderately-poorly differentiated) (See Table S1).

Finally, RRM2 may not be a global determinant of drug-resistance in pancreatic cancer cells, in which case the proposed let-7-RRM2-chemoresistance axis may not be as effective as expected in RRM2 -dependent resistance.

These data indicated the mature let-7a levels to inversely correlate with the stages of PDAC with maximal reductions in let-7a noted in stage IIB, moderately-poorly differentiated PDAC tissues (the most severe stage examined) (Fig. 7B ).

In vitro results so far demonstrated defective processing of let-7a precursors in poorly differentiated pancreatic cancer cells with critical influences on growth and chemosensitivity.

FIV-let-7 constructs (let-7a-2, let-7a-3, let-7b, let-7c, let-7e, let-7f-1, let-7f-2, let-7g, and let-7i) from GeneCopoeia (Rockville, MD) and HIV-let-7 constructs (let-7a-1 and let-7d) from System Biosciences (Mountain View, CA) were used.

Target In Vitro Reporter AssayFor luciferase binding assays, 293Ta cells were seeded on a 24-well cluster (5×10 [3] cells/well) and transduced with various let-7 precursors using the lentiviral gene transfer method (as described earlier).

These data identify profound defects in the complete processing of pre- let-7a-1 but not pre- let-7a-3 into their mature let-7a form in MIA PaCa-2, even though both are expected to generate the same mature form (i. e., let-7a; Fig. 3C ).

We decided to examine all of the 10 human let-7 members for their potential roles as chemosensitization factors [17], [31]– [33].

Future studies, especially in animal mo dels, are expected to improve the collective understanding of let-7 cancer biology and its therapeutic applications in solid tumors.

We next examined whether manipulating LIN-28 and SET, which produced the highest changes in let-7a levels in our screen (Fig. 5B ), could influence the biogenesis of various let-7 miRNAs.

These results clearly support the occurrence of defective let-7a precursor processing with acquired nucleoside analog chemoresistance in pancreatic cancer cells.

Besides several possibilities, alterations in let-7 processing machinery were found to influence the levels of mature let-7 as well as nucleoside analog chemoresistance in tumor cells.

Investigating expressional alterations of let-7 miRNAs in pancreatic cancer cells led to the identification of the influence of various RNA binding proteins in these processes.

Fourth, let-7 could also act on transcriptional factors, proteasomal machinery, cell cycle check points, DNA replication/repair enzymes, etc.

Although we used pre- let-7 members for generating all stable MIA PaCa-2 clones, functional RNA interference was expected to be mediated by the mature let-7 miRNAs generated after a series of intracellular RNA processing events.

0053436.g001 Figure 1An inverse relation of RRM2 and let-7 in human pancreatic cancer cells.

Our study also elucidates several RNA processing proteins, including SET oncoprotein and LIN-28, to disparately modulate mature let-7 biogenesis and chemosensitivity in gemcitabine-sensitive- versus –resistant pancreatic cancer cells.

As shown in Fig. 3D, a pre- let-7a-1 fusion construct failed to undergo complete processing, but a control pre- let-7b fusion construct, which produced significantly higher mature let-7 levels (Fig. 3A ), did not.

In addition, MIA PaCa-2 represents a poorly-differentiated pancreatic cancer cell mo del [23] and let-7 plays critical roles in cellular differentiation.

MIA PaCa-2 cells were infected with lentiviruses harboring shRNAs for putative RNA processing proteins, and the relative levels of mature let-7a (B) and three precursors of let-7a (C–E) in stable clones were plotted.

n = 3. Arrows indicate the candidates showing reductions in precursor let-7a with a concomitant increase in mature let-7a.

Since not all RRM2 protein induction (>5-fold in Capan-1) could be fully accounted for by the increase in RRM2 transcripts (≤2-fold), we subsequently tested whether a decrease in let-7 -mediated post-transcriptional repression of RRM2 was promoting acquired resistance.

Defective Processing of Pre- let-7a-1 in MIA PaCa-2. Defective processing of pre- let-7a-1, but not pre- let-7a-3, into let-7a in MIA PaCa-2..

3

Let-7 expression has been shown to decrease during Fas -mediated apoptosis because Fas activation suppresses Dicer; however, exogenous expression of let-7 inhibits cell sensitivity to Fas -mediated apoptosis via directly targeting Fas [43, 68], which suggests that let-7 family miRNAs may suppress tumor innate immune reactions.

The crosstalk between these oncogenes and LIN28A/LIN28B and let-7 loop is summarized in Fig.   5. Fig. 5 In summary, in a variety of cancer types, let-7 is most frequently down-regulated, while LIN28A/LIN28B is most frequently up-regulated, and the aberrant expression of one component of theLIN28A/LIN28B and let-7 loop due to transcriptional and/or post-transcriptional level dysregulation in human malignant tumors would result in the alteration of the other one.

Indeed, RAS has been found to inhibit the generation of let-7 by upregulating the expression of LIN28 via MAPK activated myc expression [26].

Interestingly, over -expression of LIN28 was shown to elevate the expression of myc via down-regulation of let-7, which targets the MYC gene.

Secondly, through repressing let-7, LIN28A/LIN28B indirectly up-regulates some cell-cycle regulators targeted by let-7, such as cyclinD1/2, CDK6, CDC34, CDC25a and Trim71 (a repressor of CDK inhibitor 1A).

Additionally, up-regulation of let-7 family miRNA expression upon estrogen exposure in endometrial adenocarcinoma enhanced cellular survival through the direct targeting of the anti-apoptosis gene BAX [97].

In addition to let-7, the miRNAs miR-26a, miR-181, miR-9, miR-30, miR-125, miR-212 and miR-27 have also been shown to directly bind the 3′UTR of LIN28A/LIN28B and repress translation of the protein, and as these miRNAs are frequently under-expressed in malignant tumors, higher levels of LIN28 expression are seen [31– 34].

As previously mentioned, STAT3 also suppresses the expression of let-7 through directly activating LIN28A/LIN28B expression during inflammation-stimulated EMT [28].

Lastly, through the down-regulation of let-7, enhanced expression of LIN28A induced the development of CSC ‘stemness’ coupled with resistance to chemotherapy -induced apoptosis [94, 95].

They showed that over -expression of LIN28B upon the activation of NF-κB inhibited the generation of let-7 family member miRNAs and elevated the production of IL-6, a target of let-7. In turn, IL-6 activated NF-κB and STAT3 transcription factors through the RTK signaling pathway.

For instance, let-7 targets the IGF1 receptor and AKT2 to inhibit PI3K/AKT pathway activity and RAS to inhibit MAPK pathway activity.

RNA binding proteins MicroRNAs LIN28A/LIN28B and let-7 loop Hallmarks of cancer MicroRNAs (miRNAs) are small non-coding RNAs that bind the mRNA of target genes to inhibit their translation and/or induce their decay.

Additionally, through the LIN28A/LIN28B -mediated inhibition of let-7, PI3K/AKT-mTOR signaling may promote ribosomal biogenesis and translation in mammary cells via activating S6, eIF4E and eIF4B, as let-7 is known to target key components of this pathway, such as AKT2 and Raptor [60, 61].

Since myc is one of the target genes of let-7, let-7 -mediated inhibition of myc thus inhibits the crosstalk of hallmarks of cancers; LIN28A/LIN28B, of course, has the opposite effect.

A recent study showed that let-7 inhibited the cancer cell migration via direct targeting of four genes in the actin cytoskeletal pathway, including RDX, DIAPH2, ITGB8 and PAK1 [81].

Additionally, let-7 represses the proliferation of cancer cells by directly targeting HMGA2, a protein which is frequently over-expressed in and promotes proliferation of many cancer types [52, 57, 58].

They observed that LIN28A over -expression promoted 3 T3 cells to form clones in vitro and form solid tumors in nude mice with a concomitant down-regulation of multiple mature let-7 family member miRNAs.

Another study showed that p53 directly bound to and inhibited the expression of let-7 during this process [99].

For instance, hepatitis B virus x protein (HBx) promotes cellular proliferation through down -regulating let-7 expression, thus elevating levels of the transcription factor signal transducer and activator of transcription 3 (STAT3), another let-7 target, in HBV infected cells [56].

Both LIN28A and LIN28B reportedly enhance aerobic glycolysis, while let-7 suppresses this process at least in part through targeting pyruvate dehydrogenase kinase 1(PDK1), which negatively regulates pyruvate dehydrogenase (PDH), thus preventing pyruvate entry into TCA under normoxic conditions [64].

For example, forced let-7a expression in A431 and HepG2 cells increased resistance to apoptosis induced by doxorubicin and paclitaxel through the direct targeting of caspase-3 [96].

IL-6 was also a direct target of let-7 to inhibit cancer cell invasion and migration.

In contrast to the expression of LIN28A/LIN28B proteins, the expression of let-7 family miRNAs is typical decreased in cancers (Table  1).

Further studies showed that IMP3 recruits LIN28B mRNA and prevents the binding of argonaute 2 (Ago2) and let-7 to LIN28B, thus allowing the increased expression of it and other let-7 target genes, like HMGA2 [38].

Conversely, let-7 miRNA may bind complementary sites on the 3′ UTR of both LIN28A and LIN28B mRNAs, thus inhibiting the expression and function of LIN28A/LIN28B protein [9, 25].

They showed that targeted expression of LIN28B promoted crypt transformation and fostered intestinal polyp and adenocarcinoma formation in vivo in a let-7 -dependent manner [72].

It’s now known that members of let-7 family play important roles in regulating cellular differentiation, metabolism and the development of certain diseases, including tumorigenesis [6].

The many established studies suggest that the LIN28A/LIN28B and let-7 loop is a master regulator of cancer development and would be a valuable target for future cancer therapeutic strategies.

BesidesHMGA2, let-7 also was reported to inhibit invasion, migration and metastasis via targetingITGB3, MAP4K3 and MYH9 [76, 79].

HMGA2 is the most frequently reported target of let-7 in the process of inhibiting invasion and metastasis [57, 77].

Fig. 2 Let-7 targets insulin signaling pathway and thus inhibits cancer cell metabolism The immune system is responsible for recognizing and eliminating cancer cells; however, tumors typically evade immune destruction through either avoiding detection by the immune system or limiting the extent of immunological eradication [53].

It has been revealed that c-myc can directly bind the promoter of LIN28B and thus elevate the production of LIN28B and consequently inhibit the generation of let-7 family of miRNAs upon activation of MAPK signaling [26].

While LIN28A/LIN28B represses apoptosis via let-7, it may also regulate the expression of pro-apoptosis and/or anti-apoptosis genes through unidentified mechanisms.

The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancer has been shown in Fig.   4. Fig. 4 The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancerThe expression of LIN28/let-7/MYC feedbacks is regulated by many signaling pathways and oncogenes.

Regulation of let-7 expression also occurs at the transcriptional level.

The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancer has been shown in Fig.   4. Fig. 4 The LIN28/let-7/MYC feedbacks loop and the crosstalk of hallmarks of cancer The expression of LIN28/let-7/MYC feedbacks is regulated by many signaling pathways and oncogenes.

Interestingly, let-7 reportedly triggers human cell senescence through modifying chromatin at the promoters of RB1/E2F target genes, thus repressing their transcription, which suggests that the LIN28A/LIN28B and let-7 loop may also be involved in the regulation of cancer cellular replicative immortality [100].

Interestingly, RAS and AKT are the direct targets of let-7 s respectively [60, 112].

Many studies have shown that the over -expression of let-7 or knockdown of LIN28A/LIN28B increases the radiosensitivity or chemosensitivity of cancer cells [84– 87].

As discussed, the expression patterns and functions of LIN28A/LIN28B and let-7 in malignancies are largely opposing and appear to compose a double -negative feedback loop regulating cancer progression.

AKT also activates the NF-κB signaling via activating IKK, and NF-κB has been reported to directly promotes the transcription of LIN28B and thus inhibits the generation of let-7 s [27].

This double -negative feedback loop between LIN28A/LIN28B and let-7 is shown in Fig.   1. Fig. 1 LIN28A/LIN28B proteins are frequently up-regulated in various malignancies originating from three germ layers (Table  1).

Indeed, LIN28A/LIN28B and let-7 are inversely expressed in normal and malignant tissues [11, 12].

While let-7 miRNAs may be regulated at multiple levels, most studies support the significance of their post-transcriptional regulation.

As previously mentioned, by competing with TGFBR3 to bind let-7, HMGA2 represses the inhibitory effect of let-7 on TGFBR3, thus elevating TGFBR3protein and facilitating cancer invasion and metastasis [52].

The binding of LIN28A/LIN28B to either pri-let-7 or pre-let-7 inhibits let-7 precursor processing by Drosha and Dicer [19].

Thus, inhibition of let-7 by LIN28A/LIN28B would increase the activities of both pathways and, subsequently, increase proliferation.

In fact, the mechanism by which let-7 inhibits invasion and metastasis is, actually, well-studied.

Conversely, let-7 miRNAs can repress DAF-12 expression by binding its 3′UTR, which suggests a complex feedback loop between DAF-12 and let-7 miRNAs [48].

Many studies have shown that LIN28A/LIN28B promotes and let-7 inhibits invasion and metastasis in various cancer types, including colon cancer, breast cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, lung cancer and esophageal cancer [57, 74– 79].

Of note, let-7 may inhibit apoptosis under certain conditions.

For example, the lncRNAH19 reportedly inhibits the bioavailability of let-7 family miRNAs through a molecular sponge mechanism [51].

In addition to LIN28A/LIN28B proteins, the complex of NF90 and NF45 proteins can inhibit pri-let-7a processing into pre-let-7a by binding to pri-let-7a [41], while Ago proteins can bind and stabilize mature miRNAs and thereby increase let-7 levels [42].

In addition to being repressed for their expression, the antitumor functions of let-7 have also been attenuated in malignant tumor cells.

Indeed, HMGA2 functions as a ceRNA, competing with the transforming growth factor beta receptor 3(TGFBR3) for let-7, thus allowing for the heightened expression of TGFBR3 and subsequent lung cancer progression [52].

For instance, Fas and TRAIL-R2 were reported to reduce the levels of mature let-7 miRNA by inhibiting the activities of Dicer [43] and Drosha [44], respectively.

Thus, LIN28A/LIN28B not only inhibits the biogenesis of let-7 family miRNAs, but also induces their degradation.

Through inhibiting let-7, LIN28A/LIN28B can activate a variety of cellular proliferation signaling pathways.

However, a recent study found that the expression of let-7 was decreased in colon cancer cells following radiation exposure [99].

A double -negative feedback loop between LIN28A/LIN28B and let-7. The mechanisms of aberrant expression of LIN28A/LIN28B and let-7 in cancer.

Moreover, the exogenous expression of let-7 increased radiation -induced cytotoxicity, which suggests that let-7 family miRNAs may also increase the genome-instability of cancer cells.

LIN28A/LIN28B and let-7 loop regulates genome instability.

High levels of LIN28A/LIN28B and low levels of let-7 contribute to the development of human malignances through promoting cellular proliferation, cell death resistance, angiogenesis, metastasis, metabolism reprogramming, tumor -associated inflammation, genome instability, acquiring immortality and evading immune destruction of cancer cells.

For instance, during tumorigenesis, mature let-7 was found to be absent, whereas pri-let-7 was present at high levels, which suggests post-transcriptional regulation of mature let-7 [40].

Crosstalk between LIN28/let-7 loop and oncogenes in regulating hallmarks of cancer.

Recent studies found that LIN28A/LIN28Band let-7 family miRNAs tend to have opposing roles in many cellular processes, in particular those involved in cancer development and progression [10].

Let-7 reportedly induces cellular apoptosis through targeting the anti-apoptotic protein B-cell lymphoma-extra large (BCL-XL) in many cell types [86– 88] as well as the IL-6/STAT3 pro-survival pathway [89].

These results suggest that the let-7 family miRNAs play a multifaceted role in the regulation of cellular apoptosis.

While the LIN28A/LIN28B and let-7 loop is known to be involved in the development of chemotherapeutic sensitivity of cancer cells to apoptosis, it is also purportedly involved in the maintenance and/or differentiation of CSCs.

LIN28A/LIN28B and let-7 loop regulates cancer cell proliferation.

LIN28A/LIN28B and let-7 loop regulates cancer cell metabolism.

LIN28A/LIN28B and let-7 loop regulates cancer cell death.

The LIN28A/LIN28B and let-7 axis is known to regulate cellular apoptosis and is involved in resistance/sensitivity to therapy.

These results suggest that the activation of TLR7 induced by extracellular let-7 may also be involved in the regulation of immune response or inflammation in cancer; however, this hypothesis has yet to be validated experimentally.

LIN28A/LIN28B and let-7 loop regulates metastasis.

The nuclear hormone receptor DAF-12, a transcriptional activator or repressor depending on the presence or absence of a DA (dafachronic acid) ligand, can directly modulate the transcription of certain let-7 miRNAs [47].

Involvement of the LIN28A/LIN28B and let-7 loop in the regulation of cancer cell invasion and metastasis is, naturally, intimately associated with EMT.

To date, the LIN28A/LIN28B and let-7 loop has been demonstrated to regulate almost all of these hallmarks.

Recent studies suggest that the LIN28A/LIN28B and let-7 loop may also regulate cancer cell immune evasion.

LIN28A/LIN28B and let-7 loop regulates the hallmarks of cancer.

LIN28A/LIN28B and let-7 loop may regulate other hallmarks of cancer.

LIN28A/LIN28B can elevate cellular proliferation signals in both let-7 -dependent and -independent manners.

The presence of a double -negative feedback loop between LIN28A/LIN28B and let-7 was also reported [10].

A recent study uncovered that extracellular let-7 interacts with and then activates TLR7, an RNA-sensing neuronal TLR, and induces neurodegeneration [70].

Activation of transcriptional factors necessary for cellular proliferation in a let-7 -dependent manner is another method by which LIN28A/LIN28B can increase proliferation.

Both the CSD and CCHC zinc fingers of LIN28A/LIN28B can interact with the conserved residues ofpri-let-7 and pre-let-7. Briefly, the CSD inserts into the apical point of the precursor loop, while the CCHC zinc fingers dimerize on a GGAG motif adjacent to the Dicer cleavage site [17, 18].

Through let-7, LIN28A/LIN28B activates insulin signaling by elevating components involved in insulin signaling pathways, such as IGF1R, insulin receptor (InsR), IRS2, AKT2 and Rictor (Fig.   2) [60].

The miRNA let-7 was identified in the nematode Caenorhabditis elegans in 2001, seven years after let-4, the first known miRNA, was identified in the same species [3].

Oligo-uridylated pre-let-7 can also be degenerated by the 3′-5′ exonuclease Dis312 [23, 24].

As previously mentioned, LIN28A/LIN28B is a common post-transcriptional repressor of let-7 miRNAs.

These results suggested a complicated feedback loop consisting of LIN28B, let-7 and MYC.

LIN28A/LIN28B and let-7 loop mediates tumor -associated inflammation.

The let-7 family of miRNAs is the largest of all miRNA families, and members of this family are highly conserved in sequence and function from C. elegans to humans [4, 5].

Interestingly, in a metastatic gastric cancer cell line, let-7 family miRNAs could be selectively secreted into the extracellular environment via exosomes [71].

Even though the hypothesis of ceRNA is challenged by some researchers recently [50], ceRNAs attenuating let-7 -mediatedantitumor activity has been extensively reported.

These results suggested that there is a complicated crosstalk between RAS, PI3K/AKT, NF-κB, LIN28A/LIN28B and let-7 loop.

LIN28A/LIN28B and let-7 loop mediates cancer cell evasion of immune destruction.

Like let-4 and let-7, LIN28A was also first identified in C. elegans [7], though it is also present in a wide variety of mammals.

Upon binding to pre-let-7, LIN28A/LIN28B recruits TUT4/TUT7, which causes oligo-uridylation at the 3′terminal of pre-let-7 [20– 22].

Importantly, this effect could be attenuated by re-introducing let-7. Recently, a consistent result was observed by Madison et al. in intestinal epithelial cells.

LIN28A/LIN28B promotes invasion and metastasis through the let-7/HMGA2/Slug or Snail/E-cadherin axis [57, 77], but also in a let-7-independent manner.

Recently, it was demonstrated that the LIN28A/LIN28B and let-7 loop is a key switch linking inflammation to cell transformation.

4

Consistent with this idea of a negative feedback loop, shRNA -mediated suppression of endogenous MYC was found to up-regulate let-7 (Wang et al., 2011), whereas let-7 expression was shown to suppress MYC expression in a Burkitt lymphoma cell line (Sampson et al., 2007).

Moreover, up-regulation of RAS was found to require down-regulation of let-7 in lung cancer and non-small cell lung cancer (NSCLC) (Takamizawa et al., 2004; Johnson et al., 2005; Kumar et al., 2008), and let-7g was shown to block tumorigenesis by suppressing RAS in NSCLC (Kumar et al., 2008).

The inverse relationship between the expression levels of let-7 and HMGA2 was further supported by recent studies demonstrating that ectopic let-7 expression can inhibit cell growth and mammosphere formation by down -regulating RAS and HMGA2 in mouse breast cancers (Sempere et al., 2007; Yu et al., 2007).

In an unfavorable environment, ligand-unbound DAF-12 suppresses let-7 expression with its co-repressor, DIN-1. When environmental conditions favor developmental progression, however, ligand-bound DAF-12 activates the transcription of let-7. This feedback loop may regulate cellular fate and developmental arrest (Bethke et al., 2009; Hammell et al., 2009).

In addition to the role of let-7 in modulating the RAS oncogene, multiple let-7 members were found to be down-regulated in human cancers and cancer stem cells, strengthening the notion that let-7 may also function as a tumor suppressor (Takamizawa et al., 2004; Shell et al., 2007; Yu et al., 2007; Dahiya et al., 2008; O’Hara et al., 2009).

It thus seems that let-7 should be expressed at specific stages of terminal differentiation, but down-regulated in stem cells being maintained in their undifferentiated state.

During differentiation, increased expression of let-7 down-regulates HMGA2 by interacting with its 3′ UTR (Yu et al., 2007; Boyerinas et al., 2008; Nishino et al., 2008).

let-7 was shown to regulate the expression of high-mobility group AT-hook 2 (HMGA2), which is an early embryonic oncofetal gene that is overexpressed in stem cells and contributes to their self-renewal (Yu et al., 2007; Nishino et al., 2008).

As a result, the majority of let-7 mutants die due to bursting of the vulva, earning this mutation its name: lethal-7. The expression pattern of let-7 is consistent with its mutant phenotype, as its expression is first detected at the L3 stage and peaks at the L4 stage (Reinhart et al., 2000; Esquela-Kerscher et al., 2005).

Purified LIN28A inhibits pri-let-7 processing in vitro and its ectopic expression selectively blocks pri-let-7 processing in vivo (Newman et al., 2008; Viswanathan et al., 2008).

The observation that let-7 expression gradually increases during development suggests that let-7 biogenesis may be tightly regulated by additional factors (Pasquinelli et al., 2000; Sempere et al., 2002; Thomson et al., 2006; Liu et al., 2007).

Moreover, the SET7/9 -mediated post-translational modification (methylation) appears to act as a switch that changes the action mode of LIN28A in the inhibition of let-7 biogenesis.

Thus, although it is not yet clear whether LIN28A directly inhibits Drosha activity, it appears to negatively regulate let-7 biogenesis in the nucleus as well as in the cytoplasm.

Transcriptional regulation of let-7 C. elegans harbors a feedback circuit between let-7 and the nuclear hormone receptor, DAF-12, in that DAF-12 is a target of let-7, but also regulates the transcription of let-7 in a ligand -dependent manner.

Even though let-7 is ubiquitously expressed in adult mammalian tissues (Sempere et al., 2004), expression of individual let-7 family members is also context -dependent.

This context -dependent expression of let-7 family members would be tightly related with the expression of LIN28A/B as well as transcription factors (Thornton and Gregory, 2012).

As let-7 is induced during development and represses the expression of pluripotency factors, its biogenesis must be precisely regulated.

In the presence of LIN28A/B, TUTases instead inhibit pre-let-7 processing by oligo-uridylation via LIN28A/B -mediated targeting.

Additionally, let-7a reportedly inhibits MYC -induced cell growth in Burkitt lymphoma cells by blocking MYC expression (Sampson et al., 2007).

Together, these lines of evidence strongly suggest that the let-7 family members act as crucial tumor suppressors that inhibit diverse oncogenes.

As let-7 expression gradually increases during development, and this miRNA plays important roles in many biological processes, it could be expected that the biogenesis of let-7 should be tightly regulated (Pasquinelli et al., 2000; Sempere et al., 2002; Thomson et al., 2006; Liu et al., 2007).

Indeed, DIS3, other catalytic subunit of cytoplasmic exosome, also indirectly regulates the expression of let-7 through degradation of LIN28B mRNAs in several mammalian cancer cell lines (Segalla et al., 2015).

With respect to the function of let-7 as tumor suppressor, the targets of C. elegans let-7 were initially predicted using computational analysis, and the 3′ UTR of let-60 [also known as an ortholog of the RAS (human Rat sarcoma) oncogene] was identified as having the highest identified sequence complementarity to let-7 (Johnson et al., 2005).

Although the expressions of LIN28A and LIN28B are mutually exclusive and these proteins play somewhat different inhibitory roles in let-7 biogenesis, recent results suggest that they might share the consensus of their molecular mechanism.

Thus, one of the mechanisms of maintaining undifferentiated state in stem cells is upregulation of HMGA2 by maintaining the low level of let-7 miRNA.

The involvement of let-7 miRNA in stem cell regulation also provided a clue as to how let-7 may function as a tumor suppressor.

Cluster1-a (let-7a-2, miR-100, miR-125b-1) and Cluster1-b (let-7c, miR-99a, miR-125b-2) are involved in HSPC (hematopoietic stem and progenitor cell) homeostasis such as self-renewal, proliferation, quiescence, and differentiation by blocking TGFβ pathway and amplifying Wnt signaling (Emmrich et al., 2014), whereas LIN28B represses let-7 to inhibit erythroid development and maintain stemness (Copley et al., 2013; Lee et al., 2013b).

Indeed, recent studies have shown that let-7 family members generally promote differentiation during development and function as tumor suppressors in various cancers (Reinhart et al., 2000; Takamizawa et al., 2004; Grosshans et al., 2005; Johnson et al., 2005; Yu et al., 2007; Caygill and Johnston, 2008; Kumar et al., 2008).

In summary, two major biological roles have been elucidated for the let-7 miRNA: as an essential regulator of terminal differentiation, and as a fundamental tumor suppressor.

This conservation suggests that let-7 may act as a regulator of gene expression across diverse animal species (Pasquinelli et al., 2000; Hertel et al., 2012).

LIN28B appears to directly bind to pri-let-7 in the nucleus and sequester it to the nucleolus, which lacks Drosha, thereby suppressing let-7 maturation via a TUTase-independent pathway.

Interestingly, a similar feedback loop has also been demonstrated in mammals: MYC is a target of let-7, but it can also repress the transcription of let-7 during MYC -mediated tumorigenesis by directly binding to the promoter and upstream region of the let-7a-1/let-7f-1/let-7d cluster (Chang et al., 2008; Wang et al., 2011).

C. elegans harbors a feedback circuit between let-7 and the nuclear hormone receptor, DAF-12, in that DAF-12 is a target of let-7, but also regulates the transcription of let-7 in a ligand -dependent manner.

In mammals, let-7 expression is high during embryogenesis and brain development (Thomson et al., 2004; Schulman et al., 2005; Thomson et al., 2006; Wulczyn et al., 2007) and remains high in adult tissues (Sempere et al., 2004; Thomson et al., 2004).

For instance, miR-48, miR-84, and miR-241 regulate the second larval (L2) to third larval (L3) transition, while let-7 regulates the fourth larval (L4) to adult transition (Fig.   1) (Reinhart et al., 2000; Abbott et al., 2005).

Several other lines of evidence strongly suggest that let-7 functions as tumor suppressor in general.

Consistent with this mutant phenotype, let-7 expression in D. melanogaster gradually increases during the third larval instar stage and peaks in the pupa (Pasquinelli et al., 2000; Bashirullah et al., 2003).

Ultimately, detailed mechanistic studies for let-7 biogenesis and its regulation involved in the developmental timing, cell division and differentiation in animals should be elucidated.

Thus, the let-7 miRNAs of C. elegans and D. melanogaster both act as essential regulators for proper development at the larva-to-adult transition.

During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Let-7 miRNAs are found in various animal species, including the human.

LIN28B has also been shown to inhibit let-7 biogenesis (Fig.   4), but the similar functions of LIN28A and LIN28B are achieved through very different action mechanisms (Piskounova et al., 2011).

In addition, a subset of let-7 family member would be expressed in specific tissues, cell lines, and cancers (Boyerinas et al., 2010; Chiu et al., 2014).

According to miRBase, Caenorhabditis elegans (nematode), Drosophila melanogaster (fly), Xenopus tropicalis (frog ), Danio rerio (zebra fish), Gallus gallus (chicken), Canis familiaris (dog), Mus musculus (mouse) and Homo sapiens (human) all express a version of let-7 (let-7a) that possesses the exact consensus sequence of ‘UGAGGUAGUAGGUUGUAUAGUU’ (Fig.   2A).

In C. elegans, let-7 controls the crucial developmental timing of the last larval transition (L4-to-adult) via regulation of transcription factors (daf-12, pha-4, die1, and lss4) in different tissues (Fig.   1) (Reinhart et al., 2000; Grosshans et al., 2005).

Sequence differences are indicated by letters (e. g., let-7a and - 7b), while different genomic loci expressing the same sequence are indicated by numbers.

The let-7 mutant is lethal in the nematode (Reinhart et al., 2000), and decreased let-7 expression or genomic deletion has been detected in several human cancer types (Takamizawa et al., 2004; Dahiya et al., 2008; O’Hara et al., 2009).

This conserved feature of the let-7 miRNAs suggests that their targets and functions may be similar across diverse animal species.

However, the exact role of let-7 family members in mammalian development has not yet been fully elucidated (Lancman et al., 2005; Schulman et al., 2005; Wulczyn et al., 2007), in large part because it is technically difficult to knock out multiple let-7 family members in the same individual.

These studies collectively support the notion that let-7 is a key regulator of proper developmental timing in C. elegans.

LIN28A and LIN28B inhibit the biogenesis of let-7 via both TUTase -dependent and -independent pathways.

In addition, precocious expression of let-7 at the L2 stage yielded an early adult-like phenotype at the L4 stage (Hayes and Ruvkun, 2006).

When LIN28A is overexpressed in HEK293T cells, the 3′-terminal oligo-uridylation of pre- let-7 yields a uridine tail of ~14 nt (Heo et al., 2008).

Further studies examining the molecular mechanisms of let-7 biogenesis and its regulation by nuclear/nucleolar and cytoplasmic factors should provide new insights into the biological roles of the let-7 family members.

The detailed relationship between LIN28B and TUTases needs to be further understood LIN28A/B negatively regulates let-7 biogenesisAs noted above, LIN28A is required for the oligo-uridylation of pre-let-7 by TUTases (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Piskounova et al., 2011; Thornton et al., 2012).

Figure 4 Regulation of let-7 biogenesis by LIN28A/B.

Thus, it appears that LIN28A may regulate pri-let-7 processing in a TUTase-independent fashion in the nucleus as well as a TUTase -dependent pathway in the cytoplasm.

In addition, pri-let-7 processing is rescued by knockdown of LIN28A in mouse embryonal carcinoma (Viswanathan et al., 2008).

In contrast, seam cells harboring the let-7 mutation fail to finish the L4-to-adult transition and instead exhibit extra cell division without proper formation of the adult alae (Reinhart et al., 2000).

Oligo-uridylation by TUTases is a marker for pre-let-7 degradationIt has been reported that let-7 is also post-transcriptionally regulated by additional factors.

Interestingly, MYC can also negatively regulate let-7 family members such as let-7a, - 7d, and - 7g by binding to their promoters, thus, forming a negative-feedback loop (Chang et al., 2008; Wang et al., 2011).

Dysregulation of let-7 family members leads to abnormal physiological processes.

It has been reported that let-7 is also post-transcriptionally regulated by additional factors.

For example, let-7 family members have been shown to repress cell cycle regulators (e. g., cyclin A, cyclin D1, cyclin D3, and CDK4) and block cell cycle progression and anchorage-independent growth in cancer cells (Johnson et al., 2007; Schultz et al., 2008).

LIN28A/B negatively regulates let-7 biogenesis.

REGULATION OF let-7 BIOGENESIS.

In addition, we discuss recent progress in better understanding the regulatory mechanisms that act upon let-7. The discovery of let-7 in C. elegansExperiments using forward genetics originally identified let-7 (lethal-7) as a heterochronic gene in C. elegans (Reinhart et al., 2000).

Despite let-7 is one of the first discovered miRNAs, the details on transcriptional regulation of let-7 family, especially individual members of let-7 family, are not clearly understood.

Based on this, it seems reasonable to speculate that other transcription factors may also participate in the transcriptional regulation of let-7 family members.

LIN28A/B proteins also regulate let-7 biogenesis via TUTase-independent pathways.

Moreover, let-7 is known to regulate hematopoietic stem cell fate along with miR-99a/100, miR-125b-1/2, and LIN28B (Copley et al., 2013; Lee et al., 2013b; Emmrich et al., 2014).

To date, several transcriptional and post-transcriptional mechanisms have been proposed as regulators of let-7 biogenesis.

Transcriptional regulation of let-7. Oligo-uridylation by TUTases is a marker for pre-let-7 degradation.

In chicken and mice, let-7 is involved in limb development (Mansfield et al., 2004; Lancman et al., 2005; Schulman et al., 2005).

Pre-let-7 is mono-uridylated at the 3′ end by LIN28A and TUTases prior to Dicer -mediated processing.

The group II pri- let-7 precursors have a bulged adenosine (pri-let-7d) or uridine (all other members of the group) next to the processing site (Heo et al., 2012).

As discussed above, TUTase is essential for the processing of the group II pre-let-7 miRNAs, which have a unique 3′ overhang (Fig.   3) (Heo et al., 2012).

Notably, each let-7 family member is often present in multiple copies across the genomes of higher animals (Table  1).

Comparison of let-7 family members in D. melanogaster and higher animals has revealed that such sequences tend to show similar genomic positions, suggesting that they form well-preserved clusters (Lagos-Quintana et al., 2001; Bashirullah et al., 2003; Sempere et al., 2003).

This oligo-uridylated pre-let-7 resists Dicer cleavage and is instead susceptible to degradation.

It was recently shown that LIN28A can prevent the biogenesis of let-7 independent of TUT4/7 in hESCs, in a manner similar to that seen for LIN28B (Fig.   4) (Kim et al., 2014).

X-ray crystallography has shown that the three RNA binding domains of DIS3L2 form an open funnel that facilitates uridine-specific interactions with the first 12 uridines of the pre- let-7 tail.

In the human, let-7g and let-7i are located individually on chromosomes 3 and 12, respectively, while the other let-7 family members are distributed among four clusters (clusters 1 to 4) (Table  2).

Cluster 2 contains let-7a, -7d, and -7f-1, whereas cluster 3 is composed of let-7a-3 and -7b.

In the human, for example, 12 distinct loci encode nine mature let-7 miRNAs (Fig.   2B and Table  2).

For one, whereas the nematode and the fly have only one let-7 miRNA, higher animals (e. g., fishes and mammals) have diverse let-7 family members including let-7a, - 7b, - 7c, - 7d, - 7e, - 7f, - 7g, - 7h, - 7i, - 7j, - 7k (see below for a discussion of this nomenclature) and miR-98 (Table  1) (Lagos-Quintana et al., 2001; Lau et al., 2001; Chen et al., 2005; Landgraf et al., 2007).

Genomic location and four clusters of these precursors are describedIn animal genomes, the let-7 family members can be encoded individually or as clusters with other family members and/or unrelated miRNAs.

Biological roles of let-7 family membersThe high degree of conservation among let-7 miRNAs across different animal species suggests that they may play important (and potentially similar) roles in the biological processes of various organisms (Pasquinelli et al., 2000; Hertel et al., 2012).

Moreover, HuR, RNA -binding protein, binds and represses MYC mRNA by recruiting the let-7/RISC complex to 3′ UTR region of MYC (Ma et al., 1996; Kim et al., 2009).

The nematode and fruit fly have a single isoform, whereas higher animals have multiple let-7 isoforms.

In addition, while the mature let-7 miRNA is not detected, pri-let-7 exists in some cell types including mESCs (Suh et al., 2004; Thomson et al., 2006; Wulczyn et al., 2007).

LIN28A is mainly localized in the cytoplasm, but it can enter the nucleus and shows affinity for both pri- and pre-let-7 (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008).

The machinery responsible for degrading oligo-uridylated pre-let-7 was recently identified as the catalytic subunit of the cytoplasmic exosome, DIS3L2 (Chang et al., 2013; Malecki et al., 2013; Ustianenko et al., 2013).

The detailed relationship between LIN28B and TUTases needs to be further understood As noted above, LIN28A is required for the oligo-uridylation of pre-let-7 by TUTases (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Piskounova et al., 2011; Thornton et al., 2012).

Figure 2 Sequence comparison of let-7 family members across diverse animal species.

Although let-7 maturation generally follows the canonical miRNA biogenesis pathway, some family members require an additional step.

The terminal loop of pre- let-7 has three independent binding sites for LIN28A, which can be multiply assembled in a stepwise fashion (Desjardins et al., 2014).

LIN28B blocks the biogenesis of the let-7 miRNA via TUTase-independent pathways.

During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Characteristics of the let-7 family Let-7 miRNAs are found in various animal species, including the human.

As an example of the latter, the precursors (also known as the stem-loop sequence in miRBase) of human let-7a-1, let-7a-2, and let-7a-3 are encoded on chromosomes 9, 11, and 12, respectively, but all produce the same let-7a miRNA (Fig.   2B and Table  1).

Experiments using forward genetics originally identified let-7 (lethal-7) as a heterochronic gene in C. elegans (Reinhart et al., 2000).

In this review, we provide an overview of the features and biological roles of the let-7 family members in higher eukaryotes.

Cluster 1, which contains three miRNAs, including let-7a, miR-100, and miR-125, is also conserved in D. melanogaster (Table  2).

For instance, we do not yet know what happens to pri-let-7 following its sequestration into the nucleolus by methylated LIN28A or LIN28B.

These lines of evidence suggest that LIN28A might participate in multiple steps of let-7 biogenesis, including both Dicer- and Drosha -mediated processing.

Mammals have two paralogs of LIN28, LIN28A (also known as LIN28) and LIN28B, which can bind to both pri- and pre-let-7 to block the activities of Drosha and Dicer (Fig.   4) (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008).

org, bottom panel) Although the let-7 sequence is well conserved from the nematode to the human, several differences distinguish the closely related let-7 family members of various animal species (Roush and Slack, 2008).

This multimerization of LIN28A is likely to be required for the efficient blockade of Dicer -dependent pre-let-7 processing.

GENERAL FEATURES OF THE let-7 FAMILY.

However, miR-125a is responsible for most of these properties in cluster 1-c and the transcription of miRNAs in cluster 1-a (let-7a-2, miR-100, and miR-125b-1) are loosely related (Sempere et al., 2004; Gerrits et al., 2012).

LIN28A helps TUTases to oligo-uridylate pre-let-7. Methylated LIN28A binds to pri-let-7 in the nucleus and sequesters it into the nucleolus to prevent Drosha -mediated processing.

Let-7 (lethal-7) was one of the first miRNAs to be discovered.

In this context, the level of pre-let-7 appears to influence the subcellular localization of LIN28B (Suzuki et al., 2015).

org, bottom panel)Although the let-7 sequence is well conserved from the nematode to the human, several differences distinguish the closely related let-7 family members of various animal species (Roush and Slack, 2008).

Three members of the let-7 family (pre- let-7a-2, -7c, and -7 e) carry the typical two-nucleotide 3′ overhang in their precursors (group I pre-miRNAs), while the rest possess one-nucleotide 3′ overhang (group II pre-miRNAs) (Heo et al., 2012).

Indeed, studies have shown that LIN28A/B blocks let-7 biogenesis in several different ways to maintain self-renewal and pluripotency in stem cells (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008; Heo et al., 2009; Piskounova et al., 2011; Kim et al., 2014).

Genomic location and four clusters of these precursors are described In animal genomes, the let-7 family members can be encoded individually or as clusters with other family members and/or unrelated miRNAs.

Subsequently, let-7 was shown to interact with let-60 and RAS in C. elegans and human cancers, respectively (Johnson et al., 2005).

The let-7 miRNA is evolutionarily conserved across various animal species, including flies and mammals, but it is not found in plants (Pasquinelli et al., 2000; Hertel et al., 2012).

The high degree of conservation among let-7 miRNAs across different animal species suggests that they may play important (and potentially similar) roles in the biological processes of various organisms (Pasquinelli et al., 2000; Hertel et al., 2012).

Higher animals have generally similar sets of let-7 family members, although slight differences may be observed (for example, let-7h exists in the zebrafish but not in the human).

TUT4 and TUT7 were recently shown to oligo-uridylate pre-let-7 in embryonic stem cells and cancer cells (Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012).

The discovery of let-7 in C. elegans.

let-7 has also been shown to function as a heterochronic gene in D. melanogaster (Caygill and Johnston, 2008; Sokol et al., 2008), wherein let-7 mutants show abnormal (delayed) cell cycle exit in the wing (Caygill and Johnston, 2008) and an irregular maturation of neuromuscular junctions in the adult abdominal muscles that results in immaturity of the neuromusculature and defects in adult fertility, motility, and flight (Sokol et al., 2008).

LIN28A reportedly competes with Dicer for pre-let-7 and blocks processing of the precursor (Rybak et al., 2008); in the absence of LIN28A, pre-let-7 is mono-uridylated by TUT2/4/7 and further processed by Dicer to generate the mature let-7 (Heo et al., 2012).

miRNA processing miRNA biogenesis let-7 family TUTase LIN28A/B MicroRNAs (miRNAs) are short (~22-nucleotide-long) non-coding RNAs found in diverse eukaryotes from plants to animals.

The details of the relationship between DIS3L2-related cytoplasmic exosomes and let-7 biogenesis are also unknown.

In the human, for instance, the let-7 family is composed of nine mature let-7 miRNAs encoded by 12 different genomic loci, some of which are clustered together (Ruby et al., 2006; Roush and Slack, 2008).

Through its RNA -binding activity, LIN28A associates with the bulging GGAG motif in the terminal loop of pre-let-7 and recruits TUT4/7 (Nam et al., 2011).

Most of let-7 sequences include the ‘seed sequence’.

Biological roles of let-7 family members.

Interestingly, the TUTases play a second role in the degradation of pre- let-7 through their terminal uridylation activity (Fig.   4) (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012).

This substantial total includes 401 let-7 sequences from various organisms.

Consensus sequences of the mature human let-7 family members, as assessed by MEME (http://meme-suite.

To distinguish between the various isoforms, a letter and/or number are placed after the term ‘ let-7’.

In this review, we briefly summarize the current state of knowledge regarding the let-7 miRNA family and its biological functions, focusing on let-7 biogenesis in higher animals.

In addition, TUTase has been shown to be involved in degrading the let-7 precursor (pre-let-7) to block the generation of mature let-7 in the cytoplasm (Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012).

Moreover, these multiple let-7 family members are likely to have functionally redundant roles.

In general, the let-7 miRNA is generated through the canonical miRNA biogenesis pathway, which involves Drosha- and Dicer -dependent processing and is supported by TUTases.

In addition, recruitment of HuR and let-7 to the transcript of MYC is interdependent (Kim et al., 2009; Gunzburg et al., 2015).

At present, the detailed molecular mechanisms underlying let-7 miRNA biogenesis are not fully understood.

Although let-7 family is generated through canonical miRNA biogenesis pathway, it would be helpful to understand the let-7 biogenesis when comparing with the non-canonical miRNA biogenesis.

5

Additional file 1: Up-regulated let-7a down-regulated human ras /RAS expression in HCC cells in vitro.

Up-regulated let-7adown-regulated ras/RAS expression after systemic deliveryTo confirm that Chol-let-7a effectively carried let-7a to target tumours in vivo, we measured let-7a abundance in HepG2 orthotopic xenografts by qRT-PCR after systemic therapy.

Thus, we hypothesize that modulation of let-7 expression and its target RAS is a promising strategy for HCC treatment, because let-7 might suppress HCC tumour growth by down -regulating all human ras genes.

These results suggest that Chol-let-7a successfully carried let-7a mimics into target HCC tumour cells and suppressed all 3 human ras genes at the transcriptional and translational levels, which were in accordance with our in vitro results.

This result was consistent with the potential functional basis of let-7a, which involves the inhibition of target ras genes at the transcriptional and translational levels.

The expression of n-ras was inhibited most significantly by Chol-let-7a (p <0.01), and expression levels of h-ras and k-ras (p <0.05) were also reduced (Figure  4C).

Up-regulated let-7adown-regulated ras/RAS expression in HCC cellsWe measured let-7a levels by quantitative real-time PCR 48 h after transfection with Chol-let-7a and Chol-miRCtrl.

Next, we analysed the expression of let-7 target ras genes at the transcriptional and translational levels 48 h after transfection.

Chol-let-7a effectively carried let-7a to target tumours in vivo and inhibit tumour growth by inhibiting cell proliferation and promoting cell death.

In addition, Chol-let-7a can inhibit HCC cell growth by regulating all 3 human ras genes at the transcriptional and translational levels.

These results suggest that Chol-let-7a inhibits HCC cell growth by regulating all 3 human ras genes at the transcriptional and translational levels.

These results suggest that Chol-let-7a inhibits tumour growth by promoting cell death and inhibiting cell proliferation.

A recent study in C. elegans reports that the let-7 family negatively regulates let-60/RAS, and also that the let-60/RAS 3′-UTRs, including the 3′-UTRs of the human ras genes, contain multiple let-7 complementary sites (LCSs), which allow let-7 to regulate RAS protein expression [12].

These results verified our hypothesis that Chol-let-7a would inhibit the transcription and translation of all 3 human ras genes in vitro.

These results suggest that Chol-let-7a inhibited tumour growth by inhibiting cell proliferation and promoting cell death.

Chol-let-7a effectively carried let-7a mimics to target tumours in vivo and inhibited tumour growth, metastasis within the liver, and local invasion and metastasis to the spleen.

In addition, we explored the effects of Chol-let-7a on ras gene expression at the transcriptional and translational levels.

Chol-let-7a exerted significant antitumor effects by down -regulating all human ras genes at the transcriptional and translational levels.

Furthermore, let-7 has been reported to inhibit tumour growth by down -regulating KRAS in some cancers, such as pancreatic carcinoma and lung cancer [13, 14].

Local invasion and metastasis to the spleen were inhibited in the Chol-let-7a -treated group (data not shown).

Given the observed high affinity of Chol-let-7a for liver tissue in nude mice, we hypothesize that Chol-let-7a may has potential off-target effects primary in liver tissue when it is administered systemically as a therapeutic molecule.

Chol-let-7a reached HCC orthotopic tumours, significantly inhibited tumour growth, and prevented local invasion and metastasis.

At 48 h, HepG2 cells in the Chol-let-7a group were inhibited.

Therefore, Chol-let-7a produces better inhibitory effects when it is systemically administered.

Beginning 2 weeks after Chol-let-7a treatment, inhibition of tumour metastasis was observed by ultrasonography.

There were no significant differences between the 2 control groups (p >0.05), indicating that Chol-let-7a suppressed HCC cell migration.

Using miRNA-specific primers, let-7a up-regulation in comparison with parental HCC cells and Chol-miRCtrl -treated control cells was confirmed in Chol-let-7a -treated cells (see Additional file 1A).

The inhibitory rates produced by Chol-let-7a and Chol-miRCtrl on xenografts were 45.49% (p <0.01) and -7.13% (p >0.05), respectively, in comparison with the blank control group that was treated with saline buffer alone.

As shown in Figure  5, the growth of orthotopic tumours was significantly inhibited following Chol-let-7a therapy (Figure  5A-C).

Chol- let-7a inhibited the viability and mobility of HCC cells.

However, further studies of Chol-let-7a-produced off-target effects when it is systemically administered are required.

A major challenge to the clinical utility of let-7 for hepatocellular carcinoma (HCC) therapy is the lack of an effective carrier to target tumours.

Chol-let-7ainhibited the migration and invasion of HCC cells in vitroWe determined the effects of Chol-let-7a on HCC cell migration and invasion, which are 2 key steps in tumour metastasis.

Chol-let-7a inhibited cell proliferation, growth, and metastasis, and mainly functioned in the cytoplasm.

Furthermore, let-7a abundance in orthotopic xenografts was coincident with a reduction in the expression of 3 human ras mRNAs and RAS proteins.

At 72 h, inhibition increased in a dose -dependent manner in the Chol-let-7a -treated group.

Figure 1 Chol-let-7a inhibited HCC cell growth and cell viability in vitro.

We analysed the expression of RAS proteins by western blotting and observed marked decreases in KRAS, HRAS, and NRAS abundance in Chol-let-7a -treated xenografts (Figure  4B).

Figure 5 Systemic Chol-let-7a therapy inhibited growth and metastasis of orthotopic HepG2 xenografts.

In the Chol-let-7a -treated group, inhibition increased as the administered dose increased.

Moreover, let-7a abundance in HepG2 orthotopic xenografts was coincident with a reduction in the expression of 3 human ras mRNAs and RAS proteins.

These results verified that Chol-let-7a inhibited HCC cell growth in vitro.

Consistent with the results from the chamber -based cell migration assay, these data indicated that Chol-let-7a inhibited HCC cell migration.

Magnification: 20× D: The inhibitory effect of Chol-let-7a on cell invasion ability in the Boyden chamber invasion assay.

C: A chamber -based cell migration assay showing that Chol-let-7a inhibits the migration of HCC cells.

A: Let-7a expression in HepG2 orthotopic xenografts was examined by quantitative real-time PCR.

B: Chol-let-7a -treated cells at 60 h post-transfection.

H&E staining was performed at the culmination of Chol-let-7a therapy.

Chol-miRCtrl, p = 0.041; Chol-let-7a vs.

We observed Chol-let-7a- and Chol-miRCtrl -treated cells under transmission electronic microscopy (TEM) at 48 h and 60 h post-transfection.

In future studies, we will investigate off-target effects of Chol-let-7a in preclinical animal mo dels.

Significant increases in let-7a levels in Chol-let-7a -treated HepG2 and SMMC7721 cells are shown.

Both results suggested that Chol-let-7a entered cells and functioned primarily in the cytoplasm.

Chol-miRCtrl, p = 0.032; Chol-let-7a vs.

HepG2 and SMMC7721 cells were transfected with Chol-let-7a or with Chol-miRCtrl as a negative miRNA control.

We previously examined the antitumor effect of Chol-let-7a on HCC by using intratumoural administration in a subcutaneous xenograft mo del.

We found some different features in the orthotopic xenograft tissues after Chol-let-7a systemic therapy in comparison with the 2 control groups.

In the cytoplasm of Chol-let-7a -treated cells, mitochondria, heterolysosomes, and RER were vacuolated and showed irregular and unclear contours and structures (see Additional file 3B), and apoptotic and necrotic cells were clearly observed 60 h after treatment.

Orthotopic xenograft mo del with nude mice and systemic therapy with Chol-let-7a.

We confirmed the high transfection efficiency of cholesterol-conjugated let-7a miRNA mimics (Chol- let-7a) in human HCC cells, as well as their high affinity for liver tissue in nude mice.

blank, parental cells; Chol-miRCtrl, Chol-miRCtrl -transfected cells; Chol-let-7a, Chol-let-7a -transfected cells.

Chol-miRCtrl, p = 0.021; Chol-let-7a vs.

We found significantly fewer invading cells in the Chol-let-7a -treated group in comparison with the 2 control groups (Figure  1D) (66.33 ± 4.73 (Chol-let-7a) vs.

T-test: n-ras (Chol-let-7a vs.

T-test: Chol-let-7a vs.

Laser confocal images of GFP -labelled HepG2 and SMMC7721 cells (green) treated with 50 nM Cy5 -labelled Chol-let-7a or Chol-miRCtrl are shown.

Images taken at the various observation time points are shown in Figure  2. The red fluorescence that indicated Chol-let-7a and Chol-miRCtrl was primarily focused in the cytoplasm (Figure  2).

T-test for n-ras in SMMC7721: Chol-let-7a vs.

214.67 ± 11.67; T-test: Chol-let-7a vs.

Given the observed high affinity of Chol-let-7a for liver tissue in nude mice, we hypothesize that Chol-let-7a may be an ideal modified molecule for systemic HCC therapy.

Autophagocytic activity was observed in Chol-let-7a- treated cells.

We confirmed the significant antitumor efficacy of Chol-let-7a on HCC, and in particular its significant effect on HepG2 orthotopic xenografts after systemic delivery in a preclinical animal mo del.

After 48 h, cells were transfected with Cy5 -labelled Chol-let-7a or the negative control mimics (Chol-miRCtrl).

Chol-miRCtrl, p = 0.008; Chol-let-7a vs.

Trang and colleagues [18] found that synthetic miR-34a and let-7 mimics caused lung tumour reduction in mice.

Abnormal organelles were observed in the cytoplasm of Chol-let-7a -treated cells (Figure  3).

Significant increases in let-7a miRNA abundance were observed in Chol-let-7a -treated xenografts.

Through analysis of live images, we found that most of the Chol-let-7a -treated cells lost GFP fluorescence earlier than the 2 control groups (Figure  2).

Chol-miRCtrl, p =0.008; Chol-let-7a vs.

The histopathological features of Chol-let-7a -treated xenografts may have been induced by the type of Chol-let-7a transportation used in this study.

Yellow arrow indicates an apoptotic cell in Chol-let-7a -treated group.

Chol-miRCtrl, p = 0.019; Chol-let-7a vs.

We determined the effects of Chol-let-7a on HCC cell migration and invasion, which are 2 key steps in tumour metastasis.

Taken together, Chol-let-7a represents a potential useful modified molecule for systemic HCC therapy.

HepG2: Chol-let-7a vs.

103.33 ± 4.73 (blank); Chol-let-7a vs.

The cholesterol-conjugated let-7a mimics (Chol-let-7a), or negative control miRNA (Chol-miRCtrl) were labelled with Cy5 fluorescence.

T-test for n-ras in HepG2: Chol-let-7a vs.

The red fluorescence that indicated Chol-let-7a and Chol-miRCtrl was primarily focused in the cytoplasm.

At 48 h, most gaps in the 2 control cell groups were completely closed; whereas the gaps in the Chol-let-7a -treated cells remained open.

revealed a marked decrease in KRAS, HRAS, and NRAS protein abundance in the Chol-let-7a -treated HepG2 and SMMC7721 cells (see Additional file 1B).

T-test for h-ras in SMMC7721: Chol-let-7a vs.

The numbers of GFP positive cells in the Chol-let-7a, Chol-miRCtrl, and parental cell groups were 40/50, 49/50, and 49/50, respectively, at 24 h after transfection, and 5/50, 40/50, and 49/50, respectively, at 39 h after transfection.

97.00 ± 5.29; T-test: Chol-let-7a vs.

the 2 control groups, both p <0.05), and similar results were observed with SMMC7721 cells (73.00 ± 5.29 (Chol-let-7a) vs.

Figure 4 Systemic Chol-let-7a therapy modulated ras /RAS abundance in HCC orthotopic xenografts.

Some Chol-let-7a -treated cells showed typical features of apoptosis (Figure  2, Additional file 2).

Chol-miRCtrl, p = 0.001; Chol-let-7a vs.

We confirmed that Chol-let-7a entered cells and functioned primarily in the cytoplasm based on morphology and ultrastructure analysis.

Chol-miRCtrl, p = 0.003; Chol-let-7a vs.

Under light microscopy, small and large necrosis foci were observed in tumour tissues from all 3 groups, but more necrosis was observed in the Chol-let-7a -treated xenografts, and necrosis was also observed in capillary-rich areas.

T-test for h-ras in HepG2: Chol-let-7a vs.

Chol-miRCtrl, p = 0.005; Chol-let-7a vs.

230.67 ± 7.02; T-test: Chol-let-7a vs.

Chol-let-7a represents a potential useful modified molecule for systemic HCC therapy.

There was a marked decrease in KRAS, HRAS, and NRA S protein abundance in Chol-let-7a -treated cells.

T-test for k-ras in HepG2: Chol-let-7a vs.

HepG2 and SMMC7721 cells were transfected with Chol-let-7a or the negative control miRNA mimic (Chol-miRCtrl).

214.67 ± 11.67 (blank); SMMC7721, 155.67 ± 6.66 (Chol-let-7a) vs.

Continuous observation of the images showed that cell proliferation and mobility decreased in the Chol-let-7a- and Chol-miRCtrl -treated cells.

97.00 ± 5.29 (blank); Chol-let-7a vs.

In vitro, we observed the effects of Chol-let-7a on HCC cells by living cell image analysis and transmission electron microscopy.

All tumour tissues contained small and large necrosis foci, but more necrosis was observed in the Chol-let-7a -treated xenografts, and necrosis was also observed in capillary-rich areas.

Cholesterol-conjugated let-7a mimics (Chol-let-7a) and the negative control miRNA (Chol-miRCtrl) were purchased from Ribobio (Guangzhou, China).

This observation shows that some Chol-let-7a -treated cells did not die.

TEM revealed that Chol-let-7a damaged some cytoplasmic organelles, but only slight changes in nuclear morphology were observed.

Chol-miRCtrl, p = 0.002; Chol-let-7a vs.

Chol-miRCtrl, p = 0.005; Chol-let-7a vs.

blank, p = 0.837); h-ras (Chol- let-7a vs.

Enlarged irregular mitochondria with disorganized mitochondrial crests and dilated rough endoplasmic reticulum (RER), which are often accompanied by degranulation, were also clearly observed in the Chol-let-7a -treated cells.

Healing speed was slower and gaps were wider in the Chol-let-7a -treated HepG2 and SMMC7721 cells at each time point (24, 48 h, and 72 h) in comparison with their respective control groups.

In addition, a few cells in which cytoplasmic Chol-let-7a was observed did not undergo cell death, and these cells subsequently lost their red fluorescence.

To confirm that Chol-let-7a effectively carried let-7a to target tumours in vivo, we measured let-7a abundance in HepG2 orthotopic xenografts by qRT-PCR after systemic therapy.

Figure 3 Organelle changes after Chol-let-7a therapy under transmission electron microscopy.

Cell viability and mobility, let-7a abundance and the target ras genes was measured.

The Chol-let-7a (green), Chol-miRCtrl (red), and blank control (blue) groups are shown.

In comparison with the rapid changes in cytoplasmic organelles, nuclear damage was strikingly delayed after Chol-let-7a-treatment.

Some organelle changes observed in the Chol-let-7a -treated cells were also found in the Chol-miRCtrl -treated HCC cells under TEM.

SMMC7721 cells: Chol-let-7a vs.

SMMC7721: Chol-let-7a vs.

After 5 days, Chol-let-7a decreased HepG2 and SMMC7721 viability by 37.7% and 36.6%, respectively, in comparison with the parental cells (blank) (p <0.05).

Moreover, we confirmed Chol-let-7a entered cells and functioned primarily in the cytoplasm, and autophagy may be an important mechanism through which Chol-let-7a produces antitumor effects.

showed that intratumoural administration of Chol-let-7a reduced tumour growth; however, cell phenotype and morphology in most areas of the subcutaneous xenografts showed no such changes, and these areas showed actively growing cells with high rates of mitosis (data not shown).

blank, p = 0.801); and k-ras (Chol-let-7a vs.

Cy5 -labelled Chol-let-7a or Chol-miRCtrl appears as distinct red bodies.

One week after HepG2 cell transplantation, the xenografts (Volume, mm [3]) of the Chol-let-7a group (8.2854 ± 2.122593) were slightly larger than those of the 2 control groups (Chol-miRCtrl, 7.8614 ± 1.69912; blank, 7.0574 ± 1.340323), while the xenografts of the Chol-let-7a -treated group (152.1528 ± 38.43266) were significantly smaller than those of the 2 control groups (Chol-miRCtrl, 424.3472 ± 60.10395; blank, 380.2284 ± 74.83116) at the culmination of therapy.

Increased autophagocytic activity in HepG2 and SMMC7721 cells was observed 48 h after Chol-let-7a treatment, as revealed by the presence of abundant lysosomes and phagolysosomes exhibiting heterolysosomes such as phagophores, multivesicular bodies (MVBs), and multilamellar bodies (MLBs) in the cytoplasm (Figure  3), but only slight changes in nuclear morphology were observed.

T-test for k-ras in SMMC7721: Chol-let-7a vs.

In comparison with the rapid changes in cytoplasmic organelles, nuclear damage was strikingly delayed after Chol-let-7a-treatment (see Additional file 3C).

The figure shows the cytoplasmic ultrastructure of Chol-let-7a -treated cells at 48 h post-transfection.

Apoptotic nuclear changes, such as nuclear shrinkage and nuclear fragmentation, were barely observed in Chol-let-7a -treated cells.

Chol-miRCtrl, p = 0.001; Chol-let-7a vs.

Tumour cells showed no significant atypia, and mitoses were very rare after systemic Chol-let-7a therapy.

Some changes observed in the Chol-let-7a -treated cells were also found in Chol-miRCtrl -treated HCC cells (see Additional file 3A); however, these effects were relatively mild in the negative control cells.

Tumour cells in capillary-rich areas could be more susceptible than other cells to systemically administered Chol-let-7a molecules.

Two cohorts were treated with 5 nmol of Chol-let-7a or the negative control mimic (Chol-miRCtrl) in 250 μL saline buffer (Ribobio, Guangzhou, China) as suggested by the instruction manual.

Chol-let-7a was primarily observed in the cytoplasm and induced organelle changes, including autophagy.

Because of the high affinity of Chol-let-7a for liver tissue in nude mice (data not shown) and the convenience of systemic administration, Chol-let-7a represents a potential useful modified molecule for systemic HCC therapy.

In addition, well-differentiated tumour cells with no significant atypia and only very rare mitoses were observed after Chol-let-7a therapy.

We explored the effects of Chol-let-7a on HCC in vitro and in vivo.

These results verified that Chol-let-7a successfully reached tumour tissues.

Apoptotic nuclear changes such as shrinkage and fragmentation were barely observed in Chol-let-7a -treated cells, including those in which mitochondria, heterolysosomes, and RER were vacuolated and showed irregular and unclear contours and structures.

Therefore, we suggest that autophagy may be an important mechanism through which Chol-let-7a produces antitumor effects [25].

Chol-let-7a and negative control mimics labelled with Cy5 were purchased from Ribobio (Guangzhou, China).

Images of live HCC cells were taken after treatment with Chol-let-7a or the negative control miRNA (Chol-miRCtrl).

T-test: HepG2: Chol-let-7a vs.

Chol-miRCtrl, p = 0.016; Chol-let-7a vs.

blank: Parental HCC cells; Chol-let-7a: Chol-let-7a -treated HCC cells; Chol-miRCtrl: Chol-miRCtrl -treated HCC cells A: HepG2 and SMMC7721 cells from the treatment groups at 48 h post-transfection.

After 24 h of cell culture, cells were transfected with 50 nM Chol-let-7a or Chol-miRCtrl according to manufacturer instructions.

More dead and apoptotic cells were found in the Chol-let-7a -treated cells, but some Chol-miRCtrl -treated cells showed similar morphology.

Thus, it appears that Chol-let-7a affects cell migration and invasion.

The images show more dead or apoptotic cells in Chol-let-7a -treated cells (yellow arrows).

Parental, Chol-let-7a- and Chol-miRCtrl -treated HCC cells were observed under TEM at 48 h and 60 h after treatment.

We confirmed the significantly higher transfection efficiency of cholesterol-conjugated let-7a miRNA mimics (Chol-let-7a) in human HCC cells in vitro.

6

To determine whether any correlation existed between the expression of let-7a and its target proteins in breast cancer cell lines, the expression levels of the predicted let-7a target proteins were examined, such as CCR7, IGF-1R, c- Myc, and CDK4 (Figure 2c).

The results from the present study suggest that targeting of CCL21-CCR7 signaling is a valid approach for breast cancer therapy and that let-7a directly binds to the 3'UTR of CCR7 and blocks its protein expression, thereby suppressing migration and invasion of human breast cancer cells.

Downregulation of let-7a expression was reported in breast cancer [19], and in the present study, the expression was determined with Northern blotting and quantitative RT-PCR analysis (Figure 2a, b).

After siRNA of CCL21 and synthetic anti-let-7a transfections, downregulation of CCL21 and overexpression of CCR7 expression was demonstrated by using RT-PCR and (Figure 5b).

In the present study, we determined that let-7a suppressed breast cancer cell migration and invasion by downregulating CCR7 expression.

In the present study, among the metastasis-related genes as potential targets of let-7a, a reverse correlation between CCR7 and let-7a expression was observed in breast cancer patient tissues and breast cancer cell lines, and let-7a specifically influenced CCR7 downexpression.

In the present study, the authors demonstrated that microRNA (miRNA) let-7a downregulates CCR7 expression and directly influences the migration and invasion of breast cancer cells.

Next, the inhibitory effect of let-7a was determined by using synthetic anti-let-7a oligo-nucleotides in MCF-7 breast cancer cells, which express a high level of let-7a and a low level of CCR7, with a high level of CCL21 expression.

The results provided confirmation that CCR7 expression and the consequent breast cancer cell proliferation and motility are downregulated by let-7a.

Collectively, the results from the present study demonstrate let-7a suppresses metastasis through CCR7 target regulation and may be potentially useful as an antimetastatic agent in breast cancer.

Therefore, we suggest that let-7a reduces breast cancer cell migration and invasion through the downregulation of CCR7 expression.

Based on our data, we can infer that let-7a regulates the translation of CCR7, which is believed to be the most common mechanism of miRNA targeting [27].

The expression of CCR7 and CDK4 was downregulated by let-7a more than that of IGF-1R and c- Myc.

Let-7a was also found to target CCR7 3'UTR directly, thereby downregulating breast cancer cell migration and invasion.

Among the target proteins, CCR7 showed a significant reverse correlation with let-7a expression, suggesting that CCR7 could be regulated by let-7a in breast cancer cells.

In seven of 15 breast cancer patients, let-7a expression was more downregulated in malignant tissues than in normal counterpart tissues (Figure 8a).

After CCL21 siRNA and synthetic let-7a transfections, downregulation of both CCL21 and CCR7 expression was shown via RT-PCR and (Figure 5a).

To clarify the role of let-7a in metastasis, potential let-7a target genes were searched, specifically metastasis-related genes, and their protein expression was examined after synthetic let-7a treatment.

Next, the anti-let-7a effect was also confirmed through the transfection of CCL21 siRNA and synthetic anti-let-7a in MCF-7 cell lines with a high expression of CCL21 and low expression of CCR7 (Figure 5b and 5d).

Figure 3 Detection of changes in the expression of let-7a predicted target proteins and cell proliferation, cell migration, and invasion of MDA-MB-231 breast cancer cells after transfection with synthetic let-7a.

The results suggest that CCR7 silencing has an inhibitory effect on breast cancer cell proliferation, migration, and invasion, and overexpression of let-7a has the same effect as CCR7 silencing.

The 3'UTR of CCR7 was confirmed as a direct target of let-7a by using the luciferase assay for the reporter gene expressing let-7a CCR7 3'UTR binding sites.

To confirm the fact that 3'UTR of CCR7 is a direct target of let-7a, a luciferase assay for the reporter gene expressing the let-7a binding sites of CCR7 3'UTR was used.

The result suggests that let-7a directly regulates CCR7 protein expression through interaction with the 3'UTR of CCR7.

Overexpression of let-7a decreases CCR7 expression as well as cell proliferation, invasion, and migration in MDA-MB-231 breast cancer cells.

Synthetic let-7a was transfected into MDA-MB-231 cells, which express low levels of let-7a, and the change in the expression level of predicted CCR7 target proteins (Figure 3a) was evaluated.

In contrast, silencing (inhibition) of let-7a resulted in increases in CCR7 expression, cell migration, and cell invasion in MCF-7 breast cancer cells, consistent with the results of CCR7 silencing by its specific siRNA.

We observed decreasing MDA-MB-231 cell migration and invasion when CCR7 expression was inhibited by synthetic let-7a.

Therefore, we suggest that targeting of CCL21-CCR7 signaling is a convincing approach for improving breast cancer therapy and the usefulness of let-7a as a direct regulator of this signaling.

Through the previously mentioned studies, we focused on the interrelation of the two agents, let-7a and CCR7, in search of promising molecular targets to inhibit metastasis and for potential antimetastatic agents for possible use in breast cancer therapy.

Let-7a directly regulates CCR7 expression by binding with the 3'UTR of CCR7.

The data showed the 3'UTR of CCR7 was a direct target of let-7a.

These experiments showed that let-7a regulates CCR7 and cell motility, dependent on CCL21 expressions.

Downregulation of let-7a increases cell invasion, migration, and proliferation in MCF-7 breast cancer cells.

Downregulation of let-7a was found in highly metastatic human breast cancer patient tissues [19], and in human breast cancer cells, such as MDA-MB-231 cells.

Let-7a was found to act as a tumor suppressor directly regulating RAS and HMGA2 oncogenes by interacting with the 3'UTR [11- 13].

Reverse correlation between the expression of let-7a and CCR7 in breast cancer cell lines.

First, the let-7a binding site on CCR7 3'UTR was predicted by using the TargetScan microRNA -binding prediction program (Figure 6a).

Within the let-7 family, let-7a expression increases after differentiation and in mature tissue, but is barely detectable in the embryonic stage [10].

Synthetic let-7a decreased breast cancer cell proliferation, migration, and invasion, as well as CCR7 protein expression in MDA-MB-231 cells.

Let-7a targeting of CCR7 3'UTR was confirmed by using a luciferase reporter gene carrying the 3'UTR of CCR7 wild-type or a mutant type of the let-7a binding site.

In addition, the strong association between the loss of let-7a expression and metastatic relapse suggests the potential of let-7a in prognostic stratification of breast cancer patients in addition to conventional clinical and pathologic staging markers.

Notably, a reverse correlation between levels of let-7a and CCR7 expression was found in both human breast cancer patient tissues and in cancer cell lines.

Figure 2Detection of basal expression levels of CCR7, IGF-1R, c- Myc, CDK-4, and let-7a in seven breast cancer cell lines.

Figure 8 Analysis of let-7a and CCR7 expression in tissues from 15 breast cancer patients (five infiltrating ductal cancers (P1, P3, P11-13), one metaplastic cancer matrix-producing type (P2), seven invasive ductal cancers (P4-10), one infiltrating cribriform cancer (P14), and one atypical medullary cancer (P15)] (Table 1).

Reverse correlation between the expression of CCR7 and let-7a in breast cancer patients.

Collectively, the data suggest that the zebrafish embryo mo del can be used to monitor the migration of breast cancer cells in a living animal, and let-7a overexpression or CCR7 silencing could cause a significant reduction in breast cancer cell migration in vivo.

Comparatively, high and low let-7a expression was detected in MCF-7 and JIMT-1 cells and in MDA-MB-231 cells, respectively.

The expression of CCR7, its ligand CCL21, and let-7a was detected in breast cancer cell lines and in breast cancer patient tissues.

In addition, a reverse correlation in the expression of CCR7 and let-7a in breast cancer cell lines and breast cancer patient tissues was detected.

Reduced levels of let-7a correlate with elevated RAS expression in lung squamous carcinoma [11].

First, CCL21-specific siRNA and synthetic let-7a were transfected into MDA-MB-231 cell lines expressing high levels of both CCL21 and CCR7 (Figure 5a and 5c).

After transfection with synthetic anti-let-7a, the level of CCR7 expression increased (Figure 4a).

The let-7a inhibitor reversed the let-7a effects on the MCF-7 cells.

In addition, the effect of cell migration and invasion activity was confirmed through the cell migration and invasion assay, indicating that let-7a decreased MDA-MB-231 cell migration and invasion activity, dependent on CCR7 and CCL21 expression (Figure 5c).

Synthetic let-7a and an inhibitor of let-7a were transfected into MDA-MB-231 and MCF-7 breast cancer cells, respectively, and cell proliferation, cell migration, and invasion assays were performed.

Additionally, the effect of cell migration and invasion activity was confirmed by the cell migration and invasion assays, showing anti-let-7a increased MCF-7 cell migration and invasion activity, dependent on CCR7 and CCL21 expression (Figure 5d).

Figure 6 Direct interaction between let-7a and 3'UTR of CCR7.

The cell lines were transfected with synthetic let-7a, CCR7 siRNA, anti-let-7a, and scRNA for 1 day and then transferred to the upper chamber of the Transwell coated with 0.5 mg/ml collagen type I (BD Bioscience) and a 1:15 dilution of Matrigel (BD Bioscience).

The studies showed that synthetic let-7a- or CCR7 siRNA -transfected cells exhibit reduced cell migration.

An in vivo invasion animal mo del system using transparent zebrafish embryos was also established to determine the let-7a effect on breast cancer cell invasion.

The luciferase reporter constructs were generated by introducing the CCR7 3'UTR carrying a let-7a binding site into the pGL3 control vector (Promega).

Notably, when analyzing in vivo invasion, MDA-MB 231 cells after synthetic let-7a transfection were unable to invade the vessels in zebrafish embryos.

Recent studies have shown that both let-7a and CCR7 influence cell proliferation, as well as cancer cell invasion and migration [5, 14, 20].

Let-7a regulation of cell migration and invasion is dependent on CCR7 and its ligand CCL21.

Transfection of synthetic let-7a decreases in vivo breast cancer cell invasion in zebrafish embryo animal mo delsTo analyze the in vivo effect of let-7a on cancer cell migration, zebrafish embryos having green fluorescent protein (GFP)-labeled blood vessels were prepared as an animal mo del.

The results showed that only the let-7 family binds CCR7 3'UTR.

Last, by using zebrafish embryo mo dels, confirmation of the let-7a effects observed in vitro was obtained in vivo.

Synthetic let-7a transfection had greater luciferase activity in the CCR7 3'UTR WT construct than in the CCR7 3'UTR MUT construct.

HEK-293 cells were transfected with each of the plasmids (empty vector (EV), CCR7 3'UTR WT and CCR7 3'UTR MUT, as a let-7a binding site) together with synthetic let-7a oligonucleotides and negative control RNA in six-well plates.

To elucidate the role of let-7a in CCR7 protein expression, the CCR7 3'UTR was prepared in the pGL3 control luciferase vector, and luciferase activity was evaluated after transfecting with synthetic let-7a (Figure 6).

The let-7 family has multiple functions.

Let-7 was the first identified miRNA originally isolated from Caenorhabditis elegans.

Red fluorescent protein (RFP)-labeled MDA-MB-231 cells were transfected with synthetic let-7a or CCR7 siRNA and injected into the abdomens of the zebrafish embryos.

The dsRNA used in transfection experiments as a scrambled siRNA (scRNA) was 5'-UCACAACCUCCUAGAAAGAGUAGA-3', synthetic let-7a: 5'-UGAGGUAGUAGGUUGUAUAGUU-3', CCL21 siRNA: 5'- GUACAGCCAAAGGAAGAUUUU-3', and CCR7 siRNA: 5'- GCTGGTCGTGTTGA CCTAT-3'.

The oligonucleotide probes used were 5'-AACTATACAA CCTACTACCTCA-3' with a sequence complementary to the mature let-7a RNA.

According to the results, a small reduction in cell proliferation was detected by silencing CCR7 with both synthetic let-7a and CCR7 siRNA in transfected MDA-MB-231 cells.

Approximately 30% of control breast cancer cells were able to migrate out from the embryo abdomen, but none of the synthetic let-7a or CCR7 siRNA -transfected cells could do so.

Additionally, the relation between let-7a and the CCL21-CCR7 signaling pathway was confirmed.

Moreover, both synthetic let-7a and CCR7 siRNA reduced cell invasion and migration by less than half of the reduction resulting from transfection with scRNA (Figure 3d, e).

Furthermore, the present study underscores the therapeutic potential of let-7a as an antitumor and antimetastatic manager in breast cancer patients.

After transfection with scRNA or synthetic let-7a, the luciferase activity was analyzed (Figure 6b).

Normal MDA-MB-231 cells have the ability to migrate out into the vessel and move toward the tail, whereas cells in which CCR7 is silenced with synthetic let-7a or CCR7 siRNA lose this ability.

As expected, transfection with anti-let-7a increased cell proliferation, invasion, and migration (Figure 4b-d).

To analyze the in vivo effect of let-7a on cancer cell migration, zebrafish embryos having green fluorescent protein (GFP)-labeled blood vessels were prepared as an animal mo del.

Next, the wild-type (WT) constructs containing let-7a binding CCR7 3'UTR and mutant type (MUT) constructs were prepared, in which the binding site was deleted.

When using scRNA -transfected cells, breast cancer cell migration was observed in nine of 21 zebrafish embryos, and no cell migration was observed in embryos by using synthetic let-7a or CCR7 siRNA -transfected cells.

However, the mechanism of let-7a action on metastasis-related genes is poorly understood.

Transfection of synthetic let-7a decreases in vivo breast cancer cell invasion in zebrafish embryo animal mo dels.

In addition, commercial anti-let-7a oligonucleotide was purchased from Panagene in Korea.

To confirm the results, MDA-MB-231 cells were transfected with synthetic let-7a or CCR7 siRNA as a CCR7-silencing positive control (Figure 3b).

Figure 5 Let-7a regulates cell migration and invasion of MDA-MB-231 and MCF-7 cell lines, dependent on CCR-7-CCL21 signaling.

The effects of let-7a and CCR7 siRNA silencing on breast cancer cell migration in vivo were also confirmed by using a zebrafish embryo mo del.

MDA-MB-231 and MCF-7 cells were plated in 96-well culture plates (3 × 10 [3 ]per well), followed by transfection of synthetic let-7a, CCR7 siRNA, anti-let-7a, and scRNA.

However, synthetic let-7a or CCR7 siRNA -transfected cells were not detected in the trunk or tail vessels of the zebrafish embryos.

7

Moreover, despite the ability of EWS-FLI-1 to directly induce expression of c-Myc, a known regulator of let-7 expression, recent evidence suggests that let-7a may also constitute a direct EWS-FLI-1 target gene [27], further supporting possible involvement of let-7a in ESFT development.

To gain insight into the mechanism whereby let-7a over -expression inhibits ESFT growth, expression levels of a panel of established let-7a target genes known to display oncogenic properties, including HMGA2, IGF2BP1, c- MYC and LIN28B, were assessed by Real-Time PCR in empty-vector infected and let-7a-transduced A673 and TC252 cells (Figure 3D).

Taken together, our observations have identified a miRNA expression signature that characterizes ESFT and that participates in ESFT pathogenesis, including the miRNA tumor suppressor family let-7. We have also shown that EWS-FLI-1 directly binds to the let-7a promoter, repressing its transcriptional activity, and that reduced let-7a expression is implicated in ESFT development through HMGA2 regulation.

The discrepancy between the lack of any significant effect of let-7a expression on proliferation and its potent inhibition of tumor growth is not surprising, as decreased stemness coupled to reduced tumor initiating potential that should result from let7a expression may be independent of cell division.

To confirm that expression of HMGA2 was altered in let-7a expressing cell-derived tumors we assessed its expression by immunohistochemical staining in ESFT cell line-derived tumors.

To verify that the reduction of tumor growth associated with let-7a expression was HMGA2 -dependent, we performed a rescue experiment where the cDNA encoding HMGA2 lacking its endogenous 3′ UTR was expressed in A673 and TC252 cells prior to their infection with the let-7a -expressing retrovirus.

Consistent with the notion that HMGA2 is a target of let-7a expression of HMGA2 was decreased in tumors derived from let-7a expressing ESFT cells (Figure S2A).

Expression of the let-7 family is also known to be tightly regulated at the post-transcriptional level by LIN28, a direct let-7 target gene [28], [29], [30].

To determine whether the reduction in tumor growth displayed by let-7a -expressing tumor cells may be at least in part mediated by the concomitant decrease in HMGA2 expression, we used an shRNA approach to deplete HMGA2 expression in A673 and TC252 cells.

D) Real-Time PCR analysis of let-7a target genes HMGA2, IGF2BP1, c-MYC and LIN28B expression in mock-infected and let-7a -overexpressing A673 and TC252 cells.

Significant reduction in HMGA2, IGF2BP1 and LIN28B expression at both the mRNA and protein levels was observed in both cell lines upon let-7a over -expression, whereas c-MYC expression was mildly affected in TC252 but not A673 cells (Figure 3D, 3E and data not shown).

We show the let-7 family member let-7a to be a direct EWS-FLI-1 target gene, whose in vivo repression promotes ESFT cell tumorigenicity via induction of its target gene HMGA2.

Importantly, however, HMGA2 expression in these cells returned to the pre-infection wild-type baseline level upon let-7a expression, consistent with selective silencing of the endogenous transcripts (Figure 4D and data not shown).

Because of the lack of the 3′ UTR that contains the let-7a binding sites, exogenous cDNA -mediated expression of HMGA2 should remain unaffected by let-7a expression whereas endogenous transcripts should be silenced.

Expression of EWS-FLI-1 resulted in reduction of pri-let-7a-1 and mature let-7a expression (Figure 2B).

To formally demonstrate that the delivered miRNA had been incorporated into the target tumor cells, we assessed the expression of HMGA2 and LIN28B by Real-Time PCR, immunohistochemical staining and and observed a decrease in both transcript and protein levels in let-7a -treated tumors (Figure 5C and Figure S2B).

D) HMGA2 expression in TC252 cells overexpressing let-7a rescues their tumorigenic properties.

Figure S2 HMGA2 and Lin28 expression in let-7a and let-7a-HMGA2 expressing ESFT cells derived tumors.

To determine whether lin28 may also participate in the regulation of let-7 expression in ESFT, we compared the expression levels of LIN28A and LIN28B in MSC, ESFT cell lines and primary tumors.

In ESFT, we have shown that direct EWS-FLI-1 -mediated repression provides a novel regulatory mechanism of let-7a expression.

The observed changes in miRNA expression are consistent with reports that members of the let-7 family are repressed in a broad range of tumors [14], that miRNA-31 is repressed in disseminating and metastatic malignancies [22], [23] and that overexpression of the cluster 17–92 is involved in the tumorigenic phenotype of haematologic malignancies as well as that of a variety of solid tumors [13].

Although all mice developed tumors, even moderate let-7a overexpression resulted in a marked decrease in tumor volume irrespective of their cell line derivation (Figure 3C), consistent with findings in other tumor types, where let-7 expression was reported to delay tumor growth [19].

Let-7a repression and the corresponding upregulation of its target gene HMGA2 provide a new mechanism of sustained ESFT growth.

Given its role as an inhibitor of differentiation [38], let-7a repression may participate in early EWS-FLI-1 -mediated transformation, by enhancing primary cell permissiveness for EWS-FLI-1 expression and function, as well as in subsequent ESFT CSC maintenance.

By contrast, let-7a only expressing cells displayed decreased tumorigenicity that was restored in cells expressing both HMGA2 and let-7a transcripts (Figure 4D and Figure S1D).

To this end, let-7a was overexpressed in the two ESFT cell lines (A673 and TC252) using a retroviral system, which resulted in a 2.5 fold increase in its expression (Figure 3A).

Lower panel: HMGA2 expression in A673 cells overexpressing let-7a rescues their tumorigenic properties.

E) Western Blot analysis showing reduction of HMGA2 and IGF2BP1 expression of in let-7a overexpressing A673 and TC252 cells.

Similar to our discovery that repression of miRNA-145 is directly involved in the emergence of ESFT CSC [8], the observed repression of let-7a may enhance expression of LIN28B, triggering a double negative feed-back loop that reinforces let-7 repression in ESFT and facilitates CSC generation and maintenance.

Real-Time PCR comparison of the pri-let-7a-1 transcript in MSCs, ESFT cell lines and primary ESFT revealed decreased expression in all ESFT cell lines tested as well as in primary ESFT (Figure S1B), supporting the notion that EWS-FLI-1 directly represses let-7a promoter activity in vivo.

Five days following EWS-FLI-1 silencing upregulation of the pri-let-7a-1 transcript as well as mature let-7a was recorded (Figure 2C).

The resulting HMGA2 knock-down efficiency of about 70% was similar to the effect of let-7a overexpression in the same cells, as assessed by Real-Time PCR and Western Blot analysis (Figure 4B).

let-7a is a direct target of EWS-FLI-1..

In the context of the recent report that ESFT CSC express high ALDH levels [41], it is tempting to speculate that let-7a and miRNA-145 repression may play a critical role in EWS-FLI-1 -mediated CSC generation.

The two ESFT cell lines revealed a similar miRNA expression profile, characterized by repression of the entire let-7 family, miRNA-100, miRNA-125b and miRNA-31, and over -expression of the miRNA 17–92 cluster and its paralogs miRNA-106a and miRNA-106b (Figure 1A).

0023592.g003 Figure 3 A) Left: Real-Time PCR analysis of let-7a overexpression in the A673 and TC252 ESFT cell lines.

D) Upper panel: of HMGA2 expression in A673 cells transduced with empty vector, let-7a alone, let-7a and HMGA2 or HMGA2 alone.

B) Real-Time PCR analysis of let-7a expression in A673 -treated or control tumors.

C) let-7a overexpression in A673 (left panel) and TC252 (right panel) tumor cells leads to a significant decrease in their tumorigenicity.

Among the genes that we found to be repressed upon let-7a expression in ESFT cell lines, we focused on HMGA2 because of its recognized role as an oncogene in a variety of human tumors [32].

The let-7a target gene HMGA2 promotes tumorigenicity in ESFT cells.

let-7a overexpression -associated loss of tumorigenicity is HMGA2 -dependent.

Six NOD/SCID mice were then injected subcutaneously with 1×10 [6] or 2×10 [6] let-7a -expressing or empty vector-infected A673 and TC252 cells, respectively, and tumor formation was assessed weekly for four weeks, whereupon the animals were sacrificed.

However, subcutaneous injection of HMGA2 -depleted A673 and TC252 cells into NOD-SCID mice resulted in markedly reduced tumor growth, mimicking the effect of let-7a overexpression (Figure 4C and Figure S1C right).

These observations indicate that direct repression of the let-7a promoter activity exerted by EWS-FLI-1 contributes to ESFT development.

Taken together these results suggest that in ESFT let-7a is subject to a triple repressive regulatory mechanism at both transcriptional and post-transcriptional levels as a result of direct binding of EWS-FLI-1 to its promoter and lin28B-hnRNP A1 -mediated maturation blockade, respectively.

B) Real-Time PCR analysis of pri-let-7a-1 and mature let-7a expression in human pediatric MSC [EWS-FLI-1].

Although low expression of all the let-7 family members was observed in primary ESFT cells and ESFT cell lines compared to MSCs (Figure 1A), we focused our attention on let-7a because its repression has been shown to be directly implicated in the pathogenesis of several cancer types as well as in maintenance of breast cancer CSC [15], [26].

B) Left: Real-Time PCR analysis of let-7 family expression in MSC, A673, TC252, STA-ET-8.2, SK-ES-1 cells and primary ESFT.

A) Immunohistochemical staining of HMGA2 in mock- let-7a and let-7a-HMGA2 expressing ESFT cell lines derived tumors.

Let-7a down-regulation is mediated by several mechanisms including Lin28 -dependent degradation (27–29) and myc -dependent transcriptional repression [37].

Finally, restoration of let-7a expression by an approach as simple as in vivo systemic delivery of synthetic miRNAs may provide the means to control malignancies as aggressive as ESFT.

Heterogeneous expression of HMGA2 and lin28B was observed in let-7a -treated tumors suggesting non uniform distribution of synthetic miRNA within the tumor.

To verify that the observed reduction of tumor growth was the consequence of exogenous miRNA administration we performed Real-Time PCR comparison of let-7a expression between treated and control tumors.

Let-7a target genes relevant to transformation and subsequent tumor development include RAS, MYC, IGF2BP1 and HMGA2.

A) Left: Real-Time PCR analysis of let-7a overexpression in the A673 and TC252 ESFT cell lines.

Let-7a is a direct EWS-FLI-1 target implicated in ESFT cell tumorigenicity.

Our observations indicate that ESFT display concomitant induction of the oncogenic miRNA 17–92 cluster [13] and repression of the entire let-7 tumor suppressor family [14], [15].

Let-7a expression was found to be increased in treated tumors compared to their control counterparts, confirming that the injected synthetic miRNAs had reached the developing tumors (Figure 5B).

LIN28 has recently been shown to be directly involved in the generation and maintenance of ovarian aldehyde dehydrogenase (ALDH) -positive CSC through its ability to block let-7 maturation [40].

A673 and TC252 cells expressing HMGA2 alone, let-7a alone or the combination of the two genes were injected subcutaneously into NOD/SCID mice, and the tumor forming ability of the different cell populations compared to that of their empty vector-infected counterparts.

Because let-7a has been wi dely described as a tumor suppressor miRNA, we investigated its putative role in ESFT development.

B) MTT proliferation assay of mock-infected and let-7a -overexpressing A673 and TC252 cells.

Together with increasing evidence of a pivotal role of let-7 in normal and cancer stem cell differentiation, this observation further supports the notion that the double negative feedback loop between LIN28 and let-7 may regulate the behavior of CSC in vivo.

Members of the let-7 family play a major role in cell differentiation and are considered to act as tumor suppressors by silencing numerous genes that encode oncogenic proteins including HMGA2, insulin-like growth factor 2 -binding protein 1 (IGF2BP1), RAS and c- MYC [24], [25].

0023592.g005 Figure 5 A) Tail vein injection of 30 µg of synthetic let-7a reduces the growth of established ESFT tumors.

C) Real-Time PCR analysis of pri-let-7a-1 and mature let-7a in EWS-FLI-1 -depleted A673.

A673 cells were injected subcutaneously into NOD-SCID mice and let-7a was administered once tumors reached a volume of 60 mm [3].

Synthetic let-7a decreases ESFT growth in vivo.

These observations uncover the important effector role of HMGA2 in ESFT cell tumorigenicity and identify let-7a -mediated repression of HMGA2 as a key mechanism in the reduction of tumor forming capacity by tumor cells upon let-7a restoration.

More importantly, we demonstrate that systemic delivery of synthetic let-7a significantly decreases tumor growth in vivo, providing a potentially potent novel therapeutic option in ESFT.

Our observations demonstrate the feasibility of reducing ESFT growth in vivo by administering relatively low doses of synthetic let-7a.

These observations explain, at least in part, the low let-7a transcript levels observed in Ewing's sarcoma cells.

To further verify the ability of EWS-FLI-1 to repress let-7a at the transcriptional level, we introduced EWS-FLI-1 into human pediatric MSC cultured in serum free medium by retroviral infection as previously described (8).

Systemic let-7a delivery reduces ESFT tumor growth in vivo.

Among induced miRNAs, we found the oncogenic miRNA 17–92 cluster and its paralogs miRNA106a/b, whereas repressed miRNAs included miRNA 100, 125b as well as the entire let-7 family.

Our observations thus far prompted us to assess the effectiveness of administering let-7a to block ESFT growth.

Among the let-7 miRNA family we focused on let-7a because of its reported functional role in diverse cancer types.

Marked reduction of tumor growth in mice treated with synthetic let-7a was observed (Figure 5A).

Lin28 is strongly implicated in the induction and control of pluripotency and binds to the terminal loops of let-7 precursors, thereby blocking their processing to mature forms [30].

let-7a blocks ESFT tumor growth.

A) Tail vein injection of 30 µg of synthetic let-7a reduces the growth of established ESFT tumors.

8

In contrast to let-7a-5p, the expression of the target gene BCL-XL was increased following the inhibition of let-7a-5p expression by FC-99 (p < 0.01) (Figure 6C).

FC-99 elevated let-7a-5p expression levels and inhibited the expression of its target gene BCL-XL.

FC-99 increased the expression of let-7a-5p that inhibited the expression of its target gene BCL-XL.

a: NC -inhibitor, b: let-7a -inhibitor, c: NC -inhibitor+FC-99, d: let-7a -inhibitor+FC-99.

The expression of the genes CD11b and CD14 was decreased at a similar level between the FC-99 and let-7a-5p inhibitor -treated cells and the let-7a-5p inhibitor -treated groups (Figure 7D).

The results of qRT-PCR demonstrated that the expression of let-7a-5p in the CLP group was significantly lower than that in the sham group (p < 0.01), whereas the target gene of let-7a-5p, BCL-XL, exhibited an opposite pattern of expression (p < 0.05).

To further validate that let-7a-5p directly regulates the expression of BCL-XL, a let-7a-5p inhibitor and a negative control (NC) were co -transfected in THP-1 cells with separate vectors.

In addition, the difference in the expression levels of let-7a-5p and BCL-XL between the FC-99 treated control group and the let-7a-5p expression group was significant (p < 0.05); let-7a-5p and BCL-XL exhibited an opposite pattern of expression.

Figure 7All THP-1 monocytes in the following experiments were knocked down using the let-7a inhibitor (50 nM final concentration) for 24 h and were subsequently treated with FC-99 (10 µM) 2 h prior to 24 h incubation with PMA (2.5 ng/mL); NC -inhibitor (50 nM final concentration) was used as a control group.

Consequently, the target gene of let-7a-5p, BCL-XL, which is an anti-apoptotic gene, could be down-regulated by FC-99.

Moreover, in the current study, the expression of let-7a-5p was identified as a biomarker of Gram -negative bacilli sepsis and was significantly downregulated in the peripheral leukocytes of patients with sepsis.

This conclusion was also confirmed using an in vitro mo del of the human monocyte cell line, which revealed that LPS stimulation downregulated the expression of let-7a-5p in THP-1 cells.

In the current study, the expression of let-7a-5p was down-regulated and its efficacy was decreased following the administration of FC-99.

FC-99 induced monocyte apoptosis and inhibition of their differentiation by up-regulation of let-7a-5p.

All THP-1 monocytes in the following experiments were knocked down using the let-7a inhibitor (50 nM final concentration) for 24 h and were subsequently treated with FC-99 (10 µM) 2 h prior to 24 h incubation with PMA (2.5 ng/mL); NC -inhibitor (50 nM final concentration) was used as a control group.

In summary, the increase in the induction of monocyte apoptosis caused by FC-99 may be involved in the regulation of the expression of let-7a-5p and its target gene BCL-XL (P < 0.05) (Figure 6D).

The expression of microRNA-Let7A (let-7a) has been confirmed to be significantly downregulated in gram -negative bacilli uro sepsis patients compared with healthy controls.

FC-99 increased the miRNA expression of let-7a-5p and resulted in the reduction of its target gene, BCL-XL in PMA -treated THP-1 cells (p < 0.05) (Figure 5F).

Moreover, the overexpression of let-7a in acute myelogenous leukemia (AML) cell lines and human hepatocellular carcinoma cells resulted in the induction of apoptosis, leading to the repressed expression of the anti-apoptotic protein BCL-XL both in vitro and in vivo [21, 22].

The expression of let-7a-5p under LPS inflammatory simulation was reduced significantly, whereas the mRNA expression of BCL-XL exhibited an opposite effect following let-7a-5p addition in Mo/Mφ cells (p < 0.05) (Figure 5D).

In addition, the overexpression of let-7a-5p in AML cells led to a reduced expression of BCL-XL and enhanced apoptosis [46].

In order to investigate the effect of FC-99 on let-7a-5p, we knocked down and/or up-regulated the expression of let-7a-5p with RNAi (Figure 6C) and/or let-7a-5p mimic, respectively (Figure 6D).

org/) were used and the analysis indicated that let-7a-5p targeted the sequences in the 3’-UTR of BCL2L1 (BCL-XL) (Figure 5B), which ensured that BCL-XL was a possible target gene of let-7a-5p.

This study demonstrated that the human miRNA let-7a negatively regulated BCL-XL expression in human AML cells, whereas let-7a -overexpressing cells exhibited a higher than 2-fold increase in the induction of apoptosis compared with the control cells [22].

A 1.504 kb 3’-untranslated region (UTR) fragment of BCL-XL containing the putative target site of let-7a-5p was subcloned into the SpeI-SacI sites of the dual luciferase psiCHECK-2 vector (Generay Biotechnology, Shanghai, China).

Thus, we hypothesized that FC-99 plays a role in inhibiting monocyte-to-macrophage differentiation by overexpressing let-7a-5p and promoting the monocyte -induced apoptosis, thereby reducing the release of inflammatory cytokines (Figure 8).

Taken together, the data demonstrated that BCL-XL could be a target gene of miRNA let-7a-5p, and that FC-99 might exert a direct regulation on let-7a-5p under LPS or PMA stimulation in vitro.

qRT-PCR was employed to detect the expression of let-7a-5p and the mRNA levels of its target gene, BCL-XL (F).

Although the roles of let-7a-5p in septic hepatocytes have not yet been fully elucidated, we speculated that the down-regulation of let-7a-5p could cause an aggravation of hepatic inflammation and dysfunction.

FC-99 induced monocyte apoptosis and inhibited their differentiation by up -regulating let-7a-5p.

The upregulated miRNA let-7a-5p was selected for further validation by qRT-PCR.

TargetScan analysis and luciferase assays indicated that the anti-apoptotic protein BCL-XL was targeted by let-7a-5p.

In addition, the target validation was essential in another mononuclear cell line, such as THP-1. The expression levels of let-7a-5p and BCL-XL were reversed compared with the aforementioned treatment conditions (Figure 5D and 5E).

The decline in the differentiation markers, CD11b and CD14, was detected by FACS, and the results indicated that THP-1 macrophages were decreased dramatically in the presence of the let-7a-5p inhibitor and FC-99 compared with the let-7a-5p inhibitor -treated group (p < 0.01) (Figure 7A).

THP-1 cells were pre -treated with FC-99 (10 μM) and/or vehicle 2 h prior to the addition of LPS for another 24 h. The expression levels of let-7a-5p and BCL-XL mRNA were detected by qRT-PCR.

The transfection experiments were conducted for 24 h in THP-1 and subsequently FC-99 was added and incubated with the cells for an additional 24 h. The interference of the expression of let-7a-5p was increased rapidly by FC-99 (p < 0.01).

Consequently, the pattern of expression of let-7a-5p and BCL-XL in vitro was similar to that noted in vivo (P < 0.05) (Figure 6B).

In addition, the expression levels of let-7a-5p and BCL-XL in PMA-untreated THP-1 monocytes (Supplementary Figure 3C) and HL-60 (Supplementary Figure 4C) were analyzed.

let-7a inhibitor group in vitro, & P < 0.05, && P < 0.01, &&& P < 0.005, vs.

This result was further confirmed by in vitro cell experiments, where let-7a-5p expression was silenced, and FC-99 was added in LPS-pre -treated THP-1 cells.

Let-7a has been shown to regulate Toll-like receptor -mediated inflammatory response in sepsis, thereby providing a potential target for the treatment of sepsis [20].

Although the expression of let-7a-5p was increased in THP-1 cells, this effect was enhanced by FC-99 treatment (p < 0.01).

1 × 10 [5] cells/mL were seeded in 6- and/or 12-well plates and transfected with RNA duplexes, 50 nM let-7a-5p miRNA mimic and/or inhibitor (RIBOBIO, Guangzhou, China) by RFect [PM] small nucleic acid transfection reagent (BAIDAI, Changzhou, China).

Moreover, THP-1 cells that were transfected with let-7a-5p mimic and/or inhibitor were subjected to Western blotting (Supplementary Figure 5C) and flow cytometry analyses (Supplementary Figure 5D) in order to assess the effects of let-7a-5p on the induction of apoptosis.

Thus, in the present study, the inhibition of let-7a-5p resulted in significantly increased concentrations of TNF-α, IL-1β, IL-6, and iNOS and decreased hepatic function in mice with sepsis.

Furthermore, the expression levels of let-7a-5p and BCL-XL in CLP mice at various differentiation time points (12, 24, 72 h) were examined (Supplementary Figure 2).

The levels of the corresponding protein expression of BCL-XL were similar to those of let-7a-5p (p < 0.05) (Figure 5G).

In addition, LPS -induced TNF-α and IL-1β secretions were reduced following let-7a-5p overexpression in THP-1 cells [20].

FC-99 treatment reversed the elevated let-7a-5p and BCL-XL expression levels that were caused by CLP application (P < 0.005 in let-7a-5p and P < 0.05 in BCL-XL) (Figure 6A).

[#] P < 0.05; [##] P < 0.01; [###] P < 0.005 vs let-7a-5p -inhibitor group.

The expression of let-7a-5p and BCL-XL in transfected THP-1 cells at 24 and/or 48 h indicated that 24 h was the time point at which the maximum transfection efficiency was noted (Supplementary Figure 5B).

At 24 h post transfection, luciferase activity assays demonstrated that let-7a-5p reduced luciferase activity to 53 ± 7% in the negative control samples, whereas the mutation of the target site abolished the reduction of luciferase activity induced by let-7a-5p (Figure 5C).

The miRNA microarray results indicated that FC-99 treatment caused a high expression of let-7a-5p.

THP-1 cells were transfected with 50 nM let-7a-5p miRNA mimic and/or inhibitor using RFect [PM] small nucleic acid transfection reagent and 800 ng psiCHECK-2 dual-luciferase reporter plasmids.

Moreover, let-7a-5p expression was abrogated upon CLP stimulation in vivo, whereas it was restored by FC-99 treatment.

Figure 6(A) qRT-PCR evaluation of the expression levels of let-7a-5p and its target gene BCL-XL in response to FC-99 (10 mg/k, i. p. ) in the septic liver at 24 h. (B) LPS (100 ng/mL) was applied in order to induce inflammation in vivo.

The expression levels of let-7a-5p and BCL-XL were assessed by qRT-PCR.

As a result, we hypothesized that let-7a-5p could inhibit the monocyte-to-macrophage differentiation during the progression of liver injury.

We found that let-7a-5p had a lower expression in the liver tissues of FC-99 -treated mice compared with control mice.

The direct effect of FC-99 on let-7a-5p in PMA -induced monocyte differentiation was subsequently examined.

The let-7a-in+FC-99 group exhibited a decreased number of macrophages compared with the let-7a -inhibited-group.

The underlying regulatory mechanism of let-7a-5p that contributes to the progression of liver injury was examined by the correlation between let-7a-5p and BCL-XL and their effects on the monocyte-to-macrophage differentiation.

In conclusion, the present study indicates that FC-99 reduced the serum levels of inflammatory factors, the induction of hepatocyte apoptosis, and the infiltration of monocytes in the liver, thereby implying the regulatory roles of FC-99 in monocyte differentiation via let-7a-5p.

The let-7a-5p inhibitor promoted luciferase activity to 35 ± 12% compared with the negative control transfection, while the mutant vector indicated no significant influence on luciferase activity.

LPS was further used (100 ng/mL) to simulate the inflammation [37] induced in the mouse monocyte/macrophage cell line RAW264.7 and to explore the association between let-7a-5p and BCL-XL.

In addition, miRNA let-7a is implicated in the induction of apoptosis [44].

The studies were designed to mimic the induction of inflammation by LPS treatment in order to determine the effect of FC-99 on let-7a-5p in THP-1 monocytes.

FC-99 exhibits potential therapeutic effects on CLP -induced liver dysfunction by restoring let-7a-5p levels.

Following the identification of let-7a-5p as a main miRNA involved in Gram -negative bacilli infection, the 3’-UTR region that corresponds to the wildtype BCL-XL protein was cloned into a luciferase reporter vector in order to explore the binding of let-7a-5p on BCL-XL.

This vector was transfected into THP-1 cells along with the let-7a-5p mimic and/or a negative control (NC).

9

We observed that let-7 miRNA was over expressed in C. elegans mo del of PD expressing wild type ‘human’ alpha-synuclein protein, while its expression was reduced in C. elegans mo del expressing mutant alpha-synuclein.

Our results suggest that loss of function of let-7 miRNA results in significant upregulation of daf-12 and daf-16 gene expression validating the fact that let-7 miRNA controls the expression level of daf-12 and daf-16 mRNA.

In our study, we found that let-7 miRNA silenced worms showed downregulation of ced-4 and jnk-1 while upregulation of lin-45 mRNA.

Thus knocking down of let-7 miRNA protects cell death by reducing the expression level of ced-4 and jnk-1 as well as via maintaining vulval viability by increasing the expression level of lin-45.

Asikainen et al. (2010) reported that let-7 miRNA was downregulated in transgenic strain expressing mutant alpha-synuclein (A53T).

RNAi of Let-7 miRNA Resulted in Upregulation of Downstream Target Genes.

Let-7 miRNA Was Over-expressed in C. elegans Mo del of PDImpaired miRNA expression is known to be associated with the development and progression of neurodegenerative PD (Wong and Nass, 2012).

Let-7 miRNA acts as tumor suppressing miRNA and may well come up as an interesting target for various cancers (Barh et al., 2010).

FIGURE 1Graph depicting relative expression of let-7 miRNA and its targets, studied through real-time PCR (qPCR).

FIGURE 9GFP expression pattern in the unc-17::GFP strain (A: control, B: lct-7 miRNA knockdown) and dat-l::GFP strain (C: control and D: let-7 miRNA knockdown) using fluorescence microscopy.

We found that loss of let-7 miRNA leads to decreased alpha-synuclein expression, increased autophagy, increased Daf-16 expression, increased oxidative stress and increased fat content with no effect on dopaminergic/acetylcholinergic neurons.

FIGURE 4Assay for autophagy marker genes in C. elegans; (A) relative expression of autophagy marker genes studied through real-time PCR after let-7 miRNA silencing (B): Expression pattern of LGG-1::GFP in DA2123 using fluorescence microscope; control (a), let-7 knockdown (b), number of puncta as quantified using ImageJ software (c).

In order to quantify the expression level of let-7 miRNA, we carried out TaqMan based real-time PCR studies for let-7 miRNA in wild type (N2) and alpha-synuclein expressing strain (NL5901) of C. elegans.

Our results also open avenues for further research toward deciphering the importance of let-7 miRNA in the context of various other diseases and may prove to be beneficial target for the treatment of PD in future.

We observed that there was a significant 174% (p < 0.05), and 134% (p < 0.05) upregulation of daf-12 and daf-16, respectively, as compared to control (Figure 1B) that validated the role of let-7 miRNA in the regulation of daf-12 (previously reported; Grosshans et al., 2005) and predicted daf-16 genes (miRBase21) [2].

Knockdown of Let-7 miRNA Influenced the Expression of Autophagy Marker Genes.

Here, we employed transgenic C. elegans strain LX929 (unc-17::GFP; expressing GFP under the influence of the unc-17 promoter specifically in cholinergic neurons) and BZ555 (P dat-1::GFP; expressing GFP under the influence of the dat-1 promoter specifically in the dopaminergic neurons) for assaying the effect of let-7 miRNA silencing on acetylcholinergic and dopaminergic neurons (Pu and Le, 2008; Barbagallo et al., 2010).

We observed no significant effect on expression of GFP either in let-7 miRNA knockdown LX929 or BZ555 strain as compared to their respective controls (Figures 9A– D), suggesting that knockdown of let-7 miRNA has no effect on these neuronal subpopulations.

Expression of alpha-synuclein protein was examined in control and let-7 miRNA knockdown worms of the NL5901 strains as described previously (Jadiya et al., 2012).

Knockdown of Let-7 miRNA Led to Reduced Expression of Alpha-synuclein Protein.

The effect of let-7 miRNA knockdown on acetylcholinergic and dopaminergic neurons was studied via expression of GFP tagged with unc-17 and dat-1 transporter of acetylcholinergic and dopaminergic neurons, respectively.

We observed that knocking down of let-7 miRNA led to increase in lgg-1 and atg-13 whereas it led to decrease in atg-5 and atg-7 expression.

FIGURE 3Alpha-synuclein expression in NL5901 strain of C. elegans (studied through fluorescence microscopy) fed on control (A) and let-7 miRNA knockdown condition (B).

Wishing to delineate the possible role of let-7 in multifactorial aspect of PD, we further examined the effect of let-7 miRNA knockdown on the expression level of genes associated with cell death.

Let-7 miRNA is found to be downregulated in different types of cancer including lung cancer, breast cancer, colon cancer, gastric cancer, and Burkitt’s lymphoma.

Our studies indicate that knockdown of let-7 miRNA protects cells from death by reducing the ced-4 and jnk-1 mRNA expression.

However, some studies have shown that its expression levels were altered in C. elegans mo del of PD (Asikainen et al., 2010), which implies that let-7 miRNA networking pathways may be playing a critical role in PD development.

Mature Let-7 miRNAs Were Downregulated in Let-7 miRNA Silenced Worms.

Let-7 miRNA are also downregulated by pathogenic LRRK2 (Gehrke et al., 2010).

Regulation of let-7 and its target oncogenes (Review).

Target genes of let-7 miRNA are denoted by yellow color.

Our study shows fat content was increased by decreasing the expression of alpha-synuclein in let-7 miRNA silenced worms.

We employed C. elegans mo del of PD, (NL5901) for quantification of the expression level of let-7 miRNA.

daf-12 mRNA acts as a downstream target of let-7 miRNA as reported previously (Hammell et al., 2009).

Our studies further provide evidence that let-7 possibly decreases alpha-synuclein expression via increasing autophagy and increasing daf-16 forkhead box O (FOXO) transcription factor.

Let-7 miRNA Was Over-expressed in C. elegans Mo del of PD.

Our studies further provide a clue toward the role of let-7 miRNA in possibly decreasing alpha-synuclein expression via increasing autophagy and increasing daf-16 FOXO transcription factor.

Our studies suggest that the targets of let-7 miRNA might be involved in autophagy pathway which was increased in the absence of let-7 miRNA.

Toward our studies of exploring the importance of let-7 miRNA in the context of PD, we constructed an RNAi feeding bacterial clone of let-7 miRNA and studied it employing transgenic C. elegans strain expressing human alpha-synuclein.

FIGURE 5Graphical representation of relative mRNA expression of apoptosis pathway genes after let-7 miRNA silencing using qPCR analysis in C. elegans.

Expression of Apoptosis Marker Genes Was Altered in Let-7 miRNA Silenced Worms.

Let-7 miRNA is differentially expressed in alpha-synuclein transgenic animals and human Parkin ortholog pdr-1 mutant animals (Asikainen et al., 2010).

Worms in the control group (NL5901 fed on EV) expressed optimal level of alpha-synuclein protein (Figure 3A), while let-7 miRNA silenced worms showed reduction in the level of alpha-synuclein protein (Figure 3B).

Let-7 miRNA Knockdown Had No Effect on Acetylcholinergic and Dopaminergic Neurons.

According to findings gathered from this tool, let-7 miRNA is involved in pathways of apoptosis, autophagy, cell cycle regulation, glycolysis/gluconeogenesis, MAPK signaling pathway and P13K-Akt signaling pathway (Figure 2).

In order to investigate the role of let-7 miRNA in PD and its associated factors we designed RNAi feeding bacterial clone of let-7 miRNA toward knocking down let-7 miRNA in the nematodes and studied its effect on disease mo del for various endpoints, including investigation of alpha-synuclein protein expression, lipid content, oxidative stress, quantification of autophagy/apoptosis marker genes, dopaminergic neurodegeneration and associated phenotypes.

GFP::LGG-1 was also increased in let-7 knockdown worms that further validate the previous findings.

Let-7 miRNA, by bioinformatics analysis, is known to regulate genes of cell death, autophagy, mTOR and insulin pathway.

Knockdown of let-7 miRNA exhibited no marked effect on motility in wild type strain N2.

For the validation of RNAi mediated inhibition we carried out TaqMan miRNA assay toward quantification of let-7 miRNA levels under untreated and let-7 miRNA silenced conditions.

We observed fluorescence intensity of 3.636 ± 0.3434 relative fluorescence intensity units (RFU) per worm in control group whereas let-7 miRNA knockdown worms exhibited fluorescence intensity of 7.300 ± 0.5500 RFU per worm, thereby displaying 50.19% (p < 0.05) increased ROS level with respect to that of control group (Figure 7).

A feedback circuit involving let-7 -family miRNAs and DAF-12 integrates environmental signals and developmental timing in Caenorhabditis elegans.

daf-12 mRNA is negatively regulated by let-7 miRNA.

Age synchronized control and let-7 knockdown worms were washed twice with 0.2% DEPC (Sigma, Cat.

Role of microRNA Let-7 in modulating multifactorial aspect of neurodegenerative diseases: an overview.

Knockdown of Let-7 miRNA Increases Oxidative Stress.

C. elegans wild type strain N2 {control and let-7 knockdown} (A).

We observed that wild type N2 strain exhibited a mean response time of 1.600 ± 0.2449 s (N = 10) whereas the mean response time of let-7 miRNA knockdown worms was 2.200 ± 0.3742 s (N = 10) (Figure 10A).

The temporal patterning microRNA let-7 regulates several transcription factors at the larval to adult transition in C. elegans.

In our studies, we observed that alpha-synuclein accumulation, and end points associated with PD were decreased in the absence of let-7 miRNA indicating the importance of let-7 miRNA directly with the progression of NDs.

The knockdown of let-7 miRNA decreased the fluorescence intensity of alpha-synuclein::YFP by 2.82-fold (p < 0.001) when compared to control worms; with mean fluorescence intensity for the control group 31.57 ± 0.5497 (N = 10) arbitrary units and that for let-7 miRNA knockdown worms was 11.18 ± 0.2047 (N = 10) arbitrary units (Figure 3C).

Oncogenes that are regulated by let-7 are ras, hgma2, myc, NIRF and JAK-STAT3 pathway molecules (Wang et al., 2012).

Let-7 is an evolutionarily conserved miRNA that has been reported to repress multiple oncogenes by affecting key regulators of the cell cycle, cell differentiation, and apoptotic pathways.

FIGURE 2 The KEGG pathway “FOXO signaling pathway” is regulated by let-7 miRNA.

Let-7 directly regulates oncogenic genes that are involved in signaling pathways in tumor progression.

Our results indicate no direct role of let-7 miRNA on functions associated with dopamine content.

We observed that let-7 miRNA was overexpressed in PD mo del by 75% (p < 0.001) as compared to that of control group (Figure 1A).

We studied the effect of let-7 miRNA knockdown on the alteration of ROS level.

let-7 sequence (C05G5.6); tacactgtggatccggtgaggtagtaggttgtatagtttggaatattaccaccggtgaactatgcaattttctaccttaccggagacagaactcttcga.

Silencing of Let-7 miRNA.

The effect of let-7 miRNA silencing on fat content in nematodes was studied by staining worms with Nile red (MP Biomedicals cat no.

In order to understand the effect of let-7 miRNA knockdown on normal locomotory behavior we employed thrashing assay to quantify motility in the worms.

This provides a clue toward protective role of let-7 miRNA in cell death.

Let-7 miRNA is 22 nt long non-coding RNA, which was first discovered in C. elegans.

Pathway Analysis of Let-7 miRNA.

There is very little that is known about the role of let-7 miRNA in the progression of PD.

We observed that let-7 miRNA was reduced by 46% (p < 0.05) in let-7 miRNA silenced worms as shown in Figure 1B.

It suggests that loss of let-7 miRNA function does not have any effect on dopamine synthesis or overall availability.

C. elegans homolog of amyloid precursor protein apl-1 is also reported to be controlled by let-7 miRNA (Yokota et al., 2003; Revuelta et al., 2008).

-D5758) was used to remove adhering bacteria from age synchronized N2 and let-7 silenced groups.

Let-7 miRNA Silenced Worms Exhibited Enhanced Motor Function in Transgenic Strain NL5901.

This suggests that absence of let-7 miRNA might help in maintaining lipid content in worms.

Nile red was mixed with control (EV)/let-7 miRNA RNAi clone and seeded onto NGM-IPTG plates followed the protocol as described previously (Ashrafi et al., 2003).

Our study leads to an understanding of the role of C. elegans let-7 miRNA in progression of PD and confirms that absence of let-7 miRNA leads to decrease in accumulation of alpha-synuclein protein in transgenic worms.

These results suggest that absence of let-7 miRNA exerts its effects via atg-5/atg-7 independent alternative pathway for clearance of misfolded aggregated proteins.

Worms of control and let-7 miRNA silenced groups were washed thrice with M9 buffer and twice with phosphate buffer saline (PBS).

In this study, control and let-7 miRNA silenced worms were washed with M9 buffer to remove any adhering bacteria.

We carried out quantitative real-time PCR of some of previously reported genes of cell death (Cecconi et al., 1998; Kuan et al., 1999; Hayakawa et al., 2011; Rutkowski et al., 2011; Jiang and Wu, 2014) under control and let-7 miRNA silenced condition.

In contrast transgenic strain NL5901 displayed mean response time of 2.600 ± 0.5099 s (N = 10) and silencing of let-7 miRNA in this strain resulted in a mean response time of 2.000 ± 0.4472 s (N = 10) (Figure 10B).

Our findings indicate that mRNA levels of lgg-1 and atg-13 were increased in let-7 silenced worms.

Our finding indicates that loss of let-7 miRNA might play protective role in C. elegans.

FIGURE 7ROS production levels as estimated by H [2]DCFDA assay in wild type strain N2 (control and let-7 knockdown condition).

Therefore, silencing of let-7 miRNA might be protecting the dopaminergic neurons via decreasing the accumulation of alpha-synuclein.

Our findings indicate that absence of let-7 miRNA has no effect on these neurons.

Let-7 miRNA Silenced Worms Displayed Enhanced Fat Content.

Our studies showed enhanced motility which suggests let-7 miRNA may have role in excitatory neurotransmission.

let-7 sequence (C05G5.6); tacactgtggatccggtgaggtagtaggttgtatagtttggaatattaccaccggtgaactatgcaattttctaccttaccggagacagaactcttcga.

To assess the effect of let-7 knockdown on dopamine function, we employed the odor -based repellent assay using 1-nonanol for various conditions.

MicroRNA let-7: an emerging next-generation cancer therapeutic.

However, motility was significantly increased after knockdown of let-7 miRNA in NL5901 strain as compared to that of N2 and NL5901.

GFP::LGG-1 Was Increased in Let-7 miRNA Silenced Condition.

Thus absence of let-7 miRNA might help in the reduction of alpha-synuclein protein aggregates in C. elegans mo del and enhancing life span.

Our studies prove that loss of let-7 miRNA did not affect the dopaminergic and acetylcholinergic neurons.

Keeping this in mind we created RNAi feeding bacterial clone for let-7 miRNA in order to decipher its function.

We carried out quantitative real-time PCR studies toward quantification of the mRNA levels of daf-12 and daf-16 in worms of control and let-7 miRNA silenced groups.

The mean punctae for the let-7 miRNA silenced worms was 57.67 ± 1.453 (N = 5) whereas it was 43.00 ± 3.215 (N = 5) for the control group (Figure 4B).

Hence, we studied ROS in the worms at the basal level and after silencing of let-7 miRNA.

So, we next examined the effect of let-7 miRNA silencing on programmed cell death associated genes.

Silencing let-7 in NL5901 transgenic strain led to decreased accumulation of alpha-synuclein.

Silencing of let-7 miRNA leads to elevated ROS level and mild increase in ROS level acts as inducer of autophagy pathway.

FIGURE 8Nile red staining for fat content in C. elegans from control (A), let-7 miRNA silenced group (B), and graphical representation for fluorescence intensity of the worms as quantified using ImageJ software (C).

To explore the function of let-7 miRNA in autophagy mediated neuroprotection, we studied known autophagy marker genes (Yue et al., 2009) and quantified their mRNA levels using quantitative real-time PCR (qPCR) in normal and let-7 miRNA silenced condition.

In brief let-7 miRNA gene sequence was retrieved from WormBase (sequence number C05G5.6).

Molecular basis for interaction of let-7 microRNAs with Lin28.

Our study provides understanding of the role of miRNA let-7 in PD and confirms that absence of let-7 miRNA leads to decrease in accumulation of alpha-synuclein protein in transgenic C. elegans.

Dopamine Associated Function Is Not Affected under Let-7 miRNA Silencing.

Employing H [2]DCFDA assay we checked ROS level in control and let-7 miRNA knockdown groups.

It is highly conserved across animal species and the let-7 family consists of 9, 14, and 13 members in C. elegans, mouse and humans, respectively (Shamsuzzama et al., 2016).

10

We picked six genes upregulated more than twofold and are GLD-1 or predicted let-7 targets (red and blue spots above the twofold line) and three genes upregulated more than 1.2-fold that are GLD-1 and predicted let-7 targets (purple spots above the 1.2-fold line).

When we tested some of the upregulated proteins for suppression of the vulva-bursting phenotype associated with the gld-1(op236) ; let-7 (mg279) ; [let-7 sponge] strain, we detected a strong suppression with the RNAi -mediated knockdown of cdl-1 gene.

Conversely, reduced expression (60.5%; n = 114) in gld-1(op236) /gld-1(q485) ; let-7(mg279) strains indicates that the phenotype is due to a mutation of gld-1. Figure 3. gld-1 affects the let-7 regulated hypodermal development (a) Simplified diagram of the let-7 pathway leading to col-19 expression.

Among them GLD-1 targets [55, 56] are coloured blue, mirWIP database let-7 target predictions [57] are coloured red, and the possible GLD-1 and let-7 co-targets based on these lists are coloured purple.

Even though these phenotypes might be unspecific, as we do not know whether GLD-1 is expressed in this tissue, co -expressing the let-7 sponge partially suppresses these phenotypes.

Interestingly, let-7 and at least one let-7 target, hbl-1, is also reported to have a similar expression pattern [50], although it is not known to what extent let-7 miRNA phenotypes require hypodermal or neuronal expression.

Thus, cdl-1 is a strong candidate to be co-regulated by both let-7 and GLD-1. However, we cannot rule out the possibility that the cdl-1 upregulation is not directly controlled by let-7 or GLD-1 and it may arise owing to secondary effects.

let-7 miRNA levels in wild-type animals are sufficient to regulate both the endogenous targets and also an additional transgene target (let-7 sponge).

Even though these reporter constructs might not exactly represent endogenous GLD-1 expression, together with our genetic results, they suggest somatic roles for gld-1. One of the targets of let-7 miRNA during larval development is the lin-41 mRNA [45].

CDL-1, DNJ-2 and B0303.3 are possible GLD-1 and let-7 targets that are upregulated more than 1.2-fold (arrows).

Overexpressing a lin-41 3′UTR construct acts as a ‘sponge’ to sequester let-7 miRNA and provides a sensitized system to assay GLD-1 activityOne of the targets of let-7 miRNA during larval development is the lin-41 mRNA [45].

Interestingly, only 28% of gld-1(op236) ; let-7(mg279) double-mutant animals have wild-type levels of transgene expression (figure 3 b) and 47% of double-mutant animals do not express col-19::GFP in the hypodermal hyp7 cells (figure 3 d).

However, another likely interpretation of these experiments is that GLD-1 and let-7 act in conjunction to excessively repress target mRNAs possibly in the same pathway, and that reducing the ‘dose’ of let-7 using the sponge alleviates target gene repression.

A transcriptional reporter expressing GFP under the control of the col-19 promoter reveals that both gld-1(op236) and let-7(mg279) single mutants have unaltered col-19::GFP expression (figure 3 b).

Either lack of let-7 or disrupted let-7 function, causes loss of col-19 expression owing to increased LIN-41 expression that leads to reduced LIN-29 activity (figure 3 a) [41].

During the L4 to adult transition, let-7 downregulates lin-41, a TRIM-NHL domain protein that keeps the transcription factor LIN-29 in an inactive state possibly through mRNA regulation as described for mammalian systems [45].

Targeting the [let-7 sponge] which is a col-10::GFP::lin41 3′UTR construct by GFP RNAi lead to a complete suppression of the vulva-bursting phenotype and thus served as a positive control.

cdl-1 is a predicted let-7 miRNA target and it was identified as a GLD-1 target [55– 57].

Similarly, lin-28 and ztf-7 are let-7 miRNA targets [70, 71] and these genes have also been identified as GLD-1 targets [55].

We next expressed gld-1 under the control of the col-10 promoter in the hypodermis to investigate whether such expression of gld-1 might cause any phenotype associated with the loss of let-7 targets.

Expression of a let-7 sponge with a deletion of the 3 let-7 binding sites or expression of the unrelated unc-54 3′UTR did not cause any bursting phenotype in let-7(mg279) and in gld-1(op236) ; let-7(mg279) animals supporting the specificity of the let-7 sponge and the interactions between gld-1 and let-7 miRNA (figure 5 a).

4.4. gld-1(op236) affects let-7 regulation of hypodermal developmentIn order to better understand the extent of genetic interactions between gld-1 and the let-7 miRNA, we focused on the role of let-7 miRNA in hypodermal development.

In addition, we wanted to determine whether GLD-1 and the let-7 miRNA regulate distinct or same targets.

Using stable isotope labelling with amino acids in cell culture (SILAC) -based proteomics, we show that the upregulation of the histone mRNA -binding protein CDL-1 is partially responsible for the genetic interactions between GLD-1 and let-7 miRNA.

The mg279 allele has a promoter mutation that reduces let-7 expression [43].

Either way, we can conclude that CDL-1 upregulation in a let-7 and GLD-1 -dependent manner is in part responsible for the vulva-bursting phenotype.

For instance, moulting defects in let-7 mutants are partly due to mis-regulation of the nuclear hormone receptors nhr-23 and nhr-25 [41], and nhr-23 is a predicted GLD-1 target [55, 56].

The depletion of one of the candidates, namely cdl-1 lead to a reduced vulva-bursting phenotype consistent with the notion that the upregulation of CDL-1 in the gld-1(op236) ; let-7(mg279) background might contribute to the vulva-bursting phenotype.

This finding can be explained by the robustness and redundancy of the let-7 miRNAs and also by the target genes whose mis-regulation is well tolerated.

A dumpy phenotype also occurs following mutation of let-7 targets such as lin-41 [45].

Proteins (239) overlap with 1322 predicted let-7 targets (figure 6 a, coloured in red, mirWIP database [57]).

gld-1(op236) affects let-7 regulation of hypodermal development.

However, the suppression of the vulva-bursting phenotype by CDL-1 RNAi in gld-1(op236) ; let-7(mg279) ; [let-7 sponge] animals is not complete.

We tested whether the depletion of these three proteins suppresses the vulva-bursting phenotype of the gld-1(op236) ; let-7(mg279) ; [let-7 sponge] strain (figure 6 b).

Our results show that gld-1 can genetically interact with the let-7 miRNA family during somatic development when the let-7 miRNA pathway is sensitized through mutations of the let-7 family miRNAs.

Fifty-four proteins are predicted to be both GLD-1 and let-7 targets (figure 6 a, coloured in purple).

Co -expression of the let-7 sponge partially rescues the dumpy and loss of alae phenotypes (figure 5 b–d).

The penetrance of the vulva-bursting phenotype is dramatically enhanced in gld-1(op236) ; let-7(mg279) double mutants expressing the GFP::lin-41–3′ UTR (let-7 sponge) (figure 5 a).

col-19::GFP expression is not affected in gld-1(op236) /+; let-7(mg279) (1.5%; n = 66) again indicating recessiveness of gld-1(op236).

let-7 sponge partially rescues the alae defects in col-10::GLD-1 expressing animals.

However, when the let-7 miRNA levels are limiting, such as in the hypomorphic let-7(mg279) mutants, endogenous targets are not efficiently dealt with when the let-7 sponge is present (figure 5 a).

Thus, by comparing the animals with a weak phenotype (B) to animals with a strong phenotype (C), we aimed to identify proteins whose expression change might be responsible for the bursting through the vulva phenotype and help explain the interaction between gld-1 and the let-7 miRNA.

By using already established tools, we could show that gld-1 affects multiple let-7 miRNA regulated pathways (figures  2– 4).

The relative abundance of the majority of suspected GLD-1 and let-7 co-targets do not change when the C/A ratios are compared with the B/A ratios.

Based on these results, we cannot exclude the possibility that gld-1 and let-7 miRNA function in parallel pathways during the hypodermal development.

To determine whether a germline is required for seam cell fusion defects in gld-1(op236) and gld-1(op236) ; let-7(mg279) animals, we used RNAi to inactivate glp-1, which is essential for germline development [49].

gld-1(q485) null/gld-1(op236) ; let-7(mg279) and gld-1(q485) null; let-7(mg279) double-mutant worms show supernumerary moulting phenotypes confirming that the synthetic phenotypes are really caused by mutations of the gld-1 gene.

Hypodermal defects in gld-1(op236) ; let-7(mg279) could be the result of mis-regulation of lin-41 mRNA.

let-7-related phenotypes arise much later during development, making a mechanism involving the maternal contribution of miRNAs unlikely.

Our results suggest that GLD-1 and let-7 synergistically affect animal development.

Overexpressing a lin-41 3′UTR construct acts as a ‘sponge’ to sequester let-7 miRNA and provides a sensitized system to assay GLD-1 activity.

SILAC in nematodes identifies proteome wide changes in gld-1 and let-7 mutantsOur results suggest that GLD-1 and let-7 synergistically affect animal development.

We indeed found that gld-1 enhances multiple let-7 and mir-35 family miRNA phenotypes affecting somatic development.

In order to better understand the extent of genetic interactions between gld-1 and the let-7 miRNA, we focused on the role of let-7 miRNA in hypodermal development.

To check whether the genetic interactions of gld-1 with the let-7 miRNA family are restricted to the hypodermal development, we looked into the let-60/RAS pathway that functions during vulva formation [48].

In summary, our combined data suggest that gld-1 affects hypodermal development in let-7 mutant background, either by acting through let-7 or through a parallel pathway.

As the animals expressing let-7 sponge alone do not display any phenotype, we considered them as the baseline similar to using wild-type.

GLD-1 affects let-60 signallingTo check whether the genetic interactions of gld-1 with the let-7 miRNA family are restricted to the hypodermal development, we looked into the let-60/RAS pathway that functions during vulva formation [48].

ain-1 and ain-2 RNAi induced the vulva-bursting phenotype only in the sensitive let-7(mg279) ; let-7 sponge animals.

The let-7 family (let-7, mir-48, mir-84, mir-241 and mir-795) miRNAs are much more studied compared with mir-35 family miRNAs during C. elegans development.

Strong ectopic junctions (arrow heads), weak ectopic junctions (small, thin arrows) and lack of junctions (not shown) are observed in gld-1(op236), let-7(mg279) and gld-1(op236) ; let-7(mg279) worms (right hand panel).

gld-1 genetically interacts with let-7 family miRNAs.

Depletion of cgh-1 enhances the defects of let-7 family mutants and CGH-1 biochemically interacts with ALG-1, AIN-1 and NHL-2 [5].

We thank Gary Ruvkun for sharing the let-7(mg279) strain, Rafal Ciosk for supporting J. E. W., and the Caenorhabditis Genetics Centre for supplying most of the parental strains.

Our let-7 sponge system confirms the notion that the miRNA pathways are highly redundant.

Furthermore, we observed that let-7 phenotypes are enhanced by gld-1 even when glp-1 RNAi animals lacking a germline were analysed.

The strongest genetic interaction between gld-1 and let-7 occurs in the let-7 sponge system (figure 5 a).

We did not observe such a phenotype in gld-1(op236) and in the hypomorphic let-7(mg279) single mutant, but to our surprise, this phenotype occurred in 84% of gld-1(op236) ; let-7(mg279) double mutants (figure 2 b and electronic supplementary material, movie S1).

Thus, gld-1(op236) specifically enhances the let-7 -dependent phenotypes, and the extent of genetic interactions between gld-1 and the let-7 miRNA pathway becomes more evident when the let-7 miRNA pathway is further compromised.

Owing to the sterility of gld-1(null) animals, gld-1(null) ; let-7(mg279) phenotype is determined by slow movement and lack of pharyngeal activity during L4 to young adult transition.

We have shown that the GLD-1 interactors CGH-1 and PAB-1 affect let-7 miRNA function (figure 7).

However, let-7(mg279) mutants showed a low penetrance bursting through the vulva phenotype reminiscent to let-7(null) phenotype (figure 5 a).

Forty-two per cent (n = 43) of mir-48 mir-241; mir-84 triple mutants die owing to a burst vulva during the L4 to adult transition reminiscent to the let-7(null) phenotype [44].

mir-84 and let-7 antagonize let-60/RAS signalling in vulval precursor cells that are not destined to form the vulva.

A supernumerary fifth moult has been described in let-7(mg279) ; mir-84(tm1304) double mutants [41], during which adult animals cease to move and stop pharyngeal activity.

However, it is unlikely that such a mo del can explain the genetic interactions we observed between gld-1 and let-7 family miRNAs.

For the SILAC experiment synchronized L1 larvae of three strains, namely (A) [let-7 sponge], (B) let-7(mg279); [let-7 sponge] and (C) gld-1(op236) ; let-7(mg279) ; [let-7 sponge] were grown up to the young-adult stage until the bursting phenotype just becomes visible and subjected to quantitative mass spectrometry (figure 6 a).

In a recent study, one of the C. elegans poly(A) binding proteins, PABP-2, was shown to antagonize let-7 miRNA function [73].

Figure 5. A let-7 sponge transgene generates a sensitive system to test miRNA function.

Analysis of differential interference contrast (DIC) images and the AJM-1::GFP junction marker indicate defects in alae formation and seam cell fusions in gld-1(op236), let-7(mg279) and gld-1(op236) ; let-7(mg279) animals (figure 3 e).

The timing of seam cell fusion and alae formation is controlled by let-7 family miRNAs [43].

Importantly, we generated a sensitized system using a let-7 sponge and showed that gld-1(op236) specifically enhances let-7 loss-of-function phenotypes (figure 5).

Indeed, cdl-1 3′UTR harbours a GLD-1 and a let-7 binding site (electronic supplementary material, figure S7).

Blots were probed with labelled let-7 RNA and U6 snRNA DNA oligonucleotides as previously described [33].

We identified a similar rise in GFP levels in SILAC experiments, and the level of GFP was further increased in gld-1(op236) ; let-7(mg279) ; let-7 sponge animals (C to A; electronic supplementary material, figure S5 b).

As previously observed for let-7(mg279) ; mir-84(tm1304) double mutants [41], gld-1(op236) ; let-7(mg279) animals with only partially shed cuticles can be observed (figure 2 c).

gld-1(op236) did not affect levels of mature let-7 miRNA, thereby ruling out the possibility that GLD-1 has an essential, non-redundant role in miRNA processing (see electronic supplementary material, figure S2).

Among the GLD-1 interactors besides alg-1 RNAi, cgh-1 and pab-1 RNAi also induced a strong vulva-bursting phenotype in the let-7(mg279) ; let-7 sponge animals, supporting their role in miRNA function.

We next quantified the extent of seam cell fusion defects and found that the incidence of seam cell fusion defects is higher in gld-1(op236) ; let-7(mg279) double-mutant animals than in single mutants (figure 3 c).

Only in this ‘very sensitive’ situation, a role for gld-1 in the let-7 miRNA pathway becomes apparent.

Figure 6. SILAC -based proteomics in let-7 and gld-1 mutants.

Bursting dramatically increases in gld-1(op236) ; let-7(mg279); [let-7 sponge] animals (error bars = s. e. m. ).

One of the phenotypes in let-7 mutants relates to moulting [41].

Heterozygous gld-1(op236) /+; let-7(mg279) animals have wild-type appearance (figure 2 b) consistent with gld-1(op236) behaving as a recessive allele.

We likened this observation to a sponge-like effect of the GFP::lin-41–3′ UTR towards let-7 miRNA.

Using lin-41 3′UTR with deleted let-7 binding sites ([Δlet-7sponge]) or [unc-54 3′UTR] in the sponge construct doesn't cause any phenotypes.

As expected, alg-1 RNAi induces a strong vulva-bursting phenotype in both let-7 sponge and let-7(mg279) ; let-7 sponge animals (figure 7 b).

In our study, we show that PAB-1 is required for proper let-7 function and this is in line with the interactions between PAB-1 and AIN-1 [63].

gld-1(op236) m+ z-; let-7(mg279) (m, maternal genotype; z, zygotic genotype) animals have a comparable phenotype with gld-1(op236) m- z-; let-7(mg279) animals (figure 2 b), showing that maternal contribution of gld-1 does not affect the supernumerary moulting phenotype.

let-7 sponge partially rescues the dumpy phenotype and the short size of the animals are rescued to wild-type levels.

This further supports the involvement of gld-1 either in the let-7 pathway or in a parallel pathway.

SILAC in nematodes identifies proteome wide changes in gld-1 and let-7 mutants.

Figure 2. gld-1 genetically interacts with mir-35 and let-7 family miRNAs.

11

Let-7 Down-Regulation and HMGA2 Up-Regulation Are Associated with a Stem Cell Signature in Intestinal Cancers in Humans and Lin28b [Lo]/ Let7 [IEC- KO] MiceTo extrapolate relevance to human CRC from these mouse mo dels, we examined expression data from human samples from The Cancer Genome Atlas (TCGA) [35] by querying for expression of Let-7 target mRNAs, with a focus on targets that exhibited significant up-regulation in either Vil-Lin28b [Med] or Lin28b [Lo]/ Let7 [IEC- KO] mouse mo dels (namely, ARID3A, PLAGL2, HMGA1, HMGA2, MYCN, IGF2BP1, IGF2BP2, and E2F5).

To extrapolate relevance to human CRC from these mouse mo dels, we examined expression data from human samples from The Cancer Genome Atlas (TCGA) [35] by querying for expression of Let-7 target mRNAs, with a focus on targets that exhibited significant up-regulation in either Vil-Lin28b [Med] or Lin28b [Lo]/ Let7 [IEC- KO] mouse mo dels (namely, ARID3A, PLAGL2, HMGA1, HMGA2, MYCN, IGF2BP1, IGF2BP2, and E2F5).

The critical nature of maintaining sufficient levels of mature Let-7 miRNAs is reflected in the large number of studies that have found LIN28A or LIN28B up-regulated in human cancers, with expression often associated with an aggressive disease phenotype and/or predictive of poor outcomes [12– 15].

K) Comparison of stem cell marker expression and Let-7 target mRNA expression levels in WT jejunum, Lin28b [Lo] /Let7 [IEC- KO] jejunum, and Lin28b [Lo] /Let7 [IEC- KO] tumors by linear regression yielded Pearson correlation coefficients, with Arid3a, Hmga1, and Hmga2 correlating very highly with expression of stem cell markers.

For example, Let-7 regulates insulin-PI3K-mTOR signaling in muscle by inhibiting expression of INSR, IGF1R, and IRS2 [21], yet can also inhibit mTORC1 without affecting insulin-PI3K signaling [22], whereas we have observed no effects on insulin-PI3K-mTOR signaling following depletion of Let-7 miRNAs in the small intestine [18].

Expression analysis was performed by Q-RT-PCR, normalized to Hprt and Actb, with n = 3 mice for each genotype at 12 weeks of age with error bars representing +/–the S. E. M. D) Identification of conserved Let-7 target genes in ten of eleven Let-7 target genes based upon TargetScan.

For examination of Let-7 miRNA expression and expression relative to candidate target genes we examined a cohort of 199 CRC patients from the TCGA Pan-Cancer analysis project visualized using the starbase miRNA CLIP-seq portal (http://starbase.

Expression of all Let-7 targets also correlated significantly between Lin28b [Lo]/ Let7 [IEC- KO] and Vil-Lin28b [Med] intestine crypts, with Hmga2, Igf2bp2, Hif3a, Arid3a, and E2f5 being the most highly induced targets in both mo dels (Fig 2C).

Let-7 Down-Regulation and HMGA2 Up-Regulation Are Associated with a Stem Cell Signature in Intestinal Cancers in Humans and Lin28b [Lo]/ Let7 [IEC- KO] Mice.

Analysis of Let-7 target mRNAs revealed two basic patterns of expression, with one group displaying expression highest in intact tumors or tumoroids/enteroids (Fig 4F).

Many studies have focused on RAS and MYC as cancer-relevant Let-7 targets, although recent high-throughput sequencing (mRNA-seq, miRNA-seq, and CLIP-seq) and meta-analyses indicate that these mRNA targets are not frequently regulated by Let-7, especially in the context of cancer [5, 6, 20, 23].

We found that Let-7a and Let-7b were significantly down-regulated in CRC specimens, while stem cell markers were significantly up-regulated (Fig 5F and 5G).

Identification of Let-7 targets up-regulated specifically in transformed cells from intestinal adenocarcinomas.

Concurrent deletion of the MirLet7c-2/Mirlet7b bi-cistronic cluster is necessary as Lin28b is unable to effectively target and inhibit processing of these specific Let-7 miRNAs [18].

Onco-fetal Let-7 targets such as HMGA2 and IGF2BP1-3 appear to be more frequently up-regulated in multiple contexts, across multiple tissues, and in association with somatic stem cell potential [4, 5, 20, 24– 29].

Dissecting the interaction and possible cooperation of Let-7 target mRNAs is critical for designing strategies to ameliorate the loss of Let-7 in human cancers via combinatorial targeted therapies against multiple oncogenes.

A) Expression of Let-7 target mRNA levels in small intestine crypts isolated from wild-type (WT) and Vil-Lin28b [Med] mice.

1005408.g002 Fig 2A) Expression of Let-7 target mRNA levels in small intestine crypts isolated from wild-type (WT) and Vil-Lin28b [Med] mice.

B) Expression of Let-7 target mRNA levels in small intestine (jejunum) crypts isolated from wild-type (WT), Vil-Lin28b [Lo], Let7 [IEC- KO], Lin28b [Lo] /Let7 [+/-], and Lin28b [Lo] /Let7 [IEC- KO] mice.

Co -expression of Let-7 Targets HMGA2, ARID3A, IGF2BP2, PLAGL2, HMGA1, HIF3A, E2F5, NR6A1, MYCN, and DDX19A with stem cell markers (LGR5, EPHB2, ASCL2, MSI1, z-score threshold +/– = 1) in two human colon cancer datasets from TCGA (http://www.

However, the differences between Let-7 target mRNAs in each of these mo dels can be quite disparate; e. g. KRAS has a larger effect on tumorigenesis than does HMGA2 in a non-small cell lung cancer mo del [49], whereas HMGA2 appears to have a much larger role in other cancer mo dels [28, 50– 53], likely as a modifier of chromatin structure and gene expression [54– 57].

While Let-7a and Let-7b depletion and increased expression of stem cell markers may appear to be a general feature of colon cancer, our discovery of a relationship between expression of Let-7 and stem cell markers suggests a functional connection.

edu) comparing expression of Let-7 target mRNAs in normal tissue (N. T. ) vs.

S1 Fig A-C) Box-and-whisker plots for Let-7a, Let-7b, and Let-7c, demonstrating significant down-regulation in colon and rectal cancer (CRC) miRNA-seq dataset.

A-C) Box-and-whisker plots for Let-7a, Let-7b, and Let-7c, demonstrating significant down-regulation in colon and rectal cancer (CRC) miRNA-seq dataset.

F) Taqman QPCR for mature Let-7a and Let-7b miRNAs in a cohort of colon adenocarcinomas (N = 20) indicates that Let-7a and Let-7b are down-regulated.

To gain insight into the association of several Let-7 targets with tumorigenesis in vivo, we examined Hmga1, Hmga2, Arid3a, and Hif3a protein expression by immunostaining adenomas and adenocarcinomas, as well as adjacent normal tissue, from Lin28b [Lo] /Let7 [IEC- KO] mice.

S2 TableCo -expression of Let-7 Targets HMGA2, ARID3A, IGF2BP2, PLAGL2, HMGA1, HIF3A, E2F5, NR6A1, MYCN, and DDX19A with stem cell markers (LGR5, EPHB2, ASCL2, MSI1, z-score threshold +/– = 1) in two human colon cancer datasets from TCGA (http://www.

Since Let-7a and Let-7b appear to be the most highly expressed Let-7 miRNAs in normal colonic epithelium, and are significantly depleted in CRC specimens [20, 30] (S1A, S1B and S1C Fig), we examined these miRNAs in a subset of colon cancer specimens.

Let-7 miRNAs and Let-7 Target anti-correlation in CRC TCGA datasets.

In the mouse intestine we have achieved comprehensive depletion of all Let-7 miRNAs in this large multi-genic family through use of an inhibitory protein, called LIN28B, that specifically represses Let-7, and genetic inactivation of another gene cluster called MirLet7c-2/Mirlet7b.

We have achieved comprehensive depletion of all Let-7 miRNAs in the intestinal epithelium and demonstrated the critical nature of their cumulative tumor-suppressive properties.

A) Schematic of the intestine-specific deletion of the Mirlet7c-2/Mirlet7b floxed locus via Villin-Cre and expression of Lin28b with a Villin-Lin28b-ires-tdTomato transgene, which repress all 8 of the Let-7 clusters.

To assay exogenous expression of Let-7 targets in enteroids, we used a lentivirus vector for transduction of wild-type mouse small intestine enteroids (Fig 6D–6G).

Inverse relationships for Let-7 and target mRNAs could be discerned by plotting miRNA-seq data against mRNA-seq data for Let-7c vs.

1005408.g001 Fig 1A) Schematic of the intestine-specific deletion of the Mirlet7c-2/Mirlet7b floxed locus via Villin-Cre and expression of Lin28b with a Villin-Lin28b-ires-tdTomato transgene, which repress all 8 of the Let-7 clusters.

Nascent tumorigenesis beginning with aberrant crypt foci and/or microadenomas may occur spontaneously in our mouse mo del of Let-7 depletion, likely due to sporadic deregulation of Wnt signaling or potential spontaneous loss of other tumor suppressive mechanisms.

We focused on Hmga2, rather than Hmga1, as it is consistently up-regulated in non-malignant intestinal tissue from Vil-Lin28b [Med] and Lin28b [Lo]/ Let7 [IEC- KO] and thus appears highly dependent on Let-7 [18].

Vil-Lin28b [Med] mice express higher levels of Lin28b, have partially depleted Let-7 miRNAs and develop adenocarcinomas of the small intestine as do Lin28b [Lo] /Let7 [IEC- KO] mice but do not exhibit a phenotype as severe as Lin28b [Lo] /Let7 [IEC- KO] mice (18).

Let-7a and Let-7b levels were also correlated tightly, suggesting co-regulation (Fig 5H), and were also inversely proportional to the expression of the stem cell markers EPHB2 and LGR5 (Fig 5I).

Let-7 miRNAs comprise one of the largest and most highly expressed families of miRNAs, possessing potent anti-carcinogenic properties in a variety of tissues [3].

To circumvent this obstacle and elucidate the mechanistic roles of Let-7 miRNAs in intestinal tumorigenesis in a genetic mouse mo del we have combined a Vil-Lin28b [Low] (Lin28b [Lo]) transgene with intestinal deletion of the MirLet7c-2/Mirlet7b bi-cistronic cluster (Let-7 [IEC- KO]) to achieve robust repression of all Let-7 miRNAs expressed in the intestinal epithelium.

In addition to our findings for HMGA2, IGF2BP1, and IGF2BP2, there is experimental evidence that HMGA1, E2F5, and ARID3A are also direct targets of Let-7 [6, 31, 32].

These compound Lin28b [Lo]/ Let7 [IEC- KO] mice, exhibit depletion of all Let-7 miRNAs specifically in intestinal epithelial cells (IEC) achieved through deletion of the MirLet7c-2/MirLet7b locus and repression of all other Let-7 miRNAs through inhibition by Lin28b [18] (and Fig 1A).

D-I) Scatter plots of Let-7 miRNA expression vs.

As documented in developmental programs in C. elegans and in human cancers, Let-7 miRNAs repress a stem cell phenotype and tumor-initiating phenotype [3], an association we observe here as well.

Comprehensive depletion of all Let-7 miRNAs leads to the development of intestinal adenocarcinomas.

All targets contained conserved Let-7 sites in the 3’UTR or coding sequence, except for Trim6, for which only the mouse mRNA possesses Let-7 sites (Fig 2D).

To examine a possible relationship between Let-7 target mRNAs and stem cell markers, we evaluated co -expression in mouse samples (from Fig 5I) and found that Hmga1 and Hmga2 had very high correlation with all of the markers we examined (Fig 5K).

Perhaps consistent with its association with a stem cell phenotype, HMGA2 is also frequently co-expressed with the stem cell markers MSI1 and LGR5 in human CRC, and notably, more frequently than any of the other Let-7 targets evaluated here in this study (Fig 5L and S2 Table).

Comprehensive Depletion of Let-7 miRNAs Leads to the Development of Intestinal Adenocarcinomas in Mice.

Let-7 biogenesis is tightly regulated, revealed by the discovery of several proteins that regulate processing by DGCR8/DROSHA in the nucleus, and by DICER1 cleavage in the cytoplasm.

We next pursued 3-D culture and manipulation of intestinal organoids (enteroids) to explore the relationship between Let-7 targets and a stem cell phenotype.

However, Let-7 action appears dependent on the particular mRNA targets affected, although Let-7 represses de-differentiation in multiple contexts.

We also observed significant elevation of mRNAs for these Let-7 targets in crypts from small intestine epithelia from Lin28b [Lo]/ Let7 [IEC- KO] (Fig 2B).

Lin28b [Lo] /Let7 [IEC- KO] mice reveals similar expression changes in each mo del of Let-7 depletion, with significant correlation (Pearson correlation shown).

Examination of Let-7 targets in these tumors and in tumoroid cultures suggest that HMGA2 is likely playing a major role in driving carcinogenesis following Let-7 depletion, a novel in vivo finding.

This activity is likely mediated via Let-7 repression of a multitude of onco-fetal mRNAs and other pro-proliferative and/or pro-metastatic targets, such as HMGA2, IGF2BP1, IGF2BP2, and NR6A1 [4– 6].

We have previously shown that crypt hyperplasia and Hmga2 expression is dependent on Let-7 depletion in crypts from Vil-Lin28b [Med] mice [18].

While HMGA2 is playing a key role, it is likely that the effects of Let-7 on an intestinal stem cell phenotype and epithelial tumorigenesis are dependent on the collective and/or cooperative role of multiple Let-7 targets.

To generate compound mutant animals we used a low -expressing transgenic line (Lin28b [Lo] ), in which we could not detect measureable changes in either protein or mRNA levels of Let-7-independent Lin28b targets [18].

We next examined Let-7 targets that might mediate programs of tumorigenesis in Lin28b [Lo]/ Let7 [IEC- KO] mice in the context of tumors and cellular transformation.

Identification of Relevant Let-7 Target mRNAs in the Intestinal Epithelium and Tumors.

These effects appear to be due to Let-7, although LIN28B can bind mRNAs and modulate protein levels of targets in the intestinal epithelium [18].

Let-7 targets were examined in small intestine crypts from Vil-Lin28b and Lin28b [Lo]/ Let7 [IEC- KO] mice.

C) Comparison of Let-7 target mRNA changes in small intestine crypts from Vil-Lin28b [Med] mice vs.

Quantification of Let-7 target mRNA levels in intestinal epithelium crypts.

Let-7 miRNA genes are shown as black hairpins while non-let-7 miRNA genes are depicted as gray hairpins.

Levels of HMGA1, HMGA2, PLAGL2, IGF2BP2, E2F5, and ARID3A transcripts were also inversely proportional to levels of Let-7 miRNA by examination of a cohort of 199 CRC patients from the TCGA Pan-Cancer analysis project [20] (Fig 5B–5E and S1D–S1I Fig).

LIN28B appears to act by sequestering primary-Let-7 (pri-Let-7) miRNAs within the nucleolus to prohibit processing by DGCR8 and DROSHA [9].

LIN28A works in concert with TRIM25 and TUT4 to mediate terminal uridylation and subsequent degradation of immature precursor-Let-7 (pre-Let-7) miRNA molecules [9– 11].

Let-7a and Let-7b miRNAs were normalized to U6 and RNU6B RNAs.

Quantification by Taqman RT-PCR confirmed that Let-7 miRNAs are severely repressed in tumoroid/enteroids and transformed tumoroid cysts (Fig 4D).

The exploration of Let-7-dependence through genetic manipulation in mouse mo dels is currently untenable due to the large number of miRNA clusters, with 12 Let-7 genes located at 8 separate clusters on 7 different chromosomes.

Supporting this hypothesis is the documentation that LIN28 proteins and Let-7 miRNAs do indeed affect proliferation, migration, and invasion in cell culture mo dels and xenografts of various malignancies [16, 17, 46– 49].

Most notable are LIN28A and LIN28B, which are RNA -binding proteins that directly bind to and block the processing of Let-7 mRNAs [7, 8].

D) Let-7 miRNAs are repressed consistently in tumoroid/enteroids (TE) and tumoroid cysts (TC).

Let-7 miRNAs were quantified using Taqman Q-RT-PCR kits (Life Technologies), according to the manufacturers instructions and normalized to U6 and SNO135 small RNA levels.

Large gene families, such as the Let-7 family, are difficult to silence or mutate because of the large amount of redundancy that exists between similar copies of the same gene; the mutation of one will often be masked or compensated by the continued function of others.

12

Based on the inverse correlation between let-7a/miR-16/miR-29b and c-Myc and CCND2 expression, we hypothezed that down regulation of c-Myc would restore the expression of tumor-suppressive miRNAs, let-7a, miR-16 and miR-29b, subsequently down-regulate CCND2 in ES cell lines.

Thus, the expression analysis data lead us to the prediction of new axis that c-Myc might repress the tumor suppressive miRNAs, let-7a, miR-16 and miR-29b, and the inhibition of these miRNAs might result in the up-regulation of CCND2 in ES cells.

We also explored whether c-Myc would regulate the expression of let-7a, miR-16 and miR-29b and these tumor suppressive miRNAs suppress the expression CCND2.

As consistent with the data of in vitro experiments, the xenograft mo del of ES also indicated that let-7a, miR-16 and miR-29b induction had the ability to inhibit ES cells development ex vivo treatment by targeting CCND2 expression.

In summary, the present study showed that the down-regulation of let-7a, miR-16 and miR-29b were mediated by c-Myc and subsequently inhibited the expression of CCND2 in SKES1.

In the present study, knockdown of c-Myc using siRNA revealed the up-regulation of let-7a, miR-16 and miR-29b, indicating that these tumor suppressive miRNAs are also regulated by c-Myc as MRMs in ES cell lines.

It is possible that let-7a, miR-16 miR-29b may have down-regulated CCND2 expression via indirect pathway.

Among the various families of miRNAs, the let-7a, miR-16 and miR-29b have become the prototypes for miRNAs that function as the tumor suppressors since these miRNAs could inhibit the expression of multiple oncogenes, including c-Myc [20– 22].

The significant suppression of let-7a, miR-16 and miR-29b expression in ES cells suggests the tumor suppressive roles of these miRNAs in ES.

In the present study, miRNA array results demonstrated that the expression of let-7a, miR-16 and miR-29b were down-regulated in all of five ES cell lines.

The results indicated that the expression of let-7a, miR-16 and miR-29b was coordinately up-regulated in ES cell lines, and made us to investigate genome-wide mRNA profiling by cDNA array to detect the possible targets of let-7a, miR-16 and miR-29b in ES cells.

Although several miRNAs have been found to target CCND2, including let-7a [15], miR-16 [16] and miR-29b [17], the correlation of CCND2 expression and miRNAs in ES cells has been unknown.

To test whether let-7a, miR-16 and miR-29b expression affected endogenous let-7a, miR-16 and miR-29b expression, we transfected let-7a, miR-16 and miR-29b mimic and their mutant oligonucleotides, as well as the negative control-miR, into SKES1 cells.

Among the predicted target genes of let-7a, miR-16 and miR-29b in the TargetScan (http://www.

c-Myc exhibited inverse correlation with let-7a, miR-16 and miR-29b, and these tumor suppressive miRNAs played important roles in SKES1 proliferation and tumorigenesis by targeting CCND2 both in vitro and ex vivo treatment.

Inhibition of CCND2 expression by let-7a, miR-16 and miR-29b and CCND2-siRNA.

Although let-7a, miR-16 and miR-29b might influence the expression of several genes, we focused on CCND2 as the target of the miRNAs in ES cells.

Furthermore, ex vivo treatment studies showed the inhibition of ES tumor cell growth in mice injected with ES cells overexpressing of let-7a, miR-16 or miR-29b.

Down regulation of let-7a, miR-16, and miR-29b expression in ES cell lines.

To study the roles of c-Myc in the regulation of let-7a, miR-16 and miR-29b in ES cells, we transfected the cells with siRNA targeting for c-Myc.

It is noteworthy that the down-regulation of CCND2 by challenge of let-7a, miR-16, miR-29b or siRNA against CCND2 did not induce apoptosis in ES cells, indicating that the repression of ES cell growth was acquired by the cell cycle retardation.

Our data suggests that c-Myc might negatively regulate let-7a, miR-16 and miR-29b expression in ES cells.

CCND2 as a direct let-7a, miR-16 and miR-29b target in ESThe region complementary to the let-7a, miR-16 and miR-29b seed region was found in the 3’-UTR of human CCND2.

Several studies have shown that let-7a, miR-16 and miR-29b are down-regulated and are closely related to the abnormal potentials in malignant tumors [23– 25].

Dong, et al reported that CCND2 is the direct target of let-7a in prostate cancer [15].

CCND2 as a direct let-7a, miR-16 and miR-29b target in ES Cell lines.

Our results suggested that the same regulatory mechanism of CCND2 expression via let-7a, miR-16 and miR-29b might exist in ES cells.

Indeed, debilitation of c-Myc using siRNA revealed down-regulation of CCND2, and induced the correction of abnormal cell cycle progression, which were consistent with the results of the transfection experiments with let-7a, miR-16 and miR-29b in ES cells.

Silencing of c-Myc with c-Myc siRNA and let-7a, miR-16, miR-29b directly target to CCND2 mRNA in SKES1.

The analysis using several algorithms, such as BLAST, and real-time PCR after miRNAs transfection, further suggested that CCND2 was directly targeted by let-7a, miR-16 and miR-29b.

Inhibition of cell cycle progression at G0/G1 phase by let-7a, miR-16 and miR-29b.

Our data regarding the cell cycle analysis showed that let-7a, miR-16 and miR-29b inhibited the proliferation of ES cells via cell cycle retardation at G1/G0 phase.

0138560.g004 Fig 4The expression of CCND2 protein was decreased in SKES1 transfected with let-7a (A), miR-16 (C), miR-29b (E) and CCND2-siRNA (G).

The expression of CCND2 protein was decreased in SKES1 transfected with let-7a (A), miR-16 (C), miR-29b (E) and CCND2-siRNA (G).

Decreased CCND2 expression at the mRNA level following transfection with the let-7a, miR-16 and miR-29b mimic (Fig 3D–3F.

The present study demonstrated that forced elevation of let-7a, miR-16 and miR-29b resulted in the reduction of the expression of CCND2 protein in ES cells.

The cell growth of SKES1 was inhibited by the transfection of let-7a, miR-16 and miR-29b in comparison with untreated and negative control miRNA transfected cells at 48 h after the transfection as determined by the cell counting (Fig 5A–5C).

Inhibition of tumor growth in nude mice xenograft mo del by let-7a, miR-16 and miR-29b.

S1 FigPredicted binding sites of let-7a (A), miR-16 (B), and miR-29b (C) in 3′-UTR of CCND2, as aligned by Basic Local Alignment Search Tool (BLAST), TargetScan 6.0 (microRNA.

Since the transfection of let-7a, miR-16, and miR-29b resulted in the reduction of CCND2 expression, we next examine the effects of let-7a, miR-16, and miR-29b on the proliferation of ES cells.

A considerable complementarity between sequences within the seed regions of let-7a, miR-16 and miR-29b and sequences in the 3’-UTR of CCND2 was predicted, using the algorithms in BLAST and TargetScan.

The protein expression level of CCND2 in the let-7a, miR-16 and miR-29b -transfected cells (40nM) were reduced to 21.7%, 43.9% and 36.7% of that in the control cells, respectively (p < 0.05) (Fig 4B, 4D and 4F).

Let-7a, miR-16 and miR-29b suppressed the ex vivo treatment tumor growth.

Predicted binding sites of let-7a (A), miR-16 (B), and miR-29b (C) in 3′-UTR of CCND2, as aligned by Basic Local Alignment Search Tool (BLAST), TargetScan 6.0 (microRNA.

Suppression of ES cell growth by transfection of let-7a, miR-16, miR-29b and CCND2-siRNA.

We next examined the functions of let-7a, miR-16 and miR-29b in the regulation of their possible target gene, CCND2, and the changes in the biological characteristics in ES cell lines.

The results herein indicated that the expressions of let-7a, miR-16 and miR-29b were repressed whereas those of c-Myc and CCND2 were increased in all five ES cell lines compared with hMSCs.

On the contrary, the expression of let-7a (2.23 fold), miR-16 (1.35 fold), and miR-29b (1.56 fold) were significantly higher in c-Myc siRNA -transfected cells (20nM) compared with the untreated ES cells, as determined by real-time quantitative RT-PCR (Fig 3C).

In the SKES1, the expression of let-7a was decreased by -24.15, miR-16 by -2.81 and miR-29b by -5.2 folds compared with hMSCs, respectively.

Consistent with the above data, the results demonstrated that CCND2 was the down-stream effector of let-7a, miR-16 and miR-29b, which were regulated by c-Myc.

Therefore, let-7a, miR-16 miR-29b may have affected CCND2 mRNA directly at least in part.

We observed an increased let-7a, miR-16, miR-29b expression by 6.23 fold, 5.99 fold, 6.66 fold respectively compared with control-miR (Fig 3C.

CCND2-siRNA transfected SKES1 cells, as same as let-7a, miR-16 and miR-29b transfected cells, showed significant inhibition of the cell proliferation compared with the negative control siRNA transfected cells (Fig 5D).

In the ES cell lines, the expression of let-7a was decreased by -24.15 ~ -46.15, miR-16 by -2.25 ~ -3.52, and miR-29b by -4.88 ~ -10.37 folds compared with hMSCs, respectively (Fig 2).

SKES1 cells transfected with the miRNAs showed statistically smaller tumors in mice compared to untreated (1949.2 ± 57.9 mm [3]) and negative control miRNA transfected groups (1805 ± 83.9 mm [3]) (Fig 8F), indicating that let-7a (848 ± 85.1 mm [3]), miR-16 (636.8 ± 64.2 mm [3]) and miR-29b (711.8 ± 71.6 mm [3]) inhibited the growth of ES cells ex vivo treatment.

analysis showed that the expression levels of CCND2 dramatically decreased in all let-7a, miR-16, and miR-29b -transfected cells compared with negative control oligo -transfected cells (Fig 4A, 4C and 4E).

To examine the correlation between let-7a, miR-16 and miR-29b and CCND2 in ES cells, these miRNAs were transfected into SKES1 cells.

Silencing of CCND2 using let-7a, miR-16 and miR-29b and CCND2-siRNA in SKES1.

The region complementary to the let-7a, miR-16 and miR-29b seed region was found in the 3’-UTR of human CCND2.

The cleavage of PARP protein, a marker of caspase -mediated apoptosis, was not observed in miRNAs (let-7a, miR-16 and miR-29b) transfectants as well as untreated cells and negative control transfectants, in marked contrast to ADM -treated (positive control) cells (Fig 6H).

The introduction of let-7a, miR-16 and miR-29b miRNAs into SKES1 cells resulted in the decreased growth of subcutaneous xenografted tumors in nude mice (Fig 8A–8E).

The cells were plated in 6-well plates (5×10 [4] cells per well), and were transfected with or without let-7a-2-3p, miR-16-2-3p and miR-29b-1-5p mimic, negative control miRNA, or CCND2 siRNA and MISSION siRNA Universal Negative Control.

The transfection of let-7a-2-3p mimic (Accession; MIMAT0010195), miR-16-2-3p mimic (Accession; MIMAT0004518) and miR-29b-1-5p (Accession; MIMAT0004514) mimic or negative control (NC) miRNA (Invitrogen) was performed using Lipofectamine 2000 reagent (Invitrogen) in antibiotics-free OptiMEM (Invitrogen) according to the manufacturer's instructions.

Briefly, 1x10 [6] SKES1 cells were seeded and incubated for 24 h, then let-7a-2-3p, miR-16-2-3p and miR-29b-1-5p mimic or siRNA for CCND2 was added to the cells followed by incubation for 48 h. The cells were washed with PBS, suspended in annexin V binding buffer, then added to an annexin V-FITC solution and propidium iodide (PI) for 20 min at room temperature.

Effects of let-7a, miR-16 and miR-29b on the induction of apoptosis in SKES1 cells.

0138560.g008 Fig 8The five groups included (A) untreated (n = 5), (B) transfected with negative control miRNA (n = 5), and (C) transfected with let-7a (n = 5), (D) transfected with miR-16 (n = 5) and (E) transfected with miR-29b (n = 5).

Furthermore, the sequence analysis suggested possible association of let-7a, miR-16 and miR-29b with 3’UTR of CCND2 (S1 Fig).

Five groups were generated: (1) untreated control (n = 5); (2) transfected with negative control-miRNA (n = 5); (3) transfected with let-7a miRNA mimic (n = 5); (4) transfected with miR-16 miRNA mimic (n = 5); (5) transfected with miR-29b miRNA mimic (n = 5).

After actinomycinD treatment, the mRNA expression level of CCND2 after transfection of negative control-miR, let-7a, miR-16, miR-29b and their mutant was measured by qRT-PCR.

Effects of let-7a, miR-16 and miR-29b miRNAs on the cell cycle in SKES1.

Densitometry quantification of CCND2 protein levels after transfection of let-7a (B), miR-16 (D), miR-29b (F) and CCND2-siRNA (H).

The data demonstrated that the restoration of let-7a miR-16 and miR-29b resulted in the cell cycle retardation at G0⁄G1 phase in ES cells.

The transfection of let-7a mimic, let-7a mutant, miR-16 mimic, miR-16 mutant, miR-29b mimic, miR-29b mutant and negative control mRNAs (Control-miR) (Invitrogen) was performed using Lipofectamine 2000 reagent (Invitrogen) in antibiotics-free OptiMEM (Invitrogen).

The five groups included (A) untreated (n = 5), (B) transfected with negative control miRNA (n = 5), and (C) transfected with let-7a (n = 5), (D) transfected with miR-16 (n = 5) and (E) transfected with miR-29b (n = 5).

The programmed cell death was not induced by let-7a, miR-16 or miR-29b in ES cells.

0138560.g005 Fig 5. Antiproliferation effect of let-7a (A), miR-16 (B), miR-29b (C) and CCND2-siRNA (D) in ES cells.

The experimental tumor bearing mice mo del was established by injection of SKES1 cells (1 x 10 [6]) transfected with let-7a-2-3p, miR-16-2-3p and miR-29b-1-5p miRNA suspended in 100 μl of normal saline in the gluteal region of mice.

However, the biological roles of let-7a, miR-16 and miR-29b in ES cells have not been clarified yet.

13

Although this correlation between let-7 expression and disease is strongest in lung tissue, where let-7 expression is high, our study finds that let-7 causes cell cycle defects in prostate cancer cell line as well.

Let-7a inhibits cell growth in vitro and induces cell cycle arrest at the G0-G1 phaseAfter transfection, the expression level of let-7a in PC3-let-7a-GFP was ∼300% higher than in PC3-GFP by real-time RT-PCR; A ten-fold increase in expression of let-7a was observed in PC3 cells transfected with let-7a (mimics) versus those transfected with NC (Fig. 2A, p<0.01).

Lastly, a synthetic let-7a -inhibitor sequence and synthetic let-7a -inhibitor negative control (NC inhibitor).

Protein and mRNA expression levels of E2F2 and CCND2 are down-regulated in PC3 and LNCaP cells after transfection with let-7a.

We found that let-7a expression level is down-regulated dramatically in prostate cancer tissue and cells lines.

Also, other genes associated with cell-cycle regulation have been reported to be repressed directly or indirectly by let-7. These include CDC34, which promotes the degradation of cyclin dependent kinase (CDK) inhibitor 1B and CCNA2, which promotes G1-S and G2-M phase transitions [25].

These data support that let-7a down -regulating the mRNA expression of E2F2 and CCND2 and repress protein translation of them.

A dual-luciferase reporter assay demonstrated that the 3′UTR of E2F2 and CCND2 were directly bound to let-7a and western blotting analysis further indicated that let-7a down-regulated the expression of E2F2 and CCND2.

In this study, we used in vitro and in vivo approaches to investigate whether E2F2 and CCND2 are direct targets of let-7a, and if let-7a acts as a tumor suppressor in prostate cancer by down -regulating E2F2 and CCND2.

Western blotting results showed no change of CDK4 protein expression between prostate cancer tissues and their adjacent non-tumorous tissues or between PC3-let-7a-GFP cells and PC3-GFP cells, the expression levels of E2F2, CCND2 increased in prostate cancer tissues compared with their adjacent non-tumorous tissues, but the expression levels of E2F2, CCND2, and k-ras decreased dramatically in PC3-let-7a-GFP cells compared with that in PC3-GFP cells (Fig. 4E).

Cotransfections of synthetic let-7a sequence (mimics) and NC, or let-7a inhibitor and NC inhibitor were also performed in human embryonic kidney cells HEK293A by using lipofectamine 2000 (Invitrogen).

Our founding expands the family of let-7 targets, and the identifying the molecular pathways affected in cancer could further reveal the mechanisms by which let-7a inhibits cell division.

Text S1 Sequences of synthetic Hsa-let-7a, negative control, Hsa-let-7a inhibitor and Inhibitor negative control.

MTT growth curves indicated that from the second day, the survival of let-7a transfected PC3 cells and LNCaP cells are significantly less than that of negative control, and the survival of let-7a inhibitor transfected PC3 cells and LNCaP cells are significantly more than that of NC inhibitor transfected cells (Fig. 2C, p<0.05).

After transfection, the expression level of let-7a in PC3-let-7a-GFP was ∼300% higher than in PC3-GFP by real-time RT-PCR; A ten-fold increase in expression of let-7a was observed in PC3 cells transfected with let-7a (mimics) versus those transfected with NC (Fig. 2A, p<0.01).

PC3 cells and LNCaP cells transfected with either NC or let-7a (mimics), or NC inhibitor and let-7a inhibitor were plated on 96-well plates at 1×10 [4] cells/well.

But compared to PrEC, mRNA expression of E2F2 and CCND2 are down-regulated after transfected with let-7a in PC3 and LNCaP cells (Fig. 4C, D, * p<0.05; ** p<0.01).

Sequences of synthetic hsa-let-7a, negative control, hsa-let-7a inhibitor and inhibitor negative control were showed in Text S1.

PC3 cells and LNCaP cells transfected with either NC or let-7a (mimics), or NC inhibitor or let-7a inhibitor were harvested 72 h after transfection, washed with cold phosphate buffered saline (PBS), and fixed in 1ml of 70% ethanol.

In this study, we used in vitro and in vivo approaches to investigate whether E2F2 and CCND2 are direct targets of let-7a, and if let-7a acts as a tumor suppressor in prostate cancer by down -regulating E2F2 and CCND2.

the percentage of let-7a inhibitor transfected PC3 cells and LNCaP cells in the G0-G1 phase was ∼23% (PC3) and 19% (LNCaP) less than that of NC inhibitor transfected cells, which paralleled with a ∼33% (PC3) and 25% (LNCaP) increase in the S phase (Fig. 2D, * p<0.05; ** p<0.01).

let-7 has been reported to act as a tumor suppressor in some cancer types, such as lung and colon cancer [9], [21]– [23] and that reduced expression levels of let-7 is correlated with poor clinical prognosis [24].

Our xenograft mo dels of prostate cancer also confirm our in vitro results and show that let-7a has the ability to inhibit prostate tumor development in vivo.

let-7 slows cellular proliferation by down -regulating the oncogenes RAS/c-MYC and HMGA-2 at the translational level [7], [8].

Compared to NC inhibitor, there is no significant difference in luciferase activity when HEK293A cells were transfected with the let-7a inhibitor and wild-type CCND2 or E2F2 (Fig. 3C).

Let-7a inhibits expression of E2F2, CCND2.

Our xenograft mo dels of prostate cancer confirmed the capability of let-7a to inhibit prostate tumor development in vivo.

These data support that E2F2 and CCND2 are direct targets of let-7a and endogenous let-7a in HEK293A has no interference to our experience.

The same tumor suppressive functions have also been reported for let-7 in colon cancer [9].

Effect of let-7a on expression of E2F2 and CCND2.

The prostate cancer cell lines LNCap expressed only ∼70% as let-7a than normal prostate epithelial cells PrEC.

Though much is still to be learned about the role of let-7a in prostate cancer tumorigenesis, let-7a provides us a new way of prostate cancer treatment via its ability to inducing cell cycle arrest and inhibiting cell growth.

k-ras, a previously-defined molecular target of let-7a [7] was used as a positive control for these experiments.

Additionally, the amount of let-7a expression in PC3 cells and DU-145 were about 50% of that observed in PrEC.

Furthermore, the ratio of tumor weight/body weight in mice bearing PC3-let-7a-GFP tumors was only ∼6% of the ratio from mice bearing PC3-GFP tumors (Fig. 5D, p<0.01), which provides strong evidence that let-7a can inhibit tumor growth in vivo.

Cellular proliferation was inhibited in PC3 cells and LNCaP cells after transfection with let-7a.

Previous work has shown reduced expression levels of let-7 in lung tumors.

In silico analyses of potential let-7a targets (www.

These data indicate that let-7a inhibits PC3 proliferation by inducing cell-cycle arrest at G1/S phase.

0010147.g002 Figure 2(A) Relative expression of let-7a in PC3 cells transfected with pcDNA3-GFP, pcDNA3-let-7a-GFP, NC, and let-7a (mimics).

org) reveal that both E2F2 and CCND2 are possible targets of let-7a.

Our dual-luciferase reporter assay verified that E2F2 and CCND2 are direct targets of let-7a.

Real-time RT-PCR show that the relative expression of let-7a in twenty-six prostate cancer samples, and in prostate cancer cell lines LNCap, PC3, DU-145 is higher than that in their adjacent non-cancerous specimens and the normal prostate epithelial cell PrEC.

0010147.g001 Figure 1Real-time RT-PCR show that the relative expression of let-7a in twenty-six prostate cancer samples, and in prostate cancer cell lines LNCap, PC3, DU-145 is higher than that in their adjacent non-cancerous specimens and the normal prostate epithelial cell PrEC.

Little is known about the expression or mechanisms of let-7a in prostate cancer.

But little is known about the expression or mechanisms of let-7a in prostate cancer.

After transfected with let-7a, the expression levels of E2F2, CCND2, and k-ras decreased dramatically in PC3-let-7a-GFP cells compared with that in PC3-GFP cells.

Previous work has shown reduced expression levels of let-7 in lung tumors compared to normal lung tissue.

Western blotting showed that expression levels of E2F2 and CCND2 decreased dramatically in PC3-let-7a-GFP tumors compared with PC3-GFP tumors (Fig. 5B).

Let-7a targets 3′UTR of E2F2 and CCND2.

Let-7a inhibits tumor growth in nude mice xenograft mo del.

Let-7a inhibits cell growth in vitro and induces cell cycle arrest at the G0-G1 phase.

Let-7a may also be novel therapeutic candidate for prostate cancer given its ability to induce cell-cycle arrest and inhibit cell growth, especially in hormone-refractory prostate cancer.

Real-time RT-PCR revealed that the expression levels of let-7a were decreased by ∼43% in resected human prostate cancer samples compared to the adjacent non-cancerous samples.

Detached PC3-let-7a-GFP and PC3-GFP cells were mixed with the topagarose suspension (final concentration 0.3%), and then the cells were layered onto the 0.5% agarose underlay.

Let-7a PCR products were cloned into the EcoRI/ PstI cloning site of a pcDNA3 plasmid containing green fluorescent protein (GFP) to form the plasmid pcDNA3-let-7a-GFP.

The lower are tumors excised from mice injected with PC3-let-7a-GFP cells.

PC3 cells transfected with let-7a were designated as PC3-let-7a-GFP, the negative control (cells transfected with the empty vector) was designated as PC3-GFP.

Flow cytometry showed that the percentage of let-7a transfected PC3 cells and LNCaP cells in the G0-G1 phase was ∼30% (PC3) and 16% (LNCaP) higher than that of negative control, which paralleled with a ∼50% (PC3) and 20% (LNCaP) decrease in the S phase.

Effect of let-7a on growth and proliferation of PC3 and LNCaP.

The weight of PC3-let-7a-GFP tumors was ∼80% lighter than PC3-GFP tumors (Fig. 5C, p<0.01).

Nude mice bearing PC3-let-7a-GFP or PC3-GFP xenografts were sacrificed 4 weeks after innoculation.

These results indicate that let-7a is decreased in prostate cancer, including the androgen-independent cancers PC3 (Fig. 1, * p<0.05; ** p<0.01).

Let-7a was amplified and purified by miRNA isolation kit (Invitrogen, Carlsbad, CA) according to manufacturer's protocol.

Colony formation analysis indicated that the colonies formation ability of PC3-let-7a-GFP cells is ∼40% less than that of control cells (Fig. 2B, p<0.01).

Of mice injected with PC3-let-7a-GFP cells, no tumor was detected in one mouse and one mouse died 2 days after injection.

For let-7a, Total RNA was extracted from samples using a miRNeasy Mini Kit (Qiagen).

RNU6B was measured in parallel and used to normalize the expression level of let-7a in each experiment.

The PCR products were 415 bp and contained two binding sites for let-7a.

Five nude mice were subcutaneously injected with ∼1×10 [6] PC3-let-7a-GFP or PC3-GFP cells at a single site of the back.

PCR products were 398 bp and contained two binding sites for let-7a.

No reduction of luciferase activity was observed in HEK293A cells transfected with let-7a (mimics) and mutated CCND2 or E2F2.

To investigate whether E2F2 and CCND2 expression were regulated by let-7a, a dual-luciferase reporter assay was performed.

Effect of let-7a on tumorigenicity in xenograft mo dels.

Twenty-five micrograms of prostate cancer specimens and their adjacent non-tumorous specimens' protein as well as PC3-let-7a-GFP and PC3-GFP protein were electrophoresed in 10% SDS–PAGE minigels and transferred onto Hybond C nitrocellulose membranes (Amersham Life Science, Buckinghamshire, UK).

0010147.g003 Figure 3(A) Binding sites on E2F2 and CCND2 for let-7a with the corresponding mutated E2F2 and CCND2 sequences.

Three wells received pcDNA3-let-7a-GFP plasmid while the other wells received the empty vector, pcDNA3-GFP.

Findings Real-time RT-PCR demonstrated that decreased levels of let-7a are present in resected prostate cancer samples and prostate cancer cell lines.

Figure 3A shows the sequences of the 3′ UTRs of E2F2 and CCND2 that represent the binding sites for let-7a.

showed that let-7a induced cell cycle arrest at the G1/S phase.

Let-7a is down regulated in resected prostate cancer samples and in prostate cancer cells.

let-7 was first identified in Caenorhabditis elegans [5].

PC3 cells were also transfected with 30 nM of synthetic let-7a (mimics), and synthetic negative control miRNAs (NC).

These findings help to unravel the anti-proliferative mechanisms of let-7a in prostate cancer.

14

More accurately, Lin28 down -expression could inhibit insulin sensitivity mostly by suppressing the let-7 targets Insr, IGF1r, Irs2, Akt2, and Rictor, and also in part by directly reducing the ribosomal translation of mRNAs encoding IGF2 and mitochondrial OxPhos enzymes.

Interestingly, Lin28A and Lin28B mRNAs themselves have potential let-7 complementary sites (3′UTR of Lin28) and serve as let-7 targets, making let-7 regulate Lin28 expression by cleaving Lin28 mRNAs or inhibiting translation of Lin28 mRNAs [6, 20– 25].

Furthermore, Sharma et al. reported that combining the Lin28/let-7a/Kras axis inhibitors (NVP-LDE-225 and NVP-BEZ-235) could inhibit tumor growth by inhibiting Bcl-2 family members and activating caspases and by suppressing PI3K-mTOR pathway, suggesting that Lin28/let-7a may be involved in the apoptosis and proliferation of cancer cells simultaneously [47].

Additionally, the let-7 target genes, such as c-MYC [26] and CDC25A [23], could regulate their downstream Lin28 via translational repression, making let-7 an indirect inhibitor of Lin28.

For instance, high Lin28A expressing exosomes could induce EMT-related gene expression and promote non-metastatic target cells to migrate and invade [108], Lin28 suppressor let-7 could activate autophagy by repressing the mTOR signaling pathway [109], human induced pluripotent stem cells (iPSCs) generated by Lin28 could spontaneously differentiate into polarized retinal pigmented epithelium [110].

For example, Cai et al. have reported that Lin28 upregulation and let-7 posttranscriptional downregulation were identified in the Wnt-β-catenin pathway-stimulated breast CSCs phenotype, while loss of function of Lin28 impaired Wnt-β-catenin-pathway -mediated let-7 inhibition and breast cancer stem cell expansion [80].

The response then led to Lin28-regulated expression of the anti-inflammatory cytokine interleukin-6 (IL-6) via inhibiting let-7 expression, thus revealing a new mechanism containing cancer cells and immune molecules [75, 76].

Furthermore, Wang et al. demonstrated that in breast cancer cell lines, let-7a could suppress cell migration by significantly blocking the direct binding target of Lin28, which provided evidence for the potential therapeutic role of targeting Lin28 strategies in conquering metastasis in breast cancer [53].

Lin28 downexpression could inhibit insulin sensitivity mostly by regulating the let-7 targets Insr, Igf1r, Irs2, Akt2, and Rictor.

Lin28 regulated the expression of the anti-inflammatory cytokine interleukin-6 (IL-6) via inhibiting let-7 or depending on hnRNP A1 expression.

The majority of studies revealed that most of let-7 family members were down-regulated in breast cancer samples with either lymph node metastasis or higher proliferation index versus normal tissues [85– 88], while one study showing up-regulation of let-7b [89].

They also found that let-7 inhibited IL-6 expression both directly through its 3′UTR and indirectly by interacting with RAS to reduce the NF-κB activity.

Recent advanced studies also have revealed that long non-coding RNA H19 acts as a sponge to antagonize let-7. For example, the ability of let-7 to repress the expression of an array of metastasis-promoting genes is compromised when H19 expression is high, leading to decreased bio-availability of let-7, increased expression of c-Myc, Hmga2 and Imp3, and activation of cell migration and invasion [107], thus prompting us to study the relationship among H19, let-7 and Lin28 during carcinogenesis.

The let-7 family of microRNA (miRNA), which was also firstly discovered in Caenorhabditis elegans [8], has been reported to be a key suppressive target of Lin28, and serves as a potent tumor suppressor via post-transcriptional repression of multiple oncogenic messenger RNA (mRNA) [9].

Since the impact of Lin28/let-7 axis on radio-sensitivity has been confirmed in vitro, increasing evidence has shown that down -expression of Lin28 and over -expression of let-7 could decrease the expression of RAS oncogene and genes associated with DNA like RAD51, RAD21, FANCD2 and CDC25, eventually radiosensitizing the cancer cells [57– 59].

More specifically, the results support a mo del in which RKIP suppresses Raf-1/MEK/ERK activity, leading to the inhibition of Lin28 and induction of let-7, finally blocking the induction of Snail transcription and other genes involved in tumor cell invasion and metastatic colonization.

Many studies focusing on proliferative signaling in cancers suggest that Lin28 functions as an oncogene by repressing let-7, leading to the dysregulation of multiple genes regulated directly or indirectly by let-7, including MYC, Hmga2, and components of PI3K-mTOR pathway [43– 46].

Besides, Chen et al. demonstrated that the C allele of rs3811463, a SNP that located near the let-7 binding-site of Lin28, could weaken the suppression of Lin28 by let-7, which means an increasing level in Lin28 expression along with a reduction of let-7 level, elevating the risk of breast cancer [40].

As for clinical researches, apart from cases for let-7 as the classical suppressor [98], other studies have suggested that let-7 does not function as a tumor suppressor under all circumstances [99– 101].

Zhang et al. found that induction of Lin28 over -expressing mouse ESCs compromised basal and maximal oxygen consumption rate (OCR), but that levels of let-7 did not change from their already suppressed levels [66].

In the aspect of cell cycle, Li et al. have demonstrated that Lin28 promotes proliferation of tumor cells through regulating the G0/G1 transition in cell cycle, namely, increasing the expression of Cyclin D1/D2, CDC25A, CDK34, CDK6, as well as other cell cycle-related factors by depressing let-7 [42].

According to Figure S4 in their study, authors not only verified that let-7 mimic in Lin28 -overexpressing cells could not reverse the reduced OCR, but also knockdowned Lin28 in Dgcr8 [−/−] ESCs (scant quantities of let-7) to exclude other possibly let-7-related microRNAs function.

As for other inflammatory mechanisms, Yang et al. have reported that breast cancer cells lacking Lin28 could increase levels of anti-inflammatory cytokines, and that the regulation of the major cytokine genes is dependent on the expression of hnRNP A1, suggesting a mechanism independent of let-7 [65].

For instance, Isanejad et al. found that markers for aggressive breast cancer cells (such as Ki67 and ERα) or for tumor blood vessels (such as HIF-1α, CD31 and VEGF) could be down-regulated by the combination hormone therapy through the let-7a pathway.

Taken together, regulation of let-7 expression is controlled by Lin28 proteins through the post-transcriptional blockade of let-7 biogenesis.

X pathway while over -expression of let-7 enhanced the sensitivity to radiation [55].

Segalla et al. reported that the ribonuclease DIS3 could promote let-7 maturation and inhibit Lin28B mRNA levels through recognition of AU-rich elements in the 3′UTR [106].

Lin28B sequesters primary let-7 transcripts and inhibits their processing by the Microprocessor [18], while Lin28A recruits TUTase4 to induce oligo-uridylation of pre-let-7, which blocks DICER processing and facilitates degradation of the RNAs [11– 13].

In fact, Lin28 can regulate multiple tumor -associated progressions in let-7 independent way, including proliferation, chemo-resistance, metabolism, inflammation, stemness and cell development (Figure 3).

Lin28 can regulate multiple tumor -associated progressions without let-7, but with proliferation (CyclinA/B/D, CDK1/2/4/6, miR-125b), chemoresistance (pRb, p21, Bcl-xL, miR-107), metabolism (IGF2, Oxidative enzymes), inflammation (hnRNP A1), stemness (OCT4, miR-200), cell development (Hbl-1, Lin4/14, miR-48/84/241) related proteins and RNAs.

It is worth mentioning that Jolly et al. discovered that independent of let-7, Lin28 was strongly inhibited by miR-200 which pushed epithelial end towards mesenchymal end of CSCs, thus allowing mesenchymal phenotype cells to gain stemness [83] (Table 1).

Lin28 also could activate or inhibit other miRNAs besides the let-7 family.

Furthermore, studies revealed that Lin28A and Lin28B inhibited let-7 biogenesis by distinct mechanisms.

Figure 3 Lin28 can regulate multiple tumor -associated progressions without let-7, but with proliferation (CyclinA/B/D, CDK1/2/4/6, miR-125b), chemoresistance (pRb, p21, Bcl-xL, miR-107), metabolism (IGF2, Oxidative enzymes), inflammation (hnRNP A1), stemness (OCT4, miR-200), cell development (Hbl-1, Lin4/14, miR-48/84/241) related proteins and RNAs.

The association of let-7 with pathogenesis of breast cancer is supported by studies examining let-7 expression in breast cancer cell lines and clinical samples (Table 2).

The canonical targets of Lin28, let-7 family members, have been most notably implicated in cancer [84].

Another study indicated that Lin28 used two different TUTases to control let-7 expression and had important implications for stem cell biology as well as cancer [19].

Therefore, Lin28/let-7 axis establishes a double -negative feedback loop whereby either let-7 or Lin28 is expressed at high levels, promoting physiological or pathological conditions, respectively (Figure 2).

Lin28 decreased chemosensitivity via inhibiting miRNA-107, let-7, Rb, p21 and Bcl-xL.

The expression of let-7 in breast cancer.

Additionally, except for researches that Lin28/let-7 loop is involved in ten hallmarks of cancer [117], the aberrant loop also regulates cellular senescence and has connection with various oncogenes and signaling pathways, including MYC, RAS, MAPK signaling and PI3K/AKT signaling [118].

The GGAG sequences in the terminal loop of let-7 precursors serve as the binding sites for the zinc finger domains critical for let-7 regulation [14].

Based on the Figure 5 of their work, miR-208a increased the activity of DICER1 while let-7a directly targeted and degraded DICER1 mRNA, it is necessary to investigate whether the observation could be explained by the competitive endogenous RNA (ceRNA) hypothesis.

Sun et al. have demonstrated that miR-208a-SOX2/β-catenin-Lin28-let-7a-DICER1 regulatory feedback loop participates in the therapy resistance of breast cancer through promoting the induction of the cancer stem cells [56].

Lin28 homologs (Lin28A and Lin28B) are small (< 30kDa) proteins which can block the processing of let-7 family members by binding to the terminal loop of the let-7 precursor (pre-let-7) hairpin via a CSD and two retroviral-like CHCC zinc-finger knuckles [11– 13].

Orange refers to factors of let-7 -dependent way, blue refers to factors of let-7-independent way, gray means factors involved in both mechanisms.

As for let-7 independent way, Cho et al. mapped the Lin28A binding sites on the genomic scale by RNA crosslinking-immunoprecipitation-sequencing (CLIP-seq) technology and ribosome footprinting.

Other researchers also have found that Lin28 -induced chemotherapy resistance is associated with let-7, Rb, p21 and Bcl-xL, thus unraveling complicated relationship between Lin28 and tumor resistance [61, 62].

Figure 2 A primary let-7 (pri-let-7) transcript produced by let-7 gene is processed by the Drosha DGCR8 microprocessor in the nucleus.

Figure 4 Lin28 exerts its critical role in breast cancer through two distinct ways: let-7 dependent and let-7 independent.

A primary let-7 (pri-let-7) transcript produced by let-7 gene is processed by the Drosha DGCR8 microprocessor in the nucleus.

Lin28′s let-7-independent functionality.

Subsequent reports have demonstrated that Lin28 blocks the processing of let-7 at primary, precursor, and mature forms of let-7 family members, as Microprocessor complexes (DGCR8 and Drosha) and DICER complexes cannot associate with Lin28-bound let-7 [15– 17].

Then the generated precursor let-7 (pre-let-7) is transported to the cytosol and further processed by the Dicer and Argonaute proteins (AGO) to generate the mature let-7. The biogenesis of pri-let-7 is blocked by Lin28A in the nucleus and Lin28B in the nucleolus, the biogenesis of pre-let-7 and mature let-7 are blocked by Lin28A/B in the cytosol, and the mature let-7 can in turn block the biogenesis of Lin28A/B.

Mechanistically, Lin28 is involved in various pathological processes of cancers via let-7 dependent and let-7 independent pathways [3].

Epithelial-to-mesenchymal transition (EMT) is known to accelerate tissue remo deling from epithelial phenotype to mesenchymal phenotype, and Lin28/let-7 axis is also a prerequisite for the process of EMT among some cases [51].

[77– 83] Lin28 exerts its critical role in breast cancer through two distinct ways: let-7 dependent and let-7 independent.

Other studies also found that gain or loss of function of let-7 in wild-type cells did not change OCR, suggesting that Lin28 reduced OCR through several let-7-independent mechanisms [67].

Studies in the past decade have shown that the Lin28/let-7 axis plays a significant role in stem cell renewal [79].

It is therefore appropriate to assign the critical functions of Lin28 to one of two classifications: let-7 dependent and let-7 independent.

Lin28′s let-7 -dependent functionality.

Taken together, these evidences support the hypothesis of Lin28/let-7 axis contributing to the anti-angiogenesis effects of the breast cancer [48].

Subsequently, several functional studies have reported novel mechanisms of let-7 in breast cancer cells [90– 97].

15

To test whether was a negative regulator of let-7 expression, we altered the expression of in different cell lines and monitored the expression of let-7. In MCF7 cells which express very low endogenous levels of, ectopic expression of decreased the expression of mature let-7c (Figure 5B ).

In addition, we also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. Further studies will be aimed at identifying the mechanism of promotion of p53 expression and its mechanism of negatively regulating let-7. In 2007, several groups identified the miR-34 family of miRNAs (miR-34a, b, and c) as a direct transcriptional target of the key tumor suppressor p53 [26]– [29], [36], [37].

However, neither the overexpression nor the inhibition of let-7 had any effect on the expression of p53 in HCT116 cells, nor did fusion of the p53 3′UTR to a luciferase gene show any suppression when let-7 was coexpressed in 293T cells (data not shown).

Downregulation of let-7 following chemotherapeutic treatment has been shown to increase stemness and tumorigenicity of breast cancer cells through regulation of multiple targets including the let-7 targets c-Myc, Ras, and HMGA2 [65].

In addition, we also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. Further studies will be aimed at identifying the mechanism of promotion of p53 expression and its mechanism of negatively regulating let-7. CSCs have gained much interest as a likely mechanistic explanation for cancer progression, tumor heterogeneity, emergence of aggressiveness, and drug resistance [16], [57], [58].

In addition, we also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. Further studies will be aimed at identifying the mechanism of promotion of p53 expression and its mechanism of negatively regulating let-7. All cells were maintained in a humidified incubator at 37°C with 5% CO [2].

Our data on the connection between p53 and let-7 are consistent with a recent report describing an inhibitory role for p53 in HCT116 cells in which let-7a and let-7b were suppressed upon upregulation of wt p53 induced by γ-irradiation.

Alternatively, the data do not exclude the possibility that regulates the expression of let-7. It has been noted that expression of is higher in let-7 low Type I cells, and is lower in Type II cells with higher let-7 expression [35].

While the lower expression of let-7 in the less differentiated cells was consistent with its function as a regulator of cellular differentiation, it was surprising that the difference in let-7 expression between the Type I and Type II cells that were sensitive to -mediated apoptosis was more significant (p<0.0005, see our previous report [15]) than the difference in let-7 expression between the Type I and Type II cells that were completely resistant to -mediated apoptosis (p>0.05, Figure 5A ).

Expression of let-7 is suppressed during embryogenesis and in ES cells but upregulated before birth and maintained at high levels during adulthood in most tissues [20].

Given our finding that expression inversely correlates with the expression of let-7 the possibility arose that changes in let-7 expression could regulate the amount of p53.

Alternatively, the data do not exclude the possibility that regulates the expression of let-7. It has been noted that expression of is higher in let-7 low Type I cells, and is lower in Type II cells with higher let-7 expression [35].

We also postulate a counteracting pathway in which maintains p53 expression and, indirectly, the expression of miR-34a, providing a substantial protective axis against the loss of let-7. In studying -mediated apoptosis, our laboratory has made extensive use of a collection of 60 human cancer cell lines maintained by the National Cancer Institute's Developmental Therapeutics Program (NCI60).

While may directly affect stemness through regulation of stem cell regulator genes, our data suggest that this could occur through its regulation of let-7, which in turn affects the expression of stem cell genes (Figure 6 ).

We suggest that suppresses the stemness -inhibitory let-7 family, thereby predisposing cells to possible adverse outcomes to the loss of this crucial maintainer of cellular differentiation.

We therefore conclude that p53, at least in the tested cells, is not a target of let-7 suggesting that the effect of altered expression on p53 is independent of let-7. A confounding problem complicating our studies is the fact that many of the connections in the network were detected as low level tonic signaling.

Expression of mRNA was shown to decrease upon differentiation in a similar fashion as the validated let-7 target Lin28.

We therefore conclude that p53, at least in the tested cells, is not a target of let-7 suggesting that the effect of altered expression on p53 is independent of let-7. A confounding problem complicating our studies is the fact that many of the connections in the network were detected as low level tonic signaling.

We suggest that suppresses the stemness -inhibitory let-7 family, thereby predisposing cells to possible adverse outcomes arising from the loss of this crucial maintainer of cellular differentiation.

A component of the mo del is the negative feedback loop as described by Geng at al. [21] in which let-7 targets and decreases expression.

It appears that the mere presence of p53 or can affect expression levels of miRNAs, although stimulation through did not have a major effect on the expression of either let-7 or miR-34 (data not shown).

let-7 miRNAs are able to directly target mRNA causing its degradation and a functional desensitization to -mediated apoptosis [56].

The suggested mechanism for this inhibition involves direct binding of p53 to an enhancer in the promoter sequence shared by these two let-7 family members [55].

Numerous let-7 targets are directly involved in maintenance or induction of stemness.

A similar negative connection between and let-7 was also observed after knockdown of (using an shRNA targeting endogenous as previously described [10]) in CAKI-1 or HCT116 cells (Figure 5B ).

That (and p53) negatively correlates with expression of let-7 can be explained by a mo del in which both and p53 are part of a regulatory network.

This analysis suggested that miR-34a and let-7 inversely correlate with a p53 response which may directly affect the expression of.

The presence of affects the expression of let-7. Mo del of proposed regulatory network.

Thus, the mere presence of may affect let-7 expression.

We noticed that the p53 3′UTR contains a highly conserved seed match for let-7 (TargetScan 6.1) making this scenario a possibility.

While miR-34a was the miRNA that best correlated with the ability of cells to respond to activation of p53, the most significant correlation between p53 responsiveness and the expression of miRNAs was a negative correlation with the let-7 family of miRNAs.

Future studies are aimed at determining the mechanism of suppression of let-7 by p53 and.

A mo del for the role of the/let-7/p53/miR-34a regulatory network and its potential relevance in cancer stem cells.

In summary, we propose that is part of a novel regulatory network together with p53 and the miRNAs let-7 and miR-34a.

We have discovered a p53 regulated network that involves, miR-34a, and let-7. Every component of this novel network has crucial functions in the generation or maintenance of cancer stem cells (CSCs).

The let-7 family of miRNAs is a key regulator of embryogenesis and differentiation.

The let-7 miRNAs are possibly the best studied family of stemness regulating miRNAs.

Based on these data we now formulate a hypothesis that links all of these players,, p53, miR-34a, and let-7, in a regulatory network (Figure 6 ).

is a negative regulator of let-7..

Direct evidence of a negative feedback loop between let-7 and in multiple cancer cell lines has also been reported [21].

Such miRNAs include the let-7 [20], miR-200 [60], and miR-34 families of miRNAs [61]– [64].

All let-7 family members are highlighted in yellow and miR-34a in light blue.

Among the top ten miRNAs to most negatively correlate with p53 response status were 6 of the 9 distinguishable let-7 activities.

Interestingly, an inverse connection between let-7 and has been reported.

Similar data were obtained for other let-7 family members including let-7g and d (data not shown).

We recently identified let-7 as a significant marker for Type II cells [15].

miR-34a and let-7 are functional opposites of p53-responsiveness.

Let-7. p53 and miR-34.

Interestingly, Type II cells were more sensitive to apoptosis induction when treated with solubleL, and Type I cells were more sensitive when treated with the agonistic anti-CD95 antibody anti-APO-1. While let-7 was found to be a marker of differentiation in the NCI60 cells it did not correlate with the sensitivity of cells to -mediated apoptosis even though signaling through was different between the two differentiation stages [15], [22].

16

In summary, we found that BR-DIM up-regulated the expression of the let-7 family and consequently down-regulated the expression of EZH2 not only in PCa cell lines but also in human PCa tissue specimens from our on-going phase II clinical trial.

To further determine the biological consequence of the let-7 family expression in the regulation of EZH2 expression, we transfected PC3 and PC3 PDGD-D cells with let-7 precursors, and the results showed that let-7 family members could significantly inhibit the expression of EZH2 in these two cell lines (Fig. 2A, middle and lower panel).

BR-DIM treatment led to the upregulation of the let-7 family and consequently down-regulated the expression of EZH2 in PCa cells.

Figure S1 BR-DIM treatment upregulated let-7 expression and consequently reduced EZH2 expression in LNCaP cells at different time points.

The let-7 family is commonly viewed as a tumor suppressor consistent with down-regulation of oncogenes such as Ras [10], high mobility group A2 (HMGA2) [11] and c-myc [12] by binding to 3′UTR of these target mRNAs.

The results obtained from eleven tumor specimens from this phase II clinical trial are exciting because it showed, for the first time, that let-7 miRNAs could be upregulated in tumors by BR-DIM intervention with consequent down-regulation of EZH2.

BR-DIM intervention in PCa patients resulted in the increased expression of let-7 family and consequently inhibited EZH2 expression in tumor tissues.

We found that the overexpression of let-7 family significantly inhibited the clonogenic growth of PC3 PDGF-D cells, which initially showed lower expression of let-7 (Fig. 2D).

0033729.g002 Figure 2 (A) Expression of EZH2 was found to be higher in PCa cell lines compared with immortalized prostate epithelial cell lines: PZ-HPV-7 and RWPE-1 (upper panel) and transfection of let-7 precursors inhibited EZH2 expression in PC3 and PC3 PDGF-D cells 3 days after transfection (middle and lower panel).

We have searched targets of the let-7 family using TargetScan software and we found that EZH2 could be regulated by the let-7 family because there is a specific binding site in the 3′UTR of EZH2 mRNA.

Therefore, finding novel approaches by which one could re-express the lost miRNAs such as let-7 family with consequent down-regulation of EZH2 could become a newer avenue for the prevention of PCa and/or treatment of aggressive PCa.

Expression of EZH2 was increased in PCa tissue specimens and was inversely correlated with the expression of the let-7 family.

Enhancer of Zeste homolog 2 (EZH2) is one of the targets of the let-7 family of miRNAs, and that the expression of EZH2 is strongly associated with molecular features of both normal stem cells and CSCs or CSLCs.

Moreover, More interestingly, the data from our on-going phase II clinical trial showed that BR-DIM treatment of PCa patients prior to radical prostatectomy led to the enhanced expression of let-7a, let-7b, let-7c, and let-7d in tumor specimens after BR-DIM intervention (Fig. 4A–C), and these results are consistent with decreased expression of EZH2 (Fig. 4D).

The results showed that let-7a, let-7b, let-7c and let-7d was highly expressed in prostate tissues and their expression was lost in human PCa tissue specimens (* p<0.05, ** p<0.01).

Our results showed that the let-7 family, especially let-7a, let-7b, let-7c and let-7d are highly expressed in human normal prostate tissue specimens and their expression was lost in PCa tissues, especially, in patients with aggressive (higher Gleason grade tumors) tumors.

These results were consistent with corresponding increased expression of EZH2, which appears to be a target of the let-7 family.

Our results suggest that the loss of expression of let-7 with a consequent over -expression of EZH2 could be associated with PCa aggressiveness.

In the current study, we found loss of expression of let-7 family consistent with over -expression EZH2 in PCa cells and in human PCa tissue specimens, especially in tumors with higher Gleason grade.

The results from correlation analysis showed that let-7 expression was inversely associated with EZH2 expression in patients with higher Gleason grade tumors.

Let-7 regulated EZH2 expression, and inhibited clonogenic growth capacity of PCa cell lines.

Therefore, our results suggest that BR-DIM could be an important agent to re-express the lost miRNAs especially the let-7 family, which would reduce the level of EZH2 expression and compromise CSCs or CSLCs function.

Interestingly, let-7 family members have been demonstrated to regulate the self-renewal capacity of breast cancer cells [17] and PCa cells by regulating stem cell -associated factors such as Oct4, Sox2, and Nanog expression [18].

Recent studies have also documented that let-7 could regulate the expression of Lin28 and Lin28B, which in turn block the accumulation of mature let-7 [19].

These results suggest that let-7 family regulates the expression of EZH2.

Emerging evidence suggests that deregulated expression of many microRNAs (miRNAs) including the let-7 family contributes to cancer progression and recurrence [8].

In order to gain further mechanistic insight, we tested whether let-7 could directly repress the expression of EZH2 by binding to 3′UTR of EZH2 mRNA.

Let-7 repressed EZH2 expression and inhibited clonogenic growth of PCa cells.

The results from miRNA expression by mircroarray expression profiling showed that all the members of the let-7 family (miR-98 was undetectable) decreased in the PCa tissues compared to adjacent normal tissue specimens (Fig. 1A).

Moreover, decreased let-7 expression was found in many cancers, including PCa [13], and it has been linked with poor patient prognosis in lung cancer [14], head and neck squamous cell carcinoma [15], and ovarian cancer [16].

BR-DIM treatment increased let-7 and consequently reduced EZH2 expression.

Therefore, we have determined and confirmed the expressions of let-7a, let-7b, let-7c, and let-7d in all the cases including 129 PCa tissue specimens and 94 adjacent normal tissue specimens.

Expression of the let-7 family was lost in prostate cancer (PCa) tissue specimens.

These results suggest that the loss of let-7 could be responsible for increased expression of EZH2.

In the present study, we found that BR-DIM treatment increased the expression of let-7 family in several PCa cell lines including LNCaP, C4-2B and PC3 cells (Fig. 3A and Fig. S1A–C).

In this study, we found that the expression of the let-7 family was lost in PCa tissue specimens with Gleason grade 7 or higher but not in patients with Gleason grade 6 tumors.

Notably, we found that the expression of let-7a, let-7b, let-7c, and let-7d was decreased in normal prostate tissues from Gleason grade 7 and higher compared with normal tissues obtained from patients with Gleason grade 6. These results suggest that the normal prostate tissues obtained from patients with higher Gleason grade tumors are not normal, which is consistent with a field-effect of prostate carcinogenesis [38].

These results suggest that the let-7 family could play a key role in the progression of PCa by maintaining and regulating molecular features of CSCs or CSLCs in PCa; however, how let-7 family contributes to PCa aggressiveness is unknown.

Moreover, we found that the expression of let-7a, let-7b, let-7c and let-7d were accurately measurable compared to other family members because their expressions were very low (Fig. 1A).

We co -transfected EZH2 3′UTR luciferase plasmid and let-7 precursors, and found that let-7a, let-7b, let-7c, and let-7b could strongly inhibit EZH2 3′UTR luciferase activity compared to transfection of cells with control miRNA (Fig. 2B).

Our data suggest that the let-7 family of miRNAs also be responsible for the regulation of EZH2 in human PCa.

We observed that the expressions of the let-7 family in grade 6 tumors are not statistically different compared to normal control.

0033729.g003 Figure 3 (A) Total RNA was isolated from LNCaP, C4-2B and PC3 cells treated with 25 µM BR-DIM for 24 h and the results from real time RT-PCR showing that the expression of let-7 was increased following BR-DIM treatment compared to untreated control (c: DMSO control).

We discovered that the expression of the let-7 family in histologically normal prostate tissues from Gleason grade 7 or higher tumor was decreased compared to histologically normal tissue from Gleason grade 6 tumors (data not shown), suggesting that the histologically normal tissues from the prostate gland of patients with higher grade tumors are not normal.

Loss of the let-7 family inversely correlated with increased expression of EZH2 in PCa tissue specimens compared to adjacent normal prostate tissues.

Although it is known that the let-7 family is associated with maintenance of stem cell signature, which is believed to be strongly linked with cancer recurrence, the mechanism by which let-7 family regulates the stem cell signatures is unknown.

Moreover, the results from 3′UTR of the EZH2 luciferase assay and further confirmed that let-7 could repress EZH2 expression by binding to 3′UTR element of EZH2 mRNA.

The results from soft agar assay further showed that the treatment of C4-2B cells with 10 or 25 µM BR-DIM reduced the colony size and numbers (Fig. 5C and 5D), suggesting that BR-DIM could eliminate tumor cells especially the cells with CSCs or CSLCs characteristics by up -regulating let-7 family and consequently by down -regulating the expression of EZH2.

However, we found a significantly decreased expression of let-7a, let-7b, let7c and let-7d in PCa with Gleason grade 7 or higher tumors compared to normal tissue control (Fig. 1B).

Here we also provide evidence for the role of BR-DIM (formulated DIM: 3,3′-diindolylmethane, abbreviated as either BR-DIM or B-DIM) in the regulation of let-7 and EZH2 in PCa cells as documented by our pre-clinical findings as well as findings from our on-going phase II clinical trial in PCa patients received BR-DIM prior to radical prostatectomy.

These results suggest that the loss of let-7 family could be associated with PCa aggressiveness especially because the lower grade tumors were no different from the normal tissue control, whereas higher grade tumors were different.

Cells were transfected with 40 nmol/L of let-7 precursors or miRNA precursors negative control#1 (Ambion, Austin, TX) using DharmaFECT3 transfection reagent (DHARMACON, Lafayette, CO).

To determine the levels of the let-7 family in PCa tissue specimens, we collected pre-treatment PCa tissues and matched adjacent normal tissue specimens (used as control for comparison with tumor tissues).

The let-7 binding sites in the 3′UTR of EZH2 mRNA are shown in Figure 2C.

PC3 PDGF-D cells with lower levels of let-7 were seeded at a density of 6×10 [3] cells/well in a 96-well plate and incubated for 24 h. The cells were co -transfected with EZH2 3′UTR luciferase plasmid (Origene, Rockville, MD) or Renilla luciferase plasmid and control miRNA, let-7a, let-7b, let-7c, and let-7d precursors using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO).

C4-2B, PC3 PDGF-D, and PC3 PDGF-D cells transfected with the let-7 family for 24 h were collected after trypsinization, and re-suspended in the complete medium.

The human let-7 family consists of let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i and miR-98.

17

The targets of let-7 include oncogenes as well as genes frequently found upregulated in tumors (LIN28 itself is a target of let-7), therefore, let-7 may have tumor suppressive effects.

In fact, treating with #44 for 2 days followed by treatment withdrawal for 2 days completely reversed the effect of this compound on various let-7 target genes (Fig.   3D), suggesting that this compound transiently regulated expression of let-7 targets.

RT-PCR for HMGA2 showed that #44 could suppress expression of this let-7 target gene in as few as 8 hours (Fig.   3C).

The fact that 3 out of 5 let-7 targets were suppressed by #44 could suggest that let-7 activity is induced in these cells, and let-7 levels are altered depending on their endogenous expression levels.

Finally, we performed a pulse-chase of treatment with #44 to determine if the effect on let-7 targets was permanent or instigated a feed forward program of suppression of let-7 targets.

Finally, treatment of HUH cells with cAMP itself also led to a downregulation of HMGA2 (Fig.   5F), further suggesting that at least some let-7 target genes are regulated by cAMP signaling.

It is possible that by downregulating LIN28B and/or upregulating let-7 activity, cancer progression can be reversed.

To measure complete degree to which #44 could regulate gene expression in Huh cells, we carried out RNA-seq to identify which genes are changed in response to treatment with these compounds and whether let-7 targets are enriched amongst these gene expression changes (Fig.   5B).

Compounds found in the HTS to significantly stimulate or inhibit Renilla luciferase expression, suggesting let-7 activity regulation, were procured from the MSSR and plated at 10uM on Huh7.5.1 reporter line cells in 48-well.

In addition, we found that the Huh cell line expressed a number of let-7 targets that could be tightly regulated by changes in let-7 levels (Fig.   1C).

We chose this gene because it is expressed in several different isoforms, only one of which has more than one let-7 target site in its 3′ UTR.

Here we describe small molecule screening for compound that affect the expression of let-7 targets.

Figure 2A secondary screen to Identify compounds that suppresses let-7 targets.

#44 appeared to dramatically slow the growth of Huh cells at 1uM, the same dose used to effectively suppress let-7 targets (Fig.   6A).

Furthermore, let-7 activity is tightly controlled to ensure appropriate regulation of their target genes, and misregulation of let-7 is strongly associated with inappropriate growth of the liver [19].

Screening using expression of let-7 target genes.

Currently, the experimental approaches employed to modulate LIN28 activity includes RNAi or overexpression; whereas let-7 activity can be induced by transfection of let-7 mimics or suppressed by antagomirs [12].

Treating a AML cell line with #44 also showed a dose-responsive effect on those let-7 targets that are expressed (Fig.   3E).

In response to the downregulation of LIN28B, mature microRNA levels rose about 2 to 3 fold for all let-7 family members (Figure  S1D).

Perhaps as a consequence, treatment of AML cells significantly upregulated mature let-7 levels in MOLM-13, THP-1 and HL60 cell lines (Fig. 2E).

As an alternative method designed to minimize the identification of molecules that target luciferase, we transiently transfected replicate wells with a PSI-Check2 plasmid that either contained the let-7 seed sequence or a clean version that should not be regulated by let-7. We then quantified the signal change in the screen as a function of the effect on the luciferase without let-7 sites (Fig. S 1E and H), and as a function of internal controls on each reporter consisting of alternate luciferase gene (firefly) driven by a constitutive promoter.

Huh 7 transiently expressing let-7 luc and Psi-Check2 line cells in were grown in standard Huh media including: DMEM High Glucose (Invitrogen), 10% FBS (HyClone), 1% HEPES Buffer (Invitrogen), 1% NEAA (Invitrogen), 1% penicillin/streptomycin, 5ml L-Glutamine.

These let-7 family members of miRNA are known to regulate developmental timing and cell-fate decisions in less complex organisms 6, 7. let-7 family members have identical seed sequences and divergent stem-loop regions.

While this approach was useful to narrow the list of candidates, we found in subsequent experiments that many of the candidates passing this secondary screen either had small or highly variable activities on let-7 activity when judged by relative amounts of let-7 target genes (data not shown).

We posited that it should be possible to use small molecules to modulate levels of let-7 targets to influence differentiation or the progression of cancer [14].

We generated a stable let-7-luciferase reporter line (Huh7.5.1 L7L), which expresses far less luciferase mRNAs (and proteins) than transiently transfected cell lines.

The Renilla luciferase gene was driven by T7 promoter and contained eight let-7 targeting sequences in the 3′ UTR, and Firefly luciferase driven by a constitutive promoter as a transfection control.

Lin28B has been proposed to chaperone primary let-7 (pri-let-7) in the nucleolus and away from the processing machinery, thus inhibiting its maturation.

After eliminating false positive hits, several potential let-7 stimulators and inhibitors remained (Fig.   2A).

As expected, many of the false positive appeared to target luciferase enzymes, and not let-7 activity.

By quantifying the relative expression of the HMGA2 isoform with many let-7 sites versus all HMGA2 isoforms, we could identify specific activation of let-7 activity without the use of an exogenous reporter.

Generation of a Huh7 cell line stably expressing a let-7 activity reporter.

In short, the Renilla luciferase is flanked by 8 repeats of let-7 target sequence and therefore its mRNA will be subject to a higher rate of degradation in the presence of a higher let-7 activity.

To determine the general applicability of #44 to influence let-7 target expression, we measured the effect of this compound on various Acute Myeloid Leukemia (AML) cell lines each with well-characterized expression levels of let-7s and LIN28.

As let-7 miRNAs are highly expressed in Huh7 cells, endogenous changes of mature let-7miRNA levels are difficult to detect.

We proceeded to validate the top potential let-7 stimulators and potential let-7 inhibitors.

Our own data and that of many others has shown that the LIN28/ let-7 circuit can be exploited to regulate developmental progression in various murine and human tissues [11].

To identify candidate regulators of let-7 activity from the screen more directly, we performed a tertiary screen that measured levels of the let-7 target HMGA2.

Most AML cell lines do not express high levels of let-7 miRNA levels.

In the cytoplasm, Lin28A recruits the TUTase Zcchc11 to inhibit the maturation of precursor let-7 (pre-let-7) [5].

On the other hand, because let-7 activity is typically diminished in human tumors, any reagents that could block the induction of let-7 targets would potentially be important to the treatment of cancer.

Cancer cells have been show to exhibit reduced malignancy and motility when LIN28 is suppressed and let-7 activity is elevated [13].

This demonstrated that strong induction of let-7 levels by direct transfection was able to effectively silence the reporter (Fig.   1E).

We observed a high level of LIN28B expression at both the RNA and protein level (Fig. S 1B and C); and as a result, a low level of let-7 activity, as shown by let-7-luc luciferase assay (Figure  S1A).

The initial screens with the let-7 reporter stably introduced into Huh cells generated significant numbers of false positives in both directions.

As a result, we were able to screen for molecules that affected let-7 activity directly, after controlling for both luciferase and transfection efficiency (Fig.   1A).

Alternatively, a fluorescence -based reporter on let-7 activity should also be considered in future screening efforts to reduce false positives due to inhibition or stimulation of the luciferase enzyme itself.

Generation of a Huh7 cell line stably expressing a let-7 activity reporterWe and others have shown that let-7 activity can be precisely assayed using a luciferase -based method (PSI-Check2 let-7 8X, Fig.   1A).

Figure 1Design of screen to identify regulators of let-7 activity.

The High Throughput Screen (HTS) measures renilla luciferase expression as a function of let-7 activity in let-7 luc transfected Huh7 cells.

We have generated a cell -based mo del suitable for high throughput small molecule screening for let-7 activity modulators in 8 small molecule libraries.

siRNA against Lin28B and let-7 mimics were purchased from Dharmacon.

Figure 6Extended treatment of cancer cells with let-7 inducing compounds blocks their growth.

Compounds were added to individual wells of either Psi-check2 transfected Huh7 cells or Psi- let-7 transfected Huh7 cells.

Structural analysis revealed that these domains bind to the stem loop and the GGAG domains of let-7 precursors respectively, allowing specific interactions with various pre-let7 members 2, 3. Spatially, it has been suggested that Lin28B is localized in the nucleus and Lin28A resides mostly in the cytoplasm [4].

Huh7.5.1 was transfected with the selectable let-7 activity reporter using Lipofectamine 2000 (Life Technologies) according to manufacturer’s protocol.

Human liver cancer cell line (HUH) is transfected each with the let-7: Luciferase and PsiCheck2-control reporter plasmids.

Our own data show that cells carefully titrate let-7 activity to prevent cancer formation.

Positive controls were luciferase readouts of let-7 mimics, negative controls were luciferase signals from control treated cells.

The Amplicin-resistance cassette in psiCHECK2- let-7 8X was digested with BamHI and BglII (New England Biolabs) and the 5000 bp fragment containing the luciferase reporters (but no Amp [R]) was ligated with the linearized Pbabe Neo.

Therefore, when let-7 activity is increased, the renilla luminescence will be decreased.

Selectable let-7 activity reporter.

Indeed, loss of function of let-7 has been linked to cancer formation in murine mo dels [8].

Psicheck2 plasmid was manipulated to contain the let-7 seed sequence 8 times in tandem and linked to the renilla sequence.

siRNA and let-7 mimic transfection.

To demonstrate the dynamic range of detection in let-7 activity, we transfected this Huh7.5.1 let-7 luciferase reporter line (Huh7.5.1 L7L) with siRNA against LIN28B (Fig. S 1F), as well as let-7 mimics (Fig.   1D).

We cloned a Neomycin resistance cassette into the PSI-Check2 let-7-luciferase, and then stably introduced the reporter plasmid into the Huh7.5.1 cell line and selected with G418 for 3 weeks (Fig.   1B).

After 48 hour incubation, let-7-regulated Renilla luciferase and constitutively expressed Firefly luciferase were measured using Promega’s Dual-Luciferase Reporter Assay System and a GloMax 96 Microplate Luminometer (Promega).

Since this luciferase system reports for let-7 mediated degradation of the Renilla luciferase mRNA, it allowed a higher sensitivity for any reagents that can modestly change the let-7 activity.

Huh7.5.1 let-7 -luciferase line was transfected with Lipofectamine RNAiMax (Life Technologies) according to manufacturer’s protocol.

This was addressed by comparing the psiCHECK2- let-7 8 × luciferase reporter and the psiCHECK2 control luciferase reporter during the screening process to weed out false positive hits and prevent the loss of false negatives.

In addition, we used transfection of mimics of let-7s to determine how sensitive the reporter was to changes in let-7 levels (Fig.   1E and F).

18

Thus, γ, γ [1], γ [2] and γ [3], respectively, represents the coefficient of Lin28 expression inhibited by let-7, the coefficient of let-7 expression, the rate constant of let-7 expression, and the efficiency of let-7 expression inhibited by Lin28, after nondimensionalization.

κ [P] is the coefficient of Lin28 expression inhibited by let-7. Γ [1] is the coefficient of let-7 expression, Γ [2] is the rate constant of let-7 expression, and Γ [3] is a measure of the efficiency of let-7 expression inhibited by Lin28.

For example, miR-181 upregulates expression of let-7 by effectively repressing Lin28 expression, and eventually promoting megakaryocytic differentiation, thus providing insight into future development of miRNA-oriented therapeutics [33].

These findings may highlight why let-7 is required for normal gene expression in the context of cell development and oncogenesis, facilitating development of approaches to exploit the regulatory pathway by manipulating Lin28/let-7 axis for novel treatments of human diseases.

Our mo del of let-7 regulated by Lin28 may provide insights into understanding of how precise levels of let-7 are maintained in the context of cell development and oncogenesis, which would facilitate the development of approaches to exploit this regulatory pathway by manipulating Lin28/let-7 axis for novel treatments of human diseases.

let-7 is wi dely viewed as a tumor suppressor miRNA and its expression is downregulated in many cancer types compared to normal tissue during tumor progression.

We perturbed the inhibition of let-7 by Lin28 to study the contribution of the double negative feedback loop on the overall response curves of let-7. Firstly, we delete the Lin28 inhibition (γ [3] = 0) (Figure 4A), the results show that the absence of inhibition by Lin28 slightly change the S-shape of the let-7 response curve compared with γ [3] = 0.5, it pushes the off-state threshold of let-7 to the left on the diagram.

This suggests that the Lin28/let-7 pathway plays an important role in fine-tuning cellular processes of self-renewal and differentiation and Lin28A/B upregulation in some cases expression correlates with advanced tumor stage and poor prognosis [9].

Generally, the on-state of let-7 denotes early development where Lin28 is expressed at a very low level, the off-state represents other processes (e. g., cancer) where Lin28 is over-expressed.

Kim C. W. Vo M. T. Kim H. K. Lee H. H. Yoon N. A. Lee B. J. Min Y. J. Joo W. D. Cha H. J. Park J. W. Ectopic over -expression of tristetraprolin in human cancer cells promotes biogenesis of let-7 by down-regulation of Lin28 Nucleic Acids Res.

We perturbed the inhibition of let-7 by Lin28 to study the contribution of the double negative feedback loop on the overall response curves of let-7. Firstly, we delete the Lin28 inhibition (γ [3] = 0) (Figure 4A), the results show that the absence of inhibition by Lin28 slightly change the S-shape of the let-7 response curve compared with γ [3] = 0.5, it pushes the off-state threshold of let-7 to the left on the diagram.

By systematically analyzing the coarse grained mo del of let-7 biogenesis network in close association with plausible experimental parameters, we find that, in the presence of Lin28 inhibition, the system undergoes a transition from monostability to a bistability and then to a one-way switch as strength of positive feedback of let-7 increases, while in the absence of Lin28 inhibition, the system loses bistability.

It is well known that Lin28 can inhibit let-7 maturation and let-7 can inversely repress Lin28 expression.

α [M] denotes expression of let-7, α [P] describes the constitutive Lin28 expression due to signal transduction pathways activated by signals in the extracellular medium.

Interestingly, another recent study portrayed that lin28 mRNAs are themselves let-7 targets, their expression are repressed by let-7, thus promoting neural stem cell differentiation [16].

Figure 1 summarizes how the complex biogenesis network is coarse-grained to a mo del with two mutually inhibited components, which represent Lin28 and let-7. Unless otherwise noted, Lin28 is Lin28 protein; let-7 represents mature let-7. It is worth noting that, in the Lin28/let-7 feedback loop, we ignored the regulatory differences among members of Lin28 family (Lin28a and Lin28b) and members of let-7 family (let-7d, let-7f, let-7a, let-7b, let-7c, etc.

The presence of [Lin28] in the denominator accounts for the Lin28 -dependent down-regulation of let-7 biogenesis.

Thus we assume a Hill function (Γ 1 [l e t − 7 ] 2 Γ 2 + [l e t − 7 ] 2 + Γ 3 [L i n 28 ] ) that was used in the mo del of E2F/Myc/miR-17-92 feedback loops [26] to represent the auto-regulated mode of let-7, which is inhibited by Lin28.

At this critical threshold, the higher stable state of let-7 switches to the lower stable state (off-state), which is accompanied by the upregulation of Lin28.

Sakurai M. Miki Y. Masuda M. Hata S. Shibahara Y. Hirakawa H. Suzuki T. Sasano H. LIN28: A regulator of tumor-suppressing activity of let-7 microRNA in human breast cancer J. Steroid Biochem.

The trends of temporal expression profiles of let-7 in fluctuation cases are similar as those in the cases without fluctuation.

If the Lin28 inhibition (γ [3] = 0) were deleted, γ has no effect on let-7 response curves (Figure 5A–C), and the systems display only the one-way switch.

The higher stable state denotes the let-7 level in an on-state, in which increased let-7 levels reduce proliferation and lead to the decrease of several oncogene targets including Myc [36].

Note that, when we use “on” and “off” state, the level of let-7 (ψ [s]) or the coefficient of let-7 expression (γ [1]) used to correlate with entry into or exit from a certain state needs to be clearly specified.

Effects of Expression of Lin28 and let-7 on Switching Behavior.

Rybak A. Fuchs H. Hadian K. Smirnova L. Wulczyn E. A. Michel G. Nitsch R. Krappmann D. Wulczyn F. G. The let-7 target gene mouse lin-41 is a stem cell specific E3 ubiquitin ligase for the miRNA pathway protein Ago2 Nat.

This mo del prediction is consistent with observations in many normal and cancer (or differentiated) cells that expression levels of let-7 and Lin28 are reciprocal [3, 31, 32].

Therefore, our results suggest that deactivation of Lin28 in some cancer cells may greatly enhance the let-7 -dependent tumor suppression and improve the treatment efficiency.

It can be observed that the let-7 activity occupies a higher stable steady state until the inhibition of let-7 by high concentration of Lin28 reaches the limit point of stable and unstable steady states.

The other parameters ε = 0.02, γ [2] = 1. We note that ε = β [M] /β [P] represents the ratio of the degradation rates of let-7 and Lin28, α = α [M] /α [P] denotes the ratio of the expression rates of let-7 and Lin28.

let-7 activity presents discontinuous bistable behavior with respect to inhibition of Lin28 (Figure 2).

Hagan J. P. Piskounova E. Gregory R. I. Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells Nat.

Cimadamore F. Amador-Arjona A. Chen C. Huang C. T. Terskikh A. V. SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors Proc.

Despite concrete progress, a lot of mechanisms such as bistability and oscillations need to be further researched in a cellular system, which can help us to understand the crucial roles of let-7 in gene regulation and physiological functions.

Effects of Dual Negative Feedback Regulation of Lin28 and let-7 on Switching Behavior.

This Lin28/let-7 axis has been demonstrated to play central roles in cell differentiation and development [9].

According to this equation, the steady states of let-7 and Lin28 increase or decrease in the opposite direction.

Although this predicted result has not been validated by experimental methods, it might also be a desirable property for such a system because the Lin28/let-7 axis is central to maintaining proper cell fate and coordinating proliferation, growth, and energy utilization at the cellular level as well as growth, developmental timing, tissue homeostasis, and metabolism in whole organisms [9].

Precise regulation of let-7 by Lin28 is a rapidly growing field and it points to the importance of small RNA metabolism in disparate fields of mammalian biology [9].

Since it is one of the factors required for pluripotency of cells, let-7 involved in a regulatory feedback loop with Lin28 is essential for stem cell differentiation and maintenance [33, 34].

In addition, although gene regulatory processes including Lin28/let-7 axis are typically subject to considerable delays induced by the underlying biochemical reactions, the impacts of a time delay would probably not qualitatively change the results of a negative feedback loop [44, 45].

For let-7, transcription of the let-7 gene is positively regulated by let-7 and can therefore be considered to act as an auto-regulatory positive feedback loop.

let-7, an important member of the miRNA family, was originally identified in C. elegans and found to be conserved in controlling late temporal transitions during embryonic development across animal phylogeny [8].

Then, we increase the strength of inhibition by Lin28 (γ [3] = 1) (Figure 4C), it also maintains the S-shape of the let-7 response curve compared with γ [3] = 0.5, while it pushes the off-state threshold of let-7 to the right on the diagram (Figure 4C).

Finally, the dynamics of Lin28 and let-7 concentrations are respectively described by following Equations (1) and (2).

Figure 6Dynamic behaviors of let-7 in response to different ε and α.

Both dimensionless parameters determine the steady states of let-7 and Lin28, and affect the switch behavior.

Since half-life of let-7 after Tamoxifen (TAM) treatment is about 4 h [27], and half-life of Lin28 is about 1.5 h [28], thus ε is about 0.4. α is allowed to vary in the range of 0~0.4.

Implications of Lin28/let-7 Axis in Cancer Treatment.

β [P] and β [M] denote the degradation rates of Lin28 and let-7, respectively.

Li X. Zhang J. Gao L. McClellan S. Finan M. A. Butler T. W. Owen L. B. Piazza G. A. Xi Y. MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit Cell Death Differ.

For examples, increased biogenesis of let-7 in differentiated cells represses progenitor cell-specific mRNA to increase the fi delity of cell fate transition during differentiation [3, 34], while exogenous Lin28 rescued the neural precursors (NPCs) proliferation and some neurogenic deficits in the absence of SOX2 [34].

Figure 1Schematic illustration of the let-7 biogenesis network involving Lin28.

It functions in blocking the processing of let-7 at both pri- and pre-miRNA steps [13, 14], since Lin28 recruits terminal uridylyl transferase-4 (TUT4) to add uracil to the 3' end of pre-let-7, thereby resulting in blockade of let-7 maturation [15].

Although mRNAs are generally less stable than many proteins, this is not the case for miRNAs, which are up to 10 times more stable than mRNA [37], for example, let-7 [37] is more stable than Lin28 [38].

Besides, the threshold that makes bistability of let-7 switch to monostability is also increased (Figure 4D).

In (A) and (B), γ [3] = 0, γ = 0.1, ε = 0.02, γ [2] = 1; in (C) and (D), γ [3] = 1, γ = 0.1, ε = 0.02, γ [2] = 1. In addition, we investigate the effects of let-7 inhibitory strength (γ) on switching behavior.

These findings imply that a double -negative feedback loop is established between let-7 and Lin28 during cell differentiation (Figure 1A).

Increasing value of ε would enhance the amplitude of let-7 fluctuation, suggesting that large ε value decreases the stability to resist stimulus fluctuations.

Figure 2The dimensionless let-7 concentration ψ [s] as a function of α under steady state conditions.

From the figure, we find that as the value of ε increases, let-7 undergoes a faster transition from off to on state.

Therefore, for convenience, we assign the lower/higher let-7 concentration as the off/on state.

This result suggests that the posttranscriptional modification of Lin28 activity during let-7 biogenesis and the interruption of Lin28/let-7 axis may play a central role in carcinogenesis.

This suggests that very high level of let-7 may interrupt the Lin28/let-7 feedback circuit, and disables the cell to maintain and transmit its state.

This established the Lin28/let-7 axis which is highly conserved across the animal kingdom and nematode worms and operates as a switch function to maintain either a differentiated or an embryonic cell fate [9].

Rybak A. Fuchs H. Smirnova L. Brandt C. Pohl E. E. Nitsch R. Wulczyn F. G. A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment Nat.

We provide the dynamic behaviors of let-7 in response to environment fluctuation described by Gaussian white noise with mean α = 0.2 and variance 0.05 (Figure 6B).

Since module let-7 with a positive feedback loop can create switching behavior, it has two possible stable states in the appropriate parameter regime.

When γ [1] ≥ 2.48 in Figure 3A (e. g., γ [1] = 3, 4), a portion of the S-shaped response curve of let-7 is pushed onto the negative regime of the diagram therefore the off-state threshold of let-7 is a negative number.

Effects of the Positive Feedback of let-7 on Switching Behavior.

Therefore the regime of γ [1] is enlarged to keep the bistability of let-7. For instance, when 2.48 ≤ γ [1] < 2.87, the system still has bistable switching behavior (Figure 4C).

In (A) and (B), γ [3] = 0, γ = 0.1, ε = 0.02, γ [2] = 1; in (C) and (D), γ [3] = 1, γ = 0.1, ε = 0.02, γ [2] = 1. In addition, we investigate the effects of let-7 inhibitory strength (γ) on switching behavior.

The value of the parameter Γ3 is a measure of the efficiency of Lin28 inhibition of let-7 biogenesis, and it combines all factors that influence Lin28 to block the biogenesis of let-7. For Lin28, the efficiency of Lin28 mRNA degradation is associated with the binding of the let-7. Thus we assume a term β P [L i n 28 ] [l e t − 7 ] [l e t − 7 ] + κ P for describing degradation of Lin28.

Due to its functional importance, major progress has been made in understanding the basic mechanism of let-7 biogenesis.

The dynamic behaviors of let-7 in response to ε = 0.1 and 0.375 are illustrated in Figure 6A.

As the α decreases, the activity of let-7 moves toward the left of the bifurcation diagram along the upper stable state and remains in an on-state when α equals to zero.

Moreover, the ratio of degradation rates of let-7 and Lin28 is critical for the switching sensitivity and resistance to stimulus fluctuations.

19

Our comparison of the ability of hbl-1- and lin-41-knockdown to suppress a let-7 null mutation reveals that lin-41 has a more significant role downstream of let-7. Therefore, we propose that hbl-1 is the most proximal regulator of L2 fates, being regulated by the three let-7 paralogs, and lin-41 is let-7's target for controlling later events (Figure 5).

First, because LIN-28 protein is down-regulated by the L3, we must consider the time of let-7 expression.

The ain-1 mutation did substantially suppress the precocious adult alae phenotype of a lin-28 mutant, as if let-7 was fully active, demonstrating that the ain-1 mutation was able to reduce although not eliminate microRNA function in seam cell development (Table 2, line 11).

We observed that the two let-7 target genes differed in their abilities to suppress this phenotype: penetrance of let-7's retarded defect was reduced from 100% to 80% by hbl-1(RNAi), whereas it was reduced to 6% by lin-41(RNAi) (Table 4).

We established stable lines carrying each construct and found that those with the chimeric pre-let-7 expressed higher mature let-7 in early larval development than those with the wildtype pre-let-7 (Table S5).

We observed that let-7 was up-regulated 42-fold in the absence of lin-28, and that no other microRNA was affected more than 1.5-fold (Table S3).

The serendipitous discovery that mammalian LIN28 binds to and inhibits let-7 precursor processing [26], and the subsequent proof that this mechanism is evolutionarily conserved in C. elegans [29], [31], caused us to consider what their molecular interaction means for the regulation of cell fate succession in C. elegans.

Given the redundancy of the three let-7 paralogs mir-48, mir-84, and mir-241 in regulating L2 fates, two alternatives seem likely: either lin-28 inhibits the accumulation of multiple let-7 family members, including these three let-7s known to control the L2-to-L3 transition, or let-7 is at least partially redundant with its relatives in controlling this early fate transition.

Therefore, the inhibition of mature let-7 accumulation is likely the means by which lin-28 governs seam cell development after the L2.

Its inhibition of let-7 microRNA processing is a novel form of gene regulation and offers a molecular explanation for how lin-28 controls cell fate succession in C. elegans.

LIN-14, LIN-28, HBL-1 and LIN-41 are expressed at the start of larval development and are eventually repressed by the microRNAs lin-4, let-7 and the three let-7 family members miR-48, miR-84, and miR-241 (3 let-7s).

This observation indicates that lin-28 is a positive regulator of hbl-1 expression that acts independently of the let-7 relatives.

Curr Opin Genet Dev 6 Abbott AL Alvarez-Saavedra E Miska EA Lau NC Bartel DP 2005 The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans.

In other words, to explain the relevance of let-7 to lin-28 function, we hypothesized that lin-28 acts in two mechanistically independent steps: first to control early fates and second to control later fates via direct action on pre-let-7. Ambros and Horvitz documented that some seam cell lineages in lin-28 null mutants display precocious development that skips two larval stages [1], [55].

Thus we could construct a version of let-7 that encoded the loop sequence of Drosophila pre-let-7 and thereby was insensitive to LIN-28's inhibitory activity.

Thus, a parsimonious explanation for lin-28's inhibition of let-7 in C. elegans is that it constitutes the second of two activities.

hbl-1 has been shown to be the primary target of let-7's relatives mir-48, mir-84; and mir-241 [6].

The let-7 family microRNAs have two known targets in the heterochronic pathway: hbl-1 and lin-41.

Histograms depicting the temporal expression profiles of (A) let-7, (B) miR-84, (C) miR-48 and (D) miR-241 levels in wild type (grey bars) and lin-28(n719) (blue bars).

Therefore, because lin-28 regulates no other microRNA in the same manner it regulates let-7, we conclude that it possesses a different molecular activity to control L2 cell fates.

1002588.g001 Figure 1Histograms depicting the temporal expression profiles of (A) let-7, (B) miR-84, (C) miR-48 and (D) miR-241 levels in wild type (grey bars) and lin-28(n719) (blue bars).

Given that the premature accumulation of mature let-7 does not account for lin-28's precocious phenotype, why then does LIN-28 inhibit let-7?

The Relative Roles of hbl-1 and lin-41 The let-7 family microRNAs have two known targets in the heterochronic pathway: hbl-1 and lin-41.

In other words, to explain the relevance of let-7 to lin-28 function, we hypothesized that lin-28 acts in two mechanistically independent steps: first to control early fates and second to control later fates via direct action on pre-let-7. Ambros and Horvitz documented that some seam cell lineages in lin-28 null mutants display precocious development that skips two larval stages [1], [55].

Early reports showed mature let-7 rising in the L4 stage, however as microRNA detection methods have improved, expression of mature let-7 could be seen a full stage earlier [6], [49].

Considering the long evolutionary association of lin-28 and let-7 with cell fate succession in diverse contexts, we propose that having two sequential, mechanistically distinct activities is critical to lin-28's role in governing successive developmental transitions.

lin-28 Has Two Separable ActivitiesWe were surprised that despite the evolutionary conservation of lin-28's ability to block let-7 accumulation, this activity is not required for its primary effect on C. elegans larval development, namely the normal execution of L2 cell fates.

Our results show, however, that lin-28 does not act via any of these let-7 family members in its primary role in C. elegans development.

lin-28 Acts Independently of let-7 MicroRNAs to Control Cell FatesTo test whether let-7 family microRNAs are required for lin-28's developmental activity, we examined mutants lacking both lin-28 and let-7 family members.

let-7 Controls L4 Development.

These observations suggest that let-7 acts primarily through lin-41 to regulate seam cell differentiation.

To test whether let-7 microRNAs indeed mediate lin-28's developmental function we first examined its ability to interact with precursor forms of let-7 relatives.

Thus we propose that let-7 (and possibly other regulators believed to control the L4-to-adult transition such as lin-41) act earlier than previously thought.

To test whether let-7 family microRNAs are required for lin-28's developmental activity, we examined mutants lacking both lin-28 and let-7 family members.

Thus, it is LIN-28's direct action on pre-let-7 that exerts influence on those later events via lin-41.

We were surprised that despite the evolutionary conservation of lin-28's ability to block let-7 accumulation, this activity is not required for its primary effect on C. elegans larval development, namely the normal execution of L2 cell fates.

To construct mir-48 mir241; mir-84 let-7 quadruple mutants, animals of the genotype mir-48 mir-241; mir-84 unc-3 let-7/+ were cultured on hbl-1(low RNAi) (see below) to suppress the lethality characteristic of these mutations.

Therefore, one possibility is that let-7 mutants reiterate L3 developmental events in the L4 stage.

Similarly, lin-28 first determines what events occur in the L2, then by its positive regulation of lin-41 via let-7, influences events of the L3.

Vertebrate homologs of several heterochronic genes, including lin-28, lin-41, and let-7, have developmental roles in a variety of contexts [11]– [16].

4Strains carrying the let-7 mutation additionally contained a linked unc-3 mutant allele.

let-7 Controls L4 Development let-7 is thought to act during the L4 stage to cause the L4-to-adult transition, including the terminal differentiation of seam cells [2].

A let-7 null mutant causes retarded development by reiterating larval fates and delaying differentiation [2].

lin-28 and let-7 had been thought to act at wi dely separated times in C. elegans larval development, with lin-28 controlling an early, proliferative fate of seam cells and let-7 controlling their terminal differentiation two larval stages later [3], [58].

The LIN-28 protein is known to bind to and block the maturation of the small RNA encoded by let-7. This mechanism would seem to explain lin-28's role in development.

It remains possible that other let-7 family members mediate lin-28's control of L2 fates, however, the LIN-28 protein interacts with none these (Table 1), and no microRNAs other than let-7 itself are dysregulated in a lin-28 null mutant (Table S3).

let-7 is thought to act during the L4 stage to cause the L4-to-adult transition, including the terminal differentiation of seam cells [2].

To analyze the V5 cell-lineage in let-7 mutant males, wIs78; him-5(e1467) males were crossed to wIs78; mnDp1(X:V)/+;unc-3(e151) let-7(mn112) X hermaphrodites and Unc males among the cross progeny were examined for V5 seam cell divisions.

E, a hbl-1::GFP::unc-54 3′UTR reporter in lin-28; mir-48 mir-241; let-7 mir-84 (lin-28; 4 let-7s).

Earlier studies of the C. elegans heterochronic pathway had not addressed the issue of whether lin-28 requires let-7 microRNAs for its function [2], [29], [39].

Furthermore, changes in let-7 levels do not fully account for Lin28's activity in this system.

C. elegans LIN-28 protein interacted with pre-let-7, pre-miR-48, pre-miR-84 and pre-miR-241, but not with the other let-7 family pre-microRNA sequences (Table 1; Figure S1).

However, this strain did not make precocious adult alae (Table 2, line 8), indicating that let-7 is required by lin-28 after the L2.

A modified version of this sequence was made by replacing the C. elegans pre-microRNA loop sequence with that of Drosophila let-7 (see Table S1).

Two of these genes, lin-28 and let-7, are evolutionarily conserved in animals where they have roles in pluripotency and differentiation.

The three let-7 family members mir-48, mir-84, and mir-241 act redundantly to control seam cell fates: when they are deleted together, the L2-specific symmetric cell division is reiterated, resulting in supernumerary seam cells [6].

1002588.g004 Figure 4Nomarski images of wild type (A) and let-7 null (B) L4 males approximately 8 hours after the L3 molt.

However, another possibility is that let-7 acts earlier together with its relatives in a previously unrecognized role, which would explain lin-28's action upon it.

A 2.5 kb let-7 genomic sequence identical to the rescuing fragment used previously [2] was cloned into pCR2.1-TOPO (Invitrogen).

We surmised that lin-28 might act on a microRNA unrelated to let-7 to control L2 events.

We and others have observed that let-7 accumulates in the L3 stage in wild type, a stage earlier than originally reported (Figure 1) [2], [6], [48], [49].

lin-28 Represses the Accumulation of let-7 in the L1 and L2.

We examined let-7 null mutant animals in the L4 stage to see whether any defects had already occurred by this time.

LIN-28 Protein Binds a Subset of let-7 Family Precursor RNAs.

We constructed a strain lacking all four genes and assessed its seam cell phenotypes: we observed that animals lacking all four let-7 family members had the same seam cell number as those lacking only three (Table 2, lines 5 and 7).

D, lin-28; mir-48 mir-241; let-7 mir-84 (lin-28; 4 let-7s).

Relative contribution of hbl-1 and lin-41 for the let-7 retarded phenotype.

let-7 itself has been believed to act much later in the heterochronic pathway, at the L4-to-adult transition.

By finding that C. elegans lin-28 has two distinct activities, we surmise that the split phenotype in mammalian neurogenesis is a consequence of a similar two-step mechanism involving let-7 -dependent and let-7-independent activities.

None of the previous data concerning let-7's role in seam cells decides whether it acts to control the L3-to-L4 transition or the L4-to-adult transition.

Animals receiving either transgene had an average of 16 seam cells at the L4 stage, indicating no change in the early cell fate decision (wildtype let-7, n = 47; chimeric let-7, n = 51).

lin-28 mutants can be two stages precocious due to let-7 activity.

The male tail tip morphogenesis is delayed in let-7 males.

The binding of mammalian LIN-28 to pre-let-7 leads to the degradation of the precursor and eventual loss of mature let-7 [27]– [32].

Second, although it is impossible at present to distinguish between L3 seam cell fates and L4 seam cell fates, we must reconsider the time of let-7's activity.

Thus, LIN-28 can specifically recognize the precursors of the four let-7 family members already known to function in the heterochronic pathway.

Seven C. elegans microRNAs—let-7, miR-48, miR-84, miR-241, miR-793, miR-794, and miR-795—belong to the let-7 family based on 5′-end sequence identity of the mature microRNAs [41]– [43].

To determine whether C. elegans lin-28 prevents the developmental accumulation of the let-7 family microRNAs, quantitative RT-PCR assays were performed on wildtype and lin-28 mutant larvae.

The absence of lin-28 caused substantial premature accumulation of let-7 in both the L1 and L2 stages, higher than its peak at the L4 molt in wild type (Figure 1A, blue bars).

Significantly, Abbott and colleagues discovered that three let-7 relatives—miR-48, miR-84 and miR-241—function redundantly to repress the transcription factor gene hbl-1 and cause the succession of L2 to L3 cell fates [6].

As previously reported [2], [6], [48], [49], mature let-7 was very low or undetectable in wildtype larvae at the L1 and L2 molts, accumulated during the L3 stage, and reached its peak by L4 (Figure 1A, grey bars).

Thus loss of let-7 might actually cause the reiteration of L3 fates, the consequence of which would be problems in the L4.

We observed a cell division in the V5 lineage that normally occurs during the L3 lethargus to be reiterated at the end of the L4 stage: 100% of animals showed a V5 lineage division in let-7 males recurring 12–13 hours after the L3 molt, in the late L4 (n = 10).

lin-28 Acts Independently of let-7 MicroRNAs to Control Cell Fates.

Importantly, only let-7 levels were altered at the L1 lethargus, the period immediately preceding the seam cell divisions of the L2.

LIN-28 dramatically represses the accumulation of the let-7 microRNA.

These observations indicate that the earliest observable consequence of let-7 activity occurs long before the L4-to-adult transition, and suggest let-7 acts at the late L3 stage.

Given that mir-48, mir-84, and mir-241 act redundantly and are related in sequence to let-7, we first wished to test whether let-7 might also be redundant with them in controlling L2 seam cell behavior.

Surprisingly, a strain lacking lin-28 and all four let-7 genes had the reduced seam cell number of a lin-28 mutant (Table 2, line 8).

However, we observed consistent abnormal cell division and morphogenesis events in the L4 male, which is in agreement with a reiteration of L3 cell fates in let-7 null mutants.

let-7 null mutants, whose defect in these lineages is first visible in the late L4 stage.

Lin-28 encodes one of twelve proteins and let-7 one of five microRNAs known to act in the heterochronic pathway [3]– [5].

Thus, the let-7 null allele is epistatic to the lin-28 null allele only for the alae phenotype, not for the early seam cell division defect; the animals display both precocious and retarded characters.

We addressed whether any aspect of lin-28's two-stage precocious phenotype depended on let-7 family members.

lin-28 Represses the Accumulation of let-7 in the L1 and L2The binding of mammalian LIN-28 to pre-let-7 leads to the degradation of the precursor and eventual loss of mature let-7 [27]– [32].

We sought to clarify the roles of these two genes with respect to let-7 activity.

let-7 null mutants show retarded adult alae synthesis, but produced the normal number of seam cells (Table 2, line 3) [2].

Like other animals, C. elegans possess multiple let-7 family members [40]– [44].

However, removing ain-1 in a strain lacking lin-28 and the three let-7 family members did not result in an increase in seam cell number (Table 2, line 11).

Here we show that lin-28's primary activity in C. elegans—the proper timing of second larval stage cell fates—does not require let-7 or related genes.

We therefore reconsidered when let-7 has its earliest role in larval development.

Arrow head, unretracted hypodermis in the let-7 mutant.

Our quantitative RT-PCR data indicate that mature let-7 accumulates during the L3 (Figure 1), after LIN-28 has disappeared [62].

We demonstrate by using null alleles that lin-28 does not require let-7, mir-48, mir-84, and mir-241 for its control of L2 cell fates (Table 2).

Similar results were obtained with animals lacking all four let-7 family members (Figure S2).

The first of lin-28's activities governs the L2-to-L3 transition and is independent of let-7 and the second acts via let-7 to control the L3-to-L4 transition.

Thus, lin-28 requires none of these let-7 family members to control the L2 seam cell fates.

Table S5Copy number, let-7 levels, and phenotypes of let-7 transgenic lines.

Another consistent defect observed in let-7 null males was a delay in tail tip retraction that normally occurs in male tail morphogenesis during the L4 (Figure 4) [57].

These observations indicate that let-7, and not its three relatives, is needed for the two-stage precocious phenotype of lin-28 null mutants.

Lack of Evidence for Additional MicroRNAs Mediating lin-28 ActivityWe surmised that lin-28 might act on a microRNA unrelated to let-7 to control L2 events.

Global microRNA profiling was performed by Exiqon (Vedbaek, Denmark) using miRCURY LNA miRNA Arrays annotated to miRBase version 14.0. let-7 TransgenesA 2.5 kb let-7 genomic sequence identical to the rescuing fragment used previously [2] was cloned into pCR2.1-TOPO (Invitrogen).

Because mature let-7 levels are very low at the L2 molt and nearly at their peak by the end of the L3, it is reasonable to assume that let-7 could act by the end of the L3.

We generated animals carrying either a wildtype let-7 genomic transgene or a chimeric worm/fly transgene.

While investigating the mechanism by which accumulation of the mature let-7 microRNA is blocked in pluripotent cells, Viswanathan and colleagues discovered that mammalian LIN28 protein can bind the let-7 pre-microRNA and inhibit its processing [26].

By contrast, none of the lin-28; let-7 animals displayed adult alae at the L2 molt (Table 3).

In contrast to removing let-7, which had no effect, removing ain-1 from a strain lacking mir-48, mir-84, and mir-241 nearly doubled its seam cell nuclei number (Table 2, line 10).

In a let-7 null mutant background, seam cells divide at the L4 molt and synthesize adult alae one stage later [2].

let-7 Transgenes.

Because lin-28's primary role is to govern this same cell fate transition, it is reasonable to hypothesize that it acts via one or more of these let-7 relatives.

Nomarski images of wild type (A) and let-7 null (B) L4 males approximately 8 hours after the L3 molt.

20

In 2BS cells, p38 is activated by overexpression of p66Shc, p52Shc, or p46Shc, or by knockdown of let-7a, while p38 is inhibited by p66Shc knockdown or by let-7a overexpression (Figs 4A, 5A, 6A, S4A, S5A and S6A).

revealed that overexpression of let-7a by transfecting a vector that expressed pre-let-7a in IDH4 cells reduced p66Shc, p52Shc, and p46Shc proteins by ~50–70% (Fig. 1A), while knockdown of let-7a by transfecting a vector expressing let-7a antisense (AS-let-7a) increased Shc proteins by ~2.3- to 5.6-fold (Fig. 1B).

MicroRNAs influence the translation or turnover of mRNAs as part of a larger molecular complex (the RISC) that includes Ago2 (Pratt & MacRae, 2009; Czech & Hannon, 2011); as anticipated, Ago2/RISC was involved in the let-7a -mediated regulation of Shc, because knockdown of Ago2 increased the levels of Shc proteins and diminished the effect of let-7 knockdown in elevating Shc expression (Fig. 1E).

The let-7a-Shc regulatory process contributes at least in part to the elevation of Shc proteins in senescent cells, because expression of the Shc CR fragment antagonizes the effect of let-7a in regulating either Shc expression or cellular lifespan (Fig. S7).

let-7 was found to suppress the expression of Ras, c-myc, E2F1, and CDC34, as well as to elevate the expression of p21.

However, expression of the flag-p66Shc CRΔ4 was modest in rescuing the effect of expression of pre-let-7a (Fig. S7).

Fig. S7 Ectopic expression of p66Shc CR fragment rescues the effect of let-7a on repressing p66Shc expression and extending the cellular life span.

Transfection of IDH4 cells with an inhibitor of let-7a increased the levels of Shc proteins; transfection of cells with let-7b inhibitor moderately induced the Shc protein levels (Fig. S2B).

The effect of let-7a was specific, as inhibition of let7c, let-7d, miR-9, miR-22, and miR-30 did not affect the levels of Shc proteins, while inhibition of let-7b moderately increased the levels of Shc proteins (Fig. S2).

We also assessed the expression of Shc proteins in cells transfecting with the siRNA or inhibitor of let-7a.

As shown in Fig. 1(D), nascent Shc protein synthesis in AS-let-7a -expressing cells was ~3.2- to 4.1-fold higher than what was observed in control cells, while Shc translation in AS-miR-30 -expressing cells was comparable with that measured in control cells.

The levels of p66Shc mRNA, which could potentially be used for synthesis of all Shc proteins, were not substantially altered by modulating let-7a or miR-30 abundance (Fig. 1C), suggesting that let-7a does not affect Shc expression at the level of mRNA turnover and instead may affect Shc translation.

Given that the expression of Shc proteins in senescent cells is robustly elevated (Fig. 3) when let-7a levels decline, the let-7a-Shc regulatory paradigm may be in part responsible for the elevation of Shc proteins in replicative senescence.

To further address the mechanism by which let-7a regulates the expression of Shc proteins, the levels of p66Shc mRNA in cells described in Fig. 1(A,B) were analyzed by reverse-transcription (RT) followed by real-time, quantitative (q)PCR analysis.

To address the impact of let-7a-p66Shc regulatory process upon replicative senescence, let-7a function in 2BS cells was either repressed or enhanced by stably transfecting cells with a vector expressing AS-let-7a or the pre-let7a, respectively.

In this study, we show that microRNA let-7a regulates lifespan of human diploid fibroblasts by repressing the translation of p66Shc.

Given that overexpression of p66Shc and that let-7a lowered the levels of all three Shc isoforms (Figs S4 and 1), it is possible that p52Shc and p46Shc also regulate replicative senescence.

Next, we tested if the interaction of let-7a with the Shc CR was important for the regulation of Shc expression.

As shown in Fig. 1(E), knockdown of Ago2 and let-7a increased the levels of Shc proteins by ~2.2–3.8- and ~2.5–3.9-fold, respectively, while simultaneous knockdown of Ago2 and let-7a did not show further effect of elevating Shc protein levels.

Cells expressing pre-let-7a continued to grow at day 37 after selection, with an increase in PDL ~6.4, while control cells stopped growing around day 25 after selection, with an increase in ~4.0 PDL (Fig. 6E).

let-7a represses the expression of Shc by associating with ‘seedless’ interaction elements in the CR of p66Shc mRNA.

To test this hypothesis, IDH4 cells transiently expressing antisense let-7a or antisense miR-30 were incubated in medium containing L-[[35]S] methionine and L-[[35]S] cysteine for 20 min, cell lysates were then prepared and subjected to immunoprecipitation to analyze the level of nascent Shc proteins.

Fig. S3 let-7a inhibits the loading of p66Shc onto the p bodies but promotes the presence of p66Shc in the polysome.

In addition, 2BS cells expressing a flag-tagged, frame-shifted p66Shc CR diminished the effect of let-7a in repressing p66Shc, p52Shc, p46Shc, p16, and the activation of p38, reducing ROS levels, promoting cell growth, delaying replicative senescence, and extending cell lifespan (Fig. S7).

We describe that let-7a interacts with ‘seedless’ sites located in the coding region (CR) of p66Shc mRNA, prevents the association p66Shc mRNA with the polysome, and enhances the recruitment of p66Shc mRNA into PBs, thereby repressing the translation of p66Shc.

HeLa cells were transfected with siRNA targeting Ago2 or let-7a, or co -transfected with both siRNAs, whereupon the levels of Shc proteins were assessed by.

Together, let-7a promoted cell proliferation, inhibited replicative senescence, and extended cell lifespan by repressing the production of p66Shc.

In contrast, cells expressing pre-let-7a exhibited reduced levels of Shc proteins (~65–70%), p16 (~50%), and phospho-p38 (~55%; Fig. 6A), reduced ROS levels (P = 0.0015; Fig. 6B), increased the S-phase cells and reduced G1-phase and SA-β-gal -positive cells (P = 0.0080; Fig. 6C,D).

To establish 2BS cells stably expressing pre-let-7, AS-let-7a, p66Shc, p52Shc, p46Shc, or p66Shc shRNA, cells (~25 pdl) were transfected by lipofectamine 2000, selected by the G418 reagent (300 μg mL [−1]; Invitrogen) for 3–4 weeks, and maintained in medium supplemented with 50 μg mL [−1] G418.

Targeting let-7a-p66Shc in cancer may avoid this apparent dilemma, as extending cellular lifespan by elevating let-7a or reducing p66Shc does not increase the risk of tumorigenesis.

On the other hand, let-7a inhibits the proliferation of human glioblastoma (Lee et al., 2011), human nonsmall cell lung tumor (Johnson et al., 2007; Kumar et al., 2008; He et al., 2009), Burkitt lymphoma (Sampson et al., 2007), breast cancer cells (Yu et al., 2007), and primary fibroblasts (Legesse-Miller et al., 2009), through the repression of Ras, c-myc, E2F1, and CDC34 as well as elevation of p21.

By repressing the translation of Shc genes, let-7a extends the lifespan of human diploid fibroblasts (Figs 1, 5 and 6).

These results support the view that let-7a represses the translation of p66Shc, p52Shc, and p46Shc in an Ago2/RISC -dependent manner.

These results support the idea that let-7a represses the translation of p66Shc, p52Shc, and p46Shc.

Together, interaction with the seedless REs of Shc mRNA was essential for let-7a to repress Shc translation.

let-7 represses the translation of p66Shc, p52Shc, and p46Shc.

These results confirmed that let-7a specifically represses the translation of p66Shc, p52Shc, and p46Shc.

let-7a extends cellular lifespan by repressing p66Shc expression.

IDH4 cells were cotransfected with a vector expressing AS-let-7a or control antisense miRNA plus pGL3, pGL3-3′UTR, pGL3-CR, pGL3-Δ1, pGL3-Δ2, pGL3-Δ3, or pGL3-Δ4 reporter vector along with pRL-CMV control reporter, whereupon the firefly luciferase activity was analyzed.

As shown in Fig. 5, cells expressing AS-let-7a increased the levels of p66Shc (~3.5-fold), p52Shc (~3.5-fold), p46Shc (undetectable in control cells, but increased by AS-let-7a), p16 (~2.3-fold), and phspho-p38 (~2.2-fold; Fig. 5A), increased ROS levels (P = 0.0034; Fig. 5B), reduced the S-phase compartment, increased the G1 compartment (Fig. 5C), and increased SA β-gal activity (P = 0.0024; Fig. 5D).

Fig. S2 let-7a specifically represses the expression of p66Shc.

However, analysis using general bioinformatics tools (Targetscan, miRanda, and microTv3.0), the p66Shc mRNA did not reveal any let-7 seed matches.

Figure 3Expression of let-7a and p66Shc in replicative senescence.

To confirm the association of let-7a with the CR of Shc mRNA, HeLa cells were transfected with the reporter vectors pSL-MS2, pSL-MS2-CR, pSL-MS2-3′UTR or pSL-MS2-CRΔ4 together with the plasmid pSL-MS2-GFP-flag expressing the chimeric MS2-GFP-flag protein (Fig. 2A).

Figure 6Overexpression of let-7a extends cellular lifespan.

Although the specific mechanisms by which let-7a represses the translation of Shc proteins are not fully understood, our data suggest that the association of let-7a with the seedless interaction elements located in the CR of Shc mRNA (Fig. 2C) lowers the presence of Shc mRNA in polysomes and enhances the recruitment of Shc mRNA into P-bodies (Fig. S3).

In addition, other let-7-regulated mRNAs may also encode proteins involved in preventing senescence.

In addition, knockdown of let-7a was less effective in elevating the luciferase activity of pGL3-CRΔ1 (~1.6-fold), pGL3-CRΔ2 (~1.9-fold), and pGL3-CRΔ3 (~1.1-fold).

In control reactions, knockdown of let-7a or miR-30 did not influence the levels of nascent GAPDH.

As shown in Fig. S3, knockdown of let-7a increased the presence of p66Shc mRNA in the polysome fraction while it reduced the presence of MS2-CR chimeric transcripts in P-bodies.

However, these regulatory processes by let-7a may not impact on replicative senescence, as Ras and c-myc proteins were undetectable 2BS cells (not shown), and the reduction of let-7a in senescent cells was not accompanied by elevation of E2F1 and CDC34 or reduction of p21 (Fig. 3A,B).

We have found that the elevation of Shc proteins in replicative senescence is regulated at post-transcriptional levels by let-7a (Figs 6 and S2).

As shown in Fig. 2(D), knockdown of let-7a increased the luciferase activity from pGL3-CR by ~2.6-fold, but not from pGL3-3′UTR or pGL3-CRΔ4.

As shown in Fig. 2(B), the level of let-7a in the MS2-GFP-flag-MS2-CR complex was much higher than that in the MS2-GFP-flag-MS2-3′UTR or MS2-GFP–MS2-CRΔ4 complexes.

Figure 5Reduction in let-7a shortens cellular lifespan.

Using the cells described in Fig. 3(A,B), the levels of let-7a, miR-30, U6, as well as p66Shc mRNA levels in 2BS and IDH4 cells progressing toward senescence were determined by Northern blot analysis (Fig. 3D) and by conventional RT-PCR analysis (Fig. 3E) respectively.

The fact that let-7 represses proliferation of tumor cells but promotes the growth of HDFs may reflect the view that cell senescence contributes to tumorigenesis (Rodier & Campisi, 2011).

Reduction of let-7a is accompanied by elevation of Shc proteins in replicative senescence.

We therefore tested the presence of p66Shc mRNA in polysomes and p-bodies of cells with silenced let-7a.

In agreement with previous findings (Marasa et al., 2010), the levels of let-7a were reduced in middle-passage (~60%) and senescent (~80%) 2BS cells as well as in senescent IDH4 cells (~90%).

These results suggest that the reduction of let-7a may contribute to the elevation of p66Shc, but not to the alterations of CDC34, E2F1, or p21 during replicative senescence.

Therefore, let-7a interacts with the ‘seedless’ REs within the CR of Shc mRNA.

After selection, AS-let-7a cells stopped proliferating around day 15, and increased ~2.7 PDL, while control cells stopped growing around day 25 and increased ~4.8 PDL (Fig. 5E).

Further work is needed to identify the complete set of effectors through which of let-7a impacts upon the cellular replicative lifespan.

This study was initiated from our findings that intervention of the let-7a levels altered the levels of p66Shc, p52Shc, and p46Shc proteins.

By using the program RNA22, we identified three let-7a ‘seedless’ recognition elements (REs) – that is, sites of interaction lacking the conventional 7–8 nucleotide ‘seed’ that typically defines microRNA–mRNA interactions – in the CR of mRNA encoding p66Shc, p52Shc, and p46Shc (Fig. S1).

As shown in the Fig. S2(A), transfection of IDH4 cells with let-7a siRNA, but not miR-30 siRNA, elevated the levels of Shc proteins.

The CRΔ4 was derived from the CR fragment mutating all three seedless REs of let-7a.

Instead, our results indicate that seedless interaction elements in the CR of p66Shc mediate the association between let-7a and p66Shc mRNA and elicit the effects of let-7a (Fig. 2).

21

In addition, miRNAs including let-7 negatively regulate target gene expression by two major mechanisms, i. e. mRNA cleavage (transcriptional level) and/or translational repression (translational level), in a sequence-specific manner [7], [8], [11], [12].

Expression of members of the let-7 family has been reported to be significantly downregulated in multiple cancer types, and this decreased let-7 expression has been correlated with poorer clinical outcomes.

For example, the expression of let-7a, let-7c, and let-7g have been found to be selectively downregulated in breast cancer [52], suggesting that there are other independent mechanisms affecting the expression of each individual let-7 family member.

Conversely, their regulatory miRNA, let-7, shows a reciprocal temporal expression pattern that is dramatically increased during differentiation and development, and it is extensively expressed in adult tissues [2]– [5].

Copy Number Alteration of let-7b is Positively Correlated with Mature let-7b Expression in Ovarian CancerTo determine whether copy number alterations of let-7b affect mature let-7 expression in cancer, we examined an ovarian cancer dataset from The Cancer Genome Atlas (TCGA) [32], because this independent genomic dataset contains matched data on both genome-wide copy number (SNP array) and mature miRNA expression (miRNA array) from a large collection of human ovarian tumor specimens.

Reduced expression of let-7 has been associated with shortened postoperative survival in patients with cancer [7], [11], [12], and forced expression of let-7 family members can suppress cancer cell growth both in vitro and in vivo [13]– [16].

For example, some direct targets of let-7, such as LIN28, RAS, MYC and HMGA2, are not expressed or activated in normal cells, but are the ‘driver’ genes promoting cell growth in tumors.

Two molecular mechanisms have been proposed that may lead to global downregulation of let-7 expression in cancer.

To determine whether copy number alterations of let-7b affect mature let-7 expression in cancer, we examined an ovarian cancer dataset from The Cancer Genome Atlas (TCGA) [32], because this independent genomic dataset contains matched data on both genome-wide copy number (SNP array) and mature miRNA expression (miRNA array) from a large collection of human ovarian tumor specimens.

Given that let-7 simultaneously inhibits multiple oncogenic pathways that are involved in most steps of tumorigenesis (such as RAS, MYC, and HMGA2), restoration of let-7 expression in tumor cells provides a novel therapeutic strategy to treat cancer.

Moreover, having found that let-7 expression is lower in lung tumors than in normal lung tissue, while RAS protein is significantly higher in lung tumors, they proposed that let-7 is a tumor suppressor gene [9], which is consistent with previous clinical observations in lung cancer [10].

46 Dangi-Garimella S, Yun J, Eves EM, Newman M, Erkeland SJ, et al (2009) Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J 28: 347– 358.

In consistent with this common behavior of miRNAs, we showed that the mRNA expression levels of multiple well-known let-7 target genes such as CCND1, CDC25A, HMGA2, IL6 and LIN28B were significantly decreased by let-7b mimic treatment (all p<0.05).

Since the mature let-7a sequence is encoded by three let-7a genes, which are located at three different chromosomal loci, we could not examine the correlation between copy number and expression for let-7a-3. Thus, we analyzed the correlation between deletions at the let-7a-3/ let-7b locus and expression of mature let-7b in this data set.

We believe it is one of important mechanisms to decrease let-7 expression in these diseases, although other mechanisms such as transcriptional deregulations, epigenetic alterations, mutations, and defects in the miRNA biogenesis machinery are needed to be further characterized in ovarian and breast cancers.

Meanwhile, the mRNA expression levels of well-known let-7 target genes such as CCND1, CDC25A, HMGA2, IL6 and LIN28B were significantly decreased by let-7b mimic treatment.

The role of let-7 in cancer was first discovered by Johnson et al. when they found that the let-7 family negatively regulates let-60/RAS in C. elegans by binding to multiple let-7 complementary sites in its 3′ untranslated region (3′UTR) [9].

These results indicate that deletion in copy number is an important mechanism leading to the downregulation of specific let-7 family members in at least these three types of human cancers.

Since it has been found that human cancers show a significantly reduced expression of the let-7 family, and that this is associated with shorter survival times in these patients [7], [11], [12], the characterization of the mechanisms leading to let-7 downregulation in cancer has important clinical significance.

This may result in an unselective, global downregulation of miRNAs, including the let-7 family.

However, the above two mechanisms cannot explain the finding that, in most cancer types, only some let-7 family members are downregulated.

Therefore, transcriptional deregulations, epigenetic alterations, mutations, DNA copy number abnormalities and defects in the miRNA biogenesis machinery might each contribute, either alone but more likely together, to the let-7 family deregulation in human cancer [29], [61], [62].

We also monitored endogenous let-7b activity using a constitutively expressed let-7b luciferase reporter that contained sequences complementary to let-7 in the 3'UTR [33], [34].

It has been well demonstrated that the mature let-7 expression is a robust biomarker to predict clinical outcome in patients with cancer.

The let-7 family is one of the first miRNA tumor suppressor families shown to be involved in human cancer.

In addition, let-7 targets multiple cell cycle associated genes, including CDC25A [24], CDK6 [24], and CDK4 [25] as well as Cyclin A [25], D1 [25], D2 [24], and D3 [25].

Importantly, focal reductions in the copy numbers of the let-7 family suggest that deletion of let-7 may play an important role during tumorigenesis, and suggests that restoring expression of these let-7 family members may be a novel strategy to treat medulloblastoma, breast cancer, and ovarian cancer.

Taken together, this demonstrates that the in vivo delivery of a let-7b mimic can functionally restore let-7 expression and remarkably reduce tumor growth in a pre-clinical animal mo del of ovarian cancer.

B. Heat map of mature let-7 family expression levels in matched TCGA specimens.

This result indicated that the DNA copy number alteration is not the only reason by which the mature let-7 expression is reduced in cancer.

The let-7 target genes lin-28 (an RNA -binding protein) and lin-41 (a putative ubiquitin ligase) block let-7 maturation and interact with argonaute proteins, respectively.

Restoration of let-7b Expression Significantly Reduces Ovarian Tumor Growth in vitro Focal loss in copy number of the let-7 family members in medulloblastoma, breast, and ovarian cancers strongly suggests that let-7 may have an important role in tumorigenesis.

In addition, it has been shown that the RNA -binding protein, LIN28, which selectively inhibits some miRNA families, including the let-7 family [36]– [41], is activated in a large percentage of cancer patients [42]– [51].

In agreement with our observations, restoration of let-7 expression has also been shown to reduce tumor growth in pre-clinical mo dels of other cancer types, such as lung cancer [13]– [16], in which the let-7 family is globally decreased [9], [10].

D. Correlations between let-7b DNA copy number and expression levels of mature miRNA of other let-7 family members in ovarian cancer from the TCGA dataset.

It is likely that let-7 performs these functions by targeting various genes.

Interestingly, we found that our let-7b treatment did not significantly affect normal ovarian surface epithelial cell growth, suggesting that treatment to restore let-7 expression may be less toxic than traditional chemotherapy.

The inhibitory function of the let-7 family in cancer has been corroborated by a number of groups and in various types of tumors [7], [11], [12].

This finding may be due to the fact that normal cells already express higher levels of endogenous let-7 and therefore the delivery of additional let-7 does not significantly increase its gene silencing activity in normal cells.

Finally, let-7 represses expression of the reprogramming factor LIN28 that functions to block differentiation and maintain cancer stem cell populations [26].

Most importantly, we confirmed the correlation between let-7 copy number alterations and mature let-7 expression in ovarian cancer.

The stable clones expressing the let-7 reporter were further confirmed by a luciferase assay.

Proc Natl Acad Sci U S A. 18 Yu F, Yao H, Zhu P, Zhang X, Pan Q, et al (2007) let-7 regulates self renewal and tumorigenicity of breast cancer cells.

After two weeks, the mice were randomly assigned to two groups, to be treated with either the let-7 mimic or the control oligonucleotide by i. p. injection.

However, this mechanism is likely cancer-type specific, since we did not find significant copy number alterations of the let-7 family in other cancer types, such as colon and prostate cancers.

For example, a systematic review of 43 published studies shows that let-7 is the miRNA most frequently and significantly associated with clinical outcomes in patients with cancer [60].

This led us to examine whether the copy-numbers of the let-7 family were altered in cancer.

0044399.g002 Figure 2Members of the let-7 family show copy number deletions in medulloblastoma, breast, and ovarian cancers.

In this pathway, the microRNA (miRNA) let-7 controls the progression of timing events, ensuring that cell cycle exit and terminal differentiation occur at the correct time [6], [7].

Briefly, we found that four let-7 loci harboring five let-7 members showed significant deletions in copy number in a cancer-type specific manner (Figure 2).

In the present study, we have shown that three let-7 loci, which harbor four let-7 members (let-7a-2, let-7a-3, let-7b, and let-7e), have deletions in copy number in a cancer-type specific manner in medulloblastoma, breast cancer, and ovarian cancer.

In addition, two non-focal deletions (let-7a-3/ let-7b, frequency 40%; let-7g, frequency 36%) were also found in breast cancer, and single non-focal deletions were found in melanoma (let-7a-2, frequency 43%) and non-small cell lung carcinoma (let-7e, frequency 31%).

To determine the copy number of the let-7 family members, we analyzed a high-resolution SNP array (Affymetrix 250 K Sty array) dataset, Tumorscape, created by the Broad Institute of MIT and Harvard [27].

Frequency indicates the fraction of cancers which exhibit amplification/ deletion at the genomic locus harboring a given let-7 gene.

The let-7 family is made up of thirteen members located at eight loci of the human genome.

Focal deletions of these let-7 family members were found in three cancer types: medulloblastoma (let-7a-2, frequency 25%; let-7e, frequency 9%), breast cancer (let-7a-2, frequency 47%), and ovarian cancer (let-7a-3/ let-7b, frequency 44%).

Summary of DNA copy number alterations of the let-7 family in 14 types of human cancers (n = 2,969).

Finally, only one let-7 family member, let-7i, was found to be amplified (in non-small cell lung carcinoma).

Members of the let-7 family show copy number deletions in medulloblastoma, breast, and ovarian cancers.

Thirteen members of the let-7 family have been identified in the human genome [7], [8] which display both distinct and overlapping functions [8].

Certain Members of the let-7 Family have Deletions in Copy Number in Medulloblastoma, Breast Cancer, and Ovarian Cancer.

Certain Members of the let-7 Family have Deletions in Copy Number in Medulloblastoma, Breast Cancer, and Ovarian CancerTo determine the copy number of the let-7 family members, we analyzed a high-resolution SNP array (Affymetrix 250 K Sty array) dataset, Tumorscape, created by the Broad Institute of MIT and Harvard [27].

Two weeks after the tumor cell injection (Figure 5A), the mice were randomly assigned to two groups, to be treated with either the let-7 mimic or the control oligonucleotide (40 ug per animal).

The let-7 reporter vector was transfected into A2780 cells using the FuGene6 Transfection Reagent (Roche).

To test this hypothesis, we delivered a small RNA mimic for let-7b, the most frequently deleted let-7 family member in ovarian cancer patients, to ovarian cancer cells in vitro and in vivo.

This suggests that genomic focal copy number deletions of let-7 may play an important role during tumorigenesis in the above cancer types.

For example, let-7 inhibits many well-characterized oncogenic proteins, including KRAS [9], [17], [18], HRAS [9], [17], [18], HMGA2 [18]– [21], c-Myc [22], and NF2 [23].

We did not find a correlation between any other let-7 family members with the let-7b copy number (Figure 3D).

Dark green represents focal deletion of the let-7 family.

Taken together, our data indicate that a reduction in copy number of specific let-7 family member genes were frequent in medulloblastoma, breast, and ovarian cancers.

Focal loss in copy number of the let-7 family members in medulloblastoma, breast, and ovarian cancers strongly suggests that let-7 may have an important role in tumorigenesis.

22

Among the potential pathways predicted from miRNAs differentially expressed between dormant and activated blastocysts, the Wnt pathway may be relevant to the observed action of let-7. Two miRNAs target gene prediction softwares, TargetScan and PicTar show that Kremen1 and Wnt1 are target genes of let-7. Wnt1 is predominantly expressed in the inner cell mass of mouse blastocyst [69], while Kremen1 is detected primarily in the trophectoderm of dormant blastocysts and is translocated into the nuclei of trophodermal cells in activated blastocysts [47].

The evidence include (a) Let-7a bound to the 3′UTR region of the integrin-β3; (b) forced -expression of let-7a reduced the expression of integrin-β3; and (c) forced -expression of integrin-β3 partially rescued the suppressive effect of let-7 on blastocyst implantation, attachment and outgrowth.

Down-regulation of let-7 in the activated blastocysts would enable up-regulation of let-7-response genes, many of which are oncogenes or cell cycle checkpoint genes, leading to cell cycle progression, DNA synthesis and cell division.

In view of the high level of let-7 in dormant embryos, we postulated that up-regulation of let-7 suppress blastocyst implantation.

To confirm that let-7a also regulated integrin-β3 expression in blastocysts, the expression of integrin-β3 protein in blastocysts at 36-hour post-electroporation of either let-7a precursor or control RNA was examined.

The expression of let-7 is dynamically regulated during oogenesis and early embryonic development [7].

Forced -expression of integrin-β3 also reduced the inhibitory action of pre-let-7a on implantation in vivo (Fig. 6e ).

Forced -expression of integrin β3 partially reduced the inhibitory effects of let-7a on embryo attachment and outgrowth.

Forced -expression of integrin-β3 partially nullifies the inhibitory action of let-7a on implantation.

Electroporation of pre-let-7a alone inhibited the ability of the embryo for attachment and spreading, while co-electroporation with integrin-β3 RNA partially reduced these suppressive actions of pre-let-7a (Fig. 6c and d ).

TargetScan and MiRanda predicted integrin-β3 as a potential target gene of let-7a (Fig. 5a ).

Apart from the possible compensatory function of integrins, the inability of forced -expression of integrin-β3 in completely nullifying the inhibitory action of let-7 precursor on blastocyst outgrowth could be due to the involvement of other pathway(s) mediating the action of of let-7 on embryo implantation.

To determine whether integrin-β3 mediated the action of let-7a on embryo implantation, ectopic expression of integrin-β3 was used to nullify the inhibitory activity of let-7a precursor.

We further demonstrated that one of the differentially expressed miRNAs, let-7a, affects implantation via its action on the expression of integrin in blastocysts.

Forced -expression of integrin β3 partially reduced the inhibitory effects of let-7a on implantation in vivo.

The high level of let-7 during dormancy relative to the normal blastocyst and the down-regulation of let-7 in the activated blastocysts suggest that a low level of let-7 is beneficial for implantation.

Similar to the report in mouse [9], a continuous decrease of expression levels of let-7 family members was found during preimplantation development of human embryos (Fig. 1d ).

Here, we studied the let-7 function by forced expression of precursor of let-7 in embryos using electroporation as described for studying the roles of specific genes in mouse preimplantation embryo development [27], [28].

The knowledge gained may be applied to humans as a continuous down-regulation of let-7 is also observed in the human preimplantation embryos.

Five of them (let-7a, -7d, -7e, -7f and -7g) were down-regulated by more than 2-fold in the activated blastocysts (Table 4).

Five of them (let-7a, -7d, -7e, -7f and -7g) were down-regulated by more than 2-fold when dormant blastocysts were activated.

Here, we provide the first in vitro and in vivo evidence that let-7a affects embryo implantation, at least partly through regulation of expression of integrin-β3.

Forced -expression of Integrin-β3 Partially Rescues the Inhibitory Effects of Let-7a.

Several of the let-7 members are upregulated in the delayed implantating mouse uterus after activation [70] and in the implantation site relative to inter-implantation site [71].

The present study showed that the expression level of let-7 family in human blastocysts is also low, consistent with a similar role of the miRNA in preimplantation embryo development.

Western blot analysis showed that the let-7a precursor decreased the expression of integrin-β3 protein in blastocysts (Fig. 5c ).

Precursor of let-7 inhibits embryo implantation in vivo.

Expression of let-7 family members (in Ct values) in dormant and activated blastocysts.

After 30 hours of culture, the blastocysts derived from embryos electroporated with pre-let-7a expressed 110 times more mature let-7a than those with control RNA (Fig. 2b ).

At 36-hour post-electroporation, the percentage of attached blastocysts with forced -expression of let-7a (42.0±8.3%) was significantly lower than that of blastocysts with control precursor (79.0±5.1%) (Fig. 4a ).

Whether let-7 modulates the expression of integrin-β3 in the uterine luminal epithelium remains to be determined.

There was a significant decrease in integrin-β3 protein expression in embryos eclectroporated with pre-let-7a relative to the control.

0037039.g003 Figure 3Precursor of let-7 inhibits embryo implantation in vivo.

Both the luminal epithelium and the stroma of endometrium express let-7 members with unknown function [71], [72].

Cells electroporated with let-7a precursor significantly suppressed the wild type reporter activity by 50% (Fig. 5b ).

Let-7a Directly Targets Mouse Integrin-β3 Subunit.

The low level of let-7a in the normal blastocysts and the activated blastocysts would favor the expression of integrin-β3 subunit.

The results showed that the outgrowth area was also significantly decreased with let-7a forced -expression (pre-let-7a 54885±9880 µm [2] vs control 26753±4976 µm [2]; Fig. 4c ).

The presence of blastocyst induces the expression of miR-320 and let-7a in the rat uterus during the implantation window [16], [17].

Let-7 family is wi dely demonstrated as a tumor suppressor.

Let-7a Inhibits Embryo Attachment and Outgrowth in vitro.

The results showed that let-7 is involved in the regulation of blastocyst activation.

We found that forced -expression of let-7a in embryos resulted in a significant reduction in the number of implantation sites (1.1±0.4) when compared with those electroporated with control precursor (3.8±0.4) (Fig. 3 ).

Let-7a interacts with the 3′-untranslated region (UTR) of integrin β3.

The positive clone was two-nucleotide-point mutated at the let-7a complementary site using the QuikChange II Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturer’s protocol.

The Expression of Let-7a is Low in Blastocyst before Implantation.

The results demonstrated that let-7a directly interacted with the 3′UTR of mouse integrin-β3.

Let-7a Inhibits Embryo Implantation in vivo.

Other than integrin-β3, let-7 is known to regulate RAS [66], HMGA2 [67] and Dicer [68].

Nine members of the let-7 family were analyzed in the profiling experiment.

The let-7 family consists of 11 members, which are conserved in invertebrates and vertebrates, including humans [48], [49].

Precursor of let-7a (pre-let-7a), scramble control (Exiqon, Denmark) or itgb3 RNA, were electroporated into the 8-cell embryos in a flat electrode chamber (1 mm gap between electrodes) (BTX Inc.

0037039.g004 Figure 4The effects of let-7a on the embryo attachment, percentage outgrowth and outgrowth area in vitro.

Eight-cell embryos were electroporated with precursor of let-7a or control RNA, and cultured on fibronectin coated dishes.

To confirm the observation, the levels of let-7a and -7e in normal, dormant and activated blastocysts were compared by direct qPCR.

In order to confirm the action of let-7a on the implantation process, 8-cell embryos were electroporated with pre-let-7a or control precursor, and the ability of the resulting blastocysts attaching onto fibronectin was determined.

Several members of the let-7 family (let-7a, -7d, -7e, -7f, -7g) were also found in the list.

Here we provide evidence that integrin-β3 mediates the action of let-7a on implantation of activated blastocysts.

Let-7 controls cellular proliferation by negatively regulating RAS and cell cycle-related genes such as cyclin D2, CDK6 and CDC25A [53].

To determine whether a low level of let-7 also occurred in human blastocysts, donated human embryos cryopreserved at the 2–4-cell stage were thawed and cultured to blastocysts.

Eight-cell embryos were electroporated with let-7a precursor either with or without integrin β3 (Itgb3) RNA.

The blastulation rates were similar between blastocysts electroporated with pre-let-7a and those with control RNA.

The effects of let-7a on the embryo attachment, percentage outgrowth and outgrowth area in vitro.

The percentage of the former group of blastocysts with trophoblast outgrowth (33.5±2.9%) was also lower than that of the latter group (67.3±3.8%) at 48-hour post-electroporation (Fig. 4b ), at which most of the blastocysts electroporated with pre-let-7a exhibited only early signs of spreading.

For assessing the mature let-7a level in embryos upon pre-let-7a electroporation, quantitative PCR was performed on embryos at 24-hour post-electroporation as described [12], [13].

0037039.g005 Figure 5 (a) The potential let-7a binding site in mouse integrin-β3 (Itgb3).

Eight-cell embryos were electroporated with precursor of let-7a or control RNA, and transferred into opposite uterine horns of mice on Day 3 of pseudopregnancy (5 embryos for each horn).

0037039.g006 Figure 6Eight-cell embryos were electroporated with let-7a precursor either with or without integrin β3 (Itgb3) RNA.

23

d. Wnt1 mRNA expression in tissues from 20 patients were tested, and there is inverse correlationship between let-7a miRNA and Wnt1 mRNA was found, Pearson = −0.722, p < 0.01 RFP based let-7a/b/c/d/e/f/g/i lentiviral vectors were successfully infected into HCC cells, asshown in Fig.   1. Inhibition of cell proliferation was detected using MTT assay at 48 h. The proliferation of let-7a -overexpressing HCC cells was suppressed most effectively compared to scramble and empty vector groups, as determined by the Student’s T-test (p < 0.01) and ANOVA (p < 0.01) analysis with Bonferroni correction (Fig.   2a).

b. Genes related to EMT were detected, and results showed that let-7 inhibited the EMT of HCC cells through regulating E-cadherin, N-cadherin and Snail, of which, E-cadherin was up-regulated, whereas, the mesenchymal biomarker N-cadherin and Snail were decreased.

To explore the possible mechanisms by which let-7a represses sphere number, we hypothesized that increased let-7a in HCC cells and HCC stem cells inhibited malignant cellular behaviors through down -regulating N-cadherin and Snail, that has been typical pathological markers for epithelial trait was up-regulated; meanwhile, was involved in the process of epithelial-mesenchymal transition (EMT) (Fig.   4b, Left).

d. Wnt1 mRNA expression in tissues from 20 patients were tested, and there is inverse correlationship between let-7a miRNA and Wnt1 mRNA was found, Pearson = −0.722, p < 0.01 Let-7 is a family consisting of 13 members located on nine different chromosomes whose expression is usually lost, reduced, or deregulated in most human malignancies [21].

a. Gene expression levels of let-7 targeted genes, which were implicated in cell apoptosis and cell cycle regulations.

Tumor suppressive let-7 miRNAs are universally down-regulated in human hepatocellular carcinoma (HCC) versus normal tissues; however, the roles and related molecular mechanisms of let-7 in HCC stem cells are poorly understood.

RFP based let-7a/b/c/d/e/f/g/i lentiviral vectors were successfully infected into HCC cells, asshown in Fig.   1. Inhibition of cell proliferation was detected using MTT assay at 48 h. The proliferation of let-7a -overexpressing HCC cells was suppressed most effectively compared to scramble and empty vector groups, as determined by the Student’s T-test (p < 0.01) and ANOVA (p < 0.01) analysis with Bonferroni correction (Fig.   2a).

a. The expression levels of let-7 miRNAs in HCC cells were detected after lentivirals infection, and results showed that we successfully constructed let-7 overexpressing HCC cells.

c. Both let-7a and cis-platinum inhibited Wnt1 explression level, and exerted sygnergic inhibition on Wnt1 activity IHC studies show that the level of β-catenin was much higher in tumors with later clinical stages (Fig.   7a-b).

In this study, we show that overexpressing let-7a exerted inhibitory effects on HCC, consistent with previously published results for other malignancies [27, 28].

In HCC stem-like cells, overexpressing let-7a inhibited the Wnt1/Frizzled/β-catenin signaling pathway, which was involved in maintaining the self-renewal ability of stem cells.

In clinical HCC and normal tissues, let-7a expression was inversely correlated with Wnt1 expression.

In clinical HCC samples, let-7a expression was much lower in tumor tissues than adjacent normal tissue (Fig.   7c), indicating an inverse relationship between let-7a expression and HCC occurrence.

Overexpressing let-7a suppressed the EMT factors of HCC cells and Wnt signaling pathway of HCC stem-like cells.

In HCC stem-like cells, key molecules of the Wnt signaling pathway universally decreased due to overexpressing let-7a, indicating that let-7a inhibited the Wnt1/Frizzled/β-catenin pathway in a population enriched with HCC stem cells (Fig.   4b, right).

Overall, our results suggest that overexpression of let-7a could be used as a therapeutic agent and prognostic indicator in the management of HCC via repression of Wnt signaling activation in stem cells, and to help understand the mechanisms through which let-7 regulates HCC stem cells.

Let-7 functions are detailed explored in many kinds of tumors, and let-7 acted through post-transcriptional regulations of the targeted genes [30].

We found that increased let-7a could inhibit sphere formation efficiency through alleviating EMT via down -regulating N-cadherin and Snail in HCC cells.

Further, using the luc-reporter assay and immunofluorescence staining, we found that let-7a inhibited Wnt signaling, which was achieved by decreasing TCF-4 promoter activity (T-test, p < 0.01, Fig.   4c) and β-catenin expression (Fig.   4d).

d. The addition of Wnt1 reversed the suppressive effects of let-7a on MFE Cis-platinum is one of the most commonly used anticancer drugs in clinical treatment; however its role in the regulation of CSCs is not well understood.

In HCC, it has been reported that aberrant expression of let-7 miRNAs contributed to the development and progression of HCC [5, 6].

d. The results of immunofluorescence showed that β-catenin was decreased due to let-7 overexpression in HCC stem cells We used the RNA interference assay to suppress Wnt1 activity in HCC cells by three independent siRNA.

Our results suggest that overexpression of let-7a could be used as a therapeutic agent and prognostic indicator in the management of HCC against Wnt activation, and help to understand the mechanisms through which let-7 regulated HCC stem cells.

Recent studies found that cholesterol-conjugated let-7a inhibited cell proliferation, growth, and metastasis, and mainly functioned in the cytoplasm through directly reaching HCC orthotropic tumors [25].

Likewise, let-7a expression level was inversely correlated with Wnt1 mRNA in HCC tissues (Fig.   7d).

The addition of recombinant Wnt1 protein increased the sphere formation efficiency of both let-7a1 and scramble controls, reversing the suppressive roles of let-7a (Fig.   5d), and also increased TCF-4 activity (Fig.   5c).

The lentivirals vectors infected cells were red when observed under Inversed Fluorescent Microscope Fig. 2The inhibitory effects let-7 on HCC cells.

Growing evidence suggests that the restoration of let-7 expression effectively repressed cell proliferation, invasion, metastasis, and resistance to therapy.

The combined use of cis-platinum and let-7a significantly decreased the sphere number, inhibiting the self-renewal ability of HCC stem-like cells through concurrent effects on Wnt signaling.

Overexpressing let-7a induced apoptosis and cell cycle arrest of HCC cells.

Let-7 miRNAs, especially let-7a, will be a promising therapeutic strategy in the treatment of HCC through eliminating HCC stem cells, which could be achieved by their inhibitory effect on the Wnt signaling pathway.

Wnt/β-catenin transactivation of let-7 in breast cancer further suggested the regulatory roles of let-7 in stem cells’ regulations [31].

b. The combined use of cis-platinum and let-7a significantly decreased the sphere number, inhibiting the self-renewal ability of HCC stem-like cells through concurrent effects on Wnt signaling.

The suppression of EMT signaling factors in HCC cells contributed to let-7’s induced tumor viability repression and Wnt activation repression.

We further identified that repressed Wnt1/Frizzled/β-catenin signaling in a CSC-enriched population was attributed to enforced let-7 and let-7 enhanced cis-platinum functions, helping to inhibit the self-renewal of stem-like cells.

The relative expression of let-7 family members was normalized to U6 expression, and then calculated using the formula 2 [−ΔΔCt] method, versus the scramble control.

Besides, Wnt1 is critical and essential for let-7a functions, and the rescue with recombinant Wnt1 agent abolished the suppressive roles of let-7a on hepatospheres.

However, the underlying mechanism by which let-7 works to inhibit CSCs in HCC remains largely unknown.

Fig. 4The suppressions of EMT factors of HCC cells and Wnt activation of HCC stem cells were related to let-7a functions.

a. The knockdown of Wnt1 (left) decreased the sphere forming efficiency of HCC stem cells, and abolished the functions of let-7a on self-renewal ability (right), which functioned through regulations of Wnt1/Frizzled/β-catenin pathway (left).

Decreased Wnt1 is required for let-7a -induced renewal inhibition of hepatospheres.

What’s more, the therapeutic trial of let-7 mimics showed suppressed effects on tumor growth in pre-clinical studies [4].

Fig. 1The construction of let-7 miRNAs overexpressing HCC cells.

Functioning as tumor suppressors, let-7 miRNAs were found to repress Ras, Bcl-xl, MAPK, c-Myc, cyclin D1 and other oncogenes in HCC [8, 9].

Let-7a suppressed the sphere formation efficiency of HCC cells.

The knockdown of Wnt1 decreased TCF-4 activity significantly, abolishing let-7a functions (Fig.   5c).

a. After let-7 miRNAs were successfully overexpressing in HCC cells, the effects of let-7 on cell proliferation were detected by MTT assay.

c. The knockdown of Wnt1 decreased TCF-4 activity, abolished let-7a effects; similarly, the addition of Wnt1 reversed let-7a effects, increasing TCF-4 activity, and no significant differences between let-7a and Scramble group were detected.

We examined the inhibitory effect of let-7 miRNAs on the proliferation of MHCC97-H and HCCLM3 hepatic cancer cells by using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, which was further confirmed by apoptosis and cell cycle studies.

Let-7 and Wnt1 expression in clinical tissues.

Let-7a sensitized HCC stem-like cells to cis-platinum -induced self-renewal inhibition.

Disaggregation of primary hepatospheres and secondary plating of suspending cells led to the formation of hepatospheres again, and the sphere forming efficiency of MHCC97-H-let-7a and HCCLM3-let-7a secondary spheres was lower than that of Scramble groups (T-test, p < 0.01,Fig.

Let-7a effectively repressed cell proliferation and viability, and in stem-like cells, also let-7a decreased the efficiency of sphere formation.

Especially, nanoparticle -based let-7 replacement therapy had been successfully applied in vivo, together with other delivery methods, including lentivirus -mediated pre–let-7 s, adenovirus -mediated hairpin sequences of mature let-7, cationic liposome–mediated pre–let-7, and electroporation of synthetic let-7 [8, 26].

The function of let-7 miRNAs in HCC cells.

Representative images of apoptosis and cell cycle are shown in Fig.   2d-e. Sphere formation efficiency of MHCC97-H-let-7a and HCCLM3-let-7a cells was significantly lower than that of Scramble groups (T-test, p < 0.01, Fig.   3a).

The findings of let-7 repression on CSC self-renewal indicated that let-7 restoration may be a useful therapeutic option in HCC and stem-like cells, which was more crucial for curing the cancer [8, 22– 24].

For the first time, we identified the let-7 controlled Wnt signaling activity, which was accused for maintaining of cell pluripotency.

To explore the role of let-7a in HCC, we first collected specimens from 58 patients, who underwent surgery at the Department of General Surgery, the Second Hospital of Jilin University from June 2008 to November 2013.

The loss of let-7a was related to the occurrence and progress of HCC.

However, there is no research focused on the relationship between let-7 and the Wnt signaling pathway.

The representative images of the FACS derived apoptosis ratios (d) and FACS derived cell cycle analysis (e) To examine whether the enforced let-7a could induce cell apoptosis and cell cycle arrest, both MHCC97-H and HCCLM3 cell lines were subjected to.

However, the roles of let-7 in HCC stem-like cells are less involved.

To identify whether Wnt1 is critical for let-7a-repressed self-renewal ability of HCC stem cells, MHCC97-H and HCCLM3 cells were cultured in ultralow attachment plates with recombinant Wnt1 protein (50 ng/ml) for 8 days.

Let-7 miRNAs Hepatocellular carcinoma Cancer stem-like cells EMT Wnt signaling Hepatocellular carcinoma (HCC) is one of the most aggressive malignancies worldwide, being recognized as the third leading cause of cancer-related deaths [1, 2].

Oligonucleotides encoding mature let-7a/b/c/d/e/f/g/i miRNAs and miRNA-LSC1 were synthesized by Invitrogen and cloned into the lentiviral vector lentilox3.7 (pLL3.7).

24

and exhibit increased expression in p53 wild-type radiation sensitive tissues which is similar to the let-7 expression pattern, but do not exhibit increased expression in radiation insensitive tissues, or tissues from p53 knock-out mice (other transcription factors mediate minimal expression of Puma in the absence of p53).

This is in part explained by the fact that let-7 family members have been shown to target expression of proteins involved in cell proliferation such as Ras [7] and cell cycle regulation such as Cdc25A and cyclin D1 [8], [9], which contribute to its tumor suppressor phenotype.

In a murine mo del, we confirm that let-7a and let-7b expression is decreased in radiation sensitive tissues, including bone marrow, lung, and small intestine in wild-type mice, but not in p53 knock-out mice, supporting our hypothesis that p53 is involved in regulation of let-7a and let-7b expression.

The radiation responsiveness of let-7a and let-7b expression inversely correlates with the transcription of other p53-regulated target genes across mouse tissues.

Furthermore, after irradiation let-7a and let-7b expression decreased in ATM [+/+] fibroblasts but not ATM -deficient fibroblasts (Fig. 2B and C) suggesting that ATM -dependent p53 activation is necessary for radiation -induced changes in let-7 expression.

Similar to the response of let-7 expression, both and showed a much greater change in expression in radiation-sensitive tissues compared to radiation- resistant tissues (Fig. 5A and B, respectively) which may suggest that let-7a and let-7b regulation by p53 may be associated with the p53 mechanisms that induce apoptosis.

Transient expression of wild-type p53 restored the decrease in let-7a and let-7b expression following exposure to radiation (Fig. 1A and B).

Deletion or mutation of let-7 family expression is highly associated with the development of cancer [5], while the presence of increased let-7b decreases lung tumor growth in mice [6] and sensitizes lung cancer cells to radiation [2].

ATM [+/+] and ATM [−/−] fibroblasts were also collected after irradiation and expression of let-7a (B) and let-7b (C) decreased in the ATM [+/+]cells but not in ATM [−/−] cells suggesting that ATM -dependent p53 activation is necessary for radiation -induced changes in let-7 expression.

This repression appears to be tissue specific since a decrease in let-7a and let-7b expression was observed in radiation sensitive tissues such as lung, bone marrow, and small intestine, but either no change or an enhancement of expression was observed in radiation resistant tissues such as brain, skin, or muscle.

However, we show that let-7a and let-7b expression does not decrease, and may in fact be enhanced, in both HCT116 p53 [−/−] cells and ATM [−/−] fibroblasts suggesting that ATM -mediated stabilization of p53 plays an important role in repressing let-7a and let-7b expression in response to radiation exposure.

These results suggest that p53 plays an important role in stress -induced miRNA expression changes and is required for the observed decrease in let-7 expression signaled by DNA damage.

Expression of let-7 remained either unchanged or increased in all tissue types collected from p53 knock-out mice.

Transcription of other p53 regulated genes such as Bax, PUMA correlates with let-7a and let-7b expression after irradiation.

0024429.g005 Figure 5 Transcription of other p53 regulated genes such as, correlates with let-7a and let-7b expression after irradiation.

Although p53 utilizes multiple mechanisms to promote repression, this binding suggests that p53 may directly mediate expression of the let-7a and let-7b genes [22].

In contrast, let-7a and let-7b expression did not decrease in the HCT116 p53 [−/−] cells.

Basal let-7 expression is greater in radiation sensitive tissues, especially lung.

0024429.g004 Figure 4Altered let-7a and let-7b expression in vivo in response to genotoxic stress is p53 dependent.

However, the mechanism underlying the decrease in let-7 expression after irradiation has not yet been elucidated, and a greater understanding may allow for manipulation of these pathways for therapeutic intervention.

To further study this interaction between p53 and let-7 expression, an in silico analysis was performed which identified a possible p53 binding site approximately 450 bp upstream of the let-7a3/let-7b gene.

In this study we show that p53 is required for repression of let-7a and let-7b expression in HCT116 colon cancer cells in response to several genotoxic stressors.

let-7a and let-7b account for about 60% of overall let-7 expression in HCT116 cells [18] and about 70% in AG01522 cells [3].

A recent study has shown that p53 can interact directly with the miRNA processing enzyme Drosha [23], and it is therefore possible that this may also play a role in the p53 -mediated repression of the let-7 family, in addition to transcriptional regulation.

p-value determined by Student's t. let-7a and let-7b account for about 60% of overall let-7 expression in HCT116 cells [18] and about 70% in AG01522 cells [3].

Studies have shown that over -expression of let-7 increases sensitivity of cells to radiation [2] and cisplatin [24].

These data show that following irradiation, p53 interacts with DNA upstream of the let7-a3 and let-7b genes suggesting a mechanism for p53 -dependent radiation -induced repression of let-7a and let-7b expression.

These in vivo findings confirm our previous in vitro results, and support the hypothesis that p53 plays an important role in radiation -induced changes in let-7a and let-7b expression.

HCT 116 p53 [+/+] cells, HCT116 p53 [−/−] cells, and HCT116 p53 [−/−] cells transfected with vector expressing exogenous p53 were collected 1 hr after irradiation and evaluated by for expression of let-7a (A) and let-7b (B).

let-7a and let-7b expression was significantly reduced in radiation sensitive tissues in the wild-type mice (Fig. 4C and D).

Tissues were collected 3 hours after irradiation and radiosensitive tissues including bone marrow, small intestine, and lung were assessed for let-7a (C) and let-7b (D) which demonstrated decreased expression in the p53 [+/+] but not the p53 [−/−] tissues.

Reduced expression of the let-7 miRNA family has been shown to be activated in response to irradiation [2], [3].

Like many miRNA, let-7a is expressed from multiple locations in the genome.

In the p53 [+/+] cells, both let-7a and let-7b expression decreased significantly even at the lowest radiation dose administered.

Our results confirm a radiation -induced decrease in let-7 expression in both HCT116 p53 [+/+] colon cancer cells and ATM [+/+] fibroblasts.

Finally, let-7a and let-7b repression is rescued through expression of exogenous wild-type p53 in HCT116 p53 [−/−] cells.

In contrast, radiation resistant tissues from the wild-type mice did not exhibit a decrease in let-7 expression (Fig. 4E and F).

A similar decrease in let-7a and let-7b expression was also observed following exposure to H [2]O [2], etoposide, and UV radiation and this decrease required p53 (Fig. 1C and D).

These radiation -induced reductions in let-7a and let-7b expression could be a part of the cellular response to oxidative stress or may be due to DNA damage -associated signaling pathways.

let-7a and let-7b expression are altered in vitro in response to genotoxic stress in a p53 dependent manner.

Altered let-7a and let-7b expression in vivo in response to genotoxic stress is p53 dependent.

Radiation -induced repression of let-7a and let-7b expression is also observed in mice that have undergone total body irradiation (TBI) to 2 Gy.

let-7a and let-7b expression is higher in radiation sensitive tissues.

Taken together, these data suggest that a tissue-specific p53 response underlies the changes in let-7a and let-7b expression we have observed.

Therefore it is logical to suggest that higher expression of let-7 may contribute to radiation sensitivity.

This differential response in let-7 expression closely mimics the difference we observed between HCT116 p53 [+/+] and p53 [−/−] cells suggesting a similar mechanism might be responsible.

We hypothesized that, since p53 is activated by both oxidative stress and DNA damage, p53 could be involved in the mechanism underlying the observed let-7 expression changes.

The in vivo response of let-7 to DNA damage was determined by treatment of C57BL/6J wild-type and p53 knock-out mice with 2.0 Gy total body irradiation (TBI).

let-7a and let-7b expression levels were assayed in several well established radiation sensitive tissues (small intestine, lung, and bone marrow), and radiation resistant tissues (brain, muscle, and skin) in C57BL/6J mice (Fig. 4A and B).

Transfection of mutant p53 into HCT116 p53 [−/−] cells did not rescue repression of let-7a and let-7b after radiation.

This p53-dependant reduction was not seen in more radiation insensitive tissues such as brain, muscle, and skin for either let-7a (E) or let-7b (F).

These genotoxic stressors similarly resulted in a decrease of both let-7 species that was observed only in the p53 [+/+] cells.

Dominant -negative p53 is known to prevent tetramerization of wild-type p53 thereby preventing its activation [16], and transfection of dominant -negative p53 into HCT116 p53 [+/+] cells prevented repression of let-7a and let-7b (Fig. 1E and F).

These observations taken together display significant potential of let-7 mimics as adjuvant cancer therapeutics.

Real-Time PCR for let-7a (E) or let-7b (F) was performed.

Repression of let-7a and let-7b is dependent on ATM phosphorylation of p53.

The results of these experiments further demonstrate that functional p53 is required for the generation of radiation -induced alterations in let-7a and let-7b.

Furthermore only let-7a and let-7b have been reported to decrease at both high and low doses of radiation, thus we chose to focus on those two members of the let-7 family.

Cells were then treated with etoposide, H [2]O [2], or UV radiation and assessed for let-7a (C) and let-7b (D).

In addition to sensitizing to cytotoxic agents, it has been previously observed that let-7 can significantly slow tumor growth in vivo [6] and suppress stem cell characteristics in tumors [25].

Several previous studies have shown that the let-7 family of miRNA is repressed following exposure to radiation in multiple cell lines [2], [3], [19], [20], [21].

This result further supports our assertion that the interaction of p53 with the DNA element is important for repression of let-7a and let-7b following irradiation.

Exposure to radiation and oxidative stress decreases let-7a and let-7b in a p53 dependent mechanism.

25

miRNA Let-7–targeted TUSC2 mRNA CleavageWe used the most extensively characterised human miRNAs, the let-7 family, and their natural mRNA target, the tumour suppressor candidate 2 gene (TUSC2, also known as FUS1), to demonstrate the mammalian miRNA -mediated target mRNA cleavage and regulatory activities in human cells using a novel SLA–RT-PCR assay (Fig. 1a).

Inhibition of let-7–mediated Target mRNA Cleavage and 3′-uridylation by Ago2- and TUTase-specific siRNA Inhibitors.

These results, together with the patterns of accumulated fragments at the C6 and C8 positions of the TUSC2 mRNA let-7 target site (Fig. 1a-I,II), suggest that the miRNA -mediated target mRNA cleavage occurred at specific positions on mRNA sequences and the concurrent 3′-oligouridyl modification of cleaved mRNA fragments with one or two uridyl residues may be sufficient to promote targeted 5′-3′ mRNA decay 21 22.

To demonstrate whether the observed accumulation of cleaved and 3′-uridylated TUSC2 mRNA fragments was specific to let-7 miRNA activity, we examined the effects of knocking down expression of endogenous let-7 miRNAs by a let-7–specific miRNA inhibitor on SLA– and U-SLA–RT-PCR outputs in H1299 cells.

To determine the potential effects of structural and spatial contexts of the target mRNA on miRNA -mediated mRNA cleavage, we developed an enhanced green fluorescence protein (EGFP) reporter plasmid -based mo del system with a defined let-7 target and SLA–RT-PCR primer binding sequences and a fully functional mammalian mRNA structure to monitor the precise action of miRNA on its target in a time- and space -dependent manner.

To determine whether Ago2 was involved in the let-7–mediated target mRNA endonucleolytic cleavage in miRISC, we analysed the effects of Ago2 knockdown on let-7–mediated target mRNA cleavage and uridylation in H1299 cells co -transfected with the pLJ-T214 plasmid and Ago2-specific siRNA (siR-Ago2) (Fig. 5a–c).

We have shown that target gene silencing mediated by let-7 family miRNAs and other human miRNAs could be initiated by Ago2-catalysed endonucleolytic cleavage on base-paired miRNA:mRNA target sites, which is consistent with the fact that the Ago2 endonucleolytic RNase H domain prefers paired bases as substrates 15 24.

pLJ-T722 let-7 dual-target expression vector.

We used the most extensively characterised human miRNAs, the let-7 family, and their natural mRNA target, the tumour suppressor candidate 2 gene (TUSC2, also known as FUS1), to demonstrate the mammalian miRNA -mediated target mRNA cleavage and regulatory activities in human cells using a novel SLA–RT-PCR assay (Fig. 1a).

A DNA fragment with two copies of let-7 targets identical to the TUSC2 let-7 target site was synthesized by GenScript.

We previously identified miR-98, a member of the let-7 miRNA family, as targeting the 3′UTR of TUSC2 mRNA and showed that overexpression of miR-98 decreased the TUSC2 mRNA level in various NSCLC cells 17.

In pLJ-T214–transfected H1299 cells, three identical copies of TUSC2 let-7 target sites were produced: one copy in the 3′UTR of the endogenous TUSC2 mRNA transcript and two copies in the 3′UTR of the exogenously expressed pLJ-T214 EGFP reporter transcript.

Overexpressed miR-622 and let-7d mRNAs were detected by qRT-PCR in H1299 cells transfected with a miR-622 or a let-7 expression vector, respectively (Fig. 2b).

To predict the actual let-7–targeted cleavage sites and their possible origins, we performed in-depth analysis of the unique pattern and relative quantity of these accumulated SLA–RT-PCR products derived from let-7–mediated TUSC2 mRNA cleavage and 3′-uridylation activities at various positions in the let-7: TUSC2 target site and its 5′- and 3′-adjacent regions (Fig. 1).

With a maximum bulge loop of 3 nt permitted on the target sequence, a putative let-7 miRNA:target base-pairing map was composed according to the minimal free energy (MFE) of each pair, as calculated with the assistance of RNA Hybrid 19, to compare the contributions from each let-7 family member to the detected target mRNA cleavage activities (Fig. 1c).

AATTCCCTAGGAAGAGGTAGTAGGTTGCATAGTTTTAGGGCAGGGATTTTGCCCACAAGGAGGTAACTATACGACCTGCTGCCTTTCTTAGGC TCGAGCCTAAGAAAGGCAGCAGGTCGTATAGTTACCTCCTTGTGGGCAAAATCCCTGCCCTAAAACTATGCAACCTACTACCTCTTCCTAGGG A DNA fragment with two copies of let-7 targets identical to the TUSC2 let-7 target site was synthesized by GenScript.

The first let-7 target site from the 5′ cap was annotated as T1 (2nd underlined section) and the second let-7 target as T2 (3rd underlined section).

To determine the structural effect of the target mRNA on let-7 miRNA–mediated mRNA fragment distribution, we constructed a plasmid vector pLJ-T722 (Fig. 2c) similar to the pLJ-T214 plasmid (Fig. 4a), in which the two copies of identical let-7:target pairing sequences in the 3′UTR of the eGFP reporter gene had the length and composition of nt adjacent to their 5′- and 3′- ends altered, labelled as ST1 and ST2 (Fig. 4c).

pLJ-T214 let-7 dual-target expression vector.

For these two identical target sites located at different positions in the same transcript, the upstream T1 appeared to have more let-7–mediated cleavage activity than the downstream T2, suggesting a potential positional advantage of T1 over T2 in accessing let-7–guided miRISCs and miRISC scanning along mRNA sequences in the 5′ to 3′ direction.

The reporter plasmid (pLJ-T214) consisted of an EGFP reporter coding sequence under the control of a cytomegalovirus (CMV) promoter, immediately followed by a 3′UTR with two identical copies of let-7 target sequences (T1 and T2) directly derived from TUSC2 mRNA sequences arranged in tandem and a BGH poly(A) signalling sequence (Fig. 4a).

The significant reduction of oligouridylated mRNA fragments at A4 and C18 suggests the indirect involvement of Ago2 in let-7–mediated target mRNA cleavage, where the majority of detected mRNA fragments at T1 originated from the 3′-5′ decay products of cleaved 5′-miRNA fragments at the T2 site.

These observations suggested that the endonuclease activity of Ago2 was directly responsible for the let-7–guided target mRNA cleavage activity at G17 and C27, leading to progressive reduction of the 3′-uridylated fragments by 3′-uridylation–facilitated 5′-3′ RNA decay.

miRNA let-7 knockdown was carried out in H1299 cells transfected with 10 μM of miRCURY LNA anti-miR-98 inhibitor packaged in a DOTAP:Chol:siRNA complex.

The accumulation of cleaved TUSC2 5′-mRNA fragments was markedly reduced by this knockdown of endogenous let-7 expression (Fig. 1a-III,b, +miR-98 LNAi).

H1299 cells were transfected with a miR-98 locked nucleic acid inhibitor (miR-98-LNAi) that is effective in all let-7 miRNA members.

The let-7: TUSC2 mRNA target interaction analysis predicted strong and extended base-pairing in the seed region (Fig. 1c).

The 3′UTR of the EGFP reporter gene containing two copies of identical predicted let-7:target pairing sequences but with varied lengths and compositions of nt (underlined) at their 5′- and 3′-adjacent regions (ST1 and ST2).

miRNA Let-7–targeted TUSC2 mRNA Cleavage.

The accumulation patterns of the 3′-uridylated T2 fragments at 16 h after transfection (Fig. 4b-II) and those of the 3′-uridylated T1 fragments at 72 h (Fig. 4b-IV) resembled the pattern obtained with the endogenous TUSC2 mRNA let-7 target site (Fig. 1a-II), particularly within the base blocks defined by red boxes in Fig. 4b.

Varied expression levels of the let-7 family miRNAs were detected in H1299 cells by real-time quantitative RT-PCR (qRT-PCR) (Fig. 1b).

Amplicon intensities at the block positions U3-C8, U15-C18, U25-C27 and G28-C32 along the let-7: TUSC2 target site (Fig. 1b-II) were significantly higher in oligouridylated mRNA fragments, as detected by 2U-SLA–RT-PCR, than those at the corresponding positions in unmodified mRNA fragments, as detected by unmodified SLA–RT-PCR reactions (Fig. 1a-I).

The specificities of the miR-98–mediated TUSC2 mRNA cleavage and sequential 3′-oligouridylation were further demonstrated by the dramatically different patterns and intensities of 2U-SLA–RT-PCR amplicons detected at various positions around the let-7: TUSC2 mRNA target site between the miR-98-LNAi–treated (Fig. 1a-IV) and –untreated (Fig. 1a-II) H1299 cells.

SLA–RT-PCR amplicons of 528 bp and 234 bp were expected on agarose gel for let-7–cleaved mRNA fragments from target sites T1 and T2, respectively.

Prediction and detection of the let-7 miRNA–mediated target cleavage sites in the 3′UTR of TUSC2 mRNA.

The accumulation of a cleaved 5′-mRNA fragment at a specific cleavage site within and near the predicted let-7: TUSC2 target pairing sequences was represented by the relative intensity of each specific SLA–RT-PCR amplicon resolved on an agarose gel (Fig. 1a-I, upper panel) and by the relative fragment abundance (RFA) on a qRT-PCR histogram (Fig. 1a-I, lower panel).

These SLA–RT-PCR products represented the dynamic activities mediated by let-7 on the TUSC2 mRNA target site.

Our results, using a novel SLA–RT-PCR assay, show endogenous let-7 miRNA–guided and Argonaute-catalysed endonucleolytic cleavage of target TUSC2 mRNAs at various sites in partially paired miRNA:mRNA sequences, predominantly within the miRNA seed region or in the 3′ supplementary pairing region.

The endogenous let-7–mediated mRNA cleavage activity on the ST1 and ST2 target sites was examined by SLA–RT-PCR or SLA-qRT-PCR (only at sites whining the red boxes), using total RNAs prepared from H1299 cells transfected by pLJ-T722 at 24 h as templates and the SLA-RT primers described in Supplementary Table 1c (Fig. 4d).

Endogenous let-7–mediated mRNA cleavage of those target sites would produce 5′-mRNA fragments with identical 3′ termini, which could be detected competitively by the same SL-RT primer in RT.

To test whether oligouridines were added to the cleaved 5′ fragments that accumulated around the let-7 target site on TUSC2 mRNA, we modified the SLA-RT primers by adding varied numbers of adenosines at the 5′ end of the probe sequences to match the non-templated oligouridine that could be added to the 3′ ends of cleaved mRNA fragments (Supplementary Fig. 1b).

To investigate the involvement of TUTases in miRNA -mediated mRNA cleavage and 3′-uridylation of the cleaved mRNA fragments within and near the miRISC, we analysed the effects of TUTase gene knockdown on let-7–mediated target mRNA 3′-oligouridylation in H1299 cells treated with siRNAs specific to all known mammalian TUTases by SLA–RT-PCR (Fig. 5d,e).

Cleavage activities on the T1 and T2 sites of the pLJ-T214 transcripts served as a control for verifying the endogenous TUSC2 mRNA fragments and internal references for defining the spatial effect of target sites on endogenous let-7 activity by the SLA–RT-PCR assay or SLA-qRT-PCR.

The expression of let-7 miRNAs was depleted in the cells transfected with miR-98 LNAi 48 h after treatment, as shown by qRT-PCR analysis using let-7–specific SL-RT primers (Fig. 1b).

RNAi gene knockdown of Let-7 family miRNAs, Ago2 and TUTases.

A series of SLA-RT primers with a 6-nt probe at their 3′ termini was designed to match along the entire let-7: TUSC2 mRNA target sequence as well as their 5′- and 3′-adjacent regions for the initial RT reaction (Supplementary Fig. 1a and Supplementary Table 1a), using total RNAs prepared from H1299 cells (Fig. 1a-I,II) as RT templates.

However, the accumulation of oligouridylated mRNA fragments at base positions G17, A26 and C27 remained strong 48 h after let-7 knockdown (Fig. 1a-IV), suggesting that degradation of the 3′-oligouridylated 5′-mRNA fragments was delayed.

SLA-RT primers and PCR primers are listed in Supplementary Table 3. (c) let-7 miRNA: TUSC2 target mRNA sequence pairing and potential cleavage sites were detected by a minimal free energy (MFE)–based miRmate algorithm 17.

The uridine base-paired G17, which was positioned at the centre of the let-7 RNA sequences near the 3′-end of the seed region, displayed a substantial accumulation of both the unmodified (Fig. 1a-I) and 3′-uridylated (Fig. 1a-II) mRNA fragments and was immediately followed by 3′-uridylation at its 3′ side close to the central bulge region, making G17 the most likely cleavage site.

As expected, the let-7–mediated TUSC2 mRNA cleavage activities were concentrated in the intensively base-paired seed region and in the predicted supplementary base-pairing region (Fig. 1a), while no apparent let-7–mediated mRNA cleavage activities were detected in the central bulge region, which lacks miRNA:mRNA base-pairings and has a high MFE microenvironment (Fig. 1a-I,III).

The accumulated fragments at C18 might also be the result of similar cleavage patterns at central pairs contributed by let-7a, -7b, -7c and -7d activities (Fig. 1c).

The characteristic pattern and intensity of mRNA fragment accumulation detected surrounding the endogenous let-7: TUSC2 target site reflected the collective activities of all let-7 family members in H1299 cells.

Let-7 miRNAs differ from each other in a few bases, primarily in the central bulge region (hence the lack of base-pairing) and the 3′ supplementary pairing region, and they share a conserved short stretch of base-paired (7–10 nt) sequences at the seed region (Fig. 1c).

Let-7 family miRNA, hsa-miR-622, hsa-miR-30a and hsa-RNU44 in H1299 cells were determined by SLA–RT-PCR methods.

Undetectable oligouridylated mRNA fragments in the central bulge region confirmed the lack of let-7–mediated mRNA cleavage activity in that region (Fig. 1a-II,IV).

26

In addition, we also targeted MYCN as a positive control because of its previously established ability to regulate let-7 transcription [1, 26, 27] and based on its expression pattern in our neurodevelopmental mo del.

These issues are highly relevant to the study of cancer, where let-7 targets are strongly induced, consistent with a loss of mature let-7. It is possible that transcriptional induction of let-7 family members could be a strategy to drive a cascade of re -expression of let-7 in cancerous tissues, akin to the process which appears to happen during early human development.

Perhaps, the constitutive transcription and maturation of small amounts of let-7 serves as something of a rheostat of developmental timing that is tuned as cells become more specified, leading to changes in let-7 targeted TFs that can then in turn regulate let-7 transcription, leading to even more mature let-7 through an additional feed-forward mechanism.

Taken together, forkhead box proteins have the molecular components necessary to induce reorganizations of the epigenetic state, and some are expressed at anatomic locations and times that correlate with let-7 expression.

Two regulatory regions upstream of the locus were identified as the temporally regulated expression binding site (TREB) and the let-7 transcription element (LTE), and many studies have tested the binding and transcriptional control exerted by several TFs including elt-1 and daf-12[2, 16– 18].

Hypothesized regulatory regions were assembled by searching 20 kilobases upstream and downstream of each transcript for colocalization of H3K27Ac, H3K4me3, and DNAse sensitivity in samples known to express let-7 primary transcripts, and H3K27me3 or H3K9me3 in samples without appreciable primary let-7 transcripts.

It is worth pointing out that some let-7 targets also regulate let-7 maturation, such as LIN28A, LIN28B and LIN41.

Studies in C. elegans, where the activity and expression of let-7 is regionally and temporally constrained, have attempted to clarify transcriptional regulation from the single let-7 locus.

Furthermore, it has been proposed that some let-7 target RNAs can act as ceRNA or sponges of mature let-7 to regulate their activity[37].

In addition, some of the TFs shown here and elsewhere to regulate let-7 transcription (e. g. N-MYC) are also let-7 target genes[27, 38, 39].

Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells.

As a first step to determine how let-7 miRNAs are transcriptionally regulated, we attempted to define developmental mo dels that display dynamism of transcription.

Even in the early neural lineage where mature let-7s are scarce, some of the let-7 polycistrons are not transcribed, whereas others appear to be constitutively expressed.

Together, these data allowed us to identify primary let-7 transcripts, based on their expression in our Chromatin -associated RNA-seq samples and in DGCR8 [-/-] RNA-seq samples, even when they disagreed with RefSeq-annotated MIRLET7 genes.

For instance, the pattern of let-7a and let-7b was conserved and dynamic in both contexts, while let-7a1, let-7d and let-7f1, which are also polycistronically transcribed, were constitutively expressed in both contexts.

Taking advantage of the annotation of promoters, we attempted to identify mechanisms of transcriptional regulation of the dynamic versus constitutively regulated let-7 polycistrons.

0169237.g002 Fig 2Expression of pri-let-7 during neural specification.

The fact that the polycistronic let-7 pri-miRNAs appeared to be regulated in concert as a result of these manipulations is further evidence of the co-regulatory mechanisms used during cell fate decision-making.

The fact that let-7 miRNAs can be dynamically regulated at the transcriptional level has only recently been appreciated, but the relative contribution of this regulation relative to levels of mature let-7s remains undefined.

While we can only speculate, it is possible that both dynamic and constitutive let-7 transcription is a function of feed-back activity of let-7-target interactions.

Therefore, sophisticated mechanisms for let-7 regulation have been preserved and expanded across evolution, perhaps pointing to their critical roles in both developmental timing and tumorigenesis.

In both developmental scenarios, we observed that a subset of let-7 family members showed transcriptional induction over developmental time, while other members appeared to be constitutively transcribed (Fig 2A).

Reciprocal expression of lin-41 and the microRNAs let-7 and mir-125 during mouse embryogenesis.

We previously identified dynamic transcriptional regulation of some let-7 family members between neural progenitors that represent distinct developmental stages[20].

Together, these data demonstrate that proper annotation of let7 loci can facilitate prediction of regulatory elements that are bound by transcription factors with the ability to regulate let-7 transcription.

Finally, by analyzing publically available data for let-7 loci, we identify transcription factors that appear to regulate let-7 transcription by acting at either promoter or enhancer elements enriched in dynamically regulated let-7 polycistrons.

Because all the let-7 family members have the same seed sequence, it seems redundant to express so many.

We knocked down several of these candidate let-7 regulator transcription factors in tissue-derived NPCs.

Expression of pri-let-7 during neural specification.

The study of regulation of the let-7 family of miRNAs has focused on these processing steps, but less is understood about how the pri- let-7 transcripts are regulated by transcription prior to any processing.

This study is not the first to identify transcriptional mechanisms for let-7 family members, but previous studies from lower organisms did not take advantage of genome-wide analyses to systematically define regulatory modules or transcription factors that regulate them.

Autoregulation of microRNA biogenesis by let-7 and Argonaute.

The time of appearance of the C. elegans let-7 microRNA is transcriptionally controlled utilizing a temporal regulatory element in its promoter.

We found that the levels of all mature let-7 family members were strongly induced across development (Fig 2B).

Using RT-PCR with primers specific to the let-7 miRNAs at different stages of processing, we tested changes in expression of the pri-let-7s (A) and their mature forms (B).

Identification of potential epigenetic regulation of let-7 polycistrons.

LIN28A and LIN28B are RNA binding proteins that regulate several of these processing steps to control levels of mature let-7 transcripts[14, 15].

While some studies have identified transcriptional mo dels of pri-miRNAs in higher organisms, the lack of proper annotation left the precise regulatory motifs for human let-7 transcripts undefined.

Together, these analyses define contexts in which particular let-7 polycistrons are transcriptionally regulated, and identify TFs that play roles in this dynamism.

SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors.

The temporal patterning microRNA let-7 regulates several transcription factors at the larval to adult transition in C. elegans.

Dynamic transcriptional regulation of some pri-let-7 transcripts.

Another group later induced pri-let-7 accumulation in the context of DGCR8 knockout, and validated with RACE PCR that primary let-7 transcripts have multiple isoforms, some of which aligned nearly identically to our observed annotation patterns and varied in different cellular contexts[21].

All other datasets are listed in supplemental tables 1 and 2. The let-7 family of miRNAs were first identified in C. elegans as a single heterochronic factor controlling developmental timing[1, 2].

Complete annotation of let-7 miRNA transcripts and regulation in human PSCs and NPCs by Chromatin RNA-seq.

Functionally defining regulators of let-7 transcription.

Here, after complete annotation of let-7 transcripts, we attempt to define regulatory motifs for this family of miRNAs by taking advantage of Chromatin -associated RNA-seq and the latest genomic descriptions of chromatin states within let-7 loci.

We then sought to determine whether the dynamic versus constitutive let-7 polycistrons display distinct regulatory schemes.

We mo del let-7 transcription in distinct neural paradigms to reveal subsets of let-7 family members that are transcribed constitutively versus dynamically regulated in particular contexts.

0169237.g001 Fig 1Dynamic transcriptional regulation of some pri-let-7 transcripts.

While all mature miRNAs increased over the course of differentiation, only a subset (marked with dotted lines), the dynamically regulated let-7s, also increased before processing, at the primary let-7 stage.

In higher organisms, a different system for regulating let-7 miRNA transcription must have been established.

Dynamically and constitutively transcribed let-7 loci show distinct epigenetic signatures.

Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA.

This is potentially an important issue to resolve as recent evidence suggests that not all let-7 miRNAs are processed by the same machinery[36], and therefore, the level of mature let-7 might not simply be DICER dependent.

In C. elegans, where let-7s were first discovered, there is evidence for both transcriptional and maturation control despite the fact that all let-7 is transcribed from a single locus.

We previously took advantage of a method that allows for the capture of nascent RNA transcripts, which are still associated with the chromatin from which they are transcribed, to carefully annotate pri- let-7 transcripts[19, 20].

In addition, in the case of let-7 miRNAs, other processes such as uridylation are used to stabilize or destabilize miRNAs[11– 13].

In so doing, we find that the RefSeq annotations underestimate the length of the let-7 polycistrons.

From these annotations, it is clear that many let-7 family members are transcribed within very long (up to 200KB), often polycistronic transcripts[20, 21].

0169237.g003 Fig 3Dynamically and constitutively transcribed let-7 loci show distinct epigenetic signatures.

Here we show that there is dynamism of let-7 transcription as measured by Chromatin -associated RNA-seq as witnessed by the fact that the let-7a3/b locus is practically silent in pluripotent stem cells, and neural progenitors derived therein, but strongly expressed in tissue derived neural progenitors (Fig 1A).

Accession numbers for these datasets are also found in Tables 1 and 2. S1 FigShown are each of the let-7 family member transcripts, including polycistrons.

At top are the Chromatin -associated RNA-Seq peaks and RefSeq annotations of the primary let-7 transcripts, and below are the relative intensities of DNAse sensitivity or histone modification ChIP-Seq peaks at those loci.

Furthermore, Chromatin -associated RNA-seq also allows for mapping reads which highlighted the fact that let-7 transcripts are long and sometimes polycistronic.

The middle section are data from the Chromatin RNA-seq described in Fig 1. Below in green are the annotations for let-7 miRNAs described in Cheng et al in the indicated cell types.

As further evidence that let-7 transcripts are polycistronic, the data in Fig 1A and 1B on dynamic versus constitutive indeed showed a shared pattern for those let-7s that are in the same polycistron.

Using these data and the imputed chromatin state mo del in tamed, we clearly identified TSSs, promoters (active and poised), enhancers, and actively transcribed regions for two of the let-7 polycistrons (Fig 3).

The study of mammalian pri- let-7 transcription is hampered by the relative scarcity of the transcript which is processed immediately in the nucleus and therefore difficult to detect.

Over evolution, let-7 isoforms have expanded such that the human genome contains 9 isoforms.

Z wgEncodeEH003090 GSM733662 NHDF-Ad H3K27ac wgEncodeEH001049 GSM733745 NHDF-Ad H3K27me3 wgEncodeEH001050 GSM733733 NHDF-Ad H3K36me3 wgEncodeEH001051 GSM1003526 NHDF-Ad H3K4me1 wgEncodeEH002429 GSM733753 NHDF-Ad H3K4me2 wgEncodeEH001052 GSM733650 NHDF-Ad H3K4me3 wgEncodeEH001053 GSM1003554 NHDF-Ad H3K79me2 wgEncodeEH002430 GSM733709 NHDF-Ad H3K9ac wgEncodeEH001054 GSM1003553 NHDF-Ad H3K9me3 wgEncodeEH002431 GSM1003486 NHDF-Ad H4K20me1 wgEncodeEH002417 WI-38 CTCF wgEncodeEH001902 GSM945265 WI-38 H3K4me3 wgEncodeEH001914 The genome regions surrounding known let-7 gene locations were surveyed for the presence of histone modifications and open chromatin in cell types representative of the stages of differentiation from PSCs to NPCs and neurons.

These sequences are not present upstream of mammalian let-7 gene, and there are not similarly consistently present sequences near all the different let-7 loci.

A complete presentation of transcriptional data from the other let-7 loci as demonstrated by Chromatin -RNA-seq is in (S1 Fig).

Shown are each of the let-7 family member transcripts, including polycistrons.

Complete annotation of let-7 miRNA transcripts and summary of available data on epigenetic marks across various cell types.

Chromatin -associated RNA-seq reads were mapped onto two distinct polycistronic let-7 loci.

Annotation of epigenetic marks at two let-7 polycistronic loci.

As with other miRNAs, the initial pri- let-7 transcripts are first transcribed by RNA polymerase II, then processed via the canonical pathway through the pre-miRNA stage generated by the action of Drosha/DGCR8.

Z wgEncodeEH003090 GSM733662 NHDF-Ad H3K27ac wgEncodeEH001049 GSM733745 NHDF-Ad H3K27me3 wgEncodeEH001050 GSM733733 NHDF-Ad H3K36me3 wgEncodeEH001051 GSM1003526 NHDF-Ad H3K4me1 wgEncodeEH002429 GSM733753 NHDF-Ad H3K4me2 wgEncodeEH001052 GSM733650 NHDF-Ad H3K4me3 wgEncodeEH001053 GSM1003554 NHDF-Ad H3K79me2 wgEncodeEH002430 GSM733709 NHDF-Ad H3K9ac wgEncodeEH001054 GSM1003553 NHDF-Ad H3K9me3 wgEncodeEH002431 GSM1003486 NHDF-Ad H4K20me1 wgEncodeEH002417 WI-38 CTCF wgEncodeEH001902 GSM945265 WI-38 H3K4me3 wgEncodeEH001914The genome regions surrounding known let-7 gene locations were surveyed for the presence of histone modifications and open chromatin in cell types representative of the stages of differentiation from PSCs to NPCs and neurons.

These issues bring to light an interesting question, why have mammals evolved to have so many let-7 isoforms in their genomes, and why do so in polycistronic fashion.

Using data from the Epigenetic Roadmap, we annotated the chromatin states across each polycistronic let-7 locus (Fig 3 and S2 Fig).

Computationally imputed chromatin states generated by the ChromHMM algorithm at the same let-7 loci.

Identification of dynamics of let-7 polycistron transcription.

S3 Fig Shown are the let-7 genomic loci with accompanying epigenetic marks as identified by ChIP-seq data available from the epigenetic roadmap across the indicated cell types.

We previously showed that pri-let-7 transcripts can be identified by Chromatin -associated RNA-seq data[20](NIH GEO Dataset GSE32916).

As further evidence for their polycistronic nature, these updated epigenetic data from a wide variety of primary cell types again predicted single, long transcripts across entire loci that encompass multiple let-7 family members, as opposed to older analyses on transformed cell lines upon which the RefSeq annotations were created.

27

In fact, the protein expression levels of LIN28B were upregulated by the existence of HBV preS2 transcript, which were antagonized by the forced expression of let-7 g. Although let-7 g is one of the twelve let-7 family members 30, because LIN28B blocks the maturation of all let-7 family members 34 35, the increased LIN28B expression may lead to repression of all miRNAs in the let-7 family, leading to a concomitant increase of let-7 targets.

In addition, when HBV products expressed from the cellular genome were suppressed by adding tetracycline after culturing the cells without tetracycline, HBV preS2 protein, although its expression was lower to begin with due to let-7 g overexpression, was decreased more rapidly in let-7 g -overexpressing Hep38.7 cells than in control Hep38.7 cells.

These results support the in vitro results that HBV transcripts may suppress let-7 function and, in those cases, let-7 target protein expression is upregulated.

The inhibitory effects on cccDNA production by let-7 g may be due to the decreased large S protein, direct effects of let-7 on cccDNA production, or indirect effects via let-7 g function on expression level changes of its target host genes.

As expected, the protein expression levels of HMGA2, LIN28B, and c-myc, which are let-7 g targets, were increased in Large S–S -expressing cells (Fig. 2d).

Expression of Large S–S (pCDH-Large S–S) reversed such suppression by inhibiting let-7 g function (left), but not in case of miR103 (right).

Forced stable expression of let-7 g in Large S–S -expressing Huh7 cells canceled the effects of Large S–S expression.

As shown in Fig. 4c, the cccDNA levels were lower in let-7 g -overexpressing cells than in control Hep38.7-tet cells in cultures without tetracycline (Fig. 4c), suggesting that let-7 g has, albeit slightly, suppressive effects on the HBV cccDNA levels.

The details of the effects on cccDNA by let-7 g expression or targeting the corresponding sequences need to be further determined.

In these cells, let-7 g -overexpressing Hep38.7 cells expressed lower levels of HBV preS2 protein after long-term culture without tetracycline (Fig. 4a).

Additionally, to introduce mutations into the seed region putatively targeted by let-7, another mutagenesis was performed to introduce mutations (ACACUCCA to TCTCUCCA) into pCDH-large S–S, constructing pCDH-large S-SM.

When examining the effects of forced expression of miRNAs, 0.4 μg Let-7 g or miR103 precursor -expressing plasmids (pCDH-let-7 g or pCDH-miR103) were transfected simultaneously.

However, when using let-7 g reporter and precursor constructs, simultaneous expression of the Large S–S construct significantly suppressed the let-7 g function, and luciferase values were recovered (Fig. 2b).

Additionally, to examine the expression levels of LIN28B, a let-7 target gene, in liver tissues derived from patients with HBV infection, immunohistochemistry was performed using HCC and the surrounding tissues from HBV-infected and -uninfected cases.

These effects were not observed when expressing the Large S-SM construct, which has mutations in the complementary regions of the let-7 g seed sequences, suggesting that the effects were let-7 g-specific.

To establish large S mRNA -expressing transgenic mice with and without mutations in the let-7 g-specific seed sequences, a DNA fragment of 2,535 bp, containing the CMV promoter region, the coding region of the large S mRNA, and a transcriptional terminator, was excised from the pcDNA3.1-Large S–S or pCDNA3.1-Large S-SM plasmids and subcloned into the EcoRI sites of pCDH-large S–S and pCDH-large S-SM by the In-Fusion method, as described above, by digestion with NruI and DraIII.

Let-7 g overexpression suppressed preS2 protein levels.

The values of the sample without let-7 g overexpression were set as 1. Data represent the means ± s. d. of three independent experiments.

The suppression of miRNA function by the Large S–S construct was not observed when using the miR103 reporter or precursor constructs (Fig. 2b), again suggesting specificity to let-7 g function.

Figure 4b, suggesting that cellular let-7 g has suppressive effects on HBV protein levels.

Based on the results in this study, supplementation of let-7 g into infected hepatocytes may be beneficial to both the prevention of tumorigenesis and the inhibition of viral envelop protein production.

While the role of Large S protein in cccDNA amplification is still controversial 27 28, we examined the levels of cccDNA by Southern blotting with and without let-7 g overexpression in Hep38.7-tet cells.

The firefly luciferase -based reporter carrying let-7 g- and miR103-responsive elements in its 3′ untranslated region, to examine corresponding miRNA function (pGL4-let-7 g and pGL4-miR103), and the internal control renilla luciferase -based plasmids (pGL4-TK) have been described previously 47.

However, the let-7 g levels in RISC were reduced by ~50% when using the cells stably expressing the let-7 g precursor construct and Large S–S.

Therefore, suppression of intrinsic function of even only let-7 g by preS2 transcript may be one of the causative factors for long-term hepatocarcinogenesis during chronic HBV infection.

Let-7 g and miR103 precursor -expressing plasmids were constructed previously 48 49.

Simultaneously, on the part of the effects of miRNA to the virus, let-7 g overexpression decreases the HBV preS2 protein levels and possibly HBV cccDNA levels.

HBV preS2 mRNA inhibits let-7 g function.

Let-7 is a well-regarded tumor-suppressive miRNA 30.

Two bases corresponding to the let-7 g seed sequences in the Large S transcript -expressing construct were mutated (Large S-SM).

In this study, we describe that sequences in HBV preS2 region can be targeted by cellular let-7 g, resulting in the impaired function of this miRNA through the decreased intrinsic recruitment of the miRNA into Ago2-related complexes.

These sequences are targeted by let-7 g, with complementarity at positions 1–13 from the miRNA 5′-end, including the seed region, and 83% complementarity of the entire miRNA sequence (Fig. 1a).

These effects were not observed when using the cells stably expressing the let-7 g precursor construct and Large S-SM, suggesting that the Large S transcripts sequestered let-7 g from RISC through their interactions and reduced let-7 g intrinsic function.

Potential let-7 g -targeting sequences, shown in red, are from nucleotides 99 to 120, and the nucleotides differing from the sequences used in this study are shown in black.

From this point, let-7 g indeed inhibited preS2 protein levels in the HBV product-inducible system both stably and after shutting off the transcription of the viral products.

In summary, we have shown that HBV preS2 transcript can be targeted by host cellular let-7 g, which may mutually anatagonize the intrinsic let-7 g function and HBV replication.

HBV preS2 mRNA can be targeted by let-7..

HBV preS2 mRNA interacts with cellular microRNA let-7 g. HBV large S mRNA suppress let-7 g function.

Let-7 g decreases HBV preS2 protein expression.

To visualize the results more easily by enhancing the basal effects, let-7 g precursor -expressing cells were used for this assay.

In addition, a construct with mutations in the preS2 sequences that disrupts the complementarity to the seed sequences of let-7 g was generated from the Large S–S construct (named as “Large S-SM”) (Fig. 1e).

How to cite this article: Takata, A. et al. Mutual antagonism between hepatitis B viral mRNA and host microRNA let-7. Sci.

Although the precipitated Ago2 protein levels were almost unchanged, let-7 g levels in RISC were approximately 20-fold higher than those in the control cells stably transfected with a control vector (Fig. 2e).

It may be important to determine which genes are indeed affected by the impaired host miRNA by the existence of HBV transcripts during the steps of chronic hepatitis and to determine the most appropriate timing for the supplementation of let-7 g into hepatocytes, to overcome the pathogenesis induced by the existence of HBV transcripts in hepatocytes.

We identified that the sequences in the HBV preS2 RNA can sequester let-7 g, which, in turn, impairs the intrinsic let-7 g function.

Data are shown after normalizing the let-7 g levels to miR103 levels in the Ago2 -associated complexes.

Through these in silico selections, the highest probabilities were attributed to the HBV preS2 sequences and let-7 g. Representative HBV genotypes A, B, C, and D were selected by referring to a previous study 10, and their sequences were extracted from the HBV sequence database, Hepatitis Virus Database (http://s2as02.

Positions of the let-7 g seed sequences are also indicated.

28

Although HMGB1 was not shown to be a direct let-7 target, its expression is modulated by the direct let-7 target HMGA1 [51].

Furthermore, aberrant let-7 expression was associated with a variety of human diseases as, for example, cardiovascular diseases [28], liver fibrosis [29], lung diseases [30], and cancer [9– 12, 26, 31– 34].

The tumor suppressor p53 in turn was found to downregulate the activity of the HMGB1 promoter [99] and to trigger the radiation induced decrease of let-7a and let-7b expression (Figures 4 and 10) in the human colon cancer cell line HCT116 [100].

Furthermore, it was shown that in these cell lines the expression of the direct let-7a targets c-Myc and KRAS was decreased upon treatment with 5 α-dihydrotestosterone and increased after an additional suppression of the miRNA let-7a [53].

Interestingly the expression of the direct let-7 target HMGA1 is as well induced by c-Myc [48], which constitutes a positive feedback loop, stimulating c-Myc expression [50] (Figures 6 and 10).

Additionally STAT3 was reported to bind the promoter of the let-7 biogenesis regulating gene Lin28, resulting in the concomitant upregulation of the let-7 targets RAS, c-Myc, and HMGA2 [158].

Dong et al. described that ectopically overexpressed let-7a induced cell cycle arrest at the G1/S phase by suppressing among others the cyclin CCND2 and additionally inhibited the proliferation of the human prostatic cell lines PC-3 and LnCap [11].

As described above let-7 was shown to be downregulated in prostatic CSCs [36] whereas reconstitution of the let-7 suppressed the growth of PC cells [10, 12].

Due to the complex regulation mechanisms of let-7 and its potential role in PC development and relapse the present review highlights let-7 and its direct and downstream targets in the context of PC.

Apart from various posttranslational protein modifications and transcriptional regulations of the c-Myc gene products, this gene was reported to be directly negatively regulated by members of the let-7 family [114, 115] (Figures 6 and 10).

Further, the reconstitution of the let-7 expression resulted in suppression of PC cell proliferation [10, 12].

Additionally, members of the miRNA let-7 family directly target IL6, which in turn constitutes a positive feedback loop on NF κB [31, 49] (Figures 7 and 10).

For a better overview all described interactions between the master regulator family let-7 and its major targets are summarized in Figure 10.

The expression of both HMGA1, HMGA2, and of its regulator let-7 was shown to be negatively correlating in gastroenteropancreatic neuroendocrine tumors [44] and retinoblastomas [72].

Furthermore, c-Myc was shown to transcriptionally activate Lin28 [119], which in turn inhibits the biogenesis of its regulator let-7 constituting a double negative feedback loop [47] (Figures 6 and 10).

Interestingly, CCND2 was shown to be a direct let-7 and miR-154 target like HMGA2 [11, 41, 45, 105] (Figures 5 and 10).

In conclusion the expression of the oncogenes NRAS, KRAS, and HRAS was described to be negatively regulated by several members of the let-7 family [42, 162] (Figures 8 and 10).

Thus, the master regulator family let-7 is as well a promising target in cancer of the prostate gland.

At least in the case of let-7a this upregulation is indicated to be triggered by AR binding to AREs located at the let-7a promoter [53] (Figures 9 and 10).

Additionally Lyu et al. described an AR induced upregulation of let-7a, let-7b, let-7c, and let-7d (Figures 9 and 10) in the breast cancer cell lines MDA-MB-231 and MDA-MB-453.

Although the role of let-7 is still not fully understood, it is evident that the let-7 family members have a distinct expression pattern in animal development [26].

Remarkably, the miRNA let-7 family members are major players in the regulation of gene expression and appear to contribute greatly to the maintenance of the Ying and Yang in “normal” prostatic cells.

Interestingly, the let-7 family [10, 11] and some of its above mentioned targets were already found to be implicated in PC.

In accordance they were found to be directly, negatively regulated by let-7 [45, 73, 74] (Figures 2 and 10).

In the embryonic stage the let-7 miRNAs were found to be barely detectable, but having an increased expression in differentiated cells [20, 27].

Notably, these let-7 targets are involved in a wide range of diverse cellular processes interwoven with let-7 and each other in a fine balanced way (Figure 10).

Further, miRNAs of the let-7 family were reported to directly, negatively regulate IL6 [24], NRAS [42], c-Myc, HMGA1 [43, 44], HMGA2 [45], and CCND2 [11].

Remarkably HMGA2 was described to bear seven let-7 -binding sites in its 3′-untranslated region (3′-UTR) [33].

Moreover, the disrupted pairing between let-7 and HMGA2 by mRNA truncations of the 3′UTR was reported to induce HMGA2 overexpression leading to tumor formation [33].

Additionally, HMGB1 was found to stimulate DNA binding of several steroid receptors including the let-7 downstream target AR (Figure 10) [97].

The elicited phosphorylation of MAPK1 and MAPK14 induces in turn the activation of the transcription factor NF κB (Figures 8 and 10) which controls the expression of various genes including the let-7 biogenesis-controlling Lin28 [47] and the cytokine IL6 [31, 161] (Figures 8 and 10).

The connection between EMT and let-7 is represented by the HMGA1 and HMGA2 genes, which are directly regulated by let-7 and were found to be implicated in EMT [40, 41].

HMGB1 was found to bind the AR promoter [52], AR protein was described itself to stimulate let-7 expression [53] (Figure 10).

Furthermore, HMGA2 was recently described to modify gene expression not only as protein but as well as a competing endogenous RNA (ceRNA) by acting as a decoy for mature let-7 miRNAs [78].

A promising marker candidate gene is the miRNA let-7, which was reported to be down regulated among others in human PC [9– 11].

Nevertheless, it is to be expected that a deeper understanding of the molecular interactions of let-7 and associated genes will significantly contribute to the development of novel diagnostic and therapeutic treatment modalities for PC.

Additionally the let-7 regulated oncogene c-Myc and the stem cell marker Klf4 were reported to stimulate the CCND2 transcription [106, 107] (Figures 5 and 10).

Additionally, a direct causal link between cancer and inflammation is given by the association of let-7, IL6, and NF κB, which are major players involved in the epigenetic switch from inflammation to cell transformation [31].

In previous reports a direct causal link between cancer and inflammation has been described with IL6, let-7, Lin28, and NF κB being the major players involved in the epigenetic switch from inflammation to cell transformation [31].

The c-Myc protein regulates the biogenesis of let-7 by stimulating Lin28 [46], Lin28 in turn blocks the maturation of let-7 [47].

In contrast to “less complex” organisms such as worms, vertebrates show a higher number of let-7 isoforms coded by different genes [16].

Remarkably, Johnson et al. reported numerous let-7 binding sites in the 3′-UTR of the RAS genes [42].

Furthermore, Tummala et al. highlighted the impact of the Lin28/ let-7/Myc axis on PC and demonstrated that Lin28 activates the AR (Figures 9 and 10) and promotes growth of PC [177].

One of the first described members of the large class of non-protein-coding RNAs is let-7 which was the second miRNA discovered and designated as lethal-7 (let-7) according to the phenotype of a let-7 deficient C. elegans mutant [20].

In humans, 13 let-7 family precursor miRNAs were described (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7e, let-7f, let-7g, let-7i, miR-98, and mir-202) which code for 10 different mature let-7 miRNA isoforms [25].

Lin28B was demonstrated to block the maturation of let-7 [46].

Remarkably, a linkage between these factors is the let-7 miRNA family.

As let-7 is linked with all these protein-coding genes a deeper insight into these connections is of great interest.

Concerning let-7 the respective acting ways are actually not entirely deciphered.

Soon thereafter, further let-7 homologs were identified in a variety of species ranging from vertebrates to mollusks [24].

Interestingly several let-7 family members were found to be located at fragile sites of human chromosomes potentially contributing to aberrant let-7 transcript levels [35].

29

let-7a overexpression by transfecting its mimic or infection of Huh7.5.1 cells with shMIMIC lentiviral miRNA significantly reduced core production expression in both part-one and part-two HCVcc assays (Fig.   5a; Supplementary Fig.   8c, d), whereas overexpression of let-7a hairpin inhibitor led to an opposite effect (Fig.   5a).

While most miRNA targets could be identified by a decrease in mRNA level, there were a few for which translation is suppressed without noticeable mRNA degradation, such as regulation of CLDN1 by let-7a.

By performings that assess viral RNA replication and protein translation, we identified let-7a, let-7b, miR-181a, and miR-99b as restriction factors impacting either HCV IRES -mediated translation specifically or both translation and replication (Fig.   3c).

3′-UTR activities (g) and mRNA levels (h) of various indicated targets were shown downregulated by let-7a mimic transfection.

Intringuingly, out of the 12 validated miRNA hits, five (miR-148a, miR-17-5p, miR-25, miR-130a, and let-7a) were significantly downregulated by HCV, while others were also suppressed, but to a lesser extent (Fig.   2e).

The addition of individual let-7 hairpin inhibitors had only a small effect on HCV infection in the primary screen (Supplementary Data  2), likely due to the other let-7 family members still present within the cells, which may compensate for the inhibition of only one miRNA.

Interestingly, three other validated let-7a targets, CHUK, IKBKE, and XPNPEP1, preferentially act on HCV assembly or secretion [9] (Supplementary Fig.   9d); implying that let-7a also acts on the late stage of HCV life cycle through targeting CHUK, IKBKE, and XPNPEP1 (Supplementary Fig.   9f).

Therefore, we demonstrated that let-7a targets CLDN1 and represses its translation to block HCV entry (Supplementary Fig.   9f).

We examined two validated let-7a targets, CHUK and PPIA, and showed that their 3′-UTR activities were inhibited by each of other let-7 miRNAs (Supplementary Fig.   10e, f).

Meanwhile, HCV infection significantly suppressed let-7a expression in cultured hepatocytes including Huh7.5.1 cells and PHHs, as well as in liver biopsy tissues from CHC patients (Fig.   5e, f).

CLDN1 protein level, nevertheless, was drastically decreased upon let-7a overexpression, comparable to that of another confirmed let-7a target, CHUK (Fig.   5l).

NS not significant To identify the cellular targets of let-7a that may mediate its antiviral effects, we applied the same algorithm employed for defining miR-25 targets (Supplementary Fig.   9a).

Surprisingly, none of the above-identified let-7a targets encode a viral entry factor; thus a mechanistic link between let-7a and the observed inhibitory effect on HCV entry is still missing.

NS not significant To identify the cellular targets of let-7a that may mediate its antiviral effects, we applied the same algorithm employed for defining miR-25 targets (Supplementary Fig.   9a).

let-7a overexpression in hepatocytes significantly suppressed the 3′-UTR activity of CLDN1 but not that of CDH1 (Fig.   5j).

i– l let-7a specifically represses CLDN1 expression to inhibit HCV entry.

Interestingly, miR-25, miR-130a/b, and let-7a—three most relevant antiviral miRNAs physiologically interacting with HCV—are downregulated by the virus, demonstrated in both cultured cells and liver tissues of CHC patients.

We performeds to assess whether let-7a targets these predicted binding sites.

let-7a inhibits HCV infection at multiple steps.

Transfection of each let-7 mimic significantly inhibited HCV core and RNA production in hepatocytes (Supplementary Fig.   10a, b).

Among all let-7 family members, let-7a is expressed most abundantly in hepatocytes (Supplementary Fig.   8a, b).

Transfection of let-7a mimic significantly inhibited the luciferase activity of each 3′-UTR construct (Fig.   5g), suggesting let-7a may act on these 3′-UTRs.

The extent of liver fibrosis, assessed by Ishak score, did not affect let-7a expression levels (Supplementary Fig.   8f).

After 24 h, the media was replaced with Transduction Medium (DMEM (4.5 g/L glucose, Sodium Pyruvate, 25 mM HEPES, no L-Glut) with 10% FBS, and Polybrene (AmericanBio) at a concentration of 4 µg/mL] combined with either the active control (SMARTvector Non -targeting hCMV-TurboGFP Control), miR-130a (shMIMIC Human Lentiviral microRNA has-miR-130a-3p hCMV-TurboGFP), miR-25 (shMIMIC Human Lentiviral microRNA has-miR-25-3p hCMV-TurboGFP), or let-7a (shMIMIC Human Lentiviral microRNA has-let-7a-5p hCMV-TurboGFP) (GE Dharmacon).

The nine let-7 miRNAs share an identical seed sequence (Supplementary Fig.   10d, seed regions are shown in blue), suggesting they target the same set of cellular factors.

l Effects of let-7a transfection on protein levels of various indicated targets, determined by western blot.

Furthermore, let-7a overexpression in Huh7.5.1 cells markedly reduced the mRNA levels of all eight genes (Fig.   5h).

e HCV infection decreases let-7a expression in Huh7.5.1 cells and PHH.

Addition of all let-7 family hairpin inhibitors in combination, however, considerably increased HCV RNA production (Supplementary Fig.   10c).

Two members of the let-7 family, let-7a, and let-7b, restrict multiple steps of the HCV life cycle—entry, translation, and RNA replication (Fig.   3f).

Overexpression of let-7a, let-7b, or miR-148a significantly blocked both HCVpp and VSV-Gpp infections (Fig.   3b).

We uncovered eight HCV host factors as putative let-7a targets, including CHUK or IKK-α, a major IκB kinase in the activation of the non-canonical NF-κB pathway; another non-canonical IκB kinase IKBKE; cyclophilin A (PPIA); the calmodulin (CaM) binding protein IQCB1; the insulin-like growth factor 2 mRNA -binding protein (IGF2BP1); RABEPK, a Rab9 effector protein implicated in vesicle docking and the trans-Golgi network; the aminopeptidase XPNPEP1; and the GTPase and GTP -binding protein GSPT1 (Supplementary Fig.   9b).

Previous studies suggest these let-7a targets might affect different stages of HCV life cycle [9].

g, h Validation of let-7a cellular targets.

c let-7a mimic transfection suppresses HCV infectivity, demonstrated by TCID [50] assay.

We uncovered multiple miRNAs as regulators of HCV infection, including the miR-25, let-7, and miR-130 families.

a Representative images and quantitative analyses of HCV core staining in Huh7.5.1 cells transfected with mimic control (M-Ctrl) or let-7a, for part one and part two of the screen.

Huh7.5.1 cells were transfected with miRNA mimic control or let-7a, miR-130a, or miR-25 mimic at 25 nM for 72 h, in triplicate.

let-7 family of miRNAs collectively restrict HCV propagation.

j Effect of let-7a transfection on CLDN1 and CDH1 3’UTR activities.

We scanned the mRNA sequences of all known HCV entry factors and identified a let-7a seed matching site in the 3’UTR of claudin-1 (CLDN1) [25] and E-cadherin (CDH1) [26] (Fig.   5i).

Next we dissected the functions and mechanisms of three miRNAs: miR-25, let-7a, and miR-130a in modulating HCV infection.

Eight of the nine let-7 family members—let-7a, let-7b, let-7c, let-7e, let-7f, let-7g, let-7i and miR-98—were identified as antiviral hits from the primary mimic screen (Supplementary Data  1).

These entry factors were excluded from the initial analysis because the microarray -based mRNA quantification did not show a decrease in their mRNA levels upon let-7 mimic transfection.

let-7a mimic transfection also reduced HCV RNA production and viral infectivity (Fig.   5b–d and Supplementary Fig.   8e), conforming an antiviral role of let-7a in hepatocytes.

let-7a, miR-130a, miR-130b, and miR-25 expression levels were determined by qPCR using TaqMan Universal PCR Master Mix (Applied Biosystems) and specific miRNA primers and probes (TaqMan MicroRNA Assays, Applied Biosystems).

k Effect of let-7a transfection on CLDN1 and CDH1 mRNA levels.

Similarly, the protein levels of CHUK and CLDN1 were repressed by these let-7 family members (Supplementary Fig.   10g).

a– c Effects of let-7a mimic transfection on productive HCV infection.

Among them, three are proviral miRNAs (miR-122, miR-151-5p, and miR-17-5p), and nine others, including let-7a, let-7b, miR-130a, miR-148a, miR-181a, miR-196a, miR-30a-5p, miR-99b, and miR-25, are antiviral factors (Fig.   2c).

s showed that let-7a mimic only slightly decreased CLDN1 mRNA level and had no effect on CDH1 mRNA level (Fig.   5k).

These include SUV420H1 for miR-25; PPIA, IQCB1, IGF2BP1, and CLDN1 for let-7a; and DDX6, NPAT, LDLR, HCCS, and INTS6 for miR-130a.

We further dissected the functions and underlying mechanisms of three physiologically relevant miRNA families (miR-25, let-7, and miR-130) in modulating HCV infection.

b Quantification of intracellular and extracellular HCV RNA levels after let-7a mimic treatment.

d Transfection efficiency of let-7a mimic, determined by Q-PCR.

Each of these genes has one or more let-7a seed sequence sites in its 3′-UTR (Supplementary Fig.   9c).

i CLDN1 and CDH1 each contain one predicted let-7a binding site in the 3′-UTR.

30

The level of expression of oncogenic miR-21, miR-221, miR-210 including the tumor suppressor miR Let-7a were found to be consistently up-regulated in TNBC tissues as well as in their corresponding sera and cancer cell lines, MDA-MB-231, MCF-7, whereas miR-145 and miR-195 were regularly downregulated (p<0.001) (Table 2a and 2b, Figs 1A, 2A and 2D).

In comparison to other breast cancer subtypes, DNBC, SNBC and TNBC patients also showed significantly a higher expression of miR-21, miR-221, miR-210 and Let-7a (Table 2a; Fig 1B)It was observed that the upregulated expression of four miRNAs was found to be increased with the increasing histopathological grade and clinical stage but also with the younger age, premenopausal stage, early menarche, smoking, higher mitotic activity, higher ki67 expression and lymph node negativity of TNBC.

In comparison to other breast cancer subtypes, DNBC, SNBC and TNBC patients also showed significantly a higher expression of miR-21, miR-221, miR-210 and Let-7a (Table 2a; Fig 1B) It was observed that the upregulated expression of four miRNAs was found to be increased with the increasing histopathological grade and clinical stage but also with the younger age, premenopausal stage, early menarche, smoking, higher mitotic activity, higher ki67 expression and lymph node negativity of TNBC.

Of six miRNAs, the expression of four miRNAs, miR-21, miR-221, miR-210 and Let-7a were found to be significantly upregulated while the other two miRNAs, miR-195 and miR-145 were downregulated in both paired tumor tissue and sera of triple negative breast cancer patients.

The upregulated expression of four miRNAs, miR-21, miR-210, miR-221 and Let-7a showed a significant (p ≤ 0.05) correlation with several most common clinicopathological and demographic variables such as age, menopausal status, oral contraceptives use, Ki67 expression, tumor grade, clinical stage, and BMI of TNBC patients (Table 1 and S1 Table).

Out of six microRNAs screened, four of them, miR-21; miR-221; miR-210 including the tumor suppressor miR Let-7a were consistently upregulated whereas two miR-145 and miR-195 were regularly downregulated in TNBC tissue as compared to that of adjacent normal tissue (Table 2a).

Although the fold change expression of 4 upregulated miRs (includes Let-7a) in TNBC tissue was significantly much higher (34.64, 28.35, 27.82, and 17.90 respectively) as compared to those in paired sera (13.99, 14.97, 8.39 and 11.84 respectively), the fold change expression in the sera samples was still significantly higher than that of adjacent normal tissue, normal sera or cell line (MCF-10A) (see Table 2a and 2b; Figs 1B and 2B).

Interestingly, Inspite of being a known tumor suppressor, Let-7a was highly expressed in TNBC tissue but it was downregulated in fibroadenoma.

Further, Pearson’s correlation coefficient analysis of 4 upregulated miRs (miR-21, miR-221, miR-210 and Let-7a) demonstrated a highly significant positive correlation of miRNA expression profiles between paired sera (r = 0.758, r = 0.647, r = 0.767 and r = 0.668 respectively, p<0.0001) and tissue samples (r = 0.881, r = 0.858, r = 0.748 and r = 0.629 respectively, p<0.0001) and it increased with the increasing severity (grade/ stage) of breast cancer (Fig 3A–3D).

Johnson et al., [30] demonstrated that the expression of let-7 inversely correlates with expression of RAS protein.

Most intriguing was the finding that one of the tumor suppressor miRNA, miR Let-7a showed consistently an increased expression in TNBC and other breast cancer subtypes and cell lines.

Interestingly, despite being a tumor suppressor, miR Let-7a showed increased expression in breast cancer cell lines.

Despite being a tumor suppressor and in contrast to miR-195 and miR-145, miR Let-7a showed increased expression in TNBC tissue and sera and also showed a good correlation with tumor grades (r = 0.629 for tissue and r = 0.668 for sera, p<0.0001).

A (miR-21); B (miR-221); C (miR-210); D (miR-195); E (miR-145); F (Let-7a); (G) comparative ROC of all six miRNAs (miR-21; miR-221; miR-210; miR-195, miR-145 and Let-7a); (H) combined ROC of three miRs (miR-21; miR-221 and miR-210); (I) combined ROC of two downregulated miRNAs (miR-195 and miR-145).

Interestingly, several authors identified Let-7a as a downregulated miRNA in breast cancer [47– 49].

All the four upregulated miRs showed a higher sensitivity and specificity of 100% and 95% for miR-21, 100% and 100% for miR-221, 95% and 95% for miR-210 and 95% and 95% for Let-7a.

We observed that while miR-21, miR-221, miR-210 and Let-7a were overexpressed as a function of severity of lesion or tumor grade and stage of tissue and paired sera, miR-145 and miR-195 showed down regulation.

Areas under the curve (AUC) and p-values were highly significant for miR-21, miR-221, miR-210 and Let-7a in both tumor tissue and sera suggesting for an enormous potential of these four upregulated miRNAs as biomarker for TNBC.

Since an altered expression level of six selected microRNAs, miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a is known to be frequently involved in breast carcinogenesis, these have been examined in paired TNBC tissue and serum samples in comparison to that of adjacent normal tissue margins and normal serum.

miR-21 was also marginally increased in benign fibroadenoma while miR-221, miR-210 and Let-7a were underexpressed.

A highly significant correlation has been observed for aberrant tissue overexpression of miR-21, miR-221, miR-210 and Let-7a between tumor grade and stage of TNBCs and their corresponding sera.

0158946.g002 Fig 2(A) Expression level of selected miRNAs (miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a) in total serum samples from breast cancer patients and healthy individuals.

We analyzed the expression pattern of a set of six selected microRNAs- miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a in four subtypes of breast cancer tissues including adjacent normal tissues.

The fold change expression levels of miR-21, miR-221, miR-210 and Let-7a were 34.64, 28.35, 27.82 and 17.90 respectively which were significantly different from those of normal breast tissues but also from all other breast cancer (BC) subtypes (see Table 2a; Fig 1B).

Taken together, the result demonstrated that four miRs i. e., miR-21, miR-221, miR-210 and Let-7a were significantly overexpressed in cell lines of TNBC as in TNBC tissue and sera.

Although several reports indicate an alteration in expression of miR-21, miR-145, miR-221, miR-195 and Let-7a in a variety of breast cancer types [16, 50– 54] but none is specific to TNBC.

0158946.g001 Fig 1 (A) The expression level of miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a in total breast tumour and adjacent normal tissues.

When we compared TNBC with TPBC patients it exhibited significantly a highest fold change expression of miR-21 (34.64 vs 4.90; p < 0.001), followed by miR-221 (28.35 vs 1.33; p < 0.001), miR-210 (27.82 vs 1.57; p < 0.001) and Let-7a (17.90 vs 0.67; p< 0.001) (Table 2a).

Let-7a showed the same level of higher expression pattern in sera but was lower than that of tumor tissue.

Reverse transcription as well as Real-Time PCR for miRNA expression analysis was carried out using primers for hsa-miR-21, hsa-miR-221, hsa-miR-210, hsa-miR-195, hsa-miR-145 and hsa-miR-Let-7a and SnRNA U6 was used as a reference control.

As observed in tumor tissues, the miR-21, miR-221, miR-210 and Let-7a were also found to be overexpressed in their paired sera (13.99; 14.97, 8.39 and 11.84 fold change, p < 0.001; Table 2b) as compared to that of normal sera, though at a lower level than those observed for tissue miRNA (Fig 2A).

We find a highly significant overexpression of Let-7a in TNBC with a fold change value of 17.90 in tissue, 11.84 in sera and 7.55 fold change in cell line (Tables 2a, 2b and 3).

9570)p = 0.0004 * miR-210 100% 100% 0.9979 (0.9911–1.000)p < 0.0001 * miR-195 78% 65% 0.6767 (0.5098–0.8437)p = 0.0400 * miR-145 78% 91% 0.8837 (0.7862–0.9812)p < 0.0001 * Let-7a 91% 86% 0.9660 (0.9237–1.008)p < 0.0001 * AUC: Area Under the Curve; CI: Confidence Interval; * Significant.

For paired serum, miR-21 had a AUC value of 0.959 (95% CI: 0.9071–1.000, p < 0.0001) with 95% sensitivity and 81% specificity, miR-221 of 0.810 (95% CI: 0.6629–0.9570, p < 0.0001) with 81% sensitivity and 72% specificity, miR-210 of 0.998 (95% CI: 0.9911–1.000, p < 0.0001) with 100% sensitivity and 100% specificity and Let-7a of 0.966 (95% CI: 0.9237–1.008, p < 0.0001) with 91% sensitivity and 86% specificity (Table 4b).

86 up0.0001 * 27.82±4.52 up0.001 * miR-195 0.78±0.08 down0.007 * 0.41±0.07 down0.001 * 0.27±0.06 down0.001 * 0.14±0.04 down0.001 * miR-145 0.76±0.09 down0.008 * 0.52±0.15 down0.001 * 0.41±0.12 down0.001 * 0.27±0.08 down0.001 * Let-7a 0.67±0.13 down0.001 * 8. 25±1.07 up0.001 * 15.61±1.76 up0.001 * 17.90±2.93 up0.001 * (b) In breast cancer sera (n = 85) miRNA Types TPBC (n = 21) SNBC (n = 20) DNBC (n = 21) TNBC (n = 23) FC±S.

31

It is interesting to note that most genes in this network are suppressed when let-7 family miRNAs are over-expressed (hES-MSC) and up-regulated when let-7 family gene expression goes down (HEPG2 cells).

Most genes in this network show a higher expression in HEPG2 cells (let-7 family miRNA expression low) relative to hES-MSC (let-7 family miRNA expression high) providing further support to our hypothesis that let-7 family of miRNAs are regulating these genes.

However combining the networks generated by sequence alignment of expressed miRNAs and Targetscan, we predict that HNF4A is indirectly regulated by the let-7 family of miRNAs.

Using such framework to conceptualize predicted miRNA gene targets from TargetScan, the targets for the let-7 family of miRNA were subjected to pathway exploration using the Ingenuity Pathway Analysis (Ingenuity [® ]Systems, http://www.

Since MSC conditioned medium contains exosomes with let-7 family miRNAs and these let-7 family miRNAs may regulate HNF4A (based on our network and expression analysis), it is highly likely that MSC conditioned medium mediated reduction of infarct size is achieved by indirect regulation of HNF4A mediated by the let-7 family of miRNAs.

Thus, a high level of expression of let-7 family of miRNA coincide with a low level of expression of HNF4A (e. g. hES_MSC) and vice versa (e. g. HEPG2).

Among the most abundantly expressed transcripts across both intra and extra-cellular environment (Tables 1 & 2) the let-7 family of miRNAs was the only overexpressed family of known miRNAs.

In summary, our study using a combination of alignment, statistical and network analysis tools to examine deep sequencing data of microRNAs in hES-MSC has led to a result that (i) identifies intracellular and exosome microRNA expression profiles of hES-MSCwith a possible mechanism of miRNA mediated intercellular regulation by these cells and (ii) placed HNF4A within the cross roads of regulation by the let-7 family of microRNAs.

Hepatic nuclear factor 4 alpha (HNF4A) was found to be a common node in both networks making it a highly probable downstream target of indirect transcriptional regulation by let-7 family of miRNA.

Conversely in HEPG2 cells where a high level of HNF4A is expressed, we find very low expression of let-7 family miRNAs.

It will be interesting to study the effect of Lin28 overexpression on differentiation of hepatocytes from hES-MSC since Lin 28 is a transcription factor that inhibits function of let-7 family miRNAs.

Since HNF family of transcription factors have been reported to be upregulated in hepatocytes derived from adipose tissue MSC [26], it is possible that let-7 regulates HNF4A levels during this process.

In undifferentiated MSC when let-7 miRNAs are highly expressed, expression of HNF4A is very low.

TargetScan [33] was used to predict gene targets for the let-7 family of miRNAs.

We suggest that let-7 family microRNAs might play a signalling role via such a mechanism amongst populations of stem cells in maintaining self renewal property by suppressing HNF4A expression.

let-7 targets include cell cycle regulators such as CDC25A and CDK6 [13]; promoters of growth including RAS and c-myc [14, 15] and a number of early embryonic genes including HMGA2, Mlin-41 and IMP-1 [16, 17].

Since genes in the HNF4A alignment network also show a similar expression profile to HNF4A in HEPG2 and hES-MSC cells, it is possible that the let-7 family miRNA regulation of HNF4A is mediated through genes in this network.

We utilized these results of which directed our attention towards establishing hepatic nuclear factor 4 alpha (HNF4A) as a downstream target of let-7 family of microRNAs.

Further we also verified the prediction that let-7 family miRNAs regulate the network of 50 genes, by examining the expression profiles of these genes in MSC and HEPG2 cells.

None of the target prediction algorithms predict the regulation of HNF4A by let-7 family of miRNAs.

Complexity Reduction using Gene interaction Networks revealed similarity in topology that suggested downstream targets for let-7 family of miRNAs.

let-7 miRNA was expressed at 5.7 fold higher levels in hES-MSC compared to HEPG2 cells, whereas HNF4A was undetectable in hES-MSC and very strongly expressed in HEPG2 cells (56,000 fold lower in hES-MSC {C [T ]32.63} compared to HEPG2 cells{C [T ]20.36}).

In conclusion, our study using a combination of different available tools to examine deep sequencing data by examining alignment, computer predictions, mathematical and network analysis has led us to a hypothesis that HNF4A is indirectly regulated by the let-7 family of miRNAs.

Further, let-7 also targets Dicer [18, 19] which is the protein responsible for miRNA maturation.

However, the large amount of predictive targets for the let-7 miRNA family constitutes a complexity that can be difficult to interpret and explore.

Thus, our study suggests the possibility of let-7 family of miRNAs indirectly regulating this particular transcription factor to achieve physiological changes.

The expression of let-7 family of miRNAs was verified by quantitative real time PCR.

Comparing both gene interaction network, similar topology was observed with HNF4A as a node amongst the interactions suggesting HNF4A as a possible downstream target for let-7 family miRNAs.

Our way of visualizing the roles of miRNA is via the concept of an integrated network emerging from the culmination of the interactions of the gene targets associated with the family of let-7 miRNAs.

Further results derived from visualization of our alignment data and network analysis showed that let-7 family microRNAs could affect the downstream target HNF4A, which is a known endodermal differentiation marker.

Therefore it is possible that the let-7 family of miRNA acts as a master regulator of miRNA function.

Since the let-7 family of miRNAs were abundantly expressed in MSC and given their central role in controlling cellular differentiation and miRNA regulation, we decided to focus on this family of miRNAs for further investigations.

To test the hypothesis that the network of genes surrounding HNF4A was controlled by let-7 family miRNA, we compared the expression of genes identified in the let-7 family alignment network in HEPG2 cells and hES-MSC.

let-7 family of miRNAs was first identified in C. elegans and has since been emerging as having important tumour-supressor role.

This led to our growing interest of let-7 miRNA's functional roles in hES-MSC.

The complete list of miRNAs in the intracellular and extracellular space of MSC ranked according to their abundance is given in supplementary file 1. let-7 family of miRNAs is represented predominantly in the top rankings miRNAs in both intra and extra cellular samples of hES-MSC.

Measurements of expression levels of let-7 family of miRNAs and HNF4A by quantitative real time reverse transcriptase polymerase chain reaction (qRT-PCR).

High read counts of let-7 family miRNAs transcripts are present in both intra and extra cellular samples of hES-MSC.

However, a high level of let-7 family of microRNAs is predominant in both intra- and extra- cellular samples of hES-MSC.

The elevated presence of let-7 microRNA in both intracellular and extra cellular environment further suggests a possible intercellular signalling mechanism through microvesicles transfer.

In our study, a high level of let-7 family of miRNA transcripts was predominant in both intra and extra cellular samples for our hES-MSC.

Apart from the let-7 family, other miRNAs like miR199b, miR22 & miR143 were also significantly overrepresented in both the intracellular and the extracellular hES-MSC samples.

32

Accordingly, over -expression of Lin28 was found to be linked to a repression of let-7 family miRNAs and a combined down-regulation of let-7 and up-regulation of Lin28 was reported in human neoplasias [20].

Studies analysing HMGA and let-7 expression in retinoblastomas and gastroenteropancreatic neuroendocrine tumors revealed a HMGA over expression accompanied by a down-regulation of let-7 [14, 15].

In conclusion, the comparative expression study analysing a possible inverse correlation between HMGA2 and Lin28 and let-7 members in OSCC revealed a down-regulation of mir-98 with a simultaneous HMGA2 over expression in human OSCC cell line samples.

Comparative analyses showed down-regulation of mir-98 in human samples and up-regulation of let-7a and mir-98 in canine neoplastic samples.

Nevertheless, our results provide a first trend of comparative expression of HMGA2, Lin28, let-7a and mir-98 in OSCC and must be verified in a larger set of tissue control and tumour samples to determine if there is an inverse correlation of expression between these genes and if there is a potential link to disease progression.

Despite the HMGA2 over -expression in neoplastic samples, the miRNAs let-7a and mir-98 were found to be up-regulated.

Similarly, our results regarding let-7a expression suggest, that a decrease in let-7a expression does not appear to be main mechanism accounting for HMGA2 deregulation.

Nevertheless, it must be considered that the statistical analyses of our real time PCRs did not confirm a significant down-regulation of let-7a and a simultaneous over -expression of Lin28 when all samples were analysed as groups.

Comparative expression analyses of HMGA2, Lin28, let-7a and mir-98Relative HMGA2/HPRT expression levels ranged from 1 to 4.61 within the non neoplastic samples, from 5.92 to 141 within the neoplastic samples and from 22.2 to 55.1 within the cell line samples (Figure  5A, Additional file 3: Table S3).

Expression of HMGA2 and Lin28 were higher in the neoplastic samples while let-7a and mir-98 expression were higher in the non-neoplastic samples.

Let-7a was over expressed within the cell line samples while mir-98 was over expressed in the tumour samples.

These low let-7 microRNAs levels allow a high expression of their usually repressed target genes as HMGA2.

In embryonic stem cells Lin28 expression is highly leading to the inhibition of let-7 microRNAs processing steps.

The let-7a miRNA was reported to be down-regulated in head and neck cancer tissues and the expression levels were significantly reduced in metastatic tissues when compared to primary tumours.

Statistical analyses of comparative HMGA2, Lin28,let-7a and mir-98 expression HMGA2 was up-regulated when HPRT was used as endogenous control gene within the tumour (p = 0.002) and cell line samples (p = 0.024) when compared to the non neoplastic samples (Figure  5A).

Comparative expression analyses of HMGA2, Lin28, let-7a and mir-98 in canine samples showed a statistical significant over expression of HMGA2 in neoplastic samples confirming our precedent results.

HMGA2 expression was shown to be partly regulated by the let-7 miRNA family member mir-98 in head and neck squamous cell carcinoma cell lines [13].

let-7a/RNU6B expression ranged from 1 to 2.76 within the non neoplastic samples, from 1.14 to 3.42 within the neoplastic samples and from 1.11 to 2.33 within the cell lines (Figure  5C, Additional file 3: Table S3).

In summary, the Lin28 – let-7 – HMGA regulatory pathway and deregulations of either one of these members or of all involved proteins and miRNAs could have an effect on the progression and pathogeneses of human and canine OSCC.

Statistical analyses of comparative HMGA2, Lin28,let-7a and mir-98 expression.

* indicates a statistical significant expression deregulation of HMGA2 and/or Lin28 and/or let-7a and/or mir-98 when compared to non neoplastic control group; p-value is displayed next to *.

Nevertheless, in adipocytic tumours, despite of some individual let-7 miRNAs, no global correlation between expression of let-7 members and HMGA2 were detected [30].

Figure 5 Comparative expression analyses of the HMGA2 and Lin28 genes and the let-7a and mir-98 miRNAs in human OSCC.

Expression levels of HMGA1, HMGA2, Lin28, let-7a and mir-98 were analysed via relative qPCR in primary human and canine OSCC, thereof derived cell lines and non-neoplastic samples.

Comparative expression analyses of HMGA2, Lin28, let-7a and mir-98.

Additionally, the HMGA negatively regulating miRNAs of the let-7 family as well as the let-7 regulating gene Lin28 were also comparatively analysed.

Figure 6 Comparative expression analyses of the HMGA2 and Lin28 genes and the let-7a and mir-98 miRNAs in canine OSCC.

These findings do not indicate a negative correlation of expression of HMGA2 and Lin28 and the let-7a and mir-98.

Here, an inverse correlation of the expression of HMGA2 and Lin28 and let-7a and mir-98 could be detected in the tumour samples when compared to healthy tissue.

However, the authors did not mention which members of the let-7 family were analysed and thus it cannot be excluded that let-7a and mir-98 were not analysed within the study.

Hereby, let-7a is likely to be involved in the pathogenesis of OSCC probably through mechanisms other than those expected.

Additionally, in human oesophageal squamous cell carcinoma, an inverse transcription of let-7 and HMGA2 was reported [29].

C: relative let-7a/RNU6B real time PCR.

These results strongly fortify the described Lin28 to let-7 to HMGA2 axis hypothesis drawn by Hammond et al. [27].

Let-7a, mir-98 and RNU6B real-time PCR.

Let-7 micro RNAs themselves are regulated post-transcriptionally by the LIN28 and LIN28B proteins encoded by the Lin28 gene [16– 19].

Thereby, a high let-7a score was found to be associated with early T-stage and low lymph node metastasis and early pathological stage [28].

In general, an inverse correlation of let-7 and HMGA2 is a frequent finding in many types of human neoplasias.

Squamous cell carcinoma HMGA1 HMGA2 let-7 mir-98 Lin28 Animal mo del Dogs Comparative oncology Oral cancer is the eighth most frequent cancer worldwide with even higher frequencies in developing than in developed countries [1].

However, interestingly Hammond et al. postulated a linear pathway from Lin28 to let-7 to HMGA2 [27].

Thus, in our study we investigated the expression levels of HMGA1, HMGA2, Lin28, let-7 a and mir-98 via relative real time PCR in human and canine non-neoplastic and tumour tissue samples and human and canine cell lines which derived from primary OSCCs.

33

Recent reports have suggested that the tumor suppressor activity of miRNA lethal 7a (let-7a) may be due to its association with KRAS and that inhibition of tumor growth may occur by suppression of K-Ras expression by let-7a [15], [16].

B) Cells were transfected with 100 nM of let-7a inhibitor for 24 h. Protein for control and for let-7a inhibited cells were collected for immunoblotting for K-Ras expression.

However, we did not observe corresponding changes in K-Ras protein expression, which conflicts with prior reports demonstrating let-7 miRNA regulation of K-Ras expression [30], [31].

When let-7a expression was inhibited (leading to increased K-Ras activity), cells lacking wild-type TP53 alleles (TP53 [−/−]and TP53 [mut/−]) had 100% cell survival.

Thus, while K-Ras expression remained unchanged by let-7a inhibition, our experiments showed that K-Ras activity was affected by let-7a.

Let-7a is expressed in all cell lines and inhibition of let-7a does not affect K-Ras protein levels.

Let-7a was inhibited by miRIDIAN miRNA inhibitors (Dharmacon; Lafeyette, CO) following the manufacturer’s protocol.

Emerging clinical data suggest that intra-tumor let-7a expression correlates with tumor response and overall survival in metastatic colorectal cancer patients receiving epidermal growth factor (EGFR) targeting agents in both KRAS wild-type and mutant populations [17].

As noted previously, we observed changes in K-Ras activity with inhibition of let-7a expression.

Let-7a Negatively RegulatesThe effect of let-7a inhibition on K-Ras activity was also determined.

Let-7a gene expression was inhibited >90% by qPCR.

Finally, K-Ras activity clearly increased when let-7a was inhibited regardless of TP53 genotype, further suggesting let-7a regulation of K-Ras activity.

Cells that had not been treated with let-7a inhibitor were similarly treated with CRT.

Cells with varying TP53 status +/− let-7a inhibitor were treated with 5-FU followed by radiation.

Cells with homozygous loss of wild-type TP53 alleles ([−/−] and [mut/−]), which correlated with highest K-Ras activity (see Figure 1B), exhibited no change in cell viability regardless of changes in let-7a expression levels.

After a total of 72 h incubation with let-7a inhibitor, cells were plated in 6-well plates and incubated overnight.

With let-7a inhibition, K-Ras activity increased across all TP53 genotypes (Figure 3).

The effect of let-7a inhibition on K-Ras activity was also determined.

Cells with Wild-type TP53 Alleles are Sensitive to CRT and let-7a Inhibition Decreases Response to CRT.

0070604.g004 Figure 4Cells with varying TP53 status +/− let-7a inhibitor were treated with 5-FU followed by radiation.

After let-7a inhibition, cell viability is partially rescued in CRT-sensitive cells.

However, in cells harboring at least one wild-type TP53 allele (previously showing some cell death), cell survival increased in response to let-7a inhibition.

Moreover, Johnson et al. [15] discovered that let-7 negatively controlled KRAS expression in lung cancer.

K-Ras protein levels were not altered by let-7a inhibition (Figure 2B).

CRT treatment was performed again with let-7a inhibition, which decreased CRT -induced cell death by nearly 20% in cells harboring at least one wild-type TP53 allele (p<0.05).

In addition, Ruzzo et al. [17] reported an improved overall survival in patients with elevated let-7a within a KRAS mutant colorectal cancer population treated with anti-EGFR therapy, suggesting a tumor inhibitory role for let-7a in KRAS-activated tumors.

K-Ras protein levels were assessed across the TP53 genotypes in the presence or absence of let-7 inhibition.

K-Ras activity is increased in cells with let-7a inhibition.

These results have two important implications: (1) TP53 genotype influences K-Ras activity and may predict response to CRT and (2) let-7a expression levels influence K-Ras activity and may alter response to CRT.

Therefore, we theorized the existence of a series of regulatory steps from TP53 to let-7a to KRAS.

Additional studies have speculated that the role of TP53 in DNA repair and apoptosis may in part be regulated by miRNAs, including let-7a [18], [19].

Let-7a expression was detected in all cell lines (Figure 2A).

We found that K-Ras activity increased by 50% to 112% compared to let-7a expressing cells (p<0.05).

Let-7a is Expressed in All HCT116 Lines.

Nonetheless, changes in K-Ras activity were regulated by let-7a.

Knowledge of the pathways linking KRAS, TP53, and let-7a may provide greater insight into the mechanisms driving the poor phenotype observed in certain mutations in CRC.

Therefore, a complex regulatory network for TP53 and KRAS may be linked by let-7a.

This first report of TP53 and let-7a regulation of K-Ras activity provides clues to better understand the complex interaction between TP53 and KRAS.

We discovered that oncogenic K-Ras activity was regulated by TP53 genotype and let-7a; and changes in both influenced response to CRT.

Let-7a Inhibitor.

Cells with Wild-type TP53 Alleles are Sensitive to CRT and let-7a Inhibition Decreases Response to CRTCells harboring different TP53 genotypes were treated with CRT and cell viability was measured (Figure 4).

We identified let-7a as a potential link between TP53 and KRAS.

Since assays were performed to assess the relative changes in K-Ras activity among the different TP53 genotypes, K-Ras activity from the parental TP53 [+/+] line was set as 1. For assays with let-7a inhibitor, each genotype acted as its own control.

Furthermore, we were able to better interrogate the role of let-7a in the setting of mutant KRAS and various TP53 genotypes.

However, we did not find a clear relationship between let-7a level and TP53 genotype.

Let-7a Negatively Regulates K-Ras Activity.

There was no pattern of change in let-7a levels which corresponded to alterations in TP53 genotype.

However, in this investigation we were unable to find consistent differences between KO and mutant TP53 alleles with regards to K-Ras activity at baseline and in response to let-7a inhibition, nor in response to CRT.

Let-7a does not Regulate K-Ras Protein Levels.

In summary, we provide insight into potential mechanisms linking KRAS, TP53, and let-7a.

34

Studies performed in lung and renal cell carcinoma reveal that the overexpression of let-7a inhibits in vitro cancer cell proliferation and in vivo tumor regeneration by reducing the expression of c-Myc and c-Myc targeted genes (Liu et al., 2012).

This massive increase in let-7a expression is intriguingly similar to the differential expression of let-7a seen in normal cells and a variety of cancer cells in which the expression of let-7 is repressed (Boyerinas et al., 2010).

Given that the methylation status of the let-7 promoters does not appear to play a significant role in the expression of let-7 miRNAs (Lu et al., 2007), it is conceivable that these inserted retrotransposon transcripts interact with a variety of host proteins, including RNA binding proteins, chromatin modifiers, and regulators of transcription/translation to form an L1 ribonucleoprotein (RNP) complex.

Third, we have demonstrated the interplay between the aberrant expression of L1 elements and miRNAs, and in particular, the tumor suppressor miRNA let-7a.

Moreover, the expression of let-7a is also controlled by c-Myc binding to the let-7 promoters which decreases its expression.

In another study, inhibition of L1 activity by antiretroviral drugs was shown to reduce c-Myc expression in cancer cells (Sciamanna et al., 2005), which may partially explain the ability of L1-silencing to activate let-7a.

Thus, to clarify the role of L1, we carried out profiling of let-7a-target gene expression, in breast cancer cells before and after silencing L1.

Another major target of let-7a is c-MET, which is one of the key genes activated by L1 expression in cancer cells (Wolff et al., 2010).

Given that let-7 is often viewed as a tumor suppressor miRNA, a strategy in which L1 activity is selectively inhibited pharmacologically could provide new therapeutic options for human cancer treatment.

Hsa-let-7a functions as a tumor suppressor in renal cell carcinoma cell lines by targeting c-myc.

This study revealed that L1 silencing reduces the expression of some let-7a -targeted genes including c-Myc and c-MET, although only to a modest degree (Figure 1B).

Together, these observations suggest that induction of DHX9 by L1 silencing (either directly or through interaction with other proteins) can activate the expression of let-7a miRNAs.

The mature let-7a also binds to a complementary region in the pri- let-7 miRNA, recruiting Argonaute and promoting its own downregulation (Zisoulis et al., 2012).

Expression of let-7a is subjected to complex regulation involving positive (p68/p72 helicases) and negative factors (c-Myc, Lin28, hnRNPA1).

Let-7a is also known to target many oncogenes including c-Myc, HMGA2, and Lin28, and its expression is a hallmark of cell differentiation.

There is little or no direct evidence for a reciprocal relationship between the silencing of L1 and let-7a expression in the literature.

Questions remain, however, as to how L1 elements, either directly or in combination with other host proteins contribute to the loss of let-7 expression in the various types of cancer.

To our surprise, most of the changes in miRNA expression occur mainly in the let-7 family of miRNAs (Figure 1A).

What is less clear from these studies is how L1 silencing leads to increased expression of let-7a miRNA in cancer cells.

Strikingly, a recent study proposed that Lin28 could antagonize the production of let-7a miRNAs by recruiting a DHX9-like RNA helicase to promote its own translation (Kallen et al., 2012).

Thus, there is evidence of a relationship, at least in the case of let-7a miRNAs, between the L1 activity and miRNA expression.

FIGURE 1 (A) Long interspersed nuclear element-1 (L1) silencing modulates the expression of the let-7 family of miRNAs.

c-Myc also activates Lin28 expression by binding to the Lin28 promoters and Lin28, in turn, binds selectively to pri- let-7 miRNAs and blocks Dicer processing of pri- let-7 miRNAs into mature let-7a (Chang et al., 2009).

As we propose above, there is a clear link between let-7a expression and the silencing of L1 elements.

Strikingly, Lin28 is itself targeted by let-7a thus affecting the functioning of Lin28 in a feedback circuit.

Importantly, hnRNPA1 also binds to pri- let-7a miRNAs and acts as a repressor of let-7 biogenesis by antagonizing the docking of KSRP (KH-type splicing regulatory protein), which is a component of Drosha/Dicer complexes and is known to positively regulate processing of miRNAs (Michlewski and Caceres, 2010; Figure 2).

Currently, however, few studies have addressed the functional role of L1 in the expression of the let-7 miRNA family.

In particular, let-7a miRNA was strongly upregulated from 149,428 normalized mapped reads to 1,855,633 reads in L1 silenced cells, accounting for 40% of the increase in the total normalized read counts in the L1-silenced cells compared to cancer cells in which L1 remained active.

So, how might L1 influence the expression of the let-7a miRNA?

Notably, the loss of let-7a expression is often considered to have prognostic value since it indicates poor survival in many cancers.

This complex binds to pre- let-7 miRNA and prevents recruitment of KSRP regulatory protein thus blocking the action of the microprocessor and preventing the formation of mature let-7 miRNAs.

Antagonistic role of hnRNP A1 and KSRP in the regulation of let-7a biogenesis.

One possible mechanism is that retrotransposon sequences located in the promoter regions of let-7 miRNAs might act as functional domains for their regulation.

Autoregulation of microRNA biogenesis by let-7 and Argonaute.

An alternative but not mutually exclusive possibility is that L1 silencing may activate miRNA-inducing proteins such as transcription factors and RNA helicases that activate let-7 biogenesis.

Thus, the link between the let-7a miRNAs and the expression of L1 elements in cancer cells requires further investigation.

Strikingly, except for pre- let-7i, all the members of the let-7 family interact with hnRNPA1.

The role of let-7 in cell differentiation and cancer.

For these reasons, there is growing interest in the therapeutic use of let-7a itself, or pharmacological modulators of let-7a to treat human cancers in clinical applications.

Regardless of whether the inserted retrotransposons within the promoter regions of let-7 miRNAs are active or not, there are at least 100 copies of highly active L1 elements present in human cells (Brouha et al., 2003).

Barplot showing DESeq-normalized absolute read counts for let-7 family miRNAs from L1-silenced small RNA deep sequencing experiment in T47D breast cancer cells.

The p68/p72 RNA helicases, as components of the Drosha microprocessor complex, stimulate the processing of pri- let-7 miRNAs into mature RNAs by Dicer -mediated processing.

By repressing let-7a, Lin28 often acts as an oncogene in cancer cells (Viswanathan et al., 2009).

FIGURE 2Schematic diagram of a mo del showing the role of L1 in let-7 miRNA processing and maturation.

Sequence analysis with the RepeatMasker database reveals the presence of retrotransposon fragments scattered throughout the promoter regions of the let-7 miRNAs, including L1, Alu, and MIR elements.

Lin-28B transactivation is necessary for Myc -mediated let-7 repression and proliferation.

35

Here we showed that the overexpression of miR-203 results in increased expression of let-7, and knockdown of let-7 reversed the inhibitory effects of miR-203 overexpression on tumor cell growth.

Mechanistically, miR-203 directly targets LIN28B, which is a critical repressor of the maturation of miRNAs, particularly let-7. Previous studies have defined a regulatory loop consisting of Lin28 and let-7, in which LIN28B suppresses let-7 maturation and let-7, in turn, directly targets LIN28B 21 22.

After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1).

Consequently, the expression levels of let-7 were decreased (Fig. 3C), suggesting that the induction of miR-203 inhibits LIN28B expression and subsequently rescues the suppression of let-7 by LIN28B.

Our findings are consistent with previous studies showing that LIN28B inhibits let-7 biogenesis, which in turn promotes the proliferation and inhibits the apoptosis of cancer cells 24 25, A549 cells transfected with LIN28B siRNA had a significantly lower proliferation rate and a higher apoptosis rate, whereas the cells transfected with the LIN28B overexpression plasmid showed the opposite effects (Fig. S2).

In summary, the present findings indicate that LIN28B is crucial for the proliferation and invasion of lung cancer cells due to its suppression of let-7 biogenesis and that miR-203 enhances let-7 biogenesis by silencing LIN28B expression, and consequently functions as a critical tumor suppressor during lung tumorigenesis.

On the other hand, the expression of the LIN28B protein was increased in A549 and 95D cells transfected with the miR-203 antagomir (Fig. 3B), leading to the subsequent downregulation of let-7 in A549 and 95D cells (Fig. 3C).

In this study, let-7 expression was found to be concordant with the miR-203 expression in normal and tumor tissues, underscoring the coordinated regulation of these two miRNAs via LIN28B as a link.

Taken together, the findings of this study show that miR-203 directly targets LIN28B and enhances let-7 biogenesis to suppress tumor growth in lung cancer.

Together, our results indicate that miR-203 directly recognizes and binds to the 3′-UTR of the LIN28B mRNA transcript and suppresses LIN28B expression, which in turn enhances let-7 biogenesis in lung cancer cells.

How to cite this article: Zhou, Y. et al. miR-203 enhances let-7 biogenesis by targeting LIN28B to suppress tumor growth in lung cancer.

A549 cells in which LIN28B expression was silenced using siRNA had a much higher level of let-7, whereas the cells transfected with the LIN28B overexpression plasmid showed decreased let-7 (Fig. S2).

miR-203 inhibits the proliferation and promotes the apoptosis of lung cancer cells by suppressing LIN28B and enhancing let-7 biogenesis.

The notion that LIN28B is the direct target of let-7 has already been established 24 25.

In fact, let-7 has been regarded as a bona fide tumor suppressor, and accumulating evidence has demonstrated that it has crucial roles in the development of cancer.

In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein.

miR-203 enhances let-7 biogenesis by directly targeting LIN28B.

Indeed, LIN28B and let-7 are inversely expressed in normal and malignant tissues 9 41.

Thus, LIN28B not only inhibits the biogenesis of let-7 family miRNAs but also induces their degradation.

Accordingly, miR-203 -induced let-7 provides a conserved mechanism to explain the suppressive role of miR-203 during lung tumorigenesis.

The binding of LIN28B to either pri-let-7 or pre-let-7 inhibits let-7 precursor processing by Drosha and Dicer 48.

The LIN28B protein and mRNA and let-7 expression levels in NSCLC tissues.

For the overexpression of miRNAs, 10 pmol of miR-203 agomir or let-7 agomir were used.

Recently, let-7 has been shown to act in a metastasis -associated signaling cascade involving the RAF kinase inhibitory protein 56 57.

Recent studies have discovered that LIN28 and let-7 family miRNAs tend to play opposing roles in many cellular processes, in particular those involved in cancer development and progression 12.

These results suggest that LIN28B functions as a link between the miRNAs miR-203 and let-7. We next investigated whether the overexpression or knockdown of miR-203 influenced cell proliferation and apoptosis by affecting let-7 biogenesis.

For the miRNA knockdown, 10 pmol of miR-203 antagomir or let-7 antagomir were used.

As expected, A549 cells transfected with the let-7 agomir exhibited decreased proliferation and increased apoptosis; in contrast, knockdown of let-7 had the opposite effects on A549 cells (Fig. S4).

A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2).

Oligo-uridylated pre-let-7 can also be degenerated by the 3′-5′ exonuclease Dis312 51 52.

These results demonstrated that miR-203 specifically represses LIN28B protein at the post-transcriptional level to enhance let-7 biogenesis.

The presence of a double -negative feedback loop between LIN28A/LIN28B and let-7 was also reported 12.

Both the CSD and CCHC zinc fingers of LIN28B can interact with the conserved residues of pri-let-7 and pre-let-7; the CSD inserts into the apical point of the precursor loop, while the CCHC zinc fingers dimerize on a GGAG motif adjacent to the Dicer cleavage site 46 47.

36

Lin-28B overexpression increased the expression of the HMGA2, c-MYC and KRAS genes, which are targeted by the cancer suppressor miRNA let-7. High Lin28B expression was associated with decreased let-7 expression and increased HMGA2, c-MYC and KRAS expression in human PDAC samples.

In addition, Lin28B silencing in PDAC cells inhibited cell proliferation, cell cycle transition, migration and the EMT and increased the expression of the c-MYC, HMGA2 and KRAS genes, which are targeted by the cancer suppressor miRNA let-7. However, Lin28B overexpression had the opposite effect.

Thus, Lin28B may increase the proliferation and migration of PDAC cells by directly inhibiting let-7 expression and subsequently upregulating HMGA2, c-MYC and KRAS expression.

We analyzed the GSE data sets to determine whether Lin28B promotes the growth and survival of PDAC cells by inhibiting let-7. The expression of let-7 targets was substantially increased in the subtype with high Lin28B expression, which exhibited increased levels of KRAS signaling intermediates and c-MYC targets (Figure 6A).

NF-kB directly activates Lin28B transcription, leading to the inhibition of let-7 and expression of IL-6 (a let-7 target).

In this study, Lin28B overexpression decreased let-7 levels and Lin28B expression was inversely correlated with let-7 expression in human PDAC samples.

Of the known let-7 targets, HMGA2 is the most frequently reported target of let-7 involved in inhibiting invasion and metastasis [39].

Furthermore, the qRT-PCR analysis showed increased expression of let-7a and let-7b in Lin28B-silenced AsPC-1 cells (Figure 6B), whereas the opposite was observed in Lin28B -overexpressing BxPC-3 PDAC cells (Figure 6C).

Figure 6GSEA plot of let-7, MYC targets and the KRAS signaling pathway in the subgroups with high and low Lin28B expression.

Lin28 and Lin28B each contain an N-terminal cold shock domain and a pair of retroviral-type CCHC zinc fingers near the C-terminus that confer RNA binding ability [7, 8] and inhibit the biogenesis of tumor-suppressive miRNAs of the let-7 family [9– 11].

GSEA plot of let-7, MYC targets and the KRAS signaling pathway in the subgroups with high and low Lin28B expression.

Lin28 inhibits let-7 biogenesis by recruiting a non-canonical poly (A) polymerase (Zcchc11/TUT4) to suppress pre-let-7 maturation [29], whereas Lin28B blocks let-7 processing through a Zcchc11-independent mechanism.

Although Lin28B -mediated repression of let-7 expression does not depend on Zcchc11 in multiple cell types, Lin28B may locate in the cytoplasm and use Zcchc11/TUT4 to suppress let-7 biogenesis in certain context, including PDAC cells.

However, Lin28 and Lin28B function through distinct mechanisms to suppress let-7 processing [12].

Taken together, these results further support the notion that overexpression of Lin28B decreased let-7 levels and activated oncogenic pathways, thereby facilitating the progression and metastasis, and leading to poor prognosis in patients with PDAC (Figure 6H).

Indeed, inverse expression of Lin28/Lin28B and let-7 is observed in normal and malignant tissues [18, 21].

Meanwhile, let-7a expression was inversely associated with the levels of the Lin28B protein (r=0.7802, P=0.022, Figure 6F).

In the second feedback loop, Lin28/Lin28B depresses c-MYC by inhibiting let-7, and c-MYC transcriptionally activates Lin28/Lin28B [38, 42].

Aberrant regulation of the Lin28B and let-7 loop in human malignancies is reportedly involved in cancer development, contributing to cell transformation, metastasis, resistance to cell death, metabolic reprogramming, and tumor -associated inflammation [27, 28].

Lin28B overexpression decreases let-7 levels and activates oncogenic pathways.

The effects of Lin28 and Lin28B, which seem similar to the effects of an oncogene, are largely due to their abilities to inhibit the let-7 miRNA family [10].

Lin28/Lin28B and the let-7 family have recently been shown to exert opposite roles in many cellular processes, particularly in cancer development and progression [27].

The presence of a double -negative feedback loop between Lin28/Lin28B and let-7 has also been reported [11, 28].

Lin28B is necessary and sufficient for MYC -mediated let-7 repression, and Lin28B has a key role in MYC -dependent cellular proliferation [38].

Therefore, Lin28 and let-7 may form a complex feedback loop during malignant transformation.

Lin28B decreases let-7 levels and activates oncogenic pathways.

Further studies are needed to elucidate the roles of Lin28/Lin28B and the let-7 network in PDAC.

Besides, Lin28B decreased let-7 levels and activated several oncogenic pathways in PDAC samples.

Lin28B participates in the EMT and represses the biogenesis of let-7, which may be one of the molecular mechanisms by which Lin28B promotes cancer progression and metastasis.

Although Lin28 and Lin28B share similar structures, they function through distinct mechanisms to repress let-7 processing.

Lin28B functions by sequestering primary let-7 transcripts and repressing their processing by the Microprocessor [12].

The third feedback loop involves Lin28B, let-7, NF-kB, and IL-6 [16].

The most well-characterized function of Lin28B is to repress the biogenesis of a family of 12 tumor suppressor miRNAs, collectively referred to as let-7 [10].

Lin28B decreased let-7 levels and activated several oncogenic pathways in PDAC cells.

37

More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55].

It was found that miR-15a and miR-16 were deleted or downregulated in lymphocytic leukaemia [39]; let-7 was downregulated in lung cancers [40, 41]; the miR-17 cluster was amplified in several types of lymphoma and solid tumours [31, 42, 43]; miR-21 was overexpressed in glioblastoma [44, 45] and breast cancer [46]; levels of miR-143 and miR-145 were decreased in colorectal neoplasia, breast, prostate and cervical cancers [46, 47]; miR155 was upregulated in Burkitt and B-cell lymphomas [48- 50] and also in breast cancer [46].

We present evidence for the down-regulation of c-MYC, one of the most potent and frequently deregulated oncogenes, by let-7 miRNA, via the predicted binding site in the 3'UTR, and verify the suppression of BCL-2 by miR16.

In humans, let-7 is expressed in normal adult lung tissue but poorly expressed in case of lung cancers [40, 71], which suggests that this miRNA may function also as a tumour suppressor.

Mounting evidence shows that the expression of the RAS oncogene is regulated by let-7, and that RAS is significantly over-expressed in lung tumour samples [40].

Both let-7 and miR-16 have been shown to downregulate their target oncogenes, c-MYC and BCL-2, respectively.

We present here evidence that let-7 binds to the 3'UTR of c-MYC oncogene and downregulates its expression.

Here we demonstrate that c-MYC is targeted by let-7. We show that 22-nt sequence from the c-MYC 3'UTR, predicted to be a binding site for let-7c, is enough to cause down-regulation of a reporter gene in HeLa cells.

Spontaneous c-MYC over -expression could be therefore the result of down-regulation or loss of specific let-7 loci.

In addition, suppression of let-7 miRNAs in these cells by anti-let-7 significantly recovers reporter gene expression.

Moreover, the suppression of let-7 in HeLa affects also the expression of the endogenous c-MYC, leading to an increase at both mRNA and protein levels.

Moreover, it has been shown that over -expression of let-7 inhibited cell growth of a lung cancer cell line in vitro [71].

We have monitored c-MYC expression at the mRNA and protein levels following the inhibition of let-7 with the antisense synthetic let-7 oligo (anti-let-7c from Dharmacon) in HeLa cells.

Finally, we determined the extent to which endogenously-expressed c-MYC is subjected to the regulation by let-7 microRNA.

Given the known importance of the regulatory miRNA we tested (let-7) and the targeted oncogene (c-MYC) studied, the validation of a let-7/ c-MYC interaction may be of particular interest.

The miRNAs that are encoded by let-7 family are conserved between mammalian species, both at the sequence level and at their temporal expression patterns, which probably indicates their general role in gene regulation [16].

The sensor construct carrying the c-MYC potential single binding site for let-7c appeared to be consistently well down-regulated by let-7 microRNA.

In this last report, the down-regulation of let-7 was shown to correlate with metastasis or higher proliferation index, which could additionally support our hypothesis for c-MYC involvement [46].

Moreover, the down-regulation of let-7 family members (including let-7c but excluding let-7b) has been reported elsewhere for breast cancer [46].

Based on our analysis it is not possible to specify which member(s) of the let-7 family is (are) responsible for the down-regulation of c-MYC.

Our results indicate that the expression of the c-MYC gene, which is one of the critical oncogenes, is modulated by let-7, expanding the number of validated oncomirs.

The 3'UTRs of the human RAS genes contain multiple let-7 complementary sites, allowing let-7 to regulate RAS [40].

However, the mechanism by which let-7 regulates cell cycle is unknown.

Although at present a comprehensive picture of the regulatory function of the let-7 miRNA family cannot be drawn, it is tempting to speculate on possible roles for this miRNA family in a complex network of interacting, proproliferative/proapoptotic factors.

The construct with the single let-7 b. s reduced the luciferase activity to 66.8 % of the control, while for the construct with the whole 3'UTR the reduction was on average up to 45.6 %.

In each tested MYC mRNA we could detect and identify in the 3' UTR a binding site for a representative of the human/murine let-7 member of miRNAs (Additional file 2).

The following reporter constructs were tested: (A) BCL-2 reporter constructs carrying a single binding site for miR-16, (B) BCL-2 reporter construct carrying a triple binding site for miR-16, (C) c-MYC reporter constructs carrying a single binding site for let-7, (D) c-MYC reporter constructs including sensors carrying the whole 3'UTRs from the c-MYC gene.

Predicted interactions of different human and murine MYC mRNAs with miRNAs of the let-7 family.

Click here for file Predicted interactions of different human and murine MYC mRNAs with miRNAs of the let-7 family.

The co-transfection of anti let-7 resulted in derepression of the luciferase activity in sensor constructs (the exception was the construct bearing PM b. s for c-MYC), although derepression was not equally efficient for all sensor constructs (Additional file 3).

Biological data may give some clues as to which of the let-7 family members may be more likely to interact with c-MYC in vivo.

We have also checked all the human/murine MYC potential interactions with let-7 and found that they are all located in the 2/3-th region of the 3'UTR.

38

To determine whether the let-7 miRNA is a critical mediator regulating IL-6 expression in MSCs, we overexpressed let-7 in 3A6 cells by transfecting cells with a synthetic let-7c precursor as the representative let-7 miRNA because of its higher expression than other members in 3A6 (data not shown), or inhibited expression levels using anti-miR oligonucleotides complementary to mature let-7 sequences, respectively.

Unlike these miRNAs are upregulated, we have shown here that the loss of let-7 in bone marrow-derived MSCs triggers their adipogenic differentiation through upregulating IL-6 expression.

This result corresponded to our marker analysis in which the expression of PPARγ, Adipoq, and UCP1 was suppressed in 3A6 [LNCaP] and 3A6 [PC3] cells when the cells were transfected with the let-7c precursor and upregulated in anti-miR let-7 -treated 3A6 [RWV] cells compared to the control oligonucleotides -transfected cells (Fig. 8B).

Collectively, these results demonstrated that let-7 downregulation confers the reactive stromal phenotypes of prostate cancer -associated MSCs through its target gene IL-6. 10.1371/journal.

Collectively, these results demonstrated that let-7 downregulation confers the reactive stromal phenotypes of prostate cancer -associated MSCs through its target gene IL-6. 10.1371/journal.

Let-7 microRNA (miRNA) is Downregulated in Cancer -associated MSCs and Targets IL-6 mRNA.

There is a possibility that these 3A6 [LNCaP]-specific miRNAs and/o