sort by

28 publications mentioning cel-mir-84

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-84. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 68
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-48, cel-mir-241
These results suggest that elt-1 normally contributes to developmental timing, at least in part, by promoting the down-regulation of lin-41 expression during L4, and that it may do so by promoting the expression of LET -7. elt-1/GATA normally promotes the expression of the developmental timing miRNAs LET-7, miR-48, miR-84, and miR-241The LET-7 family of miRNAs (miR-48, miR-84, and miR-241) have previously been shown to be expressed during or near the L2 molt to promote developmental progression [27, 28], while LET-7 is expressed primarily during L4 and required for the L4-to-Adult transition, largely by down -regulating lin-41 mRNA [3, 13]. [score:18]
This suggests that both daf-12 and elt-1 promote the expression of miR-48, miR-84, and miR-241, but that this regulation is highly redundant, so that either transcription factor alone is sufficient to promote sufficient expression of the miRs to prevent a gross phenotype in the single-mutant strains, despite defective expression of LET-7 in those single-mutant animals. [score:8]
The LET-7 family of miRNAs (miR-48, miR-84, and miR-241) have previously been shown to be expressed during or near the L2 molt to promote developmental progression [27, 28], while LET-7 is expressed primarily during L4 and required for the L4-to-Adult transition, largely by down -regulating lin-41 mRNA [3, 13]. [score:7]
In this study, we used a genetic enhancer screen to identify the GATA transcription factor ELT-1 as a new heterochronic gene and have shown that it contributes to developmental timing by providing positive regulation of the expression of the developmental timing miRNAs LET-7, miR-48, miR-84, and miR-241. [score:6]
These data are also consistent with previous studies showing that daf-12 regulates developmental progression [25, 26] and the expression of miR-48, miR-84, miR-241 and LET-7 at the L2 molt [28] and L3 stages [27]. [score:5]
A recent study of transcription factor binding sites in C. elegans included ELT-1 [45], and analysis of their data (Table 3) shows that the ELT-1 protein binds the likely promoter region of the DNA sequences encoding all members of the LET-7 miRNA family (mir-48, mir-84, mir-241, let-7), supporting the idea that ELT-1 directly regulates the transcription of the let-7 family miRNAs during late larval development. [score:4]
elt-1/GATA normally promotes the expression of the developmental timing miRNAs LET-7, miR-48, miR-84, and miR-241. [score:4]
They stimulate the nuclear hormone receptor (NHR) DAF-12, the vitamin D NHR ortholog, to promote progression from the 2 [nd] larval stage (L2) to the 3 [rd] larval stage (L3) [24– 26] by, in part, initiating expression of the LET -7 family of miRNAs, miR-48, miR-84, and miR-241, during or near the L2-to-L3 molt [27, 28]. [score:3]
The expression of the LET-7, miR-48, miR-84, and miR-241 miRNAs was therefore examined during the L4 stage in elt-1(ku491); daf-12(rh61rh411) double-mutant animals using RT-qPCR. [score:3]
However, the three LET-7 family miRNAs (miR-48, miR-84, and miR-241) all have a statistically-significant decrease in their expression during the L4 stage in the elt-1(ku491); daf-12(rh61rh411) double-mutant animals but not in either single-mutant, which likely accounts for the differences in the phenotypes and data. [score:3]
As shown in Fig. 4A, elt-1(ku491); daf-12(rh61rh411) double-mutant animals have deficient expression of LET-7 and each of the LET-7 family of miRNAs (miR-48, miR-84, and Mir-241). [score:3]
In addition, the double-mutants have an L4-stage bursting vulva phenotype (Table 1), similar to that caused by mutation of delayed heterochronic genes, including let-7 and the three other let-7 family miR genes (mir-48, mir-84, and mir-241) [3, 30]. [score:2]
A. ELT-1 and DAF-12 redundantly regulate LET-7, miR-48, miR-84, and miR-241. [score:2]
[1 to 20 of 13 sentences]
2
[+] score: 46
Other miRNAs from this paper: cel-let-7, cel-mir-48, cel-mir-241
Western blot results also showed that the SKN-1 protein expression could be upregulated by inhibition of daf-12, mir-84 and mir-241 (Fig. 6C, Fig. S11C). [score:8]
Confocal microscopic imaging of mir-84p::gfp also indicated that the mir-84 expression was highly upregulated in P. aeruginosa-infected wild-type worms, but not in the daf-12(rh61rh411) worms (Fig. 5D, Fig. S5C). [score:6]
The nsy-1 RNAi also counteracted the pathogenic defense of mir-84 mutant worms, and mutations of mir-84 or mir-241 did not affect the phosphorylation of PMK-1, suggesting that the let-7s miRNAs function downstream of DAF-12 to suppress the PMK-1/p38 MAPK signaling pathway (Fig. 5E, Fig. S8B). [score:4]
DAF-12 activates the expression of the let-7 miRNA homologs mir-84 and mir-241 (referred to as let-7s) to control developmental progression [29], [30]. [score:4]
However, the daf-12 mutation markedly reduced the expression of both mir-84 and mir-241 (Fig. 5C ). [score:4]
In this study, we showed that a P. aeruginosa infection induces the intestinal expression of mir-84 and mir-241, which is consistent with Kudlow et al. 's earlier findings that multiple miRNAs accumulate in the intestinal miRISCs upon infection [43] and that DAF-12 -mediated immunity is dependent on the activation of its downstream miRNA let-7s. [score:3]
These results suggested that skn-1 is a target of mir-84 and mir-241. [score:3]
In C. elegans, the let-7 miRNA homologs mir-48, mir-84 and mir-241 (together referred to as let-7s) regulate developmental timing and promote cellular differentiation pathways [27], [28]. [score:3]
We then employed the quantitative real-time PCR method to detect miRNA expression and found that P. aeruginosa infection of wild-type worms induced higher levels of mir-84 and mir-241 compared to E. coli. [score:2]
In the current study, we identified the nuclear hormone receptor DAF-12 and its downstream let-7 family of microRNAs, mir-84 and mir-241, are required for the regulation of C. elegans innate immunity against P. aeruginosa infection. [score:2]
To test whether mir-84 or mir-241 play a role in pathogenic defense, we infected the strains mir-84(n4037) and mir-241(n4316) with P. aeruginosa. [score:1]
In contrast to the luciferase activity in the 3′-UTR seed region mutants (skn-1 3′-UTR (mut)), which could not bind with and respond to let-7s miRNAs, the luciferase activity of the skn-1 3′-UTR decreased by approximately 30% in response to mir-48 mimics or mir-84 mimics and by approximately 10% in response to mir-241 mimics (Fig. 6B ). [score:1]
Figure S8 Mir-84 regulates innate immunity through PMK-1 pathway. [score:1]
Likewise, both mir-84(n4037) and mir-241(n4316) worms had slightly longer lifespans than wild-type animals (Fig. 5B ). [score:1]
Synchronized L4 populations of wild-type N2, daf-12(RNAi), daf-12(rh61rh411), mir-84(n4037) and mir-241(n4316) animals were infected with P. aeruginosa as described [1]. [score:1]
Conversely, skn-1 RNAi markedly reversed the enhanced pathogenic resistance of the daf-12(sa156) mutant as well as that of the mir-84 or mir-241 mutants (Fig. 7A, 7B and 7C ). [score:1]
Both mir-84(n4037) and mir-241(n4316) worms were more resistant to P. aeruginosa infection than the wild type (Fig. 5A ). [score:1]
[1 to 20 of 17 sentences]
3
[+] score: 42
LIN-14, LIN-28, HBL-1 and LIN-41 are expressed at the start of larval development and are eventually repressed by the microRNAs lin-4, let-7 and the three let-7 family members miR-48, miR-84, and miR-241 (3 let-7s). [score:4]
Given the redundancy of the three let-7 paralogs mir-48, mir-84, and mir-241 in regulating L2 fates, two alternatives seem likely: either lin-28 inhibits the accumulation of multiple let-7 family members, including these three let-7s known to control the L2-to-L3 transition, or let-7 is at least partially redundant with its relatives in controlling this early fate transition. [score:4]
1002588.g001 Figure 1Histograms depicting the temporal expression profiles of (A) let-7, (B) miR-84, (C) miR-48 and (D) miR-241 levels in wild type (grey bars) and lin-28(n719) (blue bars). [score:3]
hbl-1 has been shown to be the primary target of let-7's relatives mir-48, mir-84; and mir-241 [6]. [score:3]
Curr Opin Genet Dev 6 Abbott AL Alvarez-Saavedra E Miska EA Lau NC Bartel DP 2005 The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans. [score:3]
Histograms depicting the temporal expression profiles of (A) let-7, (B) miR-84, (C) miR-48 and (D) miR-241 levels in wild type (grey bars) and lin-28(n719) (blue bars). [score:3]
Animals lacking mir-48, mir-84, and mir-241 (3 let-7s), or animals carrying a transgene constitutively expressing lin-28 (lin-28(gf)) [62]. [score:3]
Also as seen previously [6], in a strain lacking mir-48, mir-84, and mir-241, the reporter was constitutively expressed from L1 to L4 (Figure 2B, Table S4). [score:3]
To construct mir-48 mir241; mir-84 let-7 quadruple mutants, animals of the genotype mir-48 mir-241; mir-84 unc-3 let-7/+ were cultured on hbl-1(low RNAi) (see below) to suppress the lethality characteristic of these mutations. [score:2]
Only miR-84 showed a significant difference between wild type and the lin-28 mutant at the L2 molt (Figure 1B, blue bars), as has been reported by others [29]. [score:1]
The three let-7 family members mir-48, mir-84, and mir-241 act redundantly to control seam cell fates: when they are deleted together, the L2-specific symmetric cell division is reiterated, resulting in supernumerary seam cells [6]. [score:1]
Comparable to lin-28 null mutants alone, 21% of the seam cells in animals that also lack mir-48, mir-84, and mir-241 displayed adult alae at the L2 molt (Table 3). [score:1]
In contrast to removing let-7, which had no effect, removing ain-1 from a strain lacking mir-48, mir-84, and mir-241 nearly doubled its seam cell nuclei number (Table 2, line 10). [score:1]
Significantly, Abbott and colleagues discovered that three let-7 relatives—miR-48, miR-84 and miR-241—function redundantly to repress the transcription factor gene hbl-1 and cause the succession of L2 to L3 cell fates [6]. [score:1]
We demonstrate by using null alleles that lin-28 does not require let-7, mir-48, mir-84, and mir-241 for its control of L2 cell fates (Table 2). [score:1]
C. elegans LIN-28 protein interacted with pre-let-7, pre-miR-48, pre-miR-84 and pre-miR-241, but not with the other let-7 family pre-microRNA sequences (Table 1; Figure S1). [score:1]
B, mir-48 mir-241; mir-84 (3 let-7s). [score:1]
Given that mir-48, mir-84, and mir-241 act redundantly and are related in sequence to let-7, we first wished to test whether let-7 might also be redundant with them in controlling L2 seam cell behavior. [score:1]
Seven C. elegans microRNAs—let-7, miR-48, miR-84, miR-241, miR-793, miR-794, and miR-795—belong to the let-7 family based on 5′-end sequence identity of the mature microRNAs [41]– [43]. [score:1]
C, lin-28; mir-48 mir-241; mir-84 (lin-28; 3 let-7s). [score:1]
E, a hbl-1::GFP::unc-54 3′UTR reporter in lin-28; mir-48 mir-241; let-7 mir-84 (lin-28; 4 let-7s). [score:1]
D, lin-28; mir-48 mir-241; let-7 mir-84 (lin-28; 4 let-7s). [score:1]
D, a hbl-1::GFP::unc-54 3′UTR reporter in lin-28; mir-48 mir-241; mir-84 (lin-28; 3 let-7s). [score:1]
[1 to 20 of 23 sentences]
4
[+] score: 31
Comparison of the overall microarray expression profiles of bpa-miR-5364 with the B. pahangi let-7 family miRNAs reveals a related but distinct pattern: while the expression profiles of all three miRNAs mirror each other, bpa-miR-5364 is found at a much higher level than bpa-let-7 and bpa-miR-84 and is up-regulated a minimum of 24 hours earlier (Figure  2B). [score:8]
possess three let-7 family members, let-7, miR-84 and miR-5364, all of which are up-regulated post-infection, with expression of miR-5364 increasing first, within 24 hours, and rising to a significantly greater level than either let-7 or miR-84, suggesting that in Brugia spp. [score:6]
Predicted miRNA target sites for the three target genes in both parasite species are shown in Additional file 9. Interestingly, conserved sites for let-7 and miR-84 are found for Bm1_27305 with almost identical positioning in each species. [score:5]
In the free-living nematode C. elegans, the let-7 miRNA family controls developmental transitions and consists of seven members of which only two (let-7 and miR-84) are found in Brugia spp. [score:2]
Importantly, this set included the let-7 miRNA family members bpa-let-7 and bpa-miR-84, suggesting that other B. pahangi miRNAs with important developmental functions could potentially be identified by this analysis. [score:2]
bpa-miR-5364 is a novel member of the let-7 miRNA familyIn the free-living nematode C. elegans, the let-7 miRNA family controls developmental transitions and consists of seven members of which only two (let-7 and miR-84) are found in Brugia spp. [score:2]
In addition to bpa-let-7 and bpa-miR-84, the three other miRNAs that met the criteria were bpa-miR-5364, cel-miR-789 and bpa-miR-5853. [score:1]
Given the sequence similarity between miR-5364 and the let-7 family (Figure  2A) this might be expected; however, the binding sites for miR-5364 and let-7/miR-84 are not identically positioned (see Additional file 9). [score:1]
While let-7 is involved in specifying larval-adult cell fate, miR-48, miR-84 and miR-241 are co-activated at an earlier time point where they co-ordinate the L2-L3 transition [4]. [score:1]
A. CLUSTAL alignment comparing miRNA sequences from the C. elegans let-7 family with bpa-miR-5364, bpa-let-7 and bpa-miR-84. [score:1]
B. Abundance of bpa-miR-5364, bpa-let-7 and bpa-miR-84 increase in parallel from mosquito-derived (MD) L3 to adult as determined by microarray analysis (log [10] scale). [score:1]
This family includes a further six miRNAs; miR-48, miR-84, miR-241, miR-793, miR-794, and miR-795 [12]. [score:1]
[1 to 20 of 12 sentences]
5
[+] score: 25
The six target miRNAs included three miRNAs (lin-4, mir-48, and mir-84) whose expression levels are known to vary depending on the developmental timing and three constantly expressed tissue-specific miRNAs in C. elegans. [score:8]
Similar expression levels for lsy-6, mir-55, and mir-56 were observed between the two stages; on the other hand, lin-4, mir-48, and mir-84 were upregulated in the L4 stage. [score:6]
lsy-6, mir-55, and mir-56 showed no significant changes in their expression levels, whereas lin-4, mir-48, and mir-84 were upregulated. [score:6]
Abbott AL The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegansDev. [score:3]
Development -associated miRNAs in C. elegans (lin-4, mir-48, mir-84, lsy-6, mir-55, and mir-56) and two controls (snoRNA U18 and mir-159a) were detected via CE-SSCP analysis after the dye-labeling reaction. [score:2]
[1 to 20 of 5 sentences]
6
[+] score: 24
Similarly, let-60 RAS has been suggested to be a target of miR-84, based on the observation that overexpression of miR-84 from a transgene suppresses the multivulva phenotype of let-60 RAS activation mutants. [score:7]
If let-60 RAS is a target of miR-84, loss of mir-84 might result in let-60 RAS overexpression and possibly a multivulva phenotype [91, 92]. [score:5]
Three additional C. elegans let-7-like miRNAs, miR-48, miR-84, and miR-241, also act in the control of developmental timing and likely regulate the hbl-1 mRNA, but act earlier in development than the let-7 miRNA [52, 53]. [score:4]
The overexpression of the miRNAs miR-84 and miR-61 from transgenes in C. elegans affects vulval development [89, 90]. [score:4]
Thus, for both miR-84 and miR-61, we were unable to confirm a role in vulval development based on loss-of-function alleles. [score:2]
To uncover subtle abnormalities in the miRNA mutant strains will require more detailed analyses, as has been performed for lin-4, let-7, lsy-6, mir-48, mir-84, and mir-241. [score:1]
However, as we reported previously, mir-84 single mutants or mir-48 mir-241; mir-84 triple mutants do not have a multivulva phenotype [52]. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 21
In wild type animals, hbl-1 is down-regulated by let-7-sisters (mir-48, mir-84, and mir-241) between the L2 and L3 stages of larval development [2]. [score:5]
However, previous findings showed that the precocious L3 fate phenotype of lin-28(lf) larvae cannot be entirely attributed to let-7-Family hyperactivity: mutations that simultaneously remove three (mir-48, mir-84, mir-241), or even all four (mir-48, mir-84, mir-241, let-7) of the major let-7-Family microRNAs did not suppress the precocious L3 fates of lin-28(lf) [2], [20]. [score:4]
This is noteworthy in light of previous work showing that simultaneous loss of four of seven let-7-Family genes (mir-84, mir-48, mir-241, and let-7) was not sufficient to suppress the reduced seam cell number of lin-28(lf) [20]. [score:3]
These data, in combination with our observation that lin-28(lf) seam cell lineage defects are suppressed by alg-1(anti) are consistent with the idea that other microRNAs in addition to mir-48, mir-84, mir-241, and let-7 may be hyperactive in lin-28(lf) and may contribute to controlling the L2-L3 transition. [score:3]
Therefore the potent suppression that we observe in lin-28(lf) carrying alg-1 mutations suggests that the lin-28(lf) phenotype results from hyperactivity of microRNAs in addition to mir-84, mir-48, mir-241, and let-7. Although the newly isolated missense alleles of alg-1 do not all appear to affect the same domain of ALG-1 (Figure 2A), all four mutants displayed similar phenotypic and genetic characteristics (Table 1, Table 2). [score:2]
In particular, the let-7-Family microRNAs, let-7, mir-241, mir-48, and mir-84, are key players in the heterochronic genetic network that controls progression through the C. elegans larval development [1]– [3]. [score:2]
By contrast, loss of let-7-sisters (mir-241, mir-48, and mir-84) results in the reiteration of L2 fates [1], [2], and loss of let-7 causes the reiteration of L3 fates [1]– [3], [20]. [score:1]
Deletion of the let-7 microRNA or its sisters miR-48, miR-241 and miR-84 results in reiteration of larval stage-specific cell fates, delaying the adoption of adult cell fates [1]– [3]. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 12
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-1, cel-mir-48, cel-mir-241, cel-lsy-6
The let-7 family members miR-48, miR-84 and miR-241 redundantly regulate the expression of their target gene hbl-1 during the L2-to-L3 larval stage transition [26], [28]. [score:6]
The seam cell developmental program is controlled at different larval stages by the miRNA lin-4 [25] and those of the let-7 family (miR-48, miR-84, miR-241 and let-7) [26], [27] and their targets lin-14, lin-28, hbl-1, daf-12 and lin-41 [26]– [33]. [score:4]
It was therefore possible that the altered seam cell development observed in alg-1 mutant and enhanced by loss of vps-52 resulted from impaired miR-48, miR-84 and miR-241 miRNAs function. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 12
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-48, cel-mir-237, cel-mir-241, cel-lsy-6
Three of the let-7 family miRNAs (mir-48, mir-84, and mir-241) are expressed starting at the L2 stage and function to regulate the L2 stage proliferative seam cell division, while the let-7 miRNA is strongly upregulated from the L3 stage to control the larval-to-adult transition of seam cells (Reinhart et al. 2000; Abbott et al. 2005). [score:7]
This work was funded by a NIH grant (R01 GM34028) to V. A. and a Leukemia and Lymphoma society postdoctoral fellowship to I. V-L. Abbott A. L. Alvarez-Saavedra E. Miska E. A. Lau N. C. Bartel D. P., 2005 The let-7 microRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans. [score:3]
C. elegans let-7 family miRNAs (including let-7, mir-48, mir-84, and mir-241) function semiredundantly in controlling the developmental timing of certain stage-specific hypodermal seam cell fates. [score:2]
[1 to 20 of 3 sentences]
10
[+] score: 11
The let-7 family members, mir-48, mir-84, and mir-241, function together to control the timing of the L3 stage program through down-regulation of their target, hbl-1 [12]. [score:6]
The down-regulation of hbl-1 in the hypodermis requires the let-7 family members, mir-48, mir-84, and mir-241 [12]. [score:4]
In mutants lacking mir-48, mir-84 and mir-241 (hereafter referred to as mir-48/84/241), the L3 stage program is not executed properly and the L2 stage program is reiterated. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 10
Animals harboring the alg-1(ma192) mutation inappropriately express hbl-1 (the major miRNA target of miR-48, miR-241, and miR-84) in the L3 stage and reiterate L2-specific seam cell division patterns [49]. [score:6]
Consistent with the observation that alg-1(ma192) mutations broadly affect miRNA expression, the abundance of all miRNAs tested (lin-4, miR-48, miR-241, miR-84, let-7, miR-1, miR-46, miR-58 and miR-79) was decreased in alg-1(ma192) mutants (Figure 2B). [score:4]
[1 to 20 of 2 sentences]
12
[+] score: 10
Since mir-84 mutations do not cause visible phenotypes [20], this result is consistent with these antisense reagents inhibiting the targeted miRNA with high specificity. [score:6]
In contrast, an injection of [Rh]dextran-([as-2'OMe] mir-84) [1 ]directed against another let-7 family microRNA caused no observable phenotype. [score:2]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3'For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides. [score:1]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3' For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 8
Interestingly, in such regulation the participation of miRNAs like miR-71, miR-84 and miR-241 is very important as these miRNAs down regulate the expression of AKT-1 and LIN-14, resulting in the activation of DAF-16 [116]. [score:5]
The third most expressed miRNA was miR-84-5p, that together with other abundant miRNAs like miR-48-5p and let-7-5p, are members of the let-7 family, that also includes miR-7, miR-241, miR-793, miR-794 and miR-795 [65]. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 7
For instance, miR-48, miR-84, and miR-241 regulate the second larval (L2) to third larval (L3) transition, while let-7 regulates the fourth larval (L4) to adult transition (Fig.   1) (Reinhart et al., 2000; Abbott et al., 2005). [score:3]
During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Let-7 miRNAs are found in various animal species, including the human. [score:3]
During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Characteristics of the let-7 family Let-7 miRNAs are found in various animal species, including the human. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 7
From the independent worm samples used in the microarray, the qRT-PCR experiment showed that miR-84 and 73 were upregulated (>1.5-fold change), respectively; miR-55, 56 and 124 were unchanged (1.5 >fold change >0.67). [score:4]
The microarray data from miRNA expression profiling was validated by qRT-PCR for five miRNAs, including miR-55 (GC), miR-56 (SC), miR-73 (SC), miR-84 (SF) and miR-124 (SF) (Table 4). [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 6
In C. elegans, mir-84 and mir-241, the other members in let-7 family, could even regulate the innate immune response to P. aeruginosa PA14 infection by directly targeting SKN-1 [15]. [score:5]
Recently, some miRNAs such as mir-84, mir-241, mir-233, mir-251, mir-252, and mir-360 have been shown to be involved in the control of innate immunity in C. elegans [15– 17]. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 6
mir-84 and let-7 antagonize let-60/RAS signalling in vulval precursor cells that are not destined to form the vulva. [score:1]
As previously observed for let-7(mg279) ; mir-84(tm1304) double mutants [41], gld-1(op236) ; let-7(mg279) animals with only partially shed cuticles can be observed (figure 2 c). [score:1]
A supernumerary fifth moult has been described in let-7(mg279) ; mir-84(tm1304) double mutants [41], during which adult animals cease to move and stop pharyngeal activity. [score:1]
The penetrance of this phenotype is enhanced by gld-1(op236), with 64% (n = 81, p = 0.013 Fisher's exact test) lethality observed in the gld-1(op236); mir-48 mir-241; mir-84 quadruple mutant. [score:1]
Forty-two per cent (n = 43) of mir-48 mir-241; mir-84 triple mutants die owing to a burst vulva during the L4 to adult transition reminiscent to the let-7(null) phenotype [44]. [score:1]
The let-7 family (let-7, mir-48, mir-84, mir-241 and mir-795) miRNAs are much more studied compared with mir-35 family miRNAs during C. elegans development. [score:1]
[1 to 20 of 6 sentences]
18
[+] score: 4
This developmental program is controlled at different larval stages by lin-4 miRNA [26], the let-7 family miRNAs (miR-48, miR-84, miR-241 and let-7) [25, 27] and their targets lin-14, lin-28, hbl-1, daf-12 and lin-41 [25, 27– 33]. [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 3
Mutants defective in daf-12 or carrying mutations in the microRNAs mir-48, mir-241, and mir-84 exhibit disorganized developmental progression, with specific cell divisions being reiterated or skipped (8). [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Other miRNAs from this paper: cel-mir-241
Similar results were obtained by determining the expression of mir-84 and mir-241 by qPCR (Fig. 1b). [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
Other miRNAs from this paper: cel-mir-71, cel-mir-241
Gonadal signals that activate DAF-12 also activate its miRNA targets, mir-84 and mir-241 (Antebi, 2013). [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Other miRNAs from this paper: cel-lin-4, cel-mir-48, cel-mir-241
N2 = wild-type, CB1 = dpy-1(e1), VT1207 = lin-4(e912); mir-48 mir-241(nDf51); lin-14(n179) mir-84(n4037). [score:1]
wild-type, CB1370: daf-2(e1370): CB1372, daf-7(e1372), VT2317: daf-16(mgDf50); daf-7(e1372), CB1: dpy-1(e1), VT1207: lin-4(e912); mir-48 mir-241(nDf51); lin-14(n179) mir-84(n4037), GR1395: mgIs49[mlt-10::gfp-pest] (Frand et al. 2005; Hayes et al. 2006). [score:1]
We used a strain with a defective cuticulin, CB1 dpy-1, and a heterochronic mutant with a morphologically abnormal cuticle, VT1207 lin-4; mir-48 mir-241; lin-14 mir-84. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 3
Similarly, C. elegans let-7 and the related miRNAs, mir-48, mir-84 and mir-241, also function to regulate the timing of developmental events [19, 20]. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Other miRNAs from this paper: cel-let-7, cel-mir-48, cel-mir-241
Abbott A. L. Alvarez-Saavedra E. Miska E. A. Lau N. C. Bartel D. P., 2005 The let-7 microRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 2
This germline deficient lifespan increase is dependent on an array of genes including the forkhead transcription factor DAF-16/FOXO, nuclear hormone receptors DAF-12 and NHR-80, the cytochrome P450 DAF-9, intestinal FERM domain protein KRI-1, proteasome component RPN-6.1, the microRNAs mir-71, mir-84 and mir-241, and processes such as insulin signaling, steroid hormone synthesis, increased proteasome activity, autophagy and regulation of fat metabolism [1], [14]– [24]. [score:2]
[1 to 20 of 1 sentences]
26
[+] score: 2
Other miRNAs from this paper: cel-let-7
The mir-84 and let-7 paralogous microRNA genes of Caenorhabditis elegans direct the cessation of molting via the conserved nuclear hormone receptors NHR-23 and NHR-25. [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 2
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-57, cel-mir-61, cel-mir-273
let-7 and its paralog mir-84 act synergistically to direct cessation of molting via the conserved nuclear hormone receptors NHR-23 and NHR-25 [14]. [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-48, cel-mir-232, cel-mir-233, cel-mir-241
Furthermore, Liu et al. [17] have demonstrated that the mir-84(n4037) and mir-241(n4316) mutants exhibit enhanced resistance, whereas the mir-48(n4097) mutant worms exhibit decreased resistance to P. aeruginosa infection. [score:1]
[1 to 20 of 1 sentences]